DFTB Parameters for the Periodic Table: Part 1, Electronic Structure.

PubMed

Wahiduzzaman, Mohammad; Oliveira, Augusto F; Philipsen, Pier; Zhechkov, Lyuben; van Lenthe, Erik; Witek, Henryk A; Heine, Thomas

2013-09-10

A parametrization scheme for the electronic part of the density-functional based tight-binding (DFTB) method that covers the periodic table is presented. A semiautomatic parametrization scheme has been developed that uses Kohn-Sham energies and band structure curvatures of real and fictitious homoatomic crystal structures as reference data. A confinement potential is used to tighten the Kohn-Sham orbitals, which includes two free parameters that are used to optimize the performance of the method. The method is tested on more than 100 systems and shows excellent overall performance.

Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: a comparison between density functional theory and density functional tight binding results.

PubMed

grosse Holthaus, Svea; Köppen, Susan; Frauenheim, Thomas; Ciacchi, Lucio Colombi

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101̄0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to form predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.

Molecular dynamics simulations of the amino acid-ZnO (10-10) interface: A comparison between density functional theory and density functional tight binding results

DOE Office of Scientific and Technical Information (OSTI.GOV)

Holthaus, Svea große; Köppen, Susan, E-mail: koeppen@hmi.uni-bremen.de; Frauenheim, Thomas

2014-06-21

We investigate the adsorption behavior of four different amino acids (glutamine, glutamate, serine, cysteine) on the zinc oxide (101{sup ¯}0) surface, comparing the geometry and energy associated with a number of different adsorption configurations. In doing this, we highlight the benefits and limits of using density-functional tight-binding (DFTB) with respect to standard density functional theory (DFT). The DFTB method is found to reliably reproduce the DFT adsorption geometries. Analysis of the adsorption configurations emphasizes the fundamental role of the first hydration layer in mediating the interactions between the amino acids and the surface. Direct surface-molecule bonds are found to formmore » predominantly via the carboxylate groups of the studied amino acids. No surface-mediated chemical reactions are observed, with the notable exception of a proton transfer from the thiol group of cysteine to a hydroxyl group of the surface hydration layer. The adsorption energies are found to be dominated both by the formation of direct or indirect surface-molecule hydrogen bonds, but also by the rearrangement of the hydrogen-bond network in surface proximity in a non-intuitive way. Energetic comparisons between DFTB and DFT are made difficult on one side by the long time necessary to achieve convergence of potential energy values in MD simulations and on the other side by the necessity of including higher-order corrections to DFTB to obtain a good description of the hydrogen bond energetics. Overall, our results suggest that DFTB is a good reference method to set the correct chemical states and the initial geometries of hybrid biomolecule/ZnO systems to be simulated with non-reactive force fields.« less

Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

PubMed

Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

2017-12-01

Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

Parametrization and Benchmark of Long-Range Corrected DFTB2 for Organic Molecules

DOE PAGES

Vuong, Van Quan; Akkarapattiakal Kuriappan, Jissy; Kubillus, Maximilian; ...

2017-12-12

In this paper, we present the parametrization and benchmark of long-range corrected second-order density functional tight binding (DFTB), LC-DFTB2, for organic and biological molecules. The LC-DFTB2 model not only improves fundamental orbital energy gaps but also ameliorates the DFT self-interaction error and overpolarization problem, and further improves charge-transfer excited states significantly. Electronic parameters for the construction of the DFTB2 Hamiltonian as well as repulsive potentials were optimized for molecules containing C, H, N, and O chemical elements. We use a semiautomatic parametrization scheme based on a genetic algorithm. With the new parameters, LC-DFTB2 describes geometries and vibrational frequencies of organicmore » molecules similarly well as third-order DFTB3/3OB, the de facto standard parametrization based on a GGA functional. Finally, LC-DFTB2 performs well also for atomization and reaction energies, however, slightly less satisfactorily than DFTB3/3OB.« less

Studying the varied shapes of gold clusters by an elegant optimization algorithm that hybridizes the density functional tight-binding theory and the density functional theory

NASA Astrophysics Data System (ADS)

Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.

2017-11-01

We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.

Extension of the self-consistent-charge density-functional tight-binding method: third-order expansion of the density functional theory total energy and introduction of a modified effective coulomb interaction.

PubMed

Yang, Yang; Yu, Haibo; York, Darrin; Cui, Qiang; Elstner, Marcus

2007-10-25

The standard self-consistent-charge density-functional-tight-binding (SCC-DFTB) method (Phys. Rev. B 1998, 58, 7260) is derived by a second-order expansion of the density functional theory total energy expression, followed by an approximation of the charge density fluctuations by charge monopoles and an effective damped Coulomb interaction between the atomic net charges. The central assumptions behind this effective charge-charge interaction are the inverse relation of atomic size and chemical hardness and the use of a fixed chemical hardness parameter independent of the atomic charge state. While these approximations seem to be unproblematic for many covalently bound systems, they are quantitatively insufficient for hydrogen-bonding interactions and (anionic) molecules with localized net charges. Here, we present an extension of the SCC-DFTB method to incorporate third-order terms in the charge density fluctuations, leading to chemical hardness parameters that are dependent on the atomic charge state and a modification of the Coulomb scaling to improve the electrostatic treatment within the second-order terms. These modifications lead to a significant improvement in the description of hydrogen-bonding interactions and proton affinities of biologically relevant molecules.

DFTB Parameters for the Periodic Table, Part 2: Energies and Energy Gradients from Hydrogen to Calcium.

PubMed

Oliveira, Augusto F; Philipsen, Pier; Heine, Thomas

2015-11-10

In the first part of this series, we presented a parametrization strategy to obtain high-quality electronic band structures on the basis of density-functional-based tight-binding (DFTB) calculations and published a parameter set called QUASINANO2013.1. Here, we extend our parametrization effort to include the remaining terms that are needed to compute the total energy and its gradient, commonly referred to as repulsive potential. Instead of parametrizing these terms as a two-body potential, we calculate them explicitly from the DFTB analogues of the Kohn-Sham total energy expression. This strategy requires only two further numerical parameters per element. Thus, the atomic configuration and four real numbers per element are sufficient to define the DFTB model at this level of parametrization. The QUASINANO2015 parameter set allows the calculation of energy, structure, and electronic structure of all systems composed of elements ranging from H to Ca. Extensive benchmarks show that the overall accuracy of QUASINANO2015 is comparable to that of well-established methods, including PM7 and hand-tuned DFTB parameter sets, while coverage of a much larger range of chemical systems is available.

Performance of the DFTB method in comparison to DFT and semiempirical methods for geometries and energies of C20-C86fullerene isomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Guishan; Irle, Stephan; Morokuma, Keiji

2005-07-20

The research described in this product was performed in part in the Environmental Molecular Sciences Laboratory, a national scientific user facility sponsored by the Department of Energy's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory. The performance of both non-iterative (NCC) and self-consistent charge (SCC) versions of the density functional tight binding (DFTB) method, as well as AM1 and PM3 methods, has been compared with the B3LYP method, a hybrid density functional theory (DFT) method, for equilibrium geometries and relative energies of various isomers of C20–C86 fullerenes. Both NCC- and SCCDFTB methods compare very favorablymore » with B3LYP both in geometries and isomer relative energies, while AM1 and PM3 do noticeably worse.« less

Generating Converged Accurate Free Energy Surfaces for Chemical Reactions with a Force-Matched Semiempirical Model.

PubMed

Kroonblawd, Matthew P; Pietrucci, Fabio; Saitta, Antonino Marco; Goldman, Nir

2018-04-10

We demonstrate the capability of creating robust density functional tight binding (DFTB) models for chemical reactivity in prebiotic mixtures through force matching to short time scale quantum free energy estimates. Molecular dynamics using density functional theory (DFT) is a highly accurate approach to generate free energy surfaces for chemical reactions, but the extreme computational cost often limits the time scales and range of thermodynamic states that can feasibly be studied. In contrast, DFTB is a semiempirical quantum method that affords up to a thousandfold reduction in cost and can recover DFT-level accuracy. Here, we show that a force-matched DFTB model for aqueous glycine condensation reactions yields free energy surfaces that are consistent with experimental observations of reaction energetics. Convergence analysis reveals that multiple nanoseconds of combined trajectory are needed to reach a steady-fluctuating free energy estimate for glycine condensation. Predictive accuracy of force-matched DFTB is demonstrated by direct comparison to DFT, with the two approaches yielding surfaces with large regions that differ by only a few kcal mol -1 .

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

PubMed

Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-14

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

NASA Astrophysics Data System (ADS)

Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-01

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Modelling realistic TiO2 nanospheres: A benchmark study of SCC-DFTB against hybrid DFT

NASA Astrophysics Data System (ADS)

Selli, Daniele; Fazio, Gianluca; Di Valentin, Cristiana

2017-10-01

TiO2 nanoparticles (NPs) are nowadays considered fundamental building blocks for many technological applications. Morphology is found to play a key role with spherical NPs presenting higher binding properties and chemical activity. From the experimental point of view, the characterization of these nano-objects is extremely complex, opening a large room for computational investigations. In this work, TiO2 spherical NPs of different sizes (from 300 to 4000 atoms) have been studied with a two-scale computational approach. Global optimization to obtain stable and equilibrated nanospheres was performed with a self-consistent charge density functional tight-binding (SCC-DFTB) simulated annealing process, causing a considerable atomic rearrangement within the nanospheres. Those SCC-DFTB relaxed structures have been then optimized at the DFT(B3LYP) level of theory. We present a systematic and comparative SCC-DFTB vs DFT(B3LYP) study of the structural properties, with particular emphasis on the surface-to-bulk sites ratio, coordination distribution of surface sites, and surface energy. From the electronic point of view, we compare HOMO-LUMO and Kohn-Sham gaps, total and projected density of states. Overall, the comparisons between DFTB and hybrid density functional theory show that DFTB provides a rather accurate geometrical and electronic description of these nanospheres of realistic size (up to a diameter of 4.4 nm) at an extremely reduced computational cost. This opens for new challenges in simulations of very large systems and more extended molecular dynamics.

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

PubMed

Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

2015-07-14

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

Spectral densities for Frenkel exciton dynamics in molecular crystals: A TD-DFTB approach

NASA Astrophysics Data System (ADS)

Plötz, Per-Arno; Megow, Jörg; Niehaus, Thomas; Kühn, Oliver

2017-02-01

Effects of thermal fluctuations on the electronic excitation energies and intermonomeric Coulomb couplings are investigated for a perylene-tetracarboxylic-diimide crystal. To this end, time dependent density functional theory based tight binding (TD-DFTB) in the linear response formulation is used in combination with electronic ground state classical molecular dynamics. As a result, a parametrized Frenkel exciton Hamiltonian is obtained, with the effect of exciton-vibrational coupling being described by spectral densities. Employing dynamically defined normal modes, these spectral densities are analyzed in great detail, thus providing insight into the effect of specific intramolecular motions on excitation energies and Coulomb couplings. This distinguishes the present method from approaches using fixed transition densities. The efficiency by which intramolecular contributions to the spectral density can be calculated is a clear advantage of this method as compared with standard TD-DFT.

An efficient method for quantum transport simulations in the time domain

NASA Astrophysics Data System (ADS)

Wang, Y.; Yam, C.-Y.; Frauenheim, Th.; Chen, G. H.; Niehaus, T. A.

2011-11-01

An approximate method based on adiabatic time dependent density functional theory (TDDFT) is presented, that allows for the description of the electron dynamics in nanoscale junctions under arbitrary time dependent external potentials. The density matrix of the device region is propagated according to the Liouville-von Neumann equation. The semi-infinite leads give rise to dissipative terms in the equation of motion which are calculated from first principles in the wide band limit. In contrast to earlier ab initio implementations of this formalism, the Hamiltonian is here approximated in the spirit of the density functional based tight-binding (DFTB) method. Results are presented for two prototypical molecular devices and compared to full TDDFT calculations. The temporal profile of the current traces is qualitatively well captured by the DFTB scheme. Steady state currents show considerable variations, both in comparison of approximate and full TDDFT, but also among TDDFT calculations with different basis sets.

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

DOE PAGES

Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

2015-06-26

A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

Parameterization of DFTB3/3OB for Sulfur and Phosphorus for Chemical and Biological Applications

PubMed Central

2015-01-01

We report the parametrization of the approximate density functional tight binding method, DFTB3, for sulfur and phosphorus. The parametrization is done in a framework consistent with our previous 3OB set established for O, N, C, and H, thus the resulting parameters can be used to describe a broad set of organic and biologically relevant molecules. The 3d orbitals are included in the parametrization, and the electronic parameters are chosen to minimize errors in the atomization energies. The parameters are tested using a fairly diverse set of molecules of biological relevance, focusing on the geometries, reaction energies, proton affinities, and hydrogen bonding interactions of these molecules; vibrational frequencies are also examined, although less systematically. The results of DFTB3/3OB are compared to those from DFT (B3LYP and PBE), ab initio (MP2, G3B3), and several popular semiempirical methods (PM6 and PDDG), as well as predictions of DFTB3 with the older parametrization (the MIO set). In general, DFTB3/3OB is a major improvement over the previous parametrization (DFTB3/MIO), and for the majority cases tested here, it also outperforms PM6 and PDDG, especially for structural properties, vibrational frequencies, hydrogen bonding interactions, and proton affinities. For reaction energies, DFTB3/3OB exhibits major improvement over DFTB3/MIO, due mainly to significant reduction of errors in atomization energies; compared to PM6 and PDDG, DFTB3/3OB also generally performs better, although the magnitude of improvement is more modest. Compared to high-level calculations, DFTB3/3OB is most successful at predicting geometries; larger errors are found in the energies, although the results can be greatly improved by computing single point energies at a high level with DFTB3 geometries. There are several remaining issues with the DFTB3/3OB approach, most notably its difficulty in describing phosphate hydrolysis reactions involving a change in the coordination number of the phosphorus, for which a specific parametrization (3OB/OPhyd) is developed as a temporary solution; this suggests that the current DFTB3 methodology has limited transferability for complex phosphorus chemistry at the level of accuracy required for detailed mechanistic investigations. Therefore, fundamental improvements in the DFTB3 methodology are needed for a reliable method that describes phosphorus chemistry without ad hoc parameters. Nevertheless, DFTB3/3OB is expected to be a competitive QM method in QM/MM calculations for studying phosphorus/sulfur chemistry in condensed phase systems, especially as a low-level method that drives the sampling in a dual-level QM/MM framework. PMID:24803865

III-Nitride, SiC and Diamond Materials for Electronic Devices. Symposium Held April 8-12 1996, San Francisco, California, U.S.A. Volume 423.

DTIC Science & Technology

1996-12-01

gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic

Improving intermolecular interactions in DFTB3 using extended polarization from chemical-potential equalization

PubMed Central

Christensen, Anders S.; Elstner, Marcus; Cui, Qiang

2015-01-01

Semi-empirical quantum mechanical methods traditionally expand the electron density in a minimal, valence-only electron basis set. The minimal-basis approximation causes molecular polarization to be underestimated, and hence intermolecular interaction energies are also underestimated, especially for intermolecular interactions involving charged species. In this work, the third-order self-consistent charge density functional tight-binding method (DFTB3) is augmented with an auxiliary response density using the chemical-potential equalization (CPE) method and an empirical dispersion correction (D3). The parameters in the CPE and D3 models are fitted to high-level CCSD(T) reference interaction energies for a broad range of chemical species, as well as dipole moments calculated at the DFT level; the impact of including polarizabilities of molecules in the parameterization is also considered. Parameters for the elements H, C, N, O, and S are presented. The Root Mean Square Deviation (RMSD) interaction energy is improved from 6.07 kcal/mol to 1.49 kcal/mol for interactions with one charged species, whereas the RMSD is improved from 5.60 kcal/mol to 1.73 for a set of 9 salt bridges, compared to uncorrected DFTB3. For large water clusters and complexes that are dominated by dispersion interactions, the already satisfactory performance of the DFTB3-D3 model is retained; polarizabilities of neutral molecules are also notably improved. Overall, the CPE extension of DFTB3-D3 provides a more balanced description of different types of non-covalent interactions than Neglect of Diatomic Differential Overlap type of semi-empirical methods (e.g., PM6-D3H4) and PBE-D3 with modest basis sets. PMID:26328834

Improving intermolecular interactions in DFTB3 using extended polarization from chemical-potential equalization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Christensen, Anders S., E-mail: andersx@chem.wisc.edu, E-mail: cui@chem.wisc.edu; Cui, Qiang, E-mail: andersx@chem.wisc.edu, E-mail: cui@chem.wisc.edu; Elstner, Marcus

Semi-empirical quantum mechanical methods traditionally expand the electron density in a minimal, valence-only electron basis set. The minimal-basis approximation causes molecular polarization to be underestimated, and hence intermolecular interaction energies are also underestimated, especially for intermolecular interactions involving charged species. In this work, the third-order self-consistent charge density functional tight-binding method (DFTB3) is augmented with an auxiliary response density using the chemical-potential equalization (CPE) method and an empirical dispersion correction (D3). The parameters in the CPE and D3 models are fitted to high-level CCSD(T) reference interaction energies for a broad range of chemical species, as well as dipole moments calculatedmore » at the DFT level; the impact of including polarizabilities of molecules in the parameterization is also considered. Parameters for the elements H, C, N, O, and S are presented. The Root Mean Square Deviation (RMSD) interaction energy is improved from 6.07 kcal/mol to 1.49 kcal/mol for interactions with one charged species, whereas the RMSD is improved from 5.60 kcal/mol to 1.73 for a set of 9 salt bridges, compared to uncorrected DFTB3. For large water clusters and complexes that are dominated by dispersion interactions, the already satisfactory performance of the DFTB3-D3 model is retained; polarizabilities of neutral molecules are also notably improved. Overall, the CPE extension of DFTB3-D3 provides a more balanced description of different types of non-covalent interactions than Neglect of Diatomic Differential Overlap type of semi-empirical methods (e.g., PM6-D3H4) and PBE-D3 with modest basis sets.« less

Generating Converged Accurate Free Energy Surfaces for Chemical Reactions with a Force-Matched Semiempirical Model

DOE PAGES

Kroonblawd, Matthew P.; Pietrucci, Fabio; Saitta, Antonino Marco; ...

2018-03-15

Here, we demonstrate the capability of creating robust density functional tight binding (DFTB) models for chemical reactivity in prebiotic mixtures through force matching to short time scale quantum free energy estimates. Molecular dynamics using density functional theory (DFT) is a highly accurate approach to generate free energy surfaces for chemical reactions, but the extreme computational cost often limits the time scales and range of thermodynamic states that can feasibly be studied. In contrast, DFTB is a semiempirical quantum method that affords up to a thousandfold reduction in cost and can recover DFT-level accuracy. Here, we show that a force-matched DFTBmore » model for aqueous glycine condensation reactions yields free energy surfaces that are consistent with experimental observations of reaction energetics. Convergence analysis reveals that multiple nanoseconds of combined trajectory are needed to reach a steady-fluctuating free energy estimate for glycine condensation. Predictive accuracy of force-matched DFTB is demonstrated by direct comparison to DFT, with the two approaches yielding surfaces with large regions that differ by only a few kcal mol –1.« less

Generating Converged Accurate Free Energy Surfaces for Chemical Reactions with a Force-Matched Semiempirical Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kroonblawd, Matthew P.; Pietrucci, Fabio; Saitta, Antonino Marco

Here, we demonstrate the capability of creating robust density functional tight binding (DFTB) models for chemical reactivity in prebiotic mixtures through force matching to short time scale quantum free energy estimates. Molecular dynamics using density functional theory (DFT) is a highly accurate approach to generate free energy surfaces for chemical reactions, but the extreme computational cost often limits the time scales and range of thermodynamic states that can feasibly be studied. In contrast, DFTB is a semiempirical quantum method that affords up to a thousandfold reduction in cost and can recover DFT-level accuracy. Here, we show that a force-matched DFTBmore » model for aqueous glycine condensation reactions yields free energy surfaces that are consistent with experimental observations of reaction energetics. Convergence analysis reveals that multiple nanoseconds of combined trajectory are needed to reach a steady-fluctuating free energy estimate for glycine condensation. Predictive accuracy of force-matched DFTB is demonstrated by direct comparison to DFT, with the two approaches yielding surfaces with large regions that differ by only a few kcal mol –1.« less

Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE PAGES

Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

2015-11-17

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hong; Zapol, Peter; Dixon, David A.

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Phosphorene quantum dot-fullerene nanocomposites for solar energy conversion: An unexplored inorganic-organic nanohybrid with novel photovoltaic properties

NASA Astrophysics Data System (ADS)

Rajbanshi, Biplab; Kar, Moumita; Sarkar, Pallavi; Sarkar, Pranab

2017-10-01

Using the self-consistent charge density-functional based tight-binding (SCC-DFTB) method, coupled with time-dependent density functional theory (TDDFT) calculations, for the first time we explore the possibility of use of phosphorene quantum dots in solar energy harvesting devices. The phosphorene quantum dots-fullerene (PQDs-PCBA) nanocomposites show type-II band alignment indicating spatial separation of charge carriers. The TDDFT calculations also show that the PQD-fullerene nanocomposites seem to be exciting material for future generation solar energy harvester, with extremely fast charge transfer and very poor recombination rate.

Stability and electronic properties of oxygen-doped ZnS polytypes: DFTB study

NASA Astrophysics Data System (ADS)

Popov, Ilya S.; Vorokh, Andrey S.; Enyashin, Andrey N.

2018-06-01

Synthesis from aqueous solutions is an affordable method for fabrication of II-VI semiconductors. However, application of this method often imposes a disorder of crystal lattice, manifesting as a rich variety of polytypes arising from wurtzite and zinc blende phases. The origin of this disordering still remains debatable. Here, the influence of the most likely impurity at water environment - substitutional oxygen - on the polytypic equilibrium of zinc sulphide is studied by means of density-functional tight-binding method. According to calculations, the inclusion of such oxygen does not affect the polytypic equilibrium. Apart of thermodynamic stability, the electronic and elastic properties of ZnS polytypes are studied as the function of oxygen distribution.

Origin of the Surface-Induced First Hyperpolarizability in the C60/SiO2 System: SCC-DFTB Insight.

PubMed

Nénon, Sébastien; Champagne, Benoît

2014-01-02

Using the self-consistent charge density functional tight binding (SCC-DFTB) method, C60 molecules physisorbed on an α-quartz slab are shown to display a first hyperpolarizability, whereas, owing to their symmetry, both the α-quartz slab and C60 molecule have no first hyperpolarizabilities. A larger first hyperpolarizability is achieved when the lowest-lying (five- or six-membered) ring is situated in between two hydroxyl rows, rather than on top, because this situation favors orbital overlaps and charge transfer. Further analysis has demonstrated that (i) the first hyperpolarizability originates from the MO overlap and field-induced charge transfers from the neighboring substrate/adsorbate moieties but not to geometric relaxation of the C60 molecules at the interface and that (ii) larger first hyperpolarizabilities are associated with low surface coverage and with small distances between C60 and the surface. This contribution is a clear illustration of the emergence of second-order nonlinear optical responses (first hyperpolarizability) as a result of breaking the centrosymmetry.

The structure and stability of Si60 and Ge60 cages: a computational study.

PubMed

Chen, Zhongfang; Jiao, Haijun; Seifert, Gotthard; Horn, Anselm H C; Yu, Dengke; Clark, Tim; Thiel, Walter; von Ragué Schleyer, Paul

2003-06-01

Structural studies of fullerene-like Si(60) and Ge(60) cages using ab initio methods were augmented by density functional tight-binding molecular dynamics (DFTB-MD) simulations of finite temperature effects. Neither the perfect I(h) symmetry nor the distorted T(h) structures are true minima. The energies of both are high relative to distorted, lower symmetry minima, C(i) and T, respectively, which still preserve C(60)-type connectivity. Both Si(60) and Ge(60) favor C(i) symmetry cages in which Si and Ge vertexes exhibit either near-trigonal or pyramidal geometries. These structural variations imply significant reactivity differences between different positions. The small magnetic shielding effects (NICS) indicate that aromaticity is not important in these systems. The inorganic fullerene cages have lower stabilities compared with their carbon analogs. Si(60) is stable towards spontaneous disintegration up to 700 K according to DFTB-MD simulations, and thus has potential for experimental observation. In contrast, Ge(60) preserves its cage structure only up to 200 K. Copyright 2003 Wiley Periodicals, Inc. J Comput Chem 24: 948-953, 2003

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuechler, Erich R.; Department of Chemistry, University of Minnesota, Minneapolis, Minnesota 55455-0431; Giese, Timothy J.

To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational,more » produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.« less

Quantum Effects in Cation Interactions with First and Second Coordination Shell Ligands in Metalloproteins

PubMed Central

2015-01-01

Despite decades of investigations, the principal mechanisms responsible for the high affinity and specificity of proteins for key physiological cations K+, Na+, and Ca2+ remain a hotly debated topic. At the core of the debate is an apparent need (or lack thereof) for an accurate description of the electrostatic response of the charge distribution in a protein to the binding of an ion. These effects range from partial electronic polarization of the directly ligating atoms to long-range effects related to partial charge transfer and electronic delocalization effects. While accurate modeling of cation recognition by metalloproteins warrants the use of quantum-mechanics (QM) calculations, the most popular approximations used in major biomolecular simulation packages rely on the implicit modeling of electronic polarization effects. That is, high-level QM computations for ion binding to proteins are desirable, but they are often unfeasible, because of the large size of the reactive-site models and the need to sample conformational space exhaustively at finite temperature. Several solutions to this challenge have been proposed in the field, ranging from the recently developed Drude polarizable force-field for simulations of metalloproteins to approximate tight-binding density functional theory (DFTB). To delineate the usefulness of different approximations, we examined the accuracy of three recent and commonly used theoretical models and numerical algorithms, namely, CHARMM C36, the latest developed Drude polarizable force fields, and DFTB3 with the latest 3OB parameters. We performed MD simulations for 30 cation-selective proteins with high-resolution X-ray structures to create ensembles of structures for analysis with different levels of theory, e.g., additive and polarizable force fields, DFTB3, and DFT. The results from DFT computations were used to benchmark CHARMM C36, Drude, and DFTB3 performance. The explicit modeling of quantum effects unveils the key electrostatic properties of the protein sites and the importance of specific ion-protein interactions. One of the most interesting findings is that secondary coordination shells of proteins are noticeably perturbed in a cation-dependent manner, showing significant delocalization and long-range effects of charge transfer and polarization upon binding Ca2+. PMID:26574284

Dynamic Responses and Initial Decomposition under Shock Loading: A DFTB Calculation Combined with MSST Method for β-HMX with Molecular Vacancy.

PubMed

He, Zheng-Hua; Chen, Jun; Ji, Guang-Fu; Liu, Li-Min; Zhu, Wen-Jun; Wu, Qiang

2015-08-20

Despite extensive efforts on studying the decomposition mechanism of HMX under extreme condition, an intrinsic understanding of mechanical and chemical response processes, inducing the initial chemical reaction, is not yet achieved. In this work, the microscopic dynamic response and initial decomposition of β-HMX with (1 0 0) surface and molecular vacancy under shock condition, were explored by means of the self-consistent-charge density-functional tight-binding method (SCC-DFTB) in conjunction with multiscale shock technique (MSST). The evolutions of various bond lengths and charge transfers were analyzed to explore and understand the initial reaction mechanism of HMX. Our results discovered that the C-N bond close to major axes had less compression sensitivity and higher stretch activity. The charge was transferred mainly from the N-NO2 group along the minor axes and H atom to C atom during the early compression process. The first reaction of HMX primarily initiated with the fission of the molecular ring at the site of the C-N bond close to major axes. Further breaking of the molecular ring enhanced intermolecular interactions and promoted the cleavage of C-H and N-NO2 bonds. More significantly, the dynamic response behavior clearly depended on the angle between chemical bond and shock direction.

VR-SCOSMO: A smooth conductor-like screening model with charge-dependent radii for modeling chemical reactions.

PubMed

Kuechler, Erich R; Giese, Timothy J; York, Darrin M

2016-04-28

To better represent the solvation effects observed along reaction pathways, and of ionic species in general, a charge-dependent variable-radii smooth conductor-like screening model (VR-SCOSMO) is developed. This model is implemented and parameterized with a third order density-functional tight binding quantum model, DFTB3/3OB-OPhyd, a quantum method which was developed for organic and biological compounds, utilizing a specific parameterization for phosphate hydrolysis reactions. Unlike most other applications with the DFTB3/3OB model, an auxiliary set of atomic multipoles is constructed from the underlying DFTB3 density matrix which is used to interact the solute with the solvent response surface. The resulting method is variational, produces smooth energies, and has analytic gradients. As a baseline, a conventional SCOSMO model with fixed radii is also parameterized. The SCOSMO and VR-SCOSMO models shown have comparable accuracy in reproducing neutral-molecule absolute solvation free energies; however, the VR-SCOSMO model is shown to reduce the mean unsigned errors (MUEs) of ionic compounds by half (about 2-3 kcal/mol). The VR-SCOSMO model presents similar accuracy as a charge-dependent Poisson-Boltzmann model introduced by Hou et al. [J. Chem. Theory Comput. 6, 2303 (2010)]. VR-SCOSMO is then used to examine the hydrolysis of trimethylphosphate and seven other phosphoryl transesterification reactions with different leaving groups. Two-dimensional energy landscapes are constructed for these reactions and calculated barriers are compared to those obtained from ab initio polarizable continuum calculations and experiment. Results of the VR-SCOSMO model are in good agreement in both cases, capturing the rate-limiting reaction barrier and the nature of the transition state.

Bandgap engineering of GaN nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ming, Bang-Ming; Yan, Hui; Wang, Ru-Zhi, E-mail: wrz@bjut.edu.cn, E-mail: yamcy@csrc.ac.cn

2016-05-15

Bandgap engineering has been a powerful technique for manipulating the electronic and optical properties of semiconductors. In this work, a systematic investigation of the electronic properties of [0001] GaN nanowires was carried out using the density functional based tight-binding method (DFTB). We studied the effects of geometric structure and uniaxial strain on the electronic properties of GaN nanowires with diameters ranging from 0.8 to 10 nm. Our results show that the band gap of GaN nanowires depends linearly on both the surface to volume ratio (S/V) and tensile strain. The band gap of GaN nanowires increases linearly with S/V, whilemore » it decreases linearly with increasing tensile strain. These linear relationships provide an effect way in designing GaN nanowires for their applications in novel nano-devices.« less

Intermolecular interactions in the condensed phase: Evaluation of semi-empirical quantum mechanical methods

NASA Astrophysics Data System (ADS)

Christensen, Anders S.; Kromann, Jimmy C.; Jensen, Jan H.; Cui, Qiang

2017-10-01

To facilitate further development of approximate quantum mechanical methods for condensed phase applications, we present a new benchmark dataset of intermolecular interaction energies in the solution phase for a set of 15 dimers, each containing one charged monomer. The reference interaction energy in solution is computed via a thermodynamic cycle that integrates dimer binding energy in the gas phase at the coupled cluster level and solute-solvent interaction with density functional theory; the estimated uncertainty of such calculated interaction energy is ±1.5 kcal/mol. The dataset is used to benchmark the performance of a set of semi-empirical quantum mechanical (SQM) methods that include DFTB3-D3, DFTB3/CPE-D3, OM2-D3, PM6-D3, PM6-D3H+, and PM7 as well as the HF-3c method. We find that while all tested SQM methods tend to underestimate binding energies in the gas phase with a root-mean-squared error (RMSE) of 2-5 kcal/mol, they overestimate binding energies in the solution phase with an RMSE of 3-4 kcal/mol, with the exception of DFTB3/CPE-D3 and OM2-D3, for which the systematic deviation is less pronounced. In addition, we find that HF-3c systematically overestimates binding energies in both gas and solution phases. As most approximate QM methods are parametrized and evaluated using data measured or calculated in the gas phase, the dataset represents an important first step toward calibrating QM based methods for application in the condensed phase where polarization and exchange repulsion need to be treated in a balanced fashion.

Ultrafast semi-metallic layer formation in detonating nitromethane

NASA Astrophysics Data System (ADS)

Reed, Evan; Manaa, M. Riad; Fried, Laurence; Glaesemann, Kurt; Joannopoulos, John

2008-03-01

We present the first quantum molecular dynamics simulations behind a detonation front (up to 0.2 ns) of the explosive nitromethane (CH3NO2) represented by the density-functional-based tight-binding method (DFTB). This simulation is enabled by our recently developed multi-scale shock wave molecular dynamics technique (MSST) that opens the door to longer duration simulations by several orders of magnitude. The electronic density of states around the Fermi energy initially increases as metastable material states are produced but then later decreases, perhaps unexpectedly. These changes indicate that the shock front is characterized by an increase in optical thickness and conductivity followed by a reduction around 100 picoseconds behind the front. We find that a significant population of intermediate metastable molecules are charged and charged species play an important role in the density of states evolution. The transient transformation to a semi-metallic state can be understood within the Anderson picture of metallization.

A semi-metallic layer in detonating nitromethane

NASA Astrophysics Data System (ADS)

Reed, Evan; Manaa, Riad; Fried, Laurence; Glaesemann, Kurt; Joannopoulos, John

2007-06-01

We present the first ever glimpse behind a detonation front in a chemically reactive quantum molecular dynamics simulation (up to 0.2 ns) of the explosive nitromethane (CH3NO2) represented by the density-functional-based tight-binding method (DFTB). This simulation is enabled by our recently developed multi-scale shock wave molecular dynamics technique (MSST) that opens the door to longer duration simulations by several orders of magnitude. The electronic DOS around the Fermi energy initially increases as metastable material states are produced but then later decreases, perhaps unexpectedly. These changes indicate that the shock front is characterized by an increase in optical thickness followed by a reduction in optical thickness hundreds of picoseconds behind the front, explaining recent experimental observations. We find that a significant population of intermediate metastable molecules are charged and charged species play an important role in the density of states evolution and a possible Mott metal-insulator transition.

A new efficient method for calculation of Frenkel exciton parameters in molecular aggregates

NASA Astrophysics Data System (ADS)

Plötz, Per-Arno; Niehaus, Thomas; Kühn, Oliver

2014-05-01

The Frenkel exciton Hamiltonian is at the heart of many simulations of excitation energy transfer in molecular aggregates. It separates the aggregate into Coulomb-coupled monomers. Here it is shown that the respective parameters, i.e., monomeric excitation energies and Coulomb couplings between transition densities can be efficiently calculated using time-dependent tight-binding-based density functional theory (TD-DFTB). Specifically, Coulomb couplings are expressed in terms of self-consistently determined Mulliken transition charges. The approach is applied to two dimer systems. First, formaldehyde oxime for which a detailed comparison with standard DFT using the B3LYP and the PBE functionals as well as with SCS-CC2 is provided. Second, the Coulomb coupling is explored in dependence on the intermolecular coordinates for a perylene bisimide dimer. This provides structural evidence for the previously observed biphasic aggregation behavior of this dye.

Computational predictions of the new Gallium nitride nanoporous structures

NASA Astrophysics Data System (ADS)

Lien, Le Thi Hong; Tuoc, Vu Ngoc; Duong, Do Thi; Thu Huyen, Nguyen

2018-05-01

Nanoporous structural prediction is emerging area of research because of their advantages for a wide range of materials science and technology applications in opto-electronics, environment, sensors, shape-selective and bio-catalysis, to name just a few. We propose a computationally and technically feasible approach for predicting Gallium nitride nanoporous structures with hollows at the nano scale. The designed porous structures are studied with computations using the density functional tight binding (DFTB) and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications. Their stability is discussed by means of the free energy computed within the lattice-dynamics approach. Our calculations also indicate that all the reported hollow structures are wide band gap semiconductors in the same fashion with their parent’s bulk stable phase. The electronic band structures of these nanoporous structures are finally examined in detail.

Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

NASA Astrophysics Data System (ADS)

Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

2016-02-01

This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

Use of density functional theory method to calculate structures of neutral carbon clusters C{sub n} (3 ≤ n ≤ 24) and study their variability of structural forms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yen, T. W.; Lai, S. K., E-mail: sklai@coll.phy.ncu.edu.tw

2015-02-28

In this work, we present modifications to the well-known basin hopping (BH) optimization algorithm [D. J. Wales and J. P. Doye, J. Phys. Chem. A 101, 5111 (1997)] by incorporating in it the unique and specific nature of interactions among valence electrons and ions in carbon atoms through calculating the cluster’s total energy by the density functional tight-binding (DFTB) theory, using it to find the lowest energy structures of carbon clusters and, from these optimized atomic and electronic structures, studying their varied forms of topological transitions, which include a linear chain, a monocyclic to a polycyclic ring, and a fullerene/cage-likemore » geometry. In this modified BH (MBH) algorithm, we define a spatial volume within which the cluster’s lowest energy structure is to be searched, and introduce in addition a cut-and-splice genetic operator to increase the searching performance of the energy minimum than the original BH technique. The present MBH/DFTB algorithm is, therefore, characteristically distinguishable from the original BH technique commonly applied to nonmetallic and metallic clusters, technically more thorough and natural in describing the intricate couplings between valence electrons and ions in a carbon cluster, and thus theoretically sound in putting these two charged components on an equal footing. The proposed modified minimization algorithm should be more appropriate, accurate, and precise in the description of a carbon cluster. We evaluate the present algorithm, its energy-minimum searching in particular, by its optimization robustness. Specifically, we first check the MBH/DFTB technique for two representative carbon clusters of larger size, i.e., C{sub 60} and C{sub 72} against the popular cut-and-splice approach [D. M. Deaven and K. M. Ho, Phys. Rev. Lett. 75, 288 (1995)] that normally is combined with the genetic algorithm method for finding the cluster’s energy minimum, before employing it to investigate carbon clusters in the size range C{sub 3}-C{sub 24} studying their topological transitions. An effort was also made to compare our MBH/DFTB and its re-optimized results carried out by full density functional theory (DFT) calculations with some early DFT-based studies.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Xingchen; Salahub, Dennis R.

There is no doubt that a huge gap exists in understanding heterogeneous catalysis between a cluster model of a few atoms and a bulk model of periodic slabs. Nanoparticles, which are crucial in heterogeneous catalysis in industry, lie in the middle of the gap. We present here our work on the computational modelling of molybdenum carbide nanoparticles (MCNPs) as the catalysts for the upgrading of oil sands in the in-situ environment, using benzene hydrogenation as a model reaction. With a cluster model, efforts were first made to understand the mechanism of the reaction with a density functional theory (DFT) studymore » on the adsorption of benzene and its hydrogenation product – cyclohexane, as well as the cyclic hydrogenation reaction intermediates on the Mo{sub 2}C(0001) surface. From the thermodynamic data, along with literature information, it was found that the benzene hydrogenation reaction on molybdenum carbide happens most likely through a Langmuir-Hinshelwood mechanism with the gradual lifting up of the benzene molecule. The electron localization function (ELF) was then used to help understand the nature of the interactions between the MCNPs, identifying strong multi-center interactions between the adsorbates and the MCNPs. To enable the treatment of larger nanoparticles, a fast semi-empirical density functional tight-binding (DFTB) method was parameterized. With this method, the potential energy profiles of benzene hydrogenation reactions on different sizes of MCNPs are calculated. The study was then extended to consider a MCNP embedded in solvent (benzene), using a quantum mechanical (DFTB) / molecular mechanical approach. Calculations on the free energies profiles with the umbrella sampling method show that the entropy of the MCNPs and the solvent are essential in understanding the catalytic activity of the transition metal related nanoparticles for solid/liquid heterogeneous catalysis.« less

Vibrational spectroscopy and molecular dynamics of water monomers and dimers adsorbed on polycyclic aromatic hydrocarbons.

PubMed

Simon, Aude; Rapacioli, Mathias; Mascetti, Joëlle; Spiegelman, Fernand

2012-05-21

This paper reports structures, energetics, dynamics and spectroscopy of H2O and (H2O)2 systems adsorbed on coronene (C24H12), a compact polycyclic aromatic hydrocarbon (PAH). On-the-fly Born-Oppenheimer molecular dynamics simulations are performed for temperatures T varying from 10 to 300 K, on a potential energy surface obtained within the self-consistent-charge density-functional based tight-binding (SCC-DFTB) approach. Anharmonic infrared (IR) spectra are extracted from these simulations. We first benchmark the SCC-DFTB semi-empirical hamiltonian vs. DFT (Density Functional Theory) calculations that include dispersion, on (C6H6)(H2O)1,2 small complexes. We find that charge corrections and inclusion of dispersion contributions in DFTB are necessary to obtain consistent structures, energetics and IR spectra. Using this Hamiltonian, the structures, energetics and IR features of the low-energy isomers of (C24H12)(H2O)1,2 are found to be similar to the DFT ones, with evidence for a stabilizing edge-coordination. The temperature dependence of the motions of H2O and (H2O)2 on the surface of C24H12 is analysed, revealing ultra-fast periodic motion. The water dimer starts diffusing at a higher temperature than the water monomer (150 K vs. 10 K respectively), which appears to be consistent with the binding energies. Qualitative and quantitative analyses of the effects of T on the IR spectra are performed. Anharmonic factors in particular are derived and it is shown that they can be used as signatures for the presence of PAH-water complexes. Finally, this paper lays the foundations for the studies of larger (PAH)m(H2O)n clusters, that can be treated with the efficient computational approach benchmarked in this paper.

Interaction energies for the purine inhibitor roscovitine with cyclin-dependent kinase 2: correlated ab initio quantum-chemical, DFT and empirical calculations.

PubMed

Dobes, Petr; Otyepka, Michal; Strnad, Miroslav; Hobza, Pavel

2006-05-24

The interaction between roscovitine and cyclin-dependent kinase 2 (cdk2) was investigated by performing correlated ab initio quantum-chemical calculations. The whole protein was fragmented into smaller systems consisting of one or a few amino acids, and the interaction energies of these fragments with roscovitine were determined by using the MP2 method with the extended aug-cc-pVDZ basis set. For selected complexes, the complete basis set limit MP2 interaction energies, as well as the coupled-cluster corrections with inclusion of single, double and noninteractive triples contributions [CCSD(T)], were also evaluated. The energies of interaction between roscovitine and small fragments and between roscovitine and substantial sections of protein (722 atoms) were also computed by using density-functional tight-binding methods covering dispersion energy (DFTB-D) and the Cornell empirical potential. Total stabilisation energy originates predominantly from dispersion energy and methods that do not account for the dispersion energy cannot, therefore, be recommended for the study of protein-inhibitor interactions. The Cornell empirical potential describes reasonably well the interaction between roscovitine and protein; therefore, this method can be applied in future thermodynamic calculations. A limited number of amino acid residues contribute significantly to the binding of roscovitine and cdk2, whereas a rather large number of amino acids make a negligible contribution.

Proton transfer pathways, energy landscape, and kinetics in creatine-water systems.

PubMed

Ivchenko, Olga; Whittleston, Chris S; Carr, Joanne M; Imhof, Petra; Goerke, Steffen; Bachert, Peter; Wales, David J

2014-02-27

We study the exchange processes of the metabolite creatine, which is present in both tumorous and normal tissues and has NH2 and NH groups that can transfer protons to water. Creatine produces chemical exchange saturation transfer (CEST) contrast in magnetic resonance imaging (MRI). The proton transfer pathway from zwitterionic creatine to water is examined using a kinetic transition network constructed from the discrete path sampling approach and an approximate quantum-chemical energy function, employing the self-consistent-charge density-functional tight-binding (SCC-DFTB) method. The resulting potential energy surface is visualized by constructing disconnectivity graphs. The energy landscape consists of two distinct regions corresponding to the zwitterionic creatine structures and deprotonated creatine. The activation energy that characterizes the proton transfer from the creatine NH2 group to water was determined from an Arrhenius fit of rate constants as a function of temperature, obtained from harmonic transition state theory. The result is in reasonable agreement with values obtained in water exchange spectroscopy (WEX) experiments.

Structural, electronic properties and stability of metatitanic acid (H 2TiO 3) nanotubes

NASA Astrophysics Data System (ADS)

Enyashin, A. N.; Denisova, T. A.; Ivanovskii, A. L.

2009-12-01

Quite recently, metatitanic acid (H 2TiO 3) has been successfully prepared, which extended the family of known titanic acids H 2Ti nO 2n+1 ( n = 2, 3 and 4). Here the atomic models for nanotubes (NTs) of metatitanic acid are designed and their cohesive and electronic properties are considered depending on their chirality and radii by means of density-functional theory-tight-binding (DFTB) method. Our main findings are that the proposed H 2TiO 3 tubes are stable and that all these NTs will be the insulators (independently from their chirality and the diameters) with forbidden gaps at about ˜4.6 eV. We have found also that aforementioned properties of predicted H 2TiO 3 NTs are very similar with those of recently prepared fabricated nanotubes of polytitanic acids; thus, it is possible to expect that the proposed H 2TiO 3 tubular materials may be fabricated.

Multi-level molecular modelling for plasma medicine

NASA Astrophysics Data System (ADS)

Bogaerts, Annemie; Khosravian, Narjes; Van der Paal, Jonas; Verlackt, Christof C. W.; Yusupov, Maksudbek; Kamaraj, Balu; Neyts, Erik C.

2016-02-01

Modelling at the molecular or atomic scale can be very useful for obtaining a better insight in plasma medicine. This paper gives an overview of different atomic/molecular scale modelling approaches that can be used to study the direct interaction of plasma species with biomolecules or the consequences of these interactions for the biomolecules on a somewhat longer time-scale. These approaches include density functional theory (DFT), density functional based tight binding (DFTB), classical reactive and non-reactive molecular dynamics (MD) and united-atom or coarse-grained MD, as well as hybrid quantum mechanics/molecular mechanics (QM/MM) methods. Specific examples will be given for three important types of biomolecules, present in human cells, i.e. proteins, DNA and phospholipids found in the cell membrane. The results show that each of these modelling approaches has its specific strengths and limitations, and is particularly useful for certain applications. A multi-level approach is therefore most suitable for obtaining a global picture of the plasma-biomolecule interactions.

Effects of oxidation on the plasmonic properties of aluminum nanoclusters.

PubMed

Douglas-Gallardo, Oscar A; Soldano, Germán J; Mariscal, Marcelo M; Sánchez, Cristián Gabriel

2017-11-16

The scouting of alternative plasmonic materials able to enhance and extend the optical properties of noble metal nanostructures is on the rise. Aluminum is endowed with a set of interesting properties which turn it into an attractive plasmonic material. Here we present the optical and electronic features of different aluminum nanostructures stemming from a multilevel computational study. Molecular Dynamics (MD) simulations using a reactive force field (ReaxFF), carefully validated with Density Functional Theory (DFT), were employed to mimic the oxidation of icosahedral aluminum nanoclusters. Resulting structures with different oxidation degrees were then studied through the Time-Dependent Density Functional Tight Binding (TD-DFTB) method. A similar approach was used in aluminum nanoclusters with a disordered structure to study how the loss of crystallinity affects the optical properties. To the best of our knowledge, this is the first report that addresses this issue from the fully atomistic time-dependent approach by means of two different and powerful simulation tools able to describe quantum and physicochemical properties associated with nanostructured particles.

Nucleic acid reactivity : challenges for next-generation semiempirical quantum models

PubMed Central

Huang, Ming; Giese, Timothy J.; York, Darrin M.

2016-01-01

Semiempirical quantum models are routinely used to study mechanisms of RNA catalysis and phosphoryl transfer reactions using combined quantum mechanical/molecular mechanical methods. Herein, we provide a broad assessment of the performance of existing semiempirical quantum models to describe nucleic acid structure and reactivity in order to quantify their limitations and guide the development of next-generation quantum models with improved accuracy. Neglect of diatomic diffierential overlap (NDDO) and self-consistent density-functional tight-binding (SCC-DFTB) semiempirical models are evaluated against high-level quantum mechanical benchmark calculations for seven biologically important data sets. The data sets include: proton affinities, polarizabilities, nucleobase dimer interactions, dimethyl phosphate anion, nucleoside sugar and glycosidic torsion conformations, and RNA phosphoryl transfer model reactions. As an additional baseline, comparisons are made with several commonly used density-functional models, including M062X and B3LYP (in some cases with dispersion corrections). The results show that, among the semiempirical models examined, the AM1/d-PhoT model is the most robust at predicting proton affinities. AM1/d-PhoT and DFTB3-3ob/OPhyd reproduce the MP2 potential energy surfaces of 6 associative RNA phosphoryl transfer model reactions reasonably well. Further, a recently developed linear-scaling “modified divide-and-conquer” model exhibits the most accurate results for binding energies of both hydrogen bonded and stacked nucleobase dimers. The semiempirical models considered here are shown to underestimate the isotropic polarizabilities of neutral molecules by approximately 30%. The semiempirical models also fail to adequately describe torsion profiles within the dimethyl phosphate anion, the nucleoside sugar ring puckers, and the rotations about the nucleoside glycosidic bond. The modeling of pentavalent phosphorus, particularly with thio substitutions often used experimentally as mechanistic probes, was problematic for all of the models considered. Analysis of the strengths and weakness of the models suggest that the creation of robust next-generation models should emphasize the improvement of relative conformational energies and barriers, and nonbond interactions. PMID:25943338

BH-DFTB/DFT calculations for iron clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aktürk, Abdurrahman; Sebetci, Ali, E-mail: asebetci@mevlana.edu.tr

2016-05-15

We present a study on the structural, electronic, and magnetic properties of Fe{sub n}(n  =  2  −  20) clusters by performing density functional tight binding (DFTB) calculations within a basin hopping (BH) global optimization search followed by density functional theory (DFT) investigations. The structures, total energies and total spin magnetic moments are calculated and compared with previously reported theoretical and experimental results. Two basis sets SDD with ECP and 6-31G** are employed in the DFT calculations together with BLYP GGA exchange-correlation functional. The results indicate that the offered BH-DFTB/DFT strategy collects all the global minima of which different minima havemore » been reported in the previous studies by different groups. Small Fe clusters have three kinds of packing; icosahedral (Fe{sub 9−13}), centered hexagonal antiprism (Fe{sub 14−17}, Fe{sub 20}), and truncated decahedral (Fe{sub 17(2)}, Fe{sub 18−19}). It is obtained in a qualitative agreement with the time of flight mass spectra that the magic numbers for the small Fe clusters are 7, 13, 15, and 19 and with the collision induced dissociation experiments that the sizes 6, 7, 13, 15, and 19 are thermodynamically more stable than their neighboring sizes. The spin magnetic moment per atom of Fe{sub n}(n = 2 − 20) clusters is between 2.4 and 3.6 μ{sub B} for the most of the sizes. The antiferromagnetic coupling between the central and the surface atoms of the Fe{sub 13} icosahedron, which have already been reported by experimental and theoretical studies, is verified by our calculations as well. The quantitative disagreements between the calculations and measurements of the magnetic moments of the individual sizes are still to be resolved.« less

Atomic scale behavior of oxygen-based radicals in water

NASA Astrophysics Data System (ADS)

Verlackt, C. C. W.; Neyts, E. C.; Bogaerts, A.

2017-03-01

Cold atmospheric pressure plasmas in and in contact with liquids represent a growing field of research for various applications. Understanding the interactions between the plasma generated species and the liquid is crucial. In this work we perform molecular dynamics (MD) simulations based on a quantum mechanical method, i.e. density-functional based tight-binding (DFTB), to examine the interactions of OH radicals and O atoms in bulk water. Our calculations reveal that the transport of OH radicals through water is not only governed by diffusion, but also by an equilibrium reaction of H-abstraction with water molecules. Furthermore, when two OH radicals encounter each other, they either form a stable cluster, or react, resulting in the formation of a new water molecule and an O atom. In addition, the O atoms form either oxywater (when in singlet configuration) or they remain stable in solution (when in triplet configuration), stressing the important role that O atoms can play in aqueous solution, and in contact with biomolecules. Our observations are in line with both experimental and ab initio results from the literature.

Initial decomposition of the condensed-phase β-HMX under shock waves: molecular dynamics simulations.

PubMed

Ge, Ni-Na; Wei, Yong-Kai; Ji, Guang-Fu; Chen, Xiang-Rong; Zhao, Feng; Wei, Dong-Qing

2012-11-26

We have performed quantum-based multiscale simulations to study the initial chemical processes of condensed-phase octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX) under shock wave loading. A self-consistent charge density-functional tight-binding (SCC-DFTB) method was employed. The results show that the initial decomposition of shocked HMX is triggered by the N-NO(2) bond breaking under the low velocity impact (8 km/s). As the shock velocity increases (11 km/s), the homolytic cleavage of the N-NO(2) bond is suppressed under high pressure, the C-H bond dissociation becomes the primary pathway for HMX decomposition in its early stages. It is accompanied by a five-membered ring formation and hydrogen transfer from the CH(2) group to the -NO(2) group. Our simulations suggest that the initial chemical processes of shocked HMX are dependent on the impact velocity, which gain new insights into the initial decomposition mechanism of HMX upon shock loading at the atomistic level, and have important implications for understanding and development of energetic materials.

Influence of the aggregate state on band structure and optical properties of C60 computed with different methods

NASA Astrophysics Data System (ADS)

Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei

2018-05-01

C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.

Fullerene-like Mo(W)(1-x)Re(x)S2 nanoparticles.

PubMed

Deepak, Francis Leonard; Popovitz-Biro, Ronit; Feldman, Yishay; Cohen, Hagai; Enyashin, Andrey; Seifert, Gotthard; Tenne, Reshef

2008-09-01

Inorganic fullerene-like (IF) Mo(1-x)Re(x)S(2) and W(1-x)Re(x)S(2) nanoparticles have been synthesized by a gas-phase reaction involving the respective metal halides with H(2)S. The IF-Mo(W)(1-x)Re(x)S(2) nanoparticles, containing up to 5 % Re, were characterized by a variety of experimental techniques. Analyses of the X-ray powder diffraction and different electron microscopy techniques show that the Re is doped in the MoS(2) host lattice. Interestingly, Re-doped MoS(2) nanotubes are present as well, although in small quantities ( approximately 5 %). XPS results confirm the nanoparticles to be more n-type arising from the effect of Re doping. Additionally, density-functional tight-binding (DFTB) calculations support the observed n-type behavior.

Simulations of the synthesis of boron-nitride nanostructures in a hot, high pressure gas volume† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c8sc00667a

PubMed Central

Han, Longtao; Irle, Stephan; Nakai, Hiromi

2018-01-01

We performed nanosecond timescale computer simulations of clusterization and agglomeration processes of boron nitride (BN) nanostructures in hot, high pressure gas, starting from eleven different atomic and molecular precursor systems containing boron, nitrogen and hydrogen at various temperatures from 1500 to 6000 K. The synthesized BN nanostructures self-assemble in the form of cages, flakes, and tubes as well as amorphous structures. The simulations facilitate the analysis of chemical dynamics and we are able to predict the optimal conditions concerning temperature and chemical precursor composition for controlling the synthesis process in a high temperature gas volume, at high pressure. We identify the optimal precursor/temperature choices that lead to the nanostructures of highest quality with the highest rate of synthesis, using a novel parameter of the quality of the synthesis (PQS). Two distinct mechanisms of BN nanotube growth were found, neither of them based on the root-growth process. The simulations were performed using quantum-classical molecular dynamics (QCMD) based on the density-functional tight-binding (DFTB) quantum mechanics in conjunction with a divide-and-conquer (DC) linear scaling algorithm, as implemented in the DC-DFTB-K code, enabling the study of systems as large as 1300 atoms in canonical NVT ensembles for 1 ns time. PMID:29780513

Semi-empirical quantum evaluation of peptide - MHC class II binding

NASA Astrophysics Data System (ADS)

González, Ronald; Suárez, Carlos F.; Bohórquez, Hugo J.; Patarroyo, Manuel A.; Patarroyo, Manuel E.

2017-01-01

Peptide presentation by the major histocompatibility complex (MHC) is a key process for triggering a specific immune response. Studying peptide-MHC (pMHC) binding from a structural-based approach has potential for reducing the costs of investigation into vaccine development. This study involved using two semi-empirical quantum chemistry methods (PM7 and FMO-DFTB) for computing the binding energies of peptides bonded to HLA-DR1 and HLA-DR2. We found that key stabilising water molecules involved in the peptide binding mechanism were required for finding high correlation with IC50 experimental values. Our proposal is computationally non-intensive, and is a reliable alternative for studying pMHC binding interactions.

Amino acid analogues bind to carbon nanotube via π-π interactions: Comparison of molecular mechanical and quantum mechanical calculations

NASA Astrophysics Data System (ADS)

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-01

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

Amino acid analogues bind to carbon nanotube via π-π interactions: comparison of molecular mechanical and quantum mechanical calculations.

PubMed

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-14

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

Ultrafast Coulomb explosion of a diiodomethane molecule induced by an X-ray free-electron laser pulse.

PubMed

Takanashi, Tsukasa; Nakamura, Kosuke; Kukk, Edwin; Motomura, Koji; Fukuzawa, Hironobu; Nagaya, Kiyonobu; Wada, Shin-Ichi; Kumagai, Yoshiaki; Iablonskyi, Denys; Ito, Yuta; Sakakibara, Yuta; You, Daehyun; Nishiyama, Toshiyuki; Asa, Kazuki; Sato, Yuhiro; Umemoto, Takayuki; Kariyazono, Kango; Ochiai, Kohei; Kanno, Manabu; Yamazaki, Kaoru; Kooser, Kuno; Nicolas, Christophe; Miron, Catalin; Asavei, Theodor; Neagu, Liviu; Schöffler, Markus; Kastirke, Gregor; Liu, Xiao-Jing; Rudenko, Artem; Owada, Shigeki; Katayama, Tetsuo; Togashi, Tadashi; Tono, Kensuke; Yabashi, Makina; Kono, Hirohiko; Ueda, Kiyoshi

2017-08-02

Coulomb explosion of diiodomethane CH 2 I 2 molecules irradiated by ultrashort and intense X-ray pulses from SACLA, the Japanese X-ray free electron laser facility, was investigated by multi-ion coincidence measurements and self-consistent charge density-functional-based tight-binding (SCC-DFTB) simulations. The diiodomethane molecule, containing two heavy-atom X-ray absorbing sites, exhibits a rather different charge generation and nuclear motion dynamics compared to iodomethane CH 3 I with only a single heavy atom, as studied earlier. We focus on charge creation and distribution in CH 2 I 2 in comparison to CH 3 I. The release of kinetic energy into atomic ion fragments is also studied by comparing SCC-DFTB simulations with the experiment. Compared to earlier simulations, several key enhancements are made, such as the introduction of a bond axis recoil model, where vibrational energy generated during charge creation processes induces only bond stretching or shrinking. We also propose an analytical Coulomb energy partition model to extract the essential mechanism of Coulomb explosion of molecules from the computed and the experimentally measured kinetic energies of fragment atomic ions by partitioning each pair Coulomb interaction energy into two ions of the pair under the constraint of momentum conservation. Effective internuclear distances assigned to individual fragment ions at the critical moment of the Coulomb explosion are then estimated from the average kinetic energies of the ions. We demonstrate, with good agreement between the experiment and the SCC-DFTB simulation, how the more heavily charged iodine fragments and their interplay define the characteristic features of the Coulomb explosion of CH 2 I 2 . The present study also confirms earlier findings concerning the magnitude of bond elongation in the ultrashort X-ray pulse duration, showing that structural damage to all but C-H bonds does not develop to a noticeable degree in the pulse length of ∼10 fs.

Signatures in vibrational and UV-visible absorption spectra for identifying cyclic hydrocarbons by graphene fragments.

PubMed

Meng, Yan; Wu, Qi; Chen, Lei; Wangmo, Sonam; Gao, Yang; Wang, Zhigang; Zhang, Rui-Qin; Ding, Dajun; Niehaus, Thomas A; Frauenheim, Thomas

2013-12-21

To promote possible applications of graphene in molecular identification based on stacking effects, in particular in recognizing aromatic amino acids and even sequencing nucleobases in life sciences, we comprehensively study the interaction between graphene segments and different cyclic organic hydrocarbons including benzene (C6H6), cyclohexane (C6H12), benzyne (C6H4), cyclohexene (C6H10), 1,3-cyclohexadiene (C6H8(1)) and 1,4-cyclohexadiene (C6H8(2)), using the density-functional tight-binding (DFTB) method. Interestingly, we find obviously different characteristics in Raman vibrational and ultraviolet visible absorption spectra of the small molecules adsorbed on the graphene sheet. Specifically, we find that both spectra involve clearly different characteristic peaks, belonging to the different small molecules upon adsorption, with the ones of ionized molecules being more substantial. Further analysis shows that the adsorptions are almost all due to the presence of dispersion energy in neutral cases and involve charge transfer from the graphene to the small molecules. In contrast, the main binding force in the ionic adsorption systems is the electronic interaction. The results present clear signatures that can be used to recognize different kinds of aromatic hydrocarbon rings on graphene sheets. We expect that our findings will be helpful for designing molecular recognition devices using graphene.

Structure and vibrational spectra of low-energy silicon clusters

NASA Astrophysics Data System (ADS)

Sieck, A.; Porezag, D.; Frauenheim, Th.; Pederson, M. R.; Jackson, K.

1997-12-01

We have identified low-energy structures of silicon clusters with 9 to 14 atoms using a nonorthogonal tight-binding method (TB) based on density-functional theory (DF). We have further investigated the resulting structures with an accurate all-electron first-principles technique. The results for cohesive energies, cluster geometries, and highest occupied to lowest unoccupied molecular orbital (HOMO-LUMO) gaps show an overall good agreement between DF-TB and self-consistent-field (SCF) DF theory. For Si9 and Si14, we have found equilibrium structures, whereas for Si11, Si12, and Si13, we present clusters with energies close to that of the corresponding ground-state structure recently proposed in the literature. The bonding scheme of clusters in this size range is different from the bulk tetrahedral symmetry. The most stable structures, characterized by low energies and large HOMO-LUMO gaps, have similar common subunits. To aid in their experimental identification, we have computed the full vibrational spectra of the structures, along with the Raman activities, IR intensities, and static polarizabilities, using SCF-DF theory within the local-density approximation (LDA). This method has already been successfully applied to the determination of Raman and IR spectra of silicon clusters with 3-8, 10, 13, 20, and 21 atoms.

Pressure-induced metallization of condensed phase β-HMX under shock loadings via molecular dynamics simulations in conjunction with multi-scale shock technique.

PubMed

Ge, Ni-Na; Wei, Yong-Kai; Zhao, Feng; Chen, Xiang-Rong; Ji, Guang-Fu

2014-07-01

The electronic structure and initial decomposition in high explosive HMX under conditions of shock loading are examined. The simulation is performed using quantum molecular dynamics in conjunction with multi-scale shock technique (MSST). A self-consistent charge density-functional tight-binding (SCC-DFTB) method is adapted. The results show that the N-N-C angle has a drastic change under shock wave compression along lattice vector b at shock velocity 11 km/s, which is the main reason that leads to an insulator-to-metal transition for the HMX system. The metallization pressure (about 130 GPa) of condensed-phase HMX is predicted firstly. We also detect the formation of several key products of condensed-phase HMX decomposition, such as NO2, NO, N2, N2O, H2O, CO, and CO2, and all of them have been observed in previous experimental studies. Moreover, the initial decomposition products include H2 due to the C-H bond breaking as a primary reaction pathway at extreme condition, which presents a new insight into the initial decomposition mechanism of HMX under shock loading at the atomistic level.

Extended polarization in 3rd order SCC-DFTB from chemical potential equilization

PubMed Central

Kaminski, Steve; Giese, Timothy J.; Gaus, Michael; York, Darrin M.; Elstner, Marcus

2012-01-01

In this work we augment the approximate density functional method SCC-DFTB (DFTB3) with the chemical potential equilization (CPE) approach in order to improve the performance for molecular electronic polarizabilities. The CPE method, originally implemented for NDDO type methods by Giese and York, has been shown to emend minimal basis methods wrt response properties significantly, and has been applied to SCC-DFTB recently. CPE allows to overcome this inherent limitation of minimal basis methods by supplying an additional response density. The systematic underestimation is thereby corrected quantitatively without the need to extend the atomic orbital basis, i.e. without increasing the overall computational cost significantly. Especially the dependency of polarizability as a function of molecular charge state was significantly improved from the CPE extension of DFTB3. The empirical parameters introduced by the CPE approach were optimized for 172 organic molecules in order to match the results from density functional methods (DFT) methods using large basis sets. However, the first order derivatives of molecular polarizabilities, as e.g. required to compute Raman activities, are not improved by the current CPE implementation, i.e. Raman spectra are not improved. PMID:22894819

Error estimates for (semi-)empirical dispersion terms and large biomacromolecules.

PubMed

Korth, Martin

2013-10-14

The first-principles modeling of biomaterials has made tremendous advances over the last few years with the ongoing growth of computing power and impressive developments in the application of density functional theory (DFT) codes to large systems. One important step forward was the development of dispersion corrections for DFT methods, which account for the otherwise neglected dispersive van der Waals (vdW) interactions. Approaches at different levels of theory exist, with the most often used (semi-)empirical ones based on pair-wise interatomic C6R(-6) terms. Similar terms are now also used in connection with semiempirical QM (SQM) methods and density functional tight binding methods (SCC-DFTB). Their basic structure equals the attractive term in Lennard-Jones potentials, common to most force field approaches, but they usually use some type of cutoff function to make the mixing of the (long-range) dispersion term with the already existing (short-range) dispersion and exchange-repulsion effects from the electronic structure theory methods possible. All these dispersion approximations were found to perform accurately for smaller systems, but error estimates for larger systems are very rare and completely missing for really large biomolecules. We derive such estimates for the dispersion terms of DFT, SQM and MM methods using error statistics for smaller systems and dispersion contribution estimates for the PDBbind database of protein-ligand interactions. We find that dispersion terms will usually not be a limiting factor for reaching chemical accuracy, though some force fields and large ligand sizes are problematic.

Dielectric response of molecules in empirical tight-binding theory

NASA Astrophysics Data System (ADS)

Boykin, Timothy B.; Vogl, P.

2002-01-01

In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

Multipolar Ewald Methods, 2: Applications Using a Quantum Mechanical Force Field

PubMed Central

2015-01-01

A fully quantum mechanical force field (QMFF) based on a modified “divide-and-conquer” (mDC) framework is applied to a series of molecular simulation applications, using a generalized Particle Mesh Ewald method extended to multipolar charge densities. Simulation results are presented for three example applications: liquid water, p-nitrophenylphosphate reactivity in solution, and crystalline N,N-dimethylglycine. Simulations of liquid water using a parametrized mDC model are compared to TIP3P and TIP4P/Ew water models and experiment. The mDC model is shown to be superior for cluster binding energies and generally comparable for bulk properties. Examination of the dissociative pathway for dephosphorylation of p-nitrophenylphosphate shows that the mDC method evaluated with the DFTB3/3OB and DFTB3/OPhyd semiempirical models bracket the experimental barrier, whereas DFTB2 and AM1/d-PhoT QM/MM simulations exhibit deficiencies in the barriers, the latter for which is related, in part, to the anomalous underestimation of the p-nitrophenylate leaving group pKa. Simulations of crystalline N,N-dimethylglycine are performed and the overall structure and atomic fluctuations are compared with the experiment and the general AMBER force field (GAFF). The QMFF, which was not parametrized for this application, was shown to be in better agreement with crystallographic data than GAFF. Our simulations highlight some of the application areas that may benefit from using new QMFFs, and they demonstrate progress toward the development of accurate QMFFs using the recently developed mDC framework. PMID:25691830

Low-energy hydrogen uptake by small-cage C n and C n-1B fullerenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dominguez-Gutierrez, F. Javier; Krstic, Predrag S.; Irle, Stephan

We present a theoretical study of the hydrogen uptake capability of carbon fullerene cages Cn and their boron-doped heterofullerene equivalents C n-1B, with n = 20, 40, and 60, irradiated by hydrogen atoms in an impact energy range of 0.1–100 eV. In order to predict exohedral and endohedral hydrogen captures as well as the scattering probability of hydrogen for various cage types and sizes, we perform quantum-classical molecular dynamics (QCMD) calculations using the self-consistent-charge density-functional tight-binding (SCC-DFTB) method. Maximum endohedral hydrogen capture probabilities of 20% for n = 60 and 14% for n = 40 are found at impact energiesmore » close to 15 eV for both C n and C n-1B systems. For n = 20, however, endohedral capture is observed at a maximum of 2%, while the exohedral capture reaches a maximum of 5% both at 15 eV. Similar results for the hydrogen capture are obtained by classical molecular dynamics based on the ReaxFF potential. Lastly, the stopping cross section per carbon atom from the QCMD simulations for all cage sizes displays a linear dependence on the projectile velocity with a threshold at 0.8 eV, and extrapolates well to the available theoretical data.« less

Low-energy hydrogen uptake by small-cage C n and C n-1B fullerenes

DOE PAGES

Dominguez-Gutierrez, F. Javier; Krstic, Predrag S.; Irle, Stephan; ...

2018-08-29

We present a theoretical study of the hydrogen uptake capability of carbon fullerene cages Cn and their boron-doped heterofullerene equivalents C n-1B, with n = 20, 40, and 60, irradiated by hydrogen atoms in an impact energy range of 0.1–100 eV. In order to predict exohedral and endohedral hydrogen captures as well as the scattering probability of hydrogen for various cage types and sizes, we perform quantum-classical molecular dynamics (QCMD) calculations using the self-consistent-charge density-functional tight-binding (SCC-DFTB) method. Maximum endohedral hydrogen capture probabilities of 20% for n = 60 and 14% for n = 40 are found at impact energiesmore » close to 15 eV for both C n and C n-1B systems. For n = 20, however, endohedral capture is observed at a maximum of 2%, while the exohedral capture reaches a maximum of 5% both at 15 eV. Similar results for the hydrogen capture are obtained by classical molecular dynamics based on the ReaxFF potential. Lastly, the stopping cross section per carbon atom from the QCMD simulations for all cage sizes displays a linear dependence on the projectile velocity with a threshold at 0.8 eV, and extrapolates well to the available theoretical data.« less

Formulation and validation of a reduced order model of 2D materials exhibiting a two-phase microstructure as applied to graphene oxide

NASA Astrophysics Data System (ADS)

Benedetti, Ivano; Nguyen, Hoang; Soler-Crespo, Rafael A.; Gao, Wei; Mao, Lily; Ghasemi, Arman; Wen, Jianguo; Nguyen, SonBinh; Espinosa, Horacio D.

2018-03-01

Novel 2D materials, e.g., graphene oxide (GO), are attractive building blocks in the design of advanced materials due to their reactive chemistry, which can enhance interfacial interactions while providing good in-plane mechanical properties. Recent studies have hypothesized that the randomly distributed two-phase microstructure of GO, which arises due to its oxidized chemistry, leads to differences in nano- vs meso-scale mechanical responses. However, this effect has not been carefully studied using molecular dynamics due to computational limitations. Herein, a continuum mechanics model, formulated based on density functional based tight binding (DFTB) constitutive results for GO nano-flakes, is establish for capturing the effect of oxidation patterns on the material mechanical properties. GO is idealized as a continuum heterogeneous two-phase material, where the mechanical response of each phase, graphitic and oxidized, is informed from DFTB simulations. A finite element implementation of the model is validated via MD simulations and then used to investigate the existence of GO representative volume elements (RVE). We find that for the studied GO, an RVE behavior arises for monolayer sizes in excess to 40 nm. Moreover, we reveal that the response of monolayers with two main different functional chemistries, epoxide-rich and hydroxyl-rich, present distinct differences in mechanical behavior. In addition, we explored the role of defect density in GO, and validate the applicability of the model to larger length scales by predicting membrane deflection behavior, in close agreement with previous experimental and theoretical observations. As such the work presents a reduced order modeling framework applicable in the study of mechanical properties and deformation mechanisms in 2D multiphase materials.

Tight-Binding study of Boron structures

NASA Astrophysics Data System (ADS)

McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

2014-10-01

We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.

Hybrid molecular dynamics simulation for plasma induced damage analysis

NASA Astrophysics Data System (ADS)

Matsukuma, Masaaki

2016-09-01

In order to enable further device size reduction (also known as Moore's law) and improved power performance, the semiconductor industry is introducing new materials and device structures into the semiconductor fabrication process. Materials now include III-V compounds, germanium, cobalt, ruthenium, hafnium, and others. The device structure in both memory and logic has been evolving from planar to three dimensional (3D). One such device is the FinFET, where the transistor gate is a vertical fin made either of silicon, silicon-germanium or germanium. These changes have brought renewed interests in the structural damages caused by energetic ion bombardment of the fin sidewalls which are exposed to the ion flux from the plasma during the fin-strip off step. Better control of the physical damage of the 3D devices requires a better understanding of the damage formation mechanisms on such new materials and structures. In this study, the damage formation processes by ion bombardment have been simulated for Si and Ge substrate by Quantum Mechanics/Molecular Mechanics (QM/MM) hybrid simulations and compared to the results from the classical molecular dynamics (MD) simulations. In our QM/MM simulations, the highly reactive region in which the structural damage is created is simulated with the Density Functional based Tight Binding (DFTB) method and the region remote from the primary region is simulated using classical MD with the Stillinger-Weber and Moliere potentials. The learn on the fly method is also used to reduce the computational load. Hence our QM/MM simulation is much faster than the full QC-MD simulations and the original QM/MM simulations. The amorphous layers profile simulated with QM/MM have obvious differences in their thickness for silicon and germanium substrate. The profile of damaged structure in the germanium substrate is characterized by a deeper tail then in silicon. These traits are also observed in the results from the mass selected ion beam experiments. This observed damage profile dependence on species and substrate cannot be reproduced using classical MD simulations. While the Moliere potential is convenient to describe the interactions between halogens and other atoms, more accurate interatomic modeling such as DFTB method which takes the molecular orbitals into account should be utilized to make the simulations more realistic. Based on the simulations results, the damage formation scenario will be discussed.

Modeling electronic trap state distributions in nanocrystalline anatase

NASA Astrophysics Data System (ADS)

Le, Nam; Schweigert, Igor

The charge transport properties of nanocrystalline TiO2 films, and thus the catalytic performance of devices that incorporate them, are affected strongly by the spatial and energetic distribution of localized electronic trap states. Such traps may arise from a variety of defects: Ti interstitials, O vacancies, step edges at surfaces, and grain boundaries. We have developed a procedure for applying density functional theory (DFT) and density functional tight binding (DFTB) calculations to characterize distributions of localized states arising from multiple types of defects. We have applied the procedure to investigate how the morphologies of interfaces between pairs of attached anatase nanoparticles determine the energies of trap states therein. Our results complement recent experimental findings that subtle changes in the morphology of highly porous TiO2 aerogel networks can have a dramatic effect on catalytic performance, which was attributed to changes in the distribution of trap states. This work was supported by the U.S. Naval Research Laboratory via the National Research Council and by the Office of Naval Research through the U.S. Naval Research Laboratory.

Coaxial nanocable composed by imogolite and carbon nanotubes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez, M.; González, R. I.; Munoz, F.

2015-12-31

The discovery and development of Carbon Nanotubes (CNTs) at the beginning of the 1990s has driven a major part of solid state research. The electronic properties of the CNTs have generated a large number of ideas, as building coaxial nanocables. In this work we propose a possible type of such nanocables, which is formed by three nanostructures: two conducting CNTs, where one of them is covered by an insulator (an inorganic oxide nanotube: the imogolite aluminosilicate). The theoretical calculations were carried out using the density functional tight-binding formalism, by means of the DFTB+ code. This formalism allows to calculate themore » band structure, which compares favorably with DFT calculations, but with a significantly lower computational cost. As a first step, we reproduce the calculations of already published results, where the formation of a nanocable composed by one CNT and the imogolite as an insulator. Afterwards, we simulate the band structure for the proposed structure to study the feasibility of the coaxial nanocable. Finally, using classical MD simulations, we study the possible mechanisms of formation of these nanocables.« less

Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

NASA Astrophysics Data System (ADS)

Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

2018-06-01

A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

An ab initio study of the molecular properties of the propyne water hydrogen-bonded complex

NASA Astrophysics Data System (ADS)

Lopes, Kelson C.; Araújo, Regiane C. M. U.; Rusu, Victor H.; Ramos, Mozart N.

2007-05-01

We have employed ab initio MP2 and DFT/B3LYP calculations with the 6-31++G(d,p) basis set to obtain structural, electronic and vibrational properties of the H-bonded complex between propyne and water. This study has revealed that H 2O can doubly complex with propyne forming a quasi five-membered ring. The first complexation occurs through the hydrogen bond between the acid hydrogen of H 2O and the C tbnd C triple bond, whereas the second complexation involves the oxygen atom of H 2O and the in-plane hydrogen atom of the methyl group in propyne. Our calculations have shown that the H-bond lengths between H⋯π and O⋯HC) are 2.419 and 2.707 Å, respectively, employing the DFT/B3LYP calculation whereas the corresponding MP2 values are 2.373 and 2.651 Å. The binding energies including both BSSE and ZPE corrections are -6.16 and -6.72 kJ mol -1, respectively, using the DFT/B3LYP and MP2 calculations. For example, the O-H stretching frequencies of water are decreased by -60 and -29 cm -1 using the DFT/B3LYP calculation, whereas the bending frequency is increased by +15 cm -1. As expected, the infrared intensities for the stretching modes are increased after complexation, especially involving the O-H b bond forming the hydrogen bond with the C tbnd C triple bond.

Microwave emulations and tight-binding calculations of transport in polyacetylene

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

Dissociation of polycyclic aromatic hydrocarbons: molecular dynamics studies

NASA Astrophysics Data System (ADS)

Simon, A.; Rapacioli, M.; Rouaut, G.; Trinquier, G.; Gadéa, F. X.

2017-03-01

We present dynamical studies of the dissociation of polycyclic aromatic hydrocarbon (PAH) radical cations in their ground electronic states with significant internal energy. Molecular dynamics simulations are performed, the electronic structure being described on-the-fly at the self-consistent-charge density functional-based tight binding (SCC-DFTB) level of theory. The SCC-DFTB approach is first benchmarked against DFT results. Extensive simulations are achieved for naphthalene , pyrene and coronene at several energies. Such studies enable one to derive significant trends on branching ratios, kinetics, structures and hints on the formation mechanism of the ejected neutral fragments. In particular, dependence of branching ratios on PAH size and energy were retrieved. The losses of H and C2H2 (recognized as the ethyne molecule) were identified as major dissociation channels. The H/C2H2 ratio was found to increase with PAH size and to decrease with energy. For , which is the most interesting PAH from the astrophysical point of view, the loss of H was found as the quasi-only channel for an internal energy of 30 eV. Overall, in line with experimental trends, decreasing the internal energy or increasing the PAH size will favour the hydrogen loss channels with respect to carbonaceous fragments. This article is part of the themed issue 'Theoretical and computational studies of non-equilibrium and non-statistical dynamics in the gas phase, in the condensed phase and at interfaces'.

Parametrization of DFTB3/3OB for Magnesium and Zinc for Chemical and Biological Applications

PubMed Central

2015-01-01

We report the parametrization of the approximate density functional theory, DFTB3, for magnesium and zinc for chemical and biological applications. The parametrization strategy follows that established in previous work that parametrized several key main group elements (O, N, C, H, P, and S). This 3OB set of parameters can thus be used to study many chemical and biochemical systems. The parameters are benchmarked using both gas-phase and condensed-phase systems. The gas-phase results are compared to DFT (mostly B3LYP), ab initio (MP2 and G3B3), and PM6, as well as to a previous DFTB parametrization (MIO). The results indicate that DFTB3/3OB is particularly successful at predicting structures, including rather complex dinuclear metalloenzyme active sites, while being semiquantitative (with a typical mean absolute deviation (MAD) of ∼3–5 kcal/mol) for energetics. Single-point calculations with high-level quantum mechanics (QM) methods generally lead to very satisfying (a typical MAD of ∼1 kcal/mol) energetic properties. DFTB3/MM simulations for solution and two enzyme systems also lead to encouraging structural and energetic properties in comparison to available experimental data. The remaining limitations of DFTB3, such as the treatment of interaction between metal ions and highly charged/polarizable ligands, are also discussed. PMID:25178644

Tight-binding calculation of single-band and generalized Wannier functions of graphene

NASA Astrophysics Data System (ADS)

Ribeiro, Allan Victor; Bruno-Alfonso, Alexys

Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.

Molecular simulation of water and hydration effects in different environments: challenges and developments for DFTB based models.

PubMed

Goyal, Puja; Qian, Hu-Jun; Irle, Stephan; Lu, Xiya; Roston, Daniel; Mori, Toshifumi; Elstner, Marcus; Cui, Qiang

2014-09-25

We discuss the description of water and hydration effects that employs an approximate density functional theory, DFTB3, in either a full QM or QM/MM framework. The goal is to explore, with the current formulation of DFTB3, the performance of this method for treating water in different chemical environments, the magnitude and nature of changes required to improve its performance, and factors that dictate its applicability to reactions in the condensed phase in a QM/MM framework. A relatively minor change (on the scale of kBT) in the O-H repulsive potential is observed to substantially improve the structural properties of bulk water under ambient conditions; modest improvements are also seen in dynamic properties of bulk water. This simple change also improves the description of protonated water clusters, a solvated proton, and to a more limited degree, a solvated hydroxide. By comparing results from DFTB3 models that differ in the description of water, we confirm that proton transfer energetics are adequately described by the standard DFTB3/3OB model for meaningful mechanistic analyses. For QM/MM applications, a robust parametrization of QM-MM interactions requires an explicit consideration of condensed phase properties, for which an efficient sampling technique was developed recently and is reviewed here. The discussions help make clear the value and limitations of DFTB3 based simulations, as well as the developments needed to further improve the accuracy and transferability of the methodology.

Tight-binding calculation studies of vacancy and adatom defects in graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

2016-02-19

Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

Transferable tight-binding model for strained group IV and III-V materials and heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2016-07-01

It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.

Nucleic acid reactivity: challenges for next-generation semiempirical quantum models.

PubMed

Huang, Ming; Giese, Timothy J; York, Darrin M

2015-07-05

Semiempirical quantum models are routinely used to study mechanisms of RNA catalysis and phosphoryl transfer reactions using combined quantum mechanical (QM)/molecular mechanical methods. Herein, we provide a broad assessment of the performance of existing semiempirical quantum models to describe nucleic acid structure and reactivity to quantify their limitations and guide the development of next-generation quantum models with improved accuracy. Neglect of diatomic differential overlap and self-consistent density-functional tight-binding semiempirical models are evaluated against high-level QM benchmark calculations for seven biologically important datasets. The datasets include: proton affinities, polarizabilities, nucleobase dimer interactions, dimethyl phosphate anion, nucleoside sugar and glycosidic torsion conformations, and RNA phosphoryl transfer model reactions. As an additional baseline, comparisons are made with several commonly used density-functional models, including M062X and B3LYP (in some cases with dispersion corrections). The results show that, among the semiempirical models examined, the AM1/d-PhoT model is the most robust at predicting proton affinities. AM1/d-PhoT and DFTB3-3ob/OPhyd reproduce the MP2 potential energy surfaces of 6 associative RNA phosphoryl transfer model reactions reasonably well. Further, a recently developed linear-scaling "modified divide-and-conquer" model exhibits the most accurate results for binding energies of both hydrogen bonded and stacked nucleobase dimers. The semiempirical models considered here are shown to underestimate the isotropic polarizabilities of neutral molecules by approximately 30%. The semiempirical models also fail to adequately describe torsion profiles for the dimethyl phosphate anion, the nucleoside sugar ring puckers, and the rotations about the nucleoside glycosidic bond. The modeling of pentavalent phosphorus, particularly with thio substitutions often used experimentally as mechanistic probes, was problematic for all of the models considered. Analysis of the strengths and weakness of the models suggests that the creation of robust next-generation models should emphasize the improvement of relative conformational energies and barriers, and nonbonded interactions. © 2015 Wiley Periodicals, Inc.

Absorption of CO2 on Carbon-based Sensors: First-Principle Analysis

NASA Astrophysics Data System (ADS)

Tit, Nacir; Elezzi, Mohammed; Abdullah, Hasan; Bahlouli, Hocine; Yamani, Zain

We present first-principle investigation of the adsorption properties of CO and CO2 molecules on both graphene and carbon nano-tubes (CNTs) in presence of metal catalysis, mainly iron (Fe). The relaxations were carried out using the self-consistent-charge density-functional tight-binding (SCC-DFTB) code in neglect of heat effects. The results show the following: (1) Defected graphene is found to have high sensitivity and high selectivity towards chemisorption of CO molecules and weak physisorption with CO2 molecules. (2) In case of CNTs, the iron ``Fe'' catalyst plays an essential role in capturing CO2 molecules. The Fe ad-atoms on the surface of CNT introduce huge density of states at Fermi level, but the capture of CO2 molecules would reduce that density and consequently reduce conductivity and increase sensitivity. Concerning the selectivity, we have studied the sensitivity versus various gas molecules (such as: O2, N2, H2, H2O, and CO). Furthermore, to assess the effect of catalysis on sensitivity, we have studied the sensitivity of other metal catalysts (such as: Ni, Co, Ti, and Sc). We found that CNT-Fe is highly sensitive and selective towards detection of CO and CO2 molecules. CNT being conductive or semiconducting does not matter much on the adsorption properties.

Scattering matrix of arbitrary tight-binding Hamiltonians

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

2017-03-15

A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

Spectroscopic (FT-IR, FT-Raman) and quantum mechanical studies of 3t-pentyl-2r,6c-diphenylpiperidin-4-one thiosemicarbazone

NASA Astrophysics Data System (ADS)

Savithiri, S.; Arockia doss, M.; Rajarajan, G.; Thanikachalam, V.; Bharanidharan, S.; Saleem, H.

2015-02-01

In this study, the molecular structure and vibrational spectra of 3t-pentyl2r,6c-diphenylpiperidin-4-one thiosemicarbazone (PDPOTSC) were studied. The ground-state molecular geometry was ascertained by using the density functional theory (DFT)/B3LYP method using 6-31++G(d,p) as a basis set. The vibrational (FT-IR and FT-Raman) spectra of PDPOTSC were computed using DFT/B3LYP and HF methods with 6-31++G(d,p) basis set. The fundamental vibrations were assigned on the basis of the total energy distribution (TED ⩾ 10%) of the vibrational modes, calculated with scaled quantum mechanics (SQM) methods PQS program. The electrical dipole moment (μ) and first hyperpolarizability (βo) values have been computed using DFT/B3LYP and HF methods. The calculated result (βo) shows that the title molecule might have nonlinear optical (NLO) behavior. Atomic charges of C, N, S and molecular electrostatic potential (MEP) were calculated using B3LYP/6-31G++(d,p). The HOMO-LUMO energies were calculated and natural bonding orbital (NBO) analysis has also been carried out.

Surface Passivation in Empirical Tight Binding

NASA Astrophysics Data System (ADS)

He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

2016-03-01

Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

NASA Astrophysics Data System (ADS)

Zhang, Shu-Hui; Yang, Wen

2018-01-01

We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

Design of graphene nanoparticle undergoing axial compression: quantum study

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

2011-03-01

We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

Tight-binding calculation of radiation loss in photonic crystal CROW.

PubMed

Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

2013-01-28

The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

NASA Astrophysics Data System (ADS)

Ajiki, Hiroshi

2014-07-01

Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

Phase transition, thermodynamics properties and IR spectrum of α- and γ-RDX: First principles and MD studies

NASA Astrophysics Data System (ADS)

Yuan, Jiaonan; Ji, Guangfu; Chen, Xiangrong; Wei, Dongqing; Zhao, Feng; Wu, Qiang

2016-01-01

In present letter, based on density functional theory plus dispersion (DFT-D) and a self-consistent charge density-functional tight-binding (SCC-DFTB) method, the structural and electronic properties are reported, and the phase transition are investigated by analyzing its thermodynamics properties and IR spectrum of RDX. The anisotropy of α- and γ-RDX were discussed at 0⿿10 GPa. By fitting the third-order Birch⿿Murnaghan equation of states, the bulk modulus and its pressure derivative of RDX were determined. The α-RDX phase is found stable at ambient condition, however, under pressures, both the values of lattice constants a, b, c and the οEvdw at around 4 GPa show abrupt changes which indicate a structural transition occurred. By analyzing the linear compressibility of a, b, c axes at 0⿿8 GPa, one clearly see that the molecules in α-RDX phase underwent rotations and translational motion to their position in the γ-RDX phase at about 4 GPa, which validates the α⿿γ phase transition. The IR spectra of α-form and γ-form RDX was calculated by analyzing the trajectory of molecules motion, which also show the phase transition from the spectra changes. Employing the quasi-harmonic Debye model, the enthalpy and specific heat were investigated at various pressures of both phases. The condition of equal enthalpies in both phases also indicates the phase transition of α-form to γ-form at around 4 GPa. The variation of specific heat with temperature approaches to the classical Dulong⿿Petit's law at high temperature, while at low-temperature it obeys the Debye's T3 law.

Anisotropic responses and initial decomposition of condensed-phase β-HMX under shock loadings via molecular dynamics simulations in conjunction with multiscale shock technique.

PubMed

Ge, Ni-Na; Wei, Yong-Kai; Song, Zhen-Fei; Chen, Xiang-Rong; Ji, Guang-Fu; Zhao, Feng; Wei, Dong-Qing

2014-07-24

Molecular dynamics simulations in conjunction with multiscale shock technique (MSST) are performed to study the initial chemical processes and the anisotropy of shock sensitivity of the condensed-phase HMX under shock loadings applied along the a, b, and c lattice vectors. A self-consistent charge density-functional tight-binding (SCC-DFTB) method was employed. Our results show that there is a difference between lattice vector a (or c) and lattice vector b in the response to a shock wave velocity of 11 km/s, which is investigated through reaction temperature and relative sliding rate between adjacent slipping planes. The response along lattice vectors a and c are similar to each other, whose reaction temperature is up to 7000 K, but quite different along lattice vector b, whose reaction temperature is only up to 4000 K. When compared with shock wave propagation along the lattice vectors a (18 Å/ps) and c (21 Å/ps), the relative sliding rate between adjacent slipping planes along lattice vector b is only 0.2 Å/ps. Thus, the small relative sliding rate between adjacent slipping planes results in the temperature and energy under shock loading increasing at a slower rate, which is the main reason leading to less sensitivity under shock wave compression along lattice vector b. In addition, the C-H bond dissociation is the primary pathway for HMX decomposition in early stages under high shock loading from various directions. Compared with the observation for shock velocities V(imp) = 10 and 11 km/s, the homolytic cleavage of N-NO2 bond was obviously suppressed with increasing pressure.

Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals

NASA Astrophysics Data System (ADS)

Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.

2000-02-01

We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.

Tight-binding model for borophene and borophane

NASA Astrophysics Data System (ADS)

Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

2018-03-01

Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

Development of tight-binding based GW algorithm and its computational implementation for graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

Gaussian polarizable-ion tight binding.

PubMed

Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

2016-10-14

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Gaussian polarizable-ion tight binding

NASA Astrophysics Data System (ADS)

Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

2016-10-01

To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

Tight-binding tunneling amplitude of an optical lattice

NASA Astrophysics Data System (ADS)

Arzamasovs, Maksims; Liu, Bo

2017-11-01

The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

Assessing the Accuracy of Density Functional and Semiempirical Wave Function Methods for Water Nanoparticles: Comparing Binding and Relative Energies of (H2O)16 and (H2O)17 to CCSD(T) Results.

PubMed

Leverentz, Hannah R; Qi, Helena W; Truhlar, Donald G

2013-02-12

The binding energies and relative conformational energies of five configurations of the water 16-mer are computed using 61 levels of density functional (DF) theory, 12 methods combining DF theory with molecular mechanics damped dispersion (DF-MM), seven semiempirical-wave function (SWF) methods, and five methods combining SWF theory with molecular mechanics damped dispersion (SWF-MM). The accuracies of the computed energies are assessed by comparing them to recent high-level ab initio results; this assessment is more relevant to bulk water than previous tests on small clusters because a 16-mer is large enough to have water molecules that participate in more than three hydrogen bonds. We find that for water 16-mer binding energies the best DF, DF-MM, SWF, and SWF-MM methods (and their mean unsigned errors in kcal/mol) are respectively M06-2X (1.6), ωB97X-D (2.3), SCC-DFTB-γ(h) (35.2), and PM3-D (3.2). We also mention the good performance of CAM-B3LYP (1.8), M05-2X (1.9), and TPSSLYP (3.0). In contrast, for relative energies of various water nanoparticle 16-mer structures, the best methods (and mean unsigned errors in kcal/mol), in the same order of classes of methods, are SOGGA11-X (0.3), ωB97X-D (0.2), PM6 (0.4), and PMOv1 (0.6). We also mention the good performance of LC-ωPBE-D3 (0.3) and ωB97X (0.4). When both relative and binding energies are taken into consideration, the best methods overall (out of the 85 tested) are M05-2X without molecular mechanics and ωB97X-D when molecular mechanics corrections are included; with considerably higher average errors and considerably lower cost, the best SWF or SWF-MM method is PMOv1. We use six of the best methods for binding energies of the water 16-mers to calculate the binding energies of water hexamers and water 17-mers to test whether these methods are also reliable for binding energy calculations on other types of water clusters.

Role of substrate dynamics in protein prenylation reactions.

PubMed

Chakravorty, Dhruva K; Merz, Kenneth M

2015-02-17

CONSPECTUS: The role dynamics plays in proteins is of intense contemporary interest. Fundamental insights into how dynamics affects reactivity and product distributions will facilitate the design of novel catalysts that can produce high quality compounds that can be employed, for example, as fuels and life saving drugs. We have used molecular dynamics (MD) methods and combined quantum mechanical/molecular mechanical (QM/MM) methods to study a series of proteins either whose substrates are too far away from the catalytic center or whose experimentally resolved substrate binding modes cannot explain the observed product distribution. In particular, we describe studies of farnesyl transferase (FTase) where the farnesyl pyrophosphate (FPP) substrate is ∼8 Å from the zinc-bound peptide in the active site of FTase. Using MD and QM/MM studies, we explain how the FPP substrate spans the gulf between it and the active site, and we have elucidated the nature of the transition state (TS) and offered an alternate explanation of experimentally observed kinetic isotope effects (KIEs). Our second story focuses on the nature of substrate dynamics in the aromatic prenyltransferase (APTase) protein NphB and how substrate dynamics affects the observed product distribution. Through the examples chosen we show the power of MD and QM/MM methods to provide unique insights into how protein substrate dynamics affects catalytic efficiency. We also illustrate how complex these reactions are and highlight the challenges faced when attempting to design de novo catalysts. While the methods used in our previous studies provided useful insights, several clear challenges still remain. In particular, we have utilized a semiempirical QM model (self-consistent charge density functional tight binding, SCC-DFTB) in our QM/MM studies since the problems we were addressing required extensive sampling. For the problems illustrated, this approach performed admirably (we estimate for these systems an uncertainty of ∼2 kcal/mol), but it is still a semiempirical model, and studies of this type would benefit greatly from more accurate ab initio or DFT models. However, the challenge with these methods is to reach the level of sampling needed to study systems where large conformational changes happen in the many nanoseconds to microsecond time regimes. Hence, how to couple expensive and accurate QM methods with sophisticated sampling algorithms is an important future challenge especially when large-scale studies of catalyst design become of interest. The use of MD and QM/MM models to elucidate enzyme catalytic pathways and to design novel catalytic agents is in its infancy but shows tremendous promise. While this Account summarizes where we have been, we also discuss briefly future directions that improve our fundamental ability to understand enzyme catalysis.

The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

Quantum chemical studies on structural, vibrational, nonlinear optical properties and chemical reactivity of indigo carmine dye

NASA Astrophysics Data System (ADS)

El-Mansy, M. A. M.

2017-08-01

Structural and vibrational spectroscopic studies were performed on indigo carmine (IC) isomers using FT-IR spectral analysis along with DFT/B3LYP method utilizing Gaussian 09 software. GaussView 5 program has been employed to perform a detailed interpretation of vibrational spectra. Simulation of infrared spectra has led to an excellent overall agreement with the observed spectral patterns. Mulliken population analyses on atomic charges, MEP, HOMO-LUMO, NLO, first order hyperpolarizability and thermodynamic properties have been examined by (DFT/B3LYP) method with the SDD basis set level. Density of state spectra (DOS) were calculated using GaussSum 3 at the same level of theory. Molecular modeling approved that DOS Spectra are the most significant tools for differentiating between two IC isomers so far. Moreover, The IC isomers (cis-isomer) have shown an extended applicability for manufacturing both NLO and photovoltaic devices such as solar cells.

Molecular structure, FT IR, NMR, UV, NBO and HOMO-LUMO of 1-(3-(dimethylamino)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile by DFT/B3LYP and PBEPBE methods with LanL2DZ and 6-311 ++G(d,2p) basis sets

NASA Astrophysics Data System (ADS)

Khajehzadeh, Mostafa; Moghadam, Majid

2017-06-01

Structural and molecular properties of antidepressants 1-(3-(dimethylamino)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile were examined using quantum mechanics of Density Functional Theory (DFT)/B3LYP and PBEPBE methods with 6-311 ++ G(d,2p) and LanL2DZ basis sets to study the therapeutic properties of the drug. For this, the structure of desired material was optimized by the computer calculation method and with the use of powerful Gaussian 09 software. Then the lowest energy value and the bond length, bond angle and dihedral angle between its constituent atoms in the crystal structure of the desired material were measured from the optimized values. Then the amount of positive and negative charges, polarizability and dipole moment of its atoms using Mulliken charge and Natural atomic charges, DFT/B3LYP and PBEPBE methods with 6-311 ++ G(d,2p) and LanL2DZ basis sets were determined and the results were compared with each other for individual atoms and by mentioned methods. Also the type of stretching vibrations and bending vibrations between the constituent atoms of the molecule were specified using mentioned computational methods and FT IR vibrational spectra. The experimental spectrum of this material was taken to determine the functional groups and the computational and experimental values were compared to each other and Nuclear Magnetic Resonance (NMR) was used to specify the isomer shift between the carbons and protons in the presence of polar and nonpolar solvents. Also Natural Bond Orbital (NBO) was used to determine the type of electron transfers in σ → σ ∗ and π → π ∗ and LP(1) → σ ∗ and LP(2) → σ ∗ and the amount of hardness and softness in molecule was determined using the difference between ionization energy and electron affinity energy in constituent atoms of that molecule in the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) and in the presence of solvents H2O, CH3CN and C6H12. UV-Vis spectrum of the drug was taken using DFT/B3LYP and PBEPBE methods with 6-311 ++ G(d,2p) and LanL2DZ basis sets as well as solvents H2O, CH3CN and C6H12 and the associated transmissions were examined.

Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

PubMed

Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

2015-06-09

The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

Molecular structure, natural bond analysis, vibrational and electronic spectra, surface enhanced Raman scattering and Mulliken atomic charges of the normal modes of [Mn(DDTC)2] complex.

PubMed

Téllez S, Claudio A; Costa, Anilton C; Mondragón, M A; Ferreira, Glaucio B; Versiane, O; Rangel, J L; Lima, G Müller; Martin, A A

2016-12-05

Theoretical and experimental bands have been assigned for the Fourier Transform Infrared and Raman spectra of the bis(diethyldithiocarbamate)Mn(II) complex, [Mn(DDTC)2]. The calculations have been based on the DFT/B3LYP method, second derivative spectra and band deconvolution analysis. The UV-vis experimental spectra were measured in acetonitrile solution, and the calculated electronic spectrum was obtained using the TD/B3LYP method with 6-311G(d, p) basis set for all atoms. Charge transfer bands and those d-d spin forbidden were assigned in the UV-vis spectrum. The natural bond orbital analysis was carried out using the DFT/B3LYP method and the Mn(II) hybridization leading to the planar geometry of the framework was discussed. Surface enhanced Raman scattering (SERS) was also performed. Mulliken charges of the normal modes were obtained and related to the SERS enhanced bands. Copyright © 2016 Elsevier B.V. All rights reserved.

Dynamical discrete/continuum linear response shells theory of solvation: convergence test for NH4+ and OH- ions in water solution using DFT and DFTB methods.

PubMed

de Lima, Guilherme Ferreira; Duarte, Hélio Anderson; Pliego, Josefredo R

2010-12-09

A new dynamical discrete/continuum solvation model was tested for NH(4)(+) and OH(-) ions in water solvent. The method is similar to continuum solvation models in a sense that the linear response approximation is used. However, different from pure continuum models, explicit solvent molecules are included in the inner shell, which allows adequate treatment of specific solute-solvent interactions present in the first solvation shell, the main drawback of continuum models. Molecular dynamics calculations coupled with SCC-DFTB method are used to generate the configurations of the solute in a box with 64 water molecules, while the interaction energies are calculated at the DFT level. We have tested the convergence of the method using a variable number of explicit water molecules and it was found that even a small number of waters (as low as 14) are able to produce converged values. Our results also point out that the Born model, often used for long-range correction, is not reliable and our method should be applied for more accurate calculations.

Acene-modified triphenylamine dyes for dye-sensitized solar cells: a computational study.

PubMed

Fan, Wenjie; Tan, Dazhi; Deng, Wei-Qiao

2012-06-04

A series of metal-free acene-modified triphenylamine dyes (benzene to pentacene, denoted as TPA-AC1 to TPA-AC5) are investigated as organic sensitizers for application in dye-sensitized solar cells (DSSCs). A combination of density functional theory (DFT), density functional tight-binding (DFTB), and time-dependent DFT (TDDFT) approaches is employed. The effects of acene units on the spectra and electrochemical properties of the acene-modified TPA organic dyes are demonstrated. The dye/(TiO(2))(46) anatase nanoparticle systems are also simulated to show the electronic structures at the interface. The results show that from TPA-AC1 to TPA-AC5 with increasing sizes of the acenes, the absorption and fluorescence spectra are systematically broadened and red-shifted, but the oscillator strength and electron injection properties are reduced. The molecular orbital contributions show increasing localization on the bridging acene units from TPA-AC1 to TPA-AC5. From the theoretical examination of some key parameters including free enthalpy related to the electron injection, light-harvesting efficiency, and the shift of semiconductor conduction band, TPA-AC3 with an anthracene moiety demonstrates a balance of the above crucial factors. TPA-AC3 is expected to be a promising dye with desirable energetic and spectroscopic parameters in the DSSC field, which is consistent with recent experimental work. This study is expected to deepen our understanding of TPA-based organic dyes and assist the molecular design of new metal-free dyes for the further optimization of DSSCs. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Potential mesogens based on pyridine derivatives: The geometric structure, conformational properties and characteristics of intermolecular hydrogen bonds

NASA Astrophysics Data System (ADS)

Fedorov, Mikhail S.; Giricheva, Nina I.; Shpilevaya, Kseniya E.; Lapykina, Elena A.; Syrbu, Svetlana A.

2017-03-01

Conformational properties of the main part (excluding sbnd OC3H7 radicals) of the p-n-propyloxybenzoic (A1) and p-n-propyloxycinnamic (A2) acids molecules (relating to mesomorphic compounds) as well as p-n-propyloxybenzoic acid pyridine ester (B1) and p-n-propyloxyphenylazopyridine (B2) molecules (relating to non-mesomorphic compounds) were studied by DFT(B3LYP)/cc-pVTZ method. It was shown that the main parts of A1 and A2 acids are rigid. The barrier to internal rotation of pyridine fragment in the B1 and B2 molecules depends on the nature of the bridging group. It was determined that all studied A1⋯B1, A2⋯B1 and A2⋯B2 complexes are characterized by a strong hydrogen bond. The binding energy of complexes (≈14 kcal/mol, with BSSE corrections, DFT(B97D)/6-311++G**) exceeds the energy per hydrogen bond in the corresponding acid dimers (≈10 kcal/mol). The structural non-rigidity of A⋯B complexes is mainly caused by possibility of sbnd OC3H7 radicals internal rotation and A and B molecules rotation about the (H)O⋯N line. The characteristics of intermolecular hydrogen bonds were determined by NBO-analysis. The obtained results indicate that examined complexes correspond to the basic requirements to mesogen molecular forms. The thermodynamic functions of the gas-phase complexation reactions (idealized model of the complexes formation in the condensed state) were calculated. Preliminary studies of mesogen-non-mesogen A1⋯B2 system by differential scanning calorimetry and polarizing optical microscopy, showed that it has mesomorphic properties.

Facile synthesis of fluoro, methoxy, and methyl substituted ferrocene-based urea complexes as potential therapeutic agents.

PubMed

Asghar, Faiza; Badshah, Amin; Lal, Bhajan; Zubair, Shumaila; Fatima, Saira; Butler, Ian S

2017-06-01

In the present work, the synthesis, characterization (FT-IR, multinuclear ( 1 H and 13 C) NMR, AAS, Raman, and elemental analysis), DNA binding (cyclic voltammetry, UV-Vis spectroscopy and viscometry), and in vitro biological assessment of nine new ferrocene-based ureas are reported. The desulphurization of ferrocenyl thioureas to the corresponding oxo analogues using aqueous sodium hydroxide and mercuric chloride led to the ferrocenyl ureas (F1-F9) in high yields. The DNA binding studies performed by cyclic voltammetry and UV-Vis spectroscopy produced results that are in close agreement with one another for the binding constants (K) and an electrostatic mode of interaction was observed. The nature and the extent of interaction with DNA was further investigated by viscometry. The DFT/B3LYP method was used to determine the charge distribution and HOMO/LUMO energies of the optimized structure. The DFT calculated HOMO and LUMO energies correlate well with the experimentally determined redox potential values. The synthesized ferrocenyl derivatives exhibited good scavenging activity against 1,1-diphenyl-2-picrylhydrazyl radical (DPPH). These complexes were also scanned for their in vitro cytotoxicity against human carcinoma cell line THP-1 (leukemia cells). The results showed a moderate level of cytotoxicity against the subjected cancer cell line as compared with the standard chemotherapeutic drug (cisplatin). Copyright © 2017 Elsevier Inc. All rights reserved.

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Conductance of AFM Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

2002-01-01

This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

Actinide electronic structure and atomic forces

NASA Astrophysics Data System (ADS)

Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

2000-07-01

We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

NASA Astrophysics Data System (ADS)

Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2015-08-01

Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method

NASA Technical Reports Server (NTRS)

Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)

2000-01-01

The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.

Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Molecular structure, FT IR, NMR, UV, NBO and HOMO-LUMO of 1-(3-(dimethylamino)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile by DFT/B3LYP and PBEPBE methods with LanL2DZ and 6-311++G(d,2p) basis sets.

PubMed

Khajehzadeh, Mostafa; Moghadam, Majid

2017-06-05

Structural and molecular properties of antidepressants 1-(3-(dimethylamino)propyl)-1-(4-fluorophenyl)-1,3-dihydroisobenzofuran-5-carbonitrile were examined using quantum mechanics of Density Functional Theory (DFT)/B3LYP and PBEPBE methods with 6-311++G(d,2p) and LanL2DZ basis sets to study the therapeutic properties of the drug. For this, the structure of desired material was optimized by the computer calculation method and with the use of powerful Gaussian 09 software. Then the lowest energy value and the bond length, bond angle and dihedral angle between its constituent atoms in the crystal structure of the desired material were measured from the optimized values. Then the amount of positive and negative charges, polarizability and dipole moment of its atoms using Mulliken charge and Natural atomic charges, DFT/B3LYP and PBEPBE methods with 6-311++G(d,2p) and LanL2DZ basis sets were determined and the results were compared with each other for individual atoms and by mentioned methods. Also the type of stretching vibrations and bending vibrations between the constituent atoms of the molecule were specified using mentioned computational methods and FT IR vibrational spectra. The experimental spectrum of this material was taken to determine the functional groups and the computational and experimental values were compared to each other and Nuclear Magnetic Resonance (NMR) was used to specify the isomer shift between the carbons and protons in the presence of polar and nonpolar solvents. Also Natural Bond Orbital (NBO) was used to determine the type of electron transfers in σ→σ∗ and π→π∗ and LP(1)→σ∗ and LP(2)→σ∗ and the amount of hardness and softness in molecule was determined using the difference between ionization energy and electron affinity energy in constituent atoms of that molecule in the highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) and in the presence of solvents H 2 O, CH 3 CN and C 6 H 12 . UV-Vis spectrum of the drug was taken using DFT/B3LYP and PBEPBE methods with 6-311++G(d,2p) and LanL2DZ basis sets as well as solvents H 2 O, CH 3 CN and C 6 H 12 and the associated transmissions were examined. Copyright © 2017 Elsevier B.V. All rights reserved.

Structural, vibrational spectroscopic and quantum chemical studies on indole-3-carboxaldehyde

NASA Astrophysics Data System (ADS)

Premkumar, R.; Asath, R. Mohamed; Mathavan, T.; Benial, A. Milton Franklin

2017-05-01

The potential energy surface (PES) scan was performed for indole-3-carboxaldehyde (ICA) and the most stable optimized conformer was predicted using DFT/B3LYP method with 6-31G basis set. The vibrational frequencies of ICA were theoretically calculated by the DFT/B3LYP method with cc-pVTZ basis set using Gaussian 09 program. The vibrational spectra were experimentally recorded by Fourier transform-infrared (FT-IR) and Fourier transform-Raman spectrometer (FT-Raman). The computed vibrational frequencies were scaled by scaling factors to yield a good agreement with observed vibrational frequencies. The theoretically calculated and experimentally observed vibrational frequencies were assigned on the basis of potential energy distribution (PED) calculation using VEDA 4.0 program. The molecular interaction, stability and intramolecular charge transfer of ICA were studied using frontier molecular orbitals (FMOs) analysis and Mulliken atomic charge distribution shows the distribution of the atomic charges. The presence of intramolecular charge transfer was studied using natural bond orbital (NBO) analysis.

Efficient self-consistency for magnetic tight binding

NASA Astrophysics Data System (ADS)

Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

2011-06-01

Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

Tight-binding calculation of the magnetic moment of CrAs under pressure

NASA Astrophysics Data System (ADS)

Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

2018-03-01

We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

DTIC Science & Technology

2010-06-01

for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

PubMed

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

DTIC Science & Technology

2016-06-01

simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the

Accurate modeling of defects in graphene transport calculations

NASA Astrophysics Data System (ADS)

Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

2018-01-01

We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

PubMed

Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

2016-11-21

Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

PubMed

Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

2014-07-28

A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

Transmission eigenchannels from nonequilibrium Green's functions

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Brandbyge, Mads

2007-09-01

The concept of transmission eigenchannels is described in a tight-binding nonequilibrium Green’s function (NEGF) framework. A simple procedure for calculating the eigenchannels is derived using only the properties of the device subspace and quantities normally available in a NEGF calculation. The method is exemplified by visualization in real space of the eigenchannels for three different molecular and atomic wires.

Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

PubMed Central

Lonberg-Holm, K; Whiteley, N M

1976-01-01

Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

Edge currents in frustrated Josephson junction ladders

NASA Astrophysics Data System (ADS)

Marques, A. M.; Santos, F. D. R.; Dias, R. G.

2016-09-01

We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

PubMed Central

Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

2012-01-01

Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

NASA Astrophysics Data System (ADS)

Giro, R.; Caldas, M. J.; Galvão, D. S.

The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

Uncoupling protein 1 binds one nucleotide per monomer and is stabilized by tightly bound cardiolipin

PubMed Central

Lee, Yang; Willers, Chrissie; Kunji, Edmund R. S.; Crichton, Paul G.

2015-01-01

Uncoupling protein 1 (UCP1) catalyzes fatty acid-activated, purine nucleotide-sensitive proton leak across the mitochondrial inner membrane of brown adipose tissue to produce heat, and could help combat obesity and metabolic disease in humans. Studies over the last 30 years conclude that the protein is a dimer, binding one nucleotide molecule per two proteins, and unlike the related mitochondrial ADP/ATP carrier, does not bind cardiolipin. Here, we have developed novel methods to purify milligram amounts of UCP1 from native sources by using covalent chromatography that, unlike past methods, allows the protein to be prepared in defined conditions, free of excess detergent and lipid. Assessment of purified preparations by TLC reveal that UCP1 retains tightly bound cardiolipin, with a lipid phosphorus content equating to three molecules per protein, like the ADP/ATP carrier. Cardiolipin stabilizes UCP1, as demonstrated by reconstitution experiments and thermostability assays, indicating that the lipid has an integral role in the functioning of the protein, similar to other mitochondrial carriers. Furthermore, we find that UCP1 is not dimeric but monomeric, as indicated by size exclusion analysis, and has a ligand titration profile in isothermal calorimetric measurements that clearly shows that one nucleotide binds per monomer. These findings reveal the fundamental composition of UCP1, which is essential for understanding the mechanism of the protein. Our assessment of the properties of UCP1 indicate that it is not unique among mitochondrial carriers and so is likely to use a common exchange mechanism in its primary function in brown adipose tissue mitochondria. PMID:26038550

Schematic baryon models, their tight binding description and their microwave realization

NASA Astrophysics Data System (ADS)

Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-12-01

A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

1988-04-15

We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

Atomistic analysis of valley-orbit hybrid states and inter-dot tunnel rates in a Si double quantum dot

NASA Astrophysics Data System (ADS)

Ferdous, Rifat; Rahman, Rajib; Klimeck, Gerhard

2014-03-01

Silicon quantum dots are promising candidates for solid-state quantum computing due to the long spin coherence times in silicon, arising from small spin-orbit interaction and a nearly spin free host lattice. However, the conduction band valley degeneracy adds an additional degree of freedom to the electronic structure, complicating the encoding and operation of qubits. Although the valley and the orbital indices can be uniquely identified in an ideal silicon quantum dot, atomic-scale disorder mixes valley and orbital states in realistic dots. Such valley-orbit hybridization, strongly influences the inter-dot tunnel rates.Using a full-band atomistic tight-binding method, we analyze the effect of atomic-scale interface disorder in a silicon double quantum dot. Fourier transform of the tight-binding wavefunctions helps to analyze the effect of disorder on valley-orbit hybridization. We also calculate and compare inter-dot inter-valley and intra-valley tunneling, in the presence of realistic disorder, such as interface tilt, surface roughness, alloy disorder, and interface charges. The method provides a useful way to compute electronic states in realistically disordered systems without any posteriori fitting parameters.

Crumbs3 Is Essential for Proper Epithelial Development and Viability

PubMed Central

Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

2014-01-01

First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

Reductive half-reaction of aldehyde oxidoreductase toward acetaldehyde: Ab initio and free energy quantum mechanical/molecular mechanical calculations.

PubMed

Dieterich, Johannes M; Werner, Hans-Joachim; Mata, Ricardo A; Metz, Sebastian; Thiel, Walter

2010-01-21

Energy and free energy barriers for acetaldehyde conversion in aldehyde oxidoreductase are determined for three reaction pathways using quantum mechanical/molecular mechanical (QM/MM) calculations on the solvated enzyme. Ab initio single-point QM/MM energies are obtained at the stationary points optimized at the DFT(B3LYP)/MM level. These ab initio calculations employ local correlation treatments [LMP2 and LCCSD(T0)] in combination with augmented triple- and quadruple-zeta basis sets, and the final coupled cluster results include MP2-based corrections for basis set incompleteness and for the domain approximation. Free energy perturbation (FEP) theory is used to generate free energy profiles at the DFT(B3LYP)/MM level for the most important reaction steps by sampling along the corresponding reaction paths using molecular dynamics. The ab initio and FEP QM/MM results are combined to derive improved estimates of the free energy barriers, which differ from the corresponding DFT(B3LYP)/MM energy barriers by about 3 kcal mol(-1). The present results confirm the qualitative mechanistic conclusions from a previous DFT(B3LYP)/MM study. Most favorable is a three-step Lewis base catalyzed mechanism with an initial proton transfer from the cofactor to the Glu869 residue, a subsequent nucleophilic attack that yields a tetrahedral intermediate (IM2), and a final rate-limiting hydride transfer. The competing metal center activated pathway has the same final step but needs to overcome a higher barrier in the initial step on the route to IM2. The concerted mechanism has the highest free energy barrier and can be ruled out. While confirming the qualitative mechanistic scenario proposed previously on the basis of DFT(B3LYP)/MM energy profiles, the present ab initio and FEP QM/MM calculations provide corrections to the barriers that are important when aiming at high accuracy.

Measurement of free glucocorticoids: quantifying corticosteroid-binding globulin binding affinity and its variation within and among mammalian species.

PubMed

Delehanty, Brendan; Hossain, Sabrina; Jen, Chao Ching; Crawshaw, Graham J; Boonstra, Rudy

2015-01-01

Plasma glucocorticoids (GCs) are commonly used as measures of stress in wildlife. A great deal of evidence indicates that only free GC (GC not bound by the specific binding protein, corticosteroid-binding globulin, CBG) leaves the circulation and exerts biological effects on GC-sensitive tissues. Free hormone concentrations are difficult to measure directly, so researchers estimate free GC using two measures: the binding affinity and the binding capacity in plasma. We provide an inexpensive saturation binding method for calculating the binding affinity (equilibrium dissociation constant, K d) of CBG that can be run without specialized laboratory equipment. Given that other plasma proteins, such as albumin, also bind GCs, the method compensates for this non-specific binding. Separation of bound GC from free GC was achieved with dextran-coated charcoal. The method provides repeatable estimates (12% coefficient of variation in the red squirrel, Tamiasciurus hudsonicus), and there is little evidence of inter-individual variation in K d (range 2.0-7.3 nM for 16 Richardson's ground squirrels, Urocitellus richardsonii). The K d values of 28 mammalian species we assessed were mostly clustered around a median of 4 nM, but five species had values between 13 and 61 nM. This pattern may be distinct from birds, for which published values are more tightly distributed (1.5-5.1 nM). The charcoal separation method provides a reliable and robust method for measuring the K d in a wide range of species. It uses basic laboratory equipment to provide rapid results at very low cost. Given the importance of CBG in regulating the biological activity of GCs, this method is a useful tool for physiological ecologists.

Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

Use of procainamide gels in the purification of human and horse serum cholinesterases.

PubMed Central

Ralston, J S; Main, A R; Kilpatrick, B F; Chasson, A L

1983-01-01

Two large-scale methods based primarily on the use of procainamide-Sepharose gels were developed for the purification of horse and human serum non-specific cholinesterases. With method I, the procainamide-Sepharose 4B gel was used in the first step to handle large volumes of serum. With method II, the procainamide-Sepharose 4B gel was used in the final step to obtain pure enzyme. Although both methods gave electrophoretically pure cholinesterase preparations in good yields, they were significantly more efficient at purifying the horse enzyme than the human enzyme. To study this problem, the relative binding of human and horse cholinesterases to procainamide-, methylacridinium (MAC)-, m-trimethylammoniophenyl (m-PTA)- and p-trimethylammoniophenyl (p-PTA)-Sepharose 4B gels were measured, by using two approaches. In one, binding was measured by a procedure involving equilibration of pure cholinesterase in a small volume of diluted gel slurry (4%, v/v). A partially purified preparation of Electrophorus acetylcholinesterase was included. Pure human cholinesterase bound consistently more tightly to each of the gels than did horse cholinesterase, and the acetylcholinesterase appeared to bind the gels 10-100 times more tightly than did the non-specific cholinesterases. The order of binding for the cholinesterases, beginning with the tightest, was: procainamide-Sepharose 4B, MAC-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. For the acetylcholinesterase the order was: MAC-Sepharose 4B, procainamide-Sepharose 4B, p-PTA-Sepharose 4B and m-PTA-Sepharose 4B. The second approach involved passing native sera or partially purified sera fractions through 1 ml test columns of each of the four affinity gels to determine their retention capacity for the cholinesterases. With these impure samples, the MAC-Sepharose 4B gels proved superior to the procainamide-Sepharose 4B gels at retaining human cholinesterase, but the opposite was true for the horse cholinesterase. PMID:6870822

Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desgranges, Caroline; Delhommelle, Jerome

We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

PubMed

Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

2018-05-08

Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Synthesis, X-ray diffraction method, spectroscopic characterization (FT-IR, 1H and 13C NMR), antimicrobial activity, Hirshfeld surface analysis and DFT computations of novel sulfonamide derivatives

NASA Astrophysics Data System (ADS)

Demircioğlu, Zeynep; Özdemir, Fethi Ahmet; Dayan, Osman; Şerbetçi, Zafer; Özdemir, Namık

2018-06-01

Synthesized compounds of N-(2-aminophenyl)benzenesulfonamide 1 and (Z)-N-(2-((2-nitrobenzylidene)amino)phenyl)benzenesulfonamide 2 were characterized by antimicrobial activity, FT-IR, 1H and 13C NMR. Two new Schiff base ligands containing aromatic sulfonamide fragment of (Z)-N-(2-((3-nitrobenzylidene)amino)phenyl)benzenesulfonamide 3 and (Z)-N-(2-((4-nitrobenzylidene)amino)phenyl)benzenesulfonamide 4 were synthesized and investigated by spectroscopic techniques including 1H and 13C NMR, FT-IR, single crystal X-ray diffraction, Hirshfeld surface, theoretical method analyses and by antimicrobial activity. The molecular geometry obtained from the X-ray structure determination was optimized Density Functional Theory (DFT/B3LYP) method with the 6-311++G(d,p) basis set in ground state. From the optimized geometry of the molecules of 3 and 4, the geometric parameters, vibrational wavenumbers and chemical shifts were computed. The optimized geometry results, which were well represented the X-ray data, were shown that the chosen of DFT/B3LYP 6-311G++(d,p) was a successful choice. After a successful optimization, frontier molecular orbitals, chemical activity, non-linear optical properties (NLO), molecular electrostatic mep (MEP), Mulliken population method, natural population analysis (NPA) and natural bond orbital analysis (NBO), which cannot be obtained experimentally, were calculated and investigated.

Vertical electronic transport in van de waals heterostructures

NASA Astrophysics Data System (ADS)

Qiao, Zhenhua; Zhenhua Qiao's Group Team

In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.

Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

OLIFE: Tight Binding Code for Transmission Coefficient Calculation

NASA Astrophysics Data System (ADS)

Mijbil, Zainelabideen Yousif

2018-05-01

A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

DTIC Science & Technology

1977-01-01

An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

PubMed Central

Meneses, Erick; Mittermaier, Anthony

2014-01-01

Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

Vibrational dynamics (IR, Raman, NRVS) and DFT study of new antitumor tetranuclearstannoxanecluster, Sn(IV)$-$oxo$-$${di$$-$o$-$vanillin} dimethyl dichloride

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arjmand, F.; Sharma, S.; Usman, M.

2016-06-21

The vibrational dynamics of a newly synthesized tetrastannoxane was characterized with a combination of experimental (Raman, IR and tin-based nuclear resonance vibrational spectroscopy) and computational (DFT/B3LYP) methods, with an emphasis on the vibrations of the tin sites. The cytotoxic activity revealed a significant regression selectively against the human pancreatic cell lines.

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

NASA Astrophysics Data System (ADS)

Leleyter, M.; Olivi-Tran, N.

2008-12-01

We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

Study of gas-phase O-H bond dissociation enthalpies and ionization potentials of substituted phenols - Applicability of ab initio and DFT/B3LYP methods

NASA Astrophysics Data System (ADS)

Klein, Erik; Lukeš, Vladimír

2006-11-01

In this paper, the study of phenol and 37 compounds representing various ortho-, para-, and meta-substituted phenols is presented. Molecules and their radical structures were studied using ab initio methods with inclusion of correlation energy and DFT in order to calculate the O-H bond dissociation enthalpies (BDEs) and vertical ionization potentials (IPs). Calculated BDEs and IPs were compared with available experimental values to ascertain the suitability of used methods, especially for the description of the substituent induced changes in BDE and IP. MP2, MP3, and MP4 methods do not give reliable results, since they significantly underestimate substituent induced changes in BDE and do not reflect distinct effect of substituents related to para and meta position correctly. DFT/B3LYP method reflects the effect of substituents on BDE satisfactorily, though ΔBDEs are in narrower range than experimental values. BDE of phenol was calculated also using CCSD(T) method in various basis sets. Both, DFT and HF methods describe the effect of substituents on IP identically. However, DFT considerably underestimates individual values. HF method gives IPs in very good agreement with experimental data. Obtained results show that dependences of BDEs and IPs on Hammett constants of the substituents are linear. Linearity of DFT BDE vs. IP dependence is even better than the dependences on Hammett constants and obtained equations allow estimating of O-H BDEs of meta- and para-substituted phenols from calculated IPs.

Predicting permanent and transient protein-protein interfaces.

PubMed

La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke

2013-05-01

Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

PubMed

Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

2018-04-11

We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

NASA Astrophysics Data System (ADS)

Turek, I.; Kudrnovský, J.; Drchal, V.

2015-12-01

We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

A Sparse Self-Consistent Field Algorithm and Its Parallel Implementation: Application to Density-Functional-Based Tight Binding.

PubMed

Scemama, Anthony; Renon, Nicolas; Rapacioli, Mathias

2014-06-10

We present an algorithm and its parallel implementation for solving a self-consistent problem as encountered in Hartree-Fock or density functional theory. The algorithm takes advantage of the sparsity of matrices through the use of local molecular orbitals. The implementation allows one to exploit efficiently modern symmetric multiprocessing (SMP) computer architectures. As a first application, the algorithm is used within the density-functional-based tight binding method, for which most of the computational time is spent in the linear algebra routines (diagonalization of the Fock/Kohn-Sham matrix). We show that with this algorithm (i) single point calculations on very large systems (millions of atoms) can be performed on large SMP machines, (ii) calculations involving intermediate size systems (1000-100 000 atoms) are also strongly accelerated and can run efficiently on standard servers, and (iii) the error on the total energy due to the use of a cutoff in the molecular orbital coefficients can be controlled such that it remains smaller than the SCF convergence criterion.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

Various Stone-Wales defects in phagraphene

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2016-08-01

Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

Surface passivation for tight-binding calculations of covalent solids.

PubMed

Bernstein, N

2007-07-04

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Surface passivation for tight-binding calculations of covalent solids

NASA Astrophysics Data System (ADS)

Bernstein, N.

2007-07-01

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

USDA-ARS?s Scientific Manuscript database

The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

First Experimental Realization of the Dirac Oscillator

NASA Astrophysics Data System (ADS)

Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-10-01

We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

NASA Astrophysics Data System (ADS)

Panda, Saswati; Sahoo, D. D.; Rout, G. C.

2018-04-01

We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

NASA Astrophysics Data System (ADS)

Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

2017-05-01

We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

DFT calculation and vibrational spectroscopic studies of 2-(tert-butoxycarbonyl (Boc) -amino)-5-bromopyridine

NASA Astrophysics Data System (ADS)

Premkumar, S.; Jawahar, A.; Mathavan, T.; Kumara Dhas, M.; Sathe, V. G.; Milton Franklin Benial, A.

2014-08-01

The molecular structure of 2-(tert-butoxycarbonyl (Boc) -amino)-5-bromopyridine (BABP) was optimized by the DFT/B3LYP method with 6-311G (d,p), 6-311++G (d,p) and cc-pVTZ basis sets using the Gaussian 09 program. The most stable optimized structure of the molecule was predicted by the DFT/B3LYP method with cc-pVTZ basis set. The vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals and thermodynamical parameters were calculated. These calculations were done at the ground state energy level of BABP without applying any constraint on the potential energy surface. The vibrational spectra were experimentally recorded using Fourier Transform-Infrared (FT-IR) and micro-Raman spectrometer. The computed vibrational frequencies were scaled by scale factors to yield a good agreement with observed experimental vibrational frequencies. The complete theoretically calculated and experimentally observed vibrational frequencies were assigned on the basis of Potential Energy Distribution (PED) calculation using the VEDA 4.0 program. The vibrational modes assignments were performed by using the animation option of GaussView 05 graphical interface for Gaussian program. The Mulliken atomic charge distribution was calculated for BABP molecule. The molecular reactivity and stability of BABP were also studied by frontier molecular orbitals (FMOs) analysis.

Excitons in boron nitride single layer

NASA Astrophysics Data System (ADS)

Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

2016-09-01

Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

Electronic properties of Bilayer Fullerene onions

NASA Astrophysics Data System (ADS)

Pincak, R.; Shunaev, V. V.; Smotlacha, J.; Slepchenkov, M. M.; Glukhova, O. E.

2017-10-01

The HOMO-LUMO gaps of the bilayer fullerene onions were investigated. For this purpose, the HOMO and LUMO energies were calculated for the isolated fullerenes using the parametrization of the tight binding method with the Harrison-Goodwin modification. Next, the difference of the Fermi levels of the outer and inner shell was calculated by considering the hybridization of the orbitals on the base of the geometric parameters. The results were obtained by the combination of these calculations.

Structures of Aln (n= 27, 28, 29, and 30) clusters with double-tetrahedron structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, W.; Lu, W. C.; Sun, J.

2008-01-31

Global search for lowest-energy structures of neutral aluminum clusters Al{sub n} (n = 27, 28, 29 and 30) was performed using a genetic algorithm (GA) coupled with a tight-binding (TB) method. Structural candidates obtained from our GA search were further optimized with first-principles calculations. It is found that the medium-sized aluminum clusters Al{sub 27} to Al{sub 30} favor double-tetrahedron structures.

Green's function calculations for semi-infinite carbon nanotubes

NASA Astrophysics Data System (ADS)

John, D. L.; Pulfrey, D. L.

2006-02-01

In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.

Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

PubMed

Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

2017-02-06

The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

NASA Astrophysics Data System (ADS)

Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

2015-07-01

The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

Properties of complexes formed by Na(+), Mg(2+), and Fe(2+) binding with benzene molecules.

PubMed

Kolakkandy, Sujitha; Pratihar, Subha; Aquino, Adelia J A; Wang, Hai; Hase, William L

2014-10-09

A theoretical investigation was performed to study cation-π interactions in complexes of benzene (Bz) with cations, that is, M(z+)(Bz)n for M(z+) = Na(+), Mg(2+), Fe(2+) and n = 1-3, using MP2 theory with the 6-31+G* and 6-311++G** basis sets and the DFT/(B3LYP and B3LYP-D)/6-311++G** methods. Binding energies and structures of the complexes are reported. The splitting between the quintet and single states of the Fe(2+) complexes was found to depend on the number of benzene molecules in the complex and the complex's structure. All of the M(z+)(Bz) complexes prefer a half-sandwich geometry. A geometry with the cation sandwiched between the two benzene rings was found for the M(z+)(Bz)2 complexes, with the benzene rings either in an eclipsed or staggered conformation. An approximate cyclic structure, with the cation at its center, was found for three benzene molecules interacting with the cation. The cation-benzene binding energy is substantial and equal to 22, 108, and 151 kcal/mol for the Na(+)(Bz), Mg(2+)(Bz), and Fe(2+)(Bz) complexes, respectively. The strength of the interaction of the cation with an individual benzene molecule decreases as the number of benzene molecules bound to the cation increases; for example, it is 108 kcal/mol for Mg(2+)(Bz), but only 71 kcal/mol for Mg(2+)(Bz)3. There is a range of values for the M(z+)(Bz)n intermolecular vibrational frequencies; for example, they are ∼230-360 and ∼10-330 cm(-1) for the Mg(2+)(Bz) and Mg(2+)(Bz)3 complexes, respectively. Binding of the cation to benzene both red and blue shifts the benzene vibrational frequencies. This shifting is larger for the Mg(2+) and Fe(2+) complexes, as compared to those for Na(+), as a result of the former's stronger cation-benzene binding. The present study is an initial step to understand the possible importance of cation-π interactions for polycyclic aromatic hydrocarbon aggregation processes during soot formation.

Tight-binding modeling and low-energy behavior of the semi-Dirac point.

PubMed

Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

2009-07-03

We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

NASA Astrophysics Data System (ADS)

Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

2018-04-01

We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

PubMed

Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

2016-10-28

Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Spin structure of electron subbands in (110)-grown quantum wells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nestoklon, M. O.; Tarasenko, S. A.; Jancu, J.-M.

We present the theory of fine structure of electron states in symmetric and asymmetric zinc-blende-type quantum wells with the (110) crystallographic orientation. By combining the symmetry analysis, sp{sup 3}d{sup 5}s* tight-binding method, and envelope-function approach we obtain quantitative description of in-plane wave vector, well width and applied electric field dependencies of the zero-magnetic-field spin splitting of electron subbands and extract spin-orbit-coupling parameters.

Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

2011-07-08

Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

DFT calculation and vibrational spectroscopic studies of 2-(tert-butoxycarbonyl (Boc) -amino)-5-bromopyridine.

PubMed

Premkumar, S; Jawahar, A; Mathavan, T; Kumara Dhas, M; Sathe, V G; Milton Franklin Benial, A

2014-08-14

The molecular structure of 2-(tert-butoxycarbonyl (Boc) -amino)-5-bromopyridine (BABP) was optimized by the DFT/B3LYP method with 6-311G (d,p), 6-311++G (d,p) and cc-pVTZ basis sets using the Gaussian 09 program. The most stable optimized structure of the molecule was predicted by the DFT/B3LYP method with cc-pVTZ basis set. The vibrational frequencies, Mulliken atomic charge distribution, frontier molecular orbitals and thermodynamical parameters were calculated. These calculations were done at the ground state energy level of BABP without applying any constraint on the potential energy surface. The vibrational spectra were experimentally recorded using Fourier Transform-Infrared (FT-IR) and micro-Raman spectrometer. The computed vibrational frequencies were scaled by scale factors to yield a good agreement with observed experimental vibrational frequencies. The complete theoretically calculated and experimentally observed vibrational frequencies were assigned on the basis of Potential Energy Distribution (PED) calculation using the VEDA 4.0 program. The vibrational modes assignments were performed by using the animation option of GaussView 05 graphical interface for Gaussian program. The Mulliken atomic charge distribution was calculated for BABP molecule. The molecular reactivity and stability of BABP were also studied by frontier molecular orbitals (FMOs) analysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Systematic spatial and stoichiometric screening towards understanding the surface of ultrasmall oxygenated silicon nanocrystal

NASA Astrophysics Data System (ADS)

Niaz, Shanawer; Zdetsis, Aristides D.; Koukaras, Emmanuel N.; Gülseren, Oǧuz; Sadiq, Imran

2016-11-01

In most of the realistic ab initio and model calculations which have appeared on the emission of light from silicon nanocrystals, the role of surface oxygen has been usually ignored, underestimated or completely ruled out. We investigate theoretically, by density functional theory (DFT/B3LYP) possible modes of oxygen bonding in hydrogen terminated silicon quantum dots using as a representative case of the Si29 nanocrystal. We have considered Bridge-bonded oxygen (BBO), Doubly-bonded oxygen (DBO), hydroxyl (OH) and Mix of these oxidizing agents. Due to stoichiometry, all comparisons performed are unbiased with respect to composition whereas spatial distribution of oxygen species pointed out drastic change in electronic and cohesive characteristics of nanocrytals. From an overall perspective of this study, it is shown that bridge bonded oxygenated Si nanocrystals accompanied by Mix have higher binding energies and large electronic gap compared to nanocrystals with doubly bonded oxygen atoms. In addition, it is observed that the presence of OH along with BBO, DBO and mixed configurations further lowers electronic gaps and binding energies but trends in same fashion. It is also demonstrated that within same composition, oxidizing constituent, along with their spatial distribution substantially alters binding energy, highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) gap (up to 1.48 eV) and localization of frontier orbitals.

Comparison of Conjugate Gradient Density Matrix Search and Chebyshev Expansion Methods for Avoiding Diagonalization in Large-Scale Electronic Structure Calculations

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Daniels, Andrew D.; Scuseria, Gustavo E.

1998-01-01

We report a comparison of two linear-scaling methods which avoid the diagonalization bottleneck of traditional electronic structure algorithms. The Chebyshev expansion method (CEM) is implemented for carbon tight-binding calculations of large systems and its memory and timing requirements compared to those of our previously implemented conjugate gradient density matrix search (CG-DMS). Benchmark calculations are carried out on icosahedral fullerenes from C60 to C8640 and the linear scaling memory and CPU requirements of the CEM demonstrated. We show that the CPU requisites of the CEM and CG-DMS are similar for calculations with comparable accuracy.

The relationship between water binding and desiccation tolerance in tissues

NASA Technical Reports Server (NTRS)

Vertucci, C. W.; Leopold, A. C.

1987-01-01

In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

NASA Astrophysics Data System (ADS)

Sha, Xianwei; Cohen, R. E.

2010-09-01

We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.

Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

PubMed

Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

2005-06-01

A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

PubMed

Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

2008-10-15

Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

Computational Nanotechnology Program

NASA Technical Reports Server (NTRS)

Scuseria, Gustavo E.

1997-01-01

The objectives are: (1) development of methodological and computational tool for the quantum chemistry study of carbon nanostructures and (2) development of the fundamental understanding of the bonding, reactivity, and electronic structure of carbon nanostructures. Our calculations have continued to play a central role in understanding the outcome of the carbon nanotube macroscopic production experiment. The calculations on buckyonions offer the resolution of a long controversy between experiment and theory. Our new tight binding method offers increased speed for realistic simulations of large carbon nanostructures.

Spectroscopic (FT-IR and UV-Vis) and theoretical (HF and DFT) investigation of 2-Ethyl-N-[(5-nitrothiophene-2-yl)methylidene]aniline

NASA Astrophysics Data System (ADS)

Ceylan, Ümit; Tarı, Gonca Özdemir; Gökce, Halil; Ağar, Erbil

2016-04-01

Crystal structure of the title compound, 2-Ethyl-N-[(5-nitrothiophene-2-yl)methylidene]aniline, C13H12N2O2S, has been synthesized and characterized by FT-IR and UV-Vis spectrum. The compound crystallized in the monoclinic space group P 21/c with a = 11.3578 (4) Å, b = 7.4923 (2) Å, c = 14.9676 (6) Å and β = 99.589 (3)° and Z = 4 in the unit cell. The molecular geometry was also calculated using the Gaussian 03 software and structure was optimized using the HF and DFT/B3LYP methods with the 6-311++G(d,p) basis set in ground state. Using the TD-DFT method, the electronic absorption spectra of the title compound was computed in both the gas phase and ethanol solvent. The harmonic vibrational frequencies of the title compound were calculated using the same methods with the 6-311++G(d,p) basis set. The calculated results were compared with the experimental determination results of the compound. It was seen that the optimized structure was in excellent agreement with the X-ray crystal structure. The energetic behaviors of the title compound in solvent media were examined using the HF and DFT/B3LYP methods with the 6-311++G(d,p) basis set applying the polarizable continuum model (PCM). In addition, the molecular orbitals (FMOs) analysis, molecular electrostatic potential (MEP), nonlinear optical and thermodynamic properties of the title compound were performed using the same methods with the 6-311++G(d,p) basis set.

Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

NASA Astrophysics Data System (ADS)

Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

2018-03-01

It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Tight Junction–Associated Signaling Pathways Modulate Cell Proliferation in Uveal Melanoma

PubMed Central

Jayagopal, Ashwath; Yang, Jin-Long; Haselton, Frederick R.; Chang, Min S.

2011-01-01

Purpose. To investigate the role of tight junction (TJ)–associated signaling pathways in the proliferation of uveal melanoma. Methods. Human uveal melanoma cell lines overexpressing the TJ molecule blood vessel epicardial substance (Bves) were generated. The effects of Bves overexpression on TJ protein expression, cell proliferation, and cell cycle distribution were quantified. In addition, localization and transcription activity of the TJ-associated protein ZO-1–associated nucleic acid binding protein (ZONAB) were evaluated using immunofluorescence and bioluminescence reporter assays to study the involvement of Bves signaling in cell proliferation-associated pathways. Results. Bves overexpression in uveal melanoma cell lines resulted in increased expression of the TJ proteins occludin and ZO-1, reduced cell proliferation, and increased sequestration of ZONAB at TJs and reduced ZONAB transcriptional activity. Conclusions. TJ proteins are present in uveal melanoma, and TJ-associated signaling pathways modulate cell signaling pathways relevant to proliferation in uveal melanoma. PMID:20861479

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

Optimization of binding electrostatics: Charge complementarity in the barnase-barstar protein complex

PubMed Central

lee, Lee-Peng; Tidor, Bruce

2001-01-01

Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622

Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

PubMed Central

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-01-01

Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

PubMed

Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

2018-06-27

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

PubMed

Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

2012-06-13

Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

NASA Astrophysics Data System (ADS)

Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

2018-06-01

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

Coupling the Torpedo microplate-receptor binding assay with mass spectrometry to detect cyclic imine neurotoxins.

PubMed

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M; Zakarian, Armen; Molgó, Jordi

2012-12-04

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility.

Coupling the Torpedo Microplate-Receptor Binding Assay with Mass Spectrometry to Detect Cyclic Imine Neurotoxins

PubMed Central

Aráoz, Rómulo; Ramos, Suzanne; Pelissier, Franck; Guérineau, Vincent; Benoit, Evelyne; Vilariño, Natalia; Botana, Luis M.; Zakarian, Armen; Molgó, Jordi

2014-01-01

Cyclic imine neurotoxins constitute an emergent family of neurotoxins of dinoflagellate origin that are potent antagonists of nicotinic acetylcholine receptors. We developed a target-directed functional method based on the mechanism of action of competitive agonists/antagonists of nicotinic acetylcholine receptors for the detection of marine cyclic imine neurotoxins. The key step for method development was the immobilization of Torpedo electrocyte membranes rich in nicotinic acetylcholine receptors on the surface of microplate wells and the use of biotinylated-α-bungarotoxin as tracer. Cyclic imine neurotoxins competitively inhibit biotinylated-α-bungarotoxin binding to Torpedo-nicotinic acetylcholine receptors in a concentration-dependent manner. The microplate-receptor binding assay allowed rapid detection of nanomolar concentrations of cyclic imine neurotoxins directly in shellfish samples. Although highly sensitive and specific for the detection of neurotoxins targeting nicotinic acetylcholine receptors as a class, the receptor binding assay cannot identify a given analyte. To address the low selectivity of the microplate-receptor binding assay, the cyclic imine neurotoxins tightly bound to the coated Torpedo nicotinic receptor were eluted with methanol, and the chemical nature of the eluted ligands was identified by mass spectrometry. The immobilization of Torpedo electrocyte membranes on the surface of microplate wells proved to be a high-throughput format for the survey of neurotoxins targeting nicotinic acetylcholine receptors directly in shellfish matrixes with high sensitivity and reproducibility. PMID:23131021

Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.

PubMed

He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J

2012-07-01

Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.

A combined representation method for use in band structure calculations. 1: Method

NASA Technical Reports Server (NTRS)

Friedli, C.; Ashcroft, N. W.

1975-01-01

A representation was described whose basis levels combine the important physical aspects of a finite set of plane waves with those of a set of Bloch tight-binding levels. The chosen combination has a particularly simple dependence on the wave vector within the Brillouin Zone, and its use in reducing the standard one-electron band structure problem to the usual secular equation has the advantage that the lattice sums involved in the calculation of the matrix elements are actually independent of the wave vector. For systems with complicated crystal structures, for which the Korringa-Kohn-Rostoker (KKR), Augmented-Plane Wave (APW) and Orthogonalized-Plane Wave (OPW) methods are difficult to apply, the present method leads to results with satisfactory accuracy and convergence.

Interface Schottky barrier engineering via strain in metal-semiconductor composites

NASA Astrophysics Data System (ADS)

Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

2016-01-01

The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

Oxidation of Са2+-Binding Domain of NADPH Oxidase 5 (NOX5): Toward Understanding the Mechanism of Inactivation of NOX5 by ROS.

PubMed

Petrushanko, Irina Yu; Lobachev, Vladimir M; Kononikhin, Alexey S; Makarov, Alexander A; Devred, Francois; Kovacic, Hervé; Kubatiev, Aslan A; Tsvetkov, Philipp O

2016-01-01

NOX5 protein, one of the most active generators of reactive oxygen species (ROS), plays an important role in many processes, including regulation of cell growth, death and differentiation. Because of its central role in ROS generation, it needs to be tightly regulated to guarantee cellular homeostasis. Contrary to other members of NADPH-oxidases family, NOX5 has its own regulatory calcium-binding domain and thus could be activated directly by calcium ions. While several mechanisms of activation have been described, very little is known about the mechanisms that could prevent the overproduction of ROS by NOX5. In the present study using calorimetric methods and circular dichroism we found that oxidation of cysteine and methionine residues of NOX5 decreases binding of Ca2+ ions and perturbs both secondary and tertiary structure of protein. Our data strongly suggest that oxidation of calcium-binding domain of NOX5 could be implicated in its inactivation, serving as a possible defense mechanism against oxidative stress.

Vacancy Mediated Mechanism of Nitrogen Substitution in Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Sadanadan, Bindu; Rao, Apparao M.

2003-01-01

Nitrogen substitution reaction in a graphene sheet and carbon nanotubes of different diameter are investigated using the generalized tight-binding molecular dynamics method. The formation of a vacancy in curved graphene sheet or a carbon nanotube is found to cause a curvature dependent local reconstruction of the surface. Our simulations and analysis show that vacancy mediated N substitution (rather than N chemisorption) is favored on the surface of nanotubes with diameter larger than 8 nm. This predicted value of the critical minimum diameter for N incorporation is confirmed by experimental results presented.

Atomic Structure and Properties of Extended Defects in Silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buczko, R.; Chisholm, M.F.; Kaplan, T.

1998-10-15

The Z-contrast technique represents a new approach to high-resolution electron microscopy allowing for the first time incoherent imaging of materials on the atomic scale. The key advantages of the technique, an intrinsically higher resolution limit and directly interpretable, compositionally sensitive imaging, allow a new level of insight into the atomic configurations of extended defects in silicon. This experimental technique has been combined with theoretical calculations (a combination of first principles, tight binding, and classical methods) to extend this level of insight by obtaining the energetic and electronic structure of the defects.

Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

PubMed

Nagata, Yuki

2010-02-01

A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

Investigation of the effect of scattering centers on low dimensional nanowire channel

NASA Astrophysics Data System (ADS)

Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri

2018-05-01

In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.

Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

2010-07-23

Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Pseudo-magnetic fields of strongly-curved graphene nanobubbles

NASA Astrophysics Data System (ADS)

Liu, Li-Chi

2018-04-01

We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

Dynamic CRM occupancy reflects a temporal map of developmental progression.

PubMed

Wilczyński, Bartek; Furlong, Eileen E M

2010-06-22

Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN- binding defined by EPR-based hybrid method

NASA Astrophysics Data System (ADS)

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN-, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane.

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

NASA Astrophysics Data System (ADS)

Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

2018-02-01

We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

Structural, physicochemical characterization, theoretical studies of carboxamides and their Cu(II), Zn(II) complexes having antibacterial activities against E. coli

NASA Astrophysics Data System (ADS)

Aktan, Ebru; Gündüzalp, Ayla Balaban; Özmen, Ümmühan Özdemir

2017-01-01

The carboxamides; N,N‧-bis(thiophene-2-carboxamido)-1,3-diaminopropanol (L1) and N,N‧-bis(furan-2-carboxamido)-1,3-diaminopropanol (L2) were synthesized and characterized using 1H NMR, 13C NMR, LC-MS and FT-IR spectrum. The molecular geometries of these molecules were optimized by DFT/B3LYP method with 6-311G(d,p) basis set in Gaussian 09 software. The geometrical parameters, frontier molecular orbitals (FMOs) and molecular electrostatic potential (MEP) mapped surfaces were calculated by the same basis set. Dinuclear Cu(II) and Zn(II) complexes having general formula as [MLCl]2Cl2.nH2O (in which M = Cu(II),Zn(II); n = 0,2) were also synthesized and characterized using LC-MS and FT-IR spectrum, thermogravimetric analysis (TGA/DTA curves), magnetic moments and molar conductivities. Coordination was found to be through carbonyl oxygen and two chlorine atoms as bridging in distorted tetrahedral geometry. The optimized structures, geometrical parameters, frontier molecular orbitals (FMOs) and dipole moments of metal complexes were also obtained by DFT/B3LYP method with LanL2DZ basis set. Antibacterial activities of the compounds were screened against E. coli using microdilution method (MIC's in μg/mL). The activity results show that the corresponding compounds exhibit good to moderate antibacterial effects when compared with sulfamethoxazole and sulfisoxazole antibiotics as positive controls. Also, metal complexes have remarkable increase in their activities than parent ligands against E. coli which is mostly effected by [Cu(L2)Cl]2Cl2 complex as potential antibacterial agent.

QM/MM free-energy simulations of reaction in Serratia marcescens Chitinase B reveal the protonation state of Asp142 and the critical role of Tyr214.

PubMed

Jitonnom, Jitrayut; Limb, Michael A L; Mulholland, Adrian J

2014-05-08

Serratia marcescens Chitinase B (ChiB), belonging to the glycosidase family 18 (GH18), catalyzes the hydrolysis of β-1,4-glycosidic bond, with retention of configuration, via an unusual substrate-assisted mechanism, in which the substrate itself acts as an intramolecular nucleophile. Here, both elementary steps (glycosylation and deglycosylation) of the ChiB-catalyzed reaction are investigated by means of combined quantum mechanics/molecular mechanics (QM/MM) umbrella sampling molecular dynamics (MD) simulations at the SCC-DFTB/CHARMM22 level of theory. We examine the influence of the Asp142 protonation state on the reaction and the role that this residue performs in the reaction. Our simulations show that reaction with a neutral Asp142 is preferred and demonstrate that this residue provides electrostatic stabilization of the oxazolinium ion intermediate formed in the reaction. Insight into the conformational itinerary ((1,4)B↔(4)H5↔(4)C1) adopted by the substrate (bound in subsite -1) along the preferred reaction pathway is also provided by the simulations. The relative energies of the stationary points found along the reaction pathway calculated with SCC-DFTB and B3LYP were compared. The results suggest that SCC-DFTB is an accurate method for estimating the relative barriers for both steps of the reaction; however, it was found to overestimate the relative energy of an intermediate formed in the reaction when compared with the higher level of theory. Glycosylation is suggested to be a rate-determining step in the reaction with calculated overall reaction free-energy barrier of 20.5 kcal/mol, in a reasonable agreement with the 16.1 kcal/mol barrier derived from the experiment. The role of Tyr214 in catalysis was also investigated with the results, indicating that the residue plays a critical role in the deglycosylation step of the reaction. Simulations of the enzyme-product complex were also performed with an unbinding event suggested to have been observed, affording potential new mechanistic insight into the release of the product of ChiB.

Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

NASA Astrophysics Data System (ADS)

Lei, Jie

2011-03-01

In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

A Model for Predicting Thermoelectric Properties of Bi2Te3

NASA Technical Reports Server (NTRS)

Lee, Seungwon; VonAllmen, Paul

2009-01-01

A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

Density function theory study of the adsorption and dissociation of carbon monoxide on tungsten nanoparticles.

PubMed

Weng, Meng-Hsiung; Ju, Shin-Pon; Chen, Hsin-Tsung; Chen, Hui-Lung; Lu, Jian-Ming; Lin, Ken-Huang; Lin, Jenn-Sen; Hsieh, Jin-Yuan; Yang, Hsi-Wen

2013-02-01

The adsorption and dissociation properties of carbon monoxide (CO) molecule on tungsten W(n) (n = 10-15) nanoparticles have been investigated by density-functional theory (DFT) calculations. The lowest-energy structures for W(n) (n = 10-15) nanoparticles are found by the basin-hopping method and big-bang method with the modified tight-binding many-body potential. We calculated the corresponding adsorption energies, C-O bond lengths and dissociation barriers for adsorption of CO on nanoparticles. The electronic properties of CO on nanoparticles are studied by the analysis of density of state and charge density. The characteristic of CO on W(n) nanoparticles are also compared with that of W bulk.

Visualization of atomic-scale phenomena in superconductors: application to FeSe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas

Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

Visualization of atomic-scale phenomena in superconductors: application to FeSe

DOE PAGES

Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas; ...

2014-10-31

Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

Transformation and fate of 2,4,6-trinitrotoluene (TNT) in anaerobic bioslurry reactors under various aeration schemes: implications for the decontamination of soils.

PubMed

Newcombe, David A; Crawford, Ronald L

2007-12-01

Energetic compounds have been used in a variety of industrial and military applications worldwide leading to widespread environmental contamination. Many of these compounds are toxic and resist degradation by oxidative enzymes resulting in a need for alternative remediation methods. It has been shown that trinitrotoluene (TNT)-contaminated soil subjected to treatment in strictly anaerobic bioreactors results in tight binding of TNT transformation products to soil organic matter. The research presented here examined the fate of TNT and its metabolites in bioreactors under three different aeration regimes. In all treatment regimes, the typical metabolites of aminodinitrotoluenes and diaminonitrotoluenes were observed prior to irreversible binding into the soil fraction of the slurry. Significant transformation of TNT into organic acids or simple diols, as others report in prior work, was not observed in any of the treatments and is an unlikely fate of TNT in anaerobic soil slurries. These results indicate that aeration does not dramatically affect transformation or fate of TNT in reactor systems that receive a rich carbon source but does affect the rate at which metabolites become tightly bound to the soil. The most rapid transformations and lowest redox potentials were observed in reactors in which an aerobic headspace was maintained suggesting that aerobes play a role in establishing conditions that are most conducive to TNT reduction.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

Synthesis, crystal structure investigation, spectroscopic characterizations and DFT computations on a novel 1-(2-chloro-4-phenylquinolin-3-yl)ethanone

NASA Astrophysics Data System (ADS)

Murugavel, S.; Stephen, C. S. Jacob Prasanna; Subashini, R.; Reddy, H. Raveendranatha; AnanthaKrishnan, Dhanabalan

2016-10-01

The title compound 1-(2-chloro-4-phenylquinolin-3-yl)ethanone (CPQE) was synthesised effectively by chlorination of 3-acetyl-4-phenylquinolin-2(1H)-one (APQ) using POCl3 reagent. Structural and vibrational spectroscopic studies were performed by utilizing single crystal X-ray diffraction, FTIR and NMR spectral analysis along with DFT method utilizing GAUSSIAN‧ 03 software. Veda program has been employed to perform a detailed interpretation of vibrational spectra. Mulliken population analyses on atomic charges, MEP, HOMO-LUMO, NBO, Global chemical reactivity descriptors and thermodynamic properties have been examined by (DFT/B3LYP) method with the 6-311G(d,p) basis set level.

A facile approach towards synthesis, characterization, single crystal structure, and DFT study of 5-bromosalicylalcohol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastogi, Rupali, E-mail: rastogirupali@ymail.com; Tarannum, Nazia; Butcher, R. J.

2016-03-15

5-Bromosalicylalcohol was prepared by the interaction of NaBH{sub 4} and 5-bromosalicylaldehyde. The use of sodium borohydride makes the reaction easy, facile, economic and does not require any toxic catalyst. The compound is characterized by FTIR, {sup 1}H NMR, {sup 13}C NMR, TEM and ESI-mass spectra. Crystal structure is determined by single crystal X-ray analysis. Quantum mechanical calculations of geometries, energies and thermodynamic parameters are carried out using density functional theory (DFT/B3LYP) method with 6-311G(d,p) basis set. The optimized geometrical parameters obtained by B3LYP method show good agreement with experimental data.

The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

PubMed

Vetrano, Stefania; Danese, Silvio

2009-05-01

Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

Application of a 1.48-microm diode laser for bisecting oocytes into two identical hemizonae for the hemizona assay.

PubMed

Edenfeld, J; Schöpper, B; Sturm, R; Diedrich, K; Al-Hasani, S

2002-04-01

Laser systems are very promising new technical tools in assisted reproduction. It was investigated if laser radiation can replace the mechanical cutting procedure via micromanipulator in the hemizona assay (HZA), a commonly used bioassay to determine the sperm-zona pellucida binding capacity. An oocyte was bisected precisely into two identical hemizonae with approximately 20 laser pulses (pulse length 30 msec) using a 1.48-microm diode laser. Compared with the conventional method using microscalpels for zona bisection, laser treated hemizonae showed equivalent sperm-binding and within the two groups there was no detectable difference between matching hemizonae in their capacity for tight sperm-binding. To evaluate whether laser radiation affects the outcome of the HZA when effects of certain substances are investigated, the spermatozoa were preincubated with human follicular fluid (hFF), which inhibits the binding of spermatozoa to zona pellucida in vitro. Supplementation with follicular fluid exerted an inhibitory effect in both groups. The hemizona index (HZI) showed no statistical differences between the two methods. Therefore, the 1.48-microm diode laser is a suitable new instrument for generating equally sized hemizonae. There is no use for holding pipettes and microscalpels, on the contrary, for performing the HZA the laser is a precise, very quick and easy to use new working tool.

Electronic instability and change of crystalline phase in compounds of the V3Si type at low temperature

NASA Technical Reports Server (NTRS)

Labbe, J.; Friedel, J.

1978-01-01

In V3Si, the V atoms form an array of dense linear chains; a tight-binding approximation in one dimension was used to describe the d electrons. The electronic energy calculated by this method was reduced when the lattice is deformed. This lead to a band type of the Jahn Teller effect, which may explain the cubic to tetragonal transition which was observed at low temperatures. The theory can be extended to other superconductors of the V3X type when X=Ga, Ge, Sn, etcetera, or NB3SN.

Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures

NASA Astrophysics Data System (ADS)

Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell

2017-06-01

We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.

Study on spin filtering and switching action in a double-triangular network chain

NASA Astrophysics Data System (ADS)

Zhang, Yongmei

2018-04-01

Spin transport properties of a double-triangular quantum network with local magnetic moment on backbones and magnetic flux penetrating the network plane are studied. Numerical simulation results show that such a quantum network will be a good candidate for spin filter and spin switch. Local dispersion and density of states are considered in the framework of tight-binding approximation. Transmission coefficients are calculated by the method of transfer matrix. Spin transmission is regulated by substrate magnetic moment and magnetic flux piercing those triangles. Experimental realization of such theoretical research will be conducive to designing of new spintronic devices.

Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

2000-01-01

The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.

Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

PubMed

Glover, N R; Tracey, A S

1999-04-20

The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

Stabilization of flat aromatic Si6 rings analogous to benzene: ab initio theoretical prediction.

PubMed

Zdetsis, Aristides D

2007-12-07

It is shown by ab initio calculations, based on density functional (DFT/B3LYP), and high level coupled-cluster [CCSD(T)] and quadratic CI [QCISD(T)] methods, that flat aromatic silicon structures analogous to benzene (C6H6) can be stabilized in the presence of lithium. The resulting planar Si6Li6 structure is both stable and aromatic, sharing many key characteristics with benzene. To facilitate possible synthesis and characterization of these species, routes of formation with high exothermicity are suggested and several spectral properties (including optical absorption, infrared, and Raman) are calculated.

Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

NASA Astrophysics Data System (ADS)

Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

2018-07-01

A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

Magnetic quantization in monolayer bismuthene

NASA Astrophysics Data System (ADS)

Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2012-02-01

The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

2014-03-01

The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

NASA Astrophysics Data System (ADS)

Graefe, E. M.; Korsch, H. J.; Rush, A.

2016-07-01

Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

NASA Astrophysics Data System (ADS)

Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

2017-03-01

Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

Simulation and experimental analysis of nanoindentation and mechanical properties of amorphous NiAl alloys.

PubMed

Wang, Chih-Hao; Fang, Te-Hua; Cheng, Po-Chien; Chiang, Chia-Chin; Chao, Kuan-Chi

2015-06-01

This paper used numerical and experimental methods to investigate the mechanical properties of amorphous NiAl alloys during the nanoindentation process. A simulation was performed using the many-body tight-binding potential method. Temperature, plastic deformation, elastic recovery, and hardness were evaluated. The experimental method was based on nanoindentation measurements, allowing a precise prediction of Young's modulus and hardness values for comparison with the simulation results. The indentation simulation results showed a significant increase of NiAl hardness and elastic recovery with increasing Ni content. Furthermore, the results showed that hardness and Young's modulus increase with increasing Ni content. The simulation results are in good agreement with the experimental results. Adhesion test of amorphous NiAl alloys at room temperature is also described in this study.

Non-equilibrium Green's functions method: Non-trivial and disordered leads

NASA Astrophysics Data System (ADS)

He, Yu; Wang, Yu; Klimeck, Gerhard; Kubis, Tillmann

2014-11-01

The non-equilibrium Green's function algorithm requires contact self-energies to model charge injection and extraction. All existing approaches assume infinitely periodic leads attached to a possibly quite complex device. This contradicts today's realistic devices in which contacts are spatially inhomogeneous, chemically disordered, and impacting the overall device characteristics. This work extends the complex absorbing potentials method for arbitrary, ideal, or non-ideal leads in atomistic tight binding representation. The algorithm is demonstrated on a Si nanowire with periodic leads, a graphene nanoribbon with trumpet shape leads, and devices with leads of randomly alloyed Si0.5Ge0.5. It is found that alloy randomness in the leads can reduce the predicted ON-state current of Si0.5Ge0.5 transistors by 45% compared to conventional lead methods.

Theoretical Studies about Adsorption on Silicon Surface

NASA Astrophysics Data System (ADS)

Huang, Yan; Chen, Xiaoshuang; Zhu, Xiao Yan; Duan, He; Zhou, Xiao Hao; Lu, Wei

In this review paper, we address the important research topic of adsorption on the silicon surface. The deposition of single Si ad-species (adatom and ad-dimer) on the p(2×2) reconstructed Si(100) surface has been simulated by the empirical tight-binding method. Using the clean and defective Si surfaces as the deposition substrates, the deposition energies are mapped out around the clean surface, dimer vacancies, steps and kink structures. The binding sites, saddle points and several possible diffusion paths are obtained from the calculated energy. With further analysis of the deposition and diffusion behaviors, the influences of the surface defects can be found. Then, by adopting the first-principle calculations, the adsorptions of the II-VI group elements on the clean and As-passivated Si(211) substrates have been calculated as the example of adsorption on the high-miller-index Si surface.

Trapping of the Enoyl-Acyl Carrier Protein Reductase–Acyl Carrier Protein Interaction

PubMed Central

Tallorin, Lorillee; Finzel, Kara; Nguyen, Quynh G.; Beld, Joris; La Clair, James J.; Burkart, Michael D.

2016-01-01

An ideal target for metabolic engineering, fatty acid biosynthesis remains poorly understood on a molecular level. These carrier protein-dependent pathways require fundamental protein–protein interactions to guide reactivity and processivity, and their control has become one of the major hurdles in successfully adapting these biological machines. Our laboratory has developed methods to prepare acyl carrier proteins (ACPs) loaded with substrate mimetics and cross-linkers to visualize and trap interactions with partner enzymes, and we continue to expand the tools for studying these pathways. We now describe application of the slow-onset, tight-binding inhibitor triclosan to explore the interactions between the type II fatty acid ACP from Escherichia coli, AcpP, and its corresponding enoyl-ACP reductase, FabI. We show that the AcpP–triclosan complex demonstrates nM binding, inhibits in vitro activity, and can be used to isolate FabI in complex proteomes. PMID:26938266

Modeling chain folding in protein-constrained circular DNA.

PubMed Central

Martino, J A; Olson, W K

1998-01-01

An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

Density functional theory analysis and molecular docking evaluation of 1-(2, 5-dichloro-4-sulfophenyl)-3-methyl-5-pyrazolone as COX2 inhibitor against inflammatory diseases

NASA Astrophysics Data System (ADS)

Kavitha, T.; Velraj, G.

2017-08-01

The molecular structure of 1-(2, 5-Dichloro-4-Sulfophenyl)-3-Methyl-5-Pyrazolone (DSMP) was optimized using DFT/B3LYP/6-31++G(d,p) level and its corresponding experimental as well as theoretical FT-IR, FT-Raman vibrational frequencies and UV-Vis spectral analysis were carried out. The vibrational assignments and total energy distributions of each vibration were presented with the aid of Veda 4xx software. The molecular electrostatic potential, HOMO-LUMO energies, global and local reactivity descriptors and natural bond orbitals were analyzed in order to find the most possible reactive sites of the molecule and it was found that DSMP molecule possess enhanced nucleophilic activity. One of the common known COX2 inhibitor, celecoxib (CXB) was also found to exhibit similar reactivity properties and hence DSMP was also expected to inhibit COX enzymes. In order to detect the COX inhibition nature of DSMP, molecular docking analysis was carried out with the help of Autodock software. For that, the optimized structure was in turn used for docking DSMP with COX enzymes. The binding energy scores and inhibitory constant values reveal that the DSMP molecule possess good binding affinity and low inhibition constant towards COX2 enzyme and hence it can be used as an anti-inflammatory drug after carrying out necessary biological tests.

Transition States and transition state analogue interactions with enzymes.

PubMed

Schramm, Vern L

2015-04-21

Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

PubMed Central

Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

2009-01-01

Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

PubMed Central

Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

2009-01-01

8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

Antifreeze Protein Binds Irreversibly to Ice

NASA Astrophysics Data System (ADS)

Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

2006-03-01

Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

Two-dimensional titanium carbonitrides and their hydroxylated derivatives: Structural, electronic properties and stability of MXenes Ti3C2-xNx(OH)2 from DFTB calculations

NASA Astrophysics Data System (ADS)

Enyashin, A. N.; Ivanovskii, A. L.

2013-11-01

The structural, electronic properties and stability of the new MXene compounds—two-dimensional pristine carbonitrides Ti3C2-xNx and their hydroxylated derivatives Ti3C2-xNx(OH)2 are studied by means of DFTB calculations. The genesis of the properties is discussed in the sequence: binary MXenes Ti3C2 (Ti3N2)→hydroxylated forms Ti3C2(OH)2 (Ti3N2(OH)2)→pristine MXene Ti3C2-xNx→hydroxylated Ti3C2-xNx(OH)2. All examined materials are metallic-like. The most favorable type of OH-covering is presented by the occupation of the hollow sites between three neighboring carbon (nitrogen) atoms. Two-dimensional MXene carbonitrides with random distribution of C and N atoms are found to be thermodynamically more favorable.

AFRRI Reports, Second Quarter 1994

DTIC Science & Technology

1994-08-01

the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

Triazole biotin: a tight-binding biotinidase-resistant conjugate.

PubMed

Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

2013-11-28

The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

NASA Astrophysics Data System (ADS)

Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

2016-02-01

We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

Neural-network-assisted genetic algorithm applied to silicon clusters

NASA Astrophysics Data System (ADS)

Marim, L. R.; Lemes, M. R.; dal Pino, A.

2003-03-01

Recently, a new optimization procedure that combines the power of artificial neural-networks with the versatility of the genetic algorithm (GA) was introduced. This method, called neural-network-assisted genetic algorithm (NAGA), uses a neural network to restrict the search space and it is expected to speed up the solution of global optimization problems if some previous information is available. In this paper, we have tested NAGA to determine the ground-state geometry of Sin (10⩽n⩽15) according to a tight-binding total-energy method. Our results indicate that NAGA was able to find the desired global minimum of the potential energy for all the test cases and it was at least ten times faster than pure genetic algorithm.

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN− binding defined by EPR-based hybrid method

PubMed Central

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN−, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane. PMID:26817826

Principles of water oxidation and O2-based hydrocarbon transformation by multinuclear catalytic sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Musaev, Djamaladdin G; Hill, Craig L; Morokuma, Keiji

Abstract The central thrust of this integrated experimental and computational research program was to obtain an atomistic-level understanding of the structural and dynamic factors underlying the design of catalysts for water oxidation and selective reductant-free O2-based transformations. The focus was on oxidatively robust polyoxometalate (POM) complexes in which a catalytic active site interacts with proximal metal centers in a synergistic manner. Thirty five publications in high-impact journals arose from this grant. I. Developing an oxidatively and hydrolytically stable and fast water oxidation catalyst (WOC), a central need in the production of green fuels using water as a reductant, has provenmore » particularly challenging. During this grant period we have designed and investigated several carbon-free, molecular (homogenous), oxidatively and hydrolytically stable WOCs, including the Rb8K2[{Ru4O4(OH)2(H2O)4}(γ-SiW10O36)2]·25H2O (1) and [Co4(H2O)2(α-PW9O34)2]10- (2). Although complex 1 is fast, oxidatively and hydrolytically stable WOC, Ru is neither abundant nor inexpensive. Therefore, development of a stable and fast carbon-free homogenous WOC, based on earth-abundant elements became our highest priority. In 2010, we reported the first such catalyst, complex 2. This complex is substantially faster than 1 and stable under homogeneous conditions. Recently, we have extended our efforts and reported a V2-analog of the complex 2, i.e. [Co4(H2O)2(α-VW9O34)2]10- (3), which shows an even greater stability and reactivity. We succeeded in: (a) immobilizing catalysts 1 and 2 on the surface of various electrodes, and (b) elucidating the mechanism of O2 formation and release from complex 1, as well as the Mn4O4L6 “cubane” cluster. We have shown that the direct O-O bond formation is the most likely pathway for O2 formation during water oxidation catalyzed by 1. II. Oxo transfer catalysts that contain two proximal and synergistically interacting redox active metal centers in the active site form another part of considerable interest of our grant because species with such sites [including methane monooxygenase (MMO) and more] are some of the most effective oxygenase catalysts known. Our team conducted the following research on γ-M2-Keggin complexes: (a) investigated stability of the trimer [{Fe3(OH)3(H2O)2}3(γ-SiW10O36)3]15-, 4, in water, and developed the chemistry and catalysis of the di-iron centered POM, [γ(1,2)-SiW10{Fe(OH)}2O38]6-, 5, in organic solvents (Figure 2). We also study the thermodynamic and structural stability of γ-M2-Keggin in aqueous media for different M’s (d-electron metals). We have defined two structural classes of POMs with proximally bound d-electron metal centers. We refer to these structural isomers of the {γ-M2SiW10} family of POMs as “in-pocket” and “out-of pocket”. We have elucidated the factors controlling the structure and stability of the V, Fe, Ru, Tc, Mo and Rh derivatives of [(SiO4)M2(OH)2W10O32]4- using a range of computational tools. We have: (a) demonstrated that heteroatom X in these polyanions may function as an “internal switch” for defining the ground electronic states and, consequently, the reactivity of the γ-M2-Keggin POM complexes; (b) elucidated reactivity of divacant lacunary species and polyperoxotungstates (PPTs), {Xn+O4[WO(O2)2]4}n-, which could be degradation products of γ-M2-Keggin complexes in aqueous media; (c) elucidated the role of the POM ligand in stabilization of {Ru2} and {(Ru-oxo)2} fragments in the reactant and product of the reaction of {γ-[(Xn+O4)Ru2(OH)2W10O32]}(8-n)- (where X = Si4+, P5+ and S6+) with O2, and (d) the mechanisms of olefin epoxidation catalyzed by these di-d-transition metal substituted and divacant lacunary γ-M2-Keggin complexes. III. Complementing the efforts presented above was the development of less time-consuming but reasonably accurate computational methods allowing one to explore more deeply large catalytic systems. We developed Reactive Force Field (ReaxFF) to study interaction of the targeted POMs with water, proton and hydroxide ions in the liquid phase. We tested our ReaxFF parameters on the Lindqvist POMs, M6O19n-, where M = Nb and Ta. These parameters are made available as part of the ReaxFF code. In addition, we have developed parameters for Sc, Ti, Fe, Co and Ni in combination with H, C, N, O, as well as the same metal (M-M) for the spin-polarized self-consistent-charge density-functional tight-binding (DFTB) method. Test calculations showed that the DFTB method with the present parameters in most cases reproduces structural properties very well. These parameters are made available as part of the DFTB code. Thus, this DOE BES funded research project has clarified several key areas impacting (a) water oxidation and O2-based hydrocarbon transformation, (b) stabilization of key structures and catalytic intermediates in such processes, (c) immobilization of molecular catalysts on metal oxide surfaces, and (d) application of optimal computational methods to study reaction dynamics in large systems.« less

Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

PubMed

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

PubMed Central

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

PubMed Central

Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

2013-01-01

Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

PubMed

Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

2014-01-01

Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Slow-binding inhibition of sialidase from influenza virus.

PubMed

Pegg, M S; von Itzstein, M

1994-04-01

Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

Spiral wound extraction cartridge

DOEpatents

Wisted, Eric E.; Lundquist, Susan H.

1999-01-01

A cartridge device for removing an analyte from a fluid comprises a hollow core, a sheet composite comprising a particulate-loaded porous membrane and optionally at least one reinforcing spacer sheet, the particulate being capable of binding the analyte, the sheet composite being formed into a spiral configuration about the core, wherein the sheet composite is wound around itself and wherein the windings of sheet composite are of sufficient tightness so that adjacent layers are essentially free of spaces therebetween, two end caps which are disposed over the core and the lateral ends of the spirally wound sheet composite, and means for securing the end caps to the core, the end caps also being secured to the lateral ends of the spirally wound sheet composite. A method for removing an analyte from a fluid comprises the steps of providing a spirally wound element of the invention and passing the fluid containing the analyte through the element essentially normal to a surface of the sheet composite so as to bind the analyte to the particulate of the particulate-loaded porous membrane, the method optionally including the step of eluting the bound analyte from the sheet composite.

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

PubMed

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

PubMed

Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

2018-05-10

Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

Potential evaluation of CO2 storage and enhanced oil recovery of tight oil reservoir in the Ordos Basin, China.

PubMed

Tian, Xiaofeng; Cheng, Linsong; Cao, Renyi; Zhang, Miaoyi; Guo, Qiang; Wang, Yimin; Zhang, Jian; Cui, Yu

2015-07-01

Carbon -di-oxide (CO2) is regarded as the most important greenhouse gas to accelerate climate change and ocean acidification. The Chinese government is seeking methods to reduce anthropogenic CO2 gas emission. CO2 capture and geological storage is one of the main methods. In addition, injecting CO2 is also an effective method to replenish formation energy in developing tight oil reservoirs. However, exiting methods to estimate CO2 storage capacity are all based on the material balance theory. This was absolutely correct for normal reservoirs. However, as natural fractures widely exist in tight oil reservoirs and majority of them are vertical ones, tight oil reservoirs are not close. Therefore, material balance theory is not adaptive. In the present study, a new method to calculate CO2 storage capacity is presented. The CO2 effective storage capacity, in this new method, consisted of free CO2, CO2 dissolved in oil and CO2 dissolved in water. Case studies of tight oil reservoir from Ordos Basin was conducted and it was found that due to far lower viscosity of CO2 and larger solubility in oil, CO2 could flow in tight oil reservoirs more easily. As a result, injecting CO2 in tight oil reservoirs could obviously enhance sweep efficiency by 24.5% and oil recovery efficiency by 7.5%. CO2 effective storage capacity of Chang 7 tight oil reservoir in Longdong area was 1.88 x 10(7) t. The Chang 7 tight oil reservoir in Ordos Basin was estimated to be 6.38 x 10(11) t. As tight oil reservoirs were widely distributed in Songliao Basin, Sichuan Basin and so on, geological storage capacity of CO2 in China is potential.

Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

Resonant enhancement of band-to-band tunneling in in-plane MoS2/WS2 heterojunctions

NASA Astrophysics Data System (ADS)

Kuroda, Tatsuya; Mori, Nobuya

2018-04-01

The band-to-band (BTB) tunneling current J through in-plane MoS2/WS2 heterojunctions is calculated by the nonequilibrium Green function method combined with tight-binding approximation. Types A and B of band configurations are considered. For type-A (type-B) heterojunctions, a potential notch exists (or is absent) at the heterointerface. Both type-A and type-B MoS2/WS2 heterojunctions can support a higher BTB current than MoS2 and WS2 homojunctions. For type-A heterojunctions, the resonant enhancement of J occurs resulting in a significantly higher BTB tunneling current.

Electronic topological transitions in Zn under compression

NASA Astrophysics Data System (ADS)

Kechin, Vladimir V.

2001-01-01

The electronic structure of hcp Zn under pressure up to 10 GPa has been calculated self-consistently by means of the scalar relativistic tight-binding linear muffin-tin orbital method. The calculations show that three electronic topological transitions (ETT's) occur in Zn when the c/a axial ratio diminishes under compression. One transition occurs at c/a~=1.82 when the ``needles'' appear around the symmetry point K of the Brillouin zone. The other two transitions occur at c/a~=3, when the ``butterfly'' and ``cigar'' appear simultaneously both around the L point. It has been shown that these ETT's are responsible for a number of anomalies observed in Zn at compression.

Computational predictions of zinc oxide hollow structures

NASA Astrophysics Data System (ADS)

Tuoc, Vu Ngoc; Huan, Tran Doan; Thao, Nguyen Thi

2018-03-01

Nanoporous materials are emerging as potential candidates for a wide range of technological applications in environment, electronic, and optoelectronics, to name just a few. Within this active research area, experimental works are predominant while theoretical/computational prediction and study of these materials face some intrinsic challenges, one of them is how to predict porous structures. We propose a computationally and technically feasible approach for predicting zinc oxide structures with hollows at the nano scale. The designed zinc oxide hollow structures are studied with computations using the density functional tight binding and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications.

Electronic properties of a molecular system with Platinum

NASA Astrophysics Data System (ADS)

Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David

2017-10-01

The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.

The K-turn motif in riboswitches and other RNA species☆

PubMed Central

Lilley, David M.J.

2014-01-01

The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

Theoretical and vibrational study of N-(3-chloro-4-fluoro-phenyl)-7-methoxy-6-(3-morpholin-4-ylpropoxy)-quinazolin-4-amine (gefitinib)

NASA Astrophysics Data System (ADS)

Mıhçıokur, Özlem; Özpozan, Talat

2015-12-01

N-(3-chloro-4fluoro-phenyl)-7-methoxy-6-(3-morpholin-4ylpropoxy)-quinazolin-4-amine (GEF), a quinalizoline derivative used as new anti-cancer agent, designed to target activity of epidermal growth factor receptor (EGFR) promoting the growth, division and spread of cancer cells, was examined from the vibrational and theoretical point of view. All calculations have been carried out both in gaseous and aqueous phases. In the calculations of both phases, the molecule has been optimized through conformer analysis beginning with the x-ray data. The conformer analyses have been carried out in each phases and the geometrical differences between the most stable structures in gaseous and in aqueous phases have been discussed. The solvent effect for GEF in aqueous solution was simulated by using self-consistent reaction field (SCRF) calculations employing the integral equation formalism variant (IEFPCM) model. NBO analysis has been performed to indicate the presence of intramolecular charge transfer. The complete assignments of the vibrational spectra (IR&Raman) were made with the aid of calculated spectra both in gaseous and aqueous phases. The observed spectral data of the title compound were compared with the calculated spectra obtained by DFT/B3LYP and DFT/B3PW91 methods using 6-31G(d,p) basis set. The theoretical results were found to be in good agreement with the measured experimental data especially for the interpretation of intra molecular interactions.

Non-equilibrium Green's functions method: Non-trivial and disordered leads

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Yu, E-mail: heyuyhe@gmail.com; Wang, Yu; Klimeck, Gerhard

2014-11-24

The non-equilibrium Green's function algorithm requires contact self-energies to model charge injection and extraction. All existing approaches assume infinitely periodic leads attached to a possibly quite complex device. This contradicts today's realistic devices in which contacts are spatially inhomogeneous, chemically disordered, and impacting the overall device characteristics. This work extends the complex absorbing potentials method for arbitrary, ideal, or non-ideal leads in atomistic tight binding representation. The algorithm is demonstrated on a Si nanowire with periodic leads, a graphene nanoribbon with trumpet shape leads, and devices with leads of randomly alloyed Si{sub 0.5}Ge{sub 0.5}. It is found that alloy randomnessmore » in the leads can reduce the predicted ON-state current of Si{sub 0.5}Ge{sub 0.5} transistors by 45% compared to conventional lead methods.« less

Understanding the inelastic electron-tunneling spectra of alkanedithiols on gold.

PubMed

Solomon, Gemma C; Gagliardi, Alessio; Pecchia, Alessandro; Frauenheim, Thomas; Di Carlo, Aldo; Reimers, Jeffrey R; Hush, Noel S

2006-03-07

We present results for a simulated inelastic electron-tunneling spectra (IETS) from calculations using the "gDFTB" code. The geometric and electronic structure is obtained from calculations using a local-basis density-functional scheme, and a nonequilibrium Green's function formalism is employed to deal with the transport aspects of the problem. The calculated spectrum of octanedithiol on gold(111) shows good agreement with experimental results and suggests further details in the assignment of such spectra. We show that some low-energy peaks, unassigned in the experimental spectrum, occur in a region where a number of molecular modes are predicted to be active, suggesting that these modes are the cause of the peaks rather than a matrix signal, as previously postulated. The simulations also reveal the qualitative nature of the processes dominating IETS. It is highly sensitive only to the vibrational motions that occur in the regions of the molecule where there is electron density in the low-voltage conduction channel. This result is illustrated with an examination of the predicted variation of IETS with binding site and alkane chain length.

Ligand selectivity of estrogen receptors by a molecular dynamics study.

PubMed

Hu, Guodong; Wang, Jihua

2014-03-03

Estrogen receptors α (ERα) and β (ERβ) have different physiological functions and expression levels in different tissues. ERα and ERβ are highly homologous and have only two residue substitutions in the binding pocket. This high similarity at the active site stimulates the interests for discovering subtype selective ligands. In this study, molecular dynamics (MD) simulations combined with molecular mechanics generalized Born surface area (MM-GBSA) method have been carried out to analyze the basis of selectivity of three ligands (659, 818 and 041). The calculated binding free energies show that all the ligands bind more tightly to ERβ than to ERα. The dominant free energy components of selectivity for 659 are similar to that for 041, but different from that for 818. The decompositions of free energy contributions and structural analysis imply that there are eight residues primarily contributing to the selectivity for 659, five residues for 041, as well as two residues for 818. The structural analysis implies that two residue substitutions in binding packet cause the position of 659 in ERβ-659 complex to shift relative to that in ERα-659 complex and also cause the conformational changes of other residues in the binding pocket. The higher selectivity for 041 is mainly caused by three residues, Ile373 (Met421), His475 (His524) and Leu476 (Leu525). Copyright © 2013. Published by Elsevier Masson SAS.

Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

PubMed Central

Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

2012-01-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

PubMed

Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

2012-12-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

Synthesis and DFT calculations of some 2-aminothiazoles

NASA Astrophysics Data System (ADS)

Rezania, Jafar; Behzadi, Hadi; Shockravi, Abbas; Ehsani, Morteza; Akbarzadeh, Elahe

2018-04-01

A series of 2-aminothiazole derivatives have been synthesized by the reaction of acetyl compounds with thiourea and iodine as catalyst under solvent-free condition, a green chemistry method. The quantum chemical calculations at the DFT/B3LYP level of theory in gas phase were carried out for starting acetyl derivatives. The highest occupied molecular orbital (HOMO) and lowest unoccupied molecular orbital (LUMO) and related reactivity descriptor of acetyl derivatives, as well as, enthalpy of reactions are calculated in order to investigate the reaction properties of acetyl compounds and yields of the reactions. The calculated reactivity descriptors are well correlated to activity of different acetyl derivatives.

Adaptive tight frame based medical image reconstruction: a proof-of-concept study for computed tomography

NASA Astrophysics Data System (ADS)

Zhou, Weifeng; Cai, Jian-Feng; Gao, Hao

2013-12-01

A popular approach for medical image reconstruction has been through the sparsity regularization, assuming the targeted image can be well approximated by sparse coefficients under some properly designed system. The wavelet tight frame is such a widely used system due to its capability for sparsely approximating piecewise-smooth functions, such as medical images. However, using a fixed system may not always be optimal for reconstructing a variety of diversified images. Recently, the method based on the adaptive over-complete dictionary that is specific to structures of the targeted images has demonstrated its superiority for image processing. This work is to develop the adaptive wavelet tight frame method image reconstruction. The proposed scheme first constructs the adaptive wavelet tight frame that is task specific, and then reconstructs the image of interest by solving an l1-regularized minimization problem using the constructed adaptive tight frame system. The proof-of-concept study is performed for computed tomography (CT), and the simulation results suggest that the adaptive tight frame method improves the reconstructed CT image quality from the traditional tight frame method.

Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

Conformational Changes Represent the Rate-Limiting Step in the Transport Cycle of Maize SUCROSE TRANSPORTER1[C][W

PubMed Central

Derrer, Carmen; Wittek, Anke; Bamberg, Ernst; Carpaneto, Armando; Dreyer, Ingo; Geiger, Dietmar

2013-01-01

Proton-driven Suc transporters allow phloem cells of higher plants to accumulate Suc to more than 1 M, which is up to ∼1000-fold higher than in the surrounding extracellular space. The carrier protein can accomplish this task only because proton and Suc transport are tightly coupled. This study provides insights into this coupling by resolving the first step in the transport cycle of the Suc transporter SUT1 from maize (Zea mays). Voltage clamp fluorometry measurements combining electrophysiological techniques with fluorescence-based methods enable the visualization of conformational changes of SUT1 expressed in Xenopus laevis oocytes. Using the Suc derivate sucralose, binding of which hinders conformational changes of SUT1, the association of protons to the carrier could be dissected from transport-associated movements of the protein. These combined approaches enabled us to resolve the binding of protons to the carrier and its interrelationship with the alternating movement of the protein. The data indicate that the rate-limiting step of the reaction cycle is determined by the accessibility of the proton binding site. This, in turn, is determined by the conformational change of the SUT1 protein, alternately exposing the binding pockets to the inward and to the outward face of the membrane. PMID:23964025

Automodification of PARP-1 mediates its tight binding to the nuclear matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

2010-02-26

Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

Data key to quest for quality.

PubMed

Chang, Florence S; Nielsen, Jon; Macias, Charles

2013-11-01

Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

Quantum-confinement effects on conduction band structure of rectangular cross-sectional GaAs nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, H., E-mail: tanaka@semicon.kuee.kyoto-u.ac.jp; Morioka, N.; Mori, S.

2014-02-07

The conduction band structure and electron effective mass of GaAs nanowires with various cross-sectional shapes and orientations were calculated by two methods, a tight-binding method and an effective mass equation taking the bulk full-band structure into account. The effective mass of nanowires increases as the cross-sectional size decreases, and this increase in effective mass depends on the orientations and substrate faces of nanowires. Among [001], [110], and [111]-oriented rectangular cross-sectional GaAs nanowires, [110]-oriented nanowires with wider width along the [001] direction showed the lightest effective mass. This dependence originates from the anisotropy of the Γ valley of bulk GaAs. Themore » relationship between effective mass and bulk band structure is discussed.« less

Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-11-01

We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

NASA Astrophysics Data System (ADS)

Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

2017-07-01

We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

Quantitative analysis on electric dipole energy in Rashba band splitting.

PubMed

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-09-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

Quantitative analysis on electric dipole energy in Rashba band splitting

PubMed Central

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-01-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

Modeling Magnetic Properties in EZTB

NASA Technical Reports Server (NTRS)

Lee, Seungwon; vonAllmen, Paul

2007-01-01

A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

PubMed

Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

2018-03-05

During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

Tight-binding model for materials at mesoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

2016-12-21

TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

NASA Astrophysics Data System (ADS)

Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

2018-02-01

Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

NASA Astrophysics Data System (ADS)

Aizawa, Hirohito; Kuroki, Kazuhiko

2018-03-01

We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

PubMed Central

Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

1999-01-01

A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bleil, J.D.; Wassarman, P.M.

1990-07-01

During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less

The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

PubMed Central

Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

2003-01-01

Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

Influence of stereoelectronic effects on the non-opioid analgesics gaboxadol and gaboxadol hydrochloride: Spectral and DFT study

NASA Astrophysics Data System (ADS)

Leenaraj, D. R.; Joe, I. Hubert

2018-05-01

The stereoelectronic properties of the molecular structure of most stable conformers of gaboxadol and gaboxadol hydrochloride have been studied using DFT/B3P86-LANL2DZ methodology. The energies of stable conformers of gaboxadol and gaboxadol hydrochloride are -494.2689 and -510.0117 hartrees, respectively. The stability of the molecules arising from stereoelectronic interactions, leading to its bioactivity, has been confirmed using natural bond orbital analysis. The natural bond orbital analysis of donor-acceptor (σ→σ* and n→σ*) interactions showed that the stereoelectronic hyperconjugative and anomeric interactions are exhibited in gaboxadol hydrochloride and gaboxadol, respectively. Lengthening of the axial and equatorial C-H bond lengths and natural population analysis support these results. Spectral features of gaboxadol hydrochloride have been explored by the Fourier transform infrared, Raman and Nuclear magnetic resonance spectroscopic techniques combined with density functional theory computations. NH+ … Cl- hydrogen bonding has been noticeable as a broad and strong absorption in the 2800-2400 cm-1 region. Broad peaks obtained by proton NMR are a result of the quadrupole effect of the N+ atom. Docking studies using representative GABA receptor crystal structures revealed that molecules containing azinane and isoxazole cores fit within the ligand binding domains, and the gaboxadol hydrochloride molecule shows the best binding energy with the 3D32 GABA receptor. Also, gaboxadol hydrochloride has obtained a high value of HOMO energy and a narrow HOMO- LUMO energy gap, which enhances reactivity.

Synthesis, crystal structure, DFT calculation and DNA binding studies of new water-soluble derivatives of dppz

NASA Astrophysics Data System (ADS)

Aminzadeh, Mohammad; Eslami, Abbas; Kia, Reza; Aleeshah, Roghayeh

2017-10-01

Diquaternarization of dipyrido-[2,3-a:2‧,3‧-c]-phenazine,(dppz) and its analogous dipyrido-[2,3-a:2‧,3‧-c]-dimethylphenazine,(dppx) using 1,3-dibromopropane afford new water-soluble derivatives of phenazine, propylene-bipyridyldiylium-phenazine (1) and propylene-bipyridyldiylium-dimethylphenazine (2). The compounds have been characterized by means of FT-IR, NMR, elemental analysis and conductometric measurements and their structure were determined by X-ray crystallography. The experimental studies on the compounds have been accompanied computationally by Density Functional Theory (DFT) calculations. The DNA binding properties of both compounds to calf thymus DNA (ctDNA) were investigated by UV-Vis absorption and emission methods. The expanded UV-Vis spectral data matrix was analyzed by multivariate curve resolution-alternating least squares (MCR-ALS) technique to obtain the concentration profile and pure spectra of all reaction species which existed in the interaction procedure. Multivariate curve resolution may help us to give a better understanding of the 1(Cl)2-ctDNA and 2(Cl)2-ctDNA interaction mechanism. The results suggest that both compounds bind tightly to DNA through intercalation mechanism and the DNA binding affinity of 2 is slightly lower than that of 1 due to steric hindrance of the methyl group. Also, thermal denaturation studies reveal that these compounds show strong affinity for binding with calf thymus DNA. The thermodynamic parameters of the DNA binding process were obtained from the temperature dependence of the binding constants and the results showed that binding of both compounds to DNA is an enthalpically driven process that is in agreement with proposed DNA intercalation capability of these compounds.

Mechanical coupling in myosin V: a simulation study

PubMed Central

Ovchinnikov, Victor; Trout, Bernhardt L.

2009-01-01

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The inter-domain coupling in myosin V is studied with Restrained Targeted Molecular Dynamics (RTMD) using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FS) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The ‘minimal’ FS that results in extensive structural changes in the overall myosin conformation is comprised of the ATP, Switch 1, and the nearby HF, HG and HH helices. Addition of switch 2 to the forcing set is required to achieve a complete opening of the actin-binding cleft. The RTMD simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft, and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the Relay helix, and Switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of inter-domain coupling in proteins. PMID:19853615

Mechanical coupling in myosin V: a simulation study.

PubMed

Ovchinnikov, Victor; Trout, Bernhardt L; Karplus, Martin

2010-01-29

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The interdomain coupling in myosin V is studied with restrained targeted molecular dynamics using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FSs) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The "minimal" FS that results in extensive structural changes in the overall myosin conformation is composed of ATP, switch 1, and the nearby HF, HG, and HH helices. Addition of switch 2 to the FS is required to achieve a complete opening of the actin-binding cleft. The restrained targeted molecular dynamics simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the relay helix, and switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of interdomain coupling in proteins.

In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

PubMed

Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

2013-01-15

Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

DOE PAGES

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

2016-07-01

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

PubMed

Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

2016-11-01

Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural basis for the inhibition of bacterial multidrug exporters.

PubMed

Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito

2013-08-01

The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.

Use of HPLC for the detection of iron chelators in cultures of bacteria, fungi, and algae. [E. coli; Bacillus megaterium; Ustilago sphaerogena; Anabaena flos-aqua

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boyer, G.L.; Speirs, R.J.; Morse, P.D.

1990-06-01

Iron is essential for the growth of living cells. To meet biochemical needs, microorganisms, including algae, produce high affinity chelators termed siderophores. These compounds solubilize Fe and increase its bioavailability. We have developed a new method to study siderophore formation in cultured and natural environments. Based on the fact siderophores tightly bind 55-Fe, the radioactive complexes can be separated by HPLC using an inert PRP-1 column and detected by scintillation counting. This method cleanly resolves several known siderophores, including ferrichrome A, ferrichrome, desferal, and rhodotorulic acid. The optimization of the method and its use for analysis of siderophore formation inmore » bacteria (E. coli, and Bacillus megaterium), fungi (Ustilago sphaerogena), and cyanobacteria (Anabaena flos-aqua UTEX 1444 and Anabaena sp. ATCC 27898) will be presented.« less

Analysis of cholesterol trafficking with fluorescent probes

PubMed Central

Maxfield, Frederick R.; Wüstner, Daniel

2013-01-01

Cholesterol plays an important role in determining the biophysical properties of biological membranes, and its concentration is tightly controlled by homeostatic processes. The intracellular transport of cholesterol among organelles is a key part of the homeostatic mechanism, but sterol transport processes are not well understood. Fluorescence microscopy is a valuable tool for studying intracellular transport processes, but this method can be challenging for lipid molecules because addition of a fluorophore may alter the properties of the molecule greatly. We discuss the use of fluorescent molecules that can bind to cholesterol to reveal its distribution in cells. We also discuss the use of intrinsically fluorescent sterols that closely mimic cholesterol, as well as some minimally modified fluorophore-labeled sterols. Methods for imaging these sterols by conventional fluorescence microscopy and by multiphoton microscopy are described. Some label-free methods for imaging cholesterol itself are also discussed briefly. PMID:22325611

Does the low hole transport mass in <110> and <111> Si nanowires lead to mobility enhancements at high field and stress: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Kotlyar, R.; Linton, T. D.; Rios, R.; Giles, M. D.; Cea, S. M.; Kuhn, K. J.; Povolotskyi, Michael; Kubis, Tillmann; Klimeck, Gerhard

2012-06-01

The hole surface roughness and phonon limited mobility in the silicon <100>, <110>, and <111> square nanowires under the technologically important conditions of applied gate bias and stress are studied with the self-consistent Poisson-sp3d5s*-SO tight-binding bandstructure method. Under an applied gate field, the hole carriers in a wire undergo a volume to surface inversion transition diminishing the positive effects of the high <110> and <111> valence band nonparabolicities, which are known to lead to the large gains of the phonon limited mobility at a zero field in narrow wires. Nonetheless, the hole mobility in the unstressed wires down to the 5 nm size remains competitive or shows an enhancement at high gate field over the large wire limit. Down to the studied 3 nm sizes, the hole mobility is degraded by strong surface roughness scattering in <100> and <110> wires. The <111> channels are shown to experience less surface scattering degradation. The physics of the surface roughness scattering dependence on wafer and channel orientations in a wire is discussed. The calculated uniaxial compressive channel stress gains of the hole mobility are found to reduce in the narrow wires and at the high field. This exacerbates the stressed mobility degradation with size. Nonetheless, stress gains of a factor of 2 are obtained for <110> wires down to 3 nm size at a 5×1012 cm-2 hole inversion density per gate area.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Strain-induced fundamental optical transition in (In,Ga)As/GaP quantum dots

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robert, C., E-mail: cedric.robert@insa-rennes.fr, E-mail: cedric.robert@tyndall.ie; Pedesseau, L.; Cornet, C.

The nature of the ground optical transition in an (In,Ga)As/GaP quantum dot is thoroughly investigated through a million atoms supercell tight-binding simulation. Precise quantum dot morphology is deduced from previously reported scanning-tunneling-microscopy images. The strain field is calculated with the valence force field method and has a strong influence on the confinement potentials, principally, for the conduction band states. Indeed, the wavefunction of the ground electron state is spatially confined in the GaP matrix, close to the dot apex, in a large tensile strain region, having mainly Xz character. Photoluminescence experiments under hydrostatic pressure strongly support the theoretical conclusions.

Structure of Boron Nitride Nanotubes: Tube Closing Vs. Chirality

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu

1998-01-01

The structure of boron nitride nanotubes is investigated using a generalized tight-binding molecular dynamics method. It is shown that dynamic relaxation results in a wavelike or "rippled" surface in which the B atoms rotate inward and the N atoms move outward, reminiscent of the surface relaxation of the III-V semiconductors. More importantly, the three different morphologies of the tube closing with flat, conical and amorphous ends, as observed in experiments, are shown to be directly related to the tube chiralities. The abundance of flat end tubes observed in experiments is, thus, shown to be an indication of the greater stability of "zig-zag" BN tubes over the "arm-chair" tubes under experimental conditions.

Physical and Electronic Isolation of Carbon Nanotube Conductors

NASA Technical Reports Server (NTRS)

OKeeffe, James; Biegel, Bryan (Technical Monitor)

2001-01-01

Multi-walled nanotubes are proposed as a method to electrically and physically isolate nanoscale conductors from their surroundings. We use tight binding (TB) and density functional theory (DFT) to simulate the effects of an external electric field on multi-wall nanotubes. Two categories of multi-wall nanotube are investigated, those with metallic and semiconducting outer shells. In the metallic case, simulations show that the outer wall effectively screens the inner core from an applied electric field. This offers the ability to reduce crosstalk between nanotube conductors. A semiconducting outer shell is found not to perturb an electric field incident on the inner core, thereby providing physical isolation while allowing the tube to remain electrically coupled to its surroundings.

Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices

PubMed Central

2012-01-01

We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315

The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Varnum, Susan M.

2012-03-01

Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

Electron-induced scattering dynamics of Boron, Aluminium and Gallium trihalides in the intermediate energy domain

NASA Astrophysics Data System (ADS)

Verma, Pankaj; Alam, Mohammad Jane; Ahmad, Shabbir; Antony, Bobby

2018-05-01

This article is focused on the calculation of electron-induced ionisation and total scattering cross sections by Boron, Aluminium and Gallium trihalide molecules in the intermediate energy domain. The computational formalism, spherical complex optical potential has been employed for the study of these two scattering cross sections. The ionisation cross section has been derived from the inelastic cross section using a semi-empirical method called complex scattering potential-ionisation contribution (CSP-ic) method. We have also calculated the ionisation cross section using the BEB theory with Hartree-Fock and density functional theory (DFT- ωB97XD) orbitals so that a comparison can be made with the cross sections predicted by CSP-ic method. For this theoretical study, we have also calculated polarisability and bond length of some targets which were not found in literature using DFT/B3LYP in Gaussian 09 software.

Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

PubMed Central

Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

2001-01-01

Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

Rubisco Activity: Effects of Drought Stress

PubMed Central

PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

2002-01-01

Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

PubMed Central

Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

2008-01-01

A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

Density-functional expansion methods: Grand challenges.

PubMed

Giese, Timothy J; York, Darrin M

2012-03-01

We discuss the source of errors in semiempirical density functional expansion (VE) methods. In particular, we show that VE methods are capable of well-reproducing their standard Kohn-Sham density functional method counterparts, but suffer from large errors upon using one or more of these approximations: the limited size of the atomic orbital basis, the Slater monopole auxiliary basis description of the response density, and the one- and two-body treatment of the core-Hamiltonian matrix elements. In the process of discussing these approximations and highlighting their symptoms, we introduce a new model that supplements the second-order density-functional tight-binding model with a self-consistent charge-dependent chemical potential equalization correction; we review our recently reported method for generalizing the auxiliary basis description of the atomic orbital response density; and we decompose the first-order potential into a summation of additive atomic components and many-body corrections, and from this examination, we provide new insights and preliminary results that motivate and inspire new approximate treatments of the core-Hamiltonian.

A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

PubMed

Williams, K P; Shoelson, S E

1993-03-15

Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

Study of picrate salts with amines

NASA Astrophysics Data System (ADS)

Goel, Nidhi; Singh, Udai P.; Singh, Gurdip; Srivastava, Pratibha

2013-03-01

The reaction of picric acid (2,4,6-trinitrophenol) with amines [urea, cyclohexane-1,2-diamine, 1H-1,2,4-triazole-3,5-diamine, 6-phenyl-1,3.5-triazine-2,4-diamine] yielded the corresponding picrate salts 1-4. Theoretical studies reveal that the hydrogen-bond interaction energy decreases on increasing the steric hindrance in amines. The solid state structure of compounds 1-4 was measured by X-ray techniques and compared to the gas phase optimized geometries (DFT/B3LYP). Thermal stability of these salts has been studied by means of thermogravimetric-differential scanning calorimetry (TG-DSC) while kinetic parameters have been evaluated using models fitting and isoconversional methods. Thermolytic pathways have also been suggested.

Spiral wound extraction cartridge

DOEpatents

Wisted, E.E.; Lundquist, S.H.

1999-04-27

A cartridge device for removing an analyte from a fluid comprises a hollow core, a sheet composite comprising a particulate-loaded porous membrane and optionally at least one reinforcing spacer sheet, the particulate being capable of binding the analyte, the sheet composite being formed into a spiral configuration about the core, wherein the sheet composite is wound around itself and wherein the windings of sheet composite are of sufficient tightness so that adjacent layers are essentially free of spaces therebetween, two end caps which are disposed over the core and the lateral ends of the spirally wound sheet composite, and means for securing the end caps to the core, the end caps also being secured to the lateral ends of the spirally wound sheet composite. A method for removing an analyte from a fluid comprises the steps of providing a spirally wound element of the invention and passing the fluid containing the analyte through the element essentially normal to a surface of the sheet composite so as to bind the analyte to the particulate of the particulate-loaded porous membrane, the method optionally including the step of eluting the bound analyte from the sheet composite. 4 figs.

Binding of Dihydrostreptomycin to Escherichia coli Ribosomes: Characteristics and Equilibrium of the Reaction

PubMed Central

Chang, F. N.; Flaks, Joel G.

1972-01-01

The binding of dihydrostreptomycin to ribosomes and ribosomal subunits of a number of different Escherichia coli strains was studied, and the Mg2+ and pH dependence, as well as the effect of salts and polynucleotides, was determined. The only requirement for binding with ribosomes and subunits from susceptible strains was 10 mm Mg2+. Monovalent salts weakened the binding in a manner similar to the effects on ribonucleic acid secondary structure, and this was antagonized to some extent by increased amounts of Mg2+. Bound dihydrostreptomycin could be readily exchanged by streptomycin and any antibiotically active derivative, but not by fragments of the antibiotic or any other aminoglycoside. With native (run-off) 70S ribosomes from streptomycin-susceptible strains, the binding was rapid and relatively temperature independent over the range from 0 to 37 C. Polynucleotides did not stimulate the binding. With concentrations of dihydrostreptomycin up to 10−5m, greater than 95% of native 70S ribosomes bound exactly 1 molecule of the antibiotic tightly, with a Kdiss for the bound complex at 25 C of 9.4 × 10−8m. The following thermodynamic parameters were found for the binding with 70S ribosomes at 25 C:ΔG° = −9.6 kcal/mole, ΔH° = −6.2 kcal/mole, and ΔS° = +11.4 entropy units/mole. Differences in affinity for the antibiotic were found between ribosomes of K-12 strains and those of other E. coli strains. There was insignificant binding to 70S ribosomes or subunits from streptomycin-resistant or -dependent strains, and to 50S subunits from susceptible strains. The binding to 30S subunits from susceptible strains was weaker by an order of magnitude than that to the 70S particle, with a Kdiss at 25 C of 10−6m. Polyuridylic acid stimulated this binding slightly but did not influence the affinity of the bound molecule. At antibiotic concentrations above 10−5m, streptomycin-susceptible 70S and 30S particles bound additional molecules of the antibiotic, and binding also occurred to ribosomes from streptomycin-resistant and -dependent strains, as well as to 50S subunits from all strains. Kdiss for all of these binding equilibria were [Formula: see text] 10−4m. This weaker non-specific binding coincided with the beginning of aggregation phenomena involving the particles, and occurred at sites distinct from the single site which binds the antibiotic tightly. This latter site was completely lost after the one-step mutation to high-level resistance or dependence. PMID:4133236

Chemisorption and Diffusion of H on a Graphene Sheet and Single-Wall Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Dzegilenko, Fedor; Menon, Madhu

2000-01-01

Recent experiments on hydrogen storage in single wall nanotubes and nanotube bundles have reported large fractional weight of stored molecular hydrogen which are not in agreement with theoretical estimates based of simulation of hydrogen storage by physisorption mechanisms. Hydrogen storage in catalytically doped nanotube bundles indicate that atomic H might undergo chemisorption changing the basic nature of the storage mechanism under investigation by many groups. Using a generalized tight-binding molecular dynamics (GTBMD) method for reactive C-H dynamics, we investigate chemisorption and diffusion of atomic H on graphene sheet and C nanotubes. Effective potential energy surfaces (EPS) for chemisorption and diffusion are calculated for graphene sheet and nanotubes of different curvatures. Analysis of the activation barriers and quantum rate constants, computed via wave-packet dynamics method, will be discussed in this presentation.

Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

DOE Office of Scientific and Technical Information (OSTI.GOV)

C Simmons; C Magee; D Smith

The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less

Coupled motions in the SH2 and kinase domains of Csk control Src phosphorylation.

PubMed

Wong, Lilly; Lieser, Scot A; Miyashita, Osamu; Miller, Meghan; Tasken, Kjetil; Onuchic, Josè N; Adams, Joseph A; Woods, Virgil L; Jennings, Patricia A

2005-08-05

The C-terminal Src kinase (Csk) phosphorylates and down-regulates Src family tyrosine kinases. The Csk-binding protein (Cbp) localizes Csk close to its substrates at the plasma membrane, and increases the specific activity of the kinase. To investigate this long-range catalytic effect, the phosphorylation of Src and the conformation of Csk were investigated in the presence of a high-affinity phosphopeptide derived from Cbp. This peptide binds tightly to the SH2 domain and enhances Src recognition (lowers K(m)) by increasing the apparent phosphoryl transfer rate in the Csk active site, a phenomenon detected in rapid quench flow experiments. Previous studies demonstrated that the regulation of Csk activity is linked to conformational changes in the enzyme that can be probed with hydrogen-deuterium exchange methods. We show that the Cbp peptide impacts deuterium incorporation into its binding partner (the SH2 domain), and into the SH2-kinase linker and several sequences in the kinase domain, including the glycine-rich loop in the active site. These findings, along with computational data from normal mode analyses, suggest that the SH2 domain moves in a cantilever fashion with respect to the small lobe of the kinase domain, ordering the active site for catalysis. The binding of a small Cbp-derived peptide to the SH2 domain of Csk modifies these motions, enhancing Src recognition.

Tunnel Field-Effect Transistors in 2-D Transition Metal Dichalcogenide Materials

NASA Astrophysics Data System (ADS)

Ilatikhameneh, Hesameddin; Tan, Yaohua; Novakovic, Bozidar; Klimeck, Gerhard; Rahman, Rajib; Appenzeller, Joerg

2015-12-01

In this work, the performance of Tunnel Field-Effect Transistors (TFETs) based on two-dimensional Transition Metal Dichalcogenide (TMD) materials is investigated by atomistic quantum transport simulations. One of the major challenges of TFETs is their low ON-currents. 2D material based TFETs can have tight gate control and high electric fields at the tunnel junction, and can in principle generate high ON-currents along with a sub-threshold swing smaller than 60 mV/dec. Our simulations reveal that high performance TMD TFETs, not only require good gate control, but also rely on the choice of the right channel material with optimum band gap, effective mass and source/drain doping level. Unlike previous works, a full band atomistic tight binding method is used self-consistently with 3D Poisson equation to simulate ballistic quantum transport in these devices. The effect of the choice of TMD material on the performance of the device and its transfer characteristics are discussed. Moreover, the criteria for high ON-currents are explained with a simple analytic model, showing the related fundamental factors. Finally, the subthreshold swing and energy-delay of these TFETs are compared with conventional CMOS devices.

Tight-Binding Description of Impurity States in Semiconductors

ERIC Educational Resources Information Center

Dominguez-Adame, F.

2012-01-01

Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

Intrinsic optical confinement for ultrathin InAsN quantum well superlattices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakri, A.; Robert, C.; Pedesseau, L.

We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.

Electric-field-induced plasmon in AA-stacked bilayer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

2013-12-15

The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

Transferable tight binding model for strained group IV and III-V heterostructures

NASA Astrophysics Data System (ADS)

Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.

RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.

PubMed

Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C

2015-09-23

Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.

Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

Spin textures on general surfaces of the correlated topological insulator SmB6

NASA Astrophysics Data System (ADS)

Baruselli, Pier Paolo; Vojta, Matthias

2016-05-01

Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

Tuning the electronic properties of gated multilayer phosphorene: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Li, L. L.; Partoens, B.; Peeters, F. M.

2018-04-01

By taking account of the electric-field-induced charge screening, a self-consistent calculation within the framework of the tight-binding approach is employed to obtain the electronic band structure of gated multilayer phosphorene and the charge densities on the different phosphorene layers. We find charge density and screening anomalies in single-gated multilayer phosphorene and electron-hole bilayers in dual-gated multilayer phosphorene. Due to the unique puckered lattice structure, both intralayer and interlayer charge screenings are important in gated multilayer phosphorene. We find that the electric-field tuning of the band structure of multilayer phosphorene is distinctively different in the presence and absence of charge screening. For instance, it is shown that the unscreened band gap of multilayer phosphorene decreases dramatically with increasing electric-field strength. However, in the presence of charge screening, the magnitude of this band-gap decrease is significantly reduced and the reduction depends strongly on the number of phosphorene layers. Our theoretical results of the band-gap tuning are compared with recent experiments and good agreement is found.

Landau level splitting due to graphene superlattices

NASA Astrophysics Data System (ADS)

Pal, G.; Apel, W.; Schweitzer, L.

2012-06-01

The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

NASA Astrophysics Data System (ADS)

Reijnders, K. J. A.; Katsnelson, M. I.

2017-07-01

We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

PubMed Central

Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

2016-01-01

Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

Proposed truncated Cu-Hf tight-binding potential to study the crystal-to-amorphous phase transition

NASA Astrophysics Data System (ADS)

Cui, Yuanyuan; Li, Jiahao; Dai, Ye; Liu, Baixin

2010-09-01

Proposed truncated Cu-Hf tight-binding potential was constructed by fitting the physical properties of Cu, Hf, and their stable compounds, i.e., Cu5Hf, Cu8Hf3, Cu10Hf7, and CuHf2. Based on the constructed potentials, molecular dynamics simulations were carried out to compare the relative stability of the crystalline solid solution and the disordered state. Simulation results not only reveal that the physical origin of crystal-to-amorphous transition is the crystalline lattice collapsing when the solute atoms exceeding the critical concentration, but also predict that the glass forming range (GFR) of the Cu-Hf system is 21-77 at. % Cu, which covers the GFRs determined by various metallic glass-producing techniques. Ion beam mixing experiments of the Cu-Hf system were conducted using 200 keV xenon ions and the results show that a uniform amorphous phase can be obtained in the Cu23Hf77 sample, matching well with the GFR determined by the interatomic potential, which, in turn, provides additional evidence to the relevance of the constructed Cu-Hf potential.

Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

NASA Astrophysics Data System (ADS)

Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

2018-02-01

A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

Binding of various ovotransferrin fragments to chick-embryo red cells.

PubMed Central

Oratore, A; D'Andrea, G; Moreton, K; Williams, J

1989-01-01

1. The ability of N- and C-terminal half-molecule fragments of hen ovotransferrin to interact with chick red blood cells (CERBC) has been studied under conditions that allow binding of the transferrin to transferrin receptors to take place, but not the delivery of iron to the cell. Two kinds of half-molecule fragments were used: (a) those which can associate with one another to give a dimer resembling native transferrin and (b) those which cannot associate in this way because they lack a few amino acid residues from their C-terminal ends. 2. Neither N nor C half-molecules alone can bind to the CERBC, but, when both are present, tight binding occurs. 3. Whether or not the half-molecules can associate with one another makes little difference to receptor binding. 4. Given that one of the half-molecules is iron-saturated, the presence or absence of iron in the contralateral half-molecule again makes little difference to receptor binding. PMID:2920021

Controlled rotation of the F1-ATPase reveals differential and continuous binding changes for ATP synthesis

PubMed Central

Adachi, Kengo; Oiwa, Kazuhiro; Yoshida, Masasuke; Nishizaka, Takayuki; Kinosita, Kazuhiko

2012-01-01

F1-ATPase is an ATP-driven rotary molecular motor that synthesizes ATP when rotated in reverse. To elucidate the mechanism of ATP synthesis, we imaged binding and release of fluorescently labelled ADP and ATP while rotating the motor in either direction by magnets. Here we report the binding and release rates for each of the three catalytic sites for 360° of the rotary angle. We show that the rates do not significantly depend on the rotary direction, indicating ATP synthesis by direct reversal of the hydrolysis-driven rotation. ADP and ATP are discriminated in angle-dependent binding, but not in release. Phosphate blocks ATP binding at angles where ADP binding is essential for ATP synthesis. In synthesis rotation, the affinity for ADP increases by >104, followed by a shift to high ATP affinity, and finally the affinity for ATP decreases by >104. All these angular changes are gradual, implicating tight coupling between the rotor angle and site affinities. PMID:22929779

An ultra-wide bandwidth-based range/GPS tight integration approach for relative positioning in vehicular ad hoc networks

NASA Astrophysics Data System (ADS)

Shen, Feng; Wayn Cheong, Joon; Dempster, Andrew G.

2015-04-01

Relative position awareness is a vital premise for the implementation of emerging intelligent transportation systems, such as collision warning. However, commercial global navigation satellite systems (GNSS) receivers do not satisfy the requirements of these applications. Fortunately, cooperative positioning (CP) techniques, through sharing the GNSS measurements between vehicles, can improve the performance of relative positioning in a vehicular ad hoc network (VANET). In this paper, while assuming there are no obstacles between vehicles, a new enhanced tightly coupled CP technique is presented by adding ultra-wide bandwidth (UWB)-based inter-vehicular range measurements. In the proposed CP method, each vehicle fuses the GPS measurements and the inter-vehicular range measurements. Based on analytical and experimental results, in the full GPS coverage environment, the new tight integration CP method outperforms the INS-aided tight CP method, tight CP method, and DGPS by 11%, 15%, and 24%, respectively; in the GPS outage scenario, the performance improvement achieves 60%, 65%, and 73%, respectively.

NMR Studies of the C-Terminus of alpha4 Reveal Possible Mechanism of Its Interaction with MID1 and Protein Phosphatase 2A

PubMed Central

Du, Haijuan; Massiah, Michael A.

2011-01-01

Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938

Conformation-controlled binding kinetics of antibodies

NASA Astrophysics Data System (ADS)

Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

2016-01-01

Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

The VirD2 pilot protein of Agrobacterium-transferred DNA interacts with the TATA box-binding protein and a nuclear protein kinase in plants

PubMed Central

Bakó, László; Umeda, Masaaki; Tiburcio, Antonio F.; Schell, Jeff; Koncz, Csaba

2003-01-01

The bacterial virulence protein VirD2 plays an important role in nuclear import and chromosomal integration of Agrobacterium-transferred DNA in fungal, plant, animal, and human cells. Here we show that in nuclei of alfalfa cells, VirD2 interacts with and is phosphorylated by CAK2Ms, a conserved plant ortholog of cyclin-dependent kinase-activating kinases. CAK2Ms binds to and phosphorylates the C-terminal regulatory domain of RNA polymerase II largest subunit, which can recruit the TATA box-binding protein. VirD2 is found in tight association with the TATA box-binding protein in vivo. These results indicate that recognition of VirD2 is mediated by widely conserved nuclear factors in eukaryotes. PMID:12900506

Anion-induced reconstitution of a self-assembling system to express a chloride-binding Co10L15 pentagonal prism.

PubMed

Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R

2012-09-01

Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.

Computational evaluation of sub-nanometer cluster activity of singly exposed copper atom with various coordinative environment in catalytic CO2 transformation

NASA Astrophysics Data System (ADS)

Shanmugam, Ramasamy; Thamaraichelvan, Arunachalam; Ganesan, Tharumeya Kuppusamy; Viswanathan, Balasubramanian

2017-02-01

Metal cluster, at sub-nanometer level has a unique property in the activation of small molecules, in contrast to that of bulk surface. In the present work, singly exposed active site of copper metal cluster at sub-nanometer level was designed to arrive at the energy minimised configurations, binding energy, electrostatic potential map, frontier molecular orbitals and partial density of states. The ab initio molecular dynamics was carried out to probe the catalytic nature of the cluster. Further, the stability of the metal cluster and its catalytic activity in the electrochemical reduction of CO2 to CO were evaluated by means of computational hydrogen electrode via calculation of the free energy profile using DFT/B3LYP level of theory in vacuum. The activity of the cluster is ascertained from the fact that the copper atom, present in a two coordinative environment, performs a more selective conversion of CO2 to CO at an applied potential of -0.35 V which is comparatively lower than that of higher coordinative sites. The present study helps to design any sub-nano level metal catalyst for electrochemical reduction of CO2 to various value added chemicals.

Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

PubMed

Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

Adenosylcobinamide methyl phosphate as a pseudocoenzyme for diol dehydrase.

PubMed

Ishida, A; Toraya, T

1993-02-16

Adenosylcobinamide methyl phosphate, a novel analog of adenosylcobalamin lacking the nucleotide loop moiety, was synthesized. It did not show detectable coenzymic activity but behaved as a strong competitive inhibitor against AdoCbl with relatively high affinity (Ki = 2.5 microM). When apoenzyme was incubated at 37 degrees C with this analog in the presence of substrate, the Co-C bond of the analog was almost completely and irreversibly cleaved within 10 min, forming an enzyme-bound Co(II)-containing species. The cleavage was not observed in the absence of substrate. The Co-C bond cleavage in the presence of substrate was not catalytic but stoichiometric, implying that the Co-C bond of the analog undergoes activation when the analog binds to the active site of the enzyme. 5'-Deoxyadenosine was the only product derived from the adenosyl group of the analog upon the Co-C bond cleavage. Apoenzyme did not undergo modification during this process. Therefore, it seems likely that adenosylcobinamide methyl phosphate acts as a pseudocoenzyme or a potent suicide coenzyme. Since adenosylcobinamide neither functions as coenzyme nor binds tightly to apoenzyme, it can be concluded that the phosphodiester moiety of the nucleotide loop of adenosylcobalamin is essential for tight binding to apoenzyme and therefore for subsequent activation of the Co-C bond and catalysis. It is also evident that the nucleotide loop is obligatory for the normal progress of catalytic cycle.

Engineering Designed Proteins for Light Capture, Energy Transfer, and Emissive Sensing In Vivo

NASA Astrophysics Data System (ADS)

Mancini, Joshua A.

Proteins that are used for photosynthetic light harvesting and biological signaling are critical to life. These types of proteins act as scaffolds that hold small, sometimes metal-containing organic molecules in precise locations for light absorption and successive use. For signaling proteins, this energy can be used to induce a photoisomerization of the small molecule that can turn on or off a signaling cascade that controls the physiology of an organism. Alternatively, photosynthetic light-harvesting proteins funnel this energy in a directional manner towards a charge separating catalytic component that can change this light energy into chemical energy. The protein environment also serves to tune the photophysical properties of the small molecules. This is seen extensively with the linear tetrapyrroles that are used in both photosynthetic and signaling proteins. Many efforts have been made to harness these natural proteins for societal use, including improving photophysical properties and interfacing capabilities with manmade catalytic components. Several methods of achieving improvement have entailed structurally guided mutation and directed evolution. However, these methods all have their limitations due to the inherent complexity and fragility of the natural proteins. This work presents an alternative more robust method to natural proteins. My thesis states: that man-made proteins, known as maquettes, employing basic rules of protein folding, can be designed to become light harvesting and signaling proteins that can be assembled fully in vivo providing an alternative, robust, and versatile platform for meeting the diverse array of societal "green chemistry" and biomedical needs. This in vivo assembly is carried out by interacting with cyanobacterial protein and pigment machinery, both as stand-alone units and as protein fusions with natural antenna complexes. Additionally, this work offers insight for fast and tight binding of circular and linear tetrapyrroles to the maquettes both in vitro and in vivo. Design principles are also established for increasing the amount of linear tetrapyrrole attachment to the maquette as well as modulating their photophysical properties. Fast and tight binding of cofactors, high cofactor attachment yields, and control of cofactor photophysical properties are all prerequisites for the maquettes to be successful in vivo photosynthetic light harvesting and signaling proteins.

Ultra-fast computation of electronic spectra for large systems by tight-binding based simplified Tamm-Dancoff approximation (sTDA-xTB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grimme, Stefan, E-mail: grimme@thch.uni-bonn.de; Bannwarth, Christoph

2016-08-07

The computational bottleneck of the extremely fast simplified Tamm-Dancoff approximated (sTDA) time-dependent density functional theory procedure [S. Grimme, J. Chem. Phys. 138, 244104 (2013)] for the computation of electronic spectra for large systems is the determination of the ground state Kohn-Sham orbitals and eigenvalues. This limits such treatments to single structures with a few hundred atoms and hence, e.g., sampling along molecular dynamics trajectories for flexible systems or the calculation of chromophore aggregates is often not possible. The aim of this work is to solve this problem by a specifically designed semi-empirical tight binding (TB) procedure similar to the wellmore » established self-consistent-charge density functional TB scheme. The new special purpose method provides orbitals and orbital energies of hybrid density functional character for a subsequent and basically unmodified sTDA procedure. Compared to many previous semi-empirical excited state methods, an advantage of the ansatz is that a general eigenvalue problem in a non-orthogonal, extended atomic orbital basis is solved and therefore correct occupied/virtual orbital energy splittings as well as Rydberg levels are obtained. A key idea for the success of the new model is that the determination of atomic charges (describing an effective electron-electron interaction) and the one-particle spectrum is decoupled and treated by two differently parametrized Hamiltonians/basis sets. The three-diagonalization-step composite procedure can routinely compute broad range electronic spectra (0-8 eV) within minutes of computation time for systems composed of 500-1000 atoms with an accuracy typical of standard time-dependent density functional theory (0.3-0.5 eV average error). An easily extendable parametrization based on coupled-cluster and density functional computed reference data for the elements H–Zn including transition metals is described. The accuracy of the method termed sTDA-xTB is first benchmarked for vertical excitation energies of open- and closed-shell systems in comparison to other semi-empirical methods and applied to exemplary problems in electronic spectroscopy. As side products of the development, a robust and efficient valence electron TB method for the accurate determination of atomic charges as well as a more accurate calculation scheme of dipole rotatory strengths within the Tamm-Dancoff approximation is proposed.« less

Matrix isolation infrared spectra and photochemistry of hydantoin.

PubMed

Ildiz, Gulce Ogruc; Nunes, Cláudio M; Fausto, Rui

2013-01-31

Hydantoin (C(3)H(4)N(2)O(2), 2,4-imidazolidinedione) was isolated in argon matrix at 10 K and its infrared spectrum and unimolecular photochemistry were investigated. The molecular structure of the compound was studied both at the DFT(B3LYP) and MP2 levels of approximation with valence triple- and quadruple-ζ basis sets (6-311++G(d,p); cc-pVQZ). It was concluded that the minima in the potential energy surfaces of the molecule correspond to C(1) symmetry structures. However, the energy barrier separating the two-equivalent-by-symmetry minima stays below their zero-point energy, which makes the C(s) symmetry structure, which separates the two minima, the experimentally relevant one. The electronic structure of the molecule was studied in detail by performing the Natural Bond Orbital analysis of its electronic configuration within the DFT(B3LYP)/cc-pVQZ space. The infrared spectrum of the matrix isolated compound was fully assigned also with help of the theoretically predicted spectrum. Upon irradiation at λ = 230 nm, matrix-isolated hydantoin was found to photofragment into isocyanic acid, CO, and methylenimine.

Native red electrophoresis--a new method suitable for separation of native proteins.

PubMed

Dráb, Tomáš; Kračmerová, Jana; Tichá, Ivana; Hanzlíková, Eva; Tichá, Marie; Ryšlavá, Helena; Doubnerová, Veronika; Maňásková-Postlerová, Pavla; Liberda, Jiří

2011-12-01

A new type of native electrophoresis was developed to separate and characterize proteins. In this modification of the native blue electrophoresis, the dye Ponceau Red S is used instead of Coomassie Brilliant Blue to impose uniform negative charge on proteins to enable their electrophoretic separation according to their relative molecular masses. As Ponceau Red S binds less tightly to proteins, in comparison with Coomassie Blue, it can be easily removed after the electrophoretic separation and a further investigation of protein properties is made possible (e.g. an enzyme detection or electroblotting). The tested proteins also kept their native properties (enzyme activity or aggregation state). Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Photoelectron emission from LiF surfaces by ultrashort electromagnetic pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acuna, M. A.; Gravielle, M. S.; Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires

2011-03-15

Energy- and angle-resolved electron emission spectra produced by incidence of ultrashort electromagnetic pulses on a LiF(001) surface are studied by employing a distorted-wave method named the crystal surface-Volkov (CSV) approximation. The theory makes use of the Volkov phase to describe the action of the external electric field on the emitted electron, while the electron-surface interaction is represented within the tight-binding model. The CSV approach is applied to investigate the effects introduced by the crystal lattice when the electric field is oriented parallel to the surface plane. These effects are essentially governed by the vector potential of the external field, whilemore » the influence of the crystal orientation was found to be negligible.« less

A quantum rings based on multiple quantum wells for 1.2-2.8 THz detection

NASA Astrophysics Data System (ADS)

Mobini, Alireza; Solaimani, M.

2018-07-01

In this paper optical properties of a new QR based on MQWs have been investigated for detection in the THz range. The QR composed of a periodic effective quantum sites that each one considered as QW in theta direction. Using Tight binding method, eigen value problem for a QR with circumstance of 100 nm number with different number of wells i.e. 2, 4, 6 and 8 are solved and the absorption spectrum have been calculated. The results show that absorption has maximum value in range of (1.2-2.88 THz) that can be used for THz detection. Finally, it is realized that by increasing the number of wells, the numbers of absorption line also increase.

Wavepacket dynamics in one-dimensional system with long-range correlated disorder

NASA Astrophysics Data System (ADS)

Yamada, Hiroaki S.

2018-03-01

We numerically investigate dynamical property in the one-dimensional tight-binding model with long-range correlated disorder having power spectrum 1 /fα (α: spectrum exponent) generated by Fourier filtering method. For relatively small α <αc (=2) time-dependence of mean square displacement (MSD) of the initially localized wavepacket shows ballistic spread and localizes as time elapses. It is shown that α-dependence of the dynamical localization length determined by the MSD exhibits a simple scaling law in the localization regime for the relatively weak disorder strength W. Furthermore, scaled MSD by the dynamical localization length almost obeys an universal function from the ballistic to the localization regime in the various combinations of the parameters α and W.

Why are Buckyonions Round?

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Scuseria, Gustavo E.

1998-01-01

Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite. However. theoretical models or large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations or round buckyonions and theoretical predictions of faceted icosahedral fullerenes.

Exchange and spin-orbit induced phenomena in diluted (Ga,Mn)As from first principles

NASA Astrophysics Data System (ADS)

Kudrnovský, J.; Drchal, V.; Turek, I.

2016-08-01

Physical properties induced by exchange interactions (Curie temperature and spin stiffness) and spin-orbit coupling (anomalous Hall effect, anisotropic magnetoresistance, and Gilbert damping) in the diluted (Ga,Mn)As ferromagnetic semiconductor are studied from first principles. Recently developed Kubo-Bastin transport theory and nonlocal torque operator formulation of the Gilbert damping as formulated in the tight-binding linear muffin-tin orbital method are used. The first-principles Liechtenstein mapping is employed to construct an effective Heisenberg Hamiltonian and to estimate Curie temperature and spin stiffness in the real-space random-phase approximation. Good agreement of calculated physical quantities with experiments on well-annealed samples containing only a small amount of compensating defects is obtained.

Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling

NASA Astrophysics Data System (ADS)

Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng

2018-05-01

Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.

The role of cytosine methylation on charge transport through a DNA strand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu; Govind, Niranjan, E-mail: niri.govind@pnnl.gov

Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance throughmore » the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.« less

Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

NASA Astrophysics Data System (ADS)

Mir, Raja N.; Frensley, William R.

2013-10-01

InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.

Atomistic tight-binding computations of the structural and optical properties of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak

2018-05-01

A study of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals is carried out using atomistic tight-binding theory and the configuration interaction method to provide information for applications in bioimaging, biolabeling, display devices and near-infrared electronic instruments. The calculations yield the dependences of the internal and external passivated shells on the natural behaviours of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals. The reduction of the optical band gaps is observed with increasing numbers of monolayers in the external ZnS shell due to quantum confinement. Interestingly, the optical band gaps of CdTe/CdS/ZnS core/shell/shell nanocrystals are greater than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. In the presence of an external ZnS-coated shell, electron-hole wave function overlaps, oscillation strengths, ground-state exchange energies and Stokes shift are improved, whereas ground-state coulomb energies and fine-structure splitting are reduced. The oscillation strengths, Stokes shift and fine-structure splitting are reduced with the increase in external ZnS shell thickness. The oscillation strengths, Stokes shift and fine-structure splitting of CdTe/CdS/ZnS core/shell/shell nanocrystals are larger than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. Reduction of the atomistic electron-hole interactions is observed with increasing external ZnS shell size. The strong electron-hole interactions are more probed in CdTe/CdS/ZnS core/shell/shell nanocrystals than in CdTe/CdSe/ZnS core/shell/shell nanocrystals.

The role of cytosine methylation on charge transport through a DNA strand

NASA Astrophysics Data System (ADS)

Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

2015-09-01

Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

Social Justice and Social Order: Binding Moralities across the Political Spectrum

PubMed Central

2016-01-01

Two studies explored the relationship between political ideology and endorsement of a range of moral principles. Political liberals and conservatives did not differ on intrapersonal or interpersonal moralities, which require self-regulation. However differences emerged on collective moralities, which involve social regulation. Contrary to Moral Foundations Theory, both liberals and conservatives endorsed a group-focused binding morality, specifically Social Justice and Social Order respectively. Libertarians were the group without a binding morality. Although Social Justice and Social Order appear conflictual, analyses based on earlier cross-cultural work on societal tightness-looseness suggest that countries actually benefit in terms of economic success and societal well-being when these group-based moralities co-exist and serve as counterweights in social regulation. PMID:27031103

Designing the Sniper: Improving Targeted Human Cytolytic Fusion Proteins for Anti-Cancer Therapy via Molecular Simulation.

PubMed

Bochicchio, Anna; Jordaan, Sandra; Losasso, Valeria; Chetty, Shivan; Perera, Rodrigo Casasnovas; Ippoliti, Emiliano; Barth, Stefan; Carloni, Paolo

2017-02-17

Targeted human cytolytic fusion proteins (hCFPs) are humanized immunotoxins for selective treatment of different diseases including cancer. They are composed of a ligand specifically binding to target cells genetically linked to a human apoptosis-inducing enzyme. hCFPs target cancer cells via an antibody or derivative (scFv) specifically binding to e.g., tumor associated antigens (TAAs). After internalization and translocation of the enzyme from endocytosed endosomes, the human enzymes introduced into the cytosol are efficiently inducing apoptosis. Under in vivo conditions such enzymes are subject to tight regulation by native inhibitors in order to prevent inappropriate induction of cell death in healthy cells. Tumor cells are known to upregulate these inhibitors as a survival mechanism resulting in escape of malignant cells from elimination by immune effector cells. Cytosolic inhibitors of Granzyme B and Angiogenin (Serpin P9 and RNH1, respectively), reduce the efficacy of hCFPs with these enzymes as effector domains, requiring detrimentally high doses in order to saturate inhibitor binding and rescue cytolytic activity. Variants of Granzyme B and Angiogenin might feature reduced affinity for their respective inhibitors, while retaining or even enhancing their catalytic activity. A powerful tool to design hCFPs mutants with improved potency is given by in silico methods. These include molecular dynamics (MD) simulations and enhanced sampling methods (ESM). MD and ESM allow predicting the enzyme-protein inhibitor binding stability and the associated conformational changes, provided that structural information is available. Such "high-resolution" detailed description enables the elucidation of interaction domains and the identification of sites where particular point mutations may modify those interactions. This review discusses recent advances in the use of MD and ESM for hCFP development from the viewpoints of scientists involved in both fields.

Designing the Sniper: Improving Targeted Human Cytolytic Fusion Proteins for Anti-Cancer Therapy via Molecular Simulation

PubMed Central

Bochicchio, Anna; Jordaan, Sandra; Losasso, Valeria; Chetty, Shivan; Casasnovas Perera, Rodrigo; Ippoliti, Emiliano; Barth, Stefan; Carloni, Paolo

2017-01-01

Targeted human cytolytic fusion proteins (hCFPs) are humanized immunotoxins for selective treatment of different diseases including cancer. They are composed of a ligand specifically binding to target cells genetically linked to a human apoptosis-inducing enzyme. hCFPs target cancer cells via an antibody or derivative (scFv) specifically binding to e.g., tumor associated antigens (TAAs). After internalization and translocation of the enzyme from endocytosed endosomes, the human enzymes introduced into the cytosol are efficiently inducing apoptosis. Under in vivo conditions such enzymes are subject to tight regulation by native inhibitors in order to prevent inappropriate induction of cell death in healthy cells. Tumor cells are known to up-regulate these inhibitors as a survival mechanism resulting in escape of malignant cells from elimination by immune effector cells. Cytosolic inhibitors of Granzyme B and Angiogenin (Serpin P9 and RNH1, respectively), reduce the efficacy of hCFPs with these enzymes as effector domains, requiring detrimentally high doses in order to saturate inhibitor binding and rescue cytolytic activity. Variants of Granzyme B and Angiogenin might feature reduced affinity for their respective inhibitors, while retaining or even enhancing their catalytic activity. A powerful tool to design hCFPs mutants with improved potency is given by in silico methods. These include molecular dynamics (MD) simulations and enhanced sampling methods (ESM). MD and ESM allow predicting the enzyme-protein inhibitor binding stability and the associated conformational changes, provided that structural information is available. Such “high-resolution” detailed description enables the elucidation of interaction domains and the identification of sites where particular point mutations may modify those interactions. This review discusses recent advances in the use of MD and ESM for hCFP development from the viewpoints of scientists involved in both fields. PMID:28536352

Crystal structure of coelenterazine-binding protein from Renilla muelleri at 1.7 A: why it is not a calcium-regulated photoprotein.

PubMed

Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng

2008-04-01

Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.

MCM ring hexamerization is a prerequisite for DNA-binding

DOE PAGES

Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.

2015-09-13

The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less

Kinetic mechanism of the dimeric ATP sulfurylase from plants

PubMed Central

Ravilious, Geoffrey E.; Herrmann, Jonathan; Goo Lee, Soon; Westfall, Corey S.; Jez, Joseph M.

2013-01-01

In plants, sulfur must be obtained from the environment and assimilated into usable forms for metabolism. ATP sulfurylase catalyses the thermodynamically unfavourable formation of a mixed phosphosulfate anhydride in APS (adenosine 5′-phosphosulfate) from ATP and sulfate as the first committed step of sulfur assimilation in plants. In contrast to the multi-functional, allosterically regulated ATP sulfurylases from bacteria, fungi and mammals, the plant enzyme functions as a mono-functional, non-allosteric homodimer. Owing to these differences, here we examine the kinetic mechanism of soybean ATP sulfurylase [GmATPS1 (Glycine max (soybean) ATP sulfurylase isoform 1)]. For the forward reaction (APS synthesis), initial velocity methods indicate a single-displacement mechanism. Dead-end inhibition studies with chlorate showed competitive inhibition versus sulfate and non-competitive inhibition versus APS. Initial velocity studies of the reverse reaction (ATP synthesis) demonstrate a sequential mechanism with global fitting analysis suggesting an ordered binding of substrates. ITC (isothermal titration calorimetry) showed tight binding of APS to GmATPS1. In contrast, binding of PPi (pyrophosphate) to GmATPS1 was not detected, although titration of the E•APS complex with PPi in the absence of magnesium displayed ternary complex formation. These results suggest a kinetic mechanism in which ATP and APS are the first substrates bound in the forward and reverse reactions, respectively. PMID:23789618

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuo, Nai-Wei; Gao, Yong; Schill, Megan S.

Chemokines play important roles in the immune system, not only recruiting leukocytes to the site of infection and inflammation but also guiding cell homing and cell development. The soluble poxvirusencoded protein vCCI, a CC chemokine inhibitor, can bind to human CC chemokines tightly to impair the host immune defense. This protein has no known homologs in eukaryotes, and may represent a potent method to stop inflammation. Previously, our structure of the vCCI:MIP-1β complex indicated that vCCI uses negatively charged residues in β-sheet II to interact with positively charged residues in the MIP-1βN-terminus, 20’s region and 40’s loop. However, the interactionsmore » between vCCI and other CC chemokines have not yet been fully explored. Here, we used NMR and fluorescence anisotropy to study the interaction between vCCI and eotaxin-1 (CCL11), another CC chemokine that is an important factor in the asthma response. NMR results reveal that the binding pattern is very similar to the vCCI:MIP-1βcomplex, and suggest that electrostatic interactions provide a major contribution to binding. Fluorescence anisotropy results on variants of eotaxin-1 further confirm the critical roles of the charged residues in eotaxin. Compared to wild-type eotaxin, single, double, or triple mutations at these critical charged residues weaken the binding. One exception is the K47A mutation that exhibits increased affinity for vCCI, which can be explained structurally. In addition, the binding affinity between vCCI and other wild type CC chemokines, MCP-1, MIP-1β and RANTES, were determined as 1.09 nM, 1.16 nM, and 0.22 nM, respectively. To our knowledge, this is the first work quantitatively measuring the binding affinity between vCCI and different CC chemokines.« less

The ribonucleoprotein Csr network.

PubMed

Seyll, Ethel; Van Melderen, Laurence

2013-11-08

Ribonucleoprotein complexes are essential regulatory components in bacteria. In this review, we focus on the carbon storage regulator (Csr) network, which is well conserved in the bacterial world. This regulatory network is composed of the CsrA master regulator, its targets and regulators. CsrA binds to mRNA targets and regulates translation either negatively or positively. Binding to small non-coding RNAs controls activity of this protein. Expression of these regulators is tightly regulated at the level of transcription and stability by various global regulators (RNAses, two-component systems, alarmone). We discuss the implications of these complex regulations in bacterial adaptation.

The Mismetallation of Enzymes during Oxidative Stress*

PubMed Central

Imlay, James A.

2014-01-01

Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

Protein and Antibody Engineering by Phage Display

PubMed Central

Frei, J.C.; Lai, J.R.

2017-01-01

Phage display is an in vitro selection technique that allows for the rapid isolation of proteins with desired properties including increased affinity, specificity, stability, and new enzymatic activity. The power of phage display relies on the phenotype-to-genotype linkage of the protein of interest displayed on the phage surface with the encoding DNA packaged within the phage particle, which allows for selective enrichment of library pools and high-throughput screening of resulting clones. As an in vitro method, the conditions of the binding selection can be tightly controlled. Due to the high-throughput nature, rapidity, and ease of use, phage display is an excellent technological platform for engineering antibody or proteins with enhanced properties. Here, we describe methods for synthesis, selection, and screening of phage libraries with particular emphasis on designing humanizing antibody libraries and combinatorial scanning mutagenesis libraries. We conclude with a brief section on troubleshooting for all stages of the phage display process. PMID:27586328

Improvements on non-equilibrium and transport Green function techniques: The next-generation TRANSIESTA

NASA Astrophysics Data System (ADS)

Papior, Nick; Lorente, Nicolás; Frederiksen, Thomas; García, Alberto; Brandbyge, Mads

2017-03-01

We present novel methods implemented within the non-equilibrium Green function code (NEGF) TRANSIESTA based on density functional theory (DFT). Our flexible, next-generation DFT-NEGF code handles devices with one or multiple electrodes (Ne ≥ 1) with individual chemical potentials and electronic temperatures. We describe its novel methods for electrostatic gating, contour optimizations, and assertion of charge conservation, as well as the newly implemented algorithms for optimized and scalable matrix inversion, performance-critical pivoting, and hybrid parallelization. Additionally, a generic NEGF "post-processing" code (TBTRANS/PHTRANS) for electron and phonon transport is presented with several novelties such as Hamiltonian interpolations, Ne ≥ 1 electrode capability, bond-currents, generalized interface for user-defined tight-binding transport, transmission projection using eigenstates of a projected Hamiltonian, and fast inversion algorithms for large-scale simulations easily exceeding 106 atoms on workstation computers. The new features of both codes are demonstrated and bench-marked for relevant test systems.

Origami rules for the construction of localized eigenstates of the Hubbard model in decorated lattices

NASA Astrophysics Data System (ADS)

Dias, R. G.; Gouveia, J. D.

2015-11-01

We present a method of construction of exact localized many-body eigenstates of the Hubbard model in decorated lattices, both for U = 0 and U → ∞. These states are localized in what concerns both hole and particle movement. The starting point of the method is the construction of a plaquette or a set of plaquettes with a higher symmetry than that of the whole lattice. Using a simple set of rules, the tight-binding localized state in such a plaquette can be divided, folded and unfolded to new plaquette geometries. This set of rules is also valid for the construction of a localized state for one hole in the U → ∞ limit of the same plaquette, assuming a spin configuration which is a uniform linear combination of all possible permutations of the set of spins in the plaquette.

Multiple period s-p hybridization in nano-strip embedded photonic crystal.

PubMed

Han, Seunghoon; Lee, Il-Min; Kim, Hwi; Lee, Byoungho

2005-04-04

We report and analyze hybridization of s-state and p-state modes in photonic crystal one-dimensional defect cavity array. When embedding a nano-strip into a dielectric rod photonic crystal, an effective cavity array is made, where each cavity possesses two cavity modes: s-state and p-state. The two modes are laterally even versus the nano-strip direction, and interact with each other, producing defect bands, of which the group velocity becomes zero within the first Brillouin zone. We could model and describe the phenomena by using the tight-binding method, well agreeing with the plane-wave expansion method analysis. We note that the reported s- and p-state mode interaction corresponds to the hybridization of atomic orbital in solid-state physics. The concept of multiple period s-p hybridization and the proposed model can be useful for analyzing and developing novel photonic crystal waveguides and devices.

The Relationship of Ethics to Quality: A Particular Case of Research in Autism

ERIC Educational Resources Information Center

Waltz, Mitzi

2007-01-01

To look for the answers of "What is the relationship between "ethics" and "quality" in education research?," this article explores factors that bind the two too tightly together for extrication, including representation of subject and researcher mindsets, the setting of research agendas, research design and funding. Using research in autism as a…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

Atomic resolution x-ray structure of the substrate recognition domain of higher plant rubisco activase

USDA-ARS?s Scientific Manuscript database

The rapid release of tight-binding inhibitors from dead-end Rubisco complexes requires the activity of Rubisco activase, an AAA+ ATPase that utilizes chemo-mechanical energy to catalyze the reactivation of Rubisco. Activase is thought to play a central role in coordinating the rate of CO2 fixation w...

Structural basis of oligosaccharide processing by glycosaminoglycan sulfotransferases.

PubMed

Gesteira, Tarsis F; Coulson-Thomas, Vivien J

2018-06-06

Heparan sulfate (HS) is a sulfated polysaccharide that plays a key role in morphogenesis, physiology and pathogenesis. The biosynthesis of HS takes place in the Golgi apparatus by a group of enzymes that polymerize, epimerize and sulfate the sugar chain. This biosynthetic process introduces varying degrees of sulfate substitution, which are tightly regulated and directly dictate binding specificity to different cytokines, morphogens and growth factors. Here we report the use of molecular dynamics simulations to investigate the dynamics of substrate recognition of two glycosaminoglycan (GAG) sulfotransferases, N-deacetylase-N-sulfotransferase and 2-O-sulfotransferase to the HS chain during the biosynthetic process. We performed multiple simulations of the binding of the sulfotransferase domains to both the HS oligosaccharide substrate and sulfate donor, 3'-phosphoadenosine-5'-phosphosulfate (PAPs). Analysis of extended simulations provide detailed and useful insights into the atomic interactions that are at work during oligosaccharide processing. The Fast Information Matching method was used to detect the enzyme global dynamics and to predict the pairwise contact of residues responsible for GAG-enzyme binding and unbinding. The correlation between HS displacement and the location of the modified GAG chain were calculated, indicating a possible route for HS and heparin during sulfotransferase processing. Our data also show sulfotransferases contain a conserved interspaced positively charged amino acid residues that form a patch which controls the protein-GAG binding equilibrium. Together, our findings provide further understanding on the fine-tuned complex mechanism of GAG biosynthesis. Our findings can also be extrapolated to other systems for calculating rates of protein-GAG binding.

Vibrational spectroscopy of (SO4(2-)).(H2O)n clusters, n=1-5: harmonic and anharmonic calculations and experiment.

PubMed

Miller, Yifat; Chaban, Galina M; Zhou, Jia; Asmis, Knut R; Neumark, Daniel M; Gerber, R Benny

2007-09-07

The vibrational spectroscopy of (SO4(2-)).(H2O)n is studied by theoretical calculations for n=1-5, and the results are compared with experiments for n=3-5. The calculations use both ab initio MP2 and DFT/B3LYP potential energy surfaces. Both harmonic and anharmonic calculations are reported, the latter with the CC-VSCF method. The main findings are the following: (1) With one exception (H2O bending mode), the anharmonicity of the observed transitions, all in the experimental window of 540-1850 cm(-1), is negligible. The computed anharmonic coupling suggests that intramolecular vibrational redistribution does not play any role for the observed linewidths. (2) Comparison with experiment at the harmonic level of computed fundamental frequencies indicates that MP2 is significantly more accurate than DFT/B3LYP for these systems. (3) Strong anharmonic effects are, however, calculated for numerous transitions of these systems, which are outside the present observation window. These include fundamentals as well as combination modes. (4) Combination modes for the n=1 and n=2 clusters are computed. Several relatively strong combination transitions are predicted. These show strong anharmonic effects. (5) An interesting effect of the zero point energy (ZPE) on structure is found for (SO4(2-)).(H2O)(5): The global minimum of the potential energy corresponds to a C(s) structure, but with incorporation of ZPE the lowest energy structure is C2v, in accordance with experiment. (6) No stable structures were found for (OH-).(HSO4-).(H2O)n, for n

Vibrational spectroscopy of (SO42-).(H2O)n clusters, n=1-5: Harmonic and anharmonic calculations and experiment

NASA Astrophysics Data System (ADS)

Miller, Yifat; Chaban, Galina M.; Zhou, Jia; Asmis, Knut R.; Neumark, Daniel M.; Benny Gerber, R.

2007-09-01

The vibrational spectroscopy of (SO42-)•(H2O)n is studied by theoretical calculations for n =1-5, and the results are compared with experiments for n =3-5. The calculations use both ab initio MP2 and DFT/B3LYP potential energy surfaces. Both harmonic and anharmonic calculations are reported, the latter with the CC-VSCF method. The main findings are the following: (1) With one exception (H2O bending mode), the anharmonicity of the observed transitions, all in the experimental window of 540-1850cm-1, is negligible. The computed anharmonic coupling suggests that intramolecular vibrational redistribution does not play any role for the observed linewidths. (2) Comparison with experiment at the harmonic level of computed fundamental frequencies indicates that MP2 is significantly more accurate than DFT/B3LYP for these systems. (3) Strong anharmonic effects are, however, calculated for numerous transitions of these systems, which are outside the present observation window. These include fundamentals as well as combination modes. (4) Combination modes for the n=1 and n =2 clusters are computed. Several relatively strong combination transitions are predicted. These show strong anharmonic effects. (5) An interesting effect of the zero point energy (ZPE) on structure is found for (SO42-)•(H2O)5: The global minimum of the potential energy corresponds to a Cs structure, but with incorporation of ZPE the lowest energy structure is C2v, in accordance with experiment. (6) No stable structures were found for (OH-)•(HSO4-)•(H2O)n, for n ⩽5.

Fractional charge and inter-Landau-level states at points of singular curvature.

PubMed

Biswas, Rudro R; Son, Dam Thanh

2016-08-02

The quest for universal properties of topological phases is fundamentally important because these signatures are robust to variations in system-specific details. Aspects of the response of quantum Hall states to smooth spatial curvature are well-studied, but challenging to observe experimentally. Here we go beyond this prevailing paradigm and obtain general results for the response of quantum Hall states to points of singular curvature in real space; such points may be readily experimentally actualized. We find, using continuum analytical methods, that the point of curvature binds an excess fractional charge and sequences of quantum states split away, energetically, from the degenerate bulk Landau levels. Importantly, these inter-Landau-level states are bound to the topological singularity and have energies that are universal functions of bulk parameters and the curvature. Our exact diagonalization of lattice tight-binding models on closed manifolds demonstrates that these results continue to hold even when lattice effects are significant. An important technological implication of these results is that these inter-Landau-level states, being both energetically and spatially isolated quantum states, are promising candidates for constructing qubits for quantum computation.

Novel pyrazolyl-s-triazine derivatives, molecular structure and antimicrobial activity

NASA Astrophysics Data System (ADS)

Sharma, Anamika; Ghabbour, Hazem; Khan, Shams Tabrez; de la Torre, Beatriz G.; Albericio, Fernando; El-Faham, Ayman

2017-10-01

A new series of pyrazole-containing s-triazine derivatives were synthesized by reaction of the corresponding s-triazinyl hydrazine derivatives with acetylacetone in the presence of HClO4 or DMF/TEA. The former method allowed the preparation of the target products with higher yields. All compounds were fully characterized. X-ray single crystal diffraction for two representative compounds (4-(4,6-bis(3,5-dimethyl-1H-pyrazol-1-yl)-1,3,5-triazin-2-yl)morpholine and N-benzyl-4-(3,5-dimethyl-1H-pyrazol-1-yl)-6-(piperidin-1-yl)-1,3,5-triazin-2-amine) was studied and the molecular structures were optimized using the DFT/B3LYP method. The structures were found to be in agreement with X-ray structures. The antimicrobial and antifungal activity of the prepared compounds were tested against the growth of several microorganisms.

FT-IR, micro-Raman and UV-vis spectroscopic and quantum chemical investigations of free 2,2'-dithiodipyridine and its metal (Co, Cu and Zn) halide complexes.

PubMed

Gökce, Halil; Bahçeli, Semiha

2013-10-01

In this study the elemental analysis results, molecular geometries, vibrational and electronic absorption spectra of free 2,2'-dithiodipyridine(C10H8N2S2), (or DTDP) (with synonym, 2,2'-dipyridyl disulfide) and M(C10H8N2S2)Cl2 (M=Co, Cu and Zn) complexes have been reported. Vibrational wavenumbers of free DTDP and its metal halide complexes have been calculated by using DFT/B3LYP calculation method with 6-31++G(d,p) and Lanl2DZ basis sets, respectively, in the ground state, for the first time. The calculated fundamental vibrational frequencies are in a good agreement with experimental data. The HOMO, LUMO and MEP analyses of all compounds are performed by DFT method. Copyright © 2013. Published by Elsevier B.V.

FTIR, FT-Raman, FT-NMR and quantum chemical investigations of 3-acetylcoumarin

NASA Astrophysics Data System (ADS)

Arjunan, V.; Sakiladevi, S.; Marchewka, M. K.; Mohan, S.

2013-05-01

3-Acetylcoumarin (3AC) was synthesised by a Knoevenagel reaction. Conformational analysis using the B3LYP method was also carried out to determine the most stable conformation of the compound. FTIR and FT-Raman spectra of 3AC have been recorded in the range 4000-400 and 4000-100 cm-1, respectively. 1H and 13C NMR spectra have also been recorded. The complete vibrational assignment and analysis of the fundamental modes of the compound were carried out using the experimental FTIR and FT-Raman data and quantum mechanical studies. The experimental vibrational frequencies were compared with the wavenumbers obtained theoretically from the DFT-B3LYP/B3PW91 gradient calculations employing the standard 6-31G**, high level 6-311++G** and cc-pVTZ basis sets for optimised geometry of the compound. The frontier molecular orbital energies of the compound are determined by DFT method.

The yeast transcription elongation factor Spt4/5 is a sequence‐specific RNA binding protein

PubMed Central

Blythe, Amanda J.; Yazar‐Klosinski, Berra; Webster, Michael W.; Chen, Eefei; Vandevenne, Marylène; Bendak, Katerina; Mackay, Joel P.; Hartzog, Grant A.

2016-01-01

Abstract The heterodimeric transcription elongation factor Spt4/Spt5 (Spt4/5) tightly associates with RNAPII to regulate both transcriptional elongation and co‐transcriptional pre‐mRNA processing; however, the mechanisms by which Spt4/5 acts are poorly understood. Recent studies of the human and Drosophila Spt4/5 complexes indicate that they can bind nucleic acids in vitro. We demonstrate here that yeast Spt4/5 can bind in a sequence‐specific manner to single stranded RNA containing AAN repeats. Furthermore, we show that the major protein determinants for RNA‐binding are Spt4 together with the NGN domain of Spt5 and that the KOW domains are not required for RNA recognition. These findings attribute a new function to a domain of Spt4/5 that associates directly with RNAPII, making significant steps towards elucidating the mechanism behind transcriptional control by Spt4/5. PMID:27376968

Binding of trivalent chromium to serum transferrin is sufficiently rapid to be physiologically relevant.

PubMed

Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B

2015-02-01

Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

PubMed Central

Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

2003-01-01

Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

The Possible Mechanism of Idiosyncratic Lapatinib-Induced Liver Injury in Patients Carrying Human Leukocyte Antigen-DRB1*07:01

PubMed Central

Hirasawa, Makoto; Hagihara, Katsunobu; Okudaira, Noriko; Izumi, Takashi

2015-01-01

Idiosyncratic lapatinib-induced liver injury has been reported to be associated with human leukocyte antigen (HLA)-DRB1*07:01. In order to investigate its mechanism, interaction of lapatinib with HLA-DRB1*07:01 and its ligand peptide derived from tetanus toxoid, has been evaluated in vitro. Here we show that lapatinib enhances binding of the ligand peptide to HLA-DRB1*07:01. Furthermore in silico molecular dynamics analysis revealed that lapatinib could change the β chain helix in the HLA-DRB1*07:01 specifically to form a tightly closed binding groove structure and modify a large part of the binding groove. These results indicate that lapatinib affects the ligand binding to HLA-DRB1*07:01 and idiosyncratic lapatinib-induced liver injury might be triggered by this mechanism. This is the first report showing that the clinically available drug can enhance the binding of ligand peptide to HLA class II molecules in vitro and in silico. PMID:26098642

Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

Crystal structure of the Escherichia coli regulator of sigma70, Rsd, in complex with sigma70 domain 4.

PubMed

Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A

2007-09-21

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.

Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4

PubMed Central

Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.

2007-01-01

Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patikoglou,G.; Westblade, L.; Campbell, E.

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less

AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation.

PubMed

Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

2016-03-11

This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL.

AUV Positioning Method Based on Tightly Coupled SINS/LBL for Underwater Acoustic Multipath Propagation

PubMed Central

Zhang, Tao; Shi, Hongfei; Chen, Liping; Li, Yao; Tong, Jinwu

2016-01-01

This paper researches an AUV (Autonomous Underwater Vehicle) positioning method based on SINS (Strapdown Inertial Navigation System)/LBL (Long Base Line) tightly coupled algorithm. This algorithm mainly includes SINS-assisted searching method of optimum slant-range of underwater acoustic propagation multipath, SINS/LBL tightly coupled model and multi-sensor information fusion algorithm. Fuzzy correlation peak problem of underwater LBL acoustic propagation multipath could be solved based on SINS positional information, thus improving LBL positional accuracy. Moreover, introduction of SINS-centered LBL locating information could compensate accumulative AUV position error effectively and regularly. Compared to loosely coupled algorithm, this tightly coupled algorithm can still provide accurate location information when there are fewer than four available hydrophones (or within the signal receiving range). Therefore, effective positional calibration area of tightly coupled system based on LBL array is wider and has higher reliability and fault tolerance than loosely coupled. It is more applicable to AUV positioning based on SINS/LBL. PMID:26978361

Dissipative time-dependent quantum transport theory.

PubMed

Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

2013-04-28

A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

PubMed

Zhou, Huan-Xiang

2006-11-01

Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods

PubMed Central

Bizarro, C. V.; Alemany, A.; Ritort, F.

2012-01-01

RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710

Interaction of acetone with single wall carbon nanotubes at cryogenic temperatures: a combined temperature programmed desorption and theoretical study.

PubMed

Kazachkin, Dmitry; Nishimura, Yoshifumi; Irle, Stephan; Morokuma, Keiji; Vidic, Radisav D; Borguet, Eric

2008-08-05

The interaction of acetone with single wall carbon nanotubes (SWCNTs) at low temperatures was studied by a combination of temperature programmed desorption (TPD) and dispersion-augmented density-functional-based tight binding (DFTB-D) theoretical simulations. On the basis of the results of the TPD study and theoretical simulations, the desorption peaks of acetone can be assigned to the following adsorption sites: (i) sites with energy of approximately 75 kJ mol (-1) ( T des approximately 300 K)endohedral sites of small diameter nanotubes ( approximately 7.7 A); (ii) sites with energy 40-68 kJ mol (-1) ( T des approximately 240 K)acetone adsorption on accessible interstitial, groove sites, and endohedral sites of larger nanotubes ( approximately 14 A); (iii) sites with energy 25-42 kJ mol (-1) ( T des approximately 140 K)acetone adsorption on external walls of SWCNTs and multilayer adsorption. Oxidatively purified SWCNTs have limited access to endohedral sites due to the presence of oxygen functionalities. Oxygen functionalities can be removed by annealing to elevated temperature (900 K) opening access to endohedral sites of nanotubes. Nonpurified, as-received SWCNTs are characterized by limited access for acetone to endohedral sites even after annealing to elevated temperatures (900 K). Annealing of both purified and as-produced SWCNTs to high temperatures (1400 K) leads to reduction of access for acetone molecules to endohedral sites of small nanotubes, probably due to defect self-healing and cap formation at the ends of SWCNTs. No chemical interaction between acetone and SWCNTs was detected for low temperature adsorption experiments. Theoretical simulations of acetone adsorption on finite pristine SWCNTs of different diameters suggest a clear relationship of the adsorption energy with tube sidewall curvature. Adsorption of acetone is due to dispersion forces, with its C-O bond either parallel to the surface or O pointing away from it. No significant charge transfer or polarization was found. Carbon black was used to model amorphous carbonaceous impurities present in as-produced SWCNTs. Desorption of acetone from carbon black revealed two peaks at approximately 140 and approximately 180-230 K, similar to two acetone desorption peaks from SWCNTs. The characteristic feature of acetone desorption from SWCNTs was peak at approximately 300 K that was not observed for carbon black. Care should be taken when assigning TPD peaks for molecules desorbing from carbon nanotubes as amorphous carbon can interfere.

Small Molecules Engage Hot Spots through Cooperative Binding To Inhibit a Tight Protein-Protein Interaction.

PubMed

Liu, Degang; Xu, David; Liu, Min; Knabe, William Eric; Yuan, Cai; Zhou, Donghui; Huang, Mingdong; Meroueh, Samy O

2017-03-28

Protein-protein interactions drive every aspect of cell signaling, yet only a few small-molecule inhibitors of these interactions exist. Despite our ability to identify critical residues known as hot spots, little is known about how to effectively engage them to disrupt protein-protein interactions. Here, we take advantage of the ease of preparation and stability of pyrrolinone 1, a small-molecule inhibitor of the tight interaction between the urokinase receptor (uPAR) and its binding partner, the urokinase-type plasminogen activator uPA, to synthesize more than 40 derivatives and explore their effect on the protein-protein interaction. We report the crystal structure of uPAR bound to previously discovered pyrazole 3 and to pyrrolinone 12. While both 3 and 12 bind to uPAR and compete with a fluorescently labeled peptide probe, only 12 and its derivatives inhibit the full uPAR·uPA interaction. Compounds 3 and 12 mimic and engage different hot-spot residues on uPA and uPAR, respectively. Interestingly, 12 is involved in a π-cation interaction with Arg-53, which is not considered a hot spot. Explicit-solvent molecular dynamics simulations reveal that 3 and 12 exhibit dramatically different correlations of motion with residues on uPAR. Free energy calculations for the wild-type and mutant uPAR bound to uPA or 12 show that Arg-53 interacts with uPA or with 12 in a highly cooperative manner, thereby altering the contributions of hot spots to uPAR binding. The direct engagement of peripheral residues not considered hot spots through π-cation or salt-bridge interactions could provide new opportunities for enhanced small-molecule engagement of hot spots to disrupt challenging protein-protein interactions.

Expression of Ulex europaeus agglutinin I lectin-binding sites in squamous cell carcinomas and their absence in basal cell carcinomas. Indicator of tumor type and differentiation.

PubMed

Heng, M C; Fallon-Friedlander, S; Bennett, R

1992-06-01

Lectins bind tightly to carbohydrate moieties on cell surfaces. Alterations in lectin binding have been reported to accompany epidermal cell differentiation, marking alterations in membrane sugars during this process. The presence of UEA I (Ulex europaeus agglutinin I) L-fucose-specific lectin-binding sites has been used as a marker for terminally differentiated (committed) keratinocytes. In this article, we report the presence of UEA-I-binding sites on squamous keratinocytes of well-differentiated squamous cell carcinomas, with patchy loss of UEA I positivity on poorly differentiated cells of squamous cell carcinomas, suggesting a possible use for this technique in the rapid assessment of less differentiated areas within the squamous cell tumor. The absence of UEA-I-binding sites on basal cell carcinomas may be related to an inability of cells comprising this tumor to convert the L-D-pyranosyl moiety on basal cells to the L-fucose moiety, resulting in an inability of basal cell carcinoma cell to undergo terminal differentiation into a committed keratinocyte.

Study on Synergistic Mechanism of Inhibitor Mixture Based on Electron Transfer Behavior

PubMed Central

Han, Peng; He, Yang; Chen, Changfeng; Yu, Haobo; Liu, Feng; Yang, Hong; Ma, Yue; Zheng, Yanjun

2016-01-01

Mixing is an important method to improve the performance of surfactants due to their synergistic effect. The changes in bonding interaction and adsorption structure of IM and OP molecules before and after co-adsorbed on Fe(001) surface is calculated by DFTB+ method. It is found that mixture enable the inhibitor molecules with higher EHOMO donate more electrons while the inhibitor molecules with lower ELUMO accept more electrons, which strengthens the bonding interaction of both inhibitor agent and inhibitor additive with metal surface. Meanwhile, water molecules in the compact layer of double electric layer are repulsed and the charge transfer resistance during the corrosion process increases. Accordingly, the correlation between the frontier orbital (EHOMO and ELUMO of inhibitor molecules and the Fermi level of metal) and inhibition efficiency is determined. Finally, we propose a frontier orbital matching principle for the synergistic effect of inhibitors, which is verified by electrochemical experiments. This frontier orbital matching principle provides an effective quantum chemistry calculation method for the optimal selection of inhibitor mixture. PMID:27671332

Molecular structure, FT-IR, FT-Raman, NMR studies and first order molecular hyperpolarizabilities by the DFT method of mirtazapine and its comparison with mianserin

NASA Astrophysics Data System (ADS)

Sagdinc, Seda G.; Sahinturk, Ayse Erbay

2013-03-01

Mirtazapine (±)-1,2,3,4,10,14b-hexahydro-2-methylpyrazino(2,1-a)pyrido(2,3-c)(2)benzazepine is a compound with antidepressant therapeutic effects. It is the 6-aza derivative of the tetracyclic antidepressant mianserin (±)-2-methyl-1,2,3,4,10,14b-hexahydrodibenzo[c,f]pyrazino[1,2-a]azepine. The FT-IR and FT-Raman spectra of mirtazapine have been recorded in 4000-400 cm-1 and 3500-10 cm-1, respectively. The optimized geometry, energies, nonlinear optical properties, vibrational frequencies, 13C, 1H and 15N NMR chemical shift values of mirtazapine have been determined using the density functional theory (DFT/B3LYP) method. A comparison of the experimental and theoretical results of mirtazapine indicates that the density-functional B3LYP method is able to provide satisfactory results for predicting vibrational and NMR properties. The experimental and calculated results for mirtazapine have also been compared with mianserin.

Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

PubMed

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-08-09

The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

Assessment of the Activation of Rho Family GTP-Binding Proteins in Breast Cancer Cells and Specimens

DTIC Science & Technology

2001-08-01

lymphopenia Vav2 GEF for Rho, Rac, and Cdc42 proto-oncogene product; NM009500 Vav3 GEF for Rho and Rac proto-oncogene product; NM020505 hPEM -2 GEF for...junctions, and desmosomes play a fundamental role in maintaining the polarized phenotype and vectorial transport functions of epithelial cells. The tight

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Ring, D.M.

The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

2016-04-13

We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

Model many-body Stoner Hamiltonian for binary FeCr alloys

NASA Astrophysics Data System (ADS)

Nguyen-Manh, D.; Dudarev, S. L.

2009-09-01

We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

Electronic Structure and Properties of Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Yang, Liu; Arnold, Jim (Technical Monitor)

2001-01-01

A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Photonic Bandgaps in Photonic Molecules

NASA Technical Reports Server (NTRS)

Smith, David D.; Chang, Hongrok; Gates, Amanda L.; Fuller, Kirk A.; Gregory, Don A.; Witherow, William K.; Paley, Mark S.; Frazier, Donald O.; Curreri, Peter A. (Technical Monitor)

2002-01-01

This talk will focus on photonic bandgaps that arise due to nearly free photon and tight-binding effects in coupled microparticle and ring-resonator systems. The Mie formulation for homogeneous spheres is generalized to handle core/shell systems and multiple concentric layers in a manner that exploits an analogy with stratified planar systems, thereby allowing concentric multi-layered structures to be treated as photonic bandgap (PBG) materials. Representative results from a Mie code employing this analogy demonstrate that photonic bands arising from nearly free photon effects are easily observed in the backscattering, asymmetry parameter, and albedo for periodic quarter-wave concentric layers, though are not readily apparent in extinction spectra. Rather, the periodicity simply alters the scattering profile, enhancing the ratio of backscattering to forward scattering inside the bandgap, in direct analogy with planar quarter-wave multilayers. PBGs arising from tight-binding may also be observed when the layers (or rings) are designed such that the coupling between them is weak. We demonstrate that for a structure consisting of N coupled micro-resonators, the morphology dependent resonances split into N higher-Q modes, in direct analogy with other types of oscillators, and that this splitting ultimately results in PBGs which can lead to enhanced nonlinear optical effects.

Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy

NASA Astrophysics Data System (ADS)

Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.

2018-02-01

Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.

Specific binding of Clostridium perfringens enterotoxin fragment to Claudin-b and modulation of zebrafish epidermal barrier.

PubMed

Zhang, Jingjing; Ni, Chen; Yang, Zhenguo; Piontek, Anna; Chen, Huapu; Wang, Sijie; Fan, Yiming; Qin, Zhihai; Piontek, Joerg

2015-08-01

Claudins (Cldn) are the major components of tight junctions (TJs) sealing the paracellular cleft in tissue barriers of various organs. Zebrafish Cldnb, the homolog of mammalian Cldn4, is expressed at epithelial cell-cell contacts and is important for regulating epidermal permeability. The bacterial toxin Clostridium perfringens enterotoxin (CPE) has been shown to bind to a subset of mammalian Cldns. In this study, we used the Cldn-binding C-terminal domain of CPE (194-319 amino acids, cCPE 194-319 ) to investigate its functional role in modulating zebrafish larval epidermal barriers. In vitro analyses show that cCPE 194-319 removed Cldn4 from epithelial cells and disrupted the monolayer tightness, which could be rescued by the removal of cCPE 194-319. Incubation of zebrafish larvae with cCPE 194-319 removed Cldnb specifically from the epidermal cell membrane. Dye diffusion analysis with 4-kDa fluorescent dextran indicated that the permeability of the epidermal barrier increased due to cCPE 194-319 incubation. Electron microscopic investigation revealed reversible loss of TJ integrity by Cldnb removal. Collectively, these results suggest that cCPE 194-319 could be used as a Cldnb modulator to transiently open the epidermal barrier in zebrafish. In addition, zebrafish might be used as an in vivo system to investigate the capability of cCPE to enhance drug delivery across tissue barriers. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic evidence for a tight cooperation of TatB and TatC during productive recognition of twin-arginine (Tat) signal peptides in Escherichia coli.

PubMed

Lausberg, Frank; Fleckenstein, Stefan; Kreutzenbeck, Peter; Fröbel, Julia; Rose, Patrick; Müller, Matthias; Freudl, Roland

2012-01-01

The twin arginine translocation (Tat) pathway transports folded proteins across the cytoplasmic membrane of bacteria. Tat signal peptides contain a consensus motif (S/T-R-R-X-F-L-K) that is thought to play a crucial role in substrate recognition by the Tat translocase. Replacement of the phenylalanine at the +2 consensus position in the signal peptide of a Tat-specific reporter protein (TorA-MalE) by aspartate blocked export of the corresponding TorA(D(+2))-MalE precursor, indicating that this mutation prevents a productive binding of the TorA(D(+2)) signal peptide to the Tat translocase. Mutations were identified in the extreme amino-terminal regions of TatB and TatC that synergistically suppressed the export defect of TorA(D(+2))-MalE when present in pairwise or triple combinations. The observed synergistic suppression activities were even more pronounced in the restoration of membrane translocation of another export-defective precursor, TorA(KQ)-MalE, in which the conserved twin arginine residues had been replaced by lysine-glutamine. Collectively, these findings indicate that the extreme amino-terminal regions of TatB and TatC cooperate tightly during recognition and productive binding of Tat-dependent precursor proteins and, furthermore, that TatB and TatC are both involved in the formation of a specific signal peptide binding site that reaches out as far as the end of the TatB transmembrane segment.

Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

PubMed Central

Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

Tautomerization, molecular structure, transition state structure, and vibrational spectra of 2-aminopyridines: a combined computational and experimental study.

PubMed

Al-Otaibi, Jamelah S

2015-01-01

2-amino pyridine derivatives have attracted considerable interest because they are useful precursors for the synthesis of a variety of heterocyclic compounds possessing a medicinal value. In this work we aim to study both structural and electronic as well as high quality vibrational spectra for 2-amino-3-methylpyridine (2A3MP) and 2-amino-4-methylpyridine (2A4MP). Møller-Plesset perturbation theory (MP2/6-31G(d) and MP2/6-31++G(d,p) methods were used to investigate the structure and vibrational analysis of (2A3MP) and (2A4MP). Tautomerization of 2A4MP was investigated by Density Functional Theory (DFT/B3LYP) method in the gas phase. For the first time, all tautomers including NH → NH conversions as well as those usually omitted, NH → CH and CH → CH, were considered. The canonical structure (2A4MP1) is the most stable tautomer. It is 13.60 kcal/mole more stable than the next (2A4MP2). Transition state structures of pyramidal N inversion and proton transfer were computed at B3LYP/6-311++G(d,p). Barrier to transition state of hydrogen proton transfer is calculated as 44.81 kcal/mol. Transition state activation energy of pyramidal inversion at amino N is found to be 0.41 kcal/mol using the above method. Bond order and natural atomic charges were also calculated at the same level. The raman and FT-IR spectra of (2A3MP) and (2A4MP) were measured (4000-400 cm(-1)). The optimized molecular geometries, frequencies and vibrational bands intensity were calculated at ab initio (MP2) and DFT(B3LYP) levels of theory with 6-31G(d), 6-31++G(d,p) and 6-311++G(d,p) basis sets. The vibrational frequencies were compared with experimentally measured FT-IR and FT-Raman spectra. Reconsidering the vibrational analysis of (2A3MP) and (2A4MP) with more accurate FT-IR machine and highly accurate animation programs result in new improved vibrational assignments. Sophisticated quantum mechanics methods enable studying the transition state structure for different chemical systems.

Analysis of E2F factors during epidermal differentiation.

PubMed

Chang, Wing Y; Dagnino, Lina

2005-01-01

The multigene E2F family of transcription factors is central in the control of cell cycle progression. The expression and activity of E2F proteins is tightly regulated transcriptionally and posttranslationally as a function of the proliferation and differentiation status of the cell. In this chapter, we review protocols designed to determine E2F mRNA abundance in tissues by in situ hybridization techniques. The ability to culture primary epidermal keratinocytes and maintain them as either undifferentiated or terminally differentiated cells allows the biochemical and molecular characterization of changes in E2F expression and activity. Thus, we also discuss in detail methods to analyze E2F protein abundance by immunoblot and their ability to bind DNA in cultured cells using electrophoretic mobility shift assays.

Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.

PubMed

Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid

2015-04-28

Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.

Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

NASA Astrophysics Data System (ADS)

Anglin, J. R.; Schulz, A.

2017-01-01

Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

Why Are Buckyonions Round?

NASA Technical Reports Server (NTRS)

Bates, Kevin R.; Scuseria, Gustavo E.

1997-01-01

Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite carbon. However, theoretical models of large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations of round buckyonions and theoretical predictions of faceted icosahedral fullerenes.

First-Principles Study on the Gilbert Damping Constants of Transition Metal Alloys, Fe--Ni and Fe--Pt Systems

NASA Astrophysics Data System (ADS)

Sakuma, Akimasa

2012-08-01

We adapt the tight-binding linear muffin-tin orbital (TB-LMTO) method to the torque-correlation model for the Gilbert damping constant α and perform the first-principles calculation for disordered transition metal alloys, Fe--Ni and Fe--Pt systems, within the framework of the CPA. Quantitatively, the calculated α values are about one-half of the experimental values, whereas the variations in the Fermi level dependence of α are much larger than these discrepancies. As expected, we confirm in the (Fe--Ni)1-XPtX and FePt systems that Pt atoms certainly enhance α owing to their large spin--orbit coupling. For the disordered alloys, we find that α decreases with increasing chemical degree of order in a wide range.

Enhancement of thermoelectric figure of merit in zigzag graphene nanoribbons with periodic edge vacancies

NASA Astrophysics Data System (ADS)

Kolesnikov, D. V.; Sadykova, O. G.; Osipov, V. A.

2017-06-01

The influence of periodic edge vacancies and antidot arrays on the thermoelectric properties of zigzag graphene nanoribbons (ZGNRs) are investigated. Using Green’s function method, the tight-binding approximation for the electron Hamiltonian and the 4th nearest neighbor approximation for the phonon dynamical matrix, we calculate the Seebeck coefficient and the thermoelectric figure of merit. It is found that, at a certain periodic arrangement of vacancies on both edges of zigzag nanoribbon, a finite band gap opens and almost twofold degenerate energy levels appear. As a result, a marked increase in the Seebeck coefficient takes place. It is shown that an additional enhancement of the thermoelectric figure of merit can be achieved by a combination of periodic edge defects with an antidot array.

Dynamic docking and electron transfer between Zn-myoglobin and cytochrome b(5).

PubMed

Liang, Zhao-Xun; Nocek, Judith M; Huang, Kai; Hayes, Ryan T; Kurnikov, Igor V; Beratan, David N; Hoffman, Brian M

2002-06-19

We present a broad study of the effect of neutralizing the two negative charges of the Mb propionates on the interaction and electron transfer (ET) between horse Mb and bovine cyt b(5), through use of Zn-substituted Mb (ZnMb, 1) to study the photoinitiated reaction, ((3)ZnP)Mb + Fe(3+)cyt b(5) --> (ZnP)(+)Mb + Fe(2+)cyt b(5). The charge neutralization has been carried out both by replacing the Mb heme with zinc-deuteroporphyrin dimethylester (ZnMb(dme), 2), which replaces the charges by small neutral hydrophobic patches, and also by replacement with the newly prepared zinc-deuteroporphyrin diamide (ZnMb(diamide), 3), which converts the charged groups to neutral, hydrophilic ones. The effect of propionate neutralization on the conformation of the zinc-porphyrin in the Mb heme pocket has been studied by multinuclear NMR with an (15)N labeled zinc porphyrin derivative (ZnMb((15)N-diamide), 4). The rates of photoinitiated ET between the Mb's (1-3) and cyt b(5) have been measured over a range of pH values and ionic strengths. Isothermal titration calorimetry (ITC) and NMR methods have been used to independently investigate the effect of charge neutralization on Mb/b(5) binding. The neutralization of the two heme propionates of ZnMb by formation of the heme diester or, for the first time, the diamide increases the second-order rate constant of the ET reaction between ZnMb and cyt b(5) by as much as several 100-fold, depending on pH and ionic strength, while causing negligible changes in binding affinity. Brownian dynamic (BD) simulations and ET pathway calculations provide insight into the protein docking and ET process. The results support a new "dynamic docking" paradigm for protein-protein reactions in which numerous weakly bound conformations of the docked complex contribute to the binding of cyt b(5) to Mb and Hb, but only a very small subset of these are ET active, and this subset does not include the conformations most favorable for binding; the Mb surface is a large "target" with a small "bullseye" for the cyt b(5) "arrow". This paradigm differs sharply from the more familiar, "simple" docking within a single, or narrow range of conformations, where binding strength and ET reactivity increase in parallel. Likewise, it is distinct from, although complementary to, the well-known picture of conformational control of ET through "gating", or a related picture of "conformational coupling". The new model describes situations in which tight binding does not correlate with efficient ET reactivity, and explains how it is possible to modulate reactivity without changing affinity. Such "decoupling" of reactivity from binding clearly is of physiological relevance for the reduction of met-Mb in muscle and of met-Hb in a red cell, where tight binding of cyt b(5) to the high concentration of ferrous-Mb/Hb would prevent the cytochrome from finding and reducing the oxidized proteins; it likely is of physiological relevance in other situations, as well.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Structural mechanism of the ATP-induced dissociation of rigor myosin from actin

PubMed Central

Kühner, Sebastian; Fischer, Stefan

2011-01-01

Myosin is a true nanomachine, which produces mechanical force from ATP hydrolysis by cyclically interacting with actin filaments in a four-step cycle. The principle underlying each step is that structural changes in separate regions of the protein must be mechanically coupled. The step in which myosin dissociates from tightly bound actin (the rigor state) is triggered by the 30 Å distant binding of ATP. Large conformational differences between the crystal structures make it difficult to perceive the coupling mechanism. Energetically accessible transition pathways computed at atomic detail reveal a simple coupling mechanism for the reciprocal binding of ATP and actin. PMID:21518908

Equilibrium structure and atomic vibrations of Nin clusters

NASA Astrophysics Data System (ADS)

Borisova, Svetlana D.; Rusina, Galina G.

2017-12-01

The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

A new method of evaluating tight gas sands pore structure from nuclear magnetic resonance (NMR) logs

NASA Astrophysics Data System (ADS)

Xiao, Liang; Mao, Zhi-qiang; Xie, Xiu-hong

2016-04-01

Tight gas sands always display such characteristics of ultra-low porosity, permeability, high irreducible water, low resistivity contrast, complicated pore structure and strong heterogeneity, these make that the conventional methods are invalid. Many effective gas bearing formations are considered as dry zones or water saturated layers, and cannot be identified and exploited. To improve tight gas sands evaluation, the best method is quantitative characterizing rock pore structure. The mercury injection capillary pressure (MICP) curves are advantageous in predicting formation pore structure. However, the MICP experimental measurements are limited due to the environment and economy factors, this leads formation pore structure cannot be consecutively evaluated. Nuclear magnetic resonance (NMR) logs are considered to be promising in evaluating rock pore structure. Generally, to consecutively quantitatively evaluate tight gas sands pore structure, the best method is constructing pseudo Pc curves from NMR logs. In this paper, based on the analysis of lab experimental results for 20 core samples, which were drilled from tight gas sandstone reservoirs of Sichuan basin, and simultaneously applied for lab MICP and NMR measurements, the relationships of piecewise power function between nuclear magnetic resonance (NMR) transverse relaxation T2 time and pore-throat radius Rc are established. A novel method, which is used to transform NMR reverse cumulative curve as pseudo capillary pressure (Pc) curve is proposed, and the corresponding model is established based on formation classification. By using this model, formation pseudo Pc curves can be consecutively synthesized. The pore throat radius distribution, and pore structure evaluation parameters, such as the average pore throat radius (Rm), the threshold pressure (Pd), the maximum pore throat radius (Rmax) and so on, can also be precisely extracted. After this method is extended into field applications, several tight gas sandstone reservoirs are processed, and the predicted results are compared with core derived results. Good consistency between evaluated results with core derived results illustrates the dependability of the proposed method. Comparing with the previous methods, this presented model is much more theoretical, and the applicability is much improved. Combining with the evaluated results, our target tight gas sands are well evaluated, and many potential gas-bearing layers are effectively identified.

Dipole moments and solvatochromism of metal complexes: principle photophysical and theoretical approach.

PubMed

Loukova, Galina V; Milov, Alexey A; Vasiliev, Vladimir P; Minkin, Vladimir I

2016-07-21

For metal-based compounds, the ground- and excited-state dipole moments and the difference thereof are, for the first time, obtained both experimentally and theoretically using solvatochromic equations and DFT/B3LYP/QZVP calculations. The approach is suggested to be promising and easily accessible, and can be universal to elucidate the electronic properties of metal-based compounds.

DFT:B3LYP/3-21G theoretical insights on the confocal Raman experimental observations in skin dermis of healthy young, healthy elderly, and diabetic elderly women

NASA Astrophysics Data System (ADS)

Téllez Soto, Claudio Alberto; Pereira, Liliane; dos Santos, Laurita; Rajasekaran, Ramu; Fávero, Priscila; Martin, Airton Abrahão

2016-12-01

In the confocal Raman spectra of skin dermis, the band area in the spectral region of proline and hydroxyproline varies according to the age and health condition of the volunteers, classified as healthy young women, healthy elderly women, and diabetic elderly women. Another observation refers to the intensity variation and negative Raman shift of the amide I band. To understand these effects, we adopted a model system using the DFT/B3LYP:3-21G procedure, considering the amino acid chain formed by glycine, hydroxyproline, proline, and alanine, which interacts with two and six water molecules. Through these systems, polarizability variations were analyzed to correlate its values with the observed Raman intensities of the three groups of volunteers and to assign the vibrational spectra of the skin dermis. As a way to correlate other experimental trends, we propose a model of chemical reaction of water interchange between the bonding amino acids, in which water molecules are attached with glucose by hydrogen bonds. The theoretical results are in accordance with the observed experimental trends.