Tight-binding modeling and low-energy behavior of the semi-Dirac point.
Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E
2009-07-03
We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.
1977-01-01
An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.; Ring, D.M.
We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less
NASA Astrophysics Data System (ADS)
Humeniuk, Alexander; Mitrić, Roland
2017-12-01
A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.
Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas
2015-07-14
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.
Actinide electronic structure and atomic forces
NASA Astrophysics Data System (ADS)
Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.
2000-07-01
We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids
Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas
2015-06-26
A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less
Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN
NASA Astrophysics Data System (ADS)
Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro
2017-03-01
Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.
NASA Astrophysics Data System (ADS)
Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard
2014-03-01
Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.
Tight-binding calculation of single-band and generalized Wannier functions of graphene
NASA Astrophysics Data System (ADS)
Ribeiro, Allan Victor; Bruno-Alfonso, Alexys
Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.
Design of graphene nanoparticle undergoing axial compression: quantum study
NASA Astrophysics Data System (ADS)
Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.
2011-03-01
We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.
Microwave emulations and tight-binding calculations of transport in polyacetylene
NASA Astrophysics Data System (ADS)
Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.
2017-01-01
A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.
NASA Astrophysics Data System (ADS)
Jahangiri, Soran; Mosey, Nicholas J.
2018-01-01
Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu
2016-10-15
Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.
NASA Astrophysics Data System (ADS)
Li, L. L.; Partoens, B.; Peeters, F. M.
2018-04-01
By taking account of the electric-field-induced charge screening, a self-consistent calculation within the framework of the tight-binding approach is employed to obtain the electronic band structure of gated multilayer phosphorene and the charge densities on the different phosphorene layers. We find charge density and screening anomalies in single-gated multilayer phosphorene and electron-hole bilayers in dual-gated multilayer phosphorene. Due to the unique puckered lattice structure, both intralayer and interlayer charge screenings are important in gated multilayer phosphorene. We find that the electric-field tuning of the band structure of multilayer phosphorene is distinctively different in the presence and absence of charge screening. For instance, it is shown that the unscreened band gap of multilayer phosphorene decreases dramatically with increasing electric-field strength. However, in the presence of charge screening, the magnitude of this band-gap decrease is significantly reduced and the reduction depends strongly on the number of phosphorene layers. Our theoretical results of the band-gap tuning are compared with recent experiments and good agreement is found.
Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A
2010-01-01
Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less
NASA Astrophysics Data System (ADS)
Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam
2016-12-01
Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.
Spin structure of electron subbands in (110)-grown quantum wells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nestoklon, M. O.; Tarasenko, S. A.; Jancu, J.-M.
We present the theory of fine structure of electron states in symmetric and asymmetric zinc-blende-type quantum wells with the (110) crystallographic orientation. By combining the symmetry analysis, sp{sup 3}d{sup 5}s* tight-binding method, and envelope-function approach we obtain quantitative description of in-plane wave vector, well width and applied electric field dependencies of the zero-magnetic-field spin splitting of electron subbands and extract spin-orbit-coupling parameters.
Electronic Structure and Properties of Deformed Carbon Nanotubes
NASA Technical Reports Server (NTRS)
Yang, Liu; Arnold, Jim (Technical Monitor)
2001-01-01
A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.
NASA Astrophysics Data System (ADS)
Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai
2017-07-01
We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.
Communication: Charge-population based dispersion interactions for molecules and materials
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.
2016-04-21
We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less
Tight binding simulation study on zigzag single-walled carbon nanotubes
NASA Astrophysics Data System (ADS)
Sharma, Deepa; Jaggi, Neena; Gupta, Vishu
2018-01-01
Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.
NASA Astrophysics Data System (ADS)
Jałochowski, M.; Kwapiński, T.; Łukasik, P.; Nita, P.; Kopciuszyński, M.
2016-07-01
Structural and electron transport properties of multiple Pb atomic chains fabricated on the Si(5 5 3)-Au surface are investigated using scanning tunneling spectroscopy, reflection high electron energy diffraction, angular resolved photoemission electron spectroscopy and in situ electrical resistance. The study shows that Pb atomic chains growth modulates the electron band structure of pristine Si(5 5 3)-Au surface and hence changes its sheet resistivity. Strong correlation between chains morphology, electron band structure and electron transport properties is found. To explain experimental findings a theoretical tight-binding model of multiple atomic chains interacting on effective substrate is proposed.
Lee, Stephen; Hoffmann, Roald
2002-05-01
Transition metal elements, alloys, and intermetallic compounds often adopt the body centered cubic (bcc) and face centered cubic (fcc) structures. By comparing quantitative density functional with qualitative tight-binding calculations, we analyze the electronic factors which make the bcc and fcc structures energetically favorable. To do so, we develop a tight-binding function, DeltaE(star), a function that measures the energetic effects of transferring electrons within wave vector stars. This function allows one to connect distortions in solids to the Jahn-Teller effect in molecules and to provide an orbital perspective on structure determining deformations in alloys. We illustrate its use by considering first a two-dimensional square net. We then turn to three-dimensional fcc and bcc structures, and distortions of these. Using DeltaE(star), we rationalize the differences in energy of these structures. We are able to deduce which orbitals are responsible for instabilities in seven to nine valence electron per atom (e(-)/a) bcc systems and five and six e(-)/a fcc structures. Finally we demonstrate that these results account for the bcc and fcc type structures found in both the elements and binary intermetallic compounds of group 4 through 9 transition metal atoms. The outline of a theory of metal structure deformations based on loss of point group operation rather than translational symmetry is presented.
Non-collinear magnetism with analytic Bond-Order Potentials
NASA Astrophysics Data System (ADS)
Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf
2015-03-01
The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.
Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre
2018-01-18
Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.
Multi-scale predictive modeling of nano-material and realistic electron devices
NASA Astrophysics Data System (ADS)
Palaria, Amritanshu
Among the challenges faced in further miniaturization of electronic devices, heavy influence of the detailed atomic configuration of the material(s) involved, which often differs significantly from that of the bulk material(s), is prominent. Device design has therefore become highly interrelated with material engineering at the atomic level. This thesis aims at outlining, with examples, a multi-scale simulation procedure that allows one to integrate material and device aspects of nano-electronic design to predict behavior of novel devices with novel material. This is followed in four parts: (1) An approach that combines a higher time scale reactive force field analysis with density functional theory to predict structure of new material is demonstrated for the first time for nanowires. Novel stable structures for very small diameter silicon nanowires are predicted. (2) Density functional theory is used to show that the new nanowire structures derived in 1 above have properties different from diamond core wires even though the surface bonds in some may be similar to the surface of bulk silicon. (3) Electronic structure of relatively large-scale germanium sections of realistically strained Si/strained Ge/ strained Si nanowire heterostructures is computed using empirical tight binding and it is shown that the average non-homogeneous strain in these structures drives their interesting non-conventional electronic characteristics such as hole effective masses which decrease as the wire cross-section is reduced. (4) It is shown that tight binding, though empirical in nature, is not necessarily limited to the material and atomic structure for which the parameters have been empirically derived, but that simple changes may adapt the derived parameters to new bond environments. Si (100) surface electronic structure is obtained from bulk Si parameters.
DFTB Parameters for the Periodic Table: Part 1, Electronic Structure.
Wahiduzzaman, Mohammad; Oliveira, Augusto F; Philipsen, Pier; Zhechkov, Lyuben; van Lenthe, Erik; Witek, Henryk A; Heine, Thomas
2013-09-10
A parametrization scheme for the electronic part of the density-functional based tight-binding (DFTB) method that covers the periodic table is presented. A semiautomatic parametrization scheme has been developed that uses Kohn-Sham energies and band structure curvatures of real and fictitious homoatomic crystal structures as reference data. A confinement potential is used to tighten the Kohn-Sham orbitals, which includes two free parameters that are used to optimize the performance of the method. The method is tested on more than 100 systems and shows excellent overall performance.
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...
2016-09-09
In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing
In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less
Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus
2016-10-11
In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.
Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure
NASA Astrophysics Data System (ADS)
Brockt, C.; Jeckelmann, E.
2017-02-01
We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.
Atomistic Tight-Binding Theory Applied to Structural and Optical Properties of Silicon Nanodisks
NASA Astrophysics Data System (ADS)
Sukkabot, Worasak
2018-05-01
The use of ultrathin crystalline silicon (c-Si) wafers in solar cells necessitates a highly effective light absorber to compensate for poor light absorption. One route to overcoming this problem is to use a periodic array of Si nanodisks on ultrathin c-Si. In the present manuscript, we numerically investigate the effects of the geometrical parameters of the Si nanodisks, including disk diameter (D) and length (L), on the structural and optical properties, using atomistic tight-binding theory. These computations confirm that the electronic structure and optical properties are sensitive to the structural parameters. As the disk diameter and length increase, the single-electron energies decrease, and the single-hole energies increase. These calculations also reveal that, because of the quantum confinement effect, the optical band gaps gradually decrease independently of the increasing disk diameter and length. The optical spectra can be tuned across the visible region by varying the disk diameter and length, which is a useful feature for optimizing light absorption in solar cell applications. As the disk diameter and length increased, the optical intensities also increased; however, the atomistic electron-hole interactions and ground electron-hole wave function overlap progressively decreased. The ground electron-hole wave function overlap, Stokes shift, and fine structure splitting decreased as the disk diameter and length were increased. Thus, Si nanodisks with a large diameter and length might be a suitable candidate source of entangled photons. The Si nanodisks in this study also show promise for applications to solar cells based on ultrathin c-Si wafers.
Fullerene Derived Molecular Electronic Devices
NASA Technical Reports Server (NTRS)
Menon, Madhu; Srivastava, Deepak; Saini, Subbash
1998-01-01
The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale electronic devices. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal grapheme sheet, more complex joints require other mechanisms. In this work we explore structural and electronic properties of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme.
Tight-Binding study of Boron structures
NASA Astrophysics Data System (ADS)
McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.
2014-10-01
We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.
NASA Astrophysics Data System (ADS)
Venkataraman, Vijay Shankar
The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.
NASA Astrophysics Data System (ADS)
Tretiak, Sergei
2014-03-01
The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.
NASA Astrophysics Data System (ADS)
Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.
2018-07-01
A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2014-02-01
We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.
Atomic Structure and Properties of Extended Defects in Silicon
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buczko, R.; Chisholm, M.F.; Kaplan, T.
1998-10-15
The Z-contrast technique represents a new approach to high-resolution electron microscopy allowing for the first time incoherent imaging of materials on the atomic scale. The key advantages of the technique, an intrinsically higher resolution limit and directly interpretable, compositionally sensitive imaging, allow a new level of insight into the atomic configurations of extended defects in silicon. This experimental technique has been combined with theoretical calculations (a combination of first principles, tight binding, and classical methods) to extend this level of insight by obtaining the energetic and electronic structure of the defects.
NASA Astrophysics Data System (ADS)
Giro, R.; Caldas, M. J.; Galvão, D. S.
The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.
Magnetic susceptibilities of actinide 3d-metal intermetallic compounds
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.
1988-04-15
We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.
Computational predictions of zinc oxide hollow structures
NASA Astrophysics Data System (ADS)
Tuoc, Vu Ngoc; Huan, Tran Doan; Thao, Nguyen Thi
2018-03-01
Nanoporous materials are emerging as potential candidates for a wide range of technological applications in environment, electronic, and optoelectronics, to name just a few. Within this active research area, experimental works are predominant while theoretical/computational prediction and study of these materials face some intrinsic challenges, one of them is how to predict porous structures. We propose a computationally and technically feasible approach for predicting zinc oxide structures with hollows at the nano scale. The designed zinc oxide hollow structures are studied with computations using the density functional tight binding and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications.
Electronic band structure study of colossal magnetoresistance in Tl 2Mn 2O 7
NASA Astrophysics Data System (ADS)
Seo, D.-K.; Whangbo, M.-H.; Subramanian, M. A.
1997-02-01
The electronic structure of Tl 2Mn 2O 7 was examined by performing tight binding band calculations. The overlap between the Mn t 2g- and Tl 6 s-block bands results in a partial filling of the Tl 6 s-block bands. The associated Fermi surface consists of 12 cigar-shape electron pockets with each electron pocket about {1}/{1000} of the first Brillouin zone in size. The Tl 6 s-block bands have orbital contributions from the Mn atoms, and the carrier density is very low. These are important for the occurrence of a colossal magnetoresistance in Tl 2Mn 2O 7.
Effects of Structural Deformation and Tube Chirality on Electronic Conductance of Carbon Nanotubes
NASA Technical Reports Server (NTRS)
Svizhenko, Alexei; Maiti, Amitesh; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)
2002-01-01
A combination of large scale classical force-field (UFF), density functional theory (DFT), and tight-binding Green's function transport calculations is used to study the electronic properties of carbon nanotubes under the twist, bending, and atomic force microscope (AFM)-tip deformation. We found that in agreement with experiment a significant change in electronic conductance can be induced by AFM-tip deformation of metallic zigzag tubes and by twist deformation of armchair tubes. The effect is explained in terms of bandstructure change under deformation.
Tight-binding calculation studies of vacancy and adatom defects in graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing
2016-02-19
Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less
NASA Astrophysics Data System (ADS)
Sukkabot, Worasak
2017-02-01
Nontoxic, maintainable and cost-effective group IV semiconductors are gorgeous for an expansive range of electronic and optoelectronic applications, even though the presence of the indirect band gap obstructs the optical performance. However, band structures can be modified from indirect to direct band gaps by constructing the nanostructures or by alloying with tin (Sn) material. In the study presented here, I investigate the impact of ion-centred types, Sn compositions and dimensions on the electronic structures and optical properties in Ge1-xSnx diamond cubic nanocrystals of the experimentally synthesized Sn contents and diameters using the atomistic tight-binding theory (TB) in the conjunction with the configuration interaction description (CI). The analysis of the mechanism suggests that the physical properties are mainly sensitive with ion-centred types (anion (a) and cation (c)), Sn compositions and dimensions of Ge1-xSnx diamond cubic nanocrystals. The reduction of optical band gaps is reported with the increasing diameters and Sn alloying contents. The visible spectral range is obtained allowing for the applications in bio imaging and chemical sensing. The optical band gaps based on tight-binding calculations are in close agreement with the experimental data for Ge1-xSnx nanocrystals with diameter of 2.1 nm, while for Ge1-xSnx nanocrystals with diameter of 2.7 nm there is a discrepancy of 0.4 eV with experimental results and first-principles calculations. An improvement in the luminescence properties of such Ge1-xSnx nanocrystals becomes possible in the presence of the Sn contents. The electron-hole coulomb interaction is reduced with the increasing Sn components, while the electron-hole exchange interaction is increased with the increasing Sn contents. In addition, I have to point out an astonishing phenomenon, stokes shift and fine structure splitting, with the aim for the realization of the entangled source. The stokes shift and fine structure splitting are enhanced with the increasing Sn contents and decreasing diameters as can be elucidated by the trend of ground electron-hole wave function overlaps. Ge1-xSnx nanocrystal with Sn-free content and large size is the best candidate to be a source of entangled photon pairs. Finally, the combinations of direct band gap character and broad tunable visible spectra advise the promise for use in optoelectronic devices as well as solar cells.
NASA Astrophysics Data System (ADS)
Sharma, Basant Lal
2018-05-01
Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.
NASA Astrophysics Data System (ADS)
Sukkabot, Worasak
2018-05-01
A study of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals is carried out using atomistic tight-binding theory and the configuration interaction method to provide information for applications in bioimaging, biolabeling, display devices and near-infrared electronic instruments. The calculations yield the dependences of the internal and external passivated shells on the natural behaviours of CdTe/CdX (X=S and Se)/ZnS core/shell/shell nanocrystals. The reduction of the optical band gaps is observed with increasing numbers of monolayers in the external ZnS shell due to quantum confinement. Interestingly, the optical band gaps of CdTe/CdS/ZnS core/shell/shell nanocrystals are greater than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. In the presence of an external ZnS-coated shell, electron-hole wave function overlaps, oscillation strengths, ground-state exchange energies and Stokes shift are improved, whereas ground-state coulomb energies and fine-structure splitting are reduced. The oscillation strengths, Stokes shift and fine-structure splitting are reduced with the increase in external ZnS shell thickness. The oscillation strengths, Stokes shift and fine-structure splitting of CdTe/CdS/ZnS core/shell/shell nanocrystals are larger than those of CdTe/CdSe/ZnS core/shell/shell nanocrystals. Reduction of the atomistic electron-hole interactions is observed with increasing external ZnS shell size. The strong electron-hole interactions are more probed in CdTe/CdS/ZnS core/shell/shell nanocrystals than in CdTe/CdSe/ZnS core/shell/shell nanocrystals.
NASA Astrophysics Data System (ADS)
Panda, Saswati; Sahoo, D. D.; Rout, G. C.
2018-04-01
We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.
NASA Astrophysics Data System (ADS)
Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.
2017-05-01
We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.
Electronic properties of long DNA nanowires in dry and wet conditions
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek
2015-11-01
The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.
Inorganic nanotubes and fullerenes . Structure and properties of hypothetical phosphorus fullerenes
NASA Astrophysics Data System (ADS)
Seifert, G.; Heine, T.; Fowler, P. W.
The possibility of stable non-carbon fullerenes is discussed for the case of phosphorus fullerene-like cage structures. On the basis of Density Functional Tight Binding calculations it is shown that many such cages correspond to metastable structures, but with increasing nuclearity become less stable with respect to separate molecular P4 units. Stability rules, known for carbon fullerenes, such as the ``isolated pentagon rule'', do not reflect the different electronic and steric requirements of the phosphorus atom. The computational results tend to rule out phosphorus fullerenes.
Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR
Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.
2001-01-01
The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695
Computational predictions of the new Gallium nitride nanoporous structures
NASA Astrophysics Data System (ADS)
Lien, Le Thi Hong; Tuoc, Vu Ngoc; Duong, Do Thi; Thu Huyen, Nguyen
2018-05-01
Nanoporous structural prediction is emerging area of research because of their advantages for a wide range of materials science and technology applications in opto-electronics, environment, sensors, shape-selective and bio-catalysis, to name just a few. We propose a computationally and technically feasible approach for predicting Gallium nitride nanoporous structures with hollows at the nano scale. The designed porous structures are studied with computations using the density functional tight binding (DFTB) and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications. Their stability is discussed by means of the free energy computed within the lattice-dynamics approach. Our calculations also indicate that all the reported hollow structures are wide band gap semiconductors in the same fashion with their parent’s bulk stable phase. The electronic band structures of these nanoporous structures are finally examined in detail.
NASA Astrophysics Data System (ADS)
Mašek, J.
1991-05-01
A comparative study of the electronic structure of (Zn,Co)Se and (Zn,Mn)Se is done by using a tight-binding version of the coherent potential approximation. The densities of states, relevant for a photoemission experiment, are calculated for a magnetically disordered phase. The exchange constant Jpd is obtained from the splitting of the valence band top in the ferromagnetic phase of the mixed crystal; Jdd is estimated from the energy of a spin reversal. We explain the large exchange constant in the Co-based systems as a result of efficient hybridization of the d-states with the valence band.
NASA Technical Reports Server (NTRS)
Bates, Kevin R.; Daniels, Andrew D.; Scuseria, Gustavo E.
1998-01-01
We report a comparison of two linear-scaling methods which avoid the diagonalization bottleneck of traditional electronic structure algorithms. The Chebyshev expansion method (CEM) is implemented for carbon tight-binding calculations of large systems and its memory and timing requirements compared to those of our previously implemented conjugate gradient density matrix search (CG-DMS). Benchmark calculations are carried out on icosahedral fullerenes from C60 to C8640 and the linear scaling memory and CPU requirements of the CEM demonstrated. We show that the CPU requisites of the CEM and CG-DMS are similar for calculations with comparable accuracy.
NASA Astrophysics Data System (ADS)
Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan
2018-01-01
The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.
Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.
Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N
2015-06-09
The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.
A Model for Predicting Thermoelectric Properties of Bi2Te3
NASA Technical Reports Server (NTRS)
Lee, Seungwon; VonAllmen, Paul
2009-01-01
A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.
Tailoring Dirac Fermions in Molecular Graphene
NASA Astrophysics Data System (ADS)
Gomes, Kenjiro K.; Mar, Warren; Ko, Wonhee; Camp, Charlie D.; Rastawicki, Dominik K.; Guinea, Francisco; Manoharan, Hari C.
2012-02-01
The dynamics of electrons in solids is tied to the band structure created by a periodic atomic potential. The design of artificial lattices, assembled through atomic manipulation, opens the door to engineer electronic band structure and to create novel quantum states. We present scanning tunneling spectroscopic measurements of a nanoassembled honeycomb lattice displaying a Dirac fermion band structure. The artificial lattice is created by atomic manipulation of single CO molecules with the scanning tunneling microscope on the surface of Cu(111). The periodic potential generated by the assembled CO molecules reshapes the band structure of the two-dimensional electron gas, present as a surface state of Cu(111), into a ``molecular graphene'' system. We create local defects in the lattice to observe the quasiparticle interference patterns that unveil the underlying band structure. We present direct comparison between the tunneling data, first-principles calculations of the band structure, and tight-binding models.
NASA Astrophysics Data System (ADS)
Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin
2016-01-01
Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN-, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane.
NASA Astrophysics Data System (ADS)
Kar, J. K.; Panda, Saswati; Rout, G. C.
2017-05-01
We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.
NASA Astrophysics Data System (ADS)
Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki
2018-06-01
A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.
Temperature-dependent band structure of SrTiO3 interfaces
NASA Astrophysics Data System (ADS)
Raslan, Amany; Lafleur, Patrick; Atkinson, W. A.
2017-02-01
We build a theoretical model for the electronic properties of the two-dimensional (2D) electron gas that forms at the interface between insulating SrTiO3 and a number of polar cap layers, including LaTiO3, LaAlO3, and GdTiO3. The model treats conduction electrons within a tight-binding approximation and the dielectric polarization via a Landau-Devonshire free energy that incorporates strontium titanate's strongly nonlinear, nonlocal, and temperature-dependent dielectric response. The self-consistent band structure comprises a mix of quantum 2D states that are tightly bound to the interface and quasi-three-dimensional (3D) states that extend hundreds of unit cells into the SrTiO3 substrate. We find that there is a substantial shift of electrons away from the interface into the 3D tails as temperature is lowered from 300 K to 10 K. This shift is least important at high electron densities (˜1014cm-2 ) but becomes substantial at low densities; for example, the total electron density within 4 nm of the interface changes by a factor of two for 2D electron densities ˜1013cm-2 . We speculate that the quasi-3D tails form the low-density high-mobility component of the interfacial electron gas that is widely inferred from magnetoresistance measurements.
NASA Astrophysics Data System (ADS)
Korol, Roman; Kilgour, Michael; Segal, Dvira
2018-03-01
We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.
Generalized virial theorem for massless electrons in graphene and other Dirac materials
NASA Astrophysics Data System (ADS)
Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.
2016-05-01
The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.
Spin textures on general surfaces of the correlated topological insulator SmB6
NASA Astrophysics Data System (ADS)
Baruselli, Pier Paolo; Vojta, Matthias
2016-05-01
Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.
Carbon Nanotubes: Molecular Electronic Components
NASA Technical Reports Server (NTRS)
Srivastava, Deepak; Saini, Subhash; Menon, Madhu
1997-01-01
The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale molecular electronic networks. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal graphene sheet, more complex joints require other mechanisms. In this work we explore structural characteristics of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme. The study of pi-electron local densities of states (LDOS) of these junctions reveal many interesting features, most prominent among them being the defect-induced states in the gap.
Electronic topological transitions in Zn under compression
NASA Astrophysics Data System (ADS)
Kechin, Vladimir V.
2001-01-01
The electronic structure of hcp Zn under pressure up to 10 GPa has been calculated self-consistently by means of the scalar relativistic tight-binding linear muffin-tin orbital method. The calculations show that three electronic topological transitions (ETT's) occur in Zn when the c/a axial ratio diminishes under compression. One transition occurs at c/a~=1.82 when the ``needles'' appear around the symmetry point K of the Brillouin zone. The other two transitions occur at c/a~=3, when the ``butterfly'' and ``cigar'' appear simultaneously both around the L point. It has been shown that these ETT's are responsible for a number of anomalies observed in Zn at compression.
Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B
2016-11-04
The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.
NASA Astrophysics Data System (ADS)
Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare
2016-02-01
We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.
NASA Astrophysics Data System (ADS)
Kaneko, Tatsuya; Ohta, Yukinori; Yunoki, Seiji
2018-04-01
We investigate the microscopic mechanisms of the charge-density-wave (CDW) formation in a monolayer TiSe2 using a realistic multiorbital d -p model with electron-phonon coupling and intersite Coulomb (excitonic) interactions. First, we estimate the tight-binding bands of Ti 3 d and Se 4 p orbitals in the monolayer TiSe2 on the basis of the first-principles band-structure calculations. We thereby show orbital textures of the undistorted band structure near the Fermi level. Next, we derive the electron-phonon coupling using the tight-binding approximation and show that the softening occurs in the transverse phonon mode at the M point of the Brillouin zone. The stability of the triple-q CDW state is thus examined to show that the transverse phonon modes at the M1, M2, and M3 points are frozen simultaneously. Then, we introduce the intersite Coulomb interactions between the nearest-neighbor Ti and Se atoms that lead to the excitonic instability between the valence Se 4 p and conduction Ti 3 d bands. Treating the intersite Coulomb interactions in the mean-field approximation, we show that the electron-phonon and excitonic interactions cooperatively stabilize the triple-q CDW state in TiSe2. We also calculate a single-particle spectrum in the CDW state and reproduce the band folding spectra observed in photoemission spectroscopies. Finally, to clarify the nature of the CDW state, we examine the electronic charge density distribution and show that the CDW state in TiSe2 is of a bond type and induces a vortexlike antiferroelectric polarization in the kagome network of Ti atoms.
Heptagraphene: Tunable dirac cones in a graphitic structure
Lopez-Bezanilla, Alejandro; Martin, Ivar; Littlewood, Peter B.
2016-09-13
Here, we predict the existence and dynamical stability of heptagraphene, a new graphitic structure formed of rings of 10 carbon atoms bridged by carbene groups yielding seven-membered rings. Despite the rectangular unit cell, the band structure is topologically equivalent to that of strongly distorted graphene. Density-functional-theory calculations demonstrate that heptagraphene has Dirac cones on symmetry lines that are robust against biaxial strain but which open a gap under shear. At high deformation values bond reconstructions lead to different electronic band arrangements in dynamically stable configurations. Within a tight-binding framework this richness of the electronic behavior is identified as a directmore » consequence of the symmetry breaking within the cell which, unlike other graphitic structures, leads to band gap opening. A combined approach of chemical and physical modification of graphene unit cell unfurls the opportunity to design carbon-based systems in which one aims to tune an electronic band gap.« less
Structural basis for cellobiose dehydrogenase action during oxidative cellulose degradation
NASA Astrophysics Data System (ADS)
Tan, Tien-Chye; Kracher, Daniel; Gandini, Rosaria; Sygmund, Christoph; Kittl, Roman; Haltrich, Dietmar; Hällberg, B. Martin; Ludwig, Roland; Divne, Christina
2015-07-01
A new paradigm for cellulose depolymerization by fungi focuses on an oxidative mechanism involving cellobiose dehydrogenases (CDH) and copper-dependent lytic polysaccharide monooxygenases (LPMO); however, mechanistic studies have been hampered by the lack of structural information regarding CDH. CDH contains a haem-binding cytochrome (CYT) connected via a flexible linker to a flavin-dependent dehydrogenase (DH). Electrons are generated from cellobiose oxidation catalysed by DH and shuttled via CYT to LPMO. Here we present structural analyses that provide a comprehensive picture of CDH conformers, which govern the electron transfer between redox centres. Using structure-based site-directed mutagenesis, rapid kinetics analysis and molecular docking, we demonstrate that flavin-to-haem interdomain electron transfer (IET) is enabled by a haem propionate group and that rapid IET requires a closed CDH state in which the propionate is tightly enfolded by DH. Following haem reduction, CYT reduces LPMO to initiate oxygen activation at the copper centre and subsequent cellulose depolymerization.
NASA Astrophysics Data System (ADS)
Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius
2013-07-01
We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.
NASA Astrophysics Data System (ADS)
Ferdous, Rifat; Rahman, Rajib; Klimeck, Gerhard
2014-03-01
Silicon quantum dots are promising candidates for solid-state quantum computing due to the long spin coherence times in silicon, arising from small spin-orbit interaction and a nearly spin free host lattice. However, the conduction band valley degeneracy adds an additional degree of freedom to the electronic structure, complicating the encoding and operation of qubits. Although the valley and the orbital indices can be uniquely identified in an ideal silicon quantum dot, atomic-scale disorder mixes valley and orbital states in realistic dots. Such valley-orbit hybridization, strongly influences the inter-dot tunnel rates.Using a full-band atomistic tight-binding method, we analyze the effect of atomic-scale interface disorder in a silicon double quantum dot. Fourier transform of the tight-binding wavefunctions helps to analyze the effect of disorder on valley-orbit hybridization. We also calculate and compare inter-dot inter-valley and intra-valley tunneling, in the presence of realistic disorder, such as interface tilt, surface roughness, alloy disorder, and interface charges. The method provides a useful way to compute electronic states in realistically disordered systems without any posteriori fitting parameters.
Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin
2016-01-01
Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN−, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane. PMID:26817826
Larsen, Ross E.
2016-04-12
In this study, we introduce two simple tight-binding models, which we call fragment frontier orbital extrapolations (FFOE), to extrapolate important electronic properties to the polymer limit using electronic structure calculations on only a few small oligomers. In particular, we demonstrate by comparison to explicit density functional theory calculations that for long oligomers the energies of the highest occupied molecular orbital (HOMO), the lowest unoccupied molecular orbital (LUMO), and of the first electronic excited state are accurately described as a function of number of repeat units by a simple effective Hamiltonian parameterized from electronic structure calculations on monomers, dimers and, optionally,more » tetramers. For the alternating copolymer materials that currently comprise some of the most efficient polymer organic photovoltaic devices one can use these simple but rigorous models to extrapolate computed properties to the polymer limit based on calculations on a small number of low-molecular-weight oligomers.« less
Doping Scheme in Atomic Chain Electronics
NASA Technical Reports Server (NTRS)
Toshishige, Yamada
1997-01-01
Due to the dramatic reduction in MOS size, there appear many unwanted effects. In these small devices, the number of dopant atoms in the channel is not macroscopic and electrons may suffer significantly different scattering from device to device since the spatial distribution of dopant atoms is no longer regarded as continuous. This prohibits integration, while it is impossible to control such dopant positions within atomic scale. A fundamental solution is to create electronics with simple but atomically precise structures, which could be fabricated with recent atom manipulation technology. All the constituent atoms are placed as planned, and then the device characteristics are deviation-free, which is mandatory for integration. Atomic chain electronics belongs to this category. Foreign atom chains or arrays form devices, and they are placed on the atomically flat substrate surface. We can design the band structure and the resultant Fermi energy of these structures by manipulating the lattice constant. Using the tight-binding theory with universal parameters, it has been predicted that isolated Si chains and arrays are metallic, Mg chains are insulating, and Mg arrays have metallic and insulating phases [1]. The transport properties along a metallic chain have been studied, emphasizing the role of the contact to electrodes [2]. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along die chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of pant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.
Hohl, Michael; Hürlimann, Lea M; Böhm, Simon; Schöppe, Jendrik; Grütter, Markus G; Bordignon, Enrica; Seeger, Markus A
2014-07-29
ATP binding cassette (ABC) transporters mediate vital transport processes in every living cell. ATP hydrolysis, which fuels transport, displays positive cooperativity in numerous ABC transporters. In particular, heterodimeric ABC exporters exhibit pronounced allosteric coupling between a catalytically impaired degenerate site, where nucleotides bind tightly, and a consensus site, at which ATP is hydrolyzed in every transport cycle. Whereas the functional phenomenon of cooperativity is well described, its structural basis remains poorly understood. Here, we present the apo structure of the heterodimeric ABC exporter TM287/288 and compare it to the previously solved structure with adenosine 5'-(β,γ-imido)triphosphate (AMP-PNP) bound at the degenerate site. In contrast to other ABC exporter structures, the nucleotide binding domains (NBDs) of TM287/288 remain in molecular contact even in the absence of nucleotides, and the arrangement of the transmembrane domains (TMDs) is not influenced by AMP-PNP binding, a notion confirmed by double electron-electron resonance (DEER) measurements. Nucleotide binding at the degenerate site results in structural rearrangements, which are transmitted to the consensus site via two D-loops located at the NBD interface. These loops owe their name from a highly conserved aspartate and are directly connected to the catalytically important Walker B motif. The D-loop at the degenerate site ties the NBDs together even in the absence of nucleotides and substitution of its aspartate by alanine is well-tolerated. By contrast, the D-loop of the consensus site is flexible and the aspartate to alanine mutation and conformational restriction by cross-linking strongly reduces ATP hydrolysis and substrate transport.
Conductance of three-terminal molecular bridge based on tight-binding theory
NASA Astrophysics Data System (ADS)
Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada
2005-05-01
The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.
NASA Astrophysics Data System (ADS)
Lei, Jie
2011-03-01
In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.
Modeling Magnetic Properties in EZTB
NASA Technical Reports Server (NTRS)
Lee, Seungwon; vonAllmen, Paul
2007-01-01
A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.
Tight-binding molecular-dynamics study of point defects in GaAs
NASA Astrophysics Data System (ADS)
Seong, Hyangsuk; Lewis, Laurent J.
1995-08-01
Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.
NASA Astrophysics Data System (ADS)
Feng, Baojie; Sugino, Osamu; Liu, Ro-Ya; Zhang, Jin; Yukawa, Ryu; Kawamura, Mitsuaki; Iimori, Takushi; Kim, Howon; Hasegawa, Yukio; Li, Hui; Chen, Lan; Wu, Kehui; Kumigashira, Hiroshi; Komori, Fumio; Chiang, Tai-Chang; Meng, Sheng; Matsuda, Iwao
2017-03-01
Honeycomb structures of group IV elements can host massless Dirac fermions with nontrivial Berry phases. Their potential for electronic applications has attracted great interest and spurred a broad search for new Dirac materials especially in monolayer structures. We present a detailed investigation of the β12 sheet, which is a borophene structure that can form spontaneously on a Ag(111) surface. Our tight-binding analysis revealed that the lattice of the β12 sheet could be decomposed into two triangular sublattices in a way similar to that for a honeycomb lattice, thereby hosting Dirac cones. Furthermore, each Dirac cone could be split by introducing periodic perturbations representing overlayer-substrate interactions. These unusual electronic structures were confirmed by angle-resolved photoemission spectroscopy and validated by first-principles calculations. Our results suggest monolayer boron as a new platform for realizing novel high-speed low-dissipation devices.
OLIFE: Tight Binding Code for Transmission Coefficient Calculation
NASA Astrophysics Data System (ADS)
Mijbil, Zainelabideen Yousif
2018-05-01
A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.
Computational Nanotechnology Program
NASA Technical Reports Server (NTRS)
Scuseria, Gustavo E.
1997-01-01
The objectives are: (1) development of methodological and computational tool for the quantum chemistry study of carbon nanostructures and (2) development of the fundamental understanding of the bonding, reactivity, and electronic structure of carbon nanostructures. Our calculations have continued to play a central role in understanding the outcome of the carbon nanotube macroscopic production experiment. The calculations on buckyonions offer the resolution of a long controversy between experiment and theory. Our new tight binding method offers increased speed for realistic simulations of large carbon nanostructures.
1996-12-01
gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic
Electronic Spectrum of Twisted Graphene Layers under Heterostrain
NASA Astrophysics Data System (ADS)
Huder, Loïc; Artaud, Alexandre; Le Quang, Toai; de Laissardière, Guy Trambly; Jansen, Aloysius G. M.; Lapertot, Gérard; Chapelier, Claude; Renard, Vincent T.
2018-04-01
We demonstrate that stacking layered materials allows a strain engineering where each layer is strained independently, which we call heterostrain. We combine detailed structural and spectroscopic measurements with tight-binding calculations to show that small uniaxial heterostrain suppresses Dirac cones and leads to the emergence of flat bands in twisted graphene layers (TGLs). Moreover, we demonstrate that heterostrain reconstructs, much more severely, the energy spectrum of TGLs than homostrain for which both layers are strained identically, a result which should apply to virtually all van der Waals structures opening exciting possibilities for straintronics with 2D materials.
Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions
NASA Astrophysics Data System (ADS)
Zhang, Shu-Hui; Yang, Wen
2018-01-01
We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.
Magneto-electronic properties of graphene nanoribbons in the spatially modulated electric field
NASA Astrophysics Data System (ADS)
Chen, S. C.; Wang, T. S.; Lee, C. H.; Lin, M. F.
2008-09-01
The Peierls tight-binding model with the nearest-neighbor interactions is used to calculate the magneto-electronic structure of graphene nanoribbons under a spatially modulated electric field along the y-axis. A uniform perpendicular magnetic field could make energy dispersions change into the quasi-Landau levels. Such levels are composed of the dispersionless and parabolic energy bands. A spatially modulated electric field would further induce a lot of oscillating parabolic bands with several band-edge states. It drastically modifies energy dispersions, alters subband spacings, destroys symmetry of energy spectrum about k=0, and changes features of band-edge states (number and energy). The above-mentioned magneto-electronic structures are directly reflected in density of states (DOS). The modulation effect changes shape, number, positions, and intensities of peaks in DOS. The predicted result could be tested by the optical measurements.
Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.
2015-01-01
Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613
Liu, Zhe; Jiang, Liwei; Zheng, Yisong
2015-02-04
By means of an appropriate wave function connection condition, we study the electronic structure of a line defect superlattice of graphene with the Dirac equation method. We obtain the analytical dispersion relation, which can simulate well the tight-binding numerical result about the band structure of the superlattice. Then, we generalize this theoretical method to study the electronic transmission through a potential barrier where multiple line defects are periodically patterned. We find that there exists a critical incident angle which restricts the electronic transmission through multiple line defects within a specific incident angle range. The critical angle depends sensitively on the potential barrier height, which can be modulated by a gate voltage. As a result, non-trivial transmissions of K and K' valley electrons are restricted, respectively, in two distinct ranges of the incident angle. Our theoretical result demonstrates that a gate voltage can act as a feasible measure to tune the valley polarization when electrons tunnel through multiple line defects.
Guiding, bending, and splitting of coupled defect surface modes in a surface-wave photonic crystal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Zhen; Gao, Fei; Zhang, Baile, E-mail: blzhang@ntu.edu.sg
2016-01-25
We experimentally demonstrate a type of waveguiding mechanism for coupled surface-wave defect modes in a surface-wave photonic crystal. Unlike conventional spoof surface plasmon waveguides, waveguiding of coupled surface-wave defect modes is achieved through weak coupling between tightly localized defect cavities in an otherwise gapped surface-wave photonic crystal, as a classical wave analogue of tight-binding electronic wavefunctions in solid state lattices. Wave patterns associated with the high transmission of coupled defect surface modes are directly mapped with a near-field microwave scanning probe for various structures including a straight waveguide, a sharp corner, and a T-shaped splitter. These results may find usemore » in the design of integrated surface-wave devices with suppressed crosstalk.« less
NASA Astrophysics Data System (ADS)
Menezes, Marcos; Capaz, Rodrigo
Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig
2016-05-14
We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less
Band warping, band non-parabolicity, and Dirac points in electronic and lattice structures
NASA Astrophysics Data System (ADS)
Resca, Lorenzo; Mecholsky, Nicholas A.; Pegg, Ian L.
2017-10-01
We illustrate at a fundamental level the physical and mathematical origins of band warping and band non-parabolicity in electronic and vibrational structures. We point out a robust presence of pairs of topologically induced Dirac points in a primitive-rectangular lattice using a p-type tight-binding approximation. We analyze two-dimensional primitive-rectangular and square Bravais lattices with implications that are expected to generalize to more complex structures. Band warping is shown to arise at the onset of a singular transition to a crystal lattice with a larger symmetry group, which allows the possibility of irreducible representations of higher dimensions, hence band degeneracy, at special symmetry points in reciprocal space. Band warping is incompatible with a multi-dimensional Taylor series expansion, whereas band non-parabolicities are associated with multi-dimensional Taylor series expansions to all orders. Still band non-parabolicities may merge into band warping at the onset of a larger symmetry group. Remarkably, while still maintaining a clear connection with that merging, band non-parabolicities may produce pairs of conical intersections at relatively low-symmetry points. Apparently, such conical intersections are robustly maintained by global topology requirements, rather than any local symmetry protection. For two p-type tight-binding bands, we find such pairs of conical intersections drifting along the edges of restricted Brillouin zones of primitive-rectangular Bravais lattices as lattice constants vary relatively to each other, until these conical intersections merge into degenerate warped bands at high-symmetry points at the onset of a square lattice. The conical intersections that we found appear to have similar topological characteristics as Dirac points extensively studied in graphene and other topological insulators, even though our conical intersections have none of the symmetry complexity and protection afforded by the latter more complex structures.
Dpb11 may function with RPA and DNA to initiate DNA replication.
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.
Structure of GlnK1 with bound effectors indicates regulatory mechanism for ammonia uptake.
Yildiz, Ozkan; Kalthoff, Christoph; Raunser, Stefan; Kühlbrandt, Werner
2007-01-24
A binary complex of the ammonia channel Amt1 from Methanococcus jannaschii and its cognate P(II) signalling protein GlnK1 has been produced and characterized. Complex formation is prevented specifically by the effector molecules Mg-ATP and 2-ketoglutarate. Single-particle electron microscopy of the complex shows that GlnK1 binds on the cytoplasmic side of Amt1. Three high-resolution X-ray structures of GlnK1 indicate that the functionally important T-loop has an extended, flexible conformation in the absence of Mg-ATP, but assumes a compact, tightly folded conformation upon Mg-ATP binding, which in turn creates a 2-ketoglutarate-binding site. We propose a regulatory mechanism by which nitrogen uptake is controlled by the binding of both effector molecules to GlnK1. At normal effector levels, a 2-ketoglutarate molecule binding at the apex of the compact T-loop would prevent complex formation, ensuring uninhibited ammonia uptake. At low levels of Mg-ATP, the extended loops would seal the ammonia channels in the complex. Binding of both effector molecules to P(II) signalling proteins may thus represent an effective feedback mechanism for regulating ammonium uptake through the membrane.
Growth, characterization and device development in monocrystalline diamond films
NASA Astrophysics Data System (ADS)
Davis, R. F.; Glass, J. T.; Nemanich, R. J.; Bozeman, S. P.; Sowers, A. T.
1995-06-01
Experimental and theoretical studies concerned with interface interactions of diamond with Si, Ni, and Ni3Si substrates have been conducted. Oriented diamond films deposited on (100) Si were characterized by polar Raman, polar x-ray diffraction (XRD), and cross-sectional high resolution transmission electron microscopy (HRTEM). These sutides showed that the diamond(100)/Si(100) interface adopted the 3:2-match arrangement rather than a 45 deg rotation. Extended Hueckel tight-binding (EHTB) electronic structure calculations for a model system revealed that the interface interaction favors the 3:2-match arrangement. Growth on polycrystalline Ni3Si resulted in oriented diamond particles; under the same growth conditions, graphite was formed on the nickel substrate. Our EHTB electronic structure calculations showed that the (111) and (100) surfaces of Ni3Si have a strong preference for diamond nucleation over graphite nucleation, but this was not the case for the (111) and (100) surfaces of Ni.
First principles electronic and thermal properties of some AlRE intermetallics
NASA Astrophysics Data System (ADS)
Srivastava, Vipul; Sanyal, Sankar P.; Rajagopalan, M.
2008-10-01
A study on structural and electronic properties of non-magnetic cubic B 2-type AlRE (RE=Sc, Y, La, Ce, Pr and Lu) intermetallics has been done theoretically. The self-consistent tight binding linear muffin tin orbital method is used to describe the electronic properties of these intermetallics at ambient and at high pressure. These compounds show metallic behavior under ambient conditions. The variation of density of states under compression indicates some possibility of structural phase transformation in AlLa, AlCe and AlPr. Thermal properties like Debye temperature and Grüneisen constant are calculated at T=0 K and at ambient pressure within the Debye-Grüneisen model and compared with the others’ theoretical results. Our results are in good agreement. We have also performed a pressure-induced variation of Debye temperature and have found a decrease in Debye temperature around 40 kbar in AlRE (RE=La, Ce, Pr) intermetallics.
NASA Astrophysics Data System (ADS)
Yu, Jin; van Veen, Edo; Katsnelson, Mikhail I.; Yuan, Shengjun
2018-06-01
The electronic properties of monolayer tin dilsulfide (ML -Sn S2 ), a recently synthesized metal dichalcogenide, are studied by a combination of first-principles calculations and tight-binding (TB) approximation. An effective lattice Hamiltonian based on six hybrid s p -like orbitals with trigonal rotation symmetry are proposed to calculate the band structure and density of states for ML -Sn S2 , which demonstrates good quantitative agreement with relativistic density-functional-theory calculations in a wide energy range. We show that the proposed TB model can be easily applied to the case of an external electric field, yielding results consistent with those obtained from full Hamiltonian results. In the presence of a perpendicular magnetic field, highly degenerate equidistant Landau levels are obtained, showing typical two-dimensional electron gas behavior. Thus, the proposed TB model provides a simple way in describing properties in ML -Sn S2 .
NASA Astrophysics Data System (ADS)
Li, J.; Tan, L. Z.; Zou, K.; Stabile, A. A.; Seiwell, D. J.; Watanabe, K.; Taniguchi, T.; Louie, Steven G.; Zhu, J.
2016-10-01
In a two-dimensional electron gas, the electron-electron interaction generally becomes stronger at lower carrier densities and renormalizes the Fermi-liquid parameters, such as the effective mass of carriers. We combine experiment and theory to study the effective masses of electrons and holes me* and mh* in bilayer graphene in the low carrier density regime on the order of 1 ×1011c m-2 . Measurements use temperature-dependent low-field Shubnikov-de Haas oscillations observed in high-mobility hexagonal boron nitride supported samples. We find that while me* follows a tight-binding description in the whole density range, mh* starts to drop rapidly below the tight-binding description at a carrier density of n =6 ×1011c m-2 and exhibits a strong suppression of 30% when n reaches 2 ×1011c m-2 . Contributions from the electron-electron interaction alone, evaluated using several different approximations, cannot explain the experimental trend. Instead, the effect of the potential fluctuation and the resulting electron-hole puddles play a crucial role. Calculations including both the electron-electron interaction and disorder effects explain the experimental data qualitatively and quantitatively. This Rapid Communication reveals an unusual disorder effect unique to two-dimensional semimetallic systems.
Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution
NASA Astrophysics Data System (ADS)
Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard
2015-08-01
Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.
Many-body instabilities and mass generation in slow Dirac materials
NASA Astrophysics Data System (ADS)
Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.
2015-07-01
Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less
Nishimoto, Yoshio
2015-09-07
We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2014-02-01
We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.
NASA Astrophysics Data System (ADS)
Han, M. J.; Marianetti, C. A.; Millis, A. J.
2010-10-01
The application of modern layer-by-layer growth techniques to transition-metal oxide materials raises the possibility of creating new classes of materials with rationally designed correlated electron properties. An important step toward this goal is the demonstration that electronic structure can be controlled by atomic composition. In compounds with partially occupied transition-metal d shells, one important aspect of the electronic structure is the relative occupancy of different d orbitals. Previous work has established that strain and quantum confinement can be used to influence orbital occupancy. In this paper we demonstrate a different modality for orbital control in transition-metal oxide heterostructures, using density-functional band calculations supplemented by a tight-binding analysis to show that the choice of nontransition-metal counterion X in transition-metal oxide heterostructures composed of alternating LaNiO3 and LaXO3 units strongly affects orbital occupancy, changing the magnitude and in some cases the sign of the orbital polarization.
NASA Astrophysics Data System (ADS)
Shinozuka, Yuzo; Oda, Masato
2015-09-01
The interacting quasi-band model proposed for electronic states in simple alloys is extended for compound semiconductor alloys with general lattice structures containing several atoms per unit cell. Using a tight-binding model, a variational electronic wave function for quasi-Bloch states yields a non-Hermitian Hamiltonian matrix characterized by matrix elements of constituent crystals and concentration of constituents. Solving secular equations for each k-state yields the alloy’s energy spectrum for any type of randomness and arbitrary concentration. The theory is used to address III-V (II-VI) alloys with a zincblende lattice with crystal band structures well represented by the sp3s* model. Using the resulting 15 × 15 matrix, the concentration dependence of valence and conduction bands is calculated in a unified scheme for typical alloys: Al1-xGaxAs, GaAs1-xPx, and GaSb1-xPx. Results agree well with experiments and are discussed with respect to the concentration dependence, direct-indirect gap transition, and band-gap-bowing origin.
Scattering matrix of arbitrary tight-binding Hamiltonians
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.
2017-03-15
A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.
First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe
NASA Astrophysics Data System (ADS)
Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team
The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.
Dpb11 may function with RPA and DNA to initiate DNA replication
Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.
2017-01-01
Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467
The effects of temperature and magnetic flux on electron transport through a four-channel DNA model
NASA Astrophysics Data System (ADS)
Lee, Sunhee; Hedin, Eric; Joe, Yong
2010-03-01
The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).
Basic concepts of quantum interference and electron transport in single-molecule electronics.
Lambert, C J
2015-02-21
This tutorial outlines the basic theoretical concepts and tools which underpin the fundamentals of phase-coherent electron transport through single molecules. The key quantity of interest is the transmission coefficient T(E), which yields the electrical conductance, current-voltage relations, the thermopower S and the thermoelectric figure of merit ZT of single-molecule devices. Since T(E) is strongly affected by quantum interference (QI), three manifestations of QI in single-molecules are discussed, namely Mach-Zehnder interferometry, Breit-Wigner resonances and Fano resonances. A simple MATLAB code is provided, which allows the novice reader to explore QI in multi-branched structures described by a tight-binding (Hückel) Hamiltonian. More generally, the strengths and limitations of materials-specific transport modelling based on density functional theory are discussed.
Magnetic edge states in Aharonov-Bohm graphene quantum rings
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farghadan, R., E-mail: rfarghadan@kashanu.ac.ir; Heidari Semiromi, E.; Saffarzadeh, A.
2013-12-07
The effect of electron-electron interaction on the electronic structure of Aharonov-Bohm (AB) graphene quantum rings (GQRs) is explored theoretically using the single-band tight-binding Hamiltonian and the mean-field Hubbard model. The electronic states and magnetic properties of hexagonal, triangular, and circular GQRs with different sizes and zigzag edge terminations are studied. The results show that, although the AB oscillations in the all types of nanoring are affected by the interaction, the spin splitting in the AB oscillations strongly depends on the geometry and the size of graphene nanorings. We found that the total spin of hexagonal and circular rings is zeromore » and therefore, no spin splitting can be observed in the AB oscillations. However, the non-zero magnetization of the triangular rings breaks the degeneracy between spin-up and spin-down electrons, which produces spin-polarized AB oscillations.« less
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2014-11-01
We have investigated the electronic properties of A-BNNRs in the external electric field using third nearest neighbor tight binding approximation including edge effects. We found that the dependence of on-site energy to the external electric field for edge atoms and center part atoms is different. By comparing the band structure in the different fields, several differences are clearly seen such as modification of energy dispersions, creation of additional band edge states and band gap reduction. By increasing the electric field the band gap reduces linearly until reaches zero and BNNRs with larger width are more sensitive than small ones. All changes in the band structure are directly reflected in the DOS spectrum. The numbers and the energies of the DOS peaks are dependent on the electric field strength.
Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...
2016-07-01
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Qin; Zaikowski, Lori; Kaur, Parmeet
Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less
Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tayo, Benjamin O.
2015-08-15
A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less
Long-range correction for tight-binding TD-DFT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de
2015-10-07
We present two improvements to the tight-binding approximation of time-dependent density functional theory (TD-DFTB): First, we add an exact Hartree-Fock exchange term, which is switched on at large distances, to the ground state Hamiltonian and similarly to the coupling matrix that enters the linear response equations for the calculation of excited electronic states. We show that the excitation energies of charge transfer states are improved relative to the standard approach without the long-range correction by testing the method on a set of molecules from the database in Peach et al. [J. Chem. Phys. 128, 044118 (2008)] which are known tomore » exhibit problematic charge transfer states. The degree of spatial overlap between occupied and virtual orbitals indicates where TD-DFTB and long-range corrected TD-DFTB (lc-TD-DFTB) can be expected to produce large errors. Second, we improve the calculation of oscillator strengths. The transition dipoles are obtained from Slater Koster files for the dipole matrix elements between valence orbitals. In particular, excitations localized on a single atom, which appear dark when using Mulliken transition charges, acquire a more realistic oscillator strength in this way. These extensions pave the way for using lc-TD-DFTB to describe the electronic structure of large chromophoric polymers, where uncorrected TD-DFTB fails to describe the high degree of conjugation and produces spurious low-lying charge transfer states.« less
NASA Astrophysics Data System (ADS)
Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard
2014-03-01
The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.
A combined representation method for use in band structure calculations. 1: Method
NASA Technical Reports Server (NTRS)
Friedli, C.; Ashcroft, N. W.
1975-01-01
A representation was described whose basis levels combine the important physical aspects of a finite set of plane waves with those of a set of Bloch tight-binding levels. The chosen combination has a particularly simple dependence on the wave vector within the Brillouin Zone, and its use in reducing the standard one-electron band structure problem to the usual secular equation has the advantage that the lattice sums involved in the calculation of the matrix elements are actually independent of the wave vector. For systems with complicated crystal structures, for which the Korringa-Kohn-Rostoker (KKR), Augmented-Plane Wave (APW) and Orthogonalized-Plane Wave (OPW) methods are difficult to apply, the present method leads to results with satisfactory accuracy and convergence.
NASA Astrophysics Data System (ADS)
Zhao, Hua; Meng, Wei-Feng
2017-10-01
In this paper a five layer organic electronic device with alternately placed ferromagnetic metals and organic polymers: ferromagnetic metal/organic layer/ferromagnetic metal/organic layer/ferromagnetic metal, which is injected a spin-polarized electron from outsides, is studied theoretically using one-dimensional tight binding model Hamiltonian. We calculated equilibrium state behavior after an electron with spin is injected into the organic layer of this structure, charge density distribution and spin polarization density distribution of this injected spin-polarized electron, and mainly studied possible transport behavior of the injected spin polarized electron in this multilayer structure under different external electric fields. We analyze the physical process of the injected electron in this multilayer system. It is found by our calculation that the injected spin polarized electron exists as an electron-polaron state with spin polarization in the organic layer and it can pass through the middle ferromagnetic layer from the right-hand organic layer to the left-hand organic layer by the action of increasing external electric fields, which indicates that this structure may be used as a possible spin-polarized charge electronic device and also may provide a theoretical base for the organic electronic devices and it is also found that in the boundaries between the ferromagnetic layer and the organic layer there exist induced interface local dipoles due to the external electric fields.
KISSELEVA, NATALIA; KHVOROVA, ANASTASIA; WESTHOF, ERIC; SCHIEMANN, OLAV
2005-01-01
Electron paramagnetic resonance (EPR) spectroscopy is used to study the binding of MnII ions to a tertiary stabilized hammer-head ribozyme (tsHHRz) and to compare it with the binding to the minimal hammerhead ribozyme (mHHRz). Continuous wave EPR measurements show that the tsHHRz possesses a single high-affinity MnII binding site with a KD of ≤10 nM at an NaCl concentration of 0.1 M. This dissociation constant is at least two orders of magnitude smaller than the KD determined previously for the single high-affinity MnII site in the mHHRz. In addition, whereas the high-affinity MnII is displaced from the mHHRz upon binding of the aminoglycoside antibiotic neomycin B, it is not from the tsHHRz. Despite these pronounced differences in binding, a comparison between the electron spin echo envelope modulation and hyperfine sublevel correlation spectra of the minimal and tertiary stabilized HHRz demonstrates that the structure of both binding sites is very similar. This suggests that the MnII is located in both ribozymes between the bases A9 and G10.1 of the sheared G · A tandem base pair, as shown previously and in detail for the mHHRz. Thus, the much stronger MnII binding in the tsHHRz is attributed to the interaction between the two external loops, which locks in the RNA fold, trapping the MnII in the tightly bound conformation, whereas the absence of long-range loop–loop interactions in the mHHRz leads to more dynamical and open conformations, decreasing MnII binding. PMID:15611296
Vertical electronic transport in van de waals heterostructures
NASA Astrophysics Data System (ADS)
Qiao, Zhenhua; Zhenhua Qiao's Group Team
In this work, we will introduce the theoretical investigation of the vertical electronic transport in various heterostructrues by using both tight-binding method and first-principles calculations. Counterintuitively, we find that the maximum electronic transport is achieved at very limited scattering regions but not at large overlapped catering regions. Based on this finding, we design a special setup to measure the tunneling effect in rotated bilayer systems.
Lobato, I; Rojas, J; Landauro, C V; Torres, J
2009-02-04
The structural evolution and dynamics of silver nanodrops Ag(2869) (4.4 nm in diameter) under rapid cooling conditions have been studied by means of molecular dynamics simulations and electronic density of state calculations. The interaction of silver atoms is modelled by a tight-binding semiempirical interatomic potential proposed by Cleri and Rosato. The pair correlation functions and the pair analysis technique are used to reveal the structural transition in the process of solidification. It is shown that Ag nanoparticles evolve into different nanostructures under different cooling processes. At a cooling rate of 1.5625 × 10(13) K s(-1) the nanoparticles preserve an amorphous-like structure containing a large amount of 1551 and 1541 pairs which correspond to icosahedral symmetry. For a lower cooling rate (1.5625 × 10(12) K s(-1)), the nanoparticles transform into a crystal-like structure consisting mainly of 1421 and 1422 pairs which correspond to the face centred cubic and hexagonal close packed structures, respectively. The variations of the electronic density of states for the differently cooled nanoparticles are small, but in correspondence with the structural changes.
Dwivedi, Neeraj; McIntosh, Ross; Dhand, Chetna; Kumar, Sushil; Malik, Hitendra K; Bhattacharyya, Somnath
2015-09-23
We report nitrogen-induced enhanced electron tunnel transport and improved nanomechanical properties in band gap-modulated nitrogen doped DLC (N-DLC) quantum superlattice (QSL) structures. The electrical characteristics of such superlattice devices revealed negative differential resistance (NDR) behavior. The interpretation of these measurements is supported by 1D tight binding calculations of disordered superlattice structures (chains), which include bond alternation in sp(3)-hybridized regions. Tandem theoretical and experimental analysis shows improved tunnel transport, which can be ascribed to nitrogen-driven structural modification of the N-DLC QSL structures, especially the increased sp(2) clustering that provides additional conduction paths throughout the network. The introduction of nitrogen also improved the nanomechanical properties, resulting in enhanced elastic recovery, hardness, and elastic modulus, which is unusual but is most likely due to the onset of cross-linking of the network. Moreover, the materials' stress of N-DLC QSL structures was reduced with the nitrogen doping. In general, the combination of enhanced electron tunnel transport and nanomechanical properties in N-DLC QSL structures/devices can open a platform for the development of a new class of cost-effective and mechanically robust advanced electronic devices for a wide range of applications.
Accurate modeling of defects in graphene transport calculations
NASA Astrophysics Data System (ADS)
Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian
2018-01-01
We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, H., E-mail: tanaka@semicon.kuee.kyoto-u.ac.jp; Morioka, N.; Mori, S.
2014-02-07
The conduction band structure and electron effective mass of GaAs nanowires with various cross-sectional shapes and orientations were calculated by two methods, a tight-binding method and an effective mass equation taking the bulk full-band structure into account. The effective mass of nanowires increases as the cross-sectional size decreases, and this increase in effective mass depends on the orientations and substrate faces of nanowires. Among [001], [110], and [111]-oriented rectangular cross-sectional GaAs nanowires, [110]-oriented nanowires with wider width along the [001] direction showed the lightest effective mass. This dependence originates from the anisotropy of the Γ valley of bulk GaAs. Themore » relationship between effective mass and bulk band structure is discussed.« less
Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids
2015-01-01
Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kocharian, Armen N.; Fernando, Gayanath W.; Fang, Kun
Rashba spin-orbit effects and electron correlations in the two-dimensional cylindrical lattices of square geometries are assessed using mesoscopic two-, three- and four-leg ladder structures. Here the electron transport properties are systematically calculated by including the spin-orbit coupling in tight binding and Hubbard models threaded by a magnetic flux. These results highlight important aspects of possible symmetry breaking mechanisms in square ladder geometries driven by the combined effect of a magnetic gauge field spin-orbit interaction and temperature. The observed persistent current, spin and charge polarizations in the presence of spin-orbit coupling are driven by separation of electron and hole charges andmore » opposite spins in real-space. The modeled spin-flip processes on the pairing mechanism induced by the spin-orbit coupling in assembled nanostructures (as arrays of clusters) engineered in various two-dimensional multi-leg structures provide an ideal playground for understanding spatial charge and spin density inhomogeneities leading to electron pairing and spontaneous phase separation instabilities in unconventional superconductors. Such studies also fall under the scope of current challenging problems in superconductivity and magnetism, topological insulators and spin dependent transport associated with numerous interfaces and heterostructures.« less
On the formation of suspended noble-metal monatomic chains
NASA Astrophysics Data System (ADS)
Hasmy, A.; Rincón, L.; Hernández, R.; Mujica, V.; Márquez, M.; González, C.
2008-09-01
We present a tight-binding molecular-dynamics investigation of the geometrical and the electronic structure of suspended monatomic noble-metal chains. We show that linear monatomic chains are formed at temperatures equal to or smaller than 500 K for Au, 200 K for Ag, and 4 K for Cu and that they are stable for at least 10 ns. We also evidence that such stability is associated with the persisting sd orbital hybridization along the chains. The study highlights fundamental limitations of conductance measurement experiments to detect these chains in the breaking process of nanowires.
Many-body instabilities and mass generation in slow Dirac materials
NASA Astrophysics Data System (ADS)
Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander
2015-03-01
Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.
Transferable tight-binding model for strained group IV and III-V materials and heterostructures
NASA Astrophysics Data System (ADS)
Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard
2016-07-01
It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.
Tight-binding tunneling amplitude of an optical lattice
NASA Astrophysics Data System (ADS)
Arzamasovs, Maksims; Liu, Bo
2017-11-01
The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mahan, G. D.
We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less
Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.
2011-01-01
We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.
Development of tight-binding based GW algorithm and its computational implementation for graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source
Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less
Two-electron states of a group-V donor in silicon from atomistic full configuration interactions
NASA Astrophysics Data System (ADS)
Tankasala, Archana; Salfi, Joseph; Bocquel, Juanita; Voisin, Benoit; Usman, Muhammad; Klimeck, Gerhard; Simmons, Michelle Y.; Hollenberg, Lloyd C. L.; Rogge, Sven; Rahman, Rajib
2018-05-01
Two-electron states bound to donors in silicon are important for both two-qubit gates and spin readout. We present a full configuration interaction technique in the atomistic tight-binding basis to capture multielectron exchange and correlation effects taking into account the full band structure of silicon and the atomic-scale granularity of a nanoscale device. Excited s -like states of A1 symmetry are found to strongly influence the charging energy of a negative donor center. We apply the technique on subsurface dopants subjected to gate electric fields and show that bound triplet states appear in the spectrum as a result of decreased charging energy. The exchange energy, obtained for the two-electron states in various confinement regimes, may enable engineering electrical control of spins in donor-dot hybrid qubits.
Bandgap engineering of GaN nanowires
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ming, Bang-Ming; Yan, Hui; Wang, Ru-Zhi, E-mail: wrz@bjut.edu.cn, E-mail: yamcy@csrc.ac.cn
2016-05-15
Bandgap engineering has been a powerful technique for manipulating the electronic and optical properties of semiconductors. In this work, a systematic investigation of the electronic properties of [0001] GaN nanowires was carried out using the density functional based tight-binding method (DFTB). We studied the effects of geometric structure and uniaxial strain on the electronic properties of GaN nanowires with diameters ranging from 0.8 to 10 nm. Our results show that the band gap of GaN nanowires depends linearly on both the surface to volume ratio (S/V) and tensile strain. The band gap of GaN nanowires increases linearly with S/V, whilemore » it decreases linearly with increasing tensile strain. These linear relationships provide an effect way in designing GaN nanowires for their applications in novel nano-devices.« less
STRUCTURAL DIVERSITY IN SOLID STATE CHEMISTRY:A Story of Squares and Triangles
NASA Astrophysics Data System (ADS)
Lee, Stephen
1996-10-01
A simple method for calculating the electronic energy of extended solids is discussed in this review. This method is based on the Huckel or tight-binding theory in which an explicit pairwise repulsion is added to the generally attractive forces of the partially filled valence electron bands. An expansion based on the power moments of the electronic density of states is discussed, and the structural energy difference theorem is reviewed. The repulsive energy is found to vary linearly with the second power moment of the electronic density of states. These results are then used to show why there is such a diversity of structure in the solid state. The elemental structures of the main group are rationalized by the above methods. It is the third and fourth power moments (which correspond in part to triangles and squares of bonded atoms) that account for much of the elemental structures of the main group elements of the periodic table. This serves as an introduction to further rationalizations of transition for noble metal alloy, binary and ternary telluride and selenide, and other intermetallic structures.Thus a cohesive picture of both covalent and metallic bonding is presented in this review, illustrating the importance of atomic orbitals and their overlap integrals.
Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; ...
2017-08-09
We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less
Electronic transport in disordered MoS2 nanoribbons
NASA Astrophysics Data System (ADS)
Ridolfi, Emilia; Lima, Leandro R. F.; Mucciolo, Eduardo R.; Lewenkopf, Caio H.
2017-01-01
We study the electronic structure and transport properties of zigzag and armchair monolayer molybdenum disulfide nanoribbons using an 11-band tight-binding model that accurately reproduces the material's bulk band structure near the band gap. We study the electronic properties of pristine zigzag and armchair nanoribbons, paying particular attention to the edges states that appear within the MoS2 bulk gap. By analyzing both their orbital composition and their local density of states, we find that in zigzag-terminated nanoribbons these states can be localized at a single edge for certain energies independent of the nanoribbon width. We also study the effects of disorder in these systems using the recursive Green's function technique. We show that for the zigzag nanoribbons, the conductance due to the edge states is strongly suppressed by short-range disorder such as vacancies. In contrast, the local density of states still shows edge localization. We also show that long-range disorder has a small effect on the transport properties of nanoribbons within the bulk gap energy window.
Duan, Jiahua; Chen, Runkun; Cheng, Yuan; Yang, Tianzhong; Zhai, Feng; Dai, Qing; Chen, Jianing
2018-05-01
The nontrivial topological origin and pseudospinorial character of electron wavefunctions make edge states possess unusual electronic properties. Twenty years ago, the tight-binding model calculation predicted that zigzag termination of 2D sheets of carbon atoms have peculiar edge states, which show potential application in spintronics and modern information technologies. Although scanning probe microscopy is employed to capture this phenomenon, the experimental demonstration of its optical response remains challenging. Here, the propagating graphene plasmon provides an edge-selective polaritonic probe to directly detect and control the electronic edge state at ambient condition. Compared with armchair, the edge-band structure in the bandgap gives rise to additional optical absorption and strongly absorbed rim at zigzag edge. Furthermore, the optical conductivity is reconstructed and the anisotropic plasmon damping in graphene systems is revealed. The reported approach paves the way for detecting edge-specific phenomena in other van der Waals materials and topological insulators. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda
We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen–Baerends corrected exchange potential. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene Si xC 1–x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussedmore » in the light of the available experimental and other theoretical data. As a result, our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.« less
Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function
NASA Astrophysics Data System (ADS)
Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.
2018-04-01
Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.
Valley density-wave (VDW) and Superconductivity in Iron-Pnictides
NASA Astrophysics Data System (ADS)
Cvetkovic, Vladimir; Tesanovic, Zlatko
2009-03-01
One of the experimentally observed features of iron-pnictide superconductors is the structural transition and SDW ordering occurring at almost the same temperature. Starting from a tight-binding model [1], we construct an effective theory for iron-pnictides with the distinctive two hole and two electron Fermi surfaces. This theory is then mapped onto a negative-U Hubbard model with additional orbital and spin flavors [2]. We demonstrate that the superconducting instability of the attractive Hubbard model --- valley density-wave (VDW) --- corresponds to the observed structural and SDW orders. The deviations from perfect nesting between the hole and electron Fermi surfaces are mapped onto the Zeeman field which causes portions of Fermi surface to remain ungapped. The origin of pnictide superconductivity in this model, and its ties to the VDW are discussed. [1] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0804.4678. [2] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0808.3742.
Three-dimensional graphdiyne as a topological nodal-line semimetal
NASA Astrophysics Data System (ADS)
Nomura, Takafumi; Habe, Tetsuro; Sakamoto, Ryota; Koshino, Mikito
2018-05-01
We study the electronic band structure of three-dimensional ABC-stacked (rhombohedral) graphdiyne, which is a new planar carbon allotrope recently fabricated. Using first-principles calculation, we show that the system is a nodal-line semimetal, in which the conduction band and valence band cross at a closed ring in the momentum space. We derive the minimum tight-binding model and the low-energy effective Hamiltonian in a 4 ×4 matrix form. The nodal line is protected by a nontrivial winding number, and it ensures the existence of the topological surface state in a finite-thickness slab. The Fermi surface of the doped system exhibits a peculiar, self-intersecting hourglass structure, which is quite different from the torus or pipe shape in the previously proposed nodal semimetals. Despite its simple configuration, three-dimensional graphdiyne offers unique electronic properties distinct from any other carbon allotropes.
NASA Astrophysics Data System (ADS)
Dwivedi, Vatsal
This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.
Coordinated autoinhibition of F-BAR domain membrane binding and WASp activation by Nervous Wreck.
Stanishneva-Konovalova, Tatiana B; Kelley, Charlotte F; Eskin, Tania L; Messelaar, Emily M; Wasserman, Steven A; Sokolova, Olga S; Rodal, Avital A
2016-09-20
Membrane remodeling by Fes/Cip4 homology-Bin/Amphiphysin/Rvs167 (F-BAR) proteins is regulated by autoinhibitory interactions between their SRC homology 3 (SH3) and F-BAR domains. The structural basis of autoregulation, and whether it affects interactions of SH3 domains with other cellular ligands, remain unclear. Here we used single-particle electron microscopy to determine the structure of the F-BAR protein Nervous Wreck (Nwk) in both soluble and membrane-bound states. On membrane binding, Nwk SH3 domains do not completely dissociate from the F-BAR dimer, but instead shift from its concave surface to positions on either side of the dimer. Unexpectedly, along with controlling membrane binding, these autoregulatory interactions inhibit the ability of Nwk-SH3a to activate Wiskott-Aldrich syndrome protein (WASp)/actin related protein (Arp) 2/3-dependent actin filament assembly. In Drosophila neurons, Nwk autoregulation restricts SH3a domain-dependent synaptopod formation, synaptic growth, and actin organization. Our results define structural rearrangements in Nwk that control F-BAR-membrane interactions as well as SH3 domain activities, and suggest that these two functions are tightly coordinated in vitro and in vivo.
NASA Astrophysics Data System (ADS)
Leleyter, M.; Olivi-Tran, N.
2008-12-01
We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.
Liao, Gaohua; Luo, Ning; Chen, Ke-Qiu; Xu, H. Q.
2016-01-01
We present a theoretical study of the electronic structures of freestanding nanowires made from gallium phosphide (GaP)—a III-V semiconductor with an indirect bulk bandgap. We consider [001]-oriented GaP nanowires with square and rectangular cross sections, and [111]-oriented GaP nanowires with hexagonal cross sections. Based on tight binding models, both the band structures and wave functions of the nanowires are calculated. For the [001]-oriented GaP nanowires, the bands show anti-crossing structures, while the bands of the [111]-oriented nanowires display crossing structures. Two minima are observed in the conduction bands, while the maximum of the valence bands is always at the Γ-point. Using double group theory, we analyze the symmetry properties of the lowest conduction band states and highest valence band states of GaP nanowires with different sizes and directions. The band state wave functions of the lowest conduction bands and the highest valence bands of the nanowires are evaluated by spatial probability distributions. For practical use, we fit the confinement energies of the electrons and holes in the nanowires to obtain an empirical formula. PMID:27307081
Effects of axial magnetic field on the electronic and optical properties of boron nitride nanotube
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2011-07-01
The splitting of band structure and absorption spectrum, for boron nitride nanotubes (BNNTs) under axial magnetic field, is studied using the tight binding approximation. It is found that the band splitting ( ΔE) at the Γ point is linearly proportional to the magnetic field ( Φ/Φ0). Our results indicate that the splitting rate νii, of the two first bands nearest to the Fermi level, is a linear function of n -2 for all (n,0) zigzag BNNTs. By investigation of the dependence of band structure and absorption spectrum to the magnetic field, we found that absorption splitting is equal to band splitting and the splitting rate of band structure can be used to determine the splitting rate of the absorption spectrum.
NASA Astrophysics Data System (ADS)
Ovchinnikov, Sergey G.; Makarov, Ilya A.; Kozlov, Peter A.
2017-03-01
In this work dependences of the electron band structure and spectral function in the HTSC cuprates on magnitude of electron-phonon interaction (EPI) and temperature are investigated. We use three-band p-d model with diagonal and offdiagonal EPI with breathing and buckling phonon mode in the frameworks of polaronic version of the generalized tight binding (GTB) method. The polaronic quasiparticle excitation in the system with EPI within this approach is formed by a hybridization of the local multiphonon Franck-Condon excitations with lower and upper Hubbard bands. Increasing EPI leads to transfer of spectral weight to high-energy multiphonon excitations and broadening of the spectral function. Temperature effects are taken into account by occupation numbers of local excited polaronic states and variations in the magnitude of spin-spin correlation functions. Increasing the temperature results in band structure reconstruction, spectral weight redistribution, broadening of the spectral function peak at the top of the valence band and the decreasing of the peak intensity. The effect of EPI with two phonon modes on the polaron spectral function is discussed.
Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle
2010-07-23
Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less
Theoretical prediction of low-density hexagonal ZnO hollow structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tuoc, Vu Ngoc, E-mail: tuoc.vungoc@hust.edu.vn; Huan, Tran Doan; Thao, Nguyen Thi
2016-10-14
Along with wurtzite and zinc blende, zinc oxide (ZnO) has been found in a large number of polymorphs with substantially different properties and, hence, applications. Therefore, predicting and synthesizing new classes of ZnO polymorphs are of great significance and have been gaining considerable interest. Herein, we perform a density functional theory based tight-binding study, predicting several new series of ZnO hollow structures using the bottom-up approach. The geometry of the building blocks allows for obtaining a variety of hexagonal, low-density nanoporous, and flexible ZnO hollow structures. Their stability is discussed by means of the free energy computed within the lattice-dynamicsmore » approach. Our calculations also indicate that all the reported hollow structures are wide band gap semiconductors in the same fashion with bulk ZnO. The electronic band structures of the ZnO hollow structures are finally examined in detail.« less
Tuning transport properties on graphene multiterminal structures by mechanical deformations
NASA Astrophysics Data System (ADS)
Latge, Andrea; Torres, Vanessa; Faria, Daiara
The realization of mechanical strain on graphene structures is viewed as a promise route to tune electronic and transport properties such as changing energy band-gaps and promoting localization of states. Using continuum models, mechanical deformations are described by effective gauge fields, mirrored as pseudomagnetic fields that may reach quite high values. Interesting symmetry features are developed due to out of plane deformations on graphene; lift sublattice symmetry was predicted and observed in centrosymmetric bumps and strained nanobubbles. Here we discuss the effects of Gaussian-like strain on a hexagonal graphene flake connected to three leads, modeled as perfect graphene nanoribbons. The Green function formalism is used within a tight-binding approximation. For this particular deformation sharp resonant states are achieved depending on the strained structure details. We also study a fold-strained structure in which the three leads are deformed extending up to the very center of the hexagonal flake. We show that conductance suppressions can be controlled by the strain intensity and important transport features are modeled by the electronic band structure of the leads.
Elastic Gauge Fields in Weyl Semimetals
NASA Astrophysics Data System (ADS)
Cortijo, Alberto; Ferreiros, Yago; Landsteiner, Karl; Hernandez Vozmediano, Maria Angeles
We show that, as it happens in graphene, elastic deformations couple to the electronic degrees of freedom as pseudo gauge fields in Weyl semimetals. We derive the form of the elastic gauge fields in a tight-binding model hosting Weyl nodes and see that this vector electron-phonon coupling is chiral, providing an example of axial gauge fields in three dimensions. As an example of the new response functions that arise associated to these elastic gauge fields, we derive a non-zero phonon Hall viscosity for the neutral system at zero temperature. The axial nature of the fields provides a test of the chiral anomaly in high energy with three axial vector couplings. European Union structural funds and the Comunidad de Madrid MAD2D-CM Program (S2013/MIT-3007).
Conductance manipulation at the molecular level
NASA Astrophysics Data System (ADS)
Paulsson, Magnus; Stafström, Sven
1999-05-01
Using a tight-binding model we have studied the electronic transmission through a C60 molecule sandwiched between a metal surface and a metal (scanning tunnelling microscope) tip. By simulating compression of C60 we have interpreted an experimental study of the variation of the conductance through a C60 molecule with an applied external pressure. We found that the observed increase in conductance cannot be explained in terms of the changes in the electronic structure of the C60 molecule alone. Effects related to the metal/molecule contact, i.e. the strength of the metal/C60 interaction and the shape of the molecular orbitals in the tip, are in fact more important for the conductance. In view of this we discuss the importance of interference effects in the tip/molecule coupling.
Dielectric response of molecules in empirical tight-binding theory
NASA Astrophysics Data System (ADS)
Boykin, Timothy B.; Vogl, P.
2002-01-01
In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.
NASA Astrophysics Data System (ADS)
Maiti, Santanu K.
2014-07-01
The experimentally obtained (Venkataraman et al. [1]) cosine squared relation of electronic conductance in a biphenyl molecule is verified theoretically within a tight-binding framework. Using Green's function formalism we numerically calculate two-terminal conductance as a function of relative twist angle among the molecular rings and find that the results are in good agreement with the experimental observation.
Stacking-dependent electronic property of trilayer graphene epitaxially grown on Ru(0001)
NASA Astrophysics Data System (ADS)
Que, Yande; Xiao, Wende; Chen, Hui; Wang, Dongfei; Du, Shixuan; Gao, Hong-Jun
2015-12-01
The growth, atomic structure, and electronic property of trilayer graphene (TLG) on Ru(0001) were studied by low temperature scanning tunneling microscopy and spectroscopy in combined with tight-binding approximation (TBA) calculations. TLG on Ru(0001) shows a flat surface with a hexagonal lattice due to the screening effect of the bottom two layers and the AB-stacking in the top two layers. The coexistence of AA- and AB-stacking in the bottom two layers leads to three different stacking orders of TLG, namely, ABA-, ABC-, and ABB-stacking. STS measurements combined with TBA calculations reveal that the density of states of TLG with ABC- and ABB-stacking is characterized by one and two sharp peaks near to the Fermi level, respectively, in contrast to the V-shaped feature of TLG with ABA-stacking. Our work demonstrates that TLG on Ru(0001) might be an ideal platform for exploring stacking-dependent electronic properties of graphene.
Mahdavifar, Maryam; Khoeini, Farhad
2018-08-10
We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.
Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network
NASA Astrophysics Data System (ADS)
Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael
2018-04-01
Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.
Quasi-bound states in strained graphene
NASA Astrophysics Data System (ADS)
Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David
In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.
NASA Astrophysics Data System (ADS)
Hourahine, B.; Aradi, B.; Frauenheim, T.
2010-07-01
DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.
Tight-binding model for borophene and borophane
NASA Astrophysics Data System (ADS)
Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.
2018-03-01
Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.
Colloidal nanocrystals as LEGO® bricks for building electronic band structure models.
Tadjine, Athmane; Delerue, Christophe
2018-03-28
The synthesis of self-assembled semiconductor nanocrystal (NC) superlattices using oriented attachment recently became a flourishing research topic. This technique already produced remarkable forms of NC superlattices, such as linear chains, mono and multilayer square lattices, and silicene-like honeycomb lattices. In the case of lead chalcogenide semiconductors where NCs are in the form of truncated nanocubes, the attachment mostly occurs via (100) facets. In this work, we show that all these structures can be seen as sub-structures of a simple cubic lattice. From this, we investigate a rich variety of one-dimensional or two-dimensional superlattices that could be built as few lines or few layers taken from the same cubic system following different crystallographic orientations. Each NC can be therefore considered as a LEGO® brick, and any superlattice can be obtained from another one by rearranging the bricks. Moreover, we show that this concept of LEGO® bricks can be extended to the calculation of the electronic band structure of the superlattices. This leads to a simple yet powerful way to build analytical Hamiltonians that present band structures in excellent agreement with more elaborate atomistic tight-binding calculations. This LEGO® concept could guide the synthesis of superlattices and LEGO® Hamiltonians should greatly simplify further studies on the (opto-)electronic properties of such structures.
Ohta, Takehiro; Chakrabarty, Sarmistha; Lipscomb, John D; Solomon, Edward I
2008-02-06
Near-IR MCD and variable temperature, variable field (VTVH) MCD have been applied to naphthalene 1,2-dioxygenase (NDO) to describe the coordination geometry and electronic structure of the mononuclear nonheme ferrous catalytic site in the resting and substrate-bound forms with the Rieske 2Fe2S cluster oxidized and reduced. The structural results are correlated with the crystallographic studies of NDO and other related Rieske nonheme iron oxygenases to develop molecular level insights into the structure/function correlation for this class of enzymes. The MCD data for resting NDO with the Rieske center oxidized indicate the presence of a six-coordinate high-spin ferrous site with a weak axial ligand which becomes more tightly coordinated when the Rieske center is reduced. Binding of naphthalene to resting NDO (Rieske oxidized and reduced) converts the six-coordinate sites into five-coordinate (5c) sites with elimination of a water ligand. In the Rieske oxidized form the 5c sites are square pyramidal but transform to a 1:2 mixture of trigonal bipyramial/square pyramidal sites when the Rieske center is reduced. Thus the geometric and electronic structure of the catalytic site in the presence of substrate can be significantly affected by the redox state of the Rieske center. The catalytic ferrous site is primed for the O2 reaction when substrate is bound in the active site in the presence of the reduced Rieske site. These structural changes ensure that two electrons and the substrate are present before the binding and activation of O2, which avoids the uncontrolled formation and release of reactive oxygen species.
Nanomechanics of Carbon and CxByNz Nanotubes: Via a Quantum Molecular Dynamics Method
NASA Technical Reports Server (NTRS)
Srivastava, Deepak; Menon, M.; Cho, Kyeong Jae; Saini, Subhash (Technical Monitor)
1999-01-01
Nanomechanics of single-wall C, BN and BC$_3$ and B doped C nanotubes under axial compression and tension are investigated through a generalized tight-binding molecular dynamics (GTBMD) and {\\it ab-initio} electronic structure methods. The dynamic strength of BN, BC$_3$ and B doped C nanotubes for small axial strain are comparable to each other. The main difference is in the critical strain at which structural collapse occurs. For example, even a shallow doping with B lowers the value of critical strain for C nanotubes. The critical strain for BN nanotube is found to be more than that for the similar C nanotube. Once the structural collapse starts to occur we find that carbon nanotubes irreversibly go into plastic deformation regime via the formation of tetrahedral (four-fold coordinated) bonds at the location of sharp pinches or kinks. This finding is considerably different from the classical MD (molecular dynamics) simulation results known so far. The energetics and electronic densities of states of the collapsed structures, investigated with {\\it ab-initio) methods, will also be discussed.
An additional substrate binding site in a bacterial phenylalanine hydroxylase
Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan
2014-01-01
Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686
Influence of strain on dislocation core in silicon
NASA Astrophysics Data System (ADS)
Pizzagalli, L.; Godet, J.; Brochard, S.
2018-05-01
First principles, density functional-based tight binding and semi-empirical interatomic potentials calculations are performed to analyse the influence of large strains on the structure and stability of a 60? dislocation in silicon. Such strains typically arise during the mechanical testing of nanostructures like nanopillars or nanoparticles. We focus on bi-axial strains in the plane normal to the dislocation line. Our calculations surprisingly reveal that the dislocation core structure largely depends on the applied strain, for strain levels of about 5%. In the particular case of bi-axial compression, the transformation of the dislocation to a locally disordered configuration occurs for similar strain magnitudes. The formation of an opening, however, requires larger strains, of about 7.5%. Furthermore, our results suggest that electronic structure methods should be favoured to model dislocation cores in case of large strains whenever possible.
Gaussian polarizable-ion tight binding.
Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P
2016-10-14
To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Gaussian polarizable-ion tight binding
NASA Astrophysics Data System (ADS)
Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.
2016-10-01
To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).
Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M
2016-03-14
Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.
The K-turn motif in riboswitches and other RNA species☆
Lilley, David M.J.
2014-01-01
The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.
2016-04-13
We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less
Dirac topological insulator in the dz2 manifold of a honeycomb oxide
NASA Astrophysics Data System (ADS)
Lado, J. L.; Pardo, V.
2016-09-01
We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.
-X Mixing in T- and V-Shaped Quantum Wires
NASA Astrophysics Data System (ADS)
di Carlo, A.; Pescetelli, S.; Kavokin, A.; Vladimirova, M.; Lugli, P.
1997-11-01
We have applied both tight-binding (TB) and multivalley envelope function (MEF) techniques to calculate the electronic states in T- and V-shaped realistic quantum wires taking into account -X mixing in the conduction band. Strong reduction of the electron quantization energy due to the off-resonant -X mixing has been found in all types of quantum wires. This effect appears to be tied to the localization of the electron wave function and to its overlap with atomic layers next to interfaces.
Yamada, J; Watanabe, M; Akutsu, H; Nakatsuji, S; Nishikawa, H; Ikemoto, I; Kikuchi, K
2001-05-09
The synthesis, electrochemical properties, and molecular structure of a new pi-electron donor, 2,5-bis(1,3-dithian-2-ylidene)-1,3,4,6-tetrathiapentalene (BDA-TTP), is described. In contrast to the hitherto-known tetrachalcogenafulvalene pi-donors providing organic superconductors, this donor contains only the bis-fused 1,3-dithiole-2-ylidene unit as a pi-electron system, yet produces a series of ambient-pressure superconductors beta-(BDA-TTP)2X [X = SbF6 (magnetic T(c) = 6.9 K, resistive T(c) = 7.5 K), AsF6 (magnetic T(c) = 5.9 K, resistive T(c) = 5.8 K), and PF6 (magnetic T(c) = 5.9 K)], which are isostructural. The values of the intermolecular overlap integrals calculated on the donor layers of these superconductors suggest a two-dimensional (2D) electronic structure with loose donor packing. Tight-binding band calculations also indicate that these superconductors have the 2D band dispersion relations and closed Fermi surfaces.
NASA Astrophysics Data System (ADS)
Sadhukhan, Banasree; Singh, Prashant; Nayak, Arabinda; Datta, Sujoy; Johnson, Duane D.; Mookerjee, Abhijit
2017-08-01
We present a real-space formulation for calculating the electronic structure and optical conductivity of random alloys based on Kubo-Greenwood formalism interfaced with augmented space recursion technique [Mookerjee, J. Phys. C 6, 1340 (1973), 10.1088/0022-3719/6/8/003] formulated with the tight-binding linear muffin-tin orbital basis with the van Leeuwen-Baerends corrected exchange potential [Singh, Harbola, Hemanadhan, Mookerjee, and Johnson, Phys. Rev. B 93, 085204 (2016), 10.1103/PhysRevB.93.085204]. This approach has been used to quantitatively analyze the effect of chemical disorder on the configuration averaged electronic properties and optical response of two-dimensional honeycomb siliphene SixC1 -x beyond the usual Dirac-cone approximation. We predicted the quantitative effect of disorder on both the electronic structure and optical response over a wide energy range, and the results are discussed in the light of the available experimental and other theoretical data. Our proposed formalism may open up a facile way for planned band-gap engineering in optoelectronic applications.
Kim, Beom Seo; Rhim, Jun-Won; Kim, Beomyoung; Kim, Changyoung; Park, Seung Ryong
2016-01-01
Monolayer MX2 (M = Mo, W; X = S, Se) has recently been drawn much attention due to their application possibility as well as the novel valley physics. On the other hand, it is also important to understand the electronic structures of bulk MX2 for material applications since it is very challenging to grow large size uniform and sustainable monolayer MX2. We performed angle-resolved photoemission spectroscopy and tight binding calculations to investigate the electronic structures of bulk 2H-MX2. We could extract all the important electronic band parameters for bulk 2H-MX2, including the band gap, direct band gap size at K (-K) point and spin splitting size. Upon comparing the parameters for bulk 2H-MX2 (our work) with mono- and multi-layer MX2 (published), we found that stacked layers, substrates for thin films, and carrier concentration significantly affect the parameters, especially the band gap size. The origin of such effect is discussed in terms of the screening effect. PMID:27805019
Lattice distortion and electron charge redistribution induced by defects in graphene
Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...
2016-09-14
Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.
New Computational Approach to Electron Transport in Irregular Graphene Nanostructures
NASA Astrophysics Data System (ADS)
Mason, Douglas; Heller, Eric; Prendergast, David; Neaton, Jeffrey
2009-03-01
For novel graphene devices of nanoscale-to-macroscopic scale, many aspects of their transport properties are not easily understood due to difficulties in fabricating devices with regular edges. Here we develop a framework to efficiently calculate and potentially screen electronic transport properties of arbitrary nanoscale graphene device structures. A generalization of the established recursive Green's function method is presented, providing access to arbitrary device and lead geometries with substantial computer-time savings. Using single-orbital nearest-neighbor tight-binding models and the Green's function-Landauer scattering formalism, we will explore the transmission function of irregular two-dimensional graphene-based nanostructures with arbitrary lead orientation. Prepared by LBNL under contract DE-AC02-05CH11231 and supported by the U.S. Dept. of Energy Computer Science Graduate Fellowship under grant DE-FG02-97ER25308.
Green functions of graphene: An analytic approach
NASA Astrophysics Data System (ADS)
Lawlor, James A.; Ferreira, Mauro S.
2015-04-01
In this article we derive the lattice Green Functions (GFs) of graphene using a Tight Binding Hamiltonian incorporating both first and second nearest neighbour hoppings and allowing for a non-orthogonal electron wavefunction overlap. It is shown how the resulting GFs can be simplified from a double to a single integral form to aid computation, and that when considering off-diagonal GFs in the high symmetry directions of the lattice this single integral can be approximated very accurately by an algebraic expression. By comparing our results to the conventional first nearest neighbour model commonly found in the literature, it is apparent that the extended model leads to a sizeable change in the electronic structure away from the linear regime. As such, this article serves as a blueprint for researchers who wish to examine quantities where these considerations are important.
Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal
2017-12-01
Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.
Gopalan, A; Deka, G; Prabhavathi, M; Savithri, H S; Murthy, M R N; Raja, A
2018-01-01
Latent tuberculosis (TB) is the main hurdle in reaching the goal of "Stop TB 2050". Tuberculin skin and Interferon-gamma release assay tests used currently for the diagnosis of TB infection cannot distinguish between active disease and latent tuberculosis infection (LTBI) and hence new and sensitive protein markers need to be identified for the diagnosis. A protein Rv3716c from Mycobacterium tuberculosis (MtbRv3716c) has been identified as a potential surrogate marker for the diagnosis of LTBI. Here, we present characterization of MtbRv3716c (∼13 kDa) using both biophysical and X-Ray crystallographic methods. EMSA study showed that MtbRv3716c binds to double stranded DNA. X-ray diffraction data collected on a crystal of MtbRv3716c at 1.9 Å resolution was used for structure determination using the molecular replacement method. Significant electron density was not observed for the N-terminal 21 and C-terminal 41 residues in the final electron density map. The C- terminal disordered region is proline rich and displays characteristics of intrinsically disordered proteins. Although the crystal asymmetric unit contained a protomer, a tight dimer could be generated by the application of the crystal two-fold symmetry parallel to the b axis. Packing of dimers in the crystal is mediated by a cadmium ion (Cd 2+ ) occurring at the interface of two dimers. Molecular packing analysis reveals large cavities that are probably occupied by the disordered segments of the N- and C-termini. Structural comparison with other homologous hypothetical DNA binding proteins (PDB codes: 1PUG, 1YBX) highlights structural features that might be significant for DNA binding. Copyright © 2017 Elsevier Inc. All rights reserved.
Tunable molecular plasmons in polycyclic aromatic hydrocarbons.
Manjavacas, Alejandro; Marchesin, Federico; Thongrattanasiri, Sukosin; Koval, Peter; Nordlander, Peter; Sánchez-Portal, Daniel; García de Abajo, F Javier
2013-04-23
We show that chemically synthesized polycyclic aromatic hydrocarbons (PAHs) exhibit molecular plasmon resonances that are remarkably sensitive to the net charge state of the molecule and the atomic structure of the edges. These molecules can be regarded as nanometer-sized forms of graphene, from which they inherit their high electrical tunability. Specifically, the addition or removal of a single electron switches on/off these molecular plasmons. Our first-principles time-dependent density-functional theory (TDDFT) calculations are in good agreement with a simpler tight-binding approach that can be easily extended to much larger systems. These fundamental insights enable the development of novel plasmonic devices based upon chemically available molecules, which, unlike colloidal or lithographic nanostructures, are free from structural imperfections. We further show a strong interaction between plasmons in neighboring molecules, quantified in significant energy shifts and field enhancement, and enabling molecular-based plasmonic designs. Our findings suggest new paradigms for electro-optical modulation and switching, single-electron detection, and sensing using individual molecules.
NASA Astrophysics Data System (ADS)
Tucker, D. A.; Seo, D.-K.; Whangbo, M.-H.; Sivazlian, F. R.; Stoner, B. R.; Bozeman, S. P.; Sowers, A. T.; Nemanich, R. J.; Glass, J. T.
1995-07-01
We carried out experimental and theoretical studies aimed at probing interface interactions of diamond with Si, Ni, and Ni 3Si substrates. Oriented diamond films deposited on (100) silicon were characterized by polar Raman, polar XRD, and cross-sectional HRTEM. These studies show that the diamond-(100)/Si(100) interface does not adopt the 45°-rotation but the 3 : 2-match arrangement. Our extended Hückel tight-binding (EHTB) electronic structure calculations for a model system show that the interface interaction favors the 3 : 2-match arrangement. Growth on polycrystalline Ni 3Si resulted in oriented diamond particles while, under the same growth conditions, largely graphite was formed on the nickel substrate. Our EHTB electronic structure calculations for model systems show that the (111) and (100) surfaces of Ni 3Si have a strong preference for diamond-nucleation over graphite-nucleation, but this is not the case for the (111) and (100) surfaces of Ni.
Modeling Carbon and Hydrocarbon Molecular Structures in EZTB
NASA Technical Reports Server (NTRS)
Lee, Seungwon; vonAllmen, Paul
2007-01-01
A software module that models the electronic and mechanical aspects of hydrocarbon molecules and carbon molecular structures on the basis of first principles has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure, which is summarized briefly in the immediately preceding article. Of particular interest, this module can model carbon crystals and nanotubes characterized by various coordinates and containing defects, without need to adjust parameters of the physical model. The module has been used to study the changes in electronic properties of carbon nanotubes, caused by bending of the nanotubes, for potential utility as the basis of a nonvolatile, electriccharge- free memory devices. For example, in one application of the module, it was found that an initially 50-nmlong carbon, (10,10)-chirality nanotube, which is a metallic conductor when straight, becomes a semiconductor with an energy gap of .3 meV when bent to a lateral displacement of 4 nm at the middle.
Quantum transport through single and multilayer icosahedral fullerenes
NASA Astrophysics Data System (ADS)
Lovey, Daniel A.; Romero, Rodolfo H.
2013-10-01
We use a tight-binding Hamiltonian and Green functions methods to calculate the quantum transmission through single-wall fullerenes and bilayered and trilayered onions of icosahedral symmetry attached to metallic leads. The electronic structure of the onion-like fullerenes takes into account the curvature and finite size of the fullerenes layers as well as the strength of the intershell interactions depending on to the number of interacting atom pairs belonging to adjacent shells. Misalignment of the symmetry axes of the concentric iscosahedral shells produces breaking of the level degeneracies of the individual shells, giving rise some narrow quasi-continuum bands instead of the localized discrete peaks of the individual fullerenes. As a result, the transmission function for non symmetrical onions is rapidly varying functions of the Fermi energy. Furthermore, we found that most of the features of the transmission through the onions are due to the electronic structure of the outer shell with additional Fano-like antiresonances arising from coupling with or between the inner shells.
NASA Astrophysics Data System (ADS)
Pishtshev, A.; Rubin, P.
2018-04-01
By means of periodic density functional theory (DFT) electronic structure calculations, we investigate iron-site doping effects in a structural model of bulk FeAs2. Simulations performed within the projector augmented-wave method-Perdew-Burke-Ernzerhof (PBE) generalized gradient approximation (GGA) functional scheme reveal that the impacts of the two stoichiometric substitutions Fe → Mg and Fe → Ni are radically different with respect to the structural and electronic behavior of the dopants. In particular, unlike the Ni dopant, the Mg dopant incorporated in FeAs2 occupies a noncentral equilibrium position characterized by an off-center displacement from the reference higher-symmetry position. Analysis of the respective electron and vibrational factors allows us to explain this result in terms of the local pseudo Jahn-Teller effect (pJTE). On the basis of DFT calculations, we deduce which electron orbitals and lattice vibrational modes are appropriate for promoting the local instability at the origin of the pJTE. Quantitative evaluations of the pJTE parameters performed within the polyatomic formalism of an effective tight-binding model show that it is just the enhanced vibronic interaction in the Mg-[FeAs6] cluster that is responsible for the local lattice symmetry breaking.
NASA Astrophysics Data System (ADS)
Kwapiński, Tomasz
2017-03-01
The electron transport properties of a linear atomic chain are studied theoretically within the tight-binding Hamiltonian and the Green’s function method. Variations of the local density of states (DOS) along the chain are investigated. They are crucial in scanning tunnelling experiments and give important insight into the electron transport mechanism and charge distribution inside chains. It is found that depending on the chain parity the local DOS at the Fermi level can form cone-like structures (DOS cones) along the chain. The general condition for the local DOS oscillations is obtained and the linear behaviour of the local density function is confirmed analytically. DOS cones are characterized by a linear decay towards the chain which is in contrast to the propagation properties of charge density waves, end states and Friedel oscillations in one-dimensional systems. We find that DOS cones can appear due to non-resonant electron transport, the spin-orbit scattering or for chains fabricated on a substrate with localized electrons. It is also shown that for imperfect chains (e.g. with a reduced coupling strength between two neighboring sites) a diamond-like structure of the local DOS along the chain appears.
Electronic transport in methylated fragments of DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.
2015-11-16
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Electronic transport in methylated fragments of DNA
NASA Astrophysics Data System (ADS)
de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.
2015-11-01
We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.
Weng, Meng-Hsiung; Ju, Shin-Pon; Chen, Hsin-Tsung; Chen, Hui-Lung; Lu, Jian-Ming; Lin, Ken-Huang; Lin, Jenn-Sen; Hsieh, Jin-Yuan; Yang, Hsi-Wen
2013-02-01
The adsorption and dissociation properties of carbon monoxide (CO) molecule on tungsten W(n) (n = 10-15) nanoparticles have been investigated by density-functional theory (DFT) calculations. The lowest-energy structures for W(n) (n = 10-15) nanoparticles are found by the basin-hopping method and big-bang method with the modified tight-binding many-body potential. We calculated the corresponding adsorption energies, C-O bond lengths and dissociation barriers for adsorption of CO on nanoparticles. The electronic properties of CO on nanoparticles are studied by the analysis of density of state and charge density. The characteristic of CO on W(n) nanoparticles are also compared with that of W bulk.
Vasseur, Guillaume; Fagot-Revurat, Yannick; Sicot, Muriel; ...
2016-01-04
We study the electronic structure of an ordered array of poly(para-phenylene) chains produced by surface-catalyzed dehalogenative polymerization of 1,4-dibromobenzene on copper (110). The quantization of unoccupied molecular states is measured as a function of oligomer length by scanning tunnelling spectroscopy, with Fermi level crossings observed for chains longer than ten phenyl rings. Angle-resolved photoelectron spectroscopy reveals a quasi-one-dimensional valence band as well as a direct gap of 1.15 eV, as the conduction band is partially filled through adsorption on the surface. Tight-binding modelling and ab initio density functional theory calculations lead to a full description of the organic band-structure, includingmore » the k-dispersion, the gap size and electron charge transfer mechanisms, highlighting a strong substrate-molecule interaction that drives the system into a metallic behaviour. In summary, we have fully characterized the band structure of a carbon-based conducting wire. This model system may be considered as a fingerprint of -conjugation of surface organic frameworks.« less
Electronic and structural properties of M3(HITP)2 (M = Ni, Cu and Co) metal-organic frameworks
NASA Astrophysics Data System (ADS)
Silveira, Orlando; Chacham, Helio; Alexandre, Simone
Theoretical and experimental works have demonstrated that electrical and structural properties of metal-organic frameworks (MOF) can be significantly changed by the identity of the metal center, leading to a potential strategy for tuning the selectivity of the material toward different types of technological applications. In this work, we use first principle calculations to investigate the electronic properties of 2D MOF M3(HITP)2 (M is Ni, Cu and Co and HITP = 2,3,6,7,10,11 - hexaiminotriphenylene). Our results show that for M=Ni and Co, the structures are perfect planar and there is a full charge delocalization in the 2D plane of stacking due to the predominance of π - π bonding. The band structure for M = Ni shows that this material is a semiconductor with an indirect band gap of 132 meV, whilst for M = Co the band structure shows that this material is a ferromagnetic semiconductor with a direct band gap of 386 meV for spin down and a indirect band gap of 246 meV for spin up. For M=Cu, the material is a metal and adopts a distorted structure due to a different hybridization of the metal atom in comparison with its counterparts. We also propose a tight binding model that can represent the electronic structure near the Fermi level of this family of MOF.
NASA Astrophysics Data System (ADS)
Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.
2017-01-01
Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.
Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia
2013-01-01
RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042
Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia
2013-06-01
RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.
Cascaded spintronic logic with low-dimensional carbon
NASA Astrophysics Data System (ADS)
Friedman, Joseph S.; Girdhar, Anuj; Gelfand, Ryan M.; Memik, Gokhan; Mohseni, Hooman; Taflove, Allen; Wessels, Bruce W.; Leburton, Jean-Pierre; Sahakian, Alan V.
2017-06-01
Remarkable breakthroughs have established the functionality of graphene and carbon nanotube transistors as replacements to silicon in conventional computing structures, and numerous spintronic logic gates have been presented. However, an efficient cascaded logic structure that exploits electron spin has not yet been demonstrated. In this work, we introduce and analyse a cascaded spintronic computing system composed solely of low-dimensional carbon materials. We propose a spintronic switch based on the recent discovery of negative magnetoresistance in graphene nanoribbons, and demonstrate its feasibility through tight-binding calculations of the band structure. Covalently connected carbon nanotubes create magnetic fields through graphene nanoribbons, cascading logic gates through incoherent spintronic switching. The exceptional material properties of carbon materials permit Terahertz operation and two orders of magnitude decrease in power-delay product compared to cutting-edge microprocessors. We hope to inspire the fabrication of these cascaded logic circuits to stimulate a transformative generation of energy-efficient computing.
Decoupling of epitaxial graphene via gold intercalation probed by dispersive Raman spectroscopy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pillai, P. B., E-mail: p.pillai@sheffield.ac.uk, E-mail: m.desouza@sheffield.ac.uk; DeSouza, M., E-mail: p.pillai@sheffield.ac.uk, E-mail: m.desouza@sheffield.ac.uk; Narula, R.
Signatures of a superlattice structure composed of a quasi periodic arrangement of atomic gold clusters below an epitaxied graphene (EG) layer are examined using dispersive Raman spectroscopy. The gold-graphene system exhibits a laser excitation energy dependant red shift of the 2D mode as compared to pristine epitaxial graphene. The phonon dispersions in both the systems are mapped using the experimentally observed Raman signatures and a third-nearest neighbour tight binding electronic band structure model. Our results reveal that the observed excitation dependent Raman red shift in gold EG primarily arise from the modifications of the phonon dispersion in gold-graphene and showsmore » that the extent of decoupling of graphene from the underlying SiC substrate can be monitored from the dispersive nature of the Raman 2D modes. The intercalated gold atoms restore the phonon band structure of epitaxial graphene towards free standing graphene.« less
Energy spectrum and electrical conductivity of graphene with a nitrogen impurity
NASA Astrophysics Data System (ADS)
Repetskii, S. P.; Vyshivanaya, I. G.; Skotnikov, V. A.; Yatsenyuk, A. A.
2015-04-01
The electronic structure of graphene with a nitrogen impurity has been studied based on the model of tight binding using exchange-correlation potentials in the density-functional theory. Wave functions of 2 s and 2 p states of neutral noninteracting carbon atoms have been chosen as the basis. When studying the matrix elements of the Hamiltonian, the first three coordination shells have been taken into account. It has been established that the hybridization of electron-energy bands leads to the splitting of the electron energy spectrum near the Fermi level. Due to the overlap of the energy bands, the arising gap behaves as a quasi-gap, in which the density of the electron levels is much lower than in the rest of the spectrum. It has been established that the conductivity of graphene decreases with increasing nitrogen concentration. Since the increase in the nitrogen concentration leads to an increase in the density of states at the Fermi level, the decrease in the conductivity is due to a sharper decrease in the time of relaxation of the electron sates.
Quasiparticle dynamics and spin-orbital texture of the SrTiO3 two-dimensional electron gas.
King, P D C; McKeown Walker, S; Tamai, A; de la Torre, A; Eknapakul, T; Buaphet, P; Mo, S-K; Meevasana, W; Bahramy, M S; Baumberger, F
2014-02-27
Two-dimensional electron gases (2DEGs) in SrTiO3 have become model systems for engineering emergent behaviour in complex transition metal oxides. Understanding the collective interactions that enable this, however, has thus far proved elusive. Here we demonstrate that angle-resolved photoemission can directly image the quasiparticle dynamics of the d-electron subband ladder of this complex-oxide 2DEG. Combined with realistic tight-binding supercell calculations, we uncover how quantum confinement and inversion symmetry breaking collectively tune the delicate interplay of charge, spin, orbital and lattice degrees of freedom in this system. We reveal how they lead to pronounced orbital ordering, mediate an orbitally enhanced Rashba splitting with complex subband-dependent spin-orbital textures and markedly change the character of electron-phonon coupling, co-operatively shaping the low-energy electronic structure of the 2DEG. Our results allow for a unified understanding of spectroscopic and transport measurements across different classes of SrTiO3-based 2DEGs, and yield new microscopic insights on their functional properties.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ordejon, P.; Lebedenko, D.; Menon, M.
1994-08-15
We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v
NASA Astrophysics Data System (ADS)
Dass, Devi
2018-03-01
Graphene nanoribbon (GNR), a new 2D carbon nanomaterial, has some unique features and special properties that offer a great potential for interconnect, nanoelectronic devices, optoelectronics, and nanophotonics. This paper reports the structural analysis, electronic properties, and band gaps of a GNR considering different chirality combinations obtained using the pz orbital tight binding model. In structural analysis, the analytical expressions for GNRs have been developed and verified using the simulation for the first time. It has been found that the total number of unit cells and carbon atoms within an overall unit cell and molecular structure of a GNR have been changed with the change in their chirality values which are similar to the values calculated using the developed analytical expressions thus validating both the simulation as well as analytical results. Further, the electronic band structures at different chirality values have been shown for the identification of metallic and semiconductor properties of a GNR. It has been concluded that all zigzag edge GNRs are metallic with very small band gaps range whereas all armchair GNRs show both the metallic and semiconductor nature with very small and high band gaps range. Again, the total number of subbands in each electronic band structure is equal to the total number of carbon atoms present in overall unit cell of the corresponding GNR. The semiconductors GNRs can be used as a channel material in field effect transistor suitable for advanced CMOS technology whereas the metallic GNRs could be used for interconnect.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.Y.; Xiang, J.B.
We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.
Excitons in boron nitride single layer
NASA Astrophysics Data System (ADS)
Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François
2016-09-01
Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.
Bond-order potential for magnetic body-centered-cubic iron and its transferability
NASA Astrophysics Data System (ADS)
Lin, Yi-Shen; Mrovec, M.; Vitek, V.
2016-06-01
We derived and thoroughly tested a bond-order potential (BOP) for body-centered-cubic (bcc) magnetic iron that can be employed in atomistic calculations of a broad variety of crystal defects that control structural, mechanical, and thermodynamic properties of this technologically important metal. The constructed BOP reflects correctly the mixed nearly free electron and covalent bonding arising from the partially filled d band as well as the ferromagnetism that is actually responsible for the stability of the bcc structure of iron at low temperatures. The covalent part of the cohesive energy is determined within the tight-binding bond model with the Green's function of the Schrödinger equation determined using the method of continued fractions terminated at a sufficient level of the moments of the density of states. This makes the BOP an O (N ) method usable for very large numbers of particles. Only d d bonds are included explicitly, but the effect of s electrons on the covalent energy is included via their screening of the corresponding d d bonds. The magnetic part of the cohesive energy is included using the Stoner model of itinerant magnetism. The repulsive part of the cohesive energy is represented, as in any tight-binding scheme, by an empirical formula. Its functional form is physically justified by studies of the repulsion in face-centered-cubic (fcc) solid argon under very high pressure where the repulsion originates from overlapping s and p closed-shell electrons just as it does from closed-shell s electrons in transition metals squeezed into the ion core under the influence of the large covalent d bonding. Testing of the transferability of the developed BOP to environments significantly different from those of the ideal bcc lattice was carried out by studying crystal structures and magnetic states alternative to the ferromagnetic bcc lattice, vacancies, divacancies, self-interstitial atoms (SIAs), paths continuously transforming the bcc structure to different less symmetric structures and phonons. The results of these calculations are compared with either experiments or calculations based on the density functional theory (DFT), and they all show very good agreement. Importantly, the lowest energy configuration of SIAs agrees with DFT calculations that show that it is an exception within bcc transition metals controlled by magnetism. Moreover, the migration energy of interstitials is significantly lower than that of vacancies, which is essential for correct analysis of the effects of irradiation. Finally, the core structure and glide of ½ <111 > screw dislocations that control the plastic flow in single crystals of bcc metals was explored. The results fully agree with available DFT based studies and with experimental observations of the slip geometry of bcc iron at low temperatures.
Nonlinear susceptibilities of finite conjugated organic polymers
NASA Technical Reports Server (NTRS)
Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.
1987-01-01
Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.
Stacking-dependent electronic property of trilayer graphene epitaxially grown on Ru(0001)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Que, Yande; Xiao, Wende, E-mail: wdxiao@iphy.ac.cn, E-mail: hjgao@iphy.ac.cn; Chen, Hui
The growth, atomic structure, and electronic property of trilayer graphene (TLG) on Ru(0001) were studied by low temperature scanning tunneling microscopy and spectroscopy in combined with tight-binding approximation (TBA) calculations. TLG on Ru(0001) shows a flat surface with a hexagonal lattice due to the screening effect of the bottom two layers and the AB-stacking in the top two layers. The coexistence of AA- and AB-stacking in the bottom two layers leads to three different stacking orders of TLG, namely, ABA-, ABC-, and ABB-stacking. STS measurements combined with TBA calculations reveal that the density of states of TLG with ABC- andmore » ABB-stacking is characterized by one and two sharp peaks near to the Fermi level, respectively, in contrast to the V-shaped feature of TLG with ABA-stacking. Our work demonstrates that TLG on Ru(0001) might be an ideal platform for exploring stacking-dependent electronic properties of graphene.« less
Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B
2018-05-08
Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.
Electrical control of spin dynamics in finite one-dimensional systems
NASA Astrophysics Data System (ADS)
Pertsova, A.; Stamenova, M.; Sanvito, S.
2011-10-01
We investigate the possibility of the electrical control of spin transfer in monoatomic chains incorporating spin impurities. Our theoretical framework is the mixed quantum-classical (Ehrenfest) description of the spin dynamics, in the spirit of the s-d model, where the itinerant electrons are described by a tight-binding model while localized spins are treated classically. Our main focus is on the dynamical exchange interaction between two well-separated spins. This can be quantified by the transfer of excitations in the form of transverse spin oscillations. We systematically study the effect of an electrostatic gate bias Vg on the interconnecting channel and we map out the long-range dynamical spin transfer as a function of Vg. We identify regions of Vg giving rise to significant amplification of the spin transmission at low frequencies and relate this to the electronic structure of the channel.
Bloch oscillations as generators of polarons in a 1D crystal
NASA Astrophysics Data System (ADS)
Nazareno, H. N.; Brito, P. E. de
2016-08-01
The main purpose of this work is to characterize the kind of propagation/localization of carriers in a one-dimensional crystalline structure along the tight-binding model while the electron-phonon interaction is taken into account through a deformation potential and the system is under the action of a dc electric field. The lattice was treated in the classical formalism of harmonic vibrations. A remarkable effect is obtained due to the presence of the electric field. On one side the particle performs Bloch oscillations and at the same time it interacts with the lattice and as a result at each turning point of its trajectory phonons are generated that carry with them a fraction of the electronic wave packet, it is the polaron formation. This way the Bloch oscillations pump polarons into the system. We explain why the polaron is formed at returning points of the oscillations.
disorder effect on quantum transport properties of ultra thin Fe film
NASA Astrophysics Data System (ADS)
Zhang, Xiaotian; Nakamura, Kohji; Shindou, Ryuichi
2015-03-01
Ferromagnetic ultrathin films are experimentally known to often exhibit perpendicular magnetic anisotropy, when being placed on certain substrates. Based on reported ab-initio band calculations of free-standing Fe-monolayer and that on MgO substrate, we will introduce an effective tight-binding model, which capture a part of an electronic structure near Fermi level for both cases. We will show that the model supports electronic bands with non-zero Chern number and chiral edge modes which cross a direct band gap on the order of 50meV. Unluckily, however, the direct band gap is also masked by another dispersive bands which have non-zero Berry's curvature in the k-space. To demonstrate how disorder kills conducting characters of the latter bulk bands while leave intact those of the chiral edge modes, we will clarify behaviors of localization length and conductance in the effective model with on-site disorders.
Joe, Yong S; Lee, Sun H; Hedin, Eric R; Kim, Young D
2013-06-01
We utilize a two-dimensional four-channel DNA model, with a tight-binding (TB) Hamiltonian, and investigate the temperature and the magnetic field dependence of the transport behavior of a short DNA molecule. Random variation of the hopping integrals due to the thermal structural disorder, which partially destroy phase coherence of electrons and reduce quantum interference, leads to a reduction of the localization length and causes suppressed overall transmission. We also incorporate a variation of magnetic field flux density into the hopping integrals as a phase factor and observe Aharonov-Bohm (AB) oscillations in the transmission. It is shown that for non-zero magnetic flux, the transmission zero leaves the real-energy axis and moves up into the complex-energy plane. We also point out that the hydrogen bonds between the base pair with flux variations play a role to determine the periodicity of AB oscillations in the transmission.
Thinking Like a Chemist: Intuition in Thermoelectric Materials.
Zeier, Wolfgang G; Zevalkink, Alex; Gibbs, Zachary M; Hautier, Geoffroy; Kanatzidis, Mercouri G; Snyder, G Jeffrey
2016-06-06
The coupled transport properties required to create an efficient thermoelectric material necessitates a thorough understanding of the relationship between the chemistry and physics in a solid. We approach thermoelectric material design using the chemical intuition provided by molecular orbital diagrams, tight binding theory, and a classic understanding of bond strength. Concepts such as electronegativity, band width, orbital overlap, bond energy, and bond length are used to explain trends in electronic properties such as the magnitude and temperature dependence of band gap, carrier effective mass, and band degeneracy and convergence. The lattice thermal conductivity is discussed in relation to the crystal structure and bond strength, with emphasis on the importance of bond length. We provide an overview of how symmetry and bonding strength affect electron and phonon transport in solids, and how altering these properties may be used in strategies to improve thermoelectric performance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Rationalizing Tight Ligand Binding through Cooperative Interaction Networks
2011-01-01
Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588
Reinvestigation of the giant Rashba-split states on Bi-covered Si(111)
NASA Astrophysics Data System (ADS)
Berntsen, M. H.; Götberg, O.; Tjernberg, O.
2018-03-01
We study the electronic and spin structures of the giant Rashba-split surface states of the Bi/Si(111)-(√{3 }×√{3 }) R 30∘ trimer phase by means of spin- and angle-resolved photoelectron spectroscopy (spin-ARPES). Supported by tight-binding calculations of the surface state dispersion and spin orientation, our findings show that the spin experiences a vortexlike structure around the Γ ¯ point of the surface Brillouin zone—in accordance with the standard Rashba model. Moreover, we find no evidence of a spin vortex around the K ¯ point in the hexagonal Brillouin zone and thus no peculiar Rashba split around this point, something that has been suggested by previous works. Rather the opposite, our results show that the spin structure around K¯ can be fully understood by taking into account the symmetry of the Brillouin zone and the intersection of spin vortices centered around the Γ ¯ points in neighboring Brillouin zones. As a result, the spin structure is consistently explained within the standard framework of the Rashba model although the spin-polarized surface states experience a more complex dispersion compared to free-electron-like parabolic states.
NASA Technical Reports Server (NTRS)
Lee, Seungwon; vonAllmen, Paul; Oyafuso, Fabiano; Klimeck, Gerhard; Whale, K. Birgitta
2004-01-01
Electron spin dephasing and decoherence by its interaction with nuclear spins in self-assembled quantum dots are investigated in the framework of the empirical tight-binding model. Electron spin dephasing in an ensemble of dots is induced by the inhomogeneous precession frequencies of the electron among dots, while electron spin decoherence in a single dot arises from the inhomogeneous precession frequencies of nuclear spins in the dot. For In(x)Ga(1-x) As self-assembled dots containing 30000 nuclei, the dephasing and decoherence times are predicted to be on the order of 100 ps and 1 (micro)s.
Tight-binding calculation of the magnetic moment of CrAs under pressure
NASA Astrophysics Data System (ADS)
Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio
2018-03-01
We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morris, J.R.; Lu, Z.Y.; Ring, D.M.
The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.
The role of cytosine methylation on charge transport through a DNA strand
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu; Govind, Niranjan, E-mail: niri.govind@pnnl.gov
Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance throughmore » the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.« less
NASA Astrophysics Data System (ADS)
Mir, Raja N.; Frensley, William R.
2013-10-01
InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.
The role of cytosine methylation on charge transport through a DNA strand
NASA Astrophysics Data System (ADS)
Qi, Jianqing; Govind, Niranjan; Anantram, M. P.
2015-09-01
Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pampa, K.J., E-mail: sagarikakj@gmail.com; Lokanath, N.K.; Girish, T.U.
Highlights: • Determined the structure of UDP-D-ManNAcADH to a resolution of 1.55 Å. • First complex structure of PhUDP-D-ManNAcADH with UDP-D-ManMAcA. • The monomeric structure consists of three distinct domains. • Cys258 acting as catalytic nucleophilic and Lys204 acts as acid/base catalyst. • Oligomeric state plays an important role for the catalytic function. - Abstract: UDP-N-acetyl-D-mannosamine dehydrogenase (UDP-D-ManNAcDH) belongs to UDP-glucose/GDP-mannose dehydrogenase family and catalyzes Uridine-diphospho-N-acetyl-D-mannosamine (UDP-D-ManNAc) to Uridine-diphospho-N-acetyl-D-mannosaminuronic acid (UDP-D-ManNAcA) through twofold oxidation of NAD{sup +}. In order to reveal the structural features of the Pyrococcus horikoshii UDP-D-ManNAcADH, we have determined the crystal structure of the product-bound enzyme bymore » X-ray diffraction to resolution of 1.55 Å. The protomer folds into three distinct domains; nucleotide binding domain (NBD), substrate binding domain (SBD) and oligomerization domain (OD, involved in the dimerization). The clear electron density of the UDP-D-ManNAcA is observed and the residues binding are identified for the first time. Crystal structures reveal a tight dimeric polymer chains with product-bound in all the structures. The catalytic residues Cys258 and Lys204 are conserved. The Cys258 acts as catalytic nucleophile and Lys204 as acid/base catalyst. The product is directly interacts with residues Arg211, Thr249, Arg244, Gly255, Arg289, Lys319 and Arg398. In addition, the structural parameters responsible for thermostability and oligomerization of the three dimensional structure are analyzed.« less
NASA Technical Reports Server (NTRS)
Bates, Kevin R.; Scuseria, Gustavo E.
1998-01-01
Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite. However. theoretical models or large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations or round buckyonions and theoretical predictions of faceted icosahedral fullerenes.
Size versus electronic factors in transition metal carbide and TCP phase stability
NASA Astrophysics Data System (ADS)
Pettifor, D. G.; Seiser, B.; Margine, E. R.; Kolmogorov, A. N.; Drautz, R.
2013-09-01
The contributions of atomic size and electronic factors to the structural stability of transition metal carbides and topologically close-packed (TCP) phases are investigated. The hard-sphere model that has been used by Cottrell to rationalize the occurrence of the octahedral and trigonal local coordination polyhedra within the transition metal carbides is shown to have limitations in TiC since density functional theory (DFT) predicts that the second most metastable phase closest to the B1 (NaCl) ground state takes the B? (BN) structure type with 5-atom local coordination polyhedra with very short Ti-C bond lengths. The importance of electronic factors in the TCP phases is demonstrated by DFT predictions that the A15, ? and ? phases are stabilized between groups VI and VII of the elemental transition metals, whereas the ? and Laves phases are destabilized. The origin of this difference is related to the bimodal shape parameter of the electronic density of states by using the bond-order potential expansion of the structural energy within a canonical tight-binding model. The importance of the size factor in the TCP phases is illustrated by the DFT heats of formation for the binary systems Mo-Re, Mo-Ru, Nb-Re and Nb-Ru which show that the ? and Laves phases become more and more stable compared to A15, ? and ? as the size factor increases from Mo-Re through to Nb-Ru.
NASA Astrophysics Data System (ADS)
Szczęśniak, Dominik; Ennaoui, Ahmed; Ahzi, Saïd
2016-09-01
Recently, the transition metal dichalcogenides have attracted renewed attention due to the potential use of their low-dimensional forms in both nano- and opto-electronics. In such applications, the electronic and transport properties of monolayer transition metal dichalcogenides play a pivotal role. The present paper provides a new insight into these essential properties by studying the complex band structures of popular transition metal dichalcogenide monolayers (MX 2, where M = Mo, W; X = S, Se, Te) while including spin-orbit coupling effects. The conducted symmetry-based tight-binding calculations show that the analytical continuation from the real band structures to the complex momentum space leads to nonlinear generalized eigenvalue problems. Herein an efficient method for solving such a class of nonlinear problems is presented and yields a complete set of physically relevant eigenvalues. Solutions obtained by this method are characterized and classified into propagating and evanescent states, where the latter states manifest not only monotonic but also oscillatory decay character. It is observed that some of the oscillatory evanescent states create characteristic complex loops at the direct band gap of MX 2 monolayers, where electrons can directly tunnel between the band gap edges. To describe these tunneling currents, decay behavior of electronic states in the forbidden energy region is elucidated and their importance within the ballistic transport regime is briefly discussed.
Structure of a AAA+ unfoldase in the process of unfolding substrate
Ripstein, Zev A; Huang, Rui; Augustyniak, Rafal; Kay, Lewis E; Rubinstein, John L
2017-01-01
AAA+ unfoldases are thought to unfold substrate through the central pore of their hexameric structures, but how this process occurs is not known. VAT, the Thermoplasma acidophilum homologue of eukaryotic CDC48/p97, works in conjunction with the proteasome to degrade misfolded or damaged proteins. We show that in the presence of ATP, VAT with its regulatory N-terminal domains removed unfolds other VAT complexes as substrate. We captured images of this transient process by electron cryomicroscopy (cryo-EM) to reveal the structure of the substrate-bound intermediate. Substrate binding breaks the six-fold symmetry of the complex, allowing five of the six VAT subunits to constrict into a tight helix that grips an ~80 Å stretch of unfolded protein. The structure suggests a processive hand-over-hand unfolding mechanism, where each VAT subunit releases the substrate in turn before re-engaging further along the target protein, thereby unfolding it. DOI: http://dx.doi.org/10.7554/eLife.25754.001 PMID:28390173
Cryo-EM structure of aerolysin variants reveals a novel protein fold and the pore-formation process
NASA Astrophysics Data System (ADS)
Iacovache, Ioan; de Carlo, Sacha; Cirauqui, Nuria; Dal Peraro, Matteo; van der Goot, F. Gisou; Zuber, Benoît
2016-07-01
Owing to their pathogenical role and unique ability to exist both as soluble proteins and transmembrane complexes, pore-forming toxins (PFTs) have been a focus of microbiologists and structural biologists for decades. PFTs are generally secreted as water-soluble monomers and subsequently bind the membrane of target cells. Then, they assemble into circular oligomers, which undergo conformational changes that allow membrane insertion leading to pore formation and potentially cell death. Aerolysin, produced by the human pathogen Aeromonas hydrophila, is the founding member of a major PFT family found throughout all kingdoms of life. We report cryo-electron microscopy structures of three conformational intermediates and of the final aerolysin pore, jointly providing insight into the conformational changes that allow pore formation. Moreover, the structures reveal a protein fold consisting of two concentric β-barrels, tightly kept together by hydrophobic interactions. This fold suggests a basis for the prion-like ultrastability of aerolysin pore and its stoichiometry.
Resonant and nondissipative tunneling in independently contacted graphene structures
NASA Astrophysics Data System (ADS)
Vasko, F. T.
2013-02-01
The tunneling processes between independently contacted graphene sheets separated by thin insulator are restricted by the momentum and energy conservation laws. Because of this, both dissipative tunneling transitions, with momentum transfer due to disorder scattering, and nondissipative regime of tunneling, which appears due to intersection of electron and hole branches of energy spectrum, must be taken into account. The tunneling current density is calculated for the graphene-boron nitride-graphene layers, which is described by the tight-binding approach, and for the predominant momentum scattering by static disorder. Dependencies of current on concentrations in top and bottom graphene layers, which are governed by the voltages applied through independent contacts and gates, are considered for the back- and double-gated structures. The current-voltage characteristics of the back-gated structure are in agreement with the recent experiment [ScienceSCIEAS0036-807510.1126/science.1218461 335, 947 (2012)]. For the double-gated structures, the resonant dissipative tunneling causes a 10-fold enhancement of response which is important for transistor applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grimme, Stefan, E-mail: grimme@thch.uni-bonn.de; Bannwarth, Christoph
2016-08-07
The computational bottleneck of the extremely fast simplified Tamm-Dancoff approximated (sTDA) time-dependent density functional theory procedure [S. Grimme, J. Chem. Phys. 138, 244104 (2013)] for the computation of electronic spectra for large systems is the determination of the ground state Kohn-Sham orbitals and eigenvalues. This limits such treatments to single structures with a few hundred atoms and hence, e.g., sampling along molecular dynamics trajectories for flexible systems or the calculation of chromophore aggregates is often not possible. The aim of this work is to solve this problem by a specifically designed semi-empirical tight binding (TB) procedure similar to the wellmore » established self-consistent-charge density functional TB scheme. The new special purpose method provides orbitals and orbital energies of hybrid density functional character for a subsequent and basically unmodified sTDA procedure. Compared to many previous semi-empirical excited state methods, an advantage of the ansatz is that a general eigenvalue problem in a non-orthogonal, extended atomic orbital basis is solved and therefore correct occupied/virtual orbital energy splittings as well as Rydberg levels are obtained. A key idea for the success of the new model is that the determination of atomic charges (describing an effective electron-electron interaction) and the one-particle spectrum is decoupled and treated by two differently parametrized Hamiltonians/basis sets. The three-diagonalization-step composite procedure can routinely compute broad range electronic spectra (0-8 eV) within minutes of computation time for systems composed of 500-1000 atoms with an accuracy typical of standard time-dependent density functional theory (0.3-0.5 eV average error). An easily extendable parametrization based on coupled-cluster and density functional computed reference data for the elements H–Zn including transition metals is described. The accuracy of the method termed sTDA-xTB is first benchmarked for vertical excitation energies of open- and closed-shell systems in comparison to other semi-empirical methods and applied to exemplary problems in electronic spectroscopy. As side products of the development, a robust and efficient valence electron TB method for the accurate determination of atomic charges as well as a more accurate calculation scheme of dipole rotatory strengths within the Tamm-Dancoff approximation is proposed.« less
Electronic structure and the origin of the Dzyaloshinskii-Moriya interaction in MnSi
Satpathy, S.; Shanavas, K. V.
2016-05-02
Here, the metallic helimagnet MnSi has been found to exhibit skyrmionic spin textures when subjected to magnetic fields at low temperatures. The Dzyaloshinskii-Moriya (DM) interaction plays a key role in stabilizing the skyrmion state. With the help of first-principles calculations, crystal field theory and a tight-binding model we study the electronic structure and the origin of the DM interaction in the B20 phase of MnSi. The strength ofmore » $$\\vec{D}$$ parameter is determined by the magnitude of the spin-orbit interaction and the degree of orbital mixing, induced by the symmetry-breaking distortions in the B20 phase. We find that, strong coupling between Mn-$d$ and Si-$p$ states lead to a mixed valence ground state $$|d^{7-x}p^{2+x}\\rangle$$ configuration. The experimental magnetic moment of $$0.4~\\mu_B$$ is consistent with the Coulomb-corrected DFT+$U$ calculations, which redistributes electrons between the majority and minority spin channels. We derive the magnetic interaction parameters $J$ and $$\\vec{D}$$ for Mn-Si-Mn superexchange paths using Moriya's theory assuming the interaction to be mediated by $$e_g$$ electrons near the Fermi level. Finally, using parameters from our calculations, we get reasonable agreement with the observations.« less
NASA Astrophysics Data System (ADS)
Sadhukhan, B.; Nayak, A.; Mookerjee, A.
2017-12-01
In this communication we present together four distinct techniques for the study of electronic structure of solids: the tight-binding linear muffin-tin orbitals, the real space and augmented space recursions and the modified exchange-correlation. Using this we investigate the effect of random vacancies on the electronic properties of the carbon hexagonal allotrope, graphene, and the non-hexagonal allotrope, planar T graphene. We have inserted random vacancies at different concentrations, to simulate disorder in pristine graphene and planar T graphene sheets. The resulting disorder, both on-site (diagonal disorder) as well as in the hopping integrals (off-diagonal disorder), introduces sharp peaks in the vicinity of the Dirac point built up from localized states for both hexagonal and non-hexagonal structures. These peaks become resonances with increasing vacancy concentration. We find that in presence of vacancies, graphene-like linear dispersion appears in planar T graphene and the cross points form a loop in the first Brillouin zone similar to buckled T graphene that originates from π and π* bands without regular hexagonal symmetry. We also calculate the single-particle relaxation time, τ (ěc {q}) of ěc {q} labeled quantum electronic states which originates from scattering due to presence of vacancies, causing quantum level broadening.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya
The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Wang, Lei; Jakowski, Jacek; Garashchuk, Sophya; ...
2016-08-09
The experimentally observed effect of selective deuterium substitution on the open circuit voltage for a blend of poly(3-hexylthiophene)(P3HT) and [6,6]-phenyl-C 61- butyric acid methyl ester (PCBM) (Nat. Commun. 5:3180, 2014) is explored using a 221-atom model of a polymer-wrapped PCBM molecule. We describe the protonic and deuteronic wavefunctions for the H/D isotopologues of the hexyl side chains within a Quantum Trajectory/Electronic Structure approach where the dynamics is performed with newly developed nonlinear corrections to the quantum forces, necessary to describe the nuclear wavefunctions; the classical forces are generated with a Density Functional Tight Binding method. We used the resulting protonicmore » and deuteronic time-dependent wavefunctions to assess the effects of isotopic substitution (deuteration) on the energy gaps relevant to the charge transfer for the donor and acceptor electronic states. Furthermore, while the isotope effect on the electronic energy levels is found negligible, the quantum-induced fluctuations of the energy gap between the charge transfer and charge separated states due to nuclear wavefunctions may account for experimental trends by promoting charge transfer in P3HT/PCBM and increasing charge recombination on the donor in the deuterium substituted P3HT/PCBM.« less
Suen, Nian-Tzu; Guo, Sheng-Ping; Hoos, James; Bobev, Svilen
2018-05-07
Reported are the syntheses, crystal structures, and electronic structures of six rare-earth metal-lithium stannides with the general formulas RE 3 Li 4- x Sn 4+ x (RE = La-Nd, Sm) and Eu 7 Li 8- x Sn 10+ x . These new ternary compounds have been synthesized by high-temperature reactions of the corresponding elements. Their crystal structures have been established using single-crystal X-ray diffraction methods. The RE 3 Li 4- x Sn 4+ x phases crystallize in the orthorhombic body-centered space group Immm (No. 71) with the Zr 3 Cu 4 Si 4 structure type (Pearson code oI22), and the Eu 7 Li 8- x Sn 10+ x phase crystallizes in the orthorhombic base-centered space group Cmmm (No. 65) with the Ce 7 Li 8 Ge 10 structure type (Pearson code oC50). Both structures can be consdered as part of the [RESn 2 ] n [RELi 2 Sn] m homologous series, wherein the structures are intergrowths of imaginary RESn 2 (AlB 2 -like structure type) and RELi 2 Sn (MgAl 2 Cu-like structure type) fragments. Close examination the structures indicates complex occupational Li-Sn disorder, apparently governed by the drive of the structure to achieve an optimal number of valence electrons. This conclusion based on experimental results is supported by detailed electronic structure calculations, carried out using the tight-binding linear muffin-tin orbital method.
Structural basis for the inhibition of bacterial multidrug exporters.
Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito
2013-08-01
The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.
NASA Astrophysics Data System (ADS)
Kishi, Ayaka; Oda, Masato; Shinozuka, Yuzo
2016-05-01
This paper reports on the electronic states of compound semiconductor alloys of wurtzite structure calculated by the recently proposed interacting quasi-band (IQB) theory combined with empirical sp3 tight-binding models. Solving derived quasi-Hamiltonian 24 × 24 matrix that is characterized by the crystal parameters of the constituents facilitates the calculation of the conduction and valence bands of wurtzite alloys for arbitrary concentrations under a unified scheme. The theory is applied to III-V and II-VI wurtzite alloys: cation-substituted Al1- x Ga x N and Ga1- x In x N and anion-substituted CdS1- x Se x and ZnO1- x S x . The obtained results agree well with the experimental data, and are discussed in terms of mutual mixing between the quasi-localized states (QLS) and quasi-average bands (QAB): the latter bands are approximately given by the virtual crystal approximation (VCA). The changes in the valence and conduction bands, and the origin of the band gap bowing are discussed on the basis of mixing character.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in
We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less
Universal Sign Control of Coupling in Tight-Binding Lattices
NASA Astrophysics Data System (ADS)
Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander
2016-05-01
We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.
NASA Technical Reports Server (NTRS)
Labbe, J.; Friedel, J.
1978-01-01
In V3Si, the V atoms form an array of dense linear chains; a tight-binding approximation in one dimension was used to describe the d electrons. The electronic energy calculated by this method was reduced when the lattice is deformed. This lead to a band type of the Jahn Teller effect, which may explain the cubic to tetragonal transition which was observed at low temperatures. The theory can be extended to other superconductors of the V3X type when X=Ga, Ge, Sn, etcetera, or NB3SN.
Bipolaron assisted Bloch-like oscillations in organic lattices
NASA Astrophysics Data System (ADS)
Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo
2017-06-01
The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.
Thermally induced charge current through long molecules
NASA Astrophysics Data System (ADS)
Zimbovskaya, Natalya A.; Nitzan, Abraham
2018-01-01
In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
NASA Astrophysics Data System (ADS)
Vinodha, M.; Senthilkumar, K.
2018-05-01
The structure-activity relationship of fused π-conjugated imidazolium cation with three counter anion molecules, BF4-, CF3SO3- and (CF3SO2)2N-, was studied using electronic structure calculations. The structural, opto-electronic and charge transport properties of these complexes were studied. The charge transfer from π-conjugated imidazolium(I) to counter anion was confirmed in all the studied complexes. Interaction energy varies significantly depending on the counter anion and the stability was found higher for I-BF4 complex than both I-CF3SO3 and I-(CF3SO2)2N complexes. The strong (C-H)+...F- hydrogen bond of length 1.95 Å between fused π-conjugated imidazolium and BF-4 anion is the driving force for the strongest interaction energy in I-BF4 complex. The energy decomposition analysis confirms that the interaction between imidazolium and counter anion is mainly driven by electrostatic and orbital interaction. It has been observed that the absorption spectra of the complex are independent of anion nature but the influence of anion character is observed on frontier molecular orbital pattern. The charge transport property of I-BF4 complex was studied by using tight-binding Hamiltonian approach and found that the hole mobility in I-BF4 is 1.13 × 10-4 cm2 V-1 s-1.
Entanglement entropy and entanglement spectrum of Bi1-xSbx (111) bilayers.
Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz
2018-02-14
We study topological properties of Bi$_{1-x}$Sb$_{x}$ bilayers in the (111) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. Topologically non-trivial nature of bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayer and strain in Sb bilayer. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case. © 2018 IOP Publishing Ltd.
Entanglement entropy and entanglement spectrum of Bi1-x Sb x (1 1 1) bilayers.
Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz
2018-02-28
We study topological properties of Bi 1-x Sb x bilayers in the (1 1 1) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. The topologically non-trivial nature of the bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayers and strain in Sb bilayers. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case.
Excitonic structure of the optical conductivity in MoS2 monolayers
NASA Astrophysics Data System (ADS)
Ridolfi, Emilia; Lewenkopf, Caio H.; Pereira, Vitor M.
2018-05-01
We investigate the excitonic spectrum of MoS2 monolayers and calculate its optical absorption properties over a wide range of energies. Our approach takes into account the anomalous screening in two dimensions and the presence of a substrate, both cast by a suitable effective Keldysh potential. We solve the Bethe-Salpeter equation using as a basis a Slater-Koster tight-binding model parameterized to fit the ab initio MoS2 band structure calculations. The resulting optical conductivity is in good quantitative agreement with existing measurements up to ultraviolet energies. We establish that the electronic contributions to the C excitons arise not from states at the Γ point, but from a set of k points over extended portions of the Brillouin zone. Our results reinforce the advantages of approaches based on effective models to expeditiously explore the properties and tunability of excitons in TMD systems.
Doping of Semiconducting Atomic Chains
NASA Technical Reports Server (NTRS)
Toshishige, Yamada; Kutler, Paul (Technical Monitor)
1997-01-01
Due to the rapid progress in atom manipulation technology, atomic chain electronics would not be a dream, where foreign atoms are placed on a substrate to form a chain, and its electronic properties are designed by controlling the lattice constant d. It has been shown theoretically that a Si atomic chain is metallic regardless of d and that a Mg atomic chain is semiconducting or insulating with a band gap modified with d. For electronic applications, it is essential to establish a method to dope a semiconducting chain, which is to control the Fermi energy position without altering the original band structure. If we replace some of the chain atoms with dopant atoms randomly, the electrons will see random potential along the chain and will be localized strongly in space (Anderson localization). However, if we replace periodically, although the electrons can spread over the chain, there will generally appear new bands and band gaps reflecting the new periodicity of dopant atoms. This will change the original band structure significantly. In order to overcome this dilemma, we may place a dopant atom beside the chain at every N lattice periods (N > 1). Because of the periodic arrangement of dopant atoms, we can avoid the unwanted Anderson localization. Moreover, since the dopant atoms do not constitute the chain, the overlap interaction between them is minimized, and the band structure modification can be made smallest. Some tight-binding results will be discussed to demonstrate the present idea.
Entanglement entropy and entanglement spectrum of Bi1-x Sb x (1 1 1) bilayers
NASA Astrophysics Data System (ADS)
Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz
2018-03-01
We study topological properties of Bi1-x Sb x bilayers in the (1 1 1) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. The topologically non-trivial nature of the bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayers and strain in Sb bilayers. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case.
Oliveira, Augusto F; Philipsen, Pier; Heine, Thomas
2015-11-10
In the first part of this series, we presented a parametrization strategy to obtain high-quality electronic band structures on the basis of density-functional-based tight-binding (DFTB) calculations and published a parameter set called QUASINANO2013.1. Here, we extend our parametrization effort to include the remaining terms that are needed to compute the total energy and its gradient, commonly referred to as repulsive potential. Instead of parametrizing these terms as a two-body potential, we calculate them explicitly from the DFTB analogues of the Kohn-Sham total energy expression. This strategy requires only two further numerical parameters per element. Thus, the atomic configuration and four real numbers per element are sufficient to define the DFTB model at this level of parametrization. The QUASINANO2015 parameter set allows the calculation of energy, structure, and electronic structure of all systems composed of elements ranging from H to Ca. Extensive benchmarks show that the overall accuracy of QUASINANO2015 is comparable to that of well-established methods, including PM7 and hand-tuned DFTB parameter sets, while coverage of a much larger range of chemical systems is available.
Electronic properties of one-dimensional nanostructures of the Bi2Se3 topological insulator
NASA Astrophysics Data System (ADS)
Virk, Naunidh; Autès, Gabriel; Yazyev, Oleg V.
2018-04-01
We theoretically study the electronic structure and spin properties of one-dimensional nanostructures of the prototypical bulk topological insulator Bi2Se3 . Realistic models of experimentally observed Bi2Se3 nanowires and nanoribbons are considered using the tight-binding method. At low energies, the band structures are composed of a series of evenly spaced degenerate subbands resulting from circumferential confinement of the topological surface states. The direct band gaps due to the nontrivial π Berry phase show a clear dependence on the circumference. The spin-momentum locking of the topological surface states results in a pronounced 2 π spin rotation around the circumference with the degree of spin polarization dependent on the momentum along the nanostructure. Overall, the band structures and spin textures are more complicated for nanoribbons, which expose two distinct facets. The effects of reduced dimensionality are rationalized with the help of a simple model that considers circumferential quantization of the topological surface states. Furthermore, the surface spin density induced by an electric current along the nanostructure shows a pronounced oscillatory dependence on the charge-carrier energy, which can be exploited in spintronics applications.
Recognition of Local DNA Structures by p53 Protein
Brázda, Václav; Coufal, Jan
2017-01-01
p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646
Du, Haijuan; Massiah, Michael A.
2011-01-01
Alpha4 is a regulatory subunit of the protein phosphatase family of enzymes and plays an essential role in regulating the catalytic subunit of PP2A (PP2Ac) within the rapamycin-sensitive signaling pathway. Alpha4 also interacts with MID1, a microtubule-associated ubiquitin E3 ligase that appears to regulate the function of PP2A. The C-terminal region of alpha4 plays a key role in the binding interaction of PP2Ac and MID1. Here we report on the solution structure of a 45-amino acid region derived from the C-terminus of alpha4 (alpha45) that binds tightly to MID1. In aqueous solution, alpha45 has properties of an intrinsically unstructured peptide although chemical shift index and dihedral angle estimation based on chemical shifts of backbone atoms indicate the presence of a transient α-helix. Alpha45 adopts a helix-turn-helix HEAT-like structure in 1% SDS micelles, which may mimic a negatively charged surface for which alpha45 could bind. Alpha45 binds tightly to the Bbox1 domain of MID1 in aqueous solution and adopts a structure consistent with the helix-turn-helix structure observed in 1% SDS. The structure of alpha45 reveals two distinct surfaces, one that can interact with a negatively charged surface, which is present on PP2A, and one that interacts with the Bbox1 domain of MID1. PMID:22194938
Patikoglou, Georgia A; Westblade, Lars F; Campbell, Elizabeth A; Lamour, Valérie; Lane, William J; Darst, Seth A
2007-09-21
The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) sigma(70) factor. Rsd plays a role in alternative sigma factor-dependent transcription by biasing the competition between sigma(70) and alternative sigma factors for the available core RNAP. Here, we determined the 2.6 A-resolution X-ray crystal structure of Rsd bound to sigma(70) domain 4 (sigma(70)(4)), the primary determinant for Rsd binding within sigma(70). The structure reveals that Rsd binding interferes with the two primary functions of sigma(70)(4), core RNAP binding and promoter -35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the sigma(70)(4)-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between sigma(70)(4) binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.
Crystal structure of the Escherichia coli regulator of σ70, Rsd, in complex with σ70 domain 4
Patikoglou, Georgia A.; Westblade, Lars F.; Campbell, Elizabeth A.; Lamour, Valérie; Lane, William J.; Darst, Seth A.
2007-01-01
Summary The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) σ70 factor. Rsd plays a role in alternative σ factor-dependent transcription by biasing the competition between σ70 and alternative σ factors for the available core RNAP. Here, we determined the 2.6 Å-resolution X-ray crystal structure of Rsd bound to σ70 domain 4 (σ704), the primary determinant for Rsd binding within σ70. The structure reveals that Rsd binding interferes with the two primary functions of σ704, core RNAP binding and promoter –35 element binding. Interestingly, the most highly conserved Rsd residues form a network of interactions through the middle of the Rsd structure that connect the σ704-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between σ704 binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation. PMID:17681541
Carbon Nanotube Based Molecular Electronics
NASA Technical Reports Server (NTRS)
Srivastava, Deepak; Saini, Subhash; Menon, Madhu
1998-01-01
Carbon nanotubes and the nanotube heterojunctions have recently emerged as excellent candidates for nanoscale molecular electronic device components. Experimental measurements on the conductivity, rectifying behavior and conductivity-chirality correlation have also been made. While quasi-one dimensional simple heterojunctions between nanotubes with different electronic behavior can be generated by introduction of a pair of heptagon-pentagon defects in an otherwise all hexagon graphene sheet. Other complex 3- and 4-point junctions may require other mechanisms. Structural stability as well as local electronic density of states of various nanotube junctions are investigated using a generalized tight-binding molecular dynamics (GDBMD) scheme that incorporates non-orthogonality of the orbitals. The junctions investigated include straight and small angle heterojunctions of various chiralities and diameters; as well as more complex 'T' and 'Y' junctions which do not always obey the usual pentagon-heptagon pair rule. The study of local density of states (LDOS) reveal many interesting features, most prominent among them being the defect-induced states in the gap. The proposed three and four pointjunctions are one of the smallest possible tunnel junctions made entirely of carbon atoms. Furthermore the electronic behavior of the nanotube based device components can be taylored by doping with group III-V elements such as B and N, and BN nanotubes as a wide band gap semiconductor has also been realized in experiments. Structural properties of heteroatomic nanotubes comprising C, B and N will be discussed.
Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model
NASA Astrophysics Data System (ADS)
Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad
2018-02-01
In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.
NASA Astrophysics Data System (ADS)
Gavrichkov, Vladimir A.; Pchelkina, Zlata V.; Nekrasov, Igor A.; Ovchinnikov, Sergey G.
2016-09-01
We studied the pressure dependences of the electronic structure and superexchange interaction J(P) = JA - JB (where JA and JB are antiferromagnetic (AFM) and ferromagnetic (FM) contributions) in antiferromagnetic La214 under hydrostatic, uniaxial (along c-axial) 3% compressions and 1% in-plane compressions by the local density approximation with generalized tight-binding method (LDA + GTB cell approach). The changes in J(P) correlated with the experimentally known TC(P) dependence are in accordance with the relation dTC/dP = (∂TC/∂J)(∂J/∂P), where ∂TC/∂J ˜ 0.1. The in-plane pressure more effectively stabilizes the ground singlet two-hole state A1 than the simple hydrostatic pressure, its effect on J and TC is the largest. Within the same cell approach together with the superexchange interaction J(P), the valence band structure was calculated. Its changes with pressure clearly reproduce the k-distribution of the singlet and triplet quasi-particles over the Brillouin zone (BZ).
Structures of Aln (n= 27, 28, 29, and 30) clusters with double-tetrahedron structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, W.; Lu, W. C.; Sun, J.
2008-01-31
Global search for lowest-energy structures of neutral aluminum clusters Al{sub n} (n = 27, 28, 29 and 30) was performed using a genetic algorithm (GA) coupled with a tight-binding (TB) method. Structural candidates obtained from our GA search were further optimized with first-principles calculations. It is found that the medium-sized aluminum clusters Al{sub 27} to Al{sub 30} favor double-tetrahedron structures.
Investigation of the effect of scattering centers on low dimensional nanowire channel
NASA Astrophysics Data System (ADS)
Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri
2018-05-01
In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.
Impact of the Topological Surface State on the Thermoelectric Transport in Sb2Te3 Thin Films.
Hinsche, Nicki F; Zastrow, Sebastian; Gooth, Johannes; Pudewill, Laurens; Zierold, Robert; Rittweger, Florian; Rauch, Tomáš; Henk, Jürgen; Nielsch, Kornelius; Mertig, Ingrid
2015-04-28
Ab initio electronic structure calculations based on density functional theory and tight-binding methods for the thermoelectric properties of p-type Sb2Te3 films are presented. The thickness-dependent electrical conductivity and the thermopower are computed in the diffusive limit of transport based on the Boltzmann equation. Contributions of the bulk and the surface to the transport coefficients are separated, which enables to identify a clear impact of the topological surface state on the thermoelectric properties. When the charge carrier concentration is tuned, a crossover between a surface-state-dominant and a Fuchs-Sondheimer transport regime is achieved. The calculations are corroborated by thermoelectric transport measurements on Sb2Te3 films grown by atomic layer deposition.
NASA Technical Reports Server (NTRS)
Bates, Kevin R.; Scuseria, Gustavo E.
1997-01-01
Multi-layered round carbon particles (onions) containing tens to hundreds of thousands of atoms form during electron irradiation of graphite carbon. However, theoretical models of large icosahedral fullerenes predict highly faceted shapes for molecules with more than a few hundred atoms. This discrepancy in shape may be explained by the presence of defects during the formation of carbon onions. Here, we use the semi-empirical tight-binding method for carbon to simulate the incorporation of pentagon-heptagon defects on to the surface of large icosahedral fullerenes. We show a simple mechanism that results in energetically competitive derivative structures and a global change in molecular shape from faceted to round. Our results provide a plausible explanation of the apparent discrepancy between experimental observations of round buckyonions and theoretical predictions of faceted icosahedral fullerenes.
Impurity-induced anisotropic semiconductor-semimetal transition in monolayer biased black phosphorus
NASA Astrophysics Data System (ADS)
Bui, D. H.; Yarmohammadi, Mohsen
2018-07-01
Taking into account the electron-impurity interaction within the continuum approximation of tight-binding model, the Born approximation, and the Green's function method, the main features of anisotropic electronic phase transition are investigated in monolayer biased black phosphorus (BP). To this end, we concentrated on the disordered electronic density of states (DOS), which gives useful information for electro-optical devices. Increasing the impurity concentration in both unbiased and biased impurity-infected single-layer BP, in addition to the decrease of the band gap, independent of the direction, leads to the midgap states and an extra Van Hove singularity inside and outside of the band gap, respectively. Furthermore, strong impurity scattering potentials lead to a semiconductor-semimetal transition and one more Van Hove singularity in x-direction of unbiased BP and surprisingly, this transition does not occur in biased BP. We found that there is no phase transition in y-direction. Since real applications require structures with modulated band gaps, we have studied the influence of different bias voltages on the disordered DOS in both directions, resulting in the increase of the band gap.
The electronic transport properties of defected bilayer sliding armchair graphene nanoribbons
NASA Astrophysics Data System (ADS)
Mohammadi, Amin; Haji-Nasiri, Saeed
2018-04-01
By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of perfect and defected bilayer armchair graphene nanoribbons (BAGNRs) under finite bias. Two typical defects which are placed in the middle of top layer (i.e. single vacancy (SV) and stone wale (SW) defects) are examined. The results reveal that in both perfect and defected bilayers, the maximum current refers to β-AB, AA and α-AB stacking orders, respectively, since the intermolecular interactions are stronger in them. Moreover it is observed that a SV decreases the current in all stacking orders, but the effects of a SW defect is nearly unpredictable. Besides, we introduced a sequential switching behavior and the effects of defects on the switching performance is studied as well. We found that a SW defect can significantly improve the switching behavior of a bilayer system. Transmission spectrum, band structure, molecular energy spectrum and molecular projected self-consistent Hamiltonian (MPSH) are analyzed subsequently to understand the electronic transport properties of these bilayer devices which can be used in developing nano-scale bilayer systems.
Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals
NASA Astrophysics Data System (ADS)
Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.
2000-02-01
We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.
Transferable tight binding model for strained group IV and III-V heterostructures
NASA Astrophysics Data System (ADS)
Tan, Yaohua; Povolotskyi, Micheal; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard
Modern semiconductor devices have reached critical device dimensions in the range of several nanometers. For reliable prediction of device performance, it is critical to have a numerical efficient model that are transferable to material interfaces. In this work, we present an empirical tight binding (ETB) model with transferable parameters for strained IV and III-V group semiconductors. The ETB model is numerically highly efficient as it make use of an orthogonal sp3d5s* basis set with nearest neighbor inter-atomic interactions. The ETB parameters are generated from HSE06 hybrid functional calculations. Band structures of strained group IV and III-V materials by ETB model are in good agreement with corresponding HSE06 calculations. Furthermore, the ETB model is applied to strained superlattices which consist of group IV and III-V elements. The ETB model turns out to be transferable to nano-scale hetero-structure. The ETB band structures agree with the corresponding HSE06 results in the whole Brillouin zone. The ETB band gaps of superlattices with common cations or common anions have discrepancies within 0.05eV.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patikoglou,G.; Westblade, L.; Campbell, E.
The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2013-11-01
We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.
Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela
2016-03-18
The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Faúndez, J.; Jorge, T. N.; Craco, L.
2018-03-01
Using the tight-binding treatment for the spin-asymmetric Hubbard model we explore the effect of electronic interactions in the ferromagnetic, partially filled Lieb lattice. As a key result we demonstrate the formation of correlation satellites in the minority spin channel. In addition, we consider the role played by transverse-field spin fluctuations in metallic ferromagnets. We quantify the degree of electronic demagnetization, showing that the half-metallic state is rather robust to local spin flips. Not being restricted to the case of a partially filled Lieb lattice, our findings are expected to advance the general understanding of spin-selective electronic reconstruction in strongly correlated quantum ferromagnets.
NASA Astrophysics Data System (ADS)
Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.
2016-09-01
Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.
Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference
NASA Astrophysics Data System (ADS)
Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.
2018-02-01
Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.
NASA Astrophysics Data System (ADS)
Nishimoto, Yoshio; Fedorov, Dmitri G.
2018-02-01
The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.
Structural, electronic properties and stability of metatitanic acid (H 2TiO 3) nanotubes
NASA Astrophysics Data System (ADS)
Enyashin, A. N.; Denisova, T. A.; Ivanovskii, A. L.
2009-12-01
Quite recently, metatitanic acid (H 2TiO 3) has been successfully prepared, which extended the family of known titanic acids H 2Ti nO 2n+1 ( n = 2, 3 and 4). Here the atomic models for nanotubes (NTs) of metatitanic acid are designed and their cohesive and electronic properties are considered depending on their chirality and radii by means of density-functional theory-tight-binding (DFTB) method. Our main findings are that the proposed H 2TiO 3 tubes are stable and that all these NTs will be the insulators (independently from their chirality and the diameters) with forbidden gaps at about ˜4.6 eV. We have found also that aforementioned properties of predicted H 2TiO 3 NTs are very similar with those of recently prepared fabricated nanotubes of polytitanic acids; thus, it is possible to expect that the proposed H 2TiO 3 tubular materials may be fabricated.
Electronic properties of a molecular system with Platinum
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Medina, F. G.; Becerra-Alonso, David
2017-10-01
The electronic properties are studied using a finite homogeneous molecule called Trans-platinum-linked oligo(tetraethenylethenes). This system is composed of individual molecules such as benzene rings, platinum, Phosphore and Sulfur. The mechanism for the study of the electron transport through this system is based on placing the molecule between metal contacts to control the current through the molecular system. We study this molecule based on the tight-binding approach for the calculation of the transport properties using the Landauer-Büttiker formalism and the Fischer-Lee relationship, based on a semi-analytic Green's function method within a real-space renormalization approach. Our results show a significant agreement with experimental measurements.
Paz, Yakov; Shimoni, Eyal; Weiss, Meira; Pick, Uri
2007-01-01
Uptake of iron in the halotolerant alga Dunaliella salina is mediated by a transferrin-like protein (TTf), which binds and internalizes Fe3+ ions. Recently, we found that iron deficiency induces a large enhancement of iron binding, which is associated with accumulation of three other plasma membrane proteins that associate with TTf. In this study, we characterized the kinetic properties of iron binding and internalization and identified the site of iron internalization. Iron deficiency induces a 4-fold increase in Fe binding, but only 50% enhancement in the rate of iron uptake and also increases the affinity for iron and bicarbonate, a coligand for iron binding. These results indicate that iron deprivation leads to accumulation and modification of iron-binding sites. Iron uptake in iron-sufficient cells is preceded by an apparent time lag, resulting from prebound iron, which can be eliminated by unloading iron-binding sites. Iron is tightly bound to surface-exposed sites and hardly exchanges with medium iron. All bound iron is subsequently internalized. Accumulation of iron inhibits further iron binding and internalization. The vacuolar inhibitor bafilomycin inhibits iron uptake and internalization. Internalized iron was localized by electron microscopy within vacuolar structures that were identified as acidic vacuoles. Iron internalization is accompanied by endocytosis of surface proteins into these acidic vacuoles. A novel kinetic mechanism for iron uptake is proposed, which includes two pools of bound/compartmentalized iron separated by a rate-limiting internalization stage. The major parameter that is modulated by iron deficiency is the iron-binding capacity. We propose that excessive iron binding in iron-deficient cells serves as a temporary reservoir for iron that is subsequently internalized. This mechanism is particularly suitable for organisms that are exposed to large fluctuations in iron availability. PMID:17513481
Structural mechanism of the ATP-induced dissociation of rigor myosin from actin
Kühner, Sebastian; Fischer, Stefan
2011-01-01
Myosin is a true nanomachine, which produces mechanical force from ATP hydrolysis by cyclically interacting with actin filaments in a four-step cycle. The principle underlying each step is that structural changes in separate regions of the protein must be mechanically coupled. The step in which myosin dissociates from tightly bound actin (the rigor state) is triggered by the 30 Å distant binding of ATP. Large conformational differences between the crystal structures make it difficult to perceive the coupling mechanism. Energetically accessible transition pathways computed at atomic detail reveal a simple coupling mechanism for the reciprocal binding of ATP and actin. PMID:21518908
Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes
Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.
2001-01-01
Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926
Modelling realistic TiO2 nanospheres: A benchmark study of SCC-DFTB against hybrid DFT
NASA Astrophysics Data System (ADS)
Selli, Daniele; Fazio, Gianluca; Di Valentin, Cristiana
2017-10-01
TiO2 nanoparticles (NPs) are nowadays considered fundamental building blocks for many technological applications. Morphology is found to play a key role with spherical NPs presenting higher binding properties and chemical activity. From the experimental point of view, the characterization of these nano-objects is extremely complex, opening a large room for computational investigations. In this work, TiO2 spherical NPs of different sizes (from 300 to 4000 atoms) have been studied with a two-scale computational approach. Global optimization to obtain stable and equilibrated nanospheres was performed with a self-consistent charge density functional tight-binding (SCC-DFTB) simulated annealing process, causing a considerable atomic rearrangement within the nanospheres. Those SCC-DFTB relaxed structures have been then optimized at the DFT(B3LYP) level of theory. We present a systematic and comparative SCC-DFTB vs DFT(B3LYP) study of the structural properties, with particular emphasis on the surface-to-bulk sites ratio, coordination distribution of surface sites, and surface energy. From the electronic point of view, we compare HOMO-LUMO and Kohn-Sham gaps, total and projected density of states. Overall, the comparisons between DFTB and hybrid density functional theory show that DFTB provides a rather accurate geometrical and electronic description of these nanospheres of realistic size (up to a diameter of 4.4 nm) at an extremely reduced computational cost. This opens for new challenges in simulations of very large systems and more extended molecular dynamics.
2015-01-01
Despite decades of investigations, the principal mechanisms responsible for the high affinity and specificity of proteins for key physiological cations K+, Na+, and Ca2+ remain a hotly debated topic. At the core of the debate is an apparent need (or lack thereof) for an accurate description of the electrostatic response of the charge distribution in a protein to the binding of an ion. These effects range from partial electronic polarization of the directly ligating atoms to long-range effects related to partial charge transfer and electronic delocalization effects. While accurate modeling of cation recognition by metalloproteins warrants the use of quantum-mechanics (QM) calculations, the most popular approximations used in major biomolecular simulation packages rely on the implicit modeling of electronic polarization effects. That is, high-level QM computations for ion binding to proteins are desirable, but they are often unfeasible, because of the large size of the reactive-site models and the need to sample conformational space exhaustively at finite temperature. Several solutions to this challenge have been proposed in the field, ranging from the recently developed Drude polarizable force-field for simulations of metalloproteins to approximate tight-binding density functional theory (DFTB). To delineate the usefulness of different approximations, we examined the accuracy of three recent and commonly used theoretical models and numerical algorithms, namely, CHARMM C36, the latest developed Drude polarizable force fields, and DFTB3 with the latest 3OB parameters. We performed MD simulations for 30 cation-selective proteins with high-resolution X-ray structures to create ensembles of structures for analysis with different levels of theory, e.g., additive and polarizable force fields, DFTB3, and DFT. The results from DFT computations were used to benchmark CHARMM C36, Drude, and DFTB3 performance. The explicit modeling of quantum effects unveils the key electrostatic properties of the protein sites and the importance of specific ion-protein interactions. One of the most interesting findings is that secondary coordination shells of proteins are noticeably perturbed in a cation-dependent manner, showing significant delocalization and long-range effects of charge transfer and polarization upon binding Ca2+. PMID:26574284
DOE Office of Scientific and Technical Information (OSTI.GOV)
Medvedev, Nikita; Li, Zheng; Tkachenko, Victor
2017-01-31
In the present study, a theoretical study of electron-phonon (electron-ion) coupling rates in semiconductors driven out of equilibrium is performed. Transient change of optical coefficients reflects the band gap shrinkage in covalently bonded materials, and thus, the heating of atomic lattice. Utilizing this dependence, we test various models of electron-ion coupling. The simulation technique is based on tight-binding molecular dynamics. Our simulations with the dedicated hybrid approach (XTANT) indicate that the widely used Fermi's golden rule can break down describing material excitation on femtosecond time scales. In contrast, dynamical coupling proposed in this work yields a reasonably good agreement ofmore » simulation results with available experimental data.« less
NASA Astrophysics Data System (ADS)
Szczesniak, Dominik
Recently, monolayer transition metal dichalcogenides have attracted much attention due to their potential use in both nano- and opto-electronics. In such applications, the electronic and transport properties of group-VIB transition metal dichalcogenides (MX2 , where M=Mo, W; X=S, Se, Te) are particularly important. Herein, new insight into these properties is presented by studying the complex band structures (CBS's) of MX2 monolayers while accounting for spin-orbit coupling effects. By using the symmetry-based tight-binding model a nonlinear generalized eigenvalue problem for CBS's is obtained. An efficient method for solving such class of problems is presented and gives a complete set of physically relevant solutions. Next, these solutions are characterized and classified into propagating and evanescent states, where the latter states present not only monotonic but also oscillatory decay character. It is observed that some of the oscillatory evanescent states create characteristic complex loops at the direct band gaps, which describe the tunneling currents in the MX2 materials. The importance of CBS's and tunneling currents is demonstrated by the analysis of the quantum transport across MX2 monolayers within phase field matching theory. Present work has been prepared within the Qatar Energy and Environment Research Institute (QEERI) grand challenge ATHLOC project (Project No. QEERI- GC-3008).
Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G
2012-06-13
Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.
The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression
Balda, Maria S.; Matter, Karl
2000-01-01
Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369
NASA Astrophysics Data System (ADS)
Wang, Ya-Ting; Zhao, Yu-Jun; Liao, Ji-Hai; Yang, Xiao-Bao
2018-01-01
Combining the congruence check and the first-principles calculations, we have systematically investigated the structural stabilities and gap distributions of possible diamondoids (CnHm) with the carbon numbers (n) from 10 to 41. A simple method for the nomenclature is proposed, which can be used to distinguish and screen the candidates with high efficiency. Different from previous theoretical studies, the possible diamondoids can be enumerated according to our nomenclature, without any pre-determination from experiments. The structural stabilities and electronic properties have been studied by density functional based tight binding and first-principles methods, where a nearly linear correlation is found between the energy gaps obtained by these two methods. According to the formation energy of structures, we have determined the stable configurations as a function of chemical potential. The maximum and minimum energy gaps are found to be dominated by the shape of diamondoids for clusters with a given number of carbon atoms, while the gap decreases in general as the size increases due to the quantum confinement.
Spectroscopic properties and STM images of carbon nanotubes
NASA Astrophysics Data System (ADS)
Rubio, A.
We present a theoretical study of the role of the local environment in the electronic properties of carbon nanotubes: isolated single- and multi-wall nanotubes, nanotube ropes, tubes supported on gold and cut to finite length. Interaction with the substrate or with other tubes does not alter the scanning tunneling microscopy patterns (STM) observed for isolated tubes. A finite-length nanotube shows standing-wave patterns that can be completely characterized by a set of four different three-dimensional shapes. These patterns are understood in terms of a simple π-electron tight-binding (TB) model. STM-topographic images of topological defects ani (pentagon/heptagon pair) and tube caps have also been studied. In both cases the image obtained depends on the sign of the applied voltage and can be described in terms of the previous catalog of STM images (interference between electronic waves scattered by the defect). We have also computed the electronic density of states for isolated tubes with different chiralities and radii, confirming a correlation between the peak structure in the DOS and nanotube diameter. However, the metallic plateau in the DOS also depends on the nanotube chirality. Furthermore the conduction an valence band structures are not fully symmetrical to one another. This anisotropy shows up in the DOS and indicates the limitations of the π-TB model in describing spectroscopic data. In contrast to STM images, here the interaction with the substrate does modify the energy levels of the nanotube. We observe opening of small pseudogaps around the Fermi level and broadening of the sharp van Hove singularities of the isolated single-walled nanotubes that can be used to extract useful information about the tube structure and bonding. The combination of STM and spectroscopic studies provides a new way to address the electronic and structural properties of carbon and composite nanotubes.
Analyte chemisorption and sensing on n- and p-channel copper phthalocyanine thin-film transistors.
Yang, Richard D; Park, Jeongwon; Colesniuc, Corneliu N; Schuller, Ivan K; Royer, James E; Trogler, William C; Kummel, Andrew C
2009-04-28
Chemical sensing properties of phthalocyanine thin-film transistors have been investigated using nearly identical n- and p-channel devices. P-type copper phthalocyanine (CuPc) has been modified with fluorine groups to convert the charge carriers from holes to electrons. The sensor responses to the tight binding analyte dimethyl methylphosphonate (DMMP) and weak binding analyte methanol (MeOH) were compared in air and N(2). The results suggest that the sensor response involves counterdoping of pre-adsorbed oxygen (O(2)). A linear dependence of chemical response to DMMP concentration was observed in both n- and p- type devices. For DMMP, there is a factor of 2.5 difference in the chemical sensitivity between n- and p-channel CuPc thin-film transistors, even though it has similar binding strength to n- and p-type CuPc molecules as indicated by the desorption times. The effect is attributed to the difference in the analyte perturbation of electron and hole trap energies in n- and p-type materials.
Conformation-controlled binding kinetics of antibodies
NASA Astrophysics Data System (ADS)
Galanti, Marta; Fanelli, Duccio; Piazza, Francesco
2016-01-01
Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.
A guide to the design of electronic properties of graphene nanoribbons.
Yazyev, Oleg V
2013-10-15
Graphene nanoribbons (GNRs) are one-dimensional nanostructures predicted to display a rich variety of electronic behaviors. Depending on their structure, GNRs realize metallic and semiconducting electronic structures with band gaps that can be tuned across broad ranges. Certain GNRs also exhibit a peculiar gapped magnetic phase for which the half-metallic state can be induced as well as the topologically nontrivial quantum spin Hall electronic phase. Because their electronic properties are highly tunable, GNRs have quickly become a popular subject of research toward the design of graphene-based nanostructures for technological applications. This Account presents a pedagogical overview of the various degrees of freedom in the atomic structure and interactions that researchers can use to tailor the electronic structure of these materials. The Account provides a broad picture of relevant physical concepts that would facilitate the rational design of GNRs with desired electronic properties through synthetic techniques. We start by discussing a generic model of zigzag GNR within the tight-binding model framework. We then explain how different modifications and extensions of the basic model affect the electronic band structures of GNRs. We classify the modifications based on the following categories: (1) electron-electron and spin-orbit interactions, (2) GNR configuration, which includes width and the crystallographic orientation of the nanoribbon (chirality), and (3) the local structure of the edge. We subdivide this last category into two groups: the effects of the termination of the π-electron system and the variations of electrostatic potential at the edge. This overview of the structure-property relationships provides a view of the many different electronic properties that GNRs can realize. The second part of this Account reviews three recent experimental methods for the synthesis of structurally well-defined GNRs. We describe a family of techniques that use patterning and etching of graphene and graphite to produce GNRs. Chemical unzipping of carbon nanotubes also provides a route toward producing chiral GNRs with atomically smooth edges. Scanning tunneling microscopy/spectroscopy investigations of these unzipped GNRs have revealed edge states and strongly suggest that these GNRs are magnetic. The third approach exploits the surface-assisted self-assembly of GNRs from molecular precursors. This powerful method can provide full control over the atomic structure of narrow nanoribbons and could eventually produce more complex graphene nanostructures.
The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.
Vetrano, Stefania; Danese, Silvio
2009-05-01
Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.
Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard
2017-11-16
The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Zhang, Fan; Lin, Qiu-Yue; Hu, Wan-Li; Song, Wen-Ji; Shen, Shu-Ting; Gui, Pan
2013-06-01
Three new transition metal complexes [Mn2(DCA)2(bipy)2]·5H2O (1), [M2(DCA)2(bipy)2(H2O)]·10H2O(M = Ni(II)(2);Zn(II)(3)), (DCA = demethylcantharate, 7-oxabicyclo[2,2,1]heptane-2,3-dicarboxylate, C8H8O5) were synthesized and characterized by elemental analysis, molar conductance, infrared spectra and X-ray diffraction techniques. Each metal ion was six-coordinated in complexes. Complex 1 has a Mn2O2 center. Complexes 2 and 3 have asymmetric binuclear structure. Great amount of intermolecular hydrogen-bonding and π-π* stacking interactions were formed in these complex structures. The DNA-binding properties of complexes were investigated by electronic absorption spectra and viscosity measurements. The DNA binding constants Kb/(L mol-1) were 1.71 × 104 (1), 2.62 × 104 (2) and 1.59 × 104 (3) at 298 K. The complexes could quench the intrinsic fluorescence of bovine serum albumin (BSA) strongly through static quenching. The protein binding constants Ka/(L mol-1) were 7.27 × 104 (1), 4.55 × 104 (2) and 7.87 × 104 L mol-1 (3) and binding site was one. The complexes bind more tightly with DNA and BSA than with ligands. Complexes 1 and 3 had stronger inhibition ratios than Na2(DCA) against human hepatoma cells (SMMC-7721) lines and human gastric cancer cells (MGC80-3) lines in vitro. Complex 3 showed the strongest antiproliferative activity against SMMC-7721 (IC50 = 29.46 ± 2.12 μmol L-1) and MGC80-3 (IC50 = 27.02 ± 2.38 μmol L-1), which shows potential in anti-cancer drug development.
Impact of Many-Body Effects on Landau Levels in Graphene
NASA Astrophysics Data System (ADS)
Sonntag, J.; Reichardt, S.; Wirtz, L.; Beschoten, B.; Katsnelson, M. I.; Libisch, F.; Stampfer, C.
2018-05-01
We present magneto-Raman spectroscopy measurements on suspended graphene to investigate the charge carrier density-dependent electron-electron interaction in the presence of Landau levels. Utilizing gate-tunable magnetophonon resonances, we extract the charge carrier density dependence of the Landau level transition energies and the associated effective Fermi velocity vF. In contrast to the logarithmic divergence of vF at zero magnetic field, we find a piecewise linear scaling of vF as a function of the charge carrier density, due to a magnetic-field-induced suppression of the long-range Coulomb interaction. We quantitatively confirm our experimental findings by performing tight-binding calculations on the level of the Hartree-Fock approximation, which also allow us to estimate an excitonic binding energy of ≈6 meV contained in the experimentally extracted Landau level transitions energies.
Bandyopadhyay, Arka; Nandy, Atanu; Chakrabarti, Arunava; Jana, Debnarayan
2017-08-16
Tetragonal graphene (T-graphene) is a theoretically proposed dynamically stable, metallic allotrope of graphene. In this theoretical investigation, a tight binding (TB) model is used to unravel the metal to semiconductor transition of this 2D sheet under the influence of an external magnetic flux. In addition, the environment under which the sheet exposes an appreciable direct band gap of 1.41 ± 0.01 eV is examined. Similarly, the electronic band structure of the narrowest armchair T-graphene nanoribbon (NATGNR) also gets modified with different combinations of magnetic fluxes through the elementary rings. The band tuning parameters are critically identified for both systems. It is observed that the induced band gaps vary remarkably with the tuning parameters. We have also introduced an exact analytical approach to address the band structure of the NATGNR in the absence of any magnetic flux. Finally, the optical properties of the sheet and NATGNR are also critically analysed for both parallel and perpendicular polarizations with the help of density functional theory (DFT). Our study predicts that this material and its nanoribbons can be used in optoelectronic devices.
Spin Transfer Torque in Spin Filter Tunnel Junctions
NASA Astrophysics Data System (ADS)
Ortiz Pauyac, Christian; Kalitsov, Alan; Manchon, Aurelien; Chshiev, Mair
2014-03-01
STT in MTJs is well known for its potential spin electronic applications. However, recently a new class of MTJs based on spin filtering across magnetic insulators (SFTJ) has been attracting much attention since in such MTJs electrons with a certain spin orientation tunnel much more efficiently. In this structure, STT remains to be addressed and clarified. Here we present a systematic study of its angular and voltage bias dependences consisting of one or two FM layers separated by a magnetic insulator (MI). The calculations were performed within the tight-binding model using NEGF technique in the framework of Keldysh formalism. We predict that STT is higher in magnitude compared to regular MTJs, which strongly depends in the relative directions of the magnetic states of the free layer (FM2) and MI. Namely, in case of parallel orientation of MI and FM2 moments in a FM1|MI|FM2 structure, the system behaves as a regular MTJ with a modest increase of STT magnitude. However, as the angle between MI and FM2 moments increases, the field-like torque becomes three orders of magnitude higher than the Slonczewski component and oscillates with bias as band-filling increases. This may have practical implications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sarkar, Sunandan; Rajbanshi, Biplab; Sarkar, Pranab, E-mail: pranab.sarkar@visva-bharati.ac.in
2014-09-21
By using the density-functional tight binding method, we studied the electronic structure of CdSe quantum dot(QD)-buckminsterfullerene (C{sub 60}) hybrid systems as a function of both the size of the QD and concentration of the fullerene molecule. Our calculation reveals that the lowest unoccupied molecular orbital energy level of the hybrid CdSeQD-C{sub 60} systems lies on the fullerene moiety, whereas the highest occupied molecular orbital (HOMO) energy level lies either on the QD or the fullerene depending on size of the CdSe QD. We explored the possibility of engineering the energy level alignment by varying the size of the CdSe QD.more » With increase in size of the QD, the HOMO level is shifted upward and crosses the HOMO level of the C{sub 60}-thiol molecule resulting transition from the type-I to type-II band energy alignment. The density of states and charge density plot support these types of band gap engineering of the CdSe-C{sub 60} hybrid systems. This type II band alignment indicates the possibility of application of this nanohybrid for photovoltaic purpose.« less
NASA Astrophysics Data System (ADS)
Buongiorno Nardelli, Marco
High-Throughput Quantum-Mechanics computation of materials properties by ab initio methods has become the foundation of an effective approach to materials design, discovery and characterization. This data driven approach to materials science currently presents the most promising path to the development of advanced technological materials that could solve or mitigate important social and economic challenges of the 21st century. In particular, the rapid proliferation of computational data on materials properties presents the possibility to complement and extend materials property databases where the experimental data is lacking and difficult to obtain. Enhanced repositories such as AFLOWLIB open novel opportunities for structure discovery and optimization, including uncovering of unsuspected compounds, metastable structures and correlations between various properties. The practical realization of these opportunities depends almost exclusively on the the design of efficient algorithms for electronic structure simulations of realistic material systems beyond the limitations of the current standard theories. In this talk, I will review recent progress in theoretical and computational tools, and in particular, discuss the development and validation of novel functionals within Density Functional Theory and of local basis representations for effective ab-initio tight-binding schemes. Marco Buongiorno Nardelli is a pioneer in the development of computational platforms for theory/data/applications integration rooted in his profound and extensive expertise in the design of electronic structure codes and in his vision for sustainable and innovative software development for high-performance materials simulations. His research activities range from the design and discovery of novel materials for 21st century applications in renewable energy, environment, nano-electronics and devices, the development of advanced electronic structure theories and high-throughput techniques in materials genomics and computational materials design, to an active role as community scientific software developer (QUANTUM ESPRESSO, WanT, AFLOWpi)
d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes
NASA Astrophysics Data System (ADS)
Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping
2018-04-01
We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.
Riddell, Imogen A; Smulders, Maarten M J; Clegg, Jack K; Hristova, Yana R; Breiner, Boris; Thoburn, John D; Nitschke, Jonathan R
2012-09-01
Biochemical systems are adaptable, capable of reconstitution at all levels to achieve the functions associated with life. Synthetic chemical systems are more limited in their ability to reorganize to achieve new functions; they can reconfigure to bind an added substrate (template effect) or one binding event may modulate a receptor's affinity for a second substrate (allosteric effect). Here we describe a synthetic chemical system that is capable of structural reconstitution on receipt of one anionic signal (perchlorate) to create a tight binding pocket for another anion (chloride). The complex, barrel-like structure of the chloride receptor is templated by five perchlorate anions. This second-order templation phenomenon allows chemical networks to be envisaged that express more complex responses to chemical signals than is currently feasible.
Electronic properties of Bilayer Fullerene onions
NASA Astrophysics Data System (ADS)
Pincak, R.; Shunaev, V. V.; Smotlacha, J.; Slepchenkov, M. M.; Glukhova, O. E.
2017-10-01
The HOMO-LUMO gaps of the bilayer fullerene onions were investigated. For this purpose, the HOMO and LUMO energies were calculated for the isolated fullerenes using the parametrization of the tight binding method with the Harrison-Goodwin modification. Next, the difference of the Fermi levels of the outer and inner shell was calculated by considering the hybridization of the orbitals on the base of the geometric parameters. The results were obtained by the combination of these calculations.
NASA Astrophysics Data System (ADS)
Drechsler, S. L.; Heiner, E.; Osipov, V. A.
1986-11-01
The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.
Quasiparticle Energies and Band Gaps in Graphene Nanoribbons
NASA Astrophysics Data System (ADS)
Yang, Li; Park, Cheol-Hwan; Son, Young-Woo; Cohen, Marvin L.; Louie, Steven G.
2007-11-01
We present calculations of the quasiparticle energies and band gaps of graphene nanoribbons (GNRs) carried out using a first-principles many-electron Green’s function approach within the GW approximation. Because of the quasi-one-dimensional nature of a GNR, electron-electron interaction effects due to the enhanced screened Coulomb interaction and confinement geometry greatly influence the quasiparticle band gap. Compared with previous tight-binding and density functional theory studies, our calculated quasiparticle band gaps show significant self-energy corrections for both armchair and zigzag GNRs, in the range of 0.5 3.0 eV for ribbons of width 2.4 0.4 nm. The quasiparticle band gaps found here suggest that use of GNRs for electronic device components in ambient conditions may be viable.
Study of alloy disorder in quantum dots through multi-million atom simulations
NASA Technical Reports Server (NTRS)
Kilmeck, Gerhard; Oyafuso, Fabiano; Boykin, T. B.; Bowen, R. C.; von Allmen, Paul A.
2003-01-01
A tight binding model which includes s, p, d, s orbitals is used to examine the electronic structures of an ensemble of dome-shaped In0.6 Ga0.4 As quantum dots. Given ensembles of identically sized quantum dots, variations in composition and configuration yield a linewidth broadening of less than 0.35 meV, much smaller than the total broadening determined from photoluminescence experiments. It is also found that the computed disorder-induced broadening is very sensitive to the applied boundary conditions, so that care must be taken to ensure proper convergence of the numerical results. Examination of local eigenenergies as functions of position shows similar convergence problems and indicates that an inaccurate resolution of the equilibrium atomic positions due to truncation of the simulation domain may be the source of the slow ground state convergence.
Zhang, Degang
2009-10-30
The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.
Spin-density wave state in simple hexagonal graphite
NASA Astrophysics Data System (ADS)
Mosoyan, K. S.; Rozhkov, A. V.; Sboychakov, A. O.; Rakhmanov, A. L.
2018-02-01
Simple hexagonal graphite, also known as AA graphite, is a metastable configuration of graphite. Using tight-binding approximation, it is easy to show that AA graphite is a metal with well-defined Fermi surface. The Fermi surface consists of two sheets, each shaped like a rugby ball. One sheet corresponds to electron states, another corresponds to hole states. The Fermi surface demonstrates good nesting: a suitable translation in the reciprocal space superposes one sheet onto another. In the presence of the electron-electron repulsion, a nested Fermi surface is unstable with respect to spin-density-wave ordering. This instability is studied using the mean-field theory at zero temperature, and the spin-density-wave order parameter is evaluated.
ERIC Educational Resources Information Center
Wetsel, Grover C., Jr.
1978-01-01
Calculates the energy-band structure of noninteracting electrons in a one-dimensional crystal using exact and approximate methods for a rectangular-well atomic potential. A comparison of the two solutions as a function of potential-well depth and ratio of lattice spacing to well width is presented. (Author/GA)
Effects of oxidation on the plasmonic properties of aluminum nanoclusters.
Douglas-Gallardo, Oscar A; Soldano, Germán J; Mariscal, Marcelo M; Sánchez, Cristián Gabriel
2017-11-16
The scouting of alternative plasmonic materials able to enhance and extend the optical properties of noble metal nanostructures is on the rise. Aluminum is endowed with a set of interesting properties which turn it into an attractive plasmonic material. Here we present the optical and electronic features of different aluminum nanostructures stemming from a multilevel computational study. Molecular Dynamics (MD) simulations using a reactive force field (ReaxFF), carefully validated with Density Functional Theory (DFT), were employed to mimic the oxidation of icosahedral aluminum nanoclusters. Resulting structures with different oxidation degrees were then studied through the Time-Dependent Density Functional Tight Binding (TD-DFTB) method. A similar approach was used in aluminum nanoclusters with a disordered structure to study how the loss of crystallinity affects the optical properties. To the best of our knowledge, this is the first report that addresses this issue from the fully atomistic time-dependent approach by means of two different and powerful simulation tools able to describe quantum and physicochemical properties associated with nanostructured particles.
A general intermolecular force field based on tight-binding quantum chemical calculations
NASA Astrophysics Data System (ADS)
Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas
2017-10-01
A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.
Optical properties of InAs/GaAs quantum dot superlattice structures
NASA Astrophysics Data System (ADS)
Imran, Ali; Jiang, Jianliang; Eric, Deborah; Zahid, M. Noaman; Yousaf, M.; Shah, Z. H.
2018-06-01
Quantum dot (QD) structure has potential applications in modern highly efficient optoelectronic devices due to their band-tuning. The device dimensions have been miniatured with increased efficiencies by virtue of this discovery. In this research, we have presented modified analytical and simulation results of InAs/GaAs QD superlattice (QDSL). We have applied tight binding model for the investigation of ground state energies using timeindependent Schrödinger equation (SE) with effective mass approximation. It has been investigated that the electron energies are confined due to wave function delocalization in closely coupled QD structures. The minimum ground state energy can be obtained by increasing the periodicity and decreasing the barrier layer thickness. We have calculated electronics and optical properties which includes ground state energies, transition energies, density of states (DOS), absorption coefficient and refractive index, which can be tuned by structure modification. In our results, the minimum ground state energy of QDSL is achieved to be 0.25 eV with a maximum period of 10 QDs. The minimum band to band and band to continuum transition energies are 63 meV and 130 meV with 2 nm barrier layer thickness respectively. The absorption coefficient of our proposed QDSL model is found to be maximum 1.2 × 104 cm-1 and can be used for highly sensitive infrared detector and high efficiency solar cells.
Slow-binding inhibition of sialidase from influenza virus.
Pegg, M S; von Itzstein, M
1994-04-01
Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.
Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias
2012-01-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177
Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias
2012-12-01
The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.
Intrinsic optical confinement for ultrathin InAsN quantum well superlattices
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sakri, A.; Robert, C.; Pedesseau, L.
We study energy-band engineering with InAsN monolayer in GaAs/GaP quantum well structure. A tight-binding calculation indicates that both type I alignment along with direct band-gap behavior can be obtained. We show that the optical transitions are less sensitive to the position of the probe.
Equilibrium structure and atomic vibrations of Nin clusters
NASA Astrophysics Data System (ADS)
Borisova, Svetlana D.; Rusina, Galina G.
2017-12-01
The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.
NASA Astrophysics Data System (ADS)
Henke, Paul S.; Mak, Chi H.
2014-08-01
The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study
NASA Astrophysics Data System (ADS)
Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf
2018-02-01
Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.
Henke, Paul S; Mak, Chi H
2014-08-14
The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.
NASA Astrophysics Data System (ADS)
Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim
2018-04-01
Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).
Magnetic quantization in monolayer bismuthene
NASA Astrophysics Data System (ADS)
Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa
The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2012-02-01
The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.
Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.
Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto
2018-04-11
We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.
2015-11-14
Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less
Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene
NASA Astrophysics Data System (ADS)
Reijnders, K. J. A.; Katsnelson, M. I.
2017-07-01
We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.
Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.
Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E
2018-05-08
We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.
NASA Astrophysics Data System (ADS)
Vedula, Ravi Pramod; Mehrotra, Saumitra; Kubis, Tillmann; Povolotskyi, Michael; Klimeck, Gerhard; Strachan, Alejandro
2015-05-01
We use first principles simulations to engineer Ge nanofins for maximum hole mobility by controlling strain tri-axially through nano-patterning. Large-scale molecular dynamics predict fully relaxed, atomic structures for experimentally achievable nanofins, and orthogonal tight binding is used to obtain the corresponding electronic structure. Hole transport properties are then obtained via a linearized Boltzmann formalism. This approach explicitly accounts for free surfaces and associated strain relaxation as well as strain gradients which are critical for quantitative predictions in nanoscale structures. We show that the transverse strain relaxation resulting from the reduction in the aspect ratio of the fins leads to a significant enhancement in phonon limited hole mobility (7× over unstrained, bulk Ge, and 3.5× over biaxially strained Ge). Maximum enhancement is achieved by reducing the width to be approximately 1.5 times the height and further reduction in width does not result in additional gains. These results indicate significant room for improvement over current-generation Ge nanofins, provide geometrical guidelines to design optimized geometries and insight into the physics behind the significant mobility enhancement.
Goldmann, W H; Hess, D; Isenberg, G
1999-03-01
We employed quasi-elastic light scattering and electron microscopy to investigate the influence of intact talin and talin tail fragment on actin filament dynamics and network structure. Using these methods, we confirm previous reports that intact talin induces cross-linking as well as filament shortening on actin networks. We now show that the effect of intact talin as well as talin tail fragment on actin networks is controlled by pH and ionic strength. At pH 7.5, actin filament dynamics in the presence of intact talin and talin tail fragment are characterized by a rapid decay of the dynamic structure factor and by a square root power law for the stretched exponential decay which is in contrast with the theory for pure actin solutions. At pH 6 and low ionic strength, intact talin cross-links actin filaments more tightly than talin tail fragment. Talin head fragment showed no effect on actin networks, indicating that the actin binding sites reside probably exclusively within the tail domain.
Coaxial nanocable composed by imogolite and carbon nanotubes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramírez, M.; González, R. I.; Munoz, F.
2015-12-31
The discovery and development of Carbon Nanotubes (CNTs) at the beginning of the 1990s has driven a major part of solid state research. The electronic properties of the CNTs have generated a large number of ideas, as building coaxial nanocables. In this work we propose a possible type of such nanocables, which is formed by three nanostructures: two conducting CNTs, where one of them is covered by an insulator (an inorganic oxide nanotube: the imogolite aluminosilicate). The theoretical calculations were carried out using the density functional tight-binding formalism, by means of the DFTB+ code. This formalism allows to calculate themore » band structure, which compares favorably with DFT calculations, but with a significantly lower computational cost. As a first step, we reproduce the calculations of already published results, where the formation of a nanocable composed by one CNT and the imogolite as an insulator. Afterwards, we simulate the band structure for the proposed structure to study the feasibility of the coaxial nanocable. Finally, using classical MD simulations, we study the possible mechanisms of formation of these nanocables.« less
Band gap engineering of BC2N for nanoelectronic applications
NASA Astrophysics Data System (ADS)
Lim, Wei Hong; Hamzah, Afiq; Ahmadi, Mohammad Taghi; Ismail, Razali
2017-12-01
The BC2N as an example of boron-carbon-nitride (BCN), has the analogous structure as the graphene and boron nitride. It is predicted to have controllable electronic properties. Therefore, the analytical study on the engineer-able band gap of the BC2N is carried out based on the schematic structure of BC2N. The Nearest Neighbour Tight Binding (NNTB) model is employed with the dispersion relation and the density of state (DOS) as the main band gap analysing parameter. The results show that the hopping integrals having the significant effect on the band gap, band structure and DOS of BC2N nanowire (BC2NNW) need to be taken into consideration. The presented model indicates consistent trends with the published computational results around the Dirac points with the extracted band gap of 0.12 eV. Also, it is distinguished that wide energy gap of boron nitride (BN) is successfully narrowed by this carbon doped material which assures the application of BC2N on the nanoelectronics and optoelectronics in the near future.
Meleppattu, Shimi; Arthanari, Haribabu; Zinoviev, Alexandra; Boeszoermenyi, Andras; Wagner, Gerhard; Shapira, Michal; Léger-Abraham, Mélissa
2018-03-19
Leishmania parasites are unicellular pathogens that are transmitted to humans through the bite of infected sandflies. Most of the regulation of their gene expression occurs post-transcriptionally, and the different patterns of gene expression required throughout the parasites' life cycle are regulated at the level of translation. Here, we report the X-ray crystal structure of the Leishmania cap-binding isoform 1, LeishIF4E-1, bound to a protein fragment of previously unknown function, Leish4E-IP1, that binds tightly to LeishIF4E-1. The molecular structure, coupled to NMR spectroscopy experiments and in vitro cap-binding assays, reveal that Leish4E-IP1 allosterically destabilizes the binding of LeishIF4E-1 to the 5' mRNA cap. We propose mechanisms through which Leish4E-IP1-mediated LeishIF4E-1 inhibition could regulate translation initiation in the human parasite.
Structural Analysis of the Phenol-Responsive Sensory Domain of the Transcription Activator PoxR.
Patil, Vinod Vikas; Park, Kwang-Hyun; Lee, Seung-Goo; Woo, Euijeon
2016-04-05
Positive phenol-degradative gene regulator (PoxR) is a σ(54)-dependent AAA+ ATPase transcription activator that regulates the catabolism of phenols. The PoxR sensory domain detects phenols and relays signals for the activation of transcription. Here we report the first structure of the phenol sensory domain bound to phenol and five derivatives. It exists as a tightly intertwined homodimer with a phenol-binding pocket buried inside, placing two C termini on the same side of the dimer. His102 and Trp130 interact with the hydroxyl group of the phenol in a cavity surrounded by rigid hydrophobic residues on one side and a flexible region on the other. Each monomer has a V4R fold with a unique zinc-binding site. A shift at the C-terminal helix suggests that there is a possible conformational change upon ligand binding. The results provide a structural basis of chemical effector binding for transcriptional regulation with broad implications for protein engineering. Copyright © 2016 Elsevier Ltd. All rights reserved.
Studies of the Electro-Optic Effect.
1983-01-01
electro - optic effect in crystalline solids has been pursued by employing a tight-binding theory for dielectric susceptibilities. The electronic and lattice contributions to the second-order electro - optic susceptibility have been treated separately and the lattice response of a crystal to an external dc electric field has been investigated in a general formalism. The theory has been specifically applied to the compound, tellurium dioxide. In addition, an experimental determination of the electro - optic coefficient, re, in thallium
NASA Astrophysics Data System (ADS)
Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek
2017-10-01
The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.
Interface roughness mediated phonon relaxation rates in Si quantum dots.
NASA Astrophysics Data System (ADS)
Ferdous, Rifat; Hsueh, Yuling; Klimeck, Gerhard; Rahman, Rajib
2015-03-01
Si QDs are promising candidates for solid-state quantum computing due to long spin coherence times. However, the valley degeneracy in Si adds an additional degree of freedom to the electronic structure. Although the valley and orbital indices can be uniquely identified in an ideal Si QD, interface roughness mixes valley and orbital states in realistic dots. Such valley-orbit coupling can strongly influence T1 times in Si QDs. Recent experimental measurements of various relaxation rates differ from previous predictions of phonon relaxation in ideal Si QDs. To understand how roughness affects different relaxation rates, for example spin relaxation due to spin-valley coupling, which is a byproduct of spin-orbit and valley-orbit coupling, we need to understand the effect of valley-orbit coupling on valley relaxation first. Using a full-band atomistic tight-binding description for both the system's electron and electron-phonon hamiltonian, we analyze the effect of atomic-scale interface disorder on phonon induced valley relaxation and spin relaxation in a Si QD. We find that, the valley splitting dependence of valley relaxation rate governs the magnetic field dependence of spin relaxation rate. Our results help understand experimentally measured relaxation times.
NASA Astrophysics Data System (ADS)
Nazirfakhr, Maryam; Shahhoseini, Ali
2018-03-01
By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of H-terminated zigzag graphene nanoribbon (H/ZGNR) and O-terminated ZGNR/H-terminated ZGNR (O/ZGNR-H/ZGNR) heterostructure under finite bias. Moreover, the effect of width and symmetry on the electronic transport properties of both models is also considered. The results reveal that asymmetric H/ZGNRs have linear I-V characteristics in whole bias range, but symmetric H-ZGNRs show negative differential resistance (NDR) behavior which is inversely proportional to the width of the H/ZGNR. It is also shown that the I-V characteristic of O/ZGNR-H/ZGNR heterostructure shows a rectification effect, whether the geometrical structure is symmetric or asymmetric. The fewer the number of zigzag chains, the bigger the rectification ratio. It should be mentioned that, the rectification ratios of symmetric heterostructures are much bigger than asymmetric one. Transmission spectrum, density of states (DOS), molecular projected self-consistent Hamiltonian (MPSH) and molecular eigenstates are analyzed subsequently to understand the electronic transport properties of these ZGNR devices. Our findings could be used in developing nanoscale rectifiers and NDR devices.
Stepanyuk, Galina A; Liu, Zhi-Jie; Markova, Svetlana S; Frank, Ludmila A; Lee, John; Vysotski, Eugene S; Wang, Bi-Cheng
2008-04-01
Bioluminescence in the sea pansy Renilla involves two distinct proteins, a Ca2+-triggered coelenterazine-binding protein (CBP), and Renilla luciferase. CBP contains one tightly bound coelenterazine molecule, which becomes available for reaction with luciferase and O2 only subsequent to Ca2+ binding. CBP belongs to the EF-hand superfamily of Ca2+-binding proteins and contains three "EF-hand" Ca2+-binding sites. The overall spatial structure of recombinant selenomethionine-labeled CBP determined at 1.7 A, is found to approximate the protein scaffold characteristic of the class of Ca2+-regulated photoproteins. Photoproteins however, catalyze molecular oxygen addition to coelenterazine producing a 2-hydroperoxycoelenterazine intermediate, which is stabilized within the binding cavity in the absence of Ca2+. Addition of Ca2+ triggers the bioluminescence reaction. However in CBP this first step of oxygen addition is not allowed. The different amino acid environments and hydrogen bond interactions within the binding cavity, are proposed to account for the different properties of the two classes of proteins.
MCM ring hexamerization is a prerequisite for DNA-binding
Froelich, Clifford A.; Nourse, Amanda; Enemark, Eric J.
2015-09-13
The hexameric Minichromosome Maintenance (MCM) protein complex forms a ring that unwinds DNA at the replication fork in eukaryotes and archaea. Our recent crystal structure of an archaeal MCM N-terminal domain bound to single-stranded DNA (ssDNA) revealed ssDNA associating across tight subunit interfaces but not at the loose interfaces, indicating that DNA-binding is governed not only by the DNA-binding residues of the subunits (MCM ssDNA-binding motif, MSSB) but also by the relative orientation of the subunits. We now extend these findings to show that DNA-binding by the MCM N-terminal domain of the archaeal organism Pyrococcus furiosus occurs specifically in themore » hexameric oligomeric form. We show that mutants defective for hexamerization are defective in binding ssDNA despite retaining all the residues observed to interact with ssDNA in the crystal structure. One mutation that exhibits severely defective hexamerization and ssDNA-binding is at a conserved phenylalanine that aligns with the mouse Mcm4(Chaos3) mutation associated with chromosomal instability, cancer, and decreased intersubunit association.« less
NASA Astrophysics Data System (ADS)
Cobo-Lopez, Sergio; Saeed Bahramy, Mohammad; Arita, Ryotaro; Akbari, Alireza; Eremin, Ilya
2018-04-01
We develop the realistic minimal electronic model for recently discovered BiS2 superconductors including the spin–orbit (SO) coupling based on the first-principles band structure calculations. Due to strong SO coupling, characteristic for the Bi-based systems, the tight-binding low-energy model necessarily includes p x , p y , and p z orbitals. We analyze a potential Cooper-pairing instability from purely repulsive interaction for the moderate electronic correlations using the so-called leading angular harmonics approximation. For small and intermediate doping concentrations we find the dominant instabilities to be {d}{x2-{y}2}-wave, and s ±-wave symmetries, respectively. At the same time, in the absence of the sizable spin fluctuations the intra and interband Coulomb repulsions are of the same strength, which yield the strongly anisotropic behavior of the superconducting gaps on the Fermi surface. This agrees with recent angle resolved photoemission spectroscopy findings. In addition, we find that the Fermi surface topology for BiS2 layered systems at large electron doping can resemble the doped iron-based pnictide superconductors with electron and hole Fermi surfaces maintaining sufficient nesting between them. This could provide further boost to increase T c in these systems.
Crystal Structures of the Histo-Aspartic Protease (HAP) from Plasmodium falciparum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bhaumik, Prasenjit; Xiao, Huogen; Parr, Charity L.
The structures of recombinant histo-aspartic protease (HAP) from malaria-causing parasite Plasmodium falciparum as apoenzyme and in complex with two inhibitors, pepstatin A and KNI-10006, were solved at 2.5-, 3.3-, and 3.05-{angstrom} resolutions, respectively. In the apoenzyme crystals, HAP forms a tight dimer not seen previously in any aspartic protease. The interactions between the monomers affect the conformation of two flexible loops, the functionally important 'flap' (residues 70-83) and its structural equivalent in the C-terminal domain (residues 238-245), as well as the orientation of helix 225-235. The flap is found in an open conformation in the apoenzyme. Unexpectedly, the active sitemore » of the apoenzyme contains a zinc ion tightly bound to His32 and Asp215 from one monomer and to Glu278A from the other monomer, with the coordination of Zn resembling that seen in metalloproteases. The flap is closed in the structure of the pepstatin A complex, whereas it is open in the complex with KNI-10006. Although the binding mode of pepstatin A is significantly different from that in other pepsin-like aspartic proteases, its location in the active site makes unlikely the previously proposed hypothesis that HAP is a serine protease. The binding mode of KNI-10006 is unusual compared with the binding of other inhibitors from the KNI series to aspartic proteases. The novel features of the HAP active site could facilitate design of specific inhibitors used in the development of antimalarial drugs.« less
Baier, J; Gabrielsen, M; Oellerich, S; Michel, H; van Heel, M; Cogdell, R J; Köhler, J
2009-11-04
We have investigated the spectral diffusion and the electron-phonon coupling of B800 bacteriochlorophyll a molecules in the peripheral light-harvesting complex LH2 for three different species of purple bacteria, Rhodobacter sphaeroides, Rhodospirillum molischianum, and Rhodopseudomonas acidophila. We come to the conclusion that B800 binding pockets for Rhodobacter sphaeroides and Rhodopseudomonas acidophila are rather similar with respect to the polarity of the protein environment but that the packaging of the alphabeta-polypeptides seems to be less tight in Rb. sphaeroides with respect to the other two species.
Effect of the degree of disorder on electronic and optical properties in random superlattices
NASA Technical Reports Server (NTRS)
Wang, E. G.; Su, W. P.; Ting, C. S.
1994-01-01
A three-dimensional tight-binding calculation is developed and used to study disorder effects in a realistic random superlattice. With increasing disorder, a tendency of possible indirect-direct band-gap transition is suggested. Direct evidence of mobility edges between localized and extended states in three-dimensional random systems is given. As system disorder increases, the optical absorption intensities increase dramatically from five to forty-five times stronger than the ordered (GaAs)(sub 1)/(AlAs)(sub 1) superlattice. It is believed that the degree of disorder significantly affects electronic and optical properties of GaAs/AlAs random superlattices.
Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko
2010-05-01
The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.
Duda, David M.; Olszewski, Jennifer L.; Tron, Adriana E.; Hammel, Michal; Lambert, Lester J.; Waddell, M. Brett; Mittag, Tanja; DeCaprio, James A.; Schulman, Brenda A.
2012-01-01
Summary The ~300 human Cullin-RING ligases (CRLs) are multisubunit E3s in which a RING protein, either RBX1 or RBX2, recruits an E2 to catalyze ubiquitination. RBX1-containing CRLs also can bind Glomulin (GLMN), which binds RBX1’s RING domain, regulates the RBX1-CUL1-containing SCFFBW7 complex, and is disrupted in the disease Glomuvenous Malformation. Here we report the crystal structure of a complex between GLMN, RBX1, and a fragment of CUL1. Structural and biochemical analyses reveal that GLMN adopts a HEAT-like repeat fold that tightly binds the E2-interacting surface of RBX1, inhibiting CRL-mediated chain formation by the E2 CDC34. The structure explains the basis for GLMN’s selectivity toward RBX1 over RBX2, and how disease-associated mutations disrupt GLMN-RBX1 interactions. Our study reveals a mechanism for RING E3 ligase regulation whereby an inhibitor blocks E2 access, and raises the possibility that other E3s are likewise controlled by cellular proteins that mask E2-binding surfaces to mediate inhibition. PMID:22748924
Koharudin, Leonardus M I; Kollipara, Sireesha; Aiken, Christopher; Gronenborn, Angela M
2012-09-28
Oscillatoria agardhii agglutinin homolog (OAAH) proteins belong to a recently discovered lectin family. All members contain a sequence repeat of ~66 amino acids, with the number of repeats varying among different family members. Apart from data for the founding member OAA, neither three-dimensional structures, information about carbohydrate binding specificities, nor antiviral activity data have been available up to now for any other members of the OAAH family. To elucidate the structural basis for the antiviral mechanism of OAAHs, we determined the crystal structures of Pseudomonas fluorescens and Myxococcus xanthus lectins. Both proteins exhibit the same fold, resembling the founding family member, OAA, with minor differences in loop conformations. Carbohydrate binding studies by NMR and x-ray structures of glycan-lectin complexes reveal that the number of sugar binding sites corresponds to the number of sequence repeats in each protein. As for OAA, tight and specific binding to α3,α6-mannopentaose was observed. All the OAAH proteins described here exhibit potent anti-HIV activity at comparable levels. Altogether, our results provide structural details of the protein-carbohydrate interaction for this novel lectin family and insights into the molecular basis of their HIV inactivation properties.
Tuning transport properties of graphene three-terminal structures by mechanical deformation
NASA Astrophysics Data System (ADS)
Torres, V.; Faria, D.; Latgé, A.
2018-04-01
Straintronic devices made of carbon-based materials have been pushed up due to the graphene high mechanical flexibility and the possibility of interesting changes in transport properties. Properly designed strained systems have been proposed to allow optimized transport responses that can be explored in experimental realizations. In multiterminal systems, comparisons between schemes with different geometries are important to characterize the modifications introduced by mechanical deformations, especially if the deformations are localized at a central part of the system or extended in a large region. Then, in the present analysis, we study the strain effects on the transport properties of triangular and hexagonal graphene flakes, with zigzag and armchair edges, connected to three electronic terminals, formed by semi-infinite graphene nanoribbons. Using the Green's function formalism with circular renormalization schemes, and a single band tight-binding approximation, we find that resonant tunneling transport becomes relevant and is more affected by localized deformations in the hexagonal graphene flakes. Moreover, triangular systems with deformation extended to the leads, like longitudinal three-folded type, are shown as an interesting scenario for building nanoscale waveguides for electronic current.
Effects of strong interactions in a half-metallic magnet: A determinant quantum Monte Carlo study
Jiang, M.; Pickett, W. E.; Scalettar, R. T.
2013-04-03
Understanding the effects of electron-electron interactions in half-metallic magnets (HMs), which have band structures with one gapped spin channel and one metallic channel, poses fundamental theoretical issues as well as having importance for their potential applications. Here we use determinant quantum Monte Carlo to study the impacts of an on-site Hubbard interaction U, finite temperature, and an external (Zeeman) magnetic field on a bilayer tight-binding model which is a half-metal in the absence of interactions, by calculating the spectral density, conductivity, spin polarization of carriers, and local magnetic properties. We quantify the effect of U on the degree of thermalmore » depolarization, and follow relative band shifts and monitor when significant gap states appear, each of which can degrade the HM character. For this model, Zeeman coupling induces, at fixed particle number, two successive transitions: compensated half-metal with spin-down band gap → metallic ferromagnet → saturated ferromagnetic insulator. However, over much of the more relevant parameter regime, the half-metallic properties are rather robust to U.« less
Saturable inductor and transformer structures for magnetic pulse compression
Birx, Daniel L.; Reginato, Louis L.
1990-01-01
Saturable inductor and transformer for magnetic compression of an electronic pulse, using a continuous electrical conductor looped several times around a tightly packed core of saturable inductor material.
NASA Astrophysics Data System (ADS)
Chegel, Raad; Behzad, Somayeh
2011-02-01
We have investigated the electro-optical properties of zigzag BNNTs, under an external electric field, using the tight binding approximation. It is found that an electric field modifies the band structure and splits the band degeneracy. Also the large electric strength leads to coupling the neighbor subbands which these effects reflect in the DOS and JDOS spectrum. It has been shown that, unlike CNTs, the band gap of BNNTs can be reduced linearly by applying a transverse external electric field. Also we show that the larger diameter tubes are more sensitive than small ones. The semiconducting metallic transition can be achieved through increasing the applied fields. The number and position of peaks in the JDOS spectrum are dependent on electric field strength. It is found that at a high electric field, the two lowest subbands are oscillatory with multiple nodes at the Fermi level.
Substantial optical dielectric enhancement by volume compression in LiAsSe 2
Zheng, Fan; Brehm, John A.; Young, Steve M.; ...
2016-05-15
Based on first-principles calculations, we predict a substantial increase in the optical dielectric function of LiAsSemore » $$_2$$ under pressure. We find that the optical dielectric constant is enhanced threefold under volume compression. This enhancement is mainly due to the dimerization strength reduction of the one-dimensional (1D) As--Se chains in LiAsSe$$_2$$, which significantly alters the wavefunction phase mismatch between two neighboring chains and changes the transition intensity. By developing a tight-binding model of the interacting 1D chains, the essential features of the low-energy electronic structure of LiAsSe$$_2$$ are captured. In conclusion, our findings are important for understanding the fundamental physics of LiAsSe$$_2$$ and provide a feasible way to enhance the material optical response that can be applied to light harvesting for energy applications.« less
Sun, Xiao; Liu, Zuojun; Zhang, Guilong; Qiu, Guannan; Zhong, Naiqin; Wu, Lifang; Cai, Dongqing; Wu, Zhengyan
2015-01-01
Traditional pesticides (TP) often do not adhere tightly to crop foliage. They can easily enter the surrounding environment through precipitation and volatilization. This can result in the pollution of the surrounding soil, water, and air. To reduce pesticide pollution, we developed a loss-control pesticide (LCP) by adding attapulgite with a nano networks structure fabricated using high energy electron beam (HEEB) irradiation and hydrothermal treatment to TP. HEEB irradiation effectively dispersed originally aggregated attapulgite through modified thermal, charge, and physical effects. Hydrothermal treatment further enhanced the dispersion of attapulgite to form nano porous networks via thermal and wet expansion effects, which are beneficial for pesticide binding. An LCP has improved retention on crop leaf surfaces. It has a higher adhesion capacity, reduced leaching and volatilization, and extended residual activity compared with the TP formulation. The treatment increases the residual activity of pesticides on crop foliage and decreases environmental pollution.
Intrinsic spin-orbit torque in a single-domain nanomagnet
NASA Astrophysics Data System (ADS)
Kalitsov, A.; Nikolaev, S. A.; Velev, J.; Chshiev, M.; Mryasov, O.
2017-12-01
We present theoretical studies of the intrinsic spin-orbit torque (SOT) in a single-domain ferromagnetic layer with Rashba spin-orbit coupling (SOC) using the nonequilibrium Green's function formalism for a tight-binding Hamiltonian. We find that, in the case of a small electric field, the intrinsic SOT to first order in SOC has only the field-like torque symmetry and can be interpreted as the longitudinal spin current induced by the charge current and Rashba field. We analyze the results in terms of the material-related parameters of the electronic structure, such as the band filling, bandwidth, exchange splitting, and the Rashba SOC strength. On the basis of these numerical and analytical results, we discuss the magnitude and sign of SOT. Our results suggest that the different sign of SOT in identical ferromagnets with different supporting layers, e.g., Co/Pt and Co/Ta, can be attributed to electrostatic doping of the ferromagnetic layer by the support.
Resonant tunneling diode based on band gap engineered graphene antidot structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Palla, Penchalaiah, E-mail: penchalaiah.palla@vit.ac.in; Ethiraj, Anita S.; Raina, J. P.
The present work demonstrates the operation and performance of double barrier Graphene Antidot Resonant Tunnel Diode (DBGA-RTD). Non-Equilibrium Green’s Function (NEGF) frame work with tight-binding Hamiltonian and 2-D Poisson equations were solved self-consistently for device study. The interesting feature in this device is that it is an all graphene RTD with band gap engineered graphene antidot tunnel barriers. Another interesting new finding is that it shows negative differential resistance (NDR), which involves the resonant tunneling in the graphene quantum well through both the electron and hole bound states. The Graphene Antidot Lattice (GAL) barriers in this device efficiently improved themore » Peak to Valley Ratio to approximately 20 even at room temperature. A new fitting model is developed for the number of antidots and their corresponding effective barrier width, which will help in determining effective barrier width of any size of actual antidot geometry.« less
Pressure dependence of critical temperature of bulk FeSe from spin fluctuation theory
NASA Astrophysics Data System (ADS)
Hirschfeld, Peter; Kreisel, Andreas; Wang, Yan; Tomic, Milan; Jeschke, Harald; Jacko, Anthony; Valenti, Roser; Maier, Thomas; Scalapino, Douglas
2013-03-01
The critical temperature of the 8K superconductor FeSe is extremely sensitive to pressure, rising to a maximum of 40K at about 10GPa. We test the ability of the current generation of fluctuation exchange pairing theories to account for this effect, by downfolding the density functional theory electronic structure for each pressure to a tight binding model. The Fermi surface found in such a procedure is then used with fixed Hubbard parameters to determine the pairing strength using the random phase approximation for the spin singlet pairing vertex. We find that the evolution of the Fermi surface captured by such an approach is alone not sufficient to explain the observed pressure dependence, and discuss alternative approaches. PJH, YW, AK were supported by DOE DE-FG02-05ER46236, the financial support of MT, HJ, and RV from the DFG Schwerpunktprogramm 1458 is kindly acknowledged.
Modeling Bi-induced changes in the electronic structure of GaAs1-xBix alloys
NASA Astrophysics Data System (ADS)
Virkkala, Ville; Havu, Ville; Tuomisto, Filip; Puska, Martti J.
2013-12-01
We suggested recently [V. Virkkala , Phys. Rev. BPRBMDO1098-012110.1103/PhysRevB.88.035204 88, 035204 (2013)] that the band-gap narrowing in dilute GaAs1-xNx alloys can be explained to result from the broadening of the localized N states due to the N-N interaction along the zigzag chains in the <110> directions. In that study our tight-binding modeling based on first-principles density-functional calculations took into account the random distribution of N atoms in a natural way. In this work we extend our modeling to GaAs1-xBix alloys. Our results indicate that Bi states mix with host material states. However, the states near the valence-band edge agglomerate along the zigzag chains originating from individual Bi atoms. This leads to Bi-Bi interactions in a random alloy broadening these states in energy and causing the band-gap narrowing.
Photoelectron emission from LiF surfaces by ultrashort electromagnetic pulses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Acuna, M. A.; Gravielle, M. S.; Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires
2011-03-15
Energy- and angle-resolved electron emission spectra produced by incidence of ultrashort electromagnetic pulses on a LiF(001) surface are studied by employing a distorted-wave method named the crystal surface-Volkov (CSV) approximation. The theory makes use of the Volkov phase to describe the action of the external electric field on the emitted electron, while the electron-surface interaction is represented within the tight-binding model. The CSV approach is applied to investigate the effects introduced by the crystal lattice when the electric field is oriented parallel to the surface plane. These effects are essentially governed by the vector potential of the external field, whilemore » the influence of the crystal orientation was found to be negligible.« less
Energy transfer between two vacuum-gapped metal plates: Coulomb fluctuations and electron tunneling
NASA Astrophysics Data System (ADS)
Zhang, Zu-Quan; Lü, Jing-Tao; Wang, Jian-Sheng
2018-05-01
Recent experimental measurements for near-field radiative heat transfer between two bodies have been able to approach the gap distance within 2 nm , where the contributions of Coulomb fluctuation and electron tunneling are comparable. Using the nonequilibrium Green's function method in the G0W0 approximation, based on a tight-binding model, we obtain for the energy current a Caroli formula from the Meir-Wingreen formula in the local equilibrium approximation. Also, the Caroli formula is consistent with the evanescent part of the heat transfer from the theory of fluctuational electrodynamics. We go beyond the local equilibrium approximation to study the energy transfer in the crossover region from electron tunneling to Coulomb fluctuation based on a numerical calculation.
USDA-ARS?s Scientific Manuscript database
The rapid release of tight-binding inhibitors from dead-end Rubisco complexes requires the activity of Rubisco activase, an AAA+ ATPase that utilizes chemo-mechanical energy to catalyze the reactivation of Rubisco. Activase is thought to play a central role in coordinating the rate of CO2 fixation w...
Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P
1994-02-11
TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.
Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.
Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua
2014-10-28
Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.
The effect of driven electron-phonon coupling on the electronic conductance of a polar nanowire
NASA Astrophysics Data System (ADS)
Mardaani, Mohammad; Rabani, Hassan; Esmaili, Esmat; Shariati, Ashrafalsadat
2015-08-01
A semi-classical model is proposed to explore the effect of electron-phonon coupling on the coherent electronic transport of a polar chain which is confined between two rigid leads in the presence of an external electric field. To this end, we construct the model by means of Green's function technique within the nearest neighbor tight-binding and harmonic approximations. For a time-periodic electric field, the atomic displacements from the equilibrium positions are obtained precisely. The result is then used to compute the electronic transport properties of the chain within the Peierls-type model. The numerical results indicate that the conductance of the system shows interesting behavior in some special frequencies. For each special frequency, there is an electronic quasi-state in which the scattering of electrons by vibrating atoms reaches maximum. The system electronic conductance decreases dramatically at the strong electron-phonon couplings and low electron energies. In the presence of damping forces, the electron-phonon interaction has a less significant effect on the conductance.
Interface Schottky barrier engineering via strain in metal-semiconductor composites
NASA Astrophysics Data System (ADS)
Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao
2016-01-01
The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k
Structure and vibrational spectra of low-energy silicon clusters
NASA Astrophysics Data System (ADS)
Sieck, A.; Porezag, D.; Frauenheim, Th.; Pederson, M. R.; Jackson, K.
1997-12-01
We have identified low-energy structures of silicon clusters with 9 to 14 atoms using a nonorthogonal tight-binding method (TB) based on density-functional theory (DF). We have further investigated the resulting structures with an accurate all-electron first-principles technique. The results for cohesive energies, cluster geometries, and highest occupied to lowest unoccupied molecular orbital (HOMO-LUMO) gaps show an overall good agreement between DF-TB and self-consistent-field (SCF) DF theory. For Si9 and Si14, we have found equilibrium structures, whereas for Si11, Si12, and Si13, we present clusters with energies close to that of the corresponding ground-state structure recently proposed in the literature. The bonding scheme of clusters in this size range is different from the bulk tetrahedral symmetry. The most stable structures, characterized by low energies and large HOMO-LUMO gaps, have similar common subunits. To aid in their experimental identification, we have computed the full vibrational spectra of the structures, along with the Raman activities, IR intensities, and static polarizabilities, using SCF-DF theory within the local-density approximation (LDA). This method has already been successfully applied to the determination of Raman and IR spectra of silicon clusters with 3-8, 10, 13, 20, and 21 atoms.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst
2013-01-15
Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.
Topological nonsymmorphic metals from band inversion
Muechler, Lukas; Alexandradinata, A.; Neupert, Titus; ...
2016-12-29
Here, we expand the phase diagram of two-dimensional, nonsymmorphic crystals at integer fillings that do not guarantee gaplessness. In addition to the trivial, gapped phase that is expected, we find that band inversion leads to a class of topological, gapless phases. These topological phases are exemplified by the monolayers of MTe 2 (M ¼ W; Mo) if spin-orbit coupling is neglected. We characterize the Dirac band touching of these topological metals by theWilson loop of the non-Abelian Berry gauge field. Furthermore, we develop a criterion for the proximity of these topological metals to 2D and 3D Z 2 topological insulatorsmore » when spinorbit coupling is included; our criterion is based on nonsymmorphic symmetry eigenvalues, and may be used to identify topological materials without inversion symmetry. An additional feature of the Dirac cone in monolayer MTe 2 is that it tilts over in a Lifshitz transition to produce electron and hole pockets—a type-II Dirac cone. These pockets, together with the pseudospin structure of the Dirac electrons, suggest a unified, topological explanation for the recently reported, nonsaturating magnetoresistance in WTe 2, as well as its circular dichroism in photoemission. We complement our analysis and first-principles band structure calculations with an ab-initio-derived tight-binding model for the WTe 2 monolayer.« less
Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio
2017-01-01
Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation. PMID:28223697
Toyama, Yuki; Kano, Hanaho; Mase, Yoko; Yokogawa, Mariko; Osawa, Masanori; Shimada, Ichio
2017-02-22
Heterotrimeric guanine-nucleotide-binding proteins (G proteins) serve as molecular switches in signalling pathways, by coupling the activation of cell surface receptors to intracellular responses. Mutations in the G protein α-subunit (Gα) that accelerate guanosine diphosphate (GDP) dissociation cause hyperactivation of the downstream effector proteins, leading to oncogenesis. However, the structural mechanism of the accelerated GDP dissociation has remained unclear. Here, we use magnetic field-dependent nuclear magnetic resonance relaxation analyses to investigate the structural and dynamic properties of GDP bound Gα on a microsecond timescale. We show that Gα rapidly exchanges between a ground-state conformation, which tightly binds to GDP and an excited conformation with reduced GDP affinity. The oncogenic D150N mutation accelerates GDP dissociation by shifting the equilibrium towards the excited conformation.
DeFilippi, L J; Hultquist, D E
1978-05-10
The two green hemoproteins isolated from bovine erythrocytes (form I and form II) have been characterized as to spectral, electrochemical, and chemical properties. The absorption spectra of the isolated hemoproteins are typical of high spin ferric states. Reduction of the hemoproteins yields high spin ferrohemoproteins. Complexation of the ferrohemoproteins with CO and the ferrihemoproteins with cyanide yields low spin complexes, demonstrating the presence of an exchangeable weak field ligand in both the ferrous and ferric states of the hemoproteins. The differences in position and intensity of the absorption peaks of the visible spectra allow the two forms to be distinguished from one another. The midpoint potential of forms I and II were found to be +0.075 and +0.019 V, respectively, at pH 6.4 and +0.038 and -0.005 V, respectively, at pH 7.0. This is consistent with the gaining of 1 proton/electron during the reduction. The Nernst plot reveals an unusual 0.5-electron transfer, whereas a quantitative titration demonstrates a 1-electron transfer. Form I binds cyanide more tightly than form II (KD of 84 and 252 micrometer, respectively). The observed spectral, electrochemical, and ligand-binding differences between forms I and II can be explained in terms of a greater electron-withdrawing ability of the side chains of the heme of form I relative to the heme of form II.
NASA Astrophysics Data System (ADS)
Umamaheswari, R.; Yogeswari, M.; Kalpana, G.
2013-02-01
Self-consistent scalar relativistic band structure calculations for AMO (A=Li, Na, K and Rb; M=Ag and Cu) compounds have been performed using the tight-binding linear muffin-tin orbital (TB-LMTO) method within the local density approximation (LDA). At ambient conditions, these compounds are found to crystallize in tetragonal KAgO-type structure with two different space group I-4m2 and I4/mmm. Nowadays, hypothetical structures are being considered to look for new functional materials. AMO compounds have stoichiometry similar to eight-electron half-Heusler materials of type I-I-VI which crystallizes in cubic (C1b) MgAgAs-type structure with space group F-43m. For all these compounds, by interchanging the positions of atoms in the hypothetical cubic structure, three phases (α, β and γ) are formed. The energy-volume relation for these compounds in tetragonal KAgO-type structure and cubic α, β and γ phases of related structure have been obtained. Under ambient conditions these compounds are more stable in tetragonal KAgO-type (I4/mmm) structure. The total energies calculated within the atomic sphere approximation (ASA) were used to determine the ground state properties such as equilibrium lattice parameters, c/a ratio, bulk modulus, cohesive energy and are compared with the available experimental results. The results of the electronic band structure calculations at ambient condition show that LiCuO and NaMO are indirect band gap semiconductors whereas KMO and RbMO are direct band gap semiconductors. At high pressure the band gap decreases and the phenomenon of band overlap metallization occur. Also these compounds undergo structural phase transition from tetragonal I-4m2 phase to cubic α-phase and transition pressures were calculated.
Zhang, Jian; Frerman, Frank E.; Kim, Jung-Ja P.
2006-01-01
Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an α-helix and a β-hairpin, forming a hydrophobic plateau. The UQ—flavin distance (8.5 Å) is shorter than the UQ—cluster distance (18.8 Å), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD. PMID:17050691
Zhang, Jian; Frerman, Frank E; Kim, Jung-Ja P
2006-10-31
Electron transfer flavoprotein-ubiquinone oxidoreductase (ETF-QO) is a 4Fe4S flavoprotein located in the inner mitochondrial membrane. It catalyzes ubiquinone (UQ) reduction by ETF, linking oxidation of fatty acids and some amino acids to the mitochondrial respiratory chain. Deficiencies in ETF or ETF-QO result in multiple acyl-CoA dehydrogenase deficiency, a human metabolic disease. Crystal structures of ETF-QO with and without bound UQ were determined, and they are essentially identical. The molecule forms a single structural domain. Three functional regions bind FAD, the 4Fe4S cluster, and UQ and are closely packed and share structural elements, resulting in no discrete structural domains. The UQ-binding pocket consists mainly of hydrophobic residues, and UQ binding differs from that of other UQ-binding proteins. ETF-QO is a monotopic integral membrane protein. The putative membrane-binding surface contains an alpha-helix and a beta-hairpin, forming a hydrophobic plateau. The UQ-flavin distance (8.5 A) is shorter than the UQ-cluster distance (18.8 A), and the very similar redox potentials of FAD and the cluster strongly suggest that the flavin, not the cluster, transfers electrons to UQ. Two possible electron transfer paths can be envisioned. First, electrons from the ETF flavin semiquinone may enter the ETF-QO flavin one by one, followed by rapid equilibration with the cluster. Alternatively, electrons may enter via the cluster, followed by equilibration between centers. In both cases, when ETF-QO is reduced to a two-electron reduced state (one electron at each redox center), the enzyme is primed to reduce UQ to ubiquinol via FAD.
NASA Astrophysics Data System (ADS)
Yen, Tsung-Wen; Lim, Thong-Leng; Yoon, Tiem-Leong; Lai, S. K.
2017-11-01
We combined a new parametrized density functional tight-binding (DFTB) theory (Fihey et al. 2015) with an unbiased modified basin hopping (MBH) optimization algorithm (Yen and Lai 2015) and applied it to calculate the lowest energy structures of Au clusters. From the calculated topologies and their conformational changes, we find that this DFTB/MBH method is a necessary procedure for a systematic study of the structural development of Au clusters but is somewhat insufficient for a quantitative study. As a result, we propose an extended hybridized algorithm. This improved algorithm proceeds in two steps. In the first step, the DFTB theory is employed to calculate the total energy of the cluster and this step (through running DFTB/MBH optimization for given Monte-Carlo steps) is meant to efficiently bring the Au cluster near to the region of the lowest energy minimum since the cluster as a whole has explicitly considered the interactions of valence electrons with ions, albeit semi-quantitatively. Then, in the second succeeding step, the energy-minimum searching process will continue with a skilledly replacement of the energy function calculated by the DFTB theory in the first step by one calculated in the full density functional theory (DFT). In these subsequent calculations, we couple the DFT energy also with the MBH strategy and proceed with the DFT/MBH optimization until the lowest energy value is found. We checked that this extended hybridized algorithm successfully predicts the twisted pyramidal structure for the Au40 cluster and correctly confirms also the linear shape of C8 which our previous DFTB/MBH method failed to do so. Perhaps more remarkable is the topological growth of Aun: it changes from a planar (n =3-11) → an oblate-like cage (n =12-15) → a hollow-shape cage (n =16-18) and finally a pyramidal-like cage (n =19, 20). These varied forms of the cluster's shapes are consistent with those reported in the literature.
Structure and stability of molybdenum sulfide fullerenes.
Bar-Sadan, M; Enyashin, A N; Gemming, S; Popovitz-Biro, R; Hong, S Y; Prior, Yehiam; Tenne, R; Seifert, G
2006-12-21
MoS2 nanooctahedra are believed to be the smallest stable closed-cage structures of MoS2, i.e., the genuine inorganic fullerenes. Here a combination of experiments and density functional tight binding calculations with molecular dynamics annealing are used to elucidate the structures and electronic properties of octahedral MoS2 fullerenes. Through the use of these calculations MoS2 octahedra were found to be stable beyond nMo > 100 but with the loss of 12 sulfur atoms in the six corners. In contrast to bulk and nanotubular MoS2, which are semiconductors, the Fermi level of the nanooctahedra is situated within the band, thus making them metallic-like. A model is used for extending the calculations to much larger sizes. These model calculations show that, in agreement with experiment, the multiwall nanooctahedra are stable over a limited size range of 104-105 atoms, whereupon they are converted into multiwall MoS2 nanoparticles with a quasi-spherical shape. On the experimental side, targets of MoS2 and MoSe2 were laser-ablated and analyzed mostly through transmission electron microscopy. This analysis shows that, in qualitative agreement with the theoretical analysis, multilayer nanooctahedra of MoS2 with 1000-25 000 atoms (Mo + S) are stable. Furthermore, this and previous work show that beyond approximately 105 atoms fullerene-like structures with quasi-spherical forms and 30-100 layers become stable. Laser-ablated WS2 samples yielded much less faceted and sometimes spherically symmetric nanocages.
NASA Astrophysics Data System (ADS)
Ishii, Hiroyuki; Kobayashi, Nobuhiko; Hirose, Kenji
2007-11-01
We investigated the electron-phonon coupling effects on the electronic transport properties of metallic (5,5)- and semiconducting (10,0)-carbon nanotube devices. We calculated the conductance and mobility of the carbon nanotubes with micron-order lengths at room temperature, using the time-dependent wave-packet approach based on the Kubo-Greenwood formula within a tight-binding approximation. We investigated the scattering effects of both longitudinal acoustic and optical phonon modes on the transport properties. The electron-optical phonon coupling decreases the conductance around the Fermi energy for the metallic carbon nanotubes, while the conductance of semiconductor nanotubes is decreased around the band edges by the acoustic phonons. Furthermore, we studied the Schottky-barrier effects on the mobility of the semiconducting carbon nanotube field-effect transistors for various gate voltages. We clarified how the electron mobilities of the devices are changed by the acoustic phonon.
Photonic Bandgaps in Photonic Molecules
NASA Technical Reports Server (NTRS)
Smith, David D.; Chang, Hongrok; Gates, Amanda L.; Fuller, Kirk A.; Gregory, Don A.; Witherow, William K.; Paley, Mark S.; Frazier, Donald O.; Curreri, Peter A. (Technical Monitor)
2002-01-01
This talk will focus on photonic bandgaps that arise due to nearly free photon and tight-binding effects in coupled microparticle and ring-resonator systems. The Mie formulation for homogeneous spheres is generalized to handle core/shell systems and multiple concentric layers in a manner that exploits an analogy with stratified planar systems, thereby allowing concentric multi-layered structures to be treated as photonic bandgap (PBG) materials. Representative results from a Mie code employing this analogy demonstrate that photonic bands arising from nearly free photon effects are easily observed in the backscattering, asymmetry parameter, and albedo for periodic quarter-wave concentric layers, though are not readily apparent in extinction spectra. Rather, the periodicity simply alters the scattering profile, enhancing the ratio of backscattering to forward scattering inside the bandgap, in direct analogy with planar quarter-wave multilayers. PBGs arising from tight-binding may also be observed when the layers (or rings) are designed such that the coupling between them is weak. We demonstrate that for a structure consisting of N coupled micro-resonators, the morphology dependent resonances split into N higher-Q modes, in direct analogy with other types of oscillators, and that this splitting ultimately results in PBGs which can lead to enhanced nonlinear optical effects.
A BPTTF-based self-assembled electron-donating triangle capable of C60 binding.
Goeb, Sébastien; Bivaud, Sébastien; Dron, Paul Ionut; Balandier, Jean-Yves; Chas, Marcos; Sallé, Marc
2012-03-25
A kinetically stable self-assembled redox-active triangle is isolated. The resulting electron-donating cavity, which incorporates three BPTTF units, exhibits a remarkable binding ability for electron-deficient C(60), supported by a favorable combination of structural and electronic features.
Calmodulin fishing with a structurally disordered bait triggers CyaA catalysis
O’Brien, Darragh P.; Durand, Dominique; Voegele, Alexis; Hourdel, Véronique; Davi, Marilyne; Chamot-Rooke, Julia; Vachette, Patrice; Brier, Sébastien; Ladant, Daniel
2017-01-01
Once translocated into the cytosol of target cells, the catalytic domain (AC) of the adenylate cyclase toxin (CyaA), a major virulence factor of Bordetella pertussis, is potently activated by binding calmodulin (CaM) to produce supraphysiological levels of cAMP, inducing cell death. Using a combination of small-angle X-ray scattering (SAXS), hydrogen/deuterium exchange mass spectrometry (HDX-MS), and synchrotron radiation circular dichroism (SR-CD), we show that, in the absence of CaM, AC exhibits significant structural disorder, and a 75-residue-long stretch within AC undergoes a disorder-to-order transition upon CaM binding. Beyond this local folding, CaM binding induces long-range allosteric effects that stabilize the distant catalytic site, whilst preserving catalytic loop flexibility. We propose that the high enzymatic activity of AC is due to a tight balance between the CaM-induced decrease of structural flexibility around the catalytic site and the preservation of catalytic loop flexibility, allowing for fast substrate binding and product release. The CaM-induced dampening of AC conformational disorder is likely relevant to other CaM-activated enzymes. PMID:29287065
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fernandes, Andre T.; Lopes, Carlos; Martins, Ligia O.
2012-06-08
Highlights: Black-Right-Pointing-Pointer CotA-laccase unfolds with an intermediate state. Black-Right-Pointing-Pointer Copper stabilizes the native and the intermediate state. Black-Right-Pointing-Pointer Copper binding to the unfolded state prevents refolding through protein aggregation. Black-Right-Pointing-Pointer Copper incorporation in CotA-laccase occurs as a later step during folding. -- Abstract: Copper is a redox-active metal and the main player in electron transfer reactions occurring in multicopper oxidases. The role of copper in the unfolding pathway and refolding of the multicopper oxidase CotA laccase in vitro was solved using double-jump stopped-flow experiments. Unfolding of apo- and holo-CotA was described as a three-state process with accumulation of an intermediatemore » in between the native and unfolded state. Copper stabilizes the native holo-CotA but also the intermediate state showing that copper is still bound to this state. Also, copper binds to unfolded holo-CotA in a non-native coordination promoting CotA aggregation and preventing refolding to the native structure. These results gather information on unfolding/folding pathways of multicopper oxidases and show that copper incorporation in vivo should be a tight controlled process as copper binding to the unfolded state under native conditions promotes protein aggregation.« less
NASA Astrophysics Data System (ADS)
Huo, Jin-Rong; Li, Lu; Cheng, Hai-Xia; Wang, Xiao-Xu; Zhang, Guo-Hua; Qian, Ping
2018-03-01
The interface structure, electronic and optical properties of Au-ZnO are studied using the first-principles calculation based on density functional theory (DFT). Given the interfacial distance, bonding configurations and terminated surface, we built the optimal interface structure and calculated the electronic and optical properties of the interface. The total density of states, partial electronic density of states, electric charge density and atomic populations (Mulliken) are also displayed. The results show that the electrons converge at O atoms at the interface, leading to a stronger binding of interfaces and thereby affecting the optical properties of interface structures. In addition, we present the binding energies of different interface structures. When the interface structure of Au-ZnO gets changed, furthermore, varying optical properties are exhibited.
Conductance signatures of electron confinement induced by strained nanobubbles in graphene
NASA Astrophysics Data System (ADS)
Bahamon, Dario A.; Qi, Zenan; Park, Harold S.; Pereira, Vitor M.; Campbell, David K.
2015-09-01
We investigate the impact of strained nanobubbles on the conductance characteristics of graphene nanoribbons using a combined molecular dynamics - tight-binding simulation scheme. We describe in detail how the conductance, density of states, and current density of zigzag or armchair graphene nanoribbons are modified by the presence of a nanobubble. In particular, we establish that low-energy electrons can be confined in the vicinity of or within the nanobubbles by the delicate interplay among the pseudomagnetic field pattern created by the shape of the bubble, mode mixing, and substrate interaction. The coupling between confined evanescent states and propagating modes can be enhanced under different clamping conditions, which translates into Fano resonances in the conductance traces.
NASA Astrophysics Data System (ADS)
Kakehashi, Yoshiro; Chandra, Sumal
2016-04-01
We have developed a first-principles local ansatz wavefunction approach with momentum-dependent variational parameters on the basis of the tight-binding LDA+U Hamiltonian. The theory goes beyond the first-principles Gutzwiller approach and quantitatively describes correlated electron systems. Using the theory, we find that the momentum distribution function (MDF) bands of paramagnetic bcc Fe along high-symmetry lines show a large deviation from the Fermi-Dirac function for the d electrons with eg symmetry and yield the momentum-dependent mass enhancement factors. The calculated average mass enhancement m*/m = 1.65 is consistent with low-temperature specific heat data as well as recent angle-resolved photoemission spectroscopy (ARPES) data.
Stability and electronic properties of oxygen-doped ZnS polytypes: DFTB study
NASA Astrophysics Data System (ADS)
Popov, Ilya S.; Vorokh, Andrey S.; Enyashin, Andrey N.
2018-06-01
Synthesis from aqueous solutions is an affordable method for fabrication of II-VI semiconductors. However, application of this method often imposes a disorder of crystal lattice, manifesting as a rich variety of polytypes arising from wurtzite and zinc blende phases. The origin of this disordering still remains debatable. Here, the influence of the most likely impurity at water environment - substitutional oxygen - on the polytypic equilibrium of zinc sulphide is studied by means of density-functional tight-binding method. According to calculations, the inclusion of such oxygen does not affect the polytypic equilibrium. Apart of thermodynamic stability, the electronic and elastic properties of ZnS polytypes are studied as the function of oxygen distribution.
Model many-body Stoner Hamiltonian for binary FeCr alloys
NASA Astrophysics Data System (ADS)
Nguyen-Manh, D.; Dudarev, S. L.
2009-09-01
We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.
Proton transfer along water bridges in biological systems with density-functional tight-binding
NASA Astrophysics Data System (ADS)
Reiss, Krystle; Wise, Abigail; Mazzuca, James
2015-03-01
When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.
Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.
Kowalczyk, Tim; Le, Khoa; Irle, Stephan
2016-01-12
We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.
Effect of Sb in thick InGaAsSbN layers grown by liquid phase epitaxy
NASA Astrophysics Data System (ADS)
Donchev, V.; Milanova, M.; Asenova, I.; Shtinkov, N.; Alonso-Álvarez, D.; Mellor, A.; Karmakov, Y.; Georgiev, S.; Ekins-Daukes, N.
2018-02-01
Dilute nitride InGaAsSbN layers grown by low-temperature liquid phase epitaxy are studied in comparison with quaternary InGaAsN layers grown at the same growth conditions to understand the effect of Sb in the alloy. The lattice mismatch to the GaAs substrate is found to be slightly larger for the InGaAsSbN layers, which is explained by the large atomic radius of Sb. A reduction of the band gap energy with respect to InGaAsN is demonstrated by means of photoluminescence (PL), surface photovoltage (SPV) spectroscopy and tight-binding calculations. The band-gap energies determined from PL and ellipsometry measurements are in good agreement, while the SPV spectroscopy and the tight-binding calculations provide lower values. Possible reasons for these discrepancies are discussed. The PL spectra reveal localized electronic states in the band gap near the conduction band edge, which is confirmed by SPV spectroscopy. The analysis of the power dependence of the integrated PL has allowed determining the dominant radiative recombination mechanisms in the layers. The values of the refraction index in a wide spectral region are found to be higher for the Sb containing layers.
Tight-binding model for materials at mesoscale
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei
2016-12-21
TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less
Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia
2018-05-10
Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duda, David M.; Olszewski, Jennifer L.; Tron, Adriana E.
2012-11-01
The approximately 300 human cullin-RING ligases (CRLs) are multisubunit E3s in which a RING protein, either RBX1 or RBX2, recruits an E2 to catalyze ubiquitination. RBX1-containing CRLs also can bind Glomulin (GLMN), which binds RBX1's RING domain, regulates the RBX1-CUL1-containing SCF{sup FBW7} complex, and is disrupted in the disease Glomuvenous Malformation. Here we report the crystal structure of a complex between GLMN, RBX1, and a fragment of CUL1. Structural and biochemical analyses reveal that GLMN adopts a HEAT-like repeat fold that tightly binds the E2-interacting surface of RBX1, inhibiting CRL-mediated chain formation by the E2 CDC34. The structure explains themore » basis for GLMN's selectivity toward RBX1 over RBX2, and how disease-associated mutations disrupt GLMN-RBX1 interactions. Our study reveals a mechanism for RING E3 ligase regulation, whereby an inhibitor blocks E2 access, and raises the possibility that other E3s are likewise controlled by cellular proteins that mask E2-binding surfaces to mediate inhibition.« less
Ground-state magnetic phase diagram of bow-tie graphene nanoflakes in external magnetic field
NASA Astrophysics Data System (ADS)
Szałowski, Karol
2013-12-01
The magnetic phase diagram of a ground state is studied theoretically for graphene nanoflakes of bow-tie shape and various sizes in external in-plane magnetic field. The tight-binding Hamiltonian supplemented with Hubbard term is used to model the electronic structure of the systems in question. The existence of the antiferromagnetic phase with magnetic moments localized at the sides of the bow-tie is found for low field and a field-induced spin-flip transition to ferromagnetic state is predicted to occur in charge-undoped structures. For small nanoflake doped with a single charge carrier, the low-field phase is ferrimagnetic and a metamagnetic transition to ferromagnetic ordering can be forced by the field. The critical field is found to decrease with increasing size of the nanoflake. The influence of diagonal and off-diagonal disorder on the mentioned magnetic properties is studied. The effect of off-diagonal disorder is found to be more important than that of diagonal disorder, leading to significantly widened distribution of critical fields for disordered population of nanoflakes.
Papadimou, Evangelia; Morigi, Marina; Iatropoulos, Paraskevas; Xinaris, Christodoulos; Tomasoni, Susanna; Benedetti, Valentina; Longaretti, Lorena; Rota, Cinzia; Todeschini, Marta; Rizzo, Paola; Introna, Martino; Grazia de Simoni, Maria; Remuzzi, Giuseppe; Goligorsky, Michael S; Benigni, Ariela
2015-04-14
The application of cell-based therapies in regenerative medicine is gaining recognition. Here, we show that human bone marrow stromal cells (BMSCs), also known as bone-marrow-derived mesenchymal cells, can be reprogrammed into renal proximal tubular-like epithelial cells using cell-free extracts. Streptolysin-O-permeabilized BMSCs exposed to HK2-cell extracts underwent morphological changes-formation of "domes" and tubule-like structures-and acquired epithelial functional properties such as transepithelial-resistance, albumin-binding, and uptake and specific markers E-cadherin and aquaporin-1. Transmission electron microscopy revealed the presence of brush border microvilli and tight intercellular contacts. RNA sequencing showed tubular epithelial transcript abundance and revealed the upregulation of components of the EGFR pathway. Reprogrammed BMSCs integrated into self-forming kidney tissue and formed tubular structures. Reprogrammed BMSCs infused in immunodeficient mice with cisplatin-induced acute kidney injury engrafted into proximal tubuli, reduced renal injury and improved function. Thus, reprogrammed BMSCs are a promising cell resource for future cell therapy. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, H., E-mail: tanaka@semicon.kuee.kyoto-u.ac.jp; Mori, S.; Morioka, N.
2014-12-21
We calculated the phonon-limited hole mobility in rectangular cross-sectional [001], [110], [111], and [112]-oriented germanium nanowires, and the hole transport characteristics were investigated. A tight-binding approximation was used for holes, and phonons were described by a valence force field model. Then, scattering probability of holes by phonons was calculated taking account of hole-phonon interaction atomistically, and the linearized Boltzmann's transport equation was solved to calculate the hole mobility at low longitudinal field. The dependence of the hole mobility on nanowire geometry was analyzed in terms of the valence band structure of germanium nanowires, and it was found that the dependencemore » was qualitatively reproduced by considering an average effective mass and the density of states of holes. The calculation revealed that [110] germanium nanowires with large height along the [001] direction show high hole mobility. Germanium nanowires with this geometry are also expected to exhibit high electron mobility in our previous work, and thus they are promising for complementary metal-oxide-semiconductor (CMOS) applications.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hussain, Zahid; Brouet, Veronique; Yang, Wanli
2008-01-16
We present a detailed angle-resolved photoemission spectroscopy (ARPES) investigation of the RTe3 family, which sets this system as an ideal"textbook" example for the formation of a nesting driven charge density wave (CDW). This family indeed exhibits the full range of phenomena that can be associated to CDWinstabilities, from the opening of large gaps on the best nested parts of Fermi surface (up to 0.4 eV), to the existence of residual metallic pockets. ARPES is the best suited technique to characterize these features, thanks to its unique ability to resolve the electronic structure in k space. An additional advantage of RTe3more » is that theband structure can be very accurately described by a simple two dimensional tight-binding (TB) model, which allows one to understand and easily reproduce many characteristics of the CDW. In this paper, we first establish the main features of the electronic structure by comparing our ARPES measurements with the linear muffin-tinorbital band calculations. We use this to define the validity and limits of the TB model. We then present a complete description of the CDW properties and of their strong evolution as a function of R. Using simple models, we are able to reproduce perfectly the evolution of gaps in k space, the evolution of the CDW wave vector with R, and the shape of the residual metallic pockets. Finally, we give an estimation of the CDWinteraction parameters and find that the change in the electronic density of states n (EF), due to lattice expansion when different R ions are inserted, has the correct order of magnitude to explain the evolution of the CDW properties.« less
Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.
Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel
2018-02-13
Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Lensink, M F; Haapalainen, A M; Hiltunen, J K; Glumoff, T; Juffer, A H
2002-10-11
In the study of the structure and function relationship of human MFE-2, we have investigated the dynamics of human MFE-2SCP-2L (hSCP-2L) and its response to ligand removal. A comparison was made with homologous rabbit SCP-2. Breathing and a closing motion are found, identifiable with an adjustment in size and a closing off of the binding pocket. Crucial residues for structural integrity have been identified. Particularly mobile areas of the protein are loop 1 that is connecting helices A and C in space, and helix D, next to the entrance of the pocket. In hSCP-2L, the binding pocket gets occupied by Phe93, which is making a tight hydrophobic contact with Trp36. In addition, it is found that the C-terminal peroxisomal targeting signal (PTS1) that is solvent exposed in the complexed structure becomes buried when no ligand is present. Moreover, an anti-correlation exists between burial of PTS1 and the size of the binding pocket. The results are in accordance with plant nsLTPs, where a similar accommodation of binding pocket size was found after ligand binding/removal. Furthermore, the calculations support the suggestion of a ligand-assisted targeting mechanism.
2010-06-01
for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic
Topological magnetic phase in LaMnO3 (111) bilayer
NASA Astrophysics Data System (ADS)
Weng, Yakui; Huang, Xin; Yao, Yugui; Dong, Shuai
Candidates for correlated topological insulators, originated from the spin-orbit coupling as well as Hubbard type correlation, are expected in the (111) bilayer of perovskite-structural transition-metal oxides. Based on the first-principles calculation and tight-binding model, the electronic structure of a LaMnO3 (111) bilayer sandwiched in LaScO3 barriers has been investigated. For the ideal undistorted perovskite structure, the Fermi energy of LaMnO3 (111) bilayer just stays at the Dirac point, rendering a semi-metal (graphene-like) which is also a half-metal (different from graphene nor previous studied LaNiO3 (111) bilayer). The Dirac cone can be opened by the spin-orbit coupling, giving rise to nontrivial topological bands corresponding to the (quantized) anomalous Hall effect. For the realistic orthorhombic distorted lattice, the Dirac point moves with increasing Hubbard repulsion (or equivalent Jahn-Teller distortion). Finally, a Mott gap opens, establishing a phase boundary between the Mott insulator and topological magnetic insulator. Our calculation finds that the gap opened by spin-orbit coupling is much smaller in the orthorhombic distorted lattice (~ 1 . 7 meV) than the undistorted one (~11 meV).
Structure-based optimization of Cephalothin-analogue boronic acids as β-lactamase inhibitors
Morandi, Stefania; Morandi, Federica; Caselli, Emilia; Shoichet, Brian K.; Prati, Fabio
2008-01-01
Boronic acids have proved to be promising selective inhibitors of β-lactamases, acting as transition state analogues. Starting from a previously described nanomolar inhibitor of AmpC β-lactamase, three new inhibitors were designed to gain interactions with highly conserved residues, such as Asn343, and to bind more tightly to the enzyme. Among these, one was obtained by stereoselective synthesis and succeeded in placing its anionic group into the carboxylate binding site of the enzyme, as revealed by X-ray crystallography of the complex inhibitor/AmpC. Nevertheless, it failed at improving affinity, when compared to the lead from which it was derived. The origins of this structural and energetic discrepancy are discussed. PMID:17997318
Iron loading site on the Fe-S cluster assembly scaffold protein is distinct from the active site.
Rodrigues, Andria V; Kandegedara, Ashoka; Rotondo, John A; Dancis, Andrew; Stemmler, Timothy L
2015-06-01
Iron-sulfur (Fe-S) cluster containing proteins are utilized in almost every biochemical pathway. The unique redox and coordination chemistry associated with the cofactor allows these proteins to participate in a diverse set of reactions, including electron transfer, enzyme catalysis, DNA synthesis and signaling within several pathways. Due to the high reactivity of the metal, it is not surprising that biological Fe-S cluster assembly is tightly regulated within cells. In yeast, the major assembly pathway for Fe-S clusters is the mitochondrial ISC pathway. Yeast Fe-S cluster assembly is accomplished using the scaffold protein (Isu1) as the molecular foundation, with assistance from the cysteine desulfurase (Nfs1) to provide sulfur, the accessory protein (Isd11) to regulate Nfs1 activity, the yeast frataxin homologue (Yfh1) to regulate Nfs1 activity and participate in Isu1 Fe loading possibly as a chaperone, and the ferredoxin (Yah1) to provide reducing equivalents for assembly. In this report, we utilize calorimetric and spectroscopic methods to provide molecular insight into how wt-Isu1 from S. cerevisiae becomes loaded with iron. Isothermal titration calorimetry and an iron competition binding assay were developed to characterize the energetics of protein Fe(II) binding. Differential scanning calorimetry was used to identify thermodynamic characteristics of the protein in the apo state or under iron loaded conditions. Finally, X-ray absorption spectroscopy was used to characterize the electronic and structural properties of Fe(II) bound to Isu1. Current data are compared to our previous characterization of the D37A Isu1 mutant, and these suggest that when Isu1 binds Fe(II) in a manner not perturbed by the D37A substitution, and that metal binding occurs at a site distinct from the cysteine rich active site in the protein.
First-principles modeling of the thermoelectric properties of SrTiO3/SrRuO3 superlattices
NASA Astrophysics Data System (ADS)
García-Fernández, Pablo; Verissimo-Alves, Marcos; Bilc, Daniel I.; Ghosez, Philippe; Junquera, Javier
2012-08-01
Using a combination of first-principles simulations, based on density functional theory and Boltzmann's semiclassical theory, we have calculated the transport and thermoelectric properties of the half-metallic two-dimensional electron gas confined in single SrRuO3 layers of SrTiO3/SrRuO3 periodic superlattices. Close to the Fermi energy, we find that the semiconducting majority-spin channel displays a very large in-plane component of the Seebeck tensor at room temperature, S˜ 1500 μV/K, and the minority-spin channel shows good in-plane conductivity, σ=2.5 (mΩ cm)-1. However, we find that the total power factor and thermoelectric figure of merit for reduced doping is too small for practical applications. Our results support that the confinement of the electronic motion is not the only thing that matters to describe the main features of the transport and thermoelectric properties with respect the chemical doping, but the shape of the electronic density of states, which in our case departs from the free-electron behavior, is also important. The evolution of the electronic structure, electrical conductivity, Seebeck coefficient, and power factor as a function of the chemical potential is explained by a simplified tight-binding model. We find that the electron gas in our system is composed by a pair of one-dimensional electron gases orthogonal to each other. This reflects the fact the physical dimensionality of the electronic system (1D) can be even smaller than that of the spacial confinement of the carriers (2D).
Baugh, Loren; Le Trong, Isolde; Cerutti, David S; Gülich, Susanne; Stayton, Patrick S; Stenkamp, Ronald E; Lybrand, Terry P
2010-06-08
We have identified a distal point mutation in streptavidin that causes a 1000-fold reduction in biotin binding affinity without disrupting the equilibrium complex structure. The F130L mutation creates a small cavity occupied by a water molecule; however, all neighboring side chain positions are preserved, and protein-biotin hydrogen bonds are unperturbed. Molecular dynamics simulations reveal a reduced mobility of biotin binding residues but no observable destabilization of protein-ligand interactions. Our combined structural and computational studies suggest that the additional water molecule may affect binding affinity through an electronic polarization effect that impacts the highly cooperative hydrogen bonding network in the biotin binding pocket.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jiang; Malmirchegini, G. Reza; Clubb, Robert T.
Native mass spectrometry (MS) has become an invaluable tool for the characterization of proteins and non-covalent protein complexes under near physiological solution conditions. Here we report the structural characterization of human hemoglobin (Hb), a 64 kDa oxygen-transporting protein complex, by high resolution native top-down mass spectrometry using electrospray ionization (ESI) and a 15-Tesla Fourier transform ion cyclotron resonance (FTICR) mass spectrometer. Native MS preserves the non-covalent interactions between the globin subunits, and electron capture dissociation (ECD) produces fragments directly from the intact Hb complex without dissociating the subunits. Using activated ion ECD, we observe the gradual unfolding process of themore » Hb complex in the gas phase. Without protein ion activation, the native Hb shows very limited ECD fragmentation from the N-termini, suggesting a tightly packed structure of the native complex and therefore low fragmentation efficiency. Precursor ion activation allows steady increase of N-terminal fragment ions, while the C-terminal fragments remain limited (38 c ions and 4 z ions on the α chain; 36 c ions and 2 z ions on the β chain). This ECD fragmentation pattern suggests that upon activation, the Hb complex starts to unfold from the N-termini of both subunits, whereas the C-terminal regions and therefore the potential regions involved in the subunit binding interactions remain intact. ECD-MS of the Hb dimer show similar fragmentation patterns as the Hb tetramer, providing further evidence for the hypothesized unfolding process of the Hb complex in the gas phase. Native top-down ECD-MS allows efficient probing of the Hb complex structure and the subunit binding interactions in the gas phase. Finally, it may provide a fast and effective means to probe the structure of novel protein complexes that are intractable to traditional structural characterization tools.« less
Green's function calculations for semi-infinite carbon nanotubes
NASA Astrophysics Data System (ADS)
John, D. L.; Pulfrey, D. L.
2006-02-01
In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.
Polarizable atomistic calculation of site energy disorder in amorphous Alq3.
Nagata, Yuki
2010-02-01
A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.
Nonlinear properties of gated graphene in a strong electromagnetic field
DOE Office of Scientific and Technical Information (OSTI.GOV)
Avetisyan, A. A., E-mail: artakav@ysu.am; Djotyan, A. P., E-mail: adjotyan@ysu.am; Moulopoulos, K., E-mail: cos@ucy.ac.cy
We develop a microscopic theory of a strong electromagnetic field interaction with gated bilayer graphene. Quantum kinetic equations for density matrix are obtained using a tight binding approach within second quantized Hamiltonian in an intense laser field. We show that adiabatically changing the gate potentials with time may produce (at resonant photon energy) a full inversion of the electron population with high density between valence and conduction bands. In the linear regime, excitonic absorption of an electromagnetic radiation in a graphene monolayer with opened energy gap is also studied.
Electron-phonon interaction in quantum transport through quantum dots and molecular systems
NASA Astrophysics Data System (ADS)
Ojeda, J. H.; Duque, C. A.; Laroze, D.
2016-12-01
The quantum transport and effects of decoherence properties are studied in quantum dots systems and finite homogeneous chains of aromatic molecules connected to two semi-infinite leads. We study these systems based on the tight-binding approach through Green's function technique within a real space renormalization and polaron transformation schemes. In particular, we calculate the transmission probability following the Landauer-Büttiker formalism, the I - V characteristics and the noise power of current fluctuations taken into account the decoherence. Our results may explain the inelastic effects through nanoscopic systems.
Why three-body physics does not solve the proton-radius puzzle.
Karr, Jean-Philippe; Hilico, Laurent
2012-09-07
The possible involvement of weakly bound three-body systems in the muonic hydrogen spectroscopy experiment, which could resolve the current discrepancy between determinations of the proton radius, is investigated. Using variational calculations with complex coordinate rotation, we show that in the pμe ion, which was recently proposed as a possible candidate, the pμ core fails to bind the outer electron tightly enough to explain the discrepancy. It is also shown that the ppμ molecular ion cannot play any role in the observed line.
Spin-polarized transport in multiterminal silicene nanodevices
NASA Astrophysics Data System (ADS)
Xu, Ning
2018-01-01
The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.
2D Quantum Simulation of MOSFET Using the Non Equilibrium Green's Function Method
NASA Technical Reports Server (NTRS)
Svizhenko, Alexel; Anantram, M. P.; Govindan, T. R.; Yan, Jerry (Technical Monitor)
2000-01-01
The objectives this viewgraph presentation summarizes include: (1) the development of a quantum mechanical simulator for ultra short channel MOSFET simulation, including theory, physical approximations, and computer code; (2) explore physics that is not accessible by semiclassical methods; (3) benchmarking of semiclassical and classical methods; and (4) study other two-dimensional devices and molecular structure, from discretized Hamiltonian to tight-binding Hamiltonian.
Structural mechanisms of DNA binding and unwinding in bacterial RecQ helicases
Manthei, Kelly A.; Hill, Morgan C.; Burke, Jordan E.; ...
2015-03-23
RecQ helicases unwind remarkably diverse DNA structures as key components of many cellular processes. How RecQ enzymes accommodate different substrates in a unified mechanism that couples ATP hydrolysis to DNA unwinding is unknown. In this paper, the X-ray crystal structure of the Cronobacter sakazakii RecQ catalytic core domain bound to duplex DNA with a 3' single-stranded extension identifies two DNA-dependent conformational rearrangements: a winged-helix domain pivots ~90° to close onto duplex DNA, and a conserved aromatic-rich loop is remodeled to bind ssDNA. These changes coincide with a restructuring of the RecQ ATPase active site that positions catalytic residues for ATPmore » hydrolysis. Complex formation also induces a tight bend in the DNA and melts a portion of the duplex. Finally, this bending, coupled with translocation, could provide RecQ with a mechanism for unwinding duplex and other DNA structures.« less
NASA Astrophysics Data System (ADS)
Sukkabot, Worasak; Pinsook, Udomsilp
2017-01-01
Using the atomistic tight-binding theory (TB) and a configuration interaction description (CI), we numerically compute the excitonic splitting of CdX(X = Se, S and Te)/ZnS core/shell nanocrystals with the objective to explain how types of the core materials and growth shell thickness can provide the detailed manipulation of the dark-dark (DD), dark-bright (DB) and bright-bright (BB) excitonic splitting, beneficial for the active application of quantum information. To analyze the splitting of the excitonic states, the optical band gaps, ground-state wave function overlaps and atomistic electron-hole interactions tend to be numerically demonstrated. Based on the atomistic computations, the single-particle and excitonic gaps are mainly reduced with the increasing ZnS shell thickness owing to the quantum confinement. In the range of the higher to lower energies, the order of the single-particle gaps is CdSe/ZnS, CdS/ZnS and CdTe/ZnS core/shell nanocrystals, while one of the excitonic gaps is CdS/ZnS, CdSe/ZnS and CdTe/ZnS core/shell nanocrystals because of the atomistic electron-hole interaction. The strongest electron-hole interactions are mainly observed in CdSe/ZnS core/shell nanocrystals. In addition, the computational results underline that the energies of the dark-dark (DD), dark-bright (DB) and bright-bright (BB) excitonic splitting are generally reduced with the increasing ZnS growth shell thickness as described by the trend of the electron-hole exchange interaction. The high-to-low splitting of the excitonic states is demonstrated in CdSe/ZnS, CdTe/ZnS and CdS/ZnS core/shell nanocrystals because of the fashion in the electron-hole exchange interaction and overlaps of the electron-hole wave functions. As the resulting calculations, it is expected that CdS/ZnS core/shell nanocrystals are the best candidates to be the source of entangled photons. Finally, the comprehensive information on the excitonic splitting can enable the use of suitable core/shell nanocrystals for the entangled photons in the application of quantum information.
Structural basis of recognition of farnesylated and methylated KRAS4b by PDEδ.
Dharmaiah, Srisathiyanarayanan; Bindu, Lakshman; Tran, Timothy H; Gillette, William K; Frank, Peter H; Ghirlando, Rodolfo; Nissley, Dwight V; Esposito, Dominic; McCormick, Frank; Stephen, Andrew G; Simanshu, Dhirendra K
2016-11-01
Farnesylation and carboxymethylation of KRAS4b (Kirsten rat sarcoma isoform 4b) are essential for its interaction with the plasma membrane where KRAS-mediated signaling events occur. Phosphodiesterase-δ (PDEδ) binds to KRAS4b and plays an important role in targeting it to cellular membranes. We solved structures of human farnesylated-methylated KRAS4b in complex with PDEδ in two different crystal forms. In these structures, the interaction is driven by the C-terminal amino acids together with the farnesylated and methylated C185 of KRAS4b that binds tightly in the central hydrophobic pocket present in PDEδ. In crystal form II, we see the full-length structure of farnesylated-methylated KRAS4b, including the hypervariable region. Crystal form I reveals structural details of farnesylated-methylated KRAS4b binding to PDEδ, and crystal form II suggests the potential binding mode of geranylgeranylated-methylated KRAS4b to PDEδ. We identified a 5-aa-long sequence motif (Lys-Ser-Lys-Thr-Lys) in KRAS4b that may enable PDEδ to bind both forms of prenylated KRAS4b. Structure and sequence analysis of various prenylated proteins that have been previously tested for binding to PDEδ provides a rationale for why some prenylated proteins, such as KRAS4a, RalA, RalB, and Rac1, do not bind to PDEδ. Comparison of all four available structures of PDEδ complexed with various prenylated proteins/peptides shows the presence of additional interactions due to a larger protein-protein interaction interface in KRAS4b-PDEδ complex. This interface might be exploited for designing an inhibitor with minimal off-target effects.
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
NASA Astrophysics Data System (ADS)
Roxbury, Daniel
It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.
Dynamics of Polarons in Organic Conjugated Polymers with Side Radicals.
Liu, J J; Wei, Z J; Zhang, Y L; Meng, Y; Di, B
2017-03-16
Based on the one-dimensional tight-binding Su-Schrieffer-Heeger (SSH) model, and using the molecular dynamics method, we discuss the dynamics of electron and hole polarons propagating along a polymer chain, as a function of the distance between side radicals and the magnitude of the transfer integrals between the main chain and the side radicals. We first discuss the average velocities of electron and hole polarons as a function of the distance between side radicals. It is found that the average velocities of the electron polarons remain almost unchanged, while the average velocities of hole polarons decrease significantly when the radical distance is comparable to the polaron width. Second, we have found that the average velocities of electron polarons decrease with increasing transfer integral, but the average velocities of hole polarons increase. These results may provide a theoretical basis for understanding carriers transport properties in polymers chain with side radicals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patarroyo, Manuel E., E-mail: mepatarr@mail.com; Universidad Nacional de Colombia, Bogota; Almonacid, Hannia
Highlights: Black-Right-Pointing-Pointer Fundamental residues located in some HABPs are associated with their 3D structure. Black-Right-Pointing-Pointer Electron-donor atoms present in {beta}-turn, random, distorted {alpha}-helix structures. Black-Right-Pointing-Pointer Electron-donor atoms bound to HLA-DR53. Black-Right-Pointing-Pointer Electron-acceptor atoms present in regular {alpha}-helix structure bound to HLA-DR52. -- Abstract: Plasmodium falciparum malaria continues being one of the parasitic diseases causing the highest worldwide mortality due to the parasite's multiple evasion mechanisms, such as immunological silence. Membrane and organelle proteins are used during invasion for interactions mediated by high binding ability peptides (HABPs); these have amino acids which establish hydrogen bonds between them in some of theirmore » critical binding residues. Immunisation assays in the Aotus model using HABPs whose critical residues had been modified have revealed a conformational change thereby enabling a protection-inducing response. This has improved fitting within HLA-DR{beta}1{sup Asterisk-Operator} molecules where amino acid electron-donor atoms present in {beta}-turn, random or distorted {alpha}-helix structures preferentially bound to HLA-DR53 molecules, whilst HABPs having amino acid electron-acceptor atoms present in regular {alpha}-helix structure bound to HLA-DR52. This data has great implications for vaccine development.« less
NASA Astrophysics Data System (ADS)
Cao, Zhe; Liu, Guangdi; Zhan, Hongbin; Li, Chaozheng; You, Yuan; Yang, Chengyu; Jiang, Hang
2016-11-01
Understanding the pore networks of unconventional tight reservoirs such as tight sandstones and shales is crucial for extracting oil/gas from such reservoirs. Mercury injection capillary pressure (MICP) and N2 gas adsorption (N2GA) are performed to evaluate pore structure of Chang-7 tight sandstone. Thin section observation, scanning electron microscope, grain size analysis, mineral composition analysis, and porosity measurement are applied to investigate geological control factors of pore structure. Grain size is positively correlated with detrital mineral content and grain size standard deviation while negatively related to clay content. Detrital mineral content and grain size are positively correlated with porosity, pore throat radius and withdrawal efficiency and negatively related to capillary pressure and pore-to-throat size ratio; while interstitial material is negatively correlated with above mentioned factors. Well sorted sediments with high debris usually possess strong compaction resistance to preserve original pores. Although many inter-crystalline pores are produced in clay minerals, this type of pores is not the most important contributor to porosity. Besides this, pore shape determined by N2GA hysteresis loop is consistent with SEM observation on clay inter-crystalline pores while BJH pore volume is positively related with clay content, suggesting N2GA is suitable for describing clay inter-crystalline pores in tight sandstones.
Cao, Zhe; Liu, Guangdi; Zhan, Hongbin; Li, Chaozheng; You, Yuan; Yang, Chengyu; Jiang, Hang
2016-01-01
Understanding the pore networks of unconventional tight reservoirs such as tight sandstones and shales is crucial for extracting oil/gas from such reservoirs. Mercury injection capillary pressure (MICP) and N2 gas adsorption (N2GA) are performed to evaluate pore structure of Chang-7 tight sandstone. Thin section observation, scanning electron microscope, grain size analysis, mineral composition analysis, and porosity measurement are applied to investigate geological control factors of pore structure. Grain size is positively correlated with detrital mineral content and grain size standard deviation while negatively related to clay content. Detrital mineral content and grain size are positively correlated with porosity, pore throat radius and withdrawal efficiency and negatively related to capillary pressure and pore-to-throat size ratio; while interstitial material is negatively correlated with above mentioned factors. Well sorted sediments with high debris usually possess strong compaction resistance to preserve original pores. Although many inter-crystalline pores are produced in clay minerals, this type of pores is not the most important contributor to porosity. Besides this, pore shape determined by N2GA hysteresis loop is consistent with SEM observation on clay inter-crystalline pores while BJH pore volume is positively related with clay content, suggesting N2GA is suitable for describing clay inter-crystalline pores in tight sandstones. PMID:27830731
Inhibition of ATP Synthase by Chlorinated Adenosine Analogue
Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha
2009-01-01
8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165
Sousa, Duncan R.; Stagg, Scott M.; Stroupe, M. Elizabeth
2013-01-01
Tropomyosin is a key factor in the molecular mechanisms that regulate the binding of myosin motors to actin filaments in most eukaryotic cells. This regulation is achieved by the azimuthal repositioning of tropomyosin along the actin:tropomyosin:troponin thin filament to block or expose myosin binding sites on actin. In striated muscle, including involuntary cardiac muscle, tropomyosin regulates muscle contraction by coupling Ca2+ binding to troponin with myosin binding to the thin filament. In smooth muscle, the switch is the post-translational modification of the myosin. Depending on the activation state of troponin and the binding state of myosin, tropomyosin can occupy the blocked, closed, or open position on actin. Using native cryogenic 3DEM, we have directly resolved and visualized cardiac and gizzard muscle tropomyosin on filamentous actin in the position that corresponds to the closed state. From the 8-Å resolution structure of the reconstituted Ac:Tm filament formed with gizzard-derived Tm we discuss two possible mechanisms for the transition from closed to open state and describe the role Tm plays in blocking myosin tight binding in the closed state position. PMID:24021812
Analysis of oxygen binding-energy variations for BaO on W
NASA Astrophysics Data System (ADS)
Haas, G. A.; Shih, A.; Mueller, D.; Thomas, R. E.
Interatomic Auger analyses have been made of different forms of BaO layers on W substrates. Variations in Auger spectroscopy energies of the Ba4dBa5pO2p interatomic Auger transition were found to be largely governed by the O2p binding energy of the BaO adsorbate. This was illustrated by comparing results of the Auger data values with values derived from O2p binding energies using ultraviolet photoelectron spectroscopy. Very good agreement was observed not only for the W<100> substrate but also for the W<110> substrate which showed two oxygen-induced electronics state. Variations in binding energy were noted for different states of BaO lattice formation and for different amounts of oxidation, ranging from the transition of Ba to BaO and continuing to the BaO 2 stoichiometry and beyond. Effects were also reported for adsorbate alignment and thermal activation (i.e., reduction) of the oxidized state. An empirical relationship was found suggesting that the more tightly bound the O2p states of the BaO adsorbate were, the lower its work function would be. This link between binding energy and work function was observed to be valid not only for cases of poisoning by oxidation, but held as well during reactivation by the subsequent reduction of the oxide. In addition, this relationship also appeared to predict the low work function obtained through the introduction of substances such as Sc to the BaO-W system. Possible qualitative reasons which might contribute to this are discussed in terms of enhanced dipole effects and shifts in band structure.
Dissipative time-dependent quantum transport theory.
Zhang, Yu; Yam, Chi Yung; Chen, GuanHua
2013-04-28
A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.
Electronic properties of hybrid monolayer-multilayer MoS2 nanostructured materials
NASA Astrophysics Data System (ADS)
Mlinar, Vladan
2017-12-01
The remarkable, layer-dependent properties of molybdenum disulphide (MoS2), such as an appropriately small and sizable bandgap or interplay between spin and the valley degrees of freedom, make it an attractive candidate for photodetectors, electrominescent devices, valleytronic devices, etc. Using nanostructuring to manipulate the size in lateral direction or number of layers of MoS2, we are opening a new playground for exploring and tuning properties of such systems. Here, we theoretically study the electronic properties of nanostructured MoS2 systems consisting of monolayer and multilayer MoS2 regions. In our analysis we consider hybrid systems in which monolayer region is surrounded by multilayer region and vice versa. We show how energy spectra and localization of carriers are influenced by the size and shape of the regions in lateral direction, number of MoS2 layers in the multilayer region, and the edge structure. Finally, we demonstrate how to control localization of carriers in these hybrid systems, which could make them appealing candidates for optoelectronic devices. Our findings are extracted from a tight-binding model that includes non-orthogonal sp3d5 orbitals, nearest-neighbor hopping matrix elements, and spin-orbit coupling.
Nonlocal plasmonic response of doped and optically pumped graphene, MoS2, and black phosphorus
NASA Astrophysics Data System (ADS)
Petersen, René; Pedersen, Thomas Garm; Javier García de Abajo, F.
2017-11-01
Plasmons in two-dimensional (2D) materials have emerged as a new source of physical phenomena and optoelectronic applications due in part to the relatively small number of charge carriers on which they are supported. Unlike conventional plasmonic materials, they possess a large Fermi wavelength, which can be comparable with the plasmon wavelength, thus leading to unusually strong nonlocal effects. Here, we study the optical response of a selection of 2D crystal layers (graphene, MoS2, and black phosphorus) with inclusion of nonlocal and thermal effects. We extensively analyze their plasmon dispersion relations and focus on the Purcell factor for the decay of an optical emitter in close proximity to the material as a way to probe nonlocal and thermal effects, with emphasis placed on the interplay between temperature and doping. The results are based on tight-binding modeling of the electronic structure combined with the random-phase approximation response function in which the temperature enters through the Fermi-Dirac electronic occupation distribution. Our study provides a route map for the exploration and exploitation of the ultrafast optical response of 2D materials.
Numerical Modeling of Nanoelectronic Devices
NASA Technical Reports Server (NTRS)
Klimeck, Gerhard; Oyafuso, Fabiano; Bowen, R. Chris; Boykin, Timothy
2003-01-01
Nanoelectronic Modeling 3-D (NEMO 3-D) is a computer program for numerical modeling of the electronic structure properties of a semiconductor device that is embodied in a crystal containing as many as 16 million atoms in an arbitrary configuration and that has overall dimensions of the order of tens of nanometers. The underlying mathematical model represents the quantummechanical behavior of the device resolved to the atomistic level of granularity. The system of electrons in the device is represented by a sparse Hamiltonian matrix that contains hundreds of millions of terms. NEMO 3-D solves the matrix equation on a Beowulf-class cluster computer, by use of a parallel-processing matrix vector multiplication algorithm coupled to a Lanczos and/or Rayleigh-Ritz algorithm that solves for eigenvalues. In a recent update of NEMO 3-D, a new strain treatment, parameterized for bulk material properties of GaAs and InAs, was developed for two tight-binding submodels. The utility of the NEMO 3-D was demonstrated in an atomistic analysis of the effects of disorder in alloys and, in particular, in bulk In(x)Ga(l-x)As and in In0.6Ga0.4As quantum dots.
Electronic and spectroscopic properties of early 3d metal atoms on a graphite surface
NASA Astrophysics Data System (ADS)
Rakotomahevitra, A.; Garreau, G.; Demangeat, C.; Parlebas, J. C.
1995-07-01
High-sensitivity magneto-optic Kerr effect experiments failed to detect manifestations of magnetism in epitaxial films of V on Ag(100) substrates. More recently V 3s XPS of freshly evaporated V clusters on graphite exhibited the appearance of a satellite structure which has then been interpreted by the effect of surface magnetic moments on V. It is the absence of unambiguous results on the electronic properties of early 3d supported metals that prompts us to examine the problem. Our purpose is twofold. In a first part, after a total energy calculation within a tight-binding method which yields the equilibrium position of a given adatom, we use the Hartree-Fock approximation to find out a possible magnetic solution of V (or Cr) upon graphite for a reasonable value of the exchange integral Jdd. In a second part the informations given by the density of states of the graphite surface as well as the additional states of the adsorbed atom are taken into account through a generalised impurity Anderson Hamiltonian which incorporates the various Coulomb and exchange interactions necessary to analyse the 3s XPS results.
Wang, Xiao-Tao; Chan, Ting Fai; Lam, Veronica M S; Engel, Paul C
2008-08-01
Human glucose 6-phosphate dehydrogenase, purified after overexpression in E. coli, was shown to contain one molecule/subunit of acid-extractable "structural" NADP+ and no NADPH. This tightly bound NADP+ was reduced by G6P, presumably following migration to the catalytic site. Gel-filtration yielded apoenzyme, devoid of bound NADP+ but, surprisingly, still fully active. Mr of the main component of "stripped" enzyme by gel filtration was approximately 100,000, suggesting a dimeric apoenzyme (subunit Mr = 59,000). Holoenzyme also contained tetramer molecules and, at high protein concentration, a dynamic equilibrium gave an apparent intermediate Mr of 150 kDa. Fluorescence titration of the stripped enzyme gave the K d for structural NADP+ as 37 nM, 200-fold lower than for "catalytic" NADP+. Structural NADP+ quenches 91% of protein fluorescence. At 37 degrees C, stripped enzyme, much less stable than holoenzyme, inactivated irreversibly within 2 d. Inactivation at 4 degrees C was partially reversed at room temperature, especially with added NADP+. Apoenzyme was immediately active, without any visible lag, in rapid-reaction studies. Human G6PD thus forms active dimer without structural NADP+. Apparently, the true role of the second, tightly bound NADP+ is to secure long-term stability. This fits the clinical pattern, G6PD deficiency affecting the long-lived non-nucleate erythrocyte. The Kd values for two class I mutants, G488S and G488V, were 273 nM and 480 nM, respectively (seven- and 13-fold elevated), matching the structural prediction of weakened structural NADP+ binding, which would explain decreased stability and consequent disease. Preparation of native apoenzyme and measurement of Kd constant for structural NADP+ will now allow quantitative assessment of this defect in clinical G6PD mutations.
The Ordering and Electronic Structure of Multilayer Epitaxial Graphene on SiC
NASA Astrophysics Data System (ADS)
Conrad, Edward
2011-03-01
The structural definition of graphene as a single sheet of hexagonal carbon limits how we view this material. It is the electronic properties of a single isolated graphene sheet that actually defines and motivates current graphene research. Remarkably, the best example of the idealized band structure of graphene comes does not come from a single graphene layer but from multilayer films grown on SiC. Multilayer epitaxial graphene (MEG) not only shows all the 2D properties expected for an isolated graphene sheet, but it the scalability to large scale integrated carbon circuits. I will show that the reason for this remarkable property, i.e. that a multilayer graphene films behaving like a single graphene sheet, is due to MEG's unique stacking. MEG films have a quasi-ordered rotational stacking that breaks the Bernal stacking symmetry associated with graphite. Angle resolved photoemission spectroscopy (ARPES) data demonstrates that the bands are linear at the K-point of these films. We can also show that the rotated stacking is highly ordered and that less than 20% of the graphene sheets in the film are Bernal stacked. I will also show that ARPES measurements on MEG films demonstrate serious inadequacies with both tight binding and ab initio formalisms. In particular the data shows no reductions in the Fermi velocity or the formation of Van Hove singularity that have been consistently predicted for this material. I wish to acknowledge funding from the NSF under Grants No. DMR-0820382 and DMR-1005880.
Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya
The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Hong, Seung Hwan; Choi, Han-Yong
2013-09-11
We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.
NASA Astrophysics Data System (ADS)
Usman, Muhammad
2018-04-01
Bismide semiconductor materials and heterostructures are considered a promising candidate for the design and implementation of photonic, thermoelectric, photovoltaic, and spintronic devices. This work presents a detailed theoretical study of the electronic and optical properties of strongly coupled GaBixAs1 -x /GaAs multiple quantum well (MQW) structures. Based on a systematic set of large-scale atomistic tight-binding calculations, our results reveal that the impact of atomic-scale fluctuations in alloy composition is stronger than the interwell coupling effect, and plays an important role in the electronic and optical properties of the investigated MQW structures. Independent of QW geometry parameters, alloy disorder leads to a strong confinement of charge carriers, a large broadening of the hole energies, and a red-shift in the ground-state transition wavelength. Polarization-resolved optical transition strengths exhibit a striking effect of disorder, where the inhomogeneous broadening could exceed an order of magnitude for MQWs, in comparison to a factor of about 3 for single QWs. The strong influence of alloy disorder effects persists when small variations in the size and composition of MQWs typically expected in a realistic experimental environment are considered. The presented results highlight the limited scope of continuum methods and emphasize on the need for large-scale atomistic approaches to design devices with tailored functionalities based on the novel properties of bismide materials.
Zhang, Jingjing; Ni, Chen; Yang, Zhenguo; Piontek, Anna; Chen, Huapu; Wang, Sijie; Fan, Yiming; Qin, Zhihai; Piontek, Joerg
2015-08-01
Claudins (Cldn) are the major components of tight junctions (TJs) sealing the paracellular cleft in tissue barriers of various organs. Zebrafish Cldnb, the homolog of mammalian Cldn4, is expressed at epithelial cell-cell contacts and is important for regulating epidermal permeability. The bacterial toxin Clostridium perfringens enterotoxin (CPE) has been shown to bind to a subset of mammalian Cldns. In this study, we used the Cldn-binding C-terminal domain of CPE (194-319 amino acids, cCPE 194-319 ) to investigate its functional role in modulating zebrafish larval epidermal barriers. In vitro analyses show that cCPE 194-319 removed Cldn4 from epithelial cells and disrupted the monolayer tightness, which could be rescued by the removal of cCPE 194-319. Incubation of zebrafish larvae with cCPE 194-319 removed Cldnb specifically from the epidermal cell membrane. Dye diffusion analysis with 4-kDa fluorescent dextran indicated that the permeability of the epidermal barrier increased due to cCPE 194-319 incubation. Electron microscopic investigation revealed reversible loss of TJ integrity by Cldnb removal. Collectively, these results suggest that cCPE 194-319 could be used as a Cldnb modulator to transiently open the epidermal barrier in zebrafish. In addition, zebrafish might be used as an in vivo system to investigate the capability of cCPE to enhance drug delivery across tissue barriers. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Structures and Binding Energies of the Naphthalene Dimer in Its Ground and Excited States.
Dubinets, N O; Safonov, A A; Bagaturyants, A A
2016-05-05
Possible structures of the naphthalene dimer corresponding to local energy minima in the ground and excited (excimer) electronic states are comprehensively investigated using DFT-D and TDDFT-D methods with a special accent on the excimer structures. The corresponding binding and electronic transition energies are calculated, and the nature of the electronic states in different structures is analyzed. Several parallel (stacked) and T-shaped structures were found in both the ground and excited (excimer) states in a rather narrow energy range. The T-shaped structure with the lowest energy in the excited state exhibits a marked charge transfer from the upright molecule to the base one.
Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng
2013-01-01
Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982
Carbon Nanotube Field Emission Arrays
2011-06-01
K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density
Various Stone-Wales defects in phagraphene
NASA Astrophysics Data System (ADS)
Openov, L. A.; Podlivaev, A. I.
2016-08-01
Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.
Quantum Hall effect in ac driven graphene: From the half-integer to the integer case
NASA Astrophysics Data System (ADS)
Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu
2018-01-01
We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Desgranges, Caroline; Delhommelle, Jerome
We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less
Mechanism of Enzyme Repair by the AAA+ Chaperone Rubisco Activase.
Bhat, Javaid Y; Miličić, Goran; Thieulin-Pardo, Gabriel; Bracher, Andreas; Maxwell, Andrew; Ciniawsky, Susanne; Mueller-Cajar, Oliver; Engen, John R; Hartl, F Ulrich; Wendler, Petra; Hayer-Hartl, Manajit
2017-09-07
How AAA+ chaperones conformationally remodel specific target proteins in an ATP-dependent manner is not well understood. Here, we investigated the mechanism of the AAA+ protein Rubisco activase (Rca) in metabolic repair of the photosynthetic enzyme Rubisco, a complex of eight large (RbcL) and eight small (RbcS) subunits containing eight catalytic sites. Rubisco is prone to inhibition by tight-binding sugar phosphates, whose removal is catalyzed by Rca. We engineered a stable Rca hexamer ring and analyzed its functional interaction with Rubisco. Hydrogen/deuterium exchange and chemical crosslinking showed that Rca structurally destabilizes elements of the Rubisco active site with remarkable selectivity. Cryo-electron microscopy revealed that Rca docks onto Rubisco over one active site at a time, positioning the C-terminal strand of RbcL, which stabilizes the catalytic center, for access to the Rca hexamer pore. The pulling force of Rca is fine-tuned to avoid global destabilization and allow for precise enzyme repair. Copyright © 2017 Elsevier Inc. All rights reserved.
Engineering and manipulating exciton wave packets
NASA Astrophysics Data System (ADS)
Zang, Xiaoning; Montangero, Simone; Carr, Lincoln D.; Lusk, Mark T.
2017-05-01
When a semiconductor absorbs light, the resulting electron-hole superposition amounts to a uncontrolled quantum ripple that eventually degenerates into diffusion. If the conformation of these excitonic superpositions could be engineered, though, they would constitute a new means of transporting information and energy. We show that properly designed laser pulses can be used to create such excitonic wave packets. They can be formed with a prescribed speed, direction, and spectral make-up that allows them to be selectively passed, rejected, or even dissociated using superlattices. Their coherence also provides a handle for manipulation using active, external controls. Energy and information can be conveniently processed and subsequently removed at a distant site by reversing the original procedure to produce a stimulated emission. The ability to create, manage, and remove structured excitons comprises the foundation for optoexcitonic circuits with application to a wide range of quantum information, energy, and light-flow technologies. The paradigm is demonstrated using both tight-binding and time-domain density functional theory simulations.
Effective Hamiltonian for protected edge states in graphene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Winkler, R.; Deshpande, H.
Edge states in topological insulators (TIs) disperse symmetrically about one of the time-reversal invariant momenta Λ in the Brillouin zone (BZ) with protected degeneracies at Λ. Commonly TIs are distinguished from trivial insulators by the values of one or multiple topological invariants that require an analysis of the bulk band structure across the BZ. We propose an effective two-band Hamiltonian for the electronic states in graphene based on a Taylor expansion of the tight-binding Hamiltonian about the time-reversal invariant M point at the edge of the BZ. This Hamiltonian provides a faithful description of the protected edge states for bothmore » zigzag and armchair ribbons, though the concept of a BZ is not part of such an effective model. In conclusion, we show that the edge states are determined by a band inversion in both reciprocal and real space, which allows one to select Λ for the edge states without affecting the bulk spectrum.« less
Effective Hamiltonian for protected edge states in graphene
Winkler, R.; Deshpande, H.
2017-06-15
Edge states in topological insulators (TIs) disperse symmetrically about one of the time-reversal invariant momenta Λ in the Brillouin zone (BZ) with protected degeneracies at Λ. Commonly TIs are distinguished from trivial insulators by the values of one or multiple topological invariants that require an analysis of the bulk band structure across the BZ. We propose an effective two-band Hamiltonian for the electronic states in graphene based on a Taylor expansion of the tight-binding Hamiltonian about the time-reversal invariant M point at the edge of the BZ. This Hamiltonian provides a faithful description of the protected edge states for bothmore » zigzag and armchair ribbons, though the concept of a BZ is not part of such an effective model. In conclusion, we show that the edge states are determined by a band inversion in both reciprocal and real space, which allows one to select Λ for the edge states without affecting the bulk spectrum.« less
Stability of Weyl metals under impurity scattering
NASA Astrophysics Data System (ADS)
Huang, Zhoushen; Das, Tanmoy; Balatsky, Alexander V.; Arovas, Daniel P.
2013-04-01
We investigate the effects of bulk impurities on the electronic spectrum of Weyl semimetals, a recently identified class of Dirac-type materials. Using a T-matrix approach, we study resonant scattering due to a localized impurity in tight-binding versions of the continuum models recently discussed by [Burkov, Hook, and Balents, Phys. Rev. BPRBMDO1098-012110.1103/PhysRevB.84.235126 84, 235126 (2011)], describing perturbed four-component Dirac fermions in the vicinity of a critical point. The impurity potential is described by a strength g as well as a matrix structure Λ. Unlike the case in d-wave superconductors, where a zero energy resonance can always be induced by varying the scalar and/or magnetic impurity strength, we find that for certain types of impurity (Λ), the Weyl node is protected and that a scalar impurity will induce an intragap resonance over a wide range of scattering strength. A general framework is developed to address this question, as well as to determine the dependence of resonance energy on the impurity strength.
NASA Astrophysics Data System (ADS)
Ehlen, N.; Sanna, A.; Senkovskiy, B. V.; Petaccia, L.; Fedorov, A. V.; Profeta, G.; Grüneis, A.
2018-01-01
We report a Cs-doping-induced band inversion and the direct observation of a surface resonance state with an elliptical Fermi surface in black phosphorus (BP) using angle-resolved photoemission spectroscopy. By selectively inducing a higher electron concentration (1.7 ×1014cm-2 ) in the topmost layer, the changes in the Coulomb potential are sufficiently large to cause surface band inversion between the parabolic valence band of BP and a parabolic surface state around the Γ point of the BP Brillouin zone. Tight-binding calculations reveal that band gap openings at the crossing points in the two high-symmetry directions of the Brillouin zone require out-of-plane hopping and breaking of the glide mirror symmetry. Ab initio calculations are in very good agreement with the experiment if a stacking fault on the BP surface is taken into account. The demonstrated level of control over the band structure suggests the potential application of few-layer phosphorene in topological field-effect transistors.
Diverse magnetic quantization in bilayer silicene
NASA Astrophysics Data System (ADS)
Do, Thi-Nga; Shih, Po-Hsin; Gumbs, Godfrey; Huang, Danhong; Chiu, Chih-Wei; Lin, Ming-Fa
2018-03-01
The generalized tight-binding model is developed to investigate the rich and unique electronic properties of A B -bt (bottom-top) bilayer silicene under uniform perpendicular electric and magnetic fields. The first pair of conduction and valence bands, with an observable energy gap, displays unusual energy dispersions. Each group of conduction/valence Landau levels (LLs) is further classified into four subgroups, i.e., the sublattice- and spin-dominated LL subgroups. The magnetic-field-dependent LL energy spectra exhibit irregular behavior corresponding to the critical points of the band structure. Moreover, the electric field can induce many LL anticrossings. The main features of the LLs are uncovered with many van Hove singularities in the density-of-states and nonuniform delta-function-like peaks in the magnetoabsorption spectra. The feature-rich magnetic quantization directly reflects the geometric symmetries, intralayer and interlayer atomic interactions, spin-orbital couplings, and field effects. The results of this work can be applied to novel designs of Si-based nanoelectronics and nanodevices with enhanced mobilities.
Structure of ATP-Bound Human ATP:Cobalamin Adenosyltransferase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schubert,H.; Hill, C.
Mutations in the gene encoding human ATP:cobalamin adenosyltransferase (hATR) can result in the metabolic disorder known as methylmalonic aciduria (MMA). This enzyme catalyzes the final step in the conversion of cyanocobalamin (vitamin B{sub 12}) to the essential human cofactor adenosylcobalamin. Here we present the 2.5 {angstrom} crystal structure of ATP bound to hATR refined to an R{sub free} value of 25.2%. The enzyme forms a tightly associated trimer, where the monomer comprises a five-helix bundle and the active sites lie on the subunit interfaces. Only two of the three active sites within the trimer contain the bound ATP substrate, therebymore » providing examples of apo- and substrate-bound-active sites within the same crystal structure. Comparison of the empty and occupied sites indicates that twenty residues at the enzyme's N-terminus become ordered upon binding of ATP to form a novel ATP-binding site and an extended cleft that likely binds cobalamin. The structure explains the role of 20 invariant residues; six are involved in ATP binding, including Arg190, which hydrogen bonds to ATP atoms on both sides of the scissile bond. Ten of the hydrogen bonds are required for structural stability, and four are in positions to interact with cobalamin. The structure also reveals how the point mutations that cause MMA are deficient in these functions.« less
Structure and Electronic Properties of Ionized PAH Clusters
NASA Astrophysics Data System (ADS)
Joblin, Christine; Kokkin, Damian L.; Sabbah, Hassan; Bonnamy, Anthony; Dontot, Leo; Rapacioli, Mathias; Simon, Aude; Spiegelman, Fernand; Parneix, Pascal; Pino, Thomas; Pirali, Olivier; Falvo, Cyril; Gamboa, Antonio; Brechignac, Philippe; Garcia, Gustavo A.; Nahon, Laurent
2014-06-01
Polycyclic aromatic hydrocarbon (PAH) clusters have been proposed as candidates for evaporating very small grains that are revealed by their mid-IR emission at the surface of UV-irradiated clouds in interstellar space. This suggestion is a motivation for further characterization of the properties of these clusters in particular when they are ionized. We have used a molecular beam coupled to the photoelectron-photoion coincidence spectrometer DELICIOUS II/ III at the VUV beamline DESIRS of the synchrotron SOLEIL to characterize the electronic properties of cationic coronene (C24H12) and pyrene (C16H10) clusters up to the pentamer and heptamer, respectively. These experimental results are analysed in the light of electronic structure calculations. Simulations of the properties of ionized PAH clusters are faced with the difficulty of describing charge delocalization in these large systems. We will show that recent developments combining a Density Functional Tight Binding method with Configuration Interaction scheme is successful in simulating the ionization potential, which gives strong confidence into the predicted structures for these PAH clusters. We will also present current effort to study charge transfer states by performing complementary measurements with the PIRENEA ion trap set-up. Joint ANR project GASPARIM, ANR-10-BLAN-501 M. Rapacioli, C. Joblin and P. Boissel Astron. & Astrophys., 429 (2005), 193-204. G. Garcia, H. Soldi-Lose and L. Nahon Rev. Sci. Instrum., 80 (2009), 023102; G. Garcia, B. Cunha de Miranda, M. Tia, S. Daly, L. Nahon, Rev. Sci. Instrum., 84 (2013), 053112 M. Rapacioli, A. Simon, L. Dontot and F. Spiegelman Phys. Status Solidi B, 249 (2) (2012), 245-258; L. Dontot, M. Rapacioli and F. Spiegelman (2014) submitted
Englert, L; Biela, A; Zayed, M; Heine, A; Hangauer, D; Klebe, G
2010-11-01
Prerequisite for the design of tight binding protein inhibitors and prediction of their properties is an in-depth understanding of the structural and thermodynamic details of the binding process. A series of closely related phosphonamidates was studied to elucidate the forces underlying their binding affinity to thermolysin. The investigated inhibitors are identical except for the parts penetrating into the hydrophobic S₁'-pocket. A correlation of structural, kinetic and thermodynamic data was carried out by X-ray crystallography, kinetic inhibition assay and isothermal titration calorimetry. Binding affinity increases with larger ligand hydrophobic P₁'-moieties accommodating the S₁'-pocket. Surprisingly, larger P₁'-side chain modifications are accompanied by an increase in the enthalpic contribution to binding. In agreement with other studies, it is suggested that the release of largely disordered waters from an imperfectly hydrated pocket results in an enthalpically favourable integration of these water molecules into bulk water upon inhibitor binding. This enthalpically favourable process contributes more strongly to the binding energetics than the entropy increase resulting from the release of water molecules from the S₁'-pocket or the formation of apolar interactions between protein and inhibitor. Displacement of highly disordered water molecules from a rather imperfectly hydrated and hydrophobic specificity pocket can reveal an enthalpic signature of inhibitor binding. Copyright © 2010 Elsevier B.V. All rights reserved.
Electron-phonon effects in graphene and an armchair (10,10) single-wall carbon nanotube
NASA Astrophysics Data System (ADS)
Woods, Lilia Milcheva Rapatinska
New effects due to the electron-phonon interaction in some low-dimensional tight-binding systems are discussed. A sheet of graphite (two-dimensional) and an armchair single wall carbon nanotube (SWNT) (quasi-one dimensional) are taken as examples. The geometrical structure and the linear dispersion of the energy with respect to the electron wave vector are expected to play a significant role. For the ordinary electron-phonon coupling which includes modulated hopping and linear electron-phonon interaction the matrix elements for both systems are derived in the context of a two parameter model for the phonon vibrational spectrum. It is found that they (for both structures) strongly depend on the geometry, display a deformation type of potential and are reduced by a factor of (1 - R), where R depends uniquely on the introduced phonon parameters. Next a new type of interaction is derived; it arises from the phonon modulation of the electron-electron interaction. After writing the matrix elements for the new Hamiltonian, the problem is considered in the context of many body physics. There are two contributions. One of them is the random phase approximation with one phonon line. The electron self-energy for it is calculated. It is shown that one might expect that this is not a large effect. Analytical expressions are obtained for the armchair single wall carbon nanotube. The exchange interaction in the one-phonon approximation is another term that arises and is also considered. One is able to write four new Feynman diagrams and derive an expression for -ImSk⃗ . The contribution from this type of coupling could be large and comparable to the one from the modulated hopping. These results are supported by numerical estimates of some characteristics of graphene and SWNT. The values of the electron-phonon coupling constant, lambda, and the electron lifetime, tau, are compared between the traditional electron-phonon interaction and the phonon modulated electron-electron interaction. Finally, for a perfect (defect-free) arm chair SWNT the diffusion thermopower and the phonon drag thermopower should be zero because of the complete symmetry of the energy bands of the system.
Atkinson, Sarah C; Dogovski, Con; Downton, Matthew T; Czabotar, Peter E; Dobson, Renwick C J; Gerrard, Juliet A; Wagner, John; Perugini, Matthew A
2013-03-01
Lysine is one of the most limiting amino acids in plants and its biosynthesis is carefully regulated through inhibition of the first committed step in the pathway catalyzed by dihydrodipicolinate synthase (DHDPS). This is mediated via a feedback mechanism involving the binding of lysine to the allosteric cleft of DHDPS. However, the precise allosteric mechanism is yet to be defined. We present a thorough enzyme kinetic and thermodynamic analysis of lysine inhibition of DHDPS from the common grapevine, Vitis vinifera (Vv). Our studies demonstrate that lysine binding is both tight (relative to bacterial DHDPS orthologs) and cooperative. The crystal structure of the enzyme bound to lysine (2.4 Å) identifies the allosteric binding site and clearly shows a conformational change of several residues within the allosteric and active sites. Molecular dynamics simulations comparing the lysine-bound (PDB ID 4HNN) and lysine free (PDB ID 3TUU) structures show that Tyr132, a key catalytic site residue, undergoes significant rotational motion upon lysine binding. This suggests proton relay through the catalytic triad is attenuated in the presence of lysine. Our study reveals for the first time the structural mechanism for allosteric inhibition of DHDPS from the common grapevine.
Band Structure and Contact Resistance of Carbon Nanotubes Deformed by a Metal Contact.
Hafizi, Roohollah; Tersoff, Jerry; Perebeinos, Vasili
2017-11-17
Capillary and van der Waals forces cause nanotubes to deform or even collapse under metal contacts. Using ab initio band structure calculations, we find that these deformations reduce the band gap by as much as 30%, while fully collapsed nanotubes become metallic. Moreover, degeneracy lifting due to the broken axial symmetry, and wave functions mismatch between the fully collapsed and the round portions of a CNT, lead to a 3 times higher contact resistance. The latter we demonstrate by contact resistance calculations within the tight-binding approach.
Tie2 and Eph Receptor Tyrosine Kinase Activation and Signaling
Barton, William A.; Dalton, Annamarie C.; Seegar, Tom C.M.; Himanen, Juha P.
2014-01-01
The Eph and Tie cell surface receptors mediate a variety of signaling events during development and in the adult organism. As other receptor tyrosine kinases, they are activated on binding of extracellular ligands and their catalytic activity is tightly regulated on multiple levels. The Eph and Tie receptors display some unique characteristics, including the requirement of ligand-induced receptor clustering for efficient signaling. Interestingly, both Ephs and Ties can mediate different, even opposite, biological effects depending on the specific ligand eliciting the response and on the cellular context. Here we discuss the structural features of these receptors, their interactions with various ligands, as well as functional implications for downstream signaling initiation. The Eph/ephrin structures are already well reviewed and we only provide a brief overview on the initial binding events. We go into more detail discussing the Tie-angiopoietin structures and recognition. PMID:24478383
NASA Astrophysics Data System (ADS)
Hoi, Bui Dinh; Yarmohammadi, Mohsen
2018-05-01
Motivated by the growing interest in solving the obstacles of spintronics applications, we study the Ruderman-Kittel-Kasuya-Yosida (RKKY) effective pairwise interaction between magnetic impurities interacting through the π -electrons embedded in both electronically doped-semiconducting and metallic armchair graphene nanoribbons. In terms of the Green's function formalism, treated in a tight-binding approximation with hopping beyond Dirac cone approximation, the RKKY coupling is an attraction or a repulsion depending on the magnetic impurities distances. Our results show that the RKKY coupling in semiconducting nanoribbons is much more affected by doping than metallic ones. Furthermore, we found that the RKKY coupling increases with ribbon width, while there exist some critical electronic concentrations in RKKY interaction oscillations. On the other hand, we find an unusual incoming wave-vector direction for electrons which describes more clearly the ferro- and antiferromagnetic spin configurations in such system. Also, the RKKY coupling at low and high-temperature regions has been addressed for both ferro- and antiferromagnetic spin arrangements.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ihm, J.; Cohen, M.L.; Tuan, S.F.
1981-04-01
Model calculations are used to explore the role of demons (acoustic plasmons involving light and heavy mass carriers) in superconductivity. Heavy d electrons and light s and p electrons in a transition metal are used for discussion, but the calculation presented is more general, and the results can be applied to other systems. The analysis is based on the dielectric-function approach and the Bardeen-Cooper-Schrieffer theory. The dielectric function includes intraband and interband s-d scattering, and a tight-binding model is used to examine the role of s-d hybridization. The demon contribution generally reduces the Coulomb interaction between the electrons. Under suitablemore » conditions, the model calculations indicate that the electron-electron interaction via demons can be attractive, but the results also suggest that this mechanism is probably not dominant in transition metals and transition-metal compounds. An attractive interband contribution is found, and it is proposed that this effect may lead to pairing in suitable systems.« less
A 50/50 electronic beam splitter in graphene nanoribbons as a building block for electron optics.
Lima, Leandro R F; Hernández, Alexis R; Pinheiro, Felipe A; Lewenkopf, Caio
2016-12-21
Based on the investigation of the multi-terminal conductance of a system composed of two graphene nanoribbons, in which one is on top of the other and rotated by [Formula: see text], we propose a setup for a 50/50 electronic beam splitter that neither requires large magnetic fields nor ultra low temperatures. Our findings are based on an atomistic tight-binding description of the system and on the Green function method to compute the Landauer conductance. We demonstrate that this system acts as a perfect 50/50 electronic beam splitter, in which its operation can be switched on and off by varying the doping (Fermi energy). We show that this device is robust against thermal fluctuations and long range disorder, as zigzag valley chiral states of the nanoribbons are protected against backscattering. We suggest that the proposed device can be applied as the fundamental element of the Hong-Ou-Mandel interferometer, as well as a building block of many devices in electron optics.
Lonberg-Holm, K; Whiteley, N M
1976-01-01
Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301
Edge currents in frustrated Josephson junction ladders
NASA Astrophysics Data System (ADS)
Marques, A. M.; Santos, F. D. R.; Dias, R. G.
2016-09-01
We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.
Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M
2018-06-27
We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000 × faster) but accurate (error < 1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.
Quan, Yundi; Pickett, Warren E
2018-02-21
Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point
NASA Astrophysics Data System (ADS)
Quan, Yundi; Pickett, Warren E.
2018-02-01
Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.
Phononic crystals of spherical particles: A tight binding approach
NASA Astrophysics Data System (ADS)
Mattarelli, M.; Secchi, M.; Montagna, M.
2013-11-01
The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.
Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.
2012-01-01
Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769
Structural consequences of cutting a binding loop: two circularly permuted variants of streptavidin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Le Trong, Isolde; University of Washington, Box 357742, Seattle, WA 98195-7742; Chu, Vano
2013-06-01
The crystal structures of two circularly permuted streptavidins probe the role of a flexible loop in the tight binding of biotin. Molecular-dynamics calculations for one of the mutants suggests that increased fluctuations in a hydrogen bond between the protein and biotin are associated with cleavage of the binding loop. Circular permutation of streptavidin was carried out in order to investigate the role of a main-chain amide in stabilizing the high-affinity complex of the protein and biotin. Mutant proteins CP49/48 and CP50/49 were constructed to place new N-termini at residues 49 and 50 in a flexible loop involved in stabilizing themore » biotin complex. Crystal structures of the two mutants show that half of each loop closes over the binding site, as observed in wild-type streptavidin, while the other half adopts the open conformation found in the unliganded state. The structures are consistent with kinetic and thermodynamic data and indicate that the loop plays a role in enthalpic stabilization of the bound state via the Asn49 amide–biotin hydrogen bond. In wild-type streptavidin, the entropic penalties of immobilizing a flexible portion of the protein to enhance binding are kept to a manageable level by using a contiguous loop of medium length (six residues) which is already constrained by its anchorage to strands of the β-barrel protein. A molecular-dynamics simulation for CP50/49 shows that cleavage of the binding loop results in increased structural fluctuations for Ser45 and that these fluctuations destabilize the streptavidin–biotin complex.« less
Wang, Yanli; Ludwig, Janos; Schuberth, Christine; Goldeck, Marion; Schlee, Martin; Li, Haitao; Juranek, Stefan; Sheng, Gang; Micura, Ronald; Tuschl, Thomas; Hartmann, Gunther; Patel, Dinshaw J
2010-07-01
RIG-I is a cytosolic helicase that senses 5'-ppp RNA contained in negative-strand RNA viruses and triggers innate antiviral immune responses. Calorimetric binding studies established that the RIG-I C-terminal regulatory domain (CTD) binds to blunt-end double-stranded 5'-ppp RNA a factor of 17 more tightly than to its single-stranded counterpart. Here we report on the crystal structure of RIG-I CTD bound to both blunt ends of a self-complementary 5'-ppp dsRNA 12-mer, with interactions involving 5'-pp clearly visible in the complex. The structure, supported by mutation studies, defines how a lysine-rich basic cleft within the RIG-I CTD sequesters the observable 5'-pp of the bound RNA, with a stacked phenylalanine capping the terminal base pair. Key intermolecular interactions observed in the crystalline state are retained in the complex of 5'-ppp dsRNA 24-mer and full-length RIG-I under in vivo conditions, as evaluated from the impact of binding pocket RIG-I mutations and 2'-OCH(3) RNA modifications on the interferon response.
Electronic compressibility of bilayer graphene
NASA Astrophysics Data System (ADS)
Henriksen, Erik
2011-03-01
We have recently measured the electronic compressibility of bilayer graphene, allowing exploration of the thermodynamic density of states as a function of applied electric and magnetic fields. Utilizing dual-gated field-effect devices, we can independently vary both the carrier density and the size of the tunable band gap. An oscillating voltage applied to a back gate generates corresponding signals in the top gate via electric fields lines which penetrate the graphene, thereby allowing a direct measurement of the inverse compressibility, K-1 , of the bilayer. We have mapped K-1 , which is proportional to the inverse density of states, as a function of the top and back gate voltages in zero and finite magnetic field. A sharp increase in K-1 near zero density is observed with increasing electric field strength, signaling the controlled opening of a band gap. At high magnetic fields, broad Landau level (LL) oscillations are observed, directly revealing the doubled degeneracy of the lowest LL and allowing for a determination of the disorder broadening of the levels. We compare our results to tight-binding calculations of the bilayer band structure, and to recent theoretical studies of the compressibility of bilayer graphene. Together, these clearly illustrate the unusual hyperbolic nature of the low energy band structure, reveal a sizeable electron-hole asymmetry, and suggest that many-body interactions play only a small role in bilayer-on-substrate devices. This work is a collaboration with J. P. Eisenstein of Caltech, and is supported by the NSF under Grant No. DMR-0552270 and the DOE under Grant No. DE-FG03-99ER45766.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.
Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban
2018-04-14
Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots
NASA Astrophysics Data System (ADS)
Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban
2018-04-01
Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.
Peptide Beacons: A New Design for Polypeptide-Based Optical Biosensors
Oh, Kenneth J.; Cash, Kevin J.; Hugenberg, Verena; Plaxco, Kevin W.
2008-01-01
Phage display and other in vitro selection techniques produce short polypeptides that tightly and specifically bind to any of a wide range of macromolecular targets. Here we demonstrate a potentially general means of converting such polypeptides into optical biosensors. The sensing architecture we have developed, termed peptide beacons, is based on the observation that, whereas short peptides are almost invariably unfolded and highly dynamic, they become rigid when complexed to their target. Using this effect to segregate a long-lived fluorophore from an electron transfer-based contact quencher, both covalently attached to the peptide, we have produced a robust optical sensor for anti-HIV antibodies. The binding-induced segregation of the fluorophore-quencher pair produces a six-fold increase in sensor emission, thus allowing us to readily detect as low as ∼250 pM of the target antibody. Because the sensor is based on binding-induced folding and a visible-light fluorophore, it is sufficiently selective to work directly in complex, contaminant-ridden samples such as saliva and blood. PMID:17461545
Wu, Sau-Ching; Wong, Sui-Lam
2013-01-01
Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.
Wu, Sau-Ching; Wong, Sui-Lam
2013-01-01
Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971
Structural basis of kynurenine 3-monooxygenase inhibition.
Amaral, Marta; Levy, Colin; Heyes, Derren J; Lafite, Pierre; Outeiro, Tiago F; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S
2013-04-18
Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (that is, kynurenine pathway), leads to amelioration of Huntington's-disease-relevant phenotypes in yeast, fruitfly and mouse models, as well as in a mouse model of Alzheimer's disease. KMO is a flavin adenine dinucleotide (FAD)-dependent monooxygenase and is located in the outer mitochondrial membrane where it converts l-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders, as well as cancer and several peripheral inflammatory conditions. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained unknown. Here we report the first crystal structure of Saccharomyces cerevisiae KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active-site structure, preventing productive binding of the substrate l-kynurenine. Functional assays and targeted mutagenesis reveal that the active-site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO-UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington's, Alzheimer's and Parkinson's diseases.
Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes
DOE Office of Scientific and Technical Information (OSTI.GOV)
C Simmons; C Magee; D Smith
The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADPmore » cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.« less
Schematic baryon models, their tight binding description and their microwave realization
NASA Astrophysics Data System (ADS)
Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.
2013-12-01
A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.
Keegan, Ronan; Waterman, David G; Hopper, David J; Coates, Leighton; Taylor, Graham; Guo, Jingxu; Coker, Alun R; Erskine, Peter T; Wood, Steve P; Cooper, Jonathan B
2016-08-01
During efforts to crystallize the enzyme 2,4-dihydroxyacetophenone dioxygenase (DAD) from Alcaligenes sp. 4HAP, a small number of strongly diffracting protein crystals were obtained after two years of crystal growth in one condition. The crystals diffracted synchrotron radiation to almost 1.0 Å resolution and were, until recently, assumed to be formed by the DAD protein. However, when another crystal form of this enzyme was eventually solved at lower resolution, molecular replacement using this new structure as the search model did not give a convincing solution with the original atomic resolution data set. Hence, it was considered that these crystals might have arisen from a protein impurity, although molecular replacement using the structures of common crystallization contaminants as search models again failed. A script to perform molecular replacement using MOLREP in which the first chain of every structure in the PDB was used as a search model was run on a multi-core cluster. This identified a number of prokaryotic phosphate-binding proteins as scoring highly in the MOLREP peak lists. Calculation of an electron-density map at 1.1 Å resolution based on the solution obtained with PDB entry 2q9t allowed most of the amino acids to be identified visually and built into the model. A BLAST search then indicated that the molecule was most probably a phosphate-binding protein from Stenotrophomonas maltophilia (UniProt ID B4SL31; gene ID Smal_2208), and fitting of the corresponding sequence to the atomic resolution map fully corroborated this. Proteins in this family have been linked to the virulence of antibiotic-resistant strains of pathogenic bacteria and with biofilm formation. The structure of the S. maltophilia protein has been refined to an R factor of 10.15% and an Rfree of 12.46% at 1.1 Å resolution. The molecule adopts the type II periplasmic binding protein (PBP) fold with a number of extensively elaborated loop regions. A fully dehydrated phosphate anion is bound tightly between the two domains of the protein and interacts with conserved residues and a number of helix dipoles.
Charge Density Waves and the Hidden Nesting of Purple Bronze KMo6O17
NASA Astrophysics Data System (ADS)
Su, Lei; Pereira, Vitor
The layered purple bronze KMo6O17, with its robust triple CDW phase up to high temperatures, became the emblematic example of the ''hidden nesting'' concept. Recent experiments suggest that, on the surface layers, its CDW phase can be stabilized at much higher temperatures, and with a tenfold increase in the electronic gap in comparison with the bulk. Despite such interesting fermiology and properties, the K and Na purple bronzes remain largely unexplored systems, most particularly so at the theoretical level. We introduce the first multi-orbital effective tight-binding model to describe the effect of electron-electron interactions in this system. Upon fixing all the effective hopping parameters in the normal state against an ab-initio band structure, and with only the overall scale of the interactions as sole adjustable parameter, we find that a self-consistent Hartree-Fock solution reproduces extremely well the experimental behavior of the charge density wave (CDW) order parameter in the full range 0 < T < Tc , as well as the precise reciprocal space locations of the partial gap opening and Fermi arc development. The interaction strengths extracted from fitting to the experimental CDW gap are consistent with those derived from an independent Stoner-type analysis This work was supported by the Singapore National Research Foundation under Grant NRF-CRP6-2010-05.
NASA Astrophysics Data System (ADS)
Farokhnezhad, M.; Esmaeilzadeh, M.; Shakouri, Kh.
2017-11-01
Strained two-dimensional crystals often offer novel physical properties that are usable to improve their electronic performance. Here we show by the theory of elasticity combined with the tight-binding approximation that local strains in silicene can open up new prospects for generating fully polarized spin and valley currents. The trajectory of electrons flowing through locally strained regions obeys the same behavior as light waves propagating in uniaxial anisotropic materials. The refraction angle of electrons at local strain boundaries exhibits a strong dependence on the valley degree of freedom, allowing for valley filtering based on the strain direction. The ability to control the spin polarization direction additionally requires a perpendicular electric field to be involved in combination with the local strain. Further similarities of the problem with optics of anisotropic materials are elucidated and possible applications in spin- and valleytronic nanodevices are discussed.
NASA Astrophysics Data System (ADS)
E, Lotfi; H, Rezania; B, Arghavaninia; M, Yarmohammadi
2016-07-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength.
Electronic and geometrical properties of monoatomic and diatomic 2D honeycomb lattices. A DFT study
NASA Astrophysics Data System (ADS)
Rojas, Ángela; Rey, Rafael; Fonseca, Karen; Grupo de Óptica e Información Cuántica Team
Since the discovery of graphene by Geim and Novoselov at 2004, several analogous systems have been theoretically and experimentally studied, due to their technological interest. Both monoatomic lattices, such as silicine and germanene, and diatomic lattices (h-GaAs and h-GaN) have been studied. Using Density Functional Theory we obtain and confirm the chemical stability of these hexagonal 2D systems through the total energy curves as a function of interatomic distance. Unlike graphene, silicine and germanene, gapless materials, h-GaAs and h-GaN exhibit electronic gaps, different from that of the bulk, which could be interesting for the industry. On the other hand, the ab initio band structure calculations for graphene, silicene and germanene show a non-circular cross section around K points, at variance with the prediction of usual Tight-binding models. In fact, we have found that Dirac cones display a dihedral group symmetry. This implies that Fermi speed can change up to 30 % due to the orientation of the wave vector, for both electrons and holes. Traditional analytic studies use the Dirac equation for the electron dynamics at low energies. However, this equation assumes an isotropic, homogeneous and uniform space. Authors would like to thank the División de Investigación Sede Bogotá for their financial support at Universidad Nacional de Colombia. A. M. Rojas-Cuervo would also like to thank the Colciencias, Colombia.
Reconfiguring crystal and electronic structures of MoS 2 by substitutional doping
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suh, Joonki; Tan, Teck Leong; Zhao, Weijie
Doping of traditional semiconductors has enabled technological applications in modern electronics by tailoring their chemical, optical and electronic properties. However, substitutional doping in two-dimensional semiconductors is at a comparatively early stage, and the resultant effects are less explored. In this work, we report unusual effects of degenerate doping with Nb on structural, electronic and optical characteristics of MoS 2 crystals. The doping readily induces a structural transformation from naturally occurring 2H stacking to 3R stacking. Electronically, a strong interaction of the Nb impurity states with the host valence bands drastically and nonlinearly modifies the electronic band structure with the valencemore » band maximum of multilayer MoS 2 at the Γ point pushed upward by hybridization with the Nb states. Finally, when thinned down to monolayers, in stark contrast, such significant nonlinear effect vanishes, instead resulting in strong and broadband photoluminescence via the formation of exciton complexes tightly bound to neutral acceptors.« less
Reconfiguring crystal and electronic structures of MoS 2 by substitutional doping
Suh, Joonki; Tan, Teck Leong; Zhao, Weijie; ...
2018-01-15
Doping of traditional semiconductors has enabled technological applications in modern electronics by tailoring their chemical, optical and electronic properties. However, substitutional doping in two-dimensional semiconductors is at a comparatively early stage, and the resultant effects are less explored. In this work, we report unusual effects of degenerate doping with Nb on structural, electronic and optical characteristics of MoS 2 crystals. The doping readily induces a structural transformation from naturally occurring 2H stacking to 3R stacking. Electronically, a strong interaction of the Nb impurity states with the host valence bands drastically and nonlinearly modifies the electronic band structure with the valencemore » band maximum of multilayer MoS 2 at the Γ point pushed upward by hybridization with the Nb states. Finally, when thinned down to monolayers, in stark contrast, such significant nonlinear effect vanishes, instead resulting in strong and broadband photoluminescence via the formation of exciton complexes tightly bound to neutral acceptors.« less
Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis
2017-12-15
The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.
Jeong, Hanbin; Park, Jumi; Jun, Youngsoo; Lee, Changwook
2017-01-01
The endoplasmic reticulum (ER)-mitochondria encounter structure (ERMES) comprises mitochondrial distribution and morphology 12 (Mdm12), maintenance of mitochondrial morphology 1 (Mmm1), Mdm34, and Mdm10 and mediates physical membrane contact sites and nonvesicular lipid trafficking between the ER and mitochondria in yeast. Herein, we report two crystal structures of the synaptotagmin-like mitochondrial lipid-binding protein (SMP) domain of Mmm1 and the Mdm12–Mmm1 complex at 2.8 Å and 3.8 Å resolution, respectively. Mmm1 adopts a dimeric SMP structure augmented with two extra structural elements at the N and C termini that are involved in tight self-association and phospholipid coordination. Mmm1 binds two phospholipids inside the hydrophobic cavity, and the phosphate ion of the distal phospholipid is specifically recognized through extensive H-bonds. A positively charged concave surface on the SMP domain not only mediates ER membrane docking but also results in preferential binding to glycerophospholipids such as phosphatidylcholine (PC), phosphatidic acid (PA), phosphatidylglycerol (PG), and phosphatidylserine (PS), some of which are substrates for lipid-modifying enzymes in mitochondria. The Mdm12–Mmm1 structure reveals two Mdm12s binding to the SMP domains of the Mmm1 dimer in a pairwise head-to-tail manner. Direct association of Mmm1 and Mdm12 generates a 210-Å-long continuous hydrophobic tunnel that facilitates phospholipid transport. The Mdm12–Mmm1 complex binds all glycerophospholipids except for phosphatidylethanolamine (PE) in vitro. PMID:29078410
Wavefunctions, quantum diffusion, and scaling exponents in golden-mean quasiperiodic tilings.
Thiem, Stefanie; Schreiber, Michael
2013-02-20
We study the properties of wavefunctions and the wavepacket dynamics in quasiperiodic tight-binding models in one, two, and three dimensions. The atoms in the one-dimensional quasiperiodic chains are coupled by weak and strong bonds aligned according to the Fibonacci sequence. The associated d-dimensional quasiperiodic tilings are constructed from the direct product of d such chains, which yields either the hypercubic tiling or the labyrinth tiling. This approach allows us to consider fairly large systems numerically. We show that the wavefunctions of the system are multifractal and that their properties can be related to the structure of the system in the regime of strong quasiperiodic modulation by a renormalization group (RG) approach. We also study the dynamics of wavepackets to get information about the electronic transport properties. In particular, we investigate the scaling behaviour of the return probability of the wavepacket with time. Applying again the RG approach we show that in the regime of strong quasiperiodic modulation the return probability is governed by the underlying quasiperiodic structure. Further, we also discuss lower bounds for the scaling exponent of the width of the wavepacket and propose a modified lower bound for the absolute continuous regime.
Predicting the valley physics of silicon quantum dots directly from a device layout
NASA Astrophysics Data System (ADS)
Gamble, John King; Harvey-Collard, Patrick; Jacobson, N. Tobias; Bacewski, Andrew D.; Nielsen, Erik; Montaño, Inès; Rudolph, Martin; Carroll, Malcolm S.; Muller, Richard P.
Qubits made from electrostatically-defined quantum dots in Si-based systems are excellent candidates for quantum information processing applications. However, the multi-valley structure of silicon's band structure provides additional challenges for the few-electron physics critical to qubit manipulation. Here, we present a theory for valley physics that is predictive, in that we take as input the real physical device geometry and experimental voltage operation schedule, and with minimal approximation compute the resulting valley physics. We present both effective mass theory and atomistic tight-binding calculations for two distinct metal-oxide-semiconductor (MOS) quantum dot systems, directly comparing them to experimental measurements of the valley splitting. We conclude by assessing these detailed simulations' utility for engineering desired valley physics in future devices. Sandia is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the US Department of Energy's National Nuclear Security Administration under Contract No. DE-AC04-94AL85000. The authors gratefully acknowledge support from the Sandia National Laboratories Truman Fellowship Program, which is funded by the Laboratory Directed Research and Development (LDRD) Program.
NASA Astrophysics Data System (ADS)
Pal, Amrita; Arabnejad, Saeid; Yamashita, Koichi; Manzhos, Sergei
2018-05-01
C60 and C60 based molecules are efficient acceptors and electron transport layers for planar perovskite solar cells. While properties of these molecules are well studied by ab initio methods, those of solid C60, specifically its optical absorption properties, are not. We present a combined density functional theory-Density Functional Tight Binding (DFTB) study of the effect of solid state packing on the band structure and optical absorption of C60. The valence and conduction band edge energies of solid C60 differ on the order of 0.1 eV from single molecule frontier orbital energies. We show that calculations of optical properties using linear response time dependent-DFT(B) or the imaginary part of the dielectric constant (dipole approximation) can result in unrealistically large redshifts in the presence of intermolecular interactions compared to available experimental data. We show that optical spectra computed from the frequency-dependent real polarizability can better reproduce the effect of C60 aggregation on optical absorption, specifically with a generalized gradient approximation functional, and may be more suited to study effects of molecular aggregation.
From lattice Hamiltonians to tunable band structures by lithographic design
NASA Astrophysics Data System (ADS)
Tadjine, Athmane; Allan, Guy; Delerue, Christophe
2016-08-01
Recently, new materials exhibiting exotic band structures characterized by Dirac cones, nontrivial flat bands, and band crossing points have been proposed on the basis of effective two-dimensional lattice Hamiltonians. Here, we show using atomistic tight-binding calculations that these theoretical predictions could be experimentally realized in the conduction band of superlattices nanolithographed in III-V and II-VI semiconductor ultrathin films. The lithographed patterns consist of periodic lattices of etched cylindrical holes that form potential barriers for the electrons in the quantum well. In the case of honeycomb lattices, the conduction minibands of the resulting artificial graphene host several Dirac cones and nontrivial flat bands. Similar features, but organized in different ways, in energy or in k -space are found in kagome, distorted honeycomb, and Lieb superlattices. Dirac cones extending over tens of meV could be obtained in superlattices with reasonable sizes of the lithographic patterns, for instance in InAs/AlSb heterostructures. Bilayer artificial graphene could be also realized by lithography of a double quantum-well heterostructure. These new materials should be interesting for the experimental exploration of Dirac-based quantum systems, for both fundamental and applied physics.
Crumbs3 Is Essential for Proper Epithelial Development and Viability
Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.
2014-01-01
First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893
Housset, D; Mazza, G; Grégoire, C; Piras, C; Malissen, B; Fontecilla-Camps, J C
1997-01-01
The crystal structure of a mouse T-cell antigen receptor (TCR) Fv fragment complexed to the Fab fragment of a specific anti-clonotypic antibody has been determined to 2.6 A resolution. The polypeptide backbone of the TCR V alpha domain is very similar to those of other crystallographically determined V alphas, whereas the V beta structure is so far unique among TCR V beta domains in that it displays a switch of the c" strand from the inner to the outer beta-sheet. The beta chain variable region of this TCR antigen-binding site is characterized by a rather elongated third complementarity-determining region (CDR3beta) that packs tightly against the CDR3 loop of the alpha chain, without leaving any intervening hydrophobic pocket. Thus, the conformation of the CDR loops with the highest potential diversity distinguishes the structure of this TCR antigen-binding site from those for which crystallographic data are available. On the basis of all these results, we infer that a significant conformational change of the CDR3beta loop found in our TCR is required for binding to its cognate peptide-MHC ligand. PMID:9250664
Transition States and transition state analogue interactions with enzymes.
Schramm, Vern L
2015-04-21
Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.
Race, C P; Mason, D R; Sutton, A P
2009-03-18
Using time-dependent tight-binding simulations of radiation damage cascades in a model metal we directly investigate the nature of the excitations of a system of quantum mechanical electrons in response to the motion of a set of classical ions. We furthermore investigate the effect of these excitations on the attractive electronic forces between the ions. We find that the electronic excitations are well described by a Fermi-Dirac distribution at some elevated temperature, even in the absence of the direct electron-electron interactions that would be required in order to thermalize a non-equilibrium distribution. We explain this result in terms of the spectrum of characteristic frequencies of the ionic motion. Decomposing the electronic force into four well-defined components within the basis of instantaneous electronic eigenstates, we find that the effect of accumulated excitations in weakening the interionic bonds is mostly (95%) accounted for by a thermal model for the electronic excitations. This result justifies the use of the simplifying assumption of a thermalized electron system in simulations of radiation damage with an electronic temperature dependence and in the development of temperature-dependent classical potentials.
Branch-point energies and the band-structure lineup at Schottky contacts and heterostrucures
NASA Astrophysics Data System (ADS)
Mönch, Winfried
2011-06-01
Empirical branch-point energies of Si, the group-III nitrides AlN, GaN, and InN, and the group-II and group-III oxides MgO, ZnO, Al2O3 and In2O3 are determined from experimental valance-band offsets of their heterostructures. For Si, GaN, and MgO, these values agree with the branch-point energies obtained from the barrier heights of their Schottky contacts. The empirical branch-point energies of Si and the group-III nitrides are in very good agreement with results of previously published calculations using quite different approaches such as the empirical tight-binding approximation and modern electronic-structure theory. In contrast, the empirical branch-point energies of the group-II and group-III oxides do not confirm the respective theoretical results. As at Schottky contacts, the band-structure lineup at heterostructures is also made up of a zero-charge-transfer term and an intrinsic electric-dipole contribution. Hence, valence-band offsets are not equal to the difference of the branch-point energies of the two semiconductors forming the heterostructure. The electric-dipole term may be described by the electronegativity difference of the two solids in contact. A detailed analysis of experimental Si Schottky barrier heights and heterostructure valence-band offsets explains and proves these conclusions.
Oxygen holes and hybridization in the bismuthates
NASA Astrophysics Data System (ADS)
Khazraie, Arash; Foyevtsova, Kateryna; Elfimov, Ilya; Sawatzky, George A.
2018-02-01
Motivated by the recently renewed interest in the superconducting bismuth perovskites, we investigate the electronic structure of the parent compounds A BiO3 (A = Sr, Ba) using ab initio methods and tight-binding (TB) modeling. We use the density functional theory (DFT) in the local density approximation (LDA) to understand the role of various interactions in shaping the A BiO3 band structure near the Fermi level. It is established that interatomic hybridization involving Bi-6 s and O-2 p orbitals plays the most important role. Based on our DFT calculations, we derive a minimal TB model and demonstrate that it can describe the properties of the band structure as a function of lattice distortions, such as the opening of a charge gap with the onset of the breathing distortion and the associated condensation of holes onto a1 g-symmetric molecular orbitals formed by the O-2 pσ orbitals on collapsed octahedra. We also derive a single band model involving the hopping of an extended molecular orbital involving both Bi-6 s and a linear combination of six O-2 p orbitals which provides a very good description of the dispersion and band gaps of the low energy scale bands straddling the chemical potential.
Topological magnetic phase in LaMnO3 (111) bilayer
NASA Astrophysics Data System (ADS)
Weng, Yakui; Huang, Xin; Yao, Yugui; Dong, Shuai
2015-11-01
Candidates for correlated topological insulators, originated from the spin-orbit coupling as well as the Hubbard-type correlation, are expected in the (111) bilayer of perovskite-structural transition-metal oxides. Based on the first-principles calculation and tight-binding model, the electronic structure of a LaMnO3 (111) bilayer sandwiched in LaScO3 barriers has been investigated. For the ideal undistorted perovskite structure, the Fermi energy of LaMnO3 (111) bilayer just stays at the Dirac point, rendering a semimetal (graphenelike) which is also a half metal [different from graphene or the previously studied LaNiO3 (111) bilayer]. The Dirac cone can be opened by the spin-orbit coupling, giving rise to nontrivial topological bands corresponding to the (quantized) anomalous Hall effect. For the realistic orthorhombic distorted lattice, the Dirac point moves with increasing Hubbard repulsion (or equivalent Jahn-Teller distortion). Finally, a Mott gap opens, establishing a phase boundary between the Mott insulator and topological magnetic insulator. Our calculation finds that the gap opened by spin-orbit coupling is much smaller in the orthorhombic distorted lattice (˜1.7 meV) than the undistorted one (˜11 meV). Therefore, to suppress the lattice distortion can be helpful to enhance the robustness of the topological phase in perovskite (111) bilayers.
Kou, Liangzhi; Hu, Feiming; Yan, Binghai; Frauenheim, Thomas; Chen, Changfeng
2014-07-07
Developing graphene-based nanoelectronics hinges on opening a band gap in the electronic structure of graphene, which is commonly achieved by breaking the inversion symmetry of the graphene lattice via an electric field (gate bias) or asymmetric doping of graphene layers. Here we introduce a new design strategy that places a bilayer graphene sheet sandwiched between two cladding layers of materials that possess strong spin-orbit coupling (e.g., Bi2Te3). Our ab initio and tight-binding calculations show that a proximity enhanced spin-orbit coupling effect opens a large (44 meV) band gap in bilayer graphene without breaking its lattice symmetry, and the band gap can be effectively tuned by an interlayer stacking pattern and significantly enhanced by interlayer compression. The feasibility of this quantum-well structure is demonstrated by recent experimental realization of high-quality heterojunctions between graphene and Bi2Te3, and this design also conforms to existing fabrication techniques in the semiconductor industry. The proposed quantum-well structure is expected to be especially robust since it does not require an external power supply to open and maintain a band gap, and the cladding layers provide protection against environmental degradation of the graphene layer in its device applications.
Sun, Weichao; Ren, Haisheng; Tao, Ye; Xiao, Dong; Qin, Xin; Deng, Li; Shao, Mengyao; Gao, Jiali; Chen, Xiaohua
2015-01-01
The cooperative interactions among two aromatic rings with a S-containing group are described, which may participate in electron hole transport in proteins. Ab initio calculations reveal the possibility for the formations of the π∴S:π↔π:S∴π and π∴π:S↔π:π∴S five-electron bindings in the corresponding microsurrounding structures in proteins, both facilitating electron hole transport as efficient relay stations. The relay functionality of these two special structures comes from their low local ionization energies and proper binding energies, which varies with the different aromatic amino acids, S-containing residues, and the arrangements of the same aromatic rings according to the local microsurroundings in proteins. PMID:26120374