The role of enzyme and substrate concentration in the evaluation of serum angiotensin converting enzyme (ACE) inhibition by enalaprilat in vitro.

PubMed

Weisser, K; Schloos, J

1991-10-09

The relationship between serum angiotensin converting enzyme (ACE) activity and concentration of the ACE inhibitor enalaprilat was determined in vitro in the presence of different concentrations (S = 4-200 mM) of the substrate Hip-Gly-Gly. From Henderson plots, a competitive tight-binding relationship between enalaprilat and serum ACE was found yielding a value of approximately 5 nM for serum ACE concentration (Et) and an inhibition constant (Ki) for enalaprilat of approximately 0.1 nM. A plot of reaction velocity (Vi) versus total inhibitor concentration (It) exhibited a non-parallel shift of the inhibition curve to the right with increasing S. This was reflected by apparent Hill coefficients greater than 1 when the commonly used inhibitory sigmoid concentration-effect model (Emax model) was applied to the data. Slopes greater than 1 were obviously due to discrepancies between the free inhibitor concentration (If) present in the assay and It plotted on the abscissa and could, therefore, be indicators of tight-binding conditions. Thus, the sigmoid Emax model leads to an overestimation of Ki. Therefore, a modification of the inhibitory sigmoid Emax model (called "Emax tight model") was applied, which accounts for the depletion of If by binding, refers to It and allows estimation of the parameters Et and IC50f (free concentration of inhibitor when 50% inhibition occurs) using non-linear regression analysis. This model could describe the non-symmetrical shape of the inhibition curves and the results for Ki and Et correlated very well with those derived from the Henderson plots. The latter findings confirm that the degree of ACE inhibition measured in vitro is, in fact, dependent on the concentration of substrate and enzyme present in the assay. This is of importance not only for the correct evaluation of Ki but also for the interpretation of the time course of serum ACE inhibition measured ex vivo. The non-linear model has some advantages over the linear Henderson equation: it is directly applicable without conversion of the data and avoids the stochastic dependency of the variables, allowing non-linear regression of all data points contributing with the same weight.

Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

NASA Astrophysics Data System (ADS)

Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

2018-02-01

Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

NASA Astrophysics Data System (ADS)

Humeniuk, Alexander; Mitrić, Roland

2017-12-01

A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

PubMed

Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

2018-04-11

We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

NASA Astrophysics Data System (ADS)

Zhang, Shu-Hui; Yang, Wen

2018-01-01

We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

Tight-Binding study of Boron structures

NASA Astrophysics Data System (ADS)

McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

2014-10-01

We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.

Model many-body Stoner Hamiltonian for binary FeCr alloys

NASA Astrophysics Data System (ADS)

Nguyen-Manh, D.; Dudarev, S. L.

2009-09-01

We derive a model tight-binding many-body d -electron Stoner Hamiltonian for FeCr binary alloys and investigate the sensitivity of its mean-field solutions to the choice of hopping integrals and the Stoner exchange parameters. By applying the local charge-neutrality condition within a self-consistent treatment we show that the negative enthalpy-of-mixing anomaly characterizing the alloy in the low chromium concentration limit is due entirely to the presence of the on-site exchange Stoner terms and that the occurrence of this anomaly is not specifically related to the choice of hopping integrals describing conventional chemical bonding between atoms in the alloy. The Bain transformation pathway computed, using the proposed model Hamiltonian, for the Fe15Cr alloy configuration is in excellent agreement with ab initio total-energy calculations. Our investigation also shows how the parameters of a tight-binding many-body model Hamiltonian for a magnetic alloy can be derived from the comparison of its mean-field solutions with other, more accurate, mean-field approximations (e.g., density-functional calculations), hence stimulating the development of large-scale computational algorithms for modeling radiation damage effects in magnetic alloys and steels.

Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

DOE Office of Scientific and Technical Information (OSTI.GOV)

Desgranges, Caroline; Delhommelle, Jerome

We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

2016-07-28

The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

Spin textures on general surfaces of the correlated topological insulator SmB6

NASA Astrophysics Data System (ADS)

Baruselli, Pier Paolo; Vojta, Matthias

2016-05-01

Employing the k .p expansion for a family of tight-binding models for SmB6, we analytically compute topological surface states on a generic (l m n ) surface. We show how the Dirac-cone spin structure depends on model ingredients and on the angle θ between the surface normal and the main crystal axes. We apply the general theory to (001), (110), (111), and (210) surfaces, for which we provide concrete predictions for the spin pattern of surface states which we also compare with tight-binding results. As shown in previous work, the spin pattern on a (001 ) surface can be related to the value of mirror Chern numbers, and we explore the possibility of topological phase transitions between states with different mirror Chern numbers and the associated change of the spin structure of surface states. Such transitions may be accessed by varying either the hybridization between conduction and f electrons or the crystal-field splitting of the low-energy f multiplets, and we compute corresponding phase diagrams. Experimentally, chemical doping is a promising route to realize such transitions.

Dislocation Onset and Glide in Carbon Nanotubes under Torsion

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Zhang, Dong-Bo; James, Richard

2009-03-01

The torsional plastic response of carbon nanotubes is comprehensively described in the objective molecular dynamics framework [1-3]. It is shown that an (n,m) tube is prone to slip along a nearly-axial helical path, which introduces a distinct (+1,-1) change in the wrapping index. The low energy realization occurs without loss of mass, via nucleation of a 5-7-7-5 dislocation dipole, followed by a nearly-axial glide of the 5-7 dislocation. The onset of plasticity depends not only on chirality but also on handedness. For a given handedness of the applied twist, chiral tubes of opposed handedness are most susceptible to yield. A right-handed applied twist on an armchair (zig-zag) tube leads to a right- (left-) handed tube. [4pt] [1] T. Dumitrica and R.D. James, Objective Molecular Dynamics, Journal of the Mechanics and Physics of Solids 55, 2206 (2007). [0pt] [2] D.-B. Zhang, M. Hua, and T. Dumitrica, Stability of Polycrystalline and Wurtzite Si Nanowires via Symmetry-Adapted Tight-Binding Objective Molecular Dynamics, Journal of Chemical Physics 128, 084104 (2008). [0pt] [3] D.-B. Zhang and T. Dumitrica, Elasticity of Ideal Single-Walled Carbon Nanotubes via Symmetry-Adapted Tight-Binding Objective Modeling, Applied Physics Letters 93, 031919 (2008).

Edge currents in frustrated Josephson junction ladders

NASA Astrophysics Data System (ADS)

Marques, A. M.; Santos, F. D. R.; Dias, R. G.

2016-09-01

We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

Accurate modeling of defects in graphene transport calculations

NASA Astrophysics Data System (ADS)

Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

2018-01-01

We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

Electronic transport in methylated fragments of DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

2015-11-16

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

Electronic transport in methylated fragments of DNA

NASA Astrophysics Data System (ADS)

de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

2015-11-01

We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

NASA Astrophysics Data System (ADS)

Panda, Saswati; Sahoo, D. D.; Rout, G. C.

2018-04-01

We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

Non-collinear magnetism with analytic Bond-Order Potentials

NASA Astrophysics Data System (ADS)

Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

2015-03-01

The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

Design of graphene nanoparticle undergoing axial compression: quantum study

NASA Astrophysics Data System (ADS)

Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

2011-03-01

We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

NASA Astrophysics Data System (ADS)

Shen, Ka

2018-04-01

We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

NASA Astrophysics Data System (ADS)

Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

2017-05-01

We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

Tight-binding tunneling amplitude of an optical lattice

NASA Astrophysics Data System (ADS)

Arzamasovs, Maksims; Liu, Bo

2017-11-01

The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Hysteresis in DNA compaction by Dps is described by an Ising model

PubMed Central

Vtyurina, Natalia N.; Dulin, David; Docter, Margreet W.; Meyer, Anne S.; Dekker, Nynke H.; Abbondanzieri, Elio A.

2016-01-01

In all organisms, DNA molecules are tightly compacted into a dynamic 3D nucleoprotein complex. In bacteria, this compaction is governed by the family of nucleoid-associated proteins (NAPs). Under conditions of stress and starvation, an NAP called Dps (DNA-binding protein from starved cells) becomes highly up-regulated and can massively reorganize the bacterial chromosome. Although static structures of Dps–DNA complexes have been documented, little is known about the dynamics of their assembly. Here, we use fluorescence microscopy and magnetic-tweezers measurements to resolve the process of DNA compaction by Dps. Real-time in vitro studies demonstrated a highly cooperative process of Dps binding characterized by an abrupt collapse of the DNA extension, even under applied tension. Surprisingly, we also discovered a reproducible hysteresis in the process of compaction and decompaction of the Dps–DNA complex. This hysteresis is extremely stable over hour-long timescales despite the rapid binding and dissociation rates of Dps. A modified Ising model is successfully applied to fit these kinetic features. We find that long-lived hysteresis arises naturally as a consequence of protein cooperativity in large complexes and provides a useful mechanism for cells to adopt unique epigenetic states. PMID:27091987

Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

NASA Astrophysics Data System (ADS)

Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

2013-07-01

We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

A Model for Predicting Thermoelectric Properties of Bi2Te3

NASA Technical Reports Server (NTRS)

Lee, Seungwon; VonAllmen, Paul

2009-01-01

A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

NASA Astrophysics Data System (ADS)

Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

2018-04-01

Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

Tight-binding modeling and low-energy behavior of the semi-Dirac point.

PubMed

Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

2009-07-03

We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

NASA Astrophysics Data System (ADS)

Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

2018-04-01

We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

NASA Astrophysics Data System (ADS)

Kar, J. K.; Panda, Saswati; Rout, G. C.

2017-05-01

We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

The tightly bound nuclei in the liquid drop model

NASA Astrophysics Data System (ADS)

Sree Harsha, N. R.

2018-05-01

In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

Pseudo-magnetic fields of strongly-curved graphene nanobubbles

NASA Astrophysics Data System (ADS)

Liu, Li-Chi

2018-04-01

We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

Universal Sign Control of Coupling in Tight-Binding Lattices

NASA Astrophysics Data System (ADS)

Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

2016-05-01

We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

Dpb11 may function with RPA and DNA to initiate DNA replication.

PubMed

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

PubMed

Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

2015-02-10

Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

Modeling chain folding in protein-constrained circular DNA.

PubMed Central

Martino, J A; Olson, W K

1998-01-01

An efficient method for sampling equilibrium configurations of DNA chains binding one or more DNA-bending proteins is presented. The technique is applied to obtain the tertiary structures of minimal bending energy for a selection of dinucleosomal minichromosomes that differ in degree of protein-DNA interaction, protein spacing along the DNA chain contour, and ring size. The protein-bound portions of the DNA chains are represented by tight, left-handed supercoils of fixed geometry. The protein-free regions are modeled individually as elastic rods. For each random spatial arrangement of the two nucleosomes assumed during a stochastic search for the global minimum, the paths of the flexible connecting DNA segments are determined through a numerical solution of the equations of equilibrium for torsionally relaxed elastic rods. The minimal energy forms reveal how protein binding and spacing and plasmid size differentially affect folding and offer new insights into experimental minichromosome systems. PMID:9591675

Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Nishimoto, Yoshio; Fedorov, Dmitri G.

2018-02-01

The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

PubMed Central

Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

2012-01-01

Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

2016-04-13

We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

Surface Passivation in Empirical Tight Binding

NASA Astrophysics Data System (ADS)

He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

2016-03-01

Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

Dpb11 may function with RPA and DNA to initiate DNA replication

PubMed Central

Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

2017-01-01

Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

Model construction and superconductivity analysis of organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta) based on first-principles band calculation

NASA Astrophysics Data System (ADS)

Aizawa, H.; Kuroki, K.; Yasuzuka, S.; Yamada, J.

2012-11-01

We perform a first-principles band calculation for a group of quasi-two-dimensional organic conductors β-(BDA-TTP)2MF6 (M = P, As, Sb and Ta). The ab-initio calculation shows that the density of states is correlated with the bandwidth of the singly occupied (highest) molecular orbital, while it is not necessarily correlated with the unit-cell volume. The direction of the major axis of the cross section of the Fermi surface lies in the Γ-B-direction, which differs from that obtained by the extended Hückel calculation. Then, we construct a tight-binding model which accurately reproduces the ab-initio band structure. The obtained transfer energies give a smaller dimerization than in the extended Hückel band. As to the difference in the anisotropy of the Fermi surface, the transfer energies along the inter-stacking direction are smaller than those obtained in the extended Hückel calculation. Assuming spin-fluctuation-mediated superconductivity, we apply random phase approximation to a two-band Hubbard model. This two-band Hubbard model is composed of the tight-binding model derived from the first-principles band structure and an on-site (intra-molecule) repulsive interaction taken as a variable parameter. The obtained superconducting gap changes sign four times along the Fermi surface like in a d-wave gap, and the nodal direction is different from that obtained in the extended Hückel model. Anion dependence of Tc is qualitatively consistent with the experimental observation.

Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

NASA Astrophysics Data System (ADS)

Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

2018-01-01

The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

NASA Astrophysics Data System (ADS)

You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

2012-04-01

We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

Bipolaron assisted Bloch-like oscillations in organic lattices

NASA Astrophysics Data System (ADS)

Ribeiro, Luiz Antonio; Ferreira da Cunha, Wiliam; Magela e Silva, Geraldo

2017-06-01

The transport of a dissociated bipolaron in organic one-dimensional lattices is theoretically investigated in the scope of a tight-binding model that includes electron-lattice interactions and an external electric field. Remarkably, the results point to a physical picture in which the dissociated bipolaron propagates as a combined state of two free-like electrons that coherently perform spatial Bloch oscillations (BO) above a critical field strength. It was also obtained that the BO's trajectory presents a net forward motion in the direction of the applied electric field. The impact of dynamical disorder in the formation of electronic BOs is determined.

Nucleotide-induced conformational dynamics in ABC transporters from structure-based coarse grained modelling.

NASA Astrophysics Data System (ADS)

Flechsig, Holger

2016-02-01

ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter. Possible explanations are discussed in the light of currently debated transport scenarios of ABC transporters.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.; Ring, D.M.

We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

Tight binding simulation study on zigzag single-walled carbon nanotubes

NASA Astrophysics Data System (ADS)

Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

2018-01-01

Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

NASA Astrophysics Data System (ADS)

Ajiki, Hiroshi

2014-07-01

Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

PubMed

Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

2018-05-08

Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

PubMed Central

Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

2017-01-01

Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

PubMed

Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

2018-06-27

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

NASA Astrophysics Data System (ADS)

Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

2018-06-01

We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

NASA Astrophysics Data System (ADS)

Venkataraman, Vijay Shankar

The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

Excitons in boron nitride single layer

NASA Astrophysics Data System (ADS)

Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

2016-09-01

Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

Highly tunable charge and spin transport in silicene junctions: phase transitions and half-metallic states.

PubMed

Mahdavifar, Maryam; Khoeini, Farhad

2018-08-10

We report peculiar charge and spin transport properties in S-shaped silicene junctions with the Kane-Mele tight-binding model. In this work, we investigate the effects of electric and exchange fields on the charge and spin transport properties. Our results show that by applying a perpendicular electric field, metal-semiconductor and also semimetal-semiconductor phase transitions occur in our systems. Furthermore, full spin current can be obtained in the structures, so the half-metallic states are observable. Our results enable us to control charge and spin currents and provide new opportunities and applications in silicene-based electronics, optoelectronics, and spintronics.

Transparent lattices and their solitary waves.

PubMed

Sadurní, E

2014-09-01

We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.

Tight-binding calculation of the magnetic moment of CrAs under pressure

NASA Astrophysics Data System (ADS)

Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

2018-03-01

We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

Generalized virial theorem for massless electrons in graphene and other Dirac materials

NASA Astrophysics Data System (ADS)

Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

2016-05-01

The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

NASA Astrophysics Data System (ADS)

Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

2017-03-01

Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

Microwave emulations and tight-binding calculations of transport in polyacetylene

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

PubMed Central

Balda, Maria S.; Matter, Karl

2000-01-01

Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

Affinity modulation of small-molecule ligands by borrowing endogenous protein surfaces

PubMed Central

Briesewitz, Roger; Ray, Gregory T.; Wandless, Thomas J.; Crabtree, Gerald R.

1999-01-01

A general strategy is described for improving the binding properties of small-molecule ligands to protein targets. A bifunctional molecule is created by chemically linking a ligand of interest to another small molecule that binds tightly to a second protein. When the ligand of interest is presented to the target protein by the second protein, additional protein–protein interactions outside of the ligand-binding sites serve either to increase or decrease the affinity of the binding event. We have applied this approach to an intractable target, the SH2 domain, and demonstrate a 3-fold enhancement over the natural peptide. This approach provides a way to modulate the potency and specificity of biologically active compounds. PMID:10051576

Development of tight-binding based GW algorithm and its computational implementation for graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

2010-01-01

Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

Thermodynamics of cooperative binding of FAD to human NQO1: Implications to understanding cofactor-dependent function and stability of the flavoproteome.

PubMed

Clavería-Gimeno, Rafael; Velazquez-Campoy, Adrian; Pey, Angel Luis

2017-12-15

The stability of human flavoproteins strongly depends on flavin levels, although the structural and energetic basis of this relationship is poorly understood. Here, we report an in-depth analysis on the thermodynamics of FAD binding to one of the most representative examples of such relationship, NAD(P)H:quinone oxidoreductase 1 (NQO1). NQO1 is a dimeric enzyme that tightly binds FAD, which triggers large structural changes upon binding. A common cancer-associated polymorphism (P187S) severely compromises FAD binding. We show that FAD binding is described well by a thermodynamic model explicitly incorporating binding cooperativity when applied to different sets of calorimetric analyses and NQO1 variants, thus providing insight on the effects in vitro and in cells of cancer-associated P187S, its suppressor mutation H80R and the role of NQO1 C-terminal domain to modulate binding cooperativity and energetics. Furthermore, we show that FAD binding to NQO1 is very sensitive to physiologically relevant environmental conditions, such as the presence of phosphate buffer and salts. Overall, our results contribute to understanding at the molecular level the link between NQO1 stability and fluctuations of FAD levels intracellularly, and supports the notion that FAD binding energetics and cooperativity are fundamentally linked with the dynamic nature of apo-NQO1 conformational ensemble. Copyright © 2017 Elsevier Inc. All rights reserved.

Strain-induced chiral magnetic effect in Weyl semimetals

DOE PAGES

Cortijo, Alberto; Kharzeev, Dmitri; Landsteiner, Karl; ...

2016-12-19

Here, we argue that strain applied to a time-reversal and inversion breaking Weyl semimetal in a magnetic field can induce an electric current via the chiral magnetic effect. A tight-binding model is used to show that strain generically changes the locations in the Brillouin zone but also the energies of the band touching points (tips of the Weyl cones). Since axial charge in a Weyl semimetal can relax via intervalley scattering processes, the induced current will decay with a time scale given by the lifetime of a chiral quasiparticle. Lastly, we estimate the strength and lifetime of the current formore » typical material parameters and find that it should be experimentally observable.« less

Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

NASA Astrophysics Data System (ADS)

Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

2018-07-01

A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

Intense conductivity suppression by edge defects in zigzag MoS2 and WSe2 nanoribbons: a density functional based tight-binding study.

PubMed

Silva, F W N; Costa, A L M T; Liu, Lei; Barros, E B

2016-11-04

The effects of edge vacancies on the electron transport properties of zigzag MoS2/WSe2 nanoribbons are studied using a density functional theory (DFT)-based tight-binding model with a sp(3)d(5) basis set for the electronic structure calculation and applying the Landauer-Büttiker approach for the electronic transport. Our results show that the presence of a single edge vacancy, with a missing MoS2/WSe2 triplet, is enough to suppress the conductance of the system by almost one half for most energies around the Fermi level. Furthermore, the presence of other single defects along the same edge has little effect on the overall conductance, indicating that the conductance of that particular edge has been strongly suppressed by the first defect. The presence of another defect on the opposite edge further suppresses the quantum conductance, independently of the relative position between the two defects in opposite edges. The introduction of other defects cause the suppression to be energy dependent, leading to conductance peaks which depend on the geometry of the edges. The strong conductance dependence on the presence of edge defects is corroborated by DFT calculations using SIESTA, which show that the electronic bands near the Fermi energy are strongly localized at the edge.

Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

PubMed Central

Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

2001-01-01

The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

Kinetics of bacterial phospholipase C activity at micellar interfaces: effect of substrate aggregate microstructure and a model for the kinetic parameters.

PubMed

Singh, Jasmeet; Ranganathan, Radha; Hajdu, Joseph

2008-12-25

Activity at micellar interfaces of bacterial phospholipase C from Bacillus cereus on phospholipids solubilized in micelles was investigated with the goal of elucidating the role of the interface microstructure and developing further an existing kinetic model. Enzyme kinetics and physicochemical characterization of model substrate aggregates were combined, thus enabling the interpretation of kinetics in the context of the interface. Substrates were diacylphosphatidylcholine of different acyl chain lengths in the form of mixed micelles with dodecyldimethylammoniopropanesulfonate. An early kinetic model, reformulated to reflect the interfacial nature of the kinetics, was applied to the kinetic data. A better method of data treatment is proposed, use of which makes the presence of microstructure effects quite transparent. Models for enzyme-micelle binding and enzyme-lipid binding are developed, and expressions incorporating the microstructural properties are derived for the enzyme-micelle dissociation constant K(s) and the interface Michaelis-Menten constant, K(M). Use of these expressions in the interface kinetic model brings excellent agreement between the kinetic data and the model. Numerical values for the thermodynamic and kinetic parameters are determined. Enzyme-lipid binding is found to be an activated process with an acyl chain length dependent free energy of activation that decreases with micelle lipid molar fraction with a coefficient of about -15RT and correlates with the tightness of molecular packing in the substrate aggregate. Thus, the physical insight obtained includes a model for the kinetic parameters that shows that these parameters depend on the substrate concentration and acyl chain length of the lipid. Enzyme-micelle binding is indicated to be hydrophobic and solvent mediated with a dissociation constant of 1.2 mM.

Three pillars for achieving quantum mechanical molecular dynamics simulations of huge systems: Divide-and-conquer, density-functional tight-binding, and massively parallel computation.

PubMed

Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi

2016-08-05

The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2013-11-01

We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

Actinide electronic structure and atomic forces

NASA Astrophysics Data System (ADS)

Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

2000-07-01

We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

PubMed

Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

2016-10-28

Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

NASA Astrophysics Data System (ADS)

Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

2018-02-01

We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

Tight-Binding Description of Impurity States in Semiconductors

ERIC Educational Resources Information Center

Dominguez-Adame, F.

2012-01-01

Introductory textbooks in solid state physics usually present the hydrogenic impurity model to calculate the energy of carriers bound to donors or acceptors in semiconductors. This model treats the pure semiconductor as a homogeneous medium and the impurity is represented as a fixed point charge. This approach is only valid for shallow impurities…

Development of a Multicenter Density Functional Tight Binding Model for Plutonium Surface Hydriding.

PubMed

Goldman, Nir; Aradi, Bálint; Lindsey, Rebecca K; Fried, Laurence E

2018-05-08

We detail the creation of a multicenter density functional tight binding (DFTB) model for hydrogen on δ-plutonium, using a framework of new Slater-Koster interaction parameters and a repulsive energy based on the Chebyshev Interaction Model for Efficient Simulation (ChIMES), where two- and three-center atomic interactions are represented by linear combinations of Chebyshev polynomials. We find that our DFTB/ChIMES model yields a total electron density of states for bulk δ-Pu that compares well to that from Density Functional Theory, as well as to a grid of energy calculations representing approximate H 2 dissociation paths on the δ-Pu (100) surface. We then perform molecular dynamics simulations and minimum energy pathway calculations to determine the energetics of surface dissociation and subsurface diffusion on the (100) and (111) surfaces. Our approach allows for the efficient creation of multicenter repulsive energies with a relatively small investment in initial DFT calculations. Our efforts are particularly pertinent to studies that rely on quantum calculations for interpretation and validation, such as experimental determination of chemical reactivity both on surfaces and in condensed phases.

Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

NASA Astrophysics Data System (ADS)

Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

2018-03-01

It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

The effects of Rashba spin-orbit coupling on spin-polarized transport in hexagonal graphene nano-rings and flakes

NASA Astrophysics Data System (ADS)

Laghaei, M.; Heidari Semiromi, E.

2018-03-01

Quantum transport properties and spin polarization in hexagonal graphene nanostructures with zigzag edges and different sizes were investigated in the presence of Rashba spin-orbit interaction (RSOI). The nanostructure was considered as a channel to which two semi-infinite armchair graphene nanoribbons were coupled as input and output leads. Spin transmission and spin polarization in x, y, and z directions were calculated through applying Landauer-Buttiker formalism with tight binding model and the Green's function to the system. In these quantum structures it is shown that changing the size of system, induce and control the spin polarized currents. In short, these graphene systems are typical candidates for electrical spintronic devices as spin filtering.

Photoelectron emission from LiF surfaces by ultrashort electromagnetic pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Acuna, M. A.; Gravielle, M. S.; Departamento de Fisica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires

2011-03-15

Energy- and angle-resolved electron emission spectra produced by incidence of ultrashort electromagnetic pulses on a LiF(001) surface are studied by employing a distorted-wave method named the crystal surface-Volkov (CSV) approximation. The theory makes use of the Volkov phase to describe the action of the external electric field on the emitted electron, while the electron-surface interaction is represented within the tight-binding model. The CSV approach is applied to investigate the effects introduced by the crystal lattice when the electric field is oriented parallel to the surface plane. These effects are essentially governed by the vector potential of the external field, whilemore » the influence of the crystal orientation was found to be negligible.« less

An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. I. Model and validation

NASA Astrophysics Data System (ADS)

Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy; Klimeck, Gerhard

2014-03-01

Semi-empirical Tight Binding (TB) is known to be a scalable and accurate atomistic representation for electron transport for realistically extended nano-scaled semiconductor devices that might contain millions of atoms. In this paper, an environment-aware and transferable TB model suitable for electronic structure and transport simulations in technologically relevant metals, metallic alloys, metal nanostructures, and metallic interface systems are described. Part I of this paper describes the development and validation of the new TB model. The new model incorporates intra-atomic diagonal and off-diagonal elements for implicit self-consistency and greater transferability across bonding environments. The dependence of the on-site energies on strain has been obtained by appealing to the Moments Theorem that links closed electron paths in the system to energy moments of angular momentum resolved local density of states obtained ab initio. The model matches self-consistent density functional theory electronic structure results for bulk face centered cubic metals with and without strain, metallic alloys, metallic interfaces, and metallic nanostructures with high accuracy and can be used in predictive electronic structure and transport problems in metallic systems at realistically extended length scales.

Conformation-controlled binding kinetics of antibodies

NASA Astrophysics Data System (ADS)

Galanti, Marta; Fanelli, Duccio; Piazza, Francesco

2016-01-01

Antibodies are large, extremely flexible molecules, whose internal dynamics is certainly key to their astounding ability to bind antigens of all sizes, from small hormones to giant viruses. In this paper, we build a shape-based coarse-grained model of IgG molecules and show that it can be used to generate 3D conformations in agreement with single-molecule Cryo-Electron Tomography data. Furthermore, we elaborate a theoretical model that can be solved exactly to compute the binding rate constant of a small antigen to an IgG in a prescribed 3D conformation. Our model shows that the antigen binding process is tightly related to the internal dynamics of the IgG. Our findings pave the way for further investigation of the subtle connection between the dynamics and the function of large, flexible multi-valent molecular machines.

Tight-binding calculation studies of vacancy and adatom defects in graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

2016-02-19

Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Tight-binding model for materials at mesoscale

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

2016-12-21

TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

NASA Astrophysics Data System (ADS)

Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

2018-02-01

Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

PubMed Central

1988-01-01

We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

2015-11-14

Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

Effective lattice Hamiltonian for monolayer tin disulfide: Tailoring electronic structure with electric and magnetic fields

NASA Astrophysics Data System (ADS)

Yu, Jin; van Veen, Edo; Katsnelson, Mikhail I.; Yuan, Shengjun

2018-06-01

The electronic properties of monolayer tin dilsulfide (ML -Sn S2 ), a recently synthesized metal dichalcogenide, are studied by a combination of first-principles calculations and tight-binding (TB) approximation. An effective lattice Hamiltonian based on six hybrid s p -like orbitals with trigonal rotation symmetry are proposed to calculate the band structure and density of states for ML -Sn S2 , which demonstrates good quantitative agreement with relativistic density-functional-theory calculations in a wide energy range. We show that the proposed TB model can be easily applied to the case of an external electric field, yielding results consistent with those obtained from full Hamiltonian results. In the presence of a perpendicular magnetic field, highly degenerate equidistant Landau levels are obtained, showing typical two-dimensional electron gas behavior. Thus, the proposed TB model provides a simple way in describing properties in ML -Sn S2 .

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

DOE PAGES

Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

2017-10-17

New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

Conductance manipulation at the molecular level

NASA Astrophysics Data System (ADS)

Paulsson, Magnus; Stafström, Sven

1999-05-01

Using a tight-binding model we have studied the electronic transmission through a C60 molecule sandwiched between a metal surface and a metal (scanning tunnelling microscope) tip. By simulating compression of C60 we have interpreted an experimental study of the variation of the conductance through a C60 molecule with an applied external pressure. We found that the observed increase in conductance cannot be explained in terms of the changes in the electronic structure of the C60 molecule alone. Effects related to the metal/molecule contact, i.e. the strength of the metal/C60 interaction and the shape of the molecular orbitals in the tip, are in fact more important for the conductance. In view of this we discuss the importance of interference effects in the tip/molecule coupling.

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE PAGES

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

2016-09-09

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

PubMed

Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

2016-10-11

In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

DTIC Science & Technology

2010-06-01

for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

PubMed

Tsapara, Anna; Matter, Karl; Balda, Maria S

2006-03-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

PubMed Central

Tsapara, Anna; Matter, Karl; Balda, Maria S.

2006-01-01

The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

Majorana-Hubbard model on the square lattice

NASA Astrophysics Data System (ADS)

Affleck, Ian; Rahmani, Armin; Pikulin, Dmitry

2017-09-01

We study a tight-binding model of interacting Majorana (Hermitian) modes on a square lattice. The model may have an experimental realization in a superconducting-film-topological-insulator heterostructure in a magnetic field. We find a rich phase diagram, as a function of interaction strength, including an emergent superfluid phase with spontaneous breaking of an emergent U (1 ) symmetry, separated by a supersymmetric transition from a gapless normal phase.

Studies of the Electro-Optic Effect.

DTIC Science & Technology

1983-01-01

electro - optic effect in crystalline solids has been pursued by employing a tight-binding theory for dielectric susceptibilities. The electronic and lattice contributions to the second-order electro - optic susceptibility have been treated separately and the lattice response of a crystal to an external dc electric field has been investigated in a general formalism. The theory has been specifically applied to the compound, tellurium dioxide. In addition, an experimental determination of the electro - optic coefficient, re, in thallium

Spin structure of electron subbands in (110)-grown quantum wells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nestoklon, M. O.; Tarasenko, S. A.; Jancu, J.-M.

We present the theory of fine structure of electron states in symmetric and asymmetric zinc-blende-type quantum wells with the (110) crystallographic orientation. By combining the symmetry analysis, sp{sup 3}d{sup 5}s* tight-binding method, and envelope-function approach we obtain quantitative description of in-plane wave vector, well width and applied electric field dependencies of the zero-magnetic-field spin splitting of electron subbands and extract spin-orbit-coupling parameters.

Magnetic quantization in monolayer bismuthene

NASA Astrophysics Data System (ADS)

Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

PubMed

Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

2016-03-14

Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

NASA Astrophysics Data System (ADS)

Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

2018-06-01

A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

PubMed

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

PubMed Central

Wu, Sau-Ching; Wong, Sui-Lam

2013-01-01

Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

NASA Astrophysics Data System (ADS)

Leleyter, M.; Olivi-Tran, N.

2008-12-01

We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

PubMed

Quan, Yundi; Pickett, Warren E

2018-02-21

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

NASA Astrophysics Data System (ADS)

Quan, Yundi; Pickett, Warren E.

2018-02-01

Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

Theory of a peristaltic pump for fermionic quantum fluids

NASA Astrophysics Data System (ADS)

Romeo, F.; Citro, R.

2018-05-01

Motivated by the recent developments in fermionic cold atoms and in nanostructured systems, we propose the model of a peristaltic quantum pump. Differently from the Thouless paradigm, a peristaltic pump is a quantum device that generates a particle flux as the effect of a sliding finite-size microlattice. A one-dimensional tight-binding Hamiltonian model of this quantum machine is formulated and analyzed within a lattice Green's function formalism on the Keldysh contour. The pump observables, as, e.g., the pumped particles per cycle, are studied as a function of the pumping frequency, the width of the pumping potential, the particles mean free path, and system temperature. The proposed analysis applies to arbitrary peristaltic potentials acting on fermionic quantum fluids confined to one dimension. These confinement conditions can be realized in nanostructured systems or, in a more controllable way, in cold atoms experiments. In view of the validation of the theoretical results, we describe the outcomes of the model considering a fermionic cold atoms system as a paradigmatic example.

Demons and superconductivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ihm, J.; Cohen, M.L.; Tuan, S.F.

1981-04-01

Model calculations are used to explore the role of demons (acoustic plasmons involving light and heavy mass carriers) in superconductivity. Heavy d electrons and light s and p electrons in a transition metal are used for discussion, but the calculation presented is more general, and the results can be applied to other systems. The analysis is based on the dielectric-function approach and the Bardeen-Cooper-Schrieffer theory. The dielectric function includes intraband and interband s-d scattering, and a tight-binding model is used to examine the role of s-d hybridization. The demon contribution generally reduces the Coulomb interaction between the electrons. Under suitablemore » conditions, the model calculations indicate that the electron-electron interaction via demons can be attractive, but the results also suggest that this mechanism is probably not dominant in transition metals and transition-metal compounds. An attractive interband contribution is found, and it is proposed that this effect may lead to pairing in suitable systems.« less

Dissipative time-dependent quantum transport theory.

PubMed

Zhang, Yu; Yam, Chi Yung; Chen, GuanHua

2013-04-28

A dissipative time-dependent quantum transport theory is developed to treat the transient current through molecular or nanoscopic devices in presence of electron-phonon interaction. The dissipation via phonon is taken into account by introducing a self-energy for the electron-phonon coupling in addition to the self-energy caused by the electrodes. Based on this, a numerical method is proposed. For practical implementation, the lowest order expansion is employed for the weak electron-phonon coupling case and the wide-band limit approximation is adopted for device and electrodes coupling. The corresponding hierarchical equation of motion is derived, which leads to an efficient and accurate time-dependent treatment of inelastic effect on transport for the weak electron-phonon interaction. The resulting method is applied to a one-level model system and a gold wire described by tight-binding model to demonstrate its validity and the importance of electron-phonon interaction for the quantum transport. As it is based on the effective single-electron model, the method can be readily extended to time-dependent density functional theory.

A high-throughput screening approach for the optoelectronic properties of conjugated polymers.

PubMed

Wilbraham, Liam; Berardo, Enrico; Turcani, Lukas; Jelfs, Kim E; Zwijnenburg, Martijn A

2018-06-25

We propose a general high-throughput virtual screening approach for the optical and electronic properties of conjugated polymers. This approach makes use of the recently developed xTB family of low-computational-cost density functional tight-binding methods from Grimme and co-workers, calibrated here to (TD-)DFT data computed for a representative diverse set of (co-)polymers. Parameters drawn from the resulting calibration using a linear model can then be applied to the xTB derived results for new polymers, thus generating near DFT-quality data with orders of magnitude reduction in computational cost. As a result, after an initial computational investment for calibration, this approach can be used to quickly and accurately screen on the order of thousands of polymers for target applications. We also demonstrate that the (opto)electronic properties of the conjugated polymers show only a very minor variation when considering different conformers and that the results of high-throughput screening are therefore expected to be relatively insensitive with respect to the conformer search methodology applied.

Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

NASA Astrophysics Data System (ADS)

Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

2016-02-01

We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

Electric-field-induced plasmon in AA-stacked bilayer graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuang, Y.C., E-mail: yingchih.chuang@gmail.com; Wu, J.Y., E-mail: yarst5@gmail.com; Lin, M.F., E-mail: mflin@mail.ncku.edu.tw

2013-12-15

The collective excitations in AA-stacked bilayer graphene for a perpendicular electric field are investigated analytically within the tight-binding model and the random-phase approximation. Such a field destroys the uniform probability distribution of the four sublattices. This drives a symmetry breaking between the intralayer and interlayer polarization intensities from the intrapair band excitations. A field-induced acoustic plasmon thus emerges in addition to the strongly field-tunable intrinsic acoustic and optical plasmons. At long wavelengths, the three modes show different dispersions and field dependence. The definite physical mechanism of the electrically inducible and tunable mode can be expected to also be present inmore » other AA-stacked few-layer graphenes. -- Highlights: •The analytical derivations are performed by the tight-binding model. •An electric field drives the non-uniformity of the charge distribution. •A symmetry breaking between the intralayer and interlayer polarizations is illustrated. •An extra plasmon emerges besides two intrinsic modes in AA-stacked bilayer graphene. •The mechanism of a field-induced mode is present in AA-stacked few-layer graphenes.« less

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping

NASA Astrophysics Data System (ADS)

Henke, Paul S.; Mak, Chi H.

2014-08-01

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg2+ that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Free energy of RNA-counterion interactions in a tight-binding model computed by a discrete space mapping.

PubMed

Henke, Paul S; Mak, Chi H

2014-08-14

The thermodynamic stability of a folded RNA is intricately tied to the counterions and the free energy of this interaction must be accounted for in any realistic RNA simulations. Extending a tight-binding model published previously, in this paper we investigate the fundamental structure of charges arising from the interaction between small functional RNA molecules and divalent ions such as Mg(2+) that are especially conducive to stabilizing folded conformations. The characteristic nature of these charges is utilized to construct a discretely connected energy landscape that is then traversed via a novel application of a deterministic graph search technique. This search method can be incorporated into larger simulations of small RNA molecules and provides a fast and accurate way to calculate the free energy arising from the interactions between an RNA and divalent counterions. The utility of this algorithm is demonstrated within a fully atomistic Monte Carlo simulation of the P4-P6 domain of the Tetrahymena group I intron, in which it is shown that the counterion-mediated free energy conclusively directs folding into a compact structure.

Tight-binding analysis of Si and GaAs ultrathin bodies with subatomic wave-function resolution

NASA Astrophysics Data System (ADS)

Tan, Yaohua P.; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

2015-08-01

Empirical tight-binding (ETB) methods are widely used in atomistic device simulations. Traditional ways of generating the ETB parameters rely on direct fitting to bulk experiments or theoretical electronic bands. However, ETB calculations based on existing parameters lead to unphysical results in ultrasmall structures like the As-terminated GaAs ultrathin bodies (UTBs). In this work, it is shown that more transferable ETB parameters with a short interaction range can be obtained by a process of mapping ab initio bands and wave functions to ETB models. This process enables the calibration of not only the ETB energy bands but also the ETB wave functions with corresponding ab initio calculations. Based on the mapping process, ETB models of Si and GaAs are parameterized with respect to hybrid functional calculations. Highly localized ETB basis functions are obtained. Both the ETB energy bands and wave functions with subatomic resolution of UTBs show good agreement with the corresponding hybrid functional calculations. The ETB methods can then be used to explain realistically extended devices in nonequilibrium that cannot be tackled with ab initio methods.

Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

NASA Astrophysics Data System (ADS)

Turek, I.; Kudrnovský, J.; Drchal, V.

2015-12-01

We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

Electronic Structure and Properties of Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Yang, Liu; Arnold, Jim (Technical Monitor)

2001-01-01

A theoretical framework based on Huckel tight-binding model has been formulated to analyze the electronic structure of carbon nanotubes under uniform deformation. The model successfully quantifies the dispersion relation, density of states and bandgap change of nanotubes under uniform stretching, compression, torsion and bending. Our analysis shows that the shifting of the Fermi point away from the Brillouin zone vertices is the key reason for these changes. As a result of this shifting, the electronic structure of deformed carbon nanotubes varies dramatically depending on their chirality and deformation mode. Treating the Fermi point as a function of strain and tube chirality, the analytical solution preserves the concise form of undeformed carbon nanotubes. It predicts the shifting, merging and splitting of the Van Hove singularities in the density of states and the zigzag pattern of bandgap change under strains. Four orbital tight-binding simulations of carbon nanotubes under uniform stretching, compression, torsion and bending have been performed to verify the analytical solution. Extension to more complex systems are being performed to relate this analytical solution to the spectroscopic characterization, device performance and proposed quantum structures induced by the deformation. The limitations of this model will also be discussed.

-X Mixing in T- and V-Shaped Quantum Wires

NASA Astrophysics Data System (ADS)

di Carlo, A.; Pescetelli, S.; Kavokin, A.; Vladimirova, M.; Lugli, P.

1997-11-01

We have applied both tight-binding (TB) and multivalley envelope function (MEF) techniques to calculate the electronic states in T- and V-shaped realistic quantum wires taking into account -X mixing in the conduction band. Strong reduction of the electron quantization energy due to the off-resonant -X mixing has been found in all types of quantum wires. This effect appears to be tied to the localization of the electron wave function and to its overlap with atomic layers next to interfaces.

Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

NASA Astrophysics Data System (ADS)

Jahangiri, Soran; Mosey, Nicholas J.

2018-01-01

Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

PubMed

Glover, N R; Tracey, A S

1999-04-20

The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

Time-efficient simulations of tight-binding electronic structures with Intel Xeon PhiTM many-core processors

NASA Astrophysics Data System (ADS)

Ryu, Hoon; Jeong, Yosang; Kang, Ji-Hoon; Cho, Kyu Nam

2016-12-01

Modelling of multi-million atomic semiconductor structures is important as it not only predicts properties of physically realizable novel materials, but can accelerate advanced device designs. This work elaborates a new Technology-Computer-Aided-Design (TCAD) tool for nanoelectronics modelling, which uses a sp3d5s∗ tight-binding approach to describe multi-million atomic structures, and simulate electronic structures with high performance computing (HPC), including atomic effects such as alloy and dopant disorders. Being named as Quantum simulation tool for Advanced Nanoscale Devices (Q-AND), the tool shows nice scalability on traditional multi-core HPC clusters implying the strong capability of large-scale electronic structure simulations, particularly with remarkable performance enhancement on latest clusters of Intel Xeon PhiTM coprocessors. A review of the recent modelling study conducted to understand an experimental work of highly phosphorus-doped silicon nanowires, is presented to demonstrate the utility of Q-AND. Having been developed via Intel Parallel Computing Center project, Q-AND will be open to public to establish a sound framework of nanoelectronics modelling with advanced HPC clusters of a many-core base. With details of the development methodology and exemplary study of dopant electronics, this work will present a practical guideline for TCAD development to researchers in the field of computational nanoelectronics.

Influence of strain on dislocation core in silicon

NASA Astrophysics Data System (ADS)

Pizzagalli, L.; Godet, J.; Brochard, S.

2018-05-01

First principles, density functional-based tight binding and semi-empirical interatomic potentials calculations are performed to analyse the influence of large strains on the structure and stability of a 60? dislocation in silicon. Such strains typically arise during the mechanical testing of nanostructures like nanopillars or nanoparticles. We focus on bi-axial strains in the plane normal to the dislocation line. Our calculations surprisingly reveal that the dislocation core structure largely depends on the applied strain, for strain levels of about 5%. In the particular case of bi-axial compression, the transformation of the dislocation to a locally disordered configuration occurs for similar strain magnitudes. The formation of an opening, however, requires larger strains, of about 7.5%. Furthermore, our results suggest that electronic structure methods should be favoured to model dislocation cores in case of large strains whenever possible.

Study of alloy disorder in quantum dots through multi-million atom simulations

NASA Technical Reports Server (NTRS)

Kilmeck, Gerhard; Oyafuso, Fabiano; Boykin, T. B.; Bowen, R. C.; von Allmen, Paul A.

2003-01-01

A tight binding model which includes s, p, d, s orbitals is used to examine the electronic structures of an ensemble of dome-shaped In0.6 Ga0.4 As quantum dots. Given ensembles of identically sized quantum dots, variations in composition and configuration yield a linewidth broadening of less than 0.35 meV, much smaller than the total broadening determined from photoluminescence experiments. It is also found that the computed disorder-induced broadening is very sensitive to the applied boundary conditions, so that care must be taken to ensure proper convergence of the numerical results. Examination of local eigenenergies as functions of position shows similar convergence problems and indicates that an inaccurate resolution of the equilibrium atomic positions due to truncation of the simulation domain may be the source of the slow ground state convergence.

Application of Tight-Binding Method in Atomistic Simulation of Covalent Materials

NASA Astrophysics Data System (ADS)

Isik, Ahmet

1994-05-01

The primary goal of this thesis is to develop and apply molecular dynamics simulation methods to elemental and binary covalent materials (Si, C, SiC) based on the tight-binding (TB) model of atomic cohesion in studies of bulk and deformation properties far from equilibrium. A second purpose is to compare results with those obtained using empirical interatomic potential functions in order to elucidate the applicability of models of interatomic interactions which do not take into account explicitly electronic structure effects. We have calculated the former by using a basis set consisting of four atomic orbitals, one for the s state and three for the p states, constructing a TB Hamiltonian in the usual Slater-Koster parametrization, and diagonalizing the Hamiltonian matrix at the origin of the Brillouin zone. For the repulsive part of the energy we employ a function in the form of inverse power law with screening which is then fitted to the bulk modulus and lattice parameter of several stable polytypes, results calculated by ab initio methods in the literature. Three types of applications have been investigated to demonstrate the utility of the present TB models and their advantages relative to empirical potentials. In the case of Si we show the calculated cohesive energy agrees to within a few percent with the ab initio local-density approximation (LDA) results. In addition, for clusters up to 10 atoms we find most of the energies and equilibrium structures to be in good agreement with LDA results (the failure of the empirical potential of Stillinger and Weber (SW) is well known). In the case of C clusters our TB model gives ring and chain structures which have been found both experimentally and by LDA calculations. In the second application we have applied our TB model of Si to investigate the core structure and energetics of partial dislocations on the glide plane and reconstruction antiphase defect (APD). For the 90^circ partial we show that the TB description gives the correct asymetric reconstruction previously found by LDA. For the 30^circ partial, TB gives better bond angles in the dislocation core. For the APD we have obtained a binding energy and activation for migration which are somewhat larger than the SW values, but the conclusion remains that APD is a low-energy defect which should be quite mobile. In the third application we formulate a simple TB model for SiC where the coefficients of the two-center integrals in Si-C interactions are taken to be simple averages of Si-Si and C-C integrals. Fitting is done on two polytypes, zincblende and rocksalt structures, and a simulated annealing procedure is used. The TB results are found in good agreement with LDA and experimental results in the cohesive energy, acoustic phonon modes, and elastic constants. (Abstract shortened by UMI.).

Benchmarking density functional tight binding models for barrier heights and reaction energetics of organic molecules.

PubMed

Gruden, Maja; Andjeklović, Ljubica; Jissy, Akkarapattiakal Kuriappan; Stepanović, Stepan; Zlatar, Matija; Cui, Qiang; Elstner, Marcus

2017-09-30

Density Functional Tight Binding (DFTB) models are two to three orders of magnitude faster than ab initio and Density Functional Theory (DFT) methods and therefore are particularly attractive in applications to large molecules and condensed phase systems. To establish the applicability of DFTB models to general chemical reactions, we conduct benchmark calculations for barrier heights and reaction energetics of organic molecules using existing databases and several new ones compiled in this study. Structures for the transition states and stable species have been fully optimized at the DFTB level, making it possible to characterize the reliability of DFTB models in a more thorough fashion compared to conducting single point energy calculations as done in previous benchmark studies. The encouraging results for the diverse sets of reactions studied here suggest that DFTB models, especially the most recent third-order version (DFTB3/3OB augmented with dispersion correction), in most cases provide satisfactory description of organic chemical reactions with accuracy almost comparable to popular DFT methods with large basis sets, although larger errors are also seen for certain cases. Therefore, DFTB models can be effective for mechanistic analysis (e.g., transition state search) of large (bio)molecules, especially when coupled with single point energy calculations at higher levels of theory. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

PubMed Central

Lonberg-Holm, K; Whiteley, N M

1976-01-01

Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Xiang, J.B.

We have examined a variety of structures for the (510) symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. We compare the results to classical and tight-binding models, in order to test these empirical problems.

Targeted entry of enveloped viruses: measles and herpes simplex virus I.

PubMed

Navaratnarajah, Chanakha K; Miest, Tanner S; Carfi, Andrea; Cattaneo, Roberto

2012-02-01

We compare the receptor-based mechanisms that a small RNA virus and a larger DNA virus have evolved to drive the fusion of viral and cellular membranes. Both systems rely on tight control over triggering the concerted refolding of a trimeric fusion protein. While measles virus entry depends on a receptor-binding protein and a fusion protein only, the herpes simplex virus (HSV) is more complex and requires four viral proteins. Nevertheless, in both viruses a receptor-binding protein is required for triggering the membrane fusion process. Moreover, specificity domains can be appended to these receptor-binding proteins to target virus entry to cells expressing a designated receptor. We discuss how principles established with measles and HSV can be applied to targeting other enveloped viruses, and alternatively how retargeted envelopes can be fitted on foreign capsids. Copyright © 2011 Elsevier B.V. All rights reserved.

Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

PubMed

Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

2017-02-06

The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

PubMed

Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

2016-03-18

The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

NASA Astrophysics Data System (ADS)

Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

2017-07-01

We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

Quantitative analysis on electric dipole energy in Rashba band splitting.

PubMed

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-09-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

Quantitative analysis on electric dipole energy in Rashba band splitting

PubMed Central

Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

2015-01-01

We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

PubMed

Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

2018-01-18

Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

PubMed

Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

2018-03-05

During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

1988-04-15

We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

DOE PAGES

Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei; ...

2017-03-02

A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less

Parameter-free driven Liouville-von Neumann approach for time-dependent electronic transport simulations in open quantum systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zelovich, Tamar; Hansen, Thorsten; Liu, Zhen-Fei

A parameter-free version of the recently developed driven Liouville-von Neumann equation [T. Zelovich et al., J. Chem. Theory Comput. 10(8), 2927-2941 (2014)] for electronic transport calculations in molecular junctions is presented. The single driving rate, appearing as a fitting parameter in the original methodology, is replaced by a set of state-dependent broadening factors applied to the different single-particle lead levels. These broadening factors are extracted explicitly from the self-energy of the corresponding electronic reservoir and are fully transferable to any junction incorporating the same lead model. Furthermore, the performance of the method is demonstrated via tight-binding and extended Hückel calculationsmore » of simple junction models. Our analytic considerations and numerical results indicate that the developed methodology constitutes a rigorous framework for the design of "black-box" algorithms to simulate electron dynamics in open quantum systems out of equilibrium.« less

Chemisorption of hydrogen atoms and hydroxyl groups on stretched graphene: A coupled QM/QM study

NASA Astrophysics Data System (ADS)

Katin, Konstantin P.; Prudkovskiy, Vladimir S.; Maslov, Mikhail M.

2017-09-01

Using the density functional theory coupled with the nonorthogonal tight-binding model, we analyze the chemisorption of hydrogen atoms and hydroxyl groups on the unstrained and stretched graphene sheets. Drawback of finite cluster model of graphene for the chemisorption energy calculation in comparison with the QM/QM approach applied is discussed. It is shown that the chemisorption energy for the hydroxyl group is sufficiently lower than for hydrogen at stretching up to 7.5%. The simultaneous paired chemisorption of hydrogen and hydroxyl groups on the same hexagon has also been examined. Adsorption of two radicals in ortho and para positions is found to be more energetically favorable than those in meta position at any stretching considered. In addition the energy difference between adsorbent pairs in ortho and para positions decreases as the stretching rises. It could be concluded that the graphene stretching leads to the loss of preferred mutual arrangement of two radicals on its surface.

Crumbs3 Is Essential for Proper Epithelial Development and Viability

PubMed Central

Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

2014-01-01

First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

Calcyclin Binding Protein/Siah-1 Interacting Protein Is a Hsp90 Binding Chaperone

PubMed Central

Góral, Agnieszka; Bieganowski, Paweł; Prus, Wiktor; Krzemień-Ojak, Łucja; Kądziołka, Beata; Fabczak, Hanna; Filipek, Anna

2016-01-01

The Hsp90 chaperone activity is tightly regulated by interaction with many co-chaperones. Since CacyBP/SIP shares some sequence homology with a known Hsp90 co-chaperone, Sgt1, in this work we performed a set of experiments in order to verify whether CacyBP/SIP can interact with Hsp90. By applying the immunoprecipitation assay we have found that CacyBP/SIP binds to Hsp90 and that the middle (M) domain of Hsp90 is responsible for this binding. Furthermore, the proximity ligation assay (PLA) performed on HEp-2 cells has shown that the CacyBP/SIP-Hsp90 complexes are mainly localized in the cytoplasm of these cells. Using purified proteins and applying an ELISA we have shown that Hsp90 interacts directly with CacyBP/SIP and that the latter protein does not compete with Sgt1 for the binding to Hsp90. Moreover, inhibitors of Hsp90 do not perturb CacyBP/SIP-Hsp90 binding. Luciferase renaturation assay and citrate synthase aggregation assay with the use of recombinant proteins have revealed that CacyBP/SIP exhibits chaperone properties. Also, CacyBP/SIP-3xFLAG expression in HEp-2 cells results in the appearance of more basic Hsp90 forms in 2D electrophoresis, which may indicate that CacyBP/SIP dephosphorylates Hsp90. Altogether, the obtained results suggest that CacyBP/SIP is involved in regulation of the Hsp90 chaperone machinery. PMID:27249023

Efficient self-consistency for magnetic tight binding

NASA Astrophysics Data System (ADS)

Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

2011-06-01

Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

Neuraminidase inhibitor R-125489 - A promising drug for treating influenza virus: Steered molecular dynamics approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mai, Binh Khanh; Li, Mai Suan, E-mail: masli@ifpan.edu.pl

2011-07-08

Highlights: {yields} We study binding affinity of R-125489 and its prodrug CS-8958 to neuraminidase of pathogenic influenza viruses by molecular dynamics simulations. {yields} It is shown that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. {yields} We predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus. {yields} The high correlation between theoretical and experimental data implies that SMD is a very promising tool for drug design. -- Abstract: Two neuraminidase inhibitors, oseltamivir and zanamivir, are important drug treatments for influenza. Oseltamivir-resistant mutants of the influenzamore » virus A/H1N1 and A/H5N1 have emerged, necessitating the development of new long-acting antiviral agents. One such agent is a new neuraminidase inhibitor R-125489 and its prodrug CS-8958. An atomic level understanding of the nature of this antiviral agents binding is still missing. We address this gap in our knowledge by applying steered molecular dynamics (SMD) simulations to different subtypes of seasonal and highly pathogenic influenza viruses. We show that, in agreement with experiments, R-125489 binds to neuraminidase more tightly than CS-8958. Based on results obtained by SMD and the molecular mechanics-Poisson-Boltzmann surface area method, we predict that R-125489 can be used to treat not only wild-type but also tamiflu-resistant N294S, H274Y variants of A/H5N1 virus as its binding affinity does not vary much across these systems. The high correlation level between theoretically determined rupture forces and experimental data on binding energies for the large number of systems studied here implies that SMD is a promising tool for drug design.« less

Well test mathematical model for fractures network in tight oil reservoirs

NASA Astrophysics Data System (ADS)

Diwu, Pengxiang; Liu, Tongjing; Jiang, Baoyi; Wang, Rui; Yang, Peidie; Yang, Jiping; Wang, Zhaoming

2018-02-01

Well test, especially build-up test, has been applied widely in the development of tight oil reservoirs, since it is the only available low cost way to directly quantify flow ability and formation heterogeneity parameters. However, because of the fractures network near wellbore, generated from artificial fracturing linking up natural factures, traditional infinite and finite conductivity fracture models usually result in significantly deviation in field application. In this work, considering the random distribution of natural fractures, physical model of fractures network is proposed, and it shows a composite model feature in the large scale. Consequently, a nonhomogeneous composite mathematical model is established with threshold pressure gradient. To solve this model semi-analytically, we proposed a solution approach including Laplace transform and virtual argument Bessel function, and this method is verified by comparing with existing analytical solution. The matching data of typical type curves generated from semi-analytical solution indicates that the proposed physical and mathematical model can describe the type curves characteristic in typical tight oil reservoirs, which have up warping in late-term rather than parallel lines with slope 1/2 or 1/4. It means the composite model could be used into pressure interpretation of artificial fracturing wells in tight oil reservoir.

Dirac topological insulator in the dz2 manifold of a honeycomb oxide

NASA Astrophysics Data System (ADS)

Lado, J. L.; Pardo, V.

2016-09-01

We show by means of ab initio calculations and tight-binding modeling that an oxide system based on a honeycomb lattice can sustain topologically nontrivial states if a single orbital dominates the spectrum close to the Fermi level. In such a situation, the low-energy spectrum is described by two Dirac equations that become nontrivially gapped when spin-orbit coupling (SOC) is switched on. We provide one specific example but the recipe is general. We discuss a realization of this starting from a conventional spin-1/2 honeycomb antiferromagnet whose states close to the Fermi energy are dz2 orbitals. Switching off magnetism by atomic substitution and ensuring that the electronic structure becomes two-dimensional is sufficient for topologicality to arise in such a system. By deriving a tight-binding Wannier Hamiltonian, we find that the gap in such a model scales linearly with SOC, opposed to other oxide-based topological insulators, where smaller gaps tend to appear by construction of the lattice. We show that the quantum spin Hall state in this system survives in the presence of off-plane magnetism and the orbital magnetic field and we discuss its Landau level spectra, showing that our recipe provides a dz2 realization of the Kane-Mele model.

Mobile spin impurity in an optical lattice

NASA Astrophysics Data System (ADS)

Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

2017-07-01

We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

Phononic crystals of spherical particles: A tight binding approach

NASA Astrophysics Data System (ADS)

Mattarelli, M.; Secchi, M.; Montagna, M.

2013-11-01

The vibrational dynamics of a fcc phononic crystal of spheres is studied and compared with that of a single free sphere, modelled either by a continuous homogeneous medium or by a finite cluster of atoms. For weak interaction among the spheres, the vibrational dynamics of the phononic crystal is described by shallow bands, with low degree of dispersion, corresponding to the acoustic spheroidal and torsional modes of the single sphere. The phonon displacements are therefore related to the vibrations of a sphere, as the electron wave functions in a crystal are related to the atomic wave functions in a tight binding model. Important dispersion is found for the two lowest phonon bands, which correspond to zero frequency free translation and rotation of a free sphere. Brillouin scattering spectra are calculated at some values of the exchanged wavevectors of the light, and compared with those of a single sphere. With weak interaction between particles, given the high acoustic impedance mismatch in dry systems, the density of phonon states consist of sharp bands separated by large gaps, which can be well accounted for by a single particle model. Based on the width of the frequency gaps, tunable with the particle size, and on the small number of dispersive acoustic phonons, such systems may provide excellent materials for application as sound or heat filters.

Slater-Koster Tight-Binding parametrization of single and few-layer Black-Phosphorus from first-principles calculations

NASA Astrophysics Data System (ADS)

Menezes, Marcos; Capaz, Rodrigo

Black Phosphorus (BP) is a promising material for applications in electronics, especially due to the tuning of its band gap by increasing the number of layers. In single-layer BP, also called Phosphorene, the P atoms form two staggered chains bonded by sp3 hybridization, while neighboring layers are bonded by Van-der-Waals interactions. In this work, we present a Tight-Binding (TB) parametrization of the electronic structure of single and few-layer BP, based on the Slater-Koster model within the two-center approximation. Our model includes all 3s and 3p orbitals, which makes this problem more complex than that of graphene, where only 2pz orbitals are needed for most purposes. The TB parameters are obtained from a least-squares fit of DFT calculations carried on the SIESTA code. We compare the results for different basis-sets used to expand the ab-initio wavefunctions and discuss their applicability. Our model can fit a larger number of bands than previously reported calculations based on Wannier functions. Moreover, our parameters have a clear physical interpretation based on chemical bonding. As such, we expect our results to be useful in a further understanding of multilayer BP and other 2D-materials characterized by strong sp3 hybridization. CNPq, FAPERJ, INCT-Nanomateriais de Carbono.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morris, J.R.; Lu, Z.Y.; Ring, D.M.

The authors have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si, using first-principles calculations. These calculations show that the observed structure in Si is the lowest energy structure. This structure is more complicated than what is necessary to preserve four-fold coordination. They compare the results to classical and tight-binding models, in order to test these empirical approaches.

A general intermolecular force field based on tight-binding quantum chemical calculations

NASA Astrophysics Data System (ADS)

Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

2017-10-01

A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

PubMed Central

Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

2009-01-01

8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

Investigation of the effect of scattering centers on low dimensional nanowire channel

NASA Astrophysics Data System (ADS)

Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri

2018-05-01

In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.

Entanglement entropy and entanglement spectrum of Bi_1-xSb_x (111) bilayers.

PubMed

Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz

2018-02-14

We study topological properties of Bi$_{1-x}$Sb$_{x}$ bilayers in the (111) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. Topologically non-trivial nature of bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayer and strain in Sb bilayer. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case. © 2018 IOP Publishing Ltd.

Entanglement entropy and entanglement spectrum of Bi1-x Sb x (1 1 1) bilayers.

PubMed

Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz

2018-02-28

We study topological properties of Bi 1-x Sb x bilayers in the (1 1 1) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. The topologically non-trivial nature of the bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayers and strain in Sb bilayers. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case.

Substantial optical dielectric enhancement by volume compression in LiAsSe 2

DOE PAGES

Zheng, Fan; Brehm, John A.; Young, Steve M.; ...

2016-05-15

Based on first-principles calculations, we predict a substantial increase in the optical dielectric function of LiAsSemore » $$_2$$ under pressure. We find that the optical dielectric constant is enhanced threefold under volume compression. This enhancement is mainly due to the dimerization strength reduction of the one-dimensional (1D) As--Se chains in LiAsSe$$_2$$, which significantly alters the wavefunction phase mismatch between two neighboring chains and changes the transition intensity. By developing a tight-binding model of the interacting 1D chains, the essential features of the low-energy electronic structure of LiAsSe$$_2$$ are captured. In conclusion, our findings are important for understanding the fundamental physics of LiAsSe$$_2$$ and provide a feasible way to enhance the material optical response that can be applied to light harvesting for energy applications.« less

Disorder Problem In Diluted Magnetic Semiconductors

NASA Astrophysics Data System (ADS)

Nelson, Ryky; Ekuma, Chinedu; Terletska, Hanna; Sudhindra, Vidhyadhiraja; Moreno, Juana; Jarrell, Mark

2015-03-01

Motivated by experimental studies addressing the role of impurity disorder in diluted magnetic semiconductors (DMS), we investigate the effects of disorder using a simple tight-binding Hamiltonian with random impurity potential and spin-fermion exchange which is self-consistently solved using the typical medium theory. Adopting the typical density of states (TDoS) as the order parameter, we find that the TDoS vanishes below a critical concentration of the impurity, which indicates an Anderson localization transition in the system. Our results qualitatively explain why at concentrations lower than a critical value DMS are insulating and paramagnetic, while at larger concentrations are ferromagnetic. We also compare several simple models to explore the interplay between ferromagnetic order and disorder induced insulating behavior, and the role of the spin-orbit interaction on this competition. We apply our findings to (Ga,Mn)As and (Ga,Mn)N to compare and contrast their phase diagrams.

Entanglement entropy and entanglement spectrum of Bi1-x Sb x (1 1 1) bilayers

NASA Astrophysics Data System (ADS)

Brzezińska, Marta; Bieniek, Maciej; Woźniak, Tomasz; Potasz, Paweł; Wójs, Arkadiusz

2018-03-01

We study topological properties of Bi1-x Sb x bilayers in the (1 1 1) plane using entanglement measures. Electronic structures are investigated within multi-orbital tight-binding model and structural stability is confirmed through first-principles calculations. The topologically non-trivial nature of the bismuth bilayer is proved by the presence of spectral flow in the entanglement spectrum. We consider topological phase transitions driven by a composition change x, an applied external electric field in Bi bilayers and strain in Sb bilayers. Composition- and strain-induced phase transitions reveal a finite discontinuity in the entanglement entropy. This quantity remains a continuous function of the electric field strength, but shows a finite discontinuity in the first derivative. We relate the difference in behavior of the entanglement entropy to the breaking of inversion symmetry in the last case.

The Mismetallation of Enzymes during Oxidative Stress*

PubMed Central

Imlay, James A.

2014-01-01

Mononuclear iron enzymes can tightly bind non-activating metals. How do cells avoid mismetallation? The model bacterium Escherichia coli may control its metal pools so that thermodynamics favor the correct metallation of each enzyme. This system is disrupted, however, by superoxide and hydrogen peroxide. These species oxidize ferrous iron and thereby displace it from many iron-dependent mononuclear enzymes. Ultimately, zinc binds in its place, confers little activity, and imposes metabolic bottlenecks. Data suggest that E. coli compensates by using thiols to extract the zinc and by importing manganese to replace the catalytic iron atom. Manganese resists oxidants and provides substantial activity. PMID:25160623

Modeling electronic trap state distributions in nanocrystalline anatase

NASA Astrophysics Data System (ADS)

Le, Nam; Schweigert, Igor

The charge transport properties of nanocrystalline TiO2 films, and thus the catalytic performance of devices that incorporate them, are affected strongly by the spatial and energetic distribution of localized electronic trap states. Such traps may arise from a variety of defects: Ti interstitials, O vacancies, step edges at surfaces, and grain boundaries. We have developed a procedure for applying density functional theory (DFT) and density functional tight binding (DFTB) calculations to characterize distributions of localized states arising from multiple types of defects. We have applied the procedure to investigate how the morphologies of interfaces between pairs of attached anatase nanoparticles determine the energies of trap states therein. Our results complement recent experimental findings that subtle changes in the morphology of highly porous TiO2 aerogel networks can have a dramatic effect on catalytic performance, which was attributed to changes in the distribution of trap states. This work was supported by the U.S. Naval Research Laboratory via the National Research Council and by the Office of Naval Research through the U.S. Naval Research Laboratory.

Tight-binding calculation of radiation loss in photonic crystal CROW.

PubMed

Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

2013-01-28

The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

OLIFE: Tight Binding Code for Transmission Coefficient Calculation

NASA Astrophysics Data System (ADS)

Mijbil, Zainelabideen Yousif

2018-05-01

A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

DTIC Science & Technology

1977-01-01

An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

PubMed Central

Meneses, Erick; Mittermaier, Anthony

2014-01-01

Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

Dual binding in cohesin-dockerin complexes: the energy landscape and the role of short, terminal segments of the dockerin module.

PubMed

Wojciechowski, Michał; Różycki, Bartosz; Huy, Pham Dinh Quoc; Li, Mai Suan; Bayer, Edward A; Cieplak, Marek

2018-03-22

The assembly of the polysaccharide degradating cellulosome machinery is mediated by tight binding between cohesin and dockerin domains. We have used an empirical model known as FoldX as well as molecular mechanics methods to determine the free energy of binding between a cohesin and a dockerin from Clostridium thermocellum in two possible modes that differ by an approximately 180° rotation. Our studies suggest that the full-length wild-type complex exhibits dual binding at room temperature, i.e., the two modes of binding have comparable probabilities at equilibrium. The ability to bind in the two modes persists at elevated temperatures. However, single-point mutations or truncations of terminal segments in the dockerin result in shifting the equilibrium towards one of the binding modes. Our molecular dynamics simulations of mechanical stretching of the full-length wild-type cohesin-dockerin complex indicate that each mode of binding leads to two kinds of stretching pathways, which may be mistakenly taken as evidence of dual binding.

Does the low hole transport mass in <110> and <111> Si nanowires lead to mobility enhancements at high field and stress: A self-consistent tight-binding study

NASA Astrophysics Data System (ADS)

Kotlyar, R.; Linton, T. D.; Rios, R.; Giles, M. D.; Cea, S. M.; Kuhn, K. J.; Povolotskyi, Michael; Kubis, Tillmann; Klimeck, Gerhard

2012-06-01

The hole surface roughness and phonon limited mobility in the silicon <100>, <110>, and <111> square nanowires under the technologically important conditions of applied gate bias and stress are studied with the self-consistent Poisson-sp3d5s*-SO tight-binding bandstructure method. Under an applied gate field, the hole carriers in a wire undergo a volume to surface inversion transition diminishing the positive effects of the high <110> and <111> valence band nonparabolicities, which are known to lead to the large gains of the phonon limited mobility at a zero field in narrow wires. Nonetheless, the hole mobility in the unstressed wires down to the 5 nm size remains competitive or shows an enhancement at high gate field over the large wire limit. Down to the studied 3 nm sizes, the hole mobility is degraded by strong surface roughness scattering in <100> and <110> wires. The <111> channels are shown to experience less surface scattering degradation. The physics of the surface roughness scattering dependence on wafer and channel orientations in a wire is discussed. The calculated uniaxial compressive channel stress gains of the hole mobility are found to reduce in the narrow wires and at the high field. This exacerbates the stressed mobility degradation with size. Nonetheless, stress gains of a factor of 2 are obtained for <110> wires down to 3 nm size at a 5×1012 cm-2 hole inversion density per gate area.

Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

PubMed Central

Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

2012-01-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

PubMed

Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

2012-12-01

The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

THE NORTH AMERICAN MERCURY MODEL INTER-COMPARISON STUDY (NAMMIS)

EPA Science Inventory

This paper describes the North American Mercury Model Inter-comparison Study (NAMMIS). The NAMMIS is an effort to apply atmospheric Hg models in a tightly constrained testing environment with a focus on North America. With each model using the same input data sets for initial co...

Quantum simulation of disordered systems with cold atoms

NASA Astrophysics Data System (ADS)

Garreau, Jean-Claude

2017-01-01

This paper reviews the physics of quantum disorder in relation with a series of experiments using laser-cooled atoms exposed to "kicks" of a standing wave, realizing a paradigmatic model of quantum chaos, the kicked rotor. This dynamical system can be mapped onto a tight-binding Hamiltonian with pseudo-disorder, formally equivalent to the Anderson model of quantum disorder, with quantum chaos playing the role of disorder. This provides a very good quantum simulator for the Anderson physics. xml:lang="fr"

Model of gas adsorption on magnetic surfaces

NASA Astrophysics Data System (ADS)

Pick, S.˛te˛´n.; D´, Hugues

1997-12-01

The semi-empirical self-consistent tight-binding model of gas (C, N, O) chemisorption is suggested to study its influence on surface magnetism. For the strongly ferromagnetic Fe(001), we find that the adsorbates are not effective in magnetism reduction. For the hypothetical magnetic V(001) surface, the magnetization is very sensitive to the vanadium d-band occupation used in the calculation. Supposing that the magnetization is weak, it can be essentially suppressed by the gas contamination. The effect is explained by the Stoner criterion.

Correspondence between a shaken honeycomb lattice and the Haldane model

NASA Astrophysics Data System (ADS)

Modugno, Michele; Pettini, Giulio

2017-11-01

We investigate the correspondence between the tight-binding Floquet Hamiltonian of a periodically modulated honeycomb lattice and the Haldane model. We show that—though the two systems share the same topological phase diagram, as reported in a breakthrough experiment with ultracold atoms in a stretched honeycomb lattice [G. Jotzu et al., Nature (London) 515, 237 (2014), 10.1038/nature13915]—the corresponding Hamiltonians are not equivalent, the one of the shaken lattice presenting a much richer structure.

Ligand Binding to Macromolecules: Allosteric and Sequential Models of Cooperativity.

ERIC Educational Resources Information Center

Hess, V. L.; Szabo, Attila

1979-01-01

A simple model is described for the binding of ligands to macromolecules. The model is applied to the cooperative binding by hemoglobin and aspartate transcarbamylase. The sequential and allosteric models of cooperative binding are considered. (BB)

A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

PubMed Central

Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

2009-01-01

Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN- binding defined by EPR-based hybrid method

NASA Astrophysics Data System (ADS)

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN-, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane.

Landau level splitting due to graphene superlattices

NASA Astrophysics Data System (ADS)

Pal, G.; Apel, W.; Schweitzer, L.

2012-06-01

The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

NASA Astrophysics Data System (ADS)

Reijnders, K. J. A.; Katsnelson, M. I.

2017-07-01

We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

Topological states in a two-dimensional metal alloy in Si surface: BiAg/Si(111)-4 ×4 surface

NASA Astrophysics Data System (ADS)

Zhang, Xiaoming; Cui, Bin; Zhao, Mingwen; Liu, Feng

2018-02-01

A bridging topological state with a conventional semiconductor platform offers an attractive route towards future spintronics and quantum device applications. Here, based on first-principles and tight-binding calculations, we demonstrate the existence of topological states hosted by a two-dimensional (2D) metal alloy in a Si surface, the BiAg/Si(111)-4 ×4 surface, which has already been synthesized experimentally. It exhibits a topological insulating state with an energy gap of 71 meV (˜819 K ) above the Fermi level and a topological metallic state with quasiquantized conductance below the Fermi level. The underlying mechanism leading to the formation of such nontrivial states is revealed by analysis of the "charge-transfer" and "orbital-filtering" effect of the Si substrate. A minimal effective tight-binding model is employed to reveal the formation mechanism of the topological states. Our finding opens opportunities to detect topological states and measure its quantized conductance in a large family of 2D surface metal alloys, which have been or are to be grown on semiconductor substrates.

Band gap engineering in finite elongated graphene nanoribbon heterojunctions: Tight-binding model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tayo, Benjamin O.

2015-08-15

A simple model based on the divide and conquer rule and tight-binding (TB) approximation is employed for studying the role of finite size effect on the electronic properties of elongated graphene nanoribbon (GNR) heterojunctions. In our model, the GNR heterojunction is divided into three parts: a left (L) part, middle (M) part, and right (R) part. The left part is a GNR of width W{sub L}, the middle part is a GNR of width W{sub M}, and the right part is a GNR of width W{sub R}. We assume that the left and right parts of the GNR heterojunction interactmore » with the middle part only. Under this approximation, the Hamiltonian of the system can be expressed as a block tridiagonal matrix. The matrix elements of the tridiagonal matrix are computed using real space nearest neighbor orthogonal TB approximation. The electronic structure of the GNR heterojunction is analyzed by computing the density of states. We demonstrate that for heterojunctions for which W{sub L} = W{sub R}, the band gap of the system can be tuned continuously by varying the length of the middle part, thus providing a new approach to band gap engineering in GNRs. Our TB results were compared with calculations employing divide and conquer rule in combination with density functional theory (DFT) and were found to agree nicely.« less

First-principles simulation and low-energy effective modeling of three-dimensional skyrmion in MnGe

NASA Astrophysics Data System (ADS)

Choi, Hongchul; Tai, Yuan-Yen; Zhu, Jian-Xin; T-4 Team

The skyrmion spin textures are mostly observed in two-dimensional (2D) space, which can be topologically mapped onto the surface of the sphere with an integer multiple of topological winding number. Recently, MnGe has been reported as a candidate of 3D skyrmion crystal, showing the variation of the skyrmion size along the z-direction. We have performed the first-principles simulation and constructed a tight-binding model with calculated electronic-structure information to investigate the 3D skyrmion phase in MnGe. Our first-principles study within density functional theory shows that the calculated magnetic moment is larger than that for MnSi (with different lattice constant), implying the possibility of a multiple magnetic transition under pressure. We have also found that the small-sized skyrmion could be stabilized in a 2D structure. Such a high density of the skyrmion is in good agreement with the experimental finding of large topological Hall effect. Finally, we will extend our study to consider the 3D skyrmion structure based on the constructed tight-binding model. This work was carried out under the auspices of the National Nuclear Security Administration of the U.S. Department of Energy at Los Alamos National Laboratory (LANL) under Contract No. DE-AC52-06NA25396, and was supported by the LANL LDRD Program.

A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

USDA-ARS?s Scientific Manuscript database

The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

PubMed Central

2011-01-01

Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

Electronic Spectrum of Twisted Graphene Layers under Heterostrain

NASA Astrophysics Data System (ADS)

Huder, Loïc; Artaud, Alexandre; Le Quang, Toai; de Laissardière, Guy Trambly; Jansen, Aloysius G. M.; Lapertot, Gérard; Chapelier, Claude; Renard, Vincent T.

2018-04-01

We demonstrate that stacking layered materials allows a strain engineering where each layer is strained independently, which we call heterostrain. We combine detailed structural and spectroscopic measurements with tight-binding calculations to show that small uniaxial heterostrain suppresses Dirac cones and leads to the emergence of flat bands in twisted graphene layers (TGLs). Moreover, we demonstrate that heterostrain reconstructs, much more severely, the energy spectrum of TGLs than homostrain for which both layers are strained identically, a result which should apply to virtually all van der Waals structures opening exciting possibilities for straintronics with 2D materials.

First Experimental Realization of the Dirac Oscillator

NASA Astrophysics Data System (ADS)

Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

2013-10-01

We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

DFTB+ and lanthanides

NASA Astrophysics Data System (ADS)

Hourahine, B.; Aradi, B.; Frauenheim, T.

2010-07-01

DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

NASA Astrophysics Data System (ADS)

Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

Scattering matrix of arbitrary tight-binding Hamiltonians

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

2017-03-15

A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

PubMed Central

Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

2008-01-01

Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

Carbon Nanotube Field Emission Arrays

DTIC Science & Technology

2011-06-01

K , and M [14]. Using the tight binding energy model, the energy dispersion relations for graphene can be calculated for the triangle formed from...The corresponding reciprocal lattice vectors, b1 and b2, and Brillouin zone of graphene [14]. 19 graphene band structure is the six K ...points where the two bands are degenerate and the Fermi level passes. It has been shown through thorough calculations that at T = 0 K , the density

Various Stone-Wales defects in phagraphene

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2016-08-01

Various Stone-Wales defects in phagraphene, which is a graphene allotrope, predicted recently are studied in terms of the nonorthogonal tight-binding model. The energies of the defect formation and the heights of energy barriers preventing the formation and annealing of the defects are found. Corresponding frequency factors in the Arrhenius formula are calculated. The evolution of the defect structure is studied in the real-time mode using the molecular dynamics method.

Maximally localized Wannier functions in LaMnO3 within PBE + U, hybrid functionals and partially self-consistent GW: an efficient route to construct ab initio tight-binding parameters for eg perovskites.

PubMed

Franchini, C; Kováčik, R; Marsman, M; Murthy, S Sathyanarayana; He, J; Ederer, C; Kresse, G

2012-06-13

Using the newly developed VASP2WANNIER90 interface we have constructed maximally localized Wannier functions (MLWFs) for the e(g) states of the prototypical Jahn-Teller magnetic perovskite LaMnO(3) at different levels of approximation for the exchange-correlation kernel. These include conventional density functional theory (DFT) with and without the additional on-site Hubbard U term, hybrid DFT and partially self-consistent GW. By suitably mapping the MLWFs onto an effective e(g) tight-binding (TB) Hamiltonian we have computed a complete set of TB parameters which should serve as guidance for more elaborate treatments of correlation effects in effective Hamiltonian-based approaches. The method-dependent changes of the calculated TB parameters and their interplay with the electron-electron (el-el) interaction term are discussed and interpreted. We discuss two alternative model parameterizations: one in which the effects of the el-el interaction are implicitly incorporated in the otherwise 'noninteracting' TB parameters and a second where we include an explicit mean-field el-el interaction term in the TB Hamiltonian. Both models yield a set of tabulated TB parameters which provide the band dispersion in excellent agreement with the underlying ab initio and MLWF bands.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Interface Schottky barrier engineering via strain in metal-semiconductor composites

NASA Astrophysics Data System (ADS)

Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

2016-01-01

The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

Nonlocal Gilbert damping tensor within the torque-torque correlation model

NASA Astrophysics Data System (ADS)

Thonig, Danny; Kvashnin, Yaroslav; Eriksson, Olle; Pereiro, Manuel

2018-01-01

An essential property of magnetic devices is the relaxation rate in magnetic switching, which depends strongly on the damping in the magnetization dynamics. It was recently measured that damping depends on the magnetic texture and, consequently, is a nonlocal quantity. The damping enters the Landau-Lifshitz-Gilbert equation as the phenomenological Gilbert damping parameter α , which does not, in a straightforward formulation, account for nonlocality. Efforts were spent recently to obtain Gilbert damping from first principles for magnons of wave vector q . However, to the best of our knowledge, there is no report about real-space nonlocal Gilbert damping αi j. Here, a torque-torque correlation model based on a tight-binding approach is applied to the bulk elemental itinerant magnets and it predicts significant off-site Gilbert damping contributions, which could be also negative. Supported by atomistic magnetization dynamics simulations, we reveal the importance of the nonlocal Gilbert damping in atomistic magnetization dynamics. This study gives a deeper understanding of the dynamics of the magnetic moments and dissipation processes in real magnetic materials. Ways of manipulating nonlocal damping are explored, either by temperature, materials doping, or strain.

Functionalized Fullerene Targeting Human Voltage-Gated Sodium Channel, hNav1.7.

PubMed

Hilder, Tamsyn A; Robinson, Anna; Chung, Shin-Ho

2017-08-16

Mutations of hNa v 1.7 that cause its activities to be enhanced contribute to severe neuropathic pain. Only a small number of hNa v 1.7 specific inhibitors have been identified, most of which interact with the voltage-sensing domain of the voltage-activated sodium ion channel. In our previous computational study, we demonstrated that a [Lys 6 ]-C 84 fullerene binds tightly (affinity of 46 nM) to Na v Ab, the voltage-gated sodium channel from the bacterium Arcobacter butzleri. Here, we extend this work and, using molecular dynamics simulations, demonstrate that the same [Lys 6 ]-C 84 fullerene binds strongly (2.7 nM) to the pore of a modeled human sodium ion channel hNa v 1.7. In contrast, the fullerene binds only weakly to a mutated model of hNa v 1.7 (I1399D) (14.5 mM) and a model of the skeletal muscle hNa v 1.4 (3.7 mM). Comparison of one representative sequence from each of the nine human sodium channel isoforms shows that only hNa v 1.7 possesses residues that are critical for binding the fullerene derivative and blocking the channel pore.

Ph-Dependent Inhibition of Voltage-Gated H+ Currents in Rat Alveolar Epithelial Cells by Zn2+ and Other Divalent Cations

PubMed Central

Cherny, Vladimir V.; DeCoursey, Thomas E.

1999-01-01

Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017

Loose coupling in the bacterial flagellar motor

PubMed Central

Boschert, Ryan; Adler, Frederick R.; Blair, David F.

2015-01-01

Physiological properties of the flagellar rotary motor have been taken to indicate a tightly coupled mechanism in which each revolution is driven by a fixed number of energizing ions. Measurements that would directly test the tight-coupling hypothesis have not been made. Energizing ions flow through membrane-bound complexes formed from the proteins MotA and MotB, which are anchored to the cell wall and constitute the stator. Genetic and biochemical evidence points to a “power stroke” mechanism in which the ions interact with an aspartate residue of MotB to drive conformational changes in MotA that are transmitted to the rotor protein FliG. Each stator complex contains two separate ion-binding sites, raising the question of whether the power stroke is driven by one, two, or either number of ions. Here, we describe simulations of a model in which the conformational change can be driven by either one or two ions. This loosely coupled model can account for the observed physiological properties of the motor, including those that have been taken to indicate tight coupling; it also accords with recent measurements of motor torque at high load that are harder to explain in tight-coupling models. Under loads relevant to a swimming cell, the loosely coupled motor would perform about as well as a two-proton motor and significantly better than a one-proton motor. The loosely coupled motor is predicted to be especially advantageous under conditions of diminished energy supply, or of reduced temperature, turning faster than an obligatorily two-proton motor while using fewer ions. PMID:25825730

Trans-polyacetylene within the extended tight-binding picture and evidence for next-nearest neighbour hopping from the dispersion of interband transition edges

NASA Astrophysics Data System (ADS)

Drechsler, S. L.; Heiner, E.; Osipov, V. A.

1986-11-01

The influence of additional non-nearest neighbour hopping processes is investigated in a SSH-like model. The enhanced splitting of absorption peaks due to Π-Π ∗ interband transitions (deduced from new electron loss data of Fink and Leising /17/) can be explained by a reasonable value of the next-nearest neighbour hopping integral |t 2| ≈0.05 t 0.

Predicting Electrostatic Forces in RNA Folding

PubMed Central

Tan, Zhi-Jie; Chen, Shi-Jie

2016-01-01

Metal ion-mediated electrostatic interactions are critical to RNA folding. Although considerable progress has been made in mechanistic studies, the problem of accurate predictions for the ion effects in RNA folding remains unsolved, mainly due to the complexity of several potentially important issues such as ion correlation and dehydration effects. In this chapter, after giving a brief overview of the experimental findings and theoretical approaches, we focus on a recently developed new model, the tightly bound ion (TBI) model, for ion electrostatics in RNA folding. The model is unique because it can treat ion correlation and fluctuation effects for realistic RNA 3D structures. For monovalent ion (such as Na+) solutions, where ion correlation is weak, TBI and the Poisson–Boltzmann (PB) theory give the same results and the results agree with the experimental data. For multivalent ion (such as Mg2+) solutions, where ion correlation can be strong, however, TBI gives much improved predictions than the PB. Moreover, the model suggests an ion correlation- induced mechanism for the unusual efficiency of Mg2+ ions in the stabilization of RNA tertiary folds. In this chapter, after introducing the theoretical framework of the TBI model, we will describe how to apply the model to predict ion-binding properties and ion-dependent folding stabilities. PMID:20946803

Dynamical Reduction of the Dimensionality of Exchange Interactions and the "Spin-Liquid" Phase of κ-(BEDT-TTF)_{2}X.

PubMed

Powell, B J; Kenny, E P; Merino, J

2017-08-25

We show that the anisotropy of the effective spin model for the dimer Mott insulator phase of κ-(BEDT-TTF)_{2}X salts is dramatically different from that of the underlying tight-binding model. Intradimer quantum interference results in a model of coupled spin chains, where frustrated interchain interactions suppress long-range magnetic order. Thus, we argue, the "spin liquid" phase observed in some of these materials is a remnant of the Tomonaga-Luttinger physics of a single chain. This is consistent with previous experiments and resolves some outstanding puzzles.

Interactions of Kid-Kis toxin-antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid-Kis oligomers.

PubMed

Monti, Maria C; Hernández-Arriaga, Ana M; Kamphuis, Monique B; López-Villarejo, Juan; Heck, Albert J R; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H H

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin-antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid-kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid-Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2-Kis2-Kid2-Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2-Kis2-Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2-Kis2)n complexes repress the kid-kis operon.

An improved method for predicting brittleness of rocks via well logs in tight oil reservoirs

NASA Astrophysics Data System (ADS)

Wang, Zhenlin; Sun, Ting; Feng, Cheng; Wang, Wei; Han, Chuang

2018-06-01

There can be no industrial oil production in tight oil reservoirs until fracturing is undertaken. Under such conditions, the brittleness of the rocks is a very important factor. However, it has so far been difficult to predict. In this paper, the selected study area is the tight oil reservoirs in Lucaogou formation, Permian, Jimusaer sag, Junggar basin. According to the transformation of dynamic and static rock mechanics parameters and the correction of confining pressure, an improved method is proposed for quantitatively predicting the brittleness of rocks via well logs in tight oil reservoirs. First, 19 typical tight oil core samples are selected in the study area. Their static Young’s modulus, static Poisson’s ratio and petrophysical parameters are measured. In addition, the static brittleness indices of four other tight oil cores are measured under different confining pressure conditions. Second, the dynamic Young’s modulus, Poisson’s ratio and brittleness index are calculated using the compressional and shear wave velocity. With combination of the measured and calculated results, the transformation model of dynamic and static brittleness index is built based on the influence of porosity and clay content. The comparison of the predicted brittleness indices and measured results shows that the model has high accuracy. Third, on the basis of the experimental data under different confining pressure conditions, the amplifying factor of brittleness index is proposed to correct for the influence of confining pressure on the brittleness index. Finally, the above improved models are applied to formation evaluation via well logs. Compared with the results before correction, the results of the improved models agree better with the experimental data, which indicates that the improved models have better application effects. The brittleness index prediction method of tight oil reservoirs is improved in this research. It is of great importance in the optimization of fracturing layer and fracturing construction schemes and the improvement of oil recovery.

Non-specific binding of Na+ and Mg2+ to RNA determined by force spectroscopy methods

PubMed Central

Bizarro, C. V.; Alemany, A.; Ritort, F.

2012-01-01

RNA duplex stability depends strongly on ionic conditions, and inside cells RNAs are exposed to both monovalent and multivalent ions. Despite recent advances, we do not have general methods to quantitatively account for the effects of monovalent and multivalent ions on RNA stability, and the thermodynamic parameters for secondary structure prediction have only been derived at 1M [Na+]. Here, by mechanically unfolding and folding a 20 bp RNA hairpin using optical tweezers, we study the RNA thermodynamics and kinetics at different monovalent and mixed monovalent/Mg2+ salt conditions. We measure the unfolding and folding rupture forces and apply Kramers theory to extract accurate information about the hairpin free energy landscape under tension at a wide range of ionic conditions. We obtain non-specific corrections for the free energy of formation of the RNA hairpin and measure how the distance of the transition state to the folded state changes with force and ionic strength. We experimentally validate the Tightly Bound Ion model and obtain values for the persistence length of ssRNA. Finally, we test the approximate rule by which the non-specific binding affinity of divalent cations at a given concentration is equivalent to that of monovalent cations taken at 100-fold concentration for small molecular constructs. PMID:22492710

DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

PubMed

Gaus, Michael; Cui, Qiang; Elstner, Marcus

2012-04-10

The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.

Z2Pack: Numerical implementation of hybrid Wannier centers for identifying topological materials

NASA Astrophysics Data System (ADS)

Gresch, Dominik; Autès, Gabriel; Yazyev, Oleg V.; Troyer, Matthias; Vanderbilt, David; Bernevig, B. Andrei; Soluyanov, Alexey A.

2017-02-01

The intense theoretical and experimental interest in topological insulators and semimetals has established band structure topology as a fundamental material property. Consequently, identifying band topologies has become an important, but often challenging, problem, with no exhaustive solution at the present time. In this work we compile a series of techniques, some previously known, that allow for a solution to this problem for a large set of the possible band topologies. The method is based on tracking hybrid Wannier charge centers computed for relevant Bloch states, and it works at all levels of materials modeling: continuous k .p models, tight-binding models, and ab initio calculations. We apply the method to compute and identify Chern, Z2, and crystalline topological insulators, as well as topological semimetal phases, using real material examples. Moreover, we provide a numerical implementation of this technique (the Z2Pack software package) that is ideally suited for high-throughput screening of materials databases for compounds with nontrivial topologies. We expect that our work will allow researchers to (a) identify topological materials optimal for experimental probes, (b) classify existing compounds, and (c) reveal materials that host novel, not yet described, topological states.

Band structure and orbital character of monolayer MoS2 with eleven-band tight-binding model

NASA Astrophysics Data System (ADS)

Shahriari, Majid; Ghalambor Dezfuli, Abdolmohammad; Sabaeian, Mohammad

2018-02-01

In this paper, based on a tight-binding (TB) model, first we present the calculations of eigenvalues as band structure and then present the eigenvectors as probability amplitude for finding electron in atomic orbitals for monolayer MoS2 in the first Brillouin zone. In these calculations we are considering hopping processes between the nearest-neighbor Mo-S, the next nearest-neighbor in-plan Mo-Mo, and the next nearest-neighbor in-plan and out-of-plan S-S atoms in a three-atom based unit cell of two-dimensional rhombic MoS2. The hopping integrals have been solved in terms of Slater-Koster and crystal field parameters. These parameters are calculated by comparing TB model with the density function theory (DFT) in the high-symmetry k-points (i.e. the K- and Γ-points). In our TB model all the 4d Mo orbitals and the 3p S orbitals are considered and detailed analysis of the orbital character of each energy level at the main high-symmetry points of the Brillouin zone is described. In comparison with DFT calculations, our results of TB model show a very good agreement for bands near the Fermi level. However for other bands which are far from the Fermi level, some discrepancies between our TB model and DFT calculations are observed. Upon the accuracy of Slater-Koster and crystal field parameters, on the contrary of DFT, our model provide enough accuracy to calculate all allowed transitions between energy bands that are very crucial for investigating the linear and nonlinear optical properties of monolayer MoS2.

Mass spectrometry reveals that the antibiotic simocyclinone D8 binds to DNA gyrase in a "bent-over" conformation: evidence of positive cooperativity in binding.

PubMed

Edwards, Marcus J; Williams, Mark A; Maxwell, Anthony; McKay, Adam R

2011-05-03

DNA topoisomerases are enzymes that control DNA topology and are vital targets for antimicrobial and anticancer drugs. Here we present a mass spectrometry study of complexes formed between the A subunit of the topoisomerase DNA gyrase and the bifunctional inhibitor simocyclinone D8 (SD8), an antibiotic isolated from Streptomyces. These studies show that, in an alternative mode of interaction to that found by X-ray crystallography, each subunit binds a single bifunctional inhibitor with separate binding pockets for the two ends of SD8. The gyrase subunits form constitutive dimers, and fractional occupancies of inhibitor-bound states show that there is strong allosteric cooperativity in the binding of two bifunctional ligands to the dimer. We show that the mass spectrometry data can be fitted to a general model of cooperative binding via an extension of the "tight-binding" approach, providing a rigorous determination of the dissociation constants and degree of cooperativity. This general approach will be applicable to other systems with multiple binding sites and highlights mass spectrometry's role as a powerful emerging tool for unraveling the complexities of biomolecular interactions.

Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

2011-01-01

We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

Phonon-limited carrier mobility and resistivity from carbon nanotubes to graphene

NASA Astrophysics Data System (ADS)

Li, Jing; Miranda, Henrique Pereira Coutada; Niquet, Yann-Michel; Genovese, Luigi; Duchemin, Ivan; Wirtz, Ludger; Delerue, Christophe

2015-08-01

Under which conditions do the electrical transport properties of one-dimensional (1D) carbon nanotubes (CNTs) and 2D graphene become equivalent? We have performed atomistic calculations of the phonon-limited electrical mobility in graphene and in a wide range of CNTs of different types to address this issue. The theoretical study is based on a tight-binding method and a force-constant model from which all possible electron-phonon couplings are computed. The electrical resistivity of graphene is found in very good agreement with experiments performed at high carrier density. A common methodology is applied to study the transition from one to two dimensions by considering CNTs with diameter up to 16 nm. It is found that the mobility in CNTs of increasing diameter converges to the same value, i.e., the mobility in graphene. This convergence is much faster at high temperature and high carrier density. For small-diameter CNTs, the mobility depends strongly on chirality, diameter, and the existence of a band gap.

Charge Transport Properties of Durene Crystals from First-Principles.

PubMed

Motta, Carlo; Sanvito, Stefano

2014-10-14

We establish a rigorous computational scheme for constructing an effective Hamiltonian to be used for the determination of the charge carrier mobility of pure organic crystals at finite temperature, which accounts for van der Waals interactions, and it includes vibrational contributions from the entire phonon spectrum of the crystal. Such an approach is based on the ab initio framework provided by density functional theory and the construction of a tight-binding effective model via Wannier transformation. The final Hamiltonian includes coupling of the electrons to the crystals phonons, which are also calculated from density functional theory. We apply this methodology to the case of durene, a small π-conjugated molecule, which forms a high-mobility herringbone-stacked crystal. We show that accounting correctly for dispersive forces is fundamental for obtaining a high-quality phonon spectrum, in agreement with experiments. Then, the mobility as a function of temperature is calculated along different crystallographic directions and the phonons most responsible for the scattering are identified.

Spin-orbit effects on reflectance anisotropy spectroscopy of aclean CdTe(001) surface

NASA Astrophysics Data System (ADS)

Vázquez-Nava, Raül A.

2005-03-01

The spectroscopical reflectance anisotropy (RA) response of a clean (001) surface of CdTe, which exhibits a c(2 x2) surface reconstruction, is studied using a microscopic formulation based on a semi-empirical tight binding approach (SETB) which includes the spin-orbit (SO) interaction. Following Ref. 1, we apply an unitary transformation to the usual SETB sp^3s^* basis to describe the electronic states in terms of a set of atomic states which are eigenstates of the total angular momentum (TAM). These states are better suited to treat the SO interaction in this model, and their use in the computation of the RA signal is straightforward [1]. We show how the RA changes when SO is taken into account and compare our theoretical results with experimental measurements of Ref. 2. [1] R.A. V'azquez-Nava, B.S. Mendoza and C. Castillo, Phys. Rev. B 70, 165306 (2004). [2] J. R. Molina and R. Espinosa-Luna, J. Phys. D: Appl. Phys. (2004), accepted.

Spin Transfer torques in Antiferromagnets

NASA Astrophysics Data System (ADS)

Saidaoui, Hamed; Waintal, Xavier; Manchon, Aurelien; Spsms, Cea, Grenoble France Collaboration

2013-03-01

Spin Transfer Torque (STT) has attracted tremendously growing interest in the past two decades. Consisting on the transfer of spin angular momentum of a spin polarized current to local magnetic moments, the STT gives rise to a complex dynamics of the magnetization. Depending on the the structure, the STT shows a dominated In plane component for spin valves, whereas both components coexist for magnetic tunneling junctions (MTJ). For latter case the symmetry of the structure is considered to be decisive in identifying the nature and behavior of the torque. In the present study we are interested in magnetic structures where we substitute either one or both of the magnetic layers by antiferromagnets (AF). We use Non-equilibrium Green's function formalism applied on a tight-binding model to investigate the nature of the spin torque. We notice the presence of two types of torque exerted on (AF), a torque which tends to rotate the order parameter and another one that competes with the exchange interaction. We conclude by comparison with previous works.

Diverse magnetic quantization in bilayer silicene

NASA Astrophysics Data System (ADS)

Do, Thi-Nga; Shih, Po-Hsin; Gumbs, Godfrey; Huang, Danhong; Chiu, Chih-Wei; Lin, Ming-Fa

2018-03-01

The generalized tight-binding model is developed to investigate the rich and unique electronic properties of A B -bt (bottom-top) bilayer silicene under uniform perpendicular electric and magnetic fields. The first pair of conduction and valence bands, with an observable energy gap, displays unusual energy dispersions. Each group of conduction/valence Landau levels (LLs) is further classified into four subgroups, i.e., the sublattice- and spin-dominated LL subgroups. The magnetic-field-dependent LL energy spectra exhibit irregular behavior corresponding to the critical points of the band structure. Moreover, the electric field can induce many LL anticrossings. The main features of the LLs are uncovered with many van Hove singularities in the density-of-states and nonuniform delta-function-like peaks in the magnetoabsorption spectra. The feature-rich magnetic quantization directly reflects the geometric symmetries, intralayer and interlayer atomic interactions, spin-orbital couplings, and field effects. The results of this work can be applied to novel designs of Si-based nanoelectronics and nanodevices with enhanced mobilities.

Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

NASA Astrophysics Data System (ADS)

Tretiak, Sergei

2014-03-01

The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

Tight-binding chains with off-diagonal disorder: Bands of extended electronic states induced by minimal quasi-one-dimensionality

NASA Astrophysics Data System (ADS)

Nandy, Atanu; Pal, Biplab; Chakrabarti, Arunava

2016-08-01

It is shown that an entire class of off-diagonally disordered linear lattices composed of two basic building blocks and described within a tight-binding model can be tailored to generate absolutely continuous energy bands. It can be achieved if linear atomic clusters of an appropriate size are side-coupled to a suitable subset of sites in the backbone, and if the nearest-neighbor hopping integrals, in the backbone and in the side-coupled cluster, bear a certain ratio. We work out the precise relationship between the number of atoms in one of the building blocks in the backbone and that in the side attachment. In addition, we also evaluate the definite correlation between the numerical values of the hopping integrals at different subsections of the chain, that can convert an otherwise point spectrum (or a singular continuous one for deterministically disordered lattices) with exponentially (or power law) localized eigenfunctions to an absolutely continuous spectrum comprising one or more bands (subbands) populated by extended, totally transparent eigenstates. The results, which are analytically exact, put forward a non-trivial variation of the Anderson localization (Anderson P. W., Phys. Rev., 109 (1958) 1492), pointing towards its unusual sensitivity to the numerical values of the system parameters and, go well beyond the other related models such as the Random Dimer Model (RDM) (Dunlap D. H. et al., Phys. Rev. Lett., 65 (1990) 88).

Band nesting, massive Dirac fermions, and valley Landé and Zeeman effects in transition metal dichalcogenides: A tight-binding model

NASA Astrophysics Data System (ADS)

Bieniek, Maciej; Korkusiński, Marek; Szulakowska, Ludmiła; Potasz, Paweł; Ozfidan, Isil; Hawrylak, Paweł

2018-02-01

We present here the minimal tight-binding model for a single layer of transition metal dichalcogenides (TMDCs) MX 2(M , metal; X , chalcogen) which illuminates the physics and captures band nesting, massive Dirac fermions, and valley Landé and Zeeman magnetic field effects. TMDCs share the hexagonal lattice with graphene but their electronic bands require much more complex atomic orbitals. Using symmetry arguments, a minimal basis consisting of three metal d orbitals and three chalcogen dimer p orbitals is constructed. The tunneling matrix elements between nearest-neighbor metal and chalcogen orbitals are explicitly derived at K ,-K , and Γ points of the Brillouin zone. The nearest-neighbor tunneling matrix elements connect specific metal and sulfur orbitals yielding an effective 6 ×6 Hamiltonian giving correct composition of metal and chalcogen orbitals but not the direct gap at K points. The direct gap at K , correct masses, and conduction band minima at Q points responsible for band nesting are obtained by inclusion of next-neighbor Mo-Mo tunneling. The parameters of the next-nearest-neighbor model are successfully fitted to MX 2(M =Mo ; X =S ) density functional ab initio calculations of the highest valence and lowest conduction band dispersion along K -Γ line in the Brillouin zone. The effective two-band massive Dirac Hamiltonian for MoS2, Landé g factors, and valley Zeeman splitting are obtained.

Current Status and Future Prospects for Aptamer-Based Mycotoxin Detection.

PubMed

Ruscito, Annamaria; Smith, McKenzie; Goudreau, Daniel N; DeRosa, Maria C

2016-07-01

Aptamers are single-stranded oligonucleotides with the ability to bind tightly and selectively to a target analyte. High-affinity and specific aptamers for a variety of mycotoxins have been reported over the past decade. Increasingly, these molecular recognition elements are finding applications in biosensors and assays for the detection of mycotoxins in a variety of complex matrixes. This review article highlights the mycotoxin aptamers that are available for mycotoxin detection and the array of biosensing platforms into which they have been incorporated. Key advantages that aptamers have over analogous technology, and areas in which these advantages may be applied for the benefit of practical mycotoxin detection, are also discussed.

Spin-dependent transport in antiferromagnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Merodio, P.; Kalitsov, A.; Béa, H.; Baltz, V.; Chshiev, M.

2014-09-01

We investigate the behaviour of spin transfer torque (STT) and tunnelling magnetoresistance (TMR) in epitaxial antiferromagnetic-based tunnel junctions using tight binding calculations in the framework of the Keldysh formalism. We find that the STT out-of-plane component exhibits a staggered spatial distribution similar to its in-plane component. This behaviour is specific to the use of a tunnel barrier and significantly differs from the out-of-plane torques reported in previous works using a metallic spacer. Additionally, we show that unlike conventional ferromagnetic-based tunnel junctions, the TMR can increase with applied bias and reach values comparable to typical magnetoresistances found for usual spin valves.

Unconventional Tight Reservoirs Characterization with Nuclear Magnetic Resonance

NASA Astrophysics Data System (ADS)

Santiago, C. J. S.; Solatpour, R.; Kantzas, A.

2017-12-01

The increase in tight reservoir exploitation projects causes producing many papers each year on new, modern, and modified methods and techniques on estimating characteristics of these reservoirs. The most ambiguous of all basic reservoir property estimations deals with permeability. One of the logging methods that is advertised to predict permeability but is always met by skepticism is Nuclear Magnetic Resonance (NMR). The ability of NMR to differentiate between bound and movable fluids and providing porosity increased the capability of NMR as a permeability prediction technique. This leads to a multitude of publications and the motivation of a review paper on this subject by Babadagli et al. (2002). The first part of this presentation is dedicated to an extensive review of the existing correlation models for NMR based estimates of tight reservoir permeability to update this topic. On the second part, the collected literature information is used to analyze new experimental data. The data are collected from tight reservoirs from Canada, the Middle East, and China. A case study is created to apply NMR measurement in the prediction of reservoir characterization parameters such as porosity, permeability, cut-offs, irreducible saturations etc. Moreover, permeability correlations are utilized to predict permeability. NMR experiments were conducted on water saturated cores. NMR T2 relaxation times were measured. NMR porosity, the geometric mean relaxation time (T2gm), Irreducible Bulk Volume (BVI), and Movable Bulk Volume (BVM) were calculated. The correlation coefficients were computed based on multiple regression analysis. Results are cross plots of NMR permeability versus the independently measured Klinkenberg corrected permeability. More complicated equations are discussed. Error analysis of models is presented and compared. This presentation is beneficial in understanding existing tight reservoir permeability models. The results can be used as a guide for choosing the best permeability estimation model for tight reservoirs data.

Proton transfer along water bridges in biological systems with density-functional tight-binding

NASA Astrophysics Data System (ADS)

Reiss, Krystle; Wise, Abigail; Mazzuca, James

2015-03-01

When examining the dynamics of charge transfer in high dimensional enzymatic systems, the cost of quantum mechanical treatment of electrons increases exponentially with the size of the system. As a semi-empirical method, density-functional tight-binding aids in shortening these calculation times, but can be inaccurate in the regime where bonds are being formed and broken. To address these inaccuracies with respect to proton transfer in an enzymatic system, DFTB is being used to calculate small model systems containing only a single amino acid residue donor, represented by an imidazole molecule, and a water acceptor. When DFTB calculations are compared to B3LYP geometry calculations of the donor molecule, we observe a bond angle error on the order of 1.2 degrees and a bond length error on the order of 0.011 Å. As we move forward with small donor-acceptor systems, comparisons between DFTB and B3LYP energy profiles will provide a better clue as to what extent improvements need to be made. To improve the accuracy of the DFTB calculations, the internuclear repulsion term may be altered. This would result in energy profiles that closely resemble those produced by higher-level theory. Alma College Provost's Office.

Studying the hopping parameters of half-Heusler NaAuS using maximally localized Wannier function

NASA Astrophysics Data System (ADS)

Sihi, Antik; Lal, Sohan; Pandey, Sudhir K.

2018-04-01

Here, the electronic behavior of half-Heusler NaAuS is studied using PBEsol exchange correlation functional by plotting the band structure curve. These bands are reproduced using maximally localized Wannier function using WANNIER90. Tight-binding bands are nicely matched with density functional theory bands. By fitting the tight-binding model, hopping parameter for NaAuS is obtained by including Na 2s, 2p, Au 6s, 5p, 5d and S 3s, 3p orbitals within the energy interval of -5 to 16 eV around the Fermi level. In present study, hopping integrals for NaAuS are computed for the first primitive unit cell atoms as well as the first nearest neighbor primitive unit cell. The most dominating hopping integrals are found for Na (3s) - S (3s), Na (2px) - S (2px), Au (6s) - S (3px), Au (6s) - S (3py) and Au (6s) - S (3pz) orbitals. The hopping integrals for the first nearest neighbor primitive unit cell are also discussed in this manuscript. In future, these hopping integrals are very important to find the topological invariant for NaAuS compound.

Fracking, fracture, and permeability

NASA Astrophysics Data System (ADS)

Turcotte, D. L.; Norris, J.; Rundle, J. B.

2013-12-01

Injections of large volumes of water into tight shale reservoirs allows the extraction of oil and gas not previously accessible. This large volume 'super' fracking induces damage that allows the oil and/or gas to flow to an extraction well. The purpose of this paper is to provide a model for understanding super fracking. We assume that water is injected from a small spherical cavity into a homogeneous elastic medium. The high pressure of the injected water generates hoop stresses that reactivate natural fractures in the tight shales. These fractures migrate outward as water is added creating a spherical shell of damaged rock. The porosity associated with these fractures is equal to the water volume injected. We obtain an analytic expression for this volume. We apply our model to a typical tight shale reservoir and show that the predicted water volumes are in good agreement with the volumes used in super fracking.

Effect of disorder on the optical properties of short period superlattices

NASA Technical Reports Server (NTRS)

Strozier, J. A.; Zhang, Y. A.; Horton, C.; Ignatiev, A.; Shih, H. D.

1993-01-01

The optical properties of disordered short period superlattices are studied using a one-dimensional tight-binding model. A difference vector and disorder structure factor are proposed to characterize the disordered superlattice. The density of states, participation number, and optical absorption coefficients for both ordered and disordered superlattices are calculated as a function of energy. The results show that introduction of disorder into an indirect band gap material enhances the optical transition near the indirect band edge.

Quasi-bound states in strained graphene

NASA Astrophysics Data System (ADS)

Bahamon, Dario; Qi, Zenan; Park, Harold; Pareira, Vitor; Campbell, David

In this work, we explore the possibility of manipulating electronic states in graphene nanostructures by mechanical means. Specifically, we use molecular dynamics and tight-binding models to access the electronic and transport properties of strained graphene nanobubbles and graphene kirigami. We establish that low energy electrons can be confined in the arms of the kirigami and within the nanobubbles; under different load conditions the coupling between confined states and continuous states is modified creating different conductance line-shapes.

Electron doping effects on the electrical conductivity of zigzag carbon nanotubes and corresponding unzipped armchair graphene nanoribbons

NASA Astrophysics Data System (ADS)

Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek

2017-10-01

The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.

Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

PubMed

Sattonnay, G; Tétot, R

2014-02-05

Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.

Structure of an E. coli integral membrane sulfurtransferase and its structural transition upon SCN− binding defined by EPR-based hybrid method

PubMed Central

Ling, Shenglong; Wang, Wei; Yu, Lu; Peng, Junhui; Cai, Xiaoying; Xiong, Ying; Hayati, Zahra; Zhang, Longhua; Zhang, Zhiyong; Song, Likai; Tian, Changlin

2016-01-01

Electron paramagnetic resonance (EPR)-based hybrid experimental and computational approaches were applied to determine the structure of a full-length E. coli integral membrane sulfurtransferase, dimeric YgaP, and its structural and dynamic changes upon ligand binding. The solution NMR structures of the YgaP transmembrane domain (TMD) and cytosolic catalytic rhodanese domain were reported recently, but the tertiary fold of full-length YgaP was not yet available. Here, systematic site-specific EPR analysis defined a helix-loop-helix secondary structure of the YagP-TMD monomers using mobility, accessibility and membrane immersion measurements. The tertiary folds of dimeric YgaP-TMD and full-length YgaP in detergent micelles were determined through inter- and intra-monomer distance mapping and rigid-body computation. Further EPR analysis demonstrated the tight packing of the two YgaP second transmembrane helices upon binding of the catalytic product SCN−, which provides insight into the thiocyanate exportation mechanism of YgaP in the E. coli membrane. PMID:26817826

The relationship between water binding and desiccation tolerance in tissues

NASA Technical Reports Server (NTRS)

Vertucci, C. W.; Leopold, A. C.

1987-01-01

In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

PubMed

Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

Understanding the length dependence of molecular junction thermopower.

PubMed

Karlström, Olov; Strange, Mikkel; Solomon, Gemma C

2014-01-28

Thermopower of molecular junctions is sensitive to details in the junction and may increase, decrease, or saturate with increasing chain length, depending on the system. Using McConnell's theory for exponentially suppressed transport together with a simple and easily interpretable tight binding model, we show how these different behaviors depend on the molecular backbone and its binding to the contacts. We distinguish between resonances from binding groups or undercoordinated electrode atoms, and those from the periodic backbone. It is demonstrated that while the former gives a length-independent contribution to the thermopower, possibly changing its sign, the latter determines its length dependence. This means that the question of which orbitals from the periodic chain that dominate the transport should not be inferred from the sign of the thermopower but from its length dependence. We find that the same molecular backbone can, in principle, show four qualitatively different thermopower trends depending on the binding group: It can be positive or negative for short chains, and it can either increase or decrease with length.

A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.

PubMed

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

2016-01-01

Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

Time-dependent density-functional tight-binding method with the third-order expansion of electron density

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

PubMed

Nishimoto, Yoshio

2015-09-07

We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

Weak partitioning chromatography for anion exchange purification of monoclonal antibodies.

PubMed

Kelley, Brian D; Tobler, Scott A; Brown, Paul; Coffman, Jonathan L; Godavarti, Ranga; Iskra, Timothy; Switzer, Mary; Vunnum, Suresh

2008-10-15

Weak partitioning chromatography (WPC) is an isocratic chromatographic protein separation method performed under mobile phase conditions where a significant amount of the product protein binds to the resin, well in excess of typical flowthrough operations. The more stringent load and wash conditions lead to improved removal of more tightly binding impurities, although at the cost of a reduction in step yield. The step yield can be restored by extending the column load and incorporating a short wash at the end of the load stage. The use of WPC with anion exchange resins enables a two-column cGMP purification platform to be used for many different mAbs. The operating window for WPC can be easily established using high throughput batch-binding screens. Under conditions that favor very strong product binding, competitive effects from product binding can give rise to a reduction in column loading capacity. Robust performance of WPC anion exchange chromatography has been demonstrated in multiple cGMP mAb purification processes. Excellent clearance of host cell proteins, leached Protein A, DNA, high molecular weight species, and model virus has been achieved. (c) 2008 Wiley Periodicals, Inc.

Modeling direct interband tunneling. II. Lower-dimensional structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Andrew, E-mail: pandrew@ucla.edu; Chui, Chi On; California NanoSystems Institute, University of California, Los Angeles, Los Angeles, California 90095

We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.

Superresolution imaging of transcription units on newt lampbrush chromosomes

PubMed Central

Kaufmann, Rainer; Cremer, Christoph; Gall, Joseph G.

2013-01-01

We have examined transcription loops on lampbrush chromosomes of the newt Notophthalmus by superresolution microscopy. Because of the favorable, essentially two-dimensional morphology of these loops, an average optical resolution in the x-y plane of about 50 nm was achieved. We analyzed the distribution of the multifunctional RNA-binding protein CELF1 on specific loops. CELF1 distribution is consistent with a model in which individual transcripts are tightly folded and hence closely packed against the loop axis. PMID:22892678

Chemically Doped Double-Walled Carbon Nanotubes: Cylindrical Molecular Capacitors

NASA Astrophysics Data System (ADS)

Chen, Gugang; Bandow, S.; Margine, E. R.; Nisoli, C.; Kolmogorov, A. N.; Crespi, Vincent H.; Gupta, R.; Sumanasekera, G. U.; Iijima, S.; Eklund, P. C.

2003-06-01

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

Chemically doped double-walled carbon nanotubes: cylindrical molecular capacitors.

PubMed

Chen, Gugang; Bandow, S; Margine, E R; Nisoli, C; Kolmogorov, A N; Crespi, Vincent H; Gupta, R; Sumanasekera, G U; Iijima, S; Eklund, P C

2003-06-27

A double-walled carbon nanotube is used to study the radial charge distribution on the positive inner electrode of a cylindrical molecular capacitor. The outer electrode is a shell of bromine anions. Resonant Raman scattering from phonons on each carbon shell reveals the radial charge distribution. A self-consistent tight-binding model confirms the observed molecular Faraday cage effect, i.e., most of the charge resides on the outer wall, even when this wall was originally semiconducting and the inner wall was metallic.

Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

PubMed

Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

2014-10-28

Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

NASA Astrophysics Data System (ADS)

de Moura, F. A. B. F.; Lyra, M. L.; de Almeida, M. L.; Ourique, G. S.; Fulco, U. L.; Albuquerque, E. L.

2016-10-01

We determine, by using a tight-binding model Hamiltonian, the characteristic current-voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation.

Interactions of Kid–Kis toxin–antitoxin complexes with the parD operator-promoter region of plasmid R1 are piloted by the Kis antitoxin and tuned by the stoichiometry of Kid–Kis oligomers

PubMed Central

Monti, Maria C.; Hernández-Arriaga, Ana M.; Kamphuis, Monique B.; López-Villarejo, Juan; Heck, Albert J. R.; Boelens, Rolf; Díaz-Orejas, Ramón; van den Heuvel, Robert H. H.

2007-01-01

The parD operon of Escherichia coli plasmid R1 encodes a toxin–antitoxin system, which is involved in plasmid stabilization. The toxin Kid inhibits cell growth by RNA degradation and its action is neutralized by the formation of a tight complex with the antitoxin Kis. A fascinating but poorly understood aspect of the kid–kis system is its autoregulation at the transcriptional level. Using macromolecular (tandem) mass spectrometry and DNA binding assays, we here demonstrate that Kis pilots the interaction of the Kid–Kis complex in the parD regulatory region and that two discrete Kis-binding regions are present on parD. The data clearly show that only when the Kis concentration equals or exceeds the Kid concentration a strong cooperative effect exists between strong DNA binding and Kid2–Kis2–Kid2–Kis2 complex formation. We propose a model in which transcriptional repression of the parD operon is tuned by the relative molar ratio of the antitoxin and toxin proteins in solution. When the concentration of the toxin exceeds that of the antitoxin tight Kid2–Kis2–Kid2 complexes are formed, which only neutralize the lethal activity of Kid. Upon increasing the Kis concentration, (Kid2–Kis2)n complexes repress the kid–kis operon. PMID:17317682

Tight junctions negatively regulate mechanical forces applied to adherens junctions in vertebrate epithelial tissue.

PubMed

Hatte, Guillaume; Prigent, Claude; Tassan, Jean-Pierre

2018-02-05

Epithelia are layers of polarised cells tightly bound to each other by adhesive contacts. Epithelia act as barriers between an organism and its external environment. Understanding how epithelia maintain their essential integrity while remaining sufficiently plastic to allow events such as cytokinesis to take place is a key biological problem. In vertebrates, the remodelling and reinforcement of adherens junctions maintains epithelial integrity during cytokinesis. The involvement of tight junctions in cell division, however, has remained unexplored. Here, we examine the role of tight junctions during cytokinesis in the epithelium of the Xenopus laevis embryo. Depletion of the tight junction-associated proteins ZO-1 and GEF-H1 leads to altered cytokinesis duration and contractile ring geometry. Using a tension biosensor, we show that cytokinesis defects originate from misregulation of tensile forces applied to adherens junctions. Our results reveal that tight junctions regulate mechanical tension applied to adherens junctions, which in turn impacts cytokinesis.This article has an associated First Person interview with the first author of the paper. © 2018. Published by The Company of Biologists Ltd.

Simulation of a multistage fractured horizontal well in a water-bearing tight fractured gas reservoir under non-Darcy flow

NASA Astrophysics Data System (ADS)

Zhang, Rui-Han; Zhang, Lie-Hui; Wang, Rui-He; Zhao, Yu-Long; Huang, Rui

2018-06-01

Reservoir development for unconventional resources such as tight gas reservoirs is in increasing demand due to the rapid decline of production in conventional reserves. Compared with conventional reservoirs, fluid flow in water-bearing tight gas reservoirs is subject to more nonlinear multiphase flow and gas slippage in nano/micro matrix pores because of the strong collisions between rock and gas molecules. Economic gas production from tight gas reservoirs depends on extensive application of water-based hydraulic fracturing of horizontal wells, associated with non-Darcy flow at a high flow rate, geomechanical stress sensitivity of un-propped natural fractures, complex flow geometry and multiscale heterogeneity. How to efficiently and accurately predict the production performance of a multistage fractured horizontal well (MFHW) is challenging. In this paper, a novel multicontinuum, multimechanism, two-phase simulator is established based on unstructured meshes and the control volume finite element method to analyze the production performance of MFHWs. The multiple interacting continua model and discrete fracture model are coupled to integrate the unstimulated fractured reservoir, induced fracture networks (stimulated reservoir volumes, SRVs) and irregular discrete hydraulic fractures. Several simulations and sensitivity analyses are performed with the developed simulator for determining the key factors affecting the production performance of MFHWs. Two widely applied fracturing models, classic hydraulic fracturing which generates long double-wing fractures and the volumetric fracturing aimed at creating large SRVs, are compared to identify which of them can make better use of tight gas reserves.

iAID: an improved auxin-inducible degron system for the construction of a 'tight' conditional mutant in the budding yeast Saccharomyces cerevisiae.

PubMed

Tanaka, Seiji; Miyazawa-Onami, Mayumi; Iida, Tetsushi; Araki, Hiroyuki

2015-08-01

Isolation of a 'tight' conditional mutant of a gene of interest is an effective way of studying the functions of essential genes. Strategies that use ubiquitin-mediated protein degradation to eliminate the product of a gene of interest, such as heat-inducible degron (td) and auxin-inducible degron (AID), are powerful methods for constructing conditional mutants. However, these methods do not work with some genes. Here, we describe an improved AID system (iAID) for isolating tight conditional mutants in the budding yeast Saccharomyces cerevisiae. In this method, transcriptional repression by the 'Tet-OFF' promoter is combined with proteolytic elimination of the target protein by the AID system. To provide examples, we describe the construction of tight mutants of the replication factors Dpb11 and Mcm10, dpb11-iAID, and mcm10-iAID. Because Dpb11 and Mcm10 are required for the initiation of DNA replication, their tight mutants are unable to enter S phase. This is the case for dpb11-iAID and mcm10-iAID cells after the addition of tetracycline and auxin. Both the 'Tet-OFF' promoter and the AID system have been shown to work in model eukaryotes other than budding yeast. Therefore, the iAID system is not only useful in budding yeast, but also can be applied to other model systems to isolate tight conditional mutants. Copyright © 2015 John Wiley & Sons, Ltd.

Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

PubMed

Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

2017-12-01

Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

PubMed Central

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-01-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

PubMed

Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

2013-06-01

RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

Predicting permanent and transient protein-protein interfaces.

PubMed

La, David; Kong, Misun; Hoffman, William; Choi, Youn Im; Kihara, Daisuke

2013-05-01

Protein-protein interactions (PPIs) are involved in diverse functions in a cell. To optimize functional roles of interactions, proteins interact with a spectrum of binding affinities. Interactions are conventionally classified into permanent and transient, where the former denotes tight binding between proteins that result in strong complexes, whereas the latter compose of relatively weak interactions that can dissociate after binding to regulate functional activity at specific time point. Knowing the type of interactions has significant implications for understanding the nature and function of PPIs. In this study, we constructed amino acid substitution models that capture mutation patterns at permanent and transient type of protein interfaces, which were found to be different with statistical significance. Using the substitution models, we developed a novel computational method that predicts permanent and transient protein binding interfaces (PBIs) in protein surfaces. Without knowledge of the interacting partner, the method uses a single query protein structure and a multiple sequence alignment of the sequence family. Using a large dataset of permanent and transient proteins, we show that our method, BindML+, performs very well in protein interface classification. A very high area under the curve (AUC) value of 0.957 was observed when predicted protein binding sites were classified. Remarkably, near prefect accuracy was achieved with an AUC of 0.991 when actual binding sites were classified. The developed method will be also useful for protein design of permanent and transient PBIs. Copyright © 2013 Wiley Periodicals, Inc.

Comparative Analysis of the Flax Immune Receptors L6 and L7 Suggests an Equilibrium-Based Switch Activation Model

PubMed Central

Chen, Chunhong; Newell, Kim; Lawrence, Gregory J.; Ellis, Jeffrey G.; Anderson, Peter A.; Dodds, Peter N.

2016-01-01

NOD-like receptors (NLRs) are central components of the plant immune system. L6 is a Toll/interleukin-1 receptor (TIR) domain-containing NLR from flax (Linum usitatissimum) conferring immunity to the flax rust fungus. Comparison of L6 to the weaker allele L7 identified two polymorphic regions in the TIR and the nucleotide binding (NB) domains that regulate both effector ligand-dependent and -independent cell death signaling as well as nucleotide binding to the receptor. This suggests that a negative functional interaction between the TIR and NB domains holds L7 in an inactive/ADP-bound state more tightly than L6, hence decreasing its capacity to adopt the active/ATP-bound state and explaining its weaker activity in planta. L6 and L7 variants with a more stable ADP-bound state failed to bind to AvrL567 in yeast two-hybrid assays, while binding was detected to the signaling active variants. This contrasts with current models predicting that effectors bind to inactive receptors to trigger activation. Based on the correlation between nucleotide binding, effector interaction, and immune signaling properties of L6/L7 variants, we propose that NLRs exist in an equilibrium between ON and OFF states and that effector binding to the ON state stabilizes this conformation, thereby shifting the equilibrium toward the active form of the receptor to trigger defense signaling. PMID:26744216

Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

PubMed Central

2015-01-01

Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497

Inhalational anaesthetics and n-alcohols share a site of action in the neuronal Shaw2 Kv channel

PubMed Central

Bhattacharji, Aditya; Klett, Nathan; Go, Ramon Christopher V; Covarrubias, Manuel

2010-01-01

Background and purpose: Neuronal ion channels are key targets of general anaesthetics and alcohol, and binding of these drugs to pre-existing and relatively specific sites is thought to alter channel gating. However, the underlying molecular mechanisms of this action are still poorly understood. Here, we investigated the neuronal Shaw2 voltage-gated K+ (Kv) channel to ask whether the inhalational anaesthetic halothane and n-alcohols share a binding site near the activation gate of the channel. Experimental approach: Focusing on activation gate mutations that affect channel modulation by n-alcohols, we investigated n-alcohol-sensitive and n-alcohol-resistant Kv channels heterologously expressed in Xenopus oocytes to probe the functional modulation by externally applied halothane using two-electrode voltage clamping and a gas-tight perfusion system. Key results: Shaw2 Kv channels are reversibly inhibited by halothane in a dose-dependent and saturable manner (K0.5= 400 µM; nH= 1.2). Also, discrete mutations in the channel's S4S5 linker are sufficient to reduce or confer inhibition by halothane (Shaw2-T330L and Kv3.4-G371I/T378A respectively). Furthermore, a point mutation in the S6 segment of Shaw2 (P410A) converted the halothane-induced inhibition into halothane-induced potentiation. Lastly, the inhibition resulting from the co-application of n-butanol and halothane is consistent with the presence of overlapping binding sites for these drugs and weak binding cooperativity. Conclusions and implications: These observations strongly support a molecular model of a general anaesthetic binding site in the Shaw2 Kv channel. This site may involve the amphiphilic interface between the S4S5 linker and the S6 segment, which plays a pivotal role in Kv channel activation. PMID:20136839

Modeling of full-Heusler alloys within tight-binding approximation: Case study of Fe2MnAl

NASA Astrophysics Data System (ADS)

Azhar, A.; Majidi, M. A.; Nanto, D.

2017-07-01

Heusler alloys have been known for about a century, and predictions of magnetic moment values using Slater-Pauling rule have been successful for many such materials. However, such a simple counting rule has been found not to always work for all Heusler alloys. For instance, Fe2CuAl has been found to have magnetic moment of 3.30 µB per formula unit although the Slater-Pauling rule suggests the value of 2 µB. On the other hand, a recent experiment shows that a non-stoichiometric Heusler compound Fe2Mn0.5Cu0.5Al possesses magnetic moment of 4 µB, closer to the Slater-Pauling prediction for the stoichiometric compound. Such discrepancies signify that the theory to predict the magnetic moment of Heusler alloys in general is still far from being complete. Motivated by this issue, we propose to do a theoretical study on a full-Heusler alloy Fe2MnAl to understand the formation of magnetic moment microscopically. We model the system by constructing a density-functional-theory-based tight-binding Hamiltonian and incorporating Hubbard repulsive as well as spin-spin interactions for the electrons occupying the d-orbitals. Then, we solve the model using Green's function approach, and treat the interaction terms within the mean-field approximation. At this stage, we aim to formulate the computational algorithm for the overall calculation process. Our final goal is to compute the total magnetic moment per unit cell of this system and compare it with the experimental data.

Negative differential resistance and rectification effects in zigzag graphene nanoribbon heterojunctions: Induced by edge oxidation and symmetry concept

NASA Astrophysics Data System (ADS)

Nazirfakhr, Maryam; Shahhoseini, Ali

2018-03-01

By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of H-terminated zigzag graphene nanoribbon (H/ZGNR) and O-terminated ZGNR/H-terminated ZGNR (O/ZGNR-H/ZGNR) heterostructure under finite bias. Moreover, the effect of width and symmetry on the electronic transport properties of both models is also considered. The results reveal that asymmetric H/ZGNRs have linear I-V characteristics in whole bias range, but symmetric H-ZGNRs show negative differential resistance (NDR) behavior which is inversely proportional to the width of the H/ZGNR. It is also shown that the I-V characteristic of O/ZGNR-H/ZGNR heterostructure shows a rectification effect, whether the geometrical structure is symmetric or asymmetric. The fewer the number of zigzag chains, the bigger the rectification ratio. It should be mentioned that, the rectification ratios of symmetric heterostructures are much bigger than asymmetric one. Transmission spectrum, density of states (DOS), molecular projected self-consistent Hamiltonian (MPSH) and molecular eigenstates are analyzed subsequently to understand the electronic transport properties of these ZGNR devices. Our findings could be used in developing nanoscale rectifiers and NDR devices.

Robust mode space approach for atomistic modeling of realistically large nanowire transistors

NASA Astrophysics Data System (ADS)

Huang, Jun Z.; Ilatikhameneh, Hesameddin; Povolotskyi, Michael; Klimeck, Gerhard

2018-01-01

Nanoelectronic transistors have reached 3D length scales in which the number of atoms is countable. Truly atomistic device representations are needed to capture the essential functionalities of the devices. Atomistic quantum transport simulations of realistically extended devices are, however, computationally very demanding. The widely used mode space (MS) approach can significantly reduce the numerical cost, but a good MS basis is usually very hard to obtain for atomistic full-band models. In this work, a robust and parallel algorithm is developed to optimize the MS basis for atomistic nanowires. This enables engineering-level, reliable tight binding non-equilibrium Green's function simulation of nanowire metal-oxide-semiconductor field-effect transistor (MOSFET) with a realistic cross section of 10 nm × 10 nm using a small computer cluster. This approach is applied to compare the performance of InGaAs and Si nanowire n-type MOSFETs (nMOSFETs) with various channel lengths and cross sections. Simulation results with full-band accuracy indicate that InGaAs nanowire nMOSFETs have no drive current advantage over their Si counterparts for cross sections up to about 10 nm × 10 nm.

Physical and Electronic Isolation of Carbon Nanotube Conductors

NASA Technical Reports Server (NTRS)

OKeeffe, James; Biegel, Bryan (Technical Monitor)

2001-01-01

Multi-walled nanotubes are proposed as a method to electrically and physically isolate nanoscale conductors from their surroundings. We use tight binding (TB) and density functional theory (DFT) to simulate the effects of an external electric field on multi-wall nanotubes. Two categories of multi-wall nanotube are investigated, those with metallic and semiconducting outer shells. In the metallic case, simulations show that the outer wall effectively screens the inner core from an applied electric field. This offers the ability to reduce crosstalk between nanotube conductors. A semiconducting outer shell is found not to perturb an electric field incident on the inner core, thereby providing physical isolation while allowing the tube to remain electrically coupled to its surroundings.

Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

NASA Astrophysics Data System (ADS)

Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

2016-02-01

This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

Modeling Tight Junction Dynamics and Oscillations

PubMed Central

Kassab, Fuad; Marques, Ricardo Paulino; Lacaz-Vieira, Francisco

2002-01-01

Tight junction (TJ) permeability responds to changes of extracellular Ca2+ concentration. This can be gauged through changes of the transepithelial electrical conductance (G) determined in the absence of apical Na+. The early events of TJ dynamics were evaluated by the fast Ca2+ switch assay (FCSA) (Lacaz-Vieira, 2000), which consists of opening the TJs by removing basal calcium (Ca2+ bl) and closing by returning Ca2+ bl to normal values. Oscillations of TJ permeability were observed when Ca2+ bl is removed in the presence of apical calcium (Ca2+ ap) and were interpreted as resulting from oscillations of a feedback control loop which involves: (a) a sensor (the Ca2+ binding sites of zonula adhaerens), (b) a control unit (the cell signaling machinery), and (c) an effector (the TJs). A mathematical model to explain the dynamical behavior of the TJs and oscillations was developed. The extracellular route (ER), which comprises the paracellular space in series with the submucosal interstitial fluid, was modeled as a continuous aqueous medium having the TJ as a controlled barrier located at its apical end. The ER was approximated as a linear array of cells. The most apical cell is separated from the apical solution by the TJ and this cell bears the Ca2+ binding sites of zonula adhaerens that control the TJs. According to the model, the control unit receives information from the Ca2+ binding sites and delivers a signal that regulates the TJ barrier. Ca2+ moves along the ER according to one-dimensional diffusion following Fick's second law. Across the TJ, Ca2+ diffusion follows Fick's first law. Our first approach was to simulate the experimental results in a semiquantitative way. The model tested against experiment results performed in the frog urinary bladder adequately predicts the responses obtained in different experimental conditions, such as: (a) TJ opening and closing in a FCSA, (b) opening by the presence of apical Ca2+ and attainment of a new steady-state, (c) the escape phase which follows the halt of TJ opening induced by apical Ca2+, (d) the oscillations of TJ permeability, and (e) the effect of Ca2+ ap concentration on the frequency of oscillations. PMID:12149284

Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

PubMed

Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

2016-11-21

Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

PubMed Central

Stefanski, Adrianne L.; McManaman, James L.

2013-01-01

Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

PubMed Central

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-01-01

Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

PubMed

Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

2011-08-09

The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

Surface passivation for tight-binding calculations of covalent solids.

PubMed

Bernstein, N

2007-07-04

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

Surface passivation for tight-binding calculations of covalent solids

NASA Astrophysics Data System (ADS)

Bernstein, N.

2007-07-01

Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

An Innovative Sensing Approach Using Carbon Nanotube-Based Composites for Structural Health Monitoring of Concrete Structures

NASA Astrophysics Data System (ADS)

Dwivedi, Vatsal

This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.

Simulation studies of carbon nanotube field-effect transistors

NASA Astrophysics Data System (ADS)

John, David Llewellyn

Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.

Murine Hyperglycemic Vasculopathy and Cardiomyopathy: Whole-Genome Gene Expression Analysis Predicts Cellular Targets and Regulatory Networks Influenced by Mannose Binding Lectin

PubMed Central

Zou, Chenhui; La Bonte, Laura R.; Pavlov, Vasile I.; Stahl, Gregory L.

2012-01-01

Hyperglycemia, in the absence of type 1 or 2 diabetes, is an independent risk factor for cardiovascular disease. We have previously demonstrated a central role for mannose binding lectin (MBL)-mediated cardiac dysfunction in acute hyperglycemic mice. In this study, we applied whole-genome microarray data analysis to investigate MBL’s role in systematic gene expression changes. The data predict possible intracellular events taking place in multiple cellular compartments such as enhanced insulin signaling pathway sensitivity, promoted mitochondrial respiratory function, improved cellular energy expenditure and protein quality control, improved cytoskeleton structure, and facilitated intracellular trafficking, all of which may contribute to the organismal health of MBL null mice against acute hyperglycemia. Our data show a tight association between gene expression profile and tissue function which might be a very useful tool in predicting cellular targets and regulatory networks connected with in vivo observations, providing clues for further mechanistic studies. PMID:22375142

Effects of an electric field on the electronic and optical properties of zigzag boron nitride nanotubes

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2011-02-01

We have investigated the electro-optical properties of zigzag BNNTs, under an external electric field, using the tight binding approximation. It is found that an electric field modifies the band structure and splits the band degeneracy. Also the large electric strength leads to coupling the neighbor subbands which these effects reflect in the DOS and JDOS spectrum. It has been shown that, unlike CNTs, the band gap of BNNTs can be reduced linearly by applying a transverse external electric field. Also we show that the larger diameter tubes are more sensitive than small ones. The semiconducting metallic transition can be achieved through increasing the applied fields. The number and position of peaks in the JDOS spectrum are dependent on electric field strength. It is found that at a high electric field, the two lowest subbands are oscillatory with multiple nodes at the Fermi level.

Quantum Hall effect in ac driven graphene: From the half-integer to the integer case

NASA Astrophysics Data System (ADS)

Ding, Kai-He; Lim, Lih-King; Su, Gang; Weng, Zheng-Yu

2018-01-01

We theoretically study the quantum Hall effect (QHE) in graphene with an ac electric field. Based on the tight-binding model, the structure of the half-integer Hall plateaus at σxy=±(n +1 /2 ) 4 e2/h (n is an integer) gets qualitatively changed with the addition of new integer Hall plateaus at σxy=±n (4 e2/h ) starting from the edges of the band center regime towards the band center with an increasing ac field. Beyond a critical field strength, a Hall plateau with σxy=0 can be realized at the band center, hence fully restoring a conventional integer QHE with particle-hole symmetry. Within a low-energy Hamiltonian for Dirac cones merging, we show a very good agreement with the tight-binding calculations for the Hall plateau transitions. We also obtain the band structure for driven graphene ribbons to provide a further understanding on the appearance of the new Hall plateaus, showing a trivial insulator behavior for the σxy=0 state. In the presence of disorder, we numerically study the disorder-induced destruction of the quantum Hall states in a finite driven sample and find that qualitative features known in the undriven disordered case are maintained.

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2

PubMed Central

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-01-01

Background Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. Results We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Conclusion Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation. PMID:18028534

Regulation of tight junction assembly and epithelial morphogenesis by the heat shock protein Apg-2.

PubMed

Aijaz, Saima; Sanchez-Heras, Elena; Balda, Maria S; Matter, Karl

2007-11-20

Tight junctions are required for epithelial barrier formation and participate in the regulation of signalling mechanisms that control proliferation and differentiation. ZO-1 is a tight junction-associated adaptor protein that regulates gene expression, junction assembly and epithelial morphogenesis. We have previously demonstrated that the heat shock protein Apg-2 binds ZO-1 and thereby regulates its role in cell proliferation. Here, we addressed the question whether Apg-2 is also important for junction formation and epithelial morphogenesis. We demonstrate that depletion of Apg-2 by RNAi in MDCK cells did not prevent formation of functional tight junctions. Similar to ZO-1, however, reduced expression of Apg-2 retarded de novo junction assembly if analysed in a Ca-switch model. Formation of functional junctions, as monitored by measuring transepithelial electrical resistance, and recruitment of tight and adherens junction markers were retarded. If cultured in three dimensional extracellular matrix gels, Apg-2 depleted cells, as previously shown for ZO-1 depleted cells, did not form hollow polarised cysts but poorly organised, irregular structures. Our data indicate that Apg-2 regulates junction assembly and is required for normal epithelial morphogenesis in a three-dimensional culture system, suggesting that Apg-2 is an important regulator of epithelial differentiation. As the observed phenotypes are similar to those previously described for ZO-1 depleted cells and depletion of Apg-2 retards junctional recruitment of ZO-1, regulation of ZO-1 is likely to be an important functional role for Apg-2 during epithelial differentiation.

On the distribution of Na+ pump sites in the frog skin

PubMed Central

Mills, JW; DiBona, DR

1977-01-01

Exposure of the outside of the isolated frog skin to a Ringer's solution, made hypertonic by the addition of mannitol, causes a rapid and sustained increase in transepithelial permeability through a structural distortion-a focal blistering-of the "tight" junctions of the outermost living cell layer. [(3)H]ouabain, used as an autoradiographic marker for the Na+-pump (Na+-K+-adenosine triphosphatase), is usually unable to penetrate the frog skin from the outside solution, but when added to a hypertonic mannitol- Ringer's solution in the outside bath it readily penetrates the epithelium, presumably through the opened shunt pathway. Radioautographic analysis of [(3)H]ouabain binding sites revealed that most of ouabain enters from the outside solution binds to the sites on the cell membranes of the stratum spinosum, as was the case when it was applied from the inside bath in an earlier study. The outer living cell layer, the first to be exposed to ouabain, does not appear to be the major site for the Na+-pump, and therefore, is not likely to be responsible for most of the active pumping of Na+. This result demonstrates that previous failure to show a high density of Na+-pump sites on the cells of the outermost layer, when [(3)H]ouabain was applied from the inside solution, was not due to the inability of the marker to reach these cells at a sufficient concentration to reveal all pump sites. These results provide further support for a model of Na+-transport across the frog skin which distributes the active pump step on the inward facing membranes of all living cells. PMID:144738

Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

2010-07-23

Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

2016-05-14

We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less

Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals

NASA Astrophysics Data System (ADS)

Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.

2000-02-01

We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.

Theoretical study on the perpendicular anisotropic magnetoresistance using Rashba-type ferromagnetic model

NASA Astrophysics Data System (ADS)

Yahagi, Y.; Miura, D.; Sakuma, A.

2018-05-01

We investigated the anisotropic magnetoresistance (AMR) effects in ferromagnetic-metal multi-layers stacked on non-magnetic insulators in the context of microscopic theory. We represented this situation with tight-binding models that included the exchange and Rashba fields, where the Rashba field was assumed to originate from spin-orbit interactions as junction effects with the insulator. To describe the AMR ratios, the DC conductivity was calculated based on the Kubo formula. As a result, we showed that the Rashba field induced both perpendicular and in-plane AMR effects and that the perpendicular AMR effect rapidly decayed with increasing film thickness.

Hidden order and unconventional superconductivity in URu2Si2

NASA Astrophysics Data System (ADS)

Rau, Jeffrey; Kee, Hae-Young

2012-02-01

The nature of the so-called hidden order in URu2Si2 and the subsequent superconducting phase have remained a puzzle for over two decades. Motivated by evidence for rotational symmetry breaking seen in recent magnetic torque measurements [Okazaki et al. Science 331, 439 (2011)], we derive a simple tight-binding model consistent with experimental Fermi surface probes and ab-initio calculations. From this model we use mean-field theory to examine the variety of hidden orders allowed by existing experimental results, including the torque measurements. We then construct a phase diagram in temperature and pressure and discuss relevant experimental consequences.

Interacting quasi-band theory for electronic states in compound semiconductor alloys: Wurtzite structure

NASA Astrophysics Data System (ADS)

Kishi, Ayaka; Oda, Masato; Shinozuka, Yuzo

2016-05-01

This paper reports on the electronic states of compound semiconductor alloys of wurtzite structure calculated by the recently proposed interacting quasi-band (IQB) theory combined with empirical sp3 tight-binding models. Solving derived quasi-Hamiltonian 24 × 24 matrix that is characterized by the crystal parameters of the constituents facilitates the calculation of the conduction and valence bands of wurtzite alloys for arbitrary concentrations under a unified scheme. The theory is applied to III-V and II-VI wurtzite alloys: cation-substituted Al1- x Ga x N and Ga1- x In x N and anion-substituted CdS1- x Se x and ZnO1- x S x . The obtained results agree well with the experimental data, and are discussed in terms of mutual mixing between the quasi-localized states (QLS) and quasi-average bands (QAB): the latter bands are approximately given by the virtual crystal approximation (VCA). The changes in the valence and conduction bands, and the origin of the band gap bowing are discussed on the basis of mixing character.

General theory for calculating disorder-averaged Green's function correlators within the coherent potential approximation

NASA Astrophysics Data System (ADS)

Zhou, Chenyi; Guo, Hong

2017-01-01

We report a diagrammatic method to solve the general problem of calculating configurationally averaged Green's function correlators that appear in quantum transport theory for nanostructures containing disorder. The theory treats both equilibrium and nonequilibrium quantum statistics on an equal footing. Since random impurity scattering is a problem that cannot be solved exactly in a perturbative approach, we combine our diagrammatic method with the coherent potential approximation (CPA) so that a reliable closed-form solution can be obtained. Our theory not only ensures the internal consistency of the diagrams derived at different levels of the correlators but also satisfies a set of Ward-like identities that corroborate the conserving consistency of transport calculations within the formalism. The theory is applied to calculate the quantum transport properties such as average ac conductance and transmission moments of a disordered tight-binding model, and results are numerically verified to high precision by comparing to the exact solutions obtained from enumerating all possible disorder configurations. Our formalism can be employed to predict transport properties of a wide variety of physical systems where disorder scattering is important.

The effect of interface hopping on inelastic scattering of oppositely charged polarons in polymers

NASA Astrophysics Data System (ADS)

Di, Bing; Wang, Ya-Dong; Zhang, Ya-Lin; An, Zhong

2013-06-01

The inelastic scattering of oppositely charge polarons in polymer heterojunctions is believed to be of fundamental importance for the light-emitting and transport properties of conjugated polymers. Based on the tight-binding SSH model, and by using a nonadiabatic molecular dynamic method, we investigate the effects of interface hopping on inelastic scattering of oppositely charged polarons in a polymer heterojunction. It is found that the scattering processes of the charge and lattice defect depend sensitively on the hopping integrals at the polymer/polymer interface when the interface potential barrier and applied electric field strength are constant. In particular, at an intermediate electric field, when the interface hopping integral of the polymer/polymer heterojunction material is increased beyond a critical value, two polarons can combine to become a lattice deformation in one of the two polymer chains, with the electron and the hole bound together, i.e., a self-trapped polaron—exciton. The yield of excitons then increases to a peak value. These results show that interface hopping is of fundamental importance and facilitates the formation of polaron—excitons.

Theory of Intrinsic Spin Torque Due to Interface Spin-Orbit Coupling

NASA Astrophysics Data System (ADS)

Kalitsov, Alan; Chshiev, Mairbek; Butler, William; Mryasov, Oleg

2014-03-01

The effect of intrinsic spin torque due to spin-orbit coupling (SOC) at the interface between thin ferromagnetic film and non-magnetic metal has attracted significant fundamental and applied research interest. We report quantum theory of SOC driven spin torque (SOT) within the Rashba model of SOC and two-band tight binding (TB) Hamiltonian including s-d exchange interactions (J). We employ the non-equilibrium Green Function formalism and find that SOT to the first order in SOC has symmetry consistent with the earlier quasi-classical diffusive theory. An obvious benefit of the proposed approach is the expression for the SOT given in terms of TB parameters which enables a physically transparent analysis of the dependencies of SOT on material specific parameters such as Rashba SOC constant, hopping integral, Fermi level and J. On the basis of analytical and numerical results we discuss trends in strength of SOT and its correlation with the Spin Hall conductivity. This work was supported in part by C-SPIN, STARnet, a Semiconductor Research Corporation program, sponsored by MARCO and DARPA.

The electronic transport properties of defected bilayer sliding armchair graphene nanoribbons

NASA Astrophysics Data System (ADS)

Mohammadi, Amin; Haji-Nasiri, Saeed

2018-04-01

By applying non-equilibrium Green's functions (NEGF) in combination with tight-binding (TB) model, we investigate and compare the electronic transport properties of perfect and defected bilayer armchair graphene nanoribbons (BAGNRs) under finite bias. Two typical defects which are placed in the middle of top layer (i.e. single vacancy (SV) and stone wale (SW) defects) are examined. The results reveal that in both perfect and defected bilayers, the maximum current refers to β-AB, AA and α-AB stacking orders, respectively, since the intermolecular interactions are stronger in them. Moreover it is observed that a SV decreases the current in all stacking orders, but the effects of a SW defect is nearly unpredictable. Besides, we introduced a sequential switching behavior and the effects of defects on the switching performance is studied as well. We found that a SW defect can significantly improve the switching behavior of a bilayer system. Transmission spectrum, band structure, molecular energy spectrum and molecular projected self-consistent Hamiltonian (MPSH) are analyzed subsequently to understand the electronic transport properties of these bilayer devices which can be used in developing nano-scale bilayer systems.

Stochastic Model of Supercoiling-Dependent Transcription

NASA Astrophysics Data System (ADS)

Brackley, C. A.; Johnson, J.; Bentivoglio, A.; Corless, S.; Gilbert, N.; Gonnella, G.; Marenduzzo, D.

2016-07-01

We propose a stochastic model for gene transcription coupled to DNA supercoiling, where we incorporate the experimental observation that polymerases create supercoiling as they unwind the DNA helix and that these enzymes bind more favorably to regions where the genome is unwound. Within this model, we show that when the transcriptionally induced flux of supercoiling increases, there is a sharp crossover from a regime where torsional stresses relax quickly and gene transcription is random, to one where gene expression is highly correlated and tightly regulated by supercoiling. In the latter regime, the model displays transcriptional bursts, waves of supercoiling, and up regulation of divergent or bidirectional genes. It also predicts that topological enzymes which relax twist and writhe should provide a pathway to down regulate transcription.

Application of multi-factorial design of experiments to successfully optimize immunoassays for robust measurements of therapeutic proteins.

PubMed

Ray, Chad A; Patel, Vimal; Shih, Judy; Macaraeg, Chris; Wu, Yuling; Thway, Theingi; Ma, Mark; Lee, Jean W; Desilva, Binodh

2009-02-20

Developing a process that generates robust immunoassays that can be used to support studies with tight timelines is a common challenge for bioanalytical laboratories. Design of experiments (DOEs) is a tool that has been used by many industries for the purpose of optimizing processes. The approach is capable of identifying critical factors and their interactions with a minimal number of experiments. The challenge for implementing this tool in the bioanalytical laboratory is to develop a user-friendly approach that scientists can understand and apply. We have successfully addressed these challenges by eliminating the screening design, introducing automation, and applying a simple mathematical approach for the output parameter. A modified central composite design (CCD) was applied to three ligand binding assays. The intra-plate factors selected were coating, detection antibody concentration, and streptavidin-HRP concentrations. The inter-plate factors included incubation times for each step. The objective was to maximize the logS/B (S/B) of the low standard to the blank. The maximum desirable conditions were determined using JMP 7.0. To verify the validity of the predictions, the logS/B prediction was compared against the observed logS/B during pre-study validation experiments. The three assays were optimized using the multi-factorial DOE. The total error for all three methods was less than 20% which indicated method robustness. DOE identified interactions in one of the methods. The model predictions for logS/B were within 25% of the observed pre-study validation values for all methods tested. The comparison between the CCD and hybrid screening design yielded comparable parameter estimates. The user-friendly design enables effective application of multi-factorial DOE to optimize ligand binding assays for therapeutic proteins. The approach allows for identification of interactions between factors, consistency in optimal parameter determination, and reduced method development time.

Symposium DD: Low-Dimensional Materials-Synthesis, Assembly, Property Scaling and Modeling. Held in San Francisco, CA on April 9-13, 2007

DTIC Science & Technology

2008-06-01

Ciencia e Ingenieria de los Materiales , Universidad de Costa Rica, San Jose, Costa Rica. We have developed a new unifying tight-binding theory that...Fisico Matem6ticas, Universidad Aut6noma de Nuevo Le6n, San Nicolas de los Garza, Nuevo LeAfA3n, Mexico; 2Chemical Engineering Department and Texas...ORNL), Oak Ridge, Tennessee; 2Departamento de Ciencia de los Materiales e IM y QI, Universidad de Cadiz, Puerto Real, Cadiz, Spain; 3Departamento de

Green's function calculations for semi-infinite carbon nanotubes

NASA Astrophysics Data System (ADS)

John, D. L.; Pulfrey, D. L.

2006-02-01

In the modeling of nanoscale electronic devices, the non-equilibrium Green's function technique is gaining increasing popularity. One complication in this method is the need for computation of the self-energy functions that account for the interactions between the active portion of a device and its leads. In the one-dimensional case, these functions may be computed analytically. In higher dimensions, a numerical approach is required. In this work, we generalize earlier methods that were developed for tight-binding Hamiltonians, and present results for the case of a carbon nanotube.

Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

PubMed

Nagata, Yuki

2010-02-01

A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

Lattice distortion and electron charge redistribution induced by defects in graphene

DOE PAGES

Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...

2016-09-14

Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.

Nonlinear susceptibilities of finite conjugated organic polymers

NASA Technical Reports Server (NTRS)

Beratan, David N.; Onuchic, Jose Nelson; Perry, Joseph W.

1987-01-01

Tight-binding calculations of the length dependence of the third-order molecular hyperpolarizability for polyenes and polyynes are reported. The pi-electron wave functions were determined by exploiting the limited translational symmetry of the molecules. Perturbation theory was used to calculate the longitudinal component of the electronic nonresonant hyperpolarizability. This is the first two-'band' calculation of third-order hyperpolarizabilities on finite pi-electron systems of varying length. In contrast to the results of the one-'band' models, the hyperpolarizability densities increase rapidly and then, after about 10-15 repeating units, approach an asymptotic value.

Multiple Weyl points and the sign change of their topological charges in woodpile photonic crystals

NASA Astrophysics Data System (ADS)

Chang, Ming-Li; Xiao, Meng; Chen, Wen-Jie; Chan, C. T.

2017-03-01

We show that Weyl points with topological charges 1 and 2 can be found in very simple chiral woodpile photonic crystals and the distribution of the charges can be changed by changing the material parameters without altering space-group symmetry. The underlying physics can be understood through a tight-binding model. Gapless surface states and their backscattering immune properties also are demonstrated in these systems. Obtaining Weyl points in these easily fabricated woodpile photonic crystals will facilitate the realization of Weyl point physics in optical and IR frequencies.

Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jian-Xin; Migliori, Albert; Balatsky, Alexander V.

2015-07-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum: the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model, we study the many-body instabilities of these systems and identify regions of parameter space in which the system exhibits spin density wave and charge density wave order.

Molecular dynamics simulations of dense plasmas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Collins, L.A.; Kress, J.D.; Kwon, I.

1993-12-31

We have performed quantum molecular dynamics simulations of hot, dense plasmas of hydrogen over a range of temperatures(0.1-5eV) and densities(0.0625-5g/cc). We determine the forces quantum mechanically from density functional, extended Huckel, and tight binding techniques and move the nuclei according to the classical equations of motion. We determine pair-correlation functions, diffusion coefficients, and electrical conductivities. We find that many-body effects predominate in this regime. We begin to obtain agreement with the OCP and Thomas-Fermi models only at the higher temperatures and densities.

Spin-polarized transport in multiterminal silicene nanodevices

NASA Astrophysics Data System (ADS)

Xu, Ning

2018-01-01

The spin-polarized transport properties of multiterminal silicene nanodevices are studied using the tight binding model and Landauer-Buttier approach. We propose a four-terminal †-shaped junction device and two types of three-terminal T-shaped junction devices, which are made of the crossing of a zigzag and an armchair silicene nanoribbon. If the electrons are injected into the metallic lead, the near-perfect spin polarization with 100% around the Fermi energy can be achieved easily at the other semiconducting leads. Thus the multiterminal silicene nanodevices can act as controllable spin filters.

Mechanical coupling in myosin V: a simulation study

PubMed Central

Ovchinnikov, Victor; Trout, Bernhardt L.

2009-01-01

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The inter-domain coupling in myosin V is studied with Restrained Targeted Molecular Dynamics (RTMD) using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FS) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The ‘minimal’ FS that results in extensive structural changes in the overall myosin conformation is comprised of the ATP, Switch 1, and the nearby HF, HG and HH helices. Addition of switch 2 to the forcing set is required to achieve a complete opening of the actin-binding cleft. The RTMD simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft, and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the Relay helix, and Switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of inter-domain coupling in proteins. PMID:19853615

Mechanical coupling in myosin V: a simulation study.

PubMed

Ovchinnikov, Victor; Trout, Bernhardt L; Karplus, Martin

2010-01-29

Myosin motor function depends on the interaction between different domains that transmit information from one part of the molecule to another. The interdomain coupling in myosin V is studied with restrained targeted molecular dynamics using an all-atom representation in explicit solvent. To elucidate the origin of the conformational change due to the binding of ATP, targeting forces are applied to small sets of atoms (the forcing sets, FSs) in the direction of their displacement from the rigor conformation, which has a closed actin-binding cleft, to the post-rigor conformation, in which the cleft is open. The "minimal" FS that results in extensive structural changes in the overall myosin conformation is composed of ATP, switch 1, and the nearby HF, HG, and HH helices. Addition of switch 2 to the FS is required to achieve a complete opening of the actin-binding cleft. The restrained targeted molecular dynamics simulations reveal the mechanical coupling pathways between (i) the nucleotide-binding pocket (NBP) and the actin-binding cleft, (ii) the NBP and the converter, and (iii) the actin-binding cleft and the converter. Closing of the NBP due to ATP binding is tightly coupled to the opening of the cleft and leads to the rupture of a key hydrogen bond (F441N/A684O) between switch 2 and the SH1 helix. The actin-binding cleft may mediate the rupture of this bond via a connection between the HW helix, the relay helix, and switch 2. The findings are consistent with experimental studies and a recent normal mode analysis. The present method is expected to be useful more generally in studies of interdomain coupling in proteins.

Atomistic Tight-Binding Theory Applied to Structural and Optical Properties of Silicon Nanodisks

NASA Astrophysics Data System (ADS)

Sukkabot, Worasak

2018-05-01

The use of ultrathin crystalline silicon (c-Si) wafers in solar cells necessitates a highly effective light absorber to compensate for poor light absorption. One route to overcoming this problem is to use a periodic array of Si nanodisks on ultrathin c-Si. In the present manuscript, we numerically investigate the effects of the geometrical parameters of the Si nanodisks, including disk diameter (D) and length (L), on the structural and optical properties, using atomistic tight-binding theory. These computations confirm that the electronic structure and optical properties are sensitive to the structural parameters. As the disk diameter and length increase, the single-electron energies decrease, and the single-hole energies increase. These calculations also reveal that, because of the quantum confinement effect, the optical band gaps gradually decrease independently of the increasing disk diameter and length. The optical spectra can be tuned across the visible region by varying the disk diameter and length, which is a useful feature for optimizing light absorption in solar cell applications. As the disk diameter and length increased, the optical intensities also increased; however, the atomistic electron-hole interactions and ground electron-hole wave function overlap progressively decreased. The ground electron-hole wave function overlap, Stokes shift, and fine structure splitting decreased as the disk diameter and length were increased. Thus, Si nanodisks with a large diameter and length might be a suitable candidate source of entangled photons. The Si nanodisks in this study also show promise for applications to solar cells based on ultrathin c-Si wafers.

Theory of K-edge resonant inelastic x-ray scattering and its application for La0.5Sr1.5MnO4

NASA Astrophysics Data System (ADS)

Seman, T. F.; Liu, X.; Hill, J. P.; van Veenendaal, M.; Ahn, K. H.

2013-03-01

We present a formula based on tight-binding approach for the calculation of K-edge resonant inelastic x-ray scattering spectrum for transition metal oxides, by extending the previous result [K. H. Ahn, A. J. Fedro, and M. van Veenendaal, Phys. Rev. B 79, 045103 (2009).] to include explicit momentum dependence and a basis with multiple core hole sites. We apply this formula to layered charge, orbital, and spin ordered manganites, La0.5Sr1.5MnO4. The K-edge RIXS spectrum is found not periodic with respect to the actual reciprocal lattice, but approximately periodic with respect to the reciprocal lattice for the hypothetical unit cell with one core hole site. With experimental strcuture and reasonable tight-binding parameters, we obtain good agreement with experimental data, in particular, with regards to the large variation of the intensity with momentum. We find that the screening in La0.5Sr1.5MnO4 is highly localized around the core hole site and demonstrate the potential of K-edge RIXS as a probe for the screening dynamics in materials. Work supported by US.DOE Contr. DE-AC02-98CH10886 (X.L.,J.H.), US.DOE Award DE-FG02-03ER46097 (M.v.V.), CMCSN under Grants DE-FG02-08ER46540 & DE-SC0007091 (T.S.,K.A.,M.v.V.), Argonne XSD Visitor Prog.(K.A.), US.DOE Contr. DE-AC02-06CH11357 (X.L.,J.H).

Tight-binding molecular-dynamics study of point defects in GaAs

NASA Astrophysics Data System (ADS)

Seong, Hyangsuk; Lewis, Laurent J.

1995-08-01

Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.

A combined representation method for use in band structure calculations. 1: Method

NASA Technical Reports Server (NTRS)

Friedli, C.; Ashcroft, N. W.

1975-01-01

A representation was described whose basis levels combine the important physical aspects of a finite set of plane waves with those of a set of Bloch tight-binding levels. The chosen combination has a particularly simple dependence on the wave vector within the Brillouin Zone, and its use in reducing the standard one-electron band structure problem to the usual secular equation has the advantage that the lattice sums involved in the calculation of the matrix elements are actually independent of the wave vector. For systems with complicated crystal structures, for which the Korringa-Kohn-Rostoker (KKR), Augmented-Plane Wave (APW) and Orthogonalized-Plane Wave (OPW) methods are difficult to apply, the present method leads to results with satisfactory accuracy and convergence.

Neural-network-assisted genetic algorithm applied to silicon clusters

NASA Astrophysics Data System (ADS)

Marim, L. R.; Lemes, M. R.; dal Pino, A.

2003-03-01

Recently, a new optimization procedure that combines the power of artificial neural-networks with the versatility of the genetic algorithm (GA) was introduced. This method, called neural-network-assisted genetic algorithm (NAGA), uses a neural network to restrict the search space and it is expected to speed up the solution of global optimization problems if some previous information is available. In this paper, we have tested NAGA to determine the ground-state geometry of Sin (10⩽n⩽15) according to a tight-binding total-energy method. Our results indicate that NAGA was able to find the desired global minimum of the potential energy for all the test cases and it was at least ten times faster than pure genetic algorithm.

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

PubMed

Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-14

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Kinetics and Mechanism of Mammalian Mitochondrial Ribosome Assembly.

PubMed

Bogenhagen, Daniel F; Ostermeyer-Fay, Anne G; Haley, John D; Garcia-Diaz, Miguel

2018-02-13

Mammalian mtDNA encodes only 13 proteins, all essential components of respiratory complexes, synthesized by mitochondrial ribosomes. Mitoribosomes contain greatly truncated RNAs transcribed from mtDNA, including a structural tRNA in place of 5S RNA as a scaffold for binding 82 nucleus-encoded proteins, mitoribosomal proteins (MRPs). Cryoelectron microscopy (cryo-EM) studies have determined the structure of the mitoribosome, but its mechanism of assembly is unknown. Our SILAC pulse-labeling experiments determine the rates of mitochondrial import of MRPs and their assembly into intact mitoribosomes, providing a basis for distinguishing MRPs that bind at early and late stages in mitoribosome assembly to generate a working model for mitoribosome assembly. Mitoribosome assembly is a slow process initiated at the mtDNA nucleoid driven by excess synthesis of individual MRPs. MRPs that are tightly associated in the structure frequently join the complex in a coordinated manner. Clinically significant MRP mutations reported to date affect proteins that bind early on during assembly. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

NASA Astrophysics Data System (ADS)

Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

2018-04-01

Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

Prediction and analysis of beta-turns in proteins by support vector machine.

PubMed

Pham, Tho Hoan; Satou, Kenji; Ho, Tu Bao

2003-01-01

Tight turn has long been recognized as one of the three important features of proteins after the alpha-helix and beta-sheet. Tight turns play an important role in globular proteins from both the structural and functional points of view. More than 90% tight turns are beta-turns. Analysis and prediction of beta-turns in particular and tight turns in general are very useful for the design of new molecules such as drugs, pesticides, and antigens. In this paper, we introduce a support vector machine (SVM) approach to prediction and analysis of beta-turns. We have investigated two aspects of applying SVM to the prediction and analysis of beta-turns. First, we developed a new SVM method, called BTSVM, which predicts beta-turns of a protein from its sequence. The prediction results on the dataset of 426 non-homologous protein chains by sevenfold cross-validation technique showed that our method is superior to the other previous methods. Second, we analyzed how amino acid positions support (or prevent) the formation of beta-turns based on the "multivariable" classification model of a linear SVM. This model is more general than the other ones of previous statistical methods. Our analysis results are more comprehensive and easier to use than previously published analysis results.

Sustained inhibition of intimal thickening. In vitro and in vivo effects of polymeric beta-cyclodextrin sulfate.

PubMed Central

Bachinsky, W B; Barnathan, E S; Liu, H; Okada, S S; Kuo, A; Raghunath, P N; Muttreja, M; Caron, R J; Tomaszewski, J E; Golden, M A

1995-01-01

Intimal thickening after vascular injury may be modulated in part by heparin binding growth factors. We hypothesized that placement of a therapeutic polymer in the periadventitial space capable of tightly binding growth factors might alter the vascular response to injury. We first demonstrated that incubation of rat aortic smooth muscle cells with an insoluble, sulfated polymer of beta-cyclodextrin (P-CDS) was associated with a dose-dependent inhibition of proliferation induced by fetal calf serum, fibroblast growth factor-2 (FGF-2), platelet-derived growth factor BB, or epidermal growth factor. Preincubation studies of P-CDS with FGF-2 revealed a very rapid removal of mitogenic activity. Using radiolabeled FGF-2 (0.25 microg/ml), we observed a very rapid association rate (0.34 +/- 0.07 min-1, n=4) and a very slow dissociation rate (3.3 +/- 0.2 X 10(-7) min-1) at 37 degrees C, suggesting a high affinity interaction. Using both Transwell and linear under-agarose assays, we demonstrated a significant inhibition of random migration (chemokinesis) by P-CDS. Unsulfated polymeric beta-cyclodextrin (P-CD) had little if any of these effects, suggesting that the high negative charge density of P-CDS was important for the effects. Finally, rats undergoing carotid artery balloon injury were randomized to treatment with periadventitial P-CDS or no treatment, and were killed at 4 (n=20), 14 (n=59), and 88 d (n=14). Morphometric analysis demonstrated significant and sustained inhibition of intimal thickening in P-CDS-treated rats at 14 (P < 0.01) and 88 d (P < 0.05) using absolute intimal area or intima/media area ratios. No inhibition was seen in a group of rats treated with P-CD. In P-CDS-treated rats, bromodeoxyuridine labeling studies revealed fewer labeled smooth muscle cells in the intima at 14 d (P=0.01), while staining with Evans blue revealed enhanced late endothelial cell regrowth. Thus, periadventitially applied sulfated beta-cyclodextrin polymer, which can tightly bind heparin binding growth factors, inhibits intimal thickening in vivo in a sustained fashion without using an additional delivery system. These studies suggest that cellular processes mediated by heparin binding growth factors may be modulated by P-CDS. Images PMID:8675622

Photoinduced Bandgap Renormalization and Exciton Binding Energy Reduction in WS2.

PubMed

Cunningham, Paul D; Hanbicki, Aubrey T; McCreary, Kathleen M; Jonker, Berend T

2017-12-26

Strong Coulomb attraction in monolayer transition metal dichalcogenides gives rise to tightly bound excitons and many-body interactions that dominate their optoelectronic properties. However, this Coulomb interaction can be screened through control of the surrounding dielectric environment as well as through applied voltage, which provides a potential means of tuning the bandgap, exciton binding energy, and emission wavelength. Here, we directly show that the bandgap and exciton binding energy can be optically tuned by means of the intensity of the incident light. Using transient absorption spectroscopy, we identify a sub-picosecond decay component in the excited-state dynamics of WS 2 that emerges for incident photon energies above the A-exciton resonance, which originates from a nonequilibrium population of charge carriers that form excitons as they cool. The generation of this charge-carrier population exhibits two distinct energy thresholds. The higher threshold is coincident with the onset of continuum states and therefore provides a direct optical means of determining both the bandgap and exciton binding energy. Using this technique, we observe a reduction in the exciton binding energy from 310 ± 30 to 220 ± 20 meV as the excitation density is increased from 3 × 10 11 to 1.2 × 10 12 photons/cm 2 . This reduction is due to dynamic dipolar screening of Coulomb interactions by excitons, which is the underlying physical process that initiates bandgap renormalization and leads to the insulator-metal transition in monolayer transition metal dichalcogenides.

Identification of a regulation network in response to cadmium toxicity using blood clam Tegillarca granosa as model

PubMed Central

Bao, Yongbo; Liu, Xiao; Zhang, Weiwei; Cao, Jianping; Li, Wei; Li, Chenghua; Lin, Zhihua

2016-01-01

Clam, a filter-feeding lamellibranch mollusk, is capable to accumulate high levels of trace metals and has therefore become a model for investigation the mechanism of heavy metal toxification. In this study, the effects of cadmium were characterized in the gills of Tegillarca granosa during a 96-hour exposure course using integrated metabolomic and proteomic approaches. Neurotoxicity and disturbances in energy metabolism were implicated according to the metabolic responses after Cd exposure, and eventually affected the osmotic function of gill tissue. Proteomic analysis showed that oxidative stress, calcium-binding and sulfur-compound metabolism proteins were key factors responding to Cd challenge. A knowledge-based network regulation model was constructed with both metabolic and proteomic data. The model suggests that Cd stimulation mainly inhibits a core regulation network that is associated with histone function, ribosome processing and tight junctions, with the hub proteins actin, gamma 1 and Calmodulin 1. Moreover, myosin complex inhibition causes abnormal tight junctions and is linked to the irregular synthesis of amino acids. For the first time, this study provides insight into the proteomic and metabolomic changes caused by Cd in the blood clam T. granosa and suggests a potential toxicological pathway for Cd. PMID:27760991

A photoaffinity scan maps regions of the p85 SH2 domain involved in phosphoprotein binding.

PubMed

Williams, K P; Shoelson, S E

1993-03-15

Src homology 2 (SH2) domains are modular phosphotyrosine binding pockets found within a wide variety of cytoplasmic signaling molecules. Here we develop a new approach to analyzing protein-protein interfaces termed photoaffinity scanning, and apply the method to map regions of the phosphatidylinositol 3-kinase p85 SH2 domain that participate in phospho-protein binding. Each residue except phosphotyrosine (pY) within a tightly binding, IRS-1-derived phosphopeptide (GNGDpYMPMSPKS) was substituted with the photoactive amino acid, benzoylphenylalanine (Bpa). Whereas most substitutions had little effect on binding affinity, Bpa substitution of either Met (+1 and +3 with respect to pY) reduced affinity 50-100-fold to confirm their importance in the pYMXM recognition motif. In three cases photolysis of SH2 domain/Bpa phosphopeptide complexes led to cross-linking of > 50% of the SH2 domain; cross-link positions were identified by microsequence, amino acid composition, and electrospray mass spectrometric analyses. Bpa-1 cross-links within alpha-helix I, whereas Bpa+1 and Bpa+4 cross-link the SH2 domain within the flexible loop C-terminal to alpha-helix II. Moreover, cross-linking at any position prevents SH2 domain cleavage at a trypsin-sensitive site within the flexible loop between beta-strands 1 and 2. Therefore, at least three distinct SH2 regions in addition to the beta-sheet participate in phosphoprotein binding; the loop cross-linked by phosphopeptide residues C-terminal to pY appears to confer specificity to the phosphoprotein/SH2 domain interaction.

Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

NASA Astrophysics Data System (ADS)

Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

2017-01-01

Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2014-02-01

We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

Conductance of three-terminal molecular bridge based on tight-binding theory

NASA Astrophysics Data System (ADS)

Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

2005-05-01

The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordejon, P.; Lebedenko, D.; Menon, M.

1994-08-15

We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

Crystal structures of penicillin-binding protein 3 (PBP3) from methicillin-resistant Staphylococcus aureus in the apo and cefotaxime-bound forms.

PubMed

Yoshida, Hisashi; Kawai, Fumihiro; Obayashi, Eiji; Akashi, Satoko; Roper, David I; Tame, Jeremy R H; Park, Sam-Yong

2012-10-26

Staphylococcus aureus is a widespread Gram-positive opportunistic pathogen, and a methicillin-resistant form (MRSA) is particularly difficult to treat clinically. We have solved two crystal structures of penicillin-binding protein (PBP) 3 (PBP3) from MRSA, the apo form and a complex with the β-lactam antibiotic cefotaxime, and used electrospray mass spectrometry to measure its sensitivity to a variety of penicillin derivatives. PBP3 is a class B PBP, possessing an N-terminal non-penicillin-binding domain, sometimes called a dimerization domain, and a C-terminal transpeptidase domain. The model shows a different orientation of its two domains compared to earlier models of other class B PBPs and a novel, larger N-domain. Consistent with the nomenclature of "dimerization domain", the N-terminal region forms an apparently tight interaction with a neighboring molecule related by a 2-fold symmetry axis in the crystal structure. This dimer form is predicted to be highly stable in solution by the PISA server, but mass spectrometry and analytical ultracentrifugation provide unequivocal evidence that the protein is a monomer in solution. Copyright © 2012 Elsevier Ltd. All rights reserved.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

5,10-Methylene-5,6,7,8-tetrahydrofolate conformational transitions upon binding to thymidylate synthase: molecular mechanics and continuum solvent studies

NASA Astrophysics Data System (ADS)

Jarmuła, Adam; Cieplak, Piotr; Montfort, William R.

2005-02-01

We applied the molecular mechanics Poisson-Boltzmann surface area (MM-PBSA) approach to evaluate relative stability of the extended (flat) and C-shaped (bent) solution conformational forms of the 5,10-methylene-5,6,7,8-tetrahydrofolate (mTHF) molecule in aqueous solution. Calculations indicated that both forms have similar free energies in aqueous solution but detailed energy components are different. The bent solution form has lower intramolecular electrostatic and van der Waals interaction energies. The flat form has more favorable solvation free energy and lower contribution from the bond, angle and torsion angle molecular mechanical internal energies. We exploit these results and combine them with known crystallographic data to provide a model for the progressive binding of the mTHF molecule, a natural cofactor of thymidylate synthase (TS), to the complex forming in the TS-catalyzed reaction. We propose that at the time of initial weak binding in the open enzyme the cofactor molecule remains in a close balance between the flat and bent solution conformations, with neither form clearly favored. Later, thymidylate synthase undergoes conformational change leading to the closure of the active site and the mTHF molecule is withdrawn from the solvent. That effect shifts the thermodynamic equilibrium of the mTHF molecule toward the bent solution form. At the same time, burying the cofactor molecule in the closed active site produces numerous contacts between mTHF and protein that render change in the shape of the mTHF molecule. As a result, the bent solution conformer is converted to more strained L-shaped bent enzyme conformer of the mTHF molecule. The strain in the bent enzyme conformation allows for the tight binding of the cofactor molecule to the productive ternary complex that forms in the closed active site, and facilitates the protonation of the imidazolidine N10 atom, which promotes further reaction.

X-ray Raman scattering from molecules and solids in the framework of the Mahan-Nozières-De Dominicis model

NASA Astrophysics Data System (ADS)

Privalov, Timofei; Gel'mukhanov, Faris; Ågren, Hans

2001-10-01

We have developed a formulation of resonant x-ray Raman scattering of molecules and solids based on the Mahan-Nozières-De Dominicis model. A key step in the formulation is given by a reduction of the Keldysh-Dyson equations for the Green's function to a set of linear algebraic equations. This gave way for a tractable scheme that can be used to analyze the resonant x-ray scattering in the whole time domain. The formalism is used to investigate the role of core-hole relaxation, interference, band filling, detuning, and size of the scattering target. Numerical applications are performed with a one-dimensional tight-binding model.

Human Augmentation of Reasoning Through Patterning (HARP)

DTIC Science & Technology

2008-04-01

develop what we then referred to as “ Uber - CIM,” in which a set of independent but tightly-joined CIM models could be developed. However, although that...analysts to apply “tags” (keywords) to Web-based resources, and to see and leverage the tags and tagged resources of others. Catalyst is a modeling ...issues. Catalyst models consist of nodes of information organized into hierarchical tree structures. Nodes can contain attachments or links to tags

Ni2C surface carbide to catalyze low-temperature graphene growth

NASA Astrophysics Data System (ADS)

Martinez-Gordillo, Rafael; Varvenne, Céline; Amara, Hakim; Bichara, Christophe

2018-05-01

The possibility to grow a graphene layer using the chemical-vapor-deposition technique over a Ni2C /Ni (111 ) substrate has been identified experimentally, with the advantage of having a lower processing temperature (T <500 ∘C ), compared to standard growth over a Ni (111 ) surface. To understand the role of the metal carbide/metal catalyst, we first perform a static study of the Ni2C /Ni (111 ) structure and of the binding and removal of a carbon atom at the surface, using both a tight-binding (TB) energetic model and ab initio calculations. Grand-canonical Monte Carlo TB simulations then allow us (i) to determine the thermodynamic conditions to grow graphene and (ii) to separate key reaction steps in the growth mechanism explaining how the Ni2C /Ni (111 ) substrate catalyzes graphene formation at low temperature.

High-resolution Structures of Protein-Membrane Complexes by Neutron Reflection and MD Simulation: Membrane Association of the PTEN Tumor Suppressor

NASA Astrophysics Data System (ADS)

Lösche, Matthias

2012-02-01

The lipid matrix of biomembranes is an in-plane fluid, thermally and compositionally disordered leaflet of 5 nm thickness and notoriously difficult to characterize in structural terms. Yet, biomembranes are ubiquitous in the cell, and membrane-bound proteins are implicated in a variety of signaling pathways and intra-cellular transport. We developed methodology to study proteins associated with model membranes using neutron reflection measurements and showed recently that this approach can resolve the penetration depth and orientation of membrane proteins with ångstrom resolution if their crystal or NMR structure is known. Here we apply this technology to determine the membrane bindung and unravel functional details of the PTEN phosphatase, a key player in the PI3K apoptosis pathway. PTEN is an important regulatory protein and tumor suppressor that performs its phosphatase activity as an interfacial enzyme at the plasma membrane-cytoplasm boundary. Acting as an antagonist to phosphoinositide-3-kinase (PI3K) in cell signaling, it is deleted in many human cancers. Despite its importance in regulating the levels of the phosphoinositoltriphosphate PI(3,4,5)P3, there is little understanding of how PTEN binds to membranes, is activated and then acts as a phosphatase. We investigated the structure and function of PTEN by studying its membrane affinity and localization on in-plane fluid, thermally disordered synthetic membrane models. The membrane association of the protein depends strongly on membrane composition, where phosphatidylserine (PS) and phosphatidylinositol diphosphate (PI(4,5)P2) act synergetically in attracting the enzyme to the membrane surface. Membrane affinities depend strongly on membrane fluidity, which suggests multiple binding sites on the protein for PI(4,5)P2. Neutron reflection measurements show that the PTEN phosphatase ``scoots'' along the membrane surface (penetration < 5 å) but binds the membrane tightly with its two major domains, the C2 and phosphatase domains. In the bound state, PTEN's regulatory C-terminal tail is displaced from the membrane and organized on the far side of the protein, ˜ 60 å away from the bilayer surface, in a rather compact structure. The combination of binding studies and neutron reflection allows us to distinguish between PTEN mutant proteins and ultimately may identify the structural features required for membrane binding and activation of PTEN. Molecular dynamics simulations, currently in progress, refine this structural picture further.

A new method of evaluating tight gas sands pore structure from nuclear magnetic resonance (NMR) logs

NASA Astrophysics Data System (ADS)

Xiao, Liang; Mao, Zhi-qiang; Xie, Xiu-hong

2016-04-01

Tight gas sands always display such characteristics of ultra-low porosity, permeability, high irreducible water, low resistivity contrast, complicated pore structure and strong heterogeneity, these make that the conventional methods are invalid. Many effective gas bearing formations are considered as dry zones or water saturated layers, and cannot be identified and exploited. To improve tight gas sands evaluation, the best method is quantitative characterizing rock pore structure. The mercury injection capillary pressure (MICP) curves are advantageous in predicting formation pore structure. However, the MICP experimental measurements are limited due to the environment and economy factors, this leads formation pore structure cannot be consecutively evaluated. Nuclear magnetic resonance (NMR) logs are considered to be promising in evaluating rock pore structure. Generally, to consecutively quantitatively evaluate tight gas sands pore structure, the best method is constructing pseudo Pc curves from NMR logs. In this paper, based on the analysis of lab experimental results for 20 core samples, which were drilled from tight gas sandstone reservoirs of Sichuan basin, and simultaneously applied for lab MICP and NMR measurements, the relationships of piecewise power function between nuclear magnetic resonance (NMR) transverse relaxation T2 time and pore-throat radius Rc are established. A novel method, which is used to transform NMR reverse cumulative curve as pseudo capillary pressure (Pc) curve is proposed, and the corresponding model is established based on formation classification. By using this model, formation pseudo Pc curves can be consecutively synthesized. The pore throat radius distribution, and pore structure evaluation parameters, such as the average pore throat radius (Rm), the threshold pressure (Pd), the maximum pore throat radius (Rmax) and so on, can also be precisely extracted. After this method is extended into field applications, several tight gas sandstone reservoirs are processed, and the predicted results are compared with core derived results. Good consistency between evaluated results with core derived results illustrates the dependability of the proposed method. Comparing with the previous methods, this presented model is much more theoretical, and the applicability is much improved. Combining with the evaluated results, our target tight gas sands are well evaluated, and many potential gas-bearing layers are effectively identified.

A Comprehensive Numerical Model for Simulating Fluid Transport in Nanopores

PubMed Central

Zhang, Yuan; Yu, Wei; Sepehrnoori, Kamy; Di, Yuan

2017-01-01

Since a large amount of nanopores exist in tight oil reservoirs, fluid transport in nanopores is complex due to large capillary pressure. Recent studies only focus on the effect of nanopore confinement on single-well performance with simple planar fractures in tight oil reservoirs. Its impacts on multi-well performance with complex fracture geometries have not been reported. In this study, a numerical model was developed to investigate the effect of confined phase behavior on cumulative oil and gas production of four horizontal wells with different fracture geometries. Its pore sizes were divided into five regions based on nanopore size distribution. Then, fluid properties were evaluated under different levels of capillary pressure using Peng-Robinson equation of state. Afterwards, an efficient approach of Embedded Discrete Fracture Model (EDFM) was applied to explicitly model hydraulic and natural fractures in the reservoirs. Finally, three fracture geometries, i.e. non-planar hydraulic fractures, non-planar hydraulic fractures with one set natural fractures, and non-planar hydraulic fractures with two sets natural fractures, are evaluated. The multi-well performance with confined phase behavior is analyzed with permeabilities of 0.01 md and 0.1 md. This work improves the analysis of capillarity effect on multi-well performance with complex fracture geometries in tight oil reservoirs. PMID:28091599

A Comprehensive Numerical Model for Simulating Fluid Transport in Nanopores

NASA Astrophysics Data System (ADS)

Zhang, Yuan; Yu, Wei; Sepehrnoori, Kamy; di, Yuan

2017-01-01

Since a large amount of nanopores exist in tight oil reservoirs, fluid transport in nanopores is complex due to large capillary pressure. Recent studies only focus on the effect of nanopore confinement on single-well performance with simple planar fractures in tight oil reservoirs. Its impacts on multi-well performance with complex fracture geometries have not been reported. In this study, a numerical model was developed to investigate the effect of confined phase behavior on cumulative oil and gas production of four horizontal wells with different fracture geometries. Its pore sizes were divided into five regions based on nanopore size distribution. Then, fluid properties were evaluated under different levels of capillary pressure using Peng-Robinson equation of state. Afterwards, an efficient approach of Embedded Discrete Fracture Model (EDFM) was applied to explicitly model hydraulic and natural fractures in the reservoirs. Finally, three fracture geometries, i.e. non-planar hydraulic fractures, non-planar hydraulic fractures with one set natural fractures, and non-planar hydraulic fractures with two sets natural fractures, are evaluated. The multi-well performance with confined phase behavior is analyzed with permeabilities of 0.01 md and 0.1 md. This work improves the analysis of capillarity effect on multi-well performance with complex fracture geometries in tight oil reservoirs.

Improving Density Functional Tight Binding Predictions of Free Energy Surfaces for Slow Chemical Reactions in Solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

2017-06-01

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Improving density functional tight binding predictions of free energy surfaces for peptide condensation reactions in solution

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew; Goldman, Nir

First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

In Silico Analyses of Substrate Interactions with Human Serum Paraoxonase 1

DTIC Science & Technology

2008-01-01

substrate interactions of HuPON1 remains elusive. In this study, we apply homology modeling, docking, and molecular dynamic (MD) simulations to probe the...mod- eling; docking; molecular dynamics simulations ; binding free energy decomposition. 486 PROTEINS Published 2008 WILEY-LISS, INC. yThis article is a...apply homology modeling, docking, and molecular dynamic (MD) simulations to probe the binding interactions of HuPON1 with representative substrates. The

The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

PubMed

Vetrano, Stefania; Danese, Silvio

2009-05-01

Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

PubMed

Hopton, Suzanne R; Thompson, Andrew S

2011-05-17

Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

Instability of superfluid Fermi gases induced by a rotonlike density mode in optical lattices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yunomae, Yoshihiro; Yamamoto, Daisuke; Danshita, Ippei

2009-12-15

We study the stability of superfluid Fermi gases in deep optical lattices in the BCS-Bose-Einstein condensation (BEC) crossover at zero temperature. Within the tight-binding attractive Hubbard model, we calculate the spectrum of the low-energy Anderson-Bogoliubov (AB) mode as well as the single-particle excitations in the presence of superfluid flow in order to determine the critical velocities. To obtain the spectrum of the AB mode, we calculate the density response function in the generalized random-phase approximation applying the Green's function formalism developed by Cote and Griffin to the Hubbard model. We find that the spectrum of the AB mode is separatedmore » from the particle-hole continuum having the characteristic rotonlike minimum at short wavelength due to the strong charge-density-wave fluctuations. The energy of the rotonlike minimum decreases with increasing the lattice velocity and it reaches zero at the critical velocity which is smaller than the pair-breaking velocity. This indicates that the superfluid state is energetically unstable due to the spontaneous emission of the short-wavelength rotonlike excitations of the AB mode instead due to pair breaking. We determine the critical velocities as functions of the interaction strength across the BCS-BEC crossover regime.« less

Hydrogen behaviour at twist {110} grain boundaries in α-Fe

NASA Astrophysics Data System (ADS)

McEniry, Eunan J.; Hickel, Tilmann; Neugebauer, Jörg

2017-06-01

The behaviour of hydrogen at structural defects such as grain boundaries plays a critical role in the phenomenon of hydrogen embrittlement. However, characterization of the energetics and diffusion of hydrogen in the vicinity of such extended defects using conventional ab initio techniques is challenging due to the relatively large system sizes required when dealing with realistic grain boundary geometries. In order to be able to access the required system sizes, as well as high-throughput testing of a large number of configurations, while remaining within a quantum-mechanical framework, an environmental tight-binding model for the iron-hydrogen system has been developed. The resulting model is applied to study the behaviour of hydrogen at a class of low-energy {110}-terminated twist grain boundaries in α-Fe. We find that, for particular Σ values within the coincidence site lattice description, the atomic geometry at the interface plane provides extremely favourable trap sites for H, which also possess high escape barriers for diffusion. By contrast, via simulated tensile testing, weakly trapped hydrogen at the interface plane of the bulk-like Σ3 boundary acts as a `glue' for the boundary, increasing both the energetic barrier and the elongation to rupture. This article is part of the themed issue 'The challenges of hydrogen and metals'.

Hydrogen behaviour at twist {110} grain boundaries in α-Fe.

PubMed

McEniry, Eunan J; Hickel, Tilmann; Neugebauer, Jörg

2017-07-28

The behaviour of hydrogen at structural defects such as grain boundaries plays a critical role in the phenomenon of hydrogen embrittlement. However, characterization of the energetics and diffusion of hydrogen in the vicinity of such extended defects using conventional ab initio techniques is challenging due to the relatively large system sizes required when dealing with realistic grain boundary geometries. In order to be able to access the required system sizes, as well as high-throughput testing of a large number of configurations, while remaining within a quantum-mechanical framework, an environmental tight-binding model for the iron-hydrogen system has been developed. The resulting model is applied to study the behaviour of hydrogen at a class of low-energy {110}-terminated twist grain boundaries in α -Fe. We find that, for particular Σ values within the coincidence site lattice description, the atomic geometry at the interface plane provides extremely favourable trap sites for H, which also possess high escape barriers for diffusion. By contrast, via simulated tensile testing, weakly trapped hydrogen at the interface plane of the bulk-like Σ3 boundary acts as a 'glue' for the boundary, increasing both the energetic barrier and the elongation to rupture.This article is part of the themed issue 'The challenges of hydrogen and metals'. © 2017 The Author(s).

Steady-state and quench-dependent relaxation of a quantum dot coupled to one-dimensional leads

NASA Astrophysics Data System (ADS)

Nuss, Martin; Ganahl, Martin; Evertz, Hans Gerd; Arrigoni, Enrico; von der Linden, Wolfgang

2013-07-01

We study the time evolution and steady state of the charge current in a single-impurity Anderson model, using matrix product states techniques. A nonequilibrium situation is imposed by applying a bias voltage across one-dimensional tight-binding leads. Focusing on particle-hole symmetry, we extract current-voltage characteristics from universal low-bias up to high-bias regimes, where band effects start to play a dominant role. We discuss three quenches, which after strongly quench-dependent transients yield the same steady-state current. Among these quenches we identify those favorable for extracting steady-state observables. The period of short-time oscillations is shown to compare well to real-time renormalization group results for a simpler model of spinless fermions. We find indications that many-body effects play an important role at high-bias voltage and finite bandwidth of the metallic leads. The growth of entanglement entropy after a certain time scale ∝Δ-1 is the major limiting factor for calculating the time evolution. We show that the magnitude of the steady-state current positively correlates with entanglement entropy. The role of high-energy states for the steady-state current is explored by considering a damping term in the time evolution.

Continuum theory of edge states of topological insulators: variational principle and boundary conditions.

PubMed

Medhi, Amal; Shenoy, Vijay B

2012-09-05

We develop a continuum theory to model low energy excitations of a generic four-band time reversal invariant electronic system with boundaries. We propose a variational energy functional for the wavefunctions which allows us to derive natural boundary conditions valid for such systems. Our formulation is particularly suited for developing a continuum theory of the protected edge/surface excitations of topological insulators both in two and three dimensions. By a detailed comparison of our analytical formulation with tight binding calculations of ribbons of topological insulators modelled by the Bernevig-Hughes-Zhang (BHZ) Hamiltonian, we show that the continuum theory with a natural boundary condition provides an appropriate description of the low energy physics.

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Spin-selective electronic reconstruction in quantum ferromagnets: A view from the spin-asymmetric Hubbard model

NASA Astrophysics Data System (ADS)

Faúndez, J.; Jorge, T. N.; Craco, L.

2018-03-01

Using the tight-binding treatment for the spin-asymmetric Hubbard model we explore the effect of electronic interactions in the ferromagnetic, partially filled Lieb lattice. As a key result we demonstrate the formation of correlation satellites in the minority spin channel. In addition, we consider the role played by transverse-field spin fluctuations in metallic ferromagnets. We quantify the degree of electronic demagnetization, showing that the half-metallic state is rather robust to local spin flips. Not being restricted to the case of a partially filled Lieb lattice, our findings are expected to advance the general understanding of spin-selective electronic reconstruction in strongly correlated quantum ferromagnets.

Theory of nanotube faraday cage

NASA Astrophysics Data System (ADS)

Roxana Margine, Elena; Nisoli, Cristiano; Kolmogorov, Aleksey; Crespi, Vincent H.

2003-03-01

Charge transfer between dopants and double-wall carbon nanotubes is examined theoretically. We model the system as a triple cylindrical capacitor with the dopants forming a shell around the outer wall of the nanotube. The total energy of the system contains three terms: the band structure energies of the inner and outer tube, calculated in a tight-binding model with rigid bands, and the electrostatic energy of the tri-layer distribution. Even for metallic inner and outer tube walls, wherein the diameter dependence of the bandgap does not favor the outer wall, nearly all of the dopant charge resides on the outer layer, a nanometer-scale Faraday cage. The calculated charge distribution is in agreement with recent experimental measurements.

Opening-assisted coherent transport in the semiclassical regime

NASA Astrophysics Data System (ADS)

Zhang, Yang; Celardo, G. Luca; Borgonovi, Fausto; Kaplan, Lev

2017-02-01

We study quantum enhancement of transport in open systems in the presence of disorder and dephasing. Quantum coherence effects may significantly enhance transport in open systems even in the semiclassical regime (where the decoherence rate is greater than the intersite hopping amplitude), as long as the disorder is sufficiently strong. When the strengths of disorder and dephasing are fixed, there is an optimal opening strength at which the coherent transport enhancement is optimized. Analytic results are obtained in two simple paradigmatic tight-binding models of large systems: the linear chain and the fully connected network. The physical behavior is also reflected in the Fenna-Matthews-Olson (FMO) photosynthetic complex, which may be viewed as intermediate between these paradigmatic models.

Herpes Simplex Virus Processivity Factor UL42 Imparts Increased DNA-Binding Specificity to the Viral DNA Polymerase and Decreased Dissociation from Primer-Template without Reducing the Elongation Rate

PubMed Central

Weisshart, Klaus; Chow, Connie S.; Coen, Donald M.

1999-01-01

Herpes simplex virus DNA polymerase consists of a catalytic subunit, Pol, and a processivity subunit, UL42, that, unlike other established processivity factors, binds DNA directly. We used gel retardation and filter-binding assays to investigate how UL42 affects the polymerase-DNA interaction. The Pol/UL42 heterodimer bound more tightly to DNA in a primer-template configuration than to single-stranded DNA (ssDNA), while Pol alone bound more tightly to ssDNA than to DNA in a primer-template configuration. The affinity of Pol/UL42 for ssDNA was reduced severalfold relative to that of Pol, while the affinity of Pol/UL42 for primer-template DNA was increased ∼15-fold relative to that of Pol. The affinity of Pol/UL42 for circular double-stranded DNA (dsDNA) was reduced drastically relative to that of UL42, but the affinity of Pol/UL42 for short primer-templates was increased modestly relative to that of UL42. Pol/UL42 associated with primer-template DNA ∼2-fold faster than did Pol and dissociated ∼10-fold more slowly, resulting in a half-life of 2 h and a subnanomolar Kd. Despite such stable binding, rapid-quench analysis revealed that the rates of elongation of Pol/UL42 and Pol were essentially the same, ∼30 nucleotides/s. Taken together, these studies indicate that (i) Pol/UL42 is more likely than its subunits to associate with DNA in a primer-template configuration rather than nonspecifically to either ssDNA or dsDNA, and (ii) UL42 reduces the rate of dissociation from primer-template DNA but not the rate of elongation. Two models of polymerase-DNA interactions during replication that may explain these findings are presented. PMID:9847307

Mutation-linked, excessively tight interaction between the calmodulin binding domain and the C-terminal domain of the cardiac ryanodine receptor as a novel cause of catecholaminergic polymorphic ventricular tachycardia.

PubMed

Nishimura, Shigehiko; Yamamoto, Takeshi; Nakamura, Yoshihide; Kohno, Michiaki; Hamada, Yoriomi; Sufu, Yoko; Fukui, Go; Nanno, Takuma; Ishiguchi, Hironori; Kato, Takayoshi; Xu, Xiaojuan; Ono, Makoto; Oda, Tetsuro; Okuda, Shinichi; Kobayashi, Shigeki; Yano, Masafumi

2018-06-01

Ryanodine receptor (RyR2) is known to be a causal gene of catecholaminergic polymorphic ventricular tachycardia (CPVT), an important inherited disease. Some of the human CPVT-associated mutations have been found in a domain (4026-4172) that has EF hand motifs, the so-called calmodulin (CaM)-like domain (CaMLD). The purpose of this study was to investigate the underlying mechanism by which CPVT is induced by a mutation at CaMLD. A new N4103K/+ knock-in (KI) mice model was generated. Sustained ventricular tachycardia was frequently observed after infusion of caffeine plus epinephrine in KI mice. Endogenous CaM bound to RyR2 decreased even at baseline in isolated KI cardiomyocytes. Ca 2+ spark frequency (CaSpF) was much higher in KI cells than in wild-type cells. Addition of GSH-CaM (higher affinity CaM to RyR2) significantly decreased CaSpF. In response to isoproterenol, spontaneous Ca 2+ transient (SCaT) was frequently observed in intact KI cells. Incorporation of GSH-CaM into intact KI cells using a protein delivery kit decreased SCaT significantly. An assay using a quartz crystal microbalance technique revealed that mutated CaMLD peptide showed higher binding affinity to CaM binding domain (CaMBD) peptide. In the N4103K mutant, CaM binding affinity to RyR2 was significantly reduced regardless of beta-adrenergic stimulation. We found that this was caused by an abnormally tight interaction between CaMBD and mutated CaM-like domain (N4103K-CaMBD). Thus, CaMBD-CaMLD interaction may be a novel therapeutic target for treatment of lethal arrhythmia. Copyright © 2018 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

PubMed

Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

2006-12-01

Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.

The effects of the glycation of transferrin on chromium binding and the transport and distribution of chromium in vivo.

PubMed

Deng, Ge; Dyroff, Samantha L; Lockart, Molly; Bowman, Michael K; Vincent, John B

2016-11-01

Chromium (III) has been shown to act as a pharmacological agent improving insulin sensitivity in rodent models of obesity, insulin resistance, and diabetes. To act in beneficial fashion, chromium must reach insulin-sensitive tissues. Chromium is transported from the bloodstream to the tissues by the iron-transport protein transferrin. When blood concentrations of glucose are high (as in a diabetic subject), transferrin can be glycated, modifying its ability to bind and transport iron. However, the effects of glycation of transferrin on its ability to bind and transport Cr have not been examined previously. Storage of transferrin at 37°C in the presence and absence of glucose has significant effects on the binding of Cr. Transferrin stored in the absence of glucose only binds one equivalent of Cr tightly, compared to the normal binding of two equivalents of Cr by transferrin. Glycated transferrin (stored in the presence of glucose) binds two equivalents of Cr but the changes in its extinction coefficient at 245nm that accompany binding suggest that the Cr-bound transferrin possesses a conformation that deviates appreciably from untreated transferrin. These changes have dramatic effects, greatly reducing the ability of transferrin to transport Cr in vivo in rats. The results suggest that glycation of transferrin in subjects with high blood glucose concentrations should reduce the ability of Cr from pharmacological agents to enter tissues. Copyright © 2016 Elsevier Inc. All rights reserved.

Optical properties of drug metabolites in latent fingermarks

PubMed Central

Shen, Yao; Ai, Qing

2016-01-01

Drug metabolites usually have structures of split-ring resonators (SRRs), which might lead to negative permittivity and permeability in electromagnetic field. As a result, in the UV-vis region, the latent fingermarks images of drug addicts and non drug users are inverse. The optical properties of latent fingermarks are quite different between drug addicts and non-drug users. This is a technic superiority for crime scene investigation to distinguish them. In this paper, we calculate the permittivity and permeability of drug metabolites using tight-binding model. The latent fingermarks of smokers and non-smokers are given as an example. PMID:26838730

Electronic properties of long DNA nanowires in dry and wet conditions

NASA Astrophysics Data System (ADS)

Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

2015-11-01

The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.

Effect of Hydrogen Adsorption on the Stone-Wales Transformation in Small-Diameter Carbon Nanotubes

NASA Astrophysics Data System (ADS)

Openov, L. A.; Podlivaev, A. I.

2018-04-01

The effect of hydrogenation of (4, 0) and (3, 0) carbon nanotubes on the Stone-Wales transformation is studied in the framework of the nonorthogonal tight-binding model. It is shown that the atomic hydrogen adsorption can lead to both a decrease and an increase in the barriers for the direct and inverse transformations depending on the orientation of a rotating C-C bond with respect to the nanotube axis. The characteristic times of formation and annealing the Stone-Wales defects have been estimated. The Young's moduli have been calculated.

d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes

NASA Astrophysics Data System (ADS)

Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping

2018-04-01

We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.

Anisotropic Nanomechanics of Boron Nitride Nanotubes: Nanostructured "Skin" Effect

NASA Technical Reports Server (NTRS)

Srivastava, Deepak; Menon, Madhu; Cho, KyeongJae

2000-01-01

The stiffness and plasticity of boron nitride nanotubes are investigated using generalized tight-binding molecular dynamics and ab-initio total energy methods. Due to boron-nitride BN bond buckling effects, compressed zigzag BN nanotubes are found to undergo novel anisotropic strain release followed by anisotropic plastic buckling. The strain is preferentially released towards N atoms in the rotated BN bonds. The tubes buckle anisotropically towards only one end when uniaxially compressed from both. A "skin-effect" model of smart nanocomposite materials is proposed which will localize the structural damage towards the 'skin' or surface side of the material.

Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe.

PubMed

Gurevich, A S; Kochereshko, V P; Bleuse, J; Mariette, H; Waag, A; Akimoto, R

2011-09-07

The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.

Observation of interface carrier states in no-common-atom heterostructures ZnSe/BeTe

NASA Astrophysics Data System (ADS)

Gurevich, A. S.; Kochereshko, V. P.; Bleuse, J.; Mariette, H.; Waag, A.; Akimoto, R.

2011-09-01

The existence of intrinsic carrier interface states in heterostructures with no common atom at the interface (such as ZnSe/BeTe) is shown experimentally by ellipsometry and photoluminescence spectroscopy. These states are located on interfaces and lie inside the effective bandgap of the structure; they are characterized by a high density and a long lifetime. A tight binding model confirms theoretically the existence of these states in ZnSe/BeTe heterostructures for a ZnTe-type interface, in contrast to the case of the BeSe-type interface for which they do not exist.

Many-body instabilities and mass generation in slow Dirac materials

NASA Astrophysics Data System (ADS)

Triola, Christopher; Zhu, Jianxin; Migliori, Albert; Balatsky, Alexander

2015-03-01

Some Kondo insulators are expected to possess topologically protected surface states with linear Dirac spectrum, the topological Kondo insulators. Because the bulk states of these systems typically have heavy effective electron masses, the surface states may exhibit extraordinarily small Fermi velocities that could force the effective fine structure constant of the surface states into the strong coupling regime. Using a tight-binding model we study the many-body instabilities of these systems and identify regions of parameter space for which antiferromagnetic, ferromagnetic and charge density wave instabilities occur. Work Supported by USDOE BES E304.

Thermally induced charge current through long molecules

NASA Astrophysics Data System (ADS)

Zimbovskaya, Natalya A.; Nitzan, Abraham

2018-01-01

In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

Structural basis of kynurenine 3-monooxygenase inhibition.

PubMed

Amaral, Marta; Levy, Colin; Heyes, Derren J; Lafite, Pierre; Outeiro, Tiago F; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S

2013-04-18

Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (that is, kynurenine pathway), leads to amelioration of Huntington's-disease-relevant phenotypes in yeast, fruitfly and mouse models, as well as in a mouse model of Alzheimer's disease. KMO is a flavin adenine dinucleotide (FAD)-dependent monooxygenase and is located in the outer mitochondrial membrane where it converts l-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders, as well as cancer and several peripheral inflammatory conditions. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained unknown. Here we report the first crystal structure of Saccharomyces cerevisiae KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active-site structure, preventing productive binding of the substrate l-kynurenine. Functional assays and targeted mutagenesis reveal that the active-site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO-UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington's, Alzheimer's and Parkinson's diseases.

Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

NASA Astrophysics Data System (ADS)

Chegel, Raad; Behzad, Somayeh

2012-02-01

The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

NASA Astrophysics Data System (ADS)

Graefe, E. M.; Korsch, H. J.; Rush, A.

2016-07-01

Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

NASA Astrophysics Data System (ADS)

Korol, Roman; Kilgour, Michael; Segal, Dvira

2018-03-01

We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

Communication: Charge-population based dispersion interactions for molecules and materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

2016-04-21

We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

Reusable Component Model Development Approach for Parallel and Distributed Simulation

PubMed Central

Zhu, Feng; Yao, Yiping; Chen, Huilong; Yao, Feng

2014-01-01

Model reuse is a key issue to be resolved in parallel and distributed simulation at present. However, component models built by different domain experts usually have diversiform interfaces, couple tightly, and bind with simulation platforms closely. As a result, they are difficult to be reused across different simulation platforms and applications. To address the problem, this paper first proposed a reusable component model framework. Based on this framework, then our reusable model development approach is elaborated, which contains two phases: (1) domain experts create simulation computational modules observing three principles to achieve their independence; (2) model developer encapsulates these simulation computational modules with six standard service interfaces to improve their reusability. The case study of a radar model indicates that the model developed using our approach has good reusability and it is easy to be used in different simulation platforms and applications. PMID:24729751

Interactions of 2’-O-methyl oligoribonucleotides with the RNA models of the 30S subunit A-site

PubMed Central

Jasiński, Maciej; Kulik, Marta; Wojciechowska, Monika; Stolarski, Ryszard

2018-01-01

Synthetic oligonucleotides targeting functional regions of the prokaryotic rRNA could be promising antimicrobial agents. Indeed, such oligonucleotides were proven to inhibit bacterial growth. 2’-O-methylated (2’-O-Me) oligoribonucleotides with a sequence complementary to the decoding site in 16S rRNA were reported as inhibitors of bacterial translation. However, the binding mode and structures of the formed complexes, as well as the level of selectivity of the oligonucleotides between the prokaryotic and eukaryotic target, were not determined. We have analyzed three 2’-O-Me oligoribonucleotides designed to hybridize with the models of the prokaryotic rRNA containing two neighboring aminoglycoside binding pockets. One pocket is the paromomycin/kanamycin binding site corresponding to the decoding site in the small ribosomal subunit and the other one is the close-by hygromycin B binding site whose dynamics has not been previously reported. Molecular dynamics (MD) simulations, as well as isothermal titration calorimetry, gel electrophoresis and spectroscopic studies have shown that the eukaryotic rRNA model is less conformationally stable (in terms of hydrogen bonds and stacking interactions) than the corresponding prokaryotic one. In MD simulations of the eukaryotic construct, the nucleotide U1498, which plays an important role in correct positioning of mRNA during translation, is flexible and spontaneously flips out into the solvent. In solution studies, the 2’-O-Me oligoribonucleotides did not interact with the double stranded rRNA models but all formed stable complexes with the single-stranded prokaryotic target. 2’-O-Me oligoribonucleotides with one and two mismatches bound less tightly to the eukaryotic target. This shows that at least three mismatches between the 2’-O-Me oligoribonucleotide and eukaryotic rRNA are required to ensure target selectivity. The results also suggest that, in the ribosome environment, the strand invasion is the preferred binding mode of 2’-O-Me oligoribonucleotides targeting the aminoglycoside binding sites in 16S rRNA. PMID:29351348

Rce1, a novel transcriptional repressor, regulates cellulase gene expression by antagonizing the transactivator Xyr1 in Trichoderma reesei.

PubMed

Cao, Yanli; Zheng, Fanglin; Wang, Lei; Zhao, Guolei; Chen, Guanjun; Zhang, Weixin; Liu, Weifeng

2017-07-01

Cellulase gene expression in the model cellulolytic fungus Trichoderma reesei is supposed to be controlled by an intricate regulatory network involving multiple transcription factors. Here, we identified a novel transcriptional repressor of cellulase gene expression, Rce1. Disruption of the rce1 gene not only facilitated the induced expression of cellulase genes but also led to a significant delay in terminating the induction process. However, Rce1 did not participate in Cre1-mediated catabolite repression. Electrophoretic mobility shift (EMSA) and DNase I footprinting assays in combination with chromatin immunoprecipitation (ChIP) demonstrated that Rce1 could bind directly to a cbh1 (cellobiohydrolase 1-encoding) gene promoter region containing a cluster of Xyr1 binding sites. Furthermore, competitive binding assays revealed that Rce1 antagonized Xyr1 from binding to the cbh1 promoter. These results indicate that intricate interactions exist between a variety of transcription factors to ensure tight and energy-efficient regulation of cellulase gene expression in T. reesei. This study also provides important clues regarding increased cellulase production in T. reesei. © 2017 John Wiley & Sons Ltd.

Assembly of streptolysin O pores assessed by quartz crystal microbalance and atomic force microscopy provides evidence for the formation of anchored but incomplete oligomers.

PubMed

Stewart, Sarah E; D'Angelo, Michael E; Paintavigna, Stefania; Tabor, Rico F; Martin, Lisandra L; Bird, Phillip I

2015-01-01

Streptolysin O (SLO) is a bacterial pore forming protein that is part of the cholesterol dependent cytolysin (CDC) family. We have used quartz crystal microbalance with dissipation monitoring (QCM-D) to examine SLO membrane binding and pore formation. In this system, SLO binds tightly to cholesterol-containing membranes, and assembles into partial and complete pores confirmed by atomic force microscopy. SLO binds to the lipid bilayer at a single rate consistent with the Langmuir isotherm model of adsorption. Changes in dissipation illustrate that SLO alters the viscoelastic properties of the bilayer during pore formation, but there is no loss of material from the bilayer as reported for small membrane-penetrating peptides. SLO mutants were used to further dissect the assembly and insertion processes by QCM-D. This shows the signature of SLO in QCM-D changes when pore formation is inhibited, and that bound and inserted SLO forms can be distinguished. Furthermore a pre-pore locked SLO mutant binds reversibly to lipid, suggesting that the partially complete wtSLO forms observed by AFM are anchored to the membrane. Copyright © 2014 Elsevier B.V. All rights reserved.

Efficient electron open boundaries for simulating electrochemical cells

NASA Astrophysics Data System (ADS)

Zauchner, Mario G.; Horsfield, Andrew P.; Todorov, Tchavdar N.

2018-01-01

Nonequilibrium electrochemistry raises new challenges for atomistic simulation: we need to perform molecular dynamics for the nuclear degrees of freedom with an explicit description of the electrons, which in turn must be free to enter and leave the computational cell. Here we present a limiting form for electron open boundaries that we expect to apply when the magnitude of the electric current is determined by the drift and diffusion of ions in a solution and which is sufficiently computationally efficient to be used with molecular dynamics. We present tight-binding simulations of a parallel-plate capacitor with nothing, a dimer, or an atomic wire situated in the space between the plates. These simulations demonstrate that this scheme can be used to perform molecular dynamics simulations when there is an applied bias between two metal plates with, at most, weak electronic coupling between them. This simple system captures some of the essential features of an electrochemical cell, suggesting this approach might be suitable for simulations of electrochemical cells out of equilibrium.

Regulatable killing of eukaryotic cells by the prokaryotic proteins Kid and Kis

PubMed Central

de la Cueva-Méndez, Guillermo; Mills, Anthony D.; Clay-Farrace, Lorena; Díaz-Orejas, Ramón; Laskey, Ronald A.

2003-01-01

Plasmid R1 inhibits growth of bacteria by synthesizing an inhibitor of cell proliferation, Kid, and a neutralizing antidote, Kis, which binds tightly to the toxin. Here we report that this toxin and antidote, which have evolved to function in bacteria, also function efficiently in a wide range of eukaryotes. Kid inhibits cell proliferation in yeast, Xenopus laevis and human cells, whilst Kis protects. Moreover, we show that Kid triggers apoptosis in human cells. These effects can be regulated in vivo by modulating the relative amounts of antidote and toxin using inducible eukaryotic promoters for independent transcriptional control of their genes. These findings allow highly regulatable, selective killing of eukaryotic cells, and could be applied to eliminate cancer cells or specific cell lineages in development. PMID:12514130

Transition States and transition state analogue interactions with enzymes.

PubMed

Schramm, Vern L

2015-04-21

Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

PubMed Central

Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

2009-01-01

Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

PubMed

Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

2017-11-16

The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

Antifreeze Protein Binds Irreversibly to Ice

NASA Astrophysics Data System (ADS)

Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

2006-03-01

Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

Quantitative analyses of bifunctional molecules.

PubMed

Braun, Patrick D; Wandless, Thomas J

2004-05-11

Small molecules can be discovered or engineered to bind tightly to biologically relevant proteins, and these molecules have proven to be powerful tools for both basic research and therapeutic applications. In many cases, detailed biophysical analyses of the intermolecular binding events are essential for improving the activity of the small molecules. These interactions can often be characterized as straightforward bimolecular binding events, and a variety of experimental and analytical techniques have been developed and refined to facilitate these analyses. Several investigators have recently synthesized heterodimeric molecules that are designed to bind simultaneously with two different proteins to form ternary complexes. These heterodimeric molecules often display compelling biological activity; however, they are difficult to characterize. The bimolecular interaction between one protein and the heterodimeric ligand (primary dissociation constant) can be determined by a number of methods. However, the interaction between that protein-ligand complex and the second protein (secondary dissociation constant) is more difficult to measure due to the noncovalent nature of the original protein-ligand complex. Consequently, these heterodimeric compounds are often characterized in terms of their activity, which is an experimentally dependent metric. We have developed a general quantitative mathematical model that can be used to measure both the primary (protein + ligand) and secondary (protein-ligand + protein) dissociation constants for heterodimeric small molecules. These values are largely independent of the experimental technique used and furthermore provide a direct measure of the thermodynamic stability of the ternary complexes that are formed. Fluorescence polarization and this model were used to characterize the heterodimeric molecule, SLFpYEEI, which binds to both FKBP12 and the Fyn SH2 domain, demonstrating that the model is useful for both predictive as well as ex post facto analytical applications.

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

PubMed Central

Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

2011-01-01

RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

PubMed

Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

2011-04-29

RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

Engineering Encodable Lanthanide-Binding Tags (LBTs) into Loop Regions of Proteins

PubMed Central

Barthelmes, Katja; Reynolds, Anne M.; Peisach, Ezra; Jonker, Hendrik R. A.; DeNunzio, Nicholas J.; Allen, Karen N.; Imperiali, Barbara; Schwalbe, Harald

2011-01-01

Lanthanide-binding-tags (LBTs) are valuable tools for investigation of protein structure, function, and dynamics by NMR spectroscopy, X-ray crystallography and luminescence studies. We have inserted LBTs into three different loop positions (denoted L, R, and S) of the model protein interleukin-1β and varied the length of the spacer between the LBT and the protein (denoted 1-3). Luminescence studies demonstrate that all nine constructs bind Tb3+ tightly in the low nanomolar range. No significant change in the fusion protein occurs from insertion of the LBT, as shown by two X-ray crystallographic structures of the IL1β-S1 and IL1β-L3 constructs and for the remaining constructs by comparing 1H-15N-HSQC NMR spectra with wild-type IL1β. Additionally, binding of LBT-loop IL1β proteins to their native binding partner in vitro remains unaltered. X-ray crystallographic phasing was successful using only the signal from the bound lanthanide. Large residual dipolar couplings (RDCs) could be determined by NMR spectroscopy for all LBT-loop-constructs and revealed that the LBT-2 series were rigidly incorporated into the interleukin-1β structure. The paramagnetic NMR spectra of loop-LBT mutant IL1β-R2 were assigned and the Δχ tensor components were calculated based on RDCs and pseudocontact shifts (PCSs). A structural model of the IL1β-R2 construct was calculated using the paramagnetic restraints. The current data provide support that encodable LBTs serve as versatile biophysical tags when inserted into loop regions of proteins of known structure or predicted via homology modelling. PMID:21182275

AFRRI Reports, Second Quarter 1994

DTIC Science & Technology

1994-08-01

the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

Triazole biotin: a tight-binding biotinidase-resistant conjugate.

PubMed

Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

2013-11-28

The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

Regulation of transcriptional activators by DNA-binding domain ubiquitination

PubMed Central

Landré, Vivien; Revi, Bhindu; Mir, Maria Gil; Verma, Chandra; Hupp, Ted R; Gilbert, Nick; Ball, Kathryn L

2017-01-01

Ubiquitin is a key component of the regulatory network that maintains gene expression in eukaryotes, yet the molecular mechanism(s) by which non-degradative ubiquitination modulates transcriptional activator (TA) function is unknown. Here endogenous p53, a stress-activated transcription factor required to maintain health, is stably monoubiquitinated, following pathway activation by IR or Nutlin-3 and localized to the nucleus where it becomes tightly associated with chromatin. Comparative structure–function analysis and in silico modelling demonstrate a direct role for DNA-binding domain (DBD) monoubiquitination in TA activation. When attached to the DBD of either p53, or a second TA IRF-1, ubiquitin is orientated towards, and makes contact with, the DNA. The contact is made between a predominantly cationic surface on ubiquitin and the anionic DNA. Our data demonstrate an unexpected role for ubiquitin in the mechanism of TA-activity enhancement and provides insight into a new level of transcriptional regulation. PMID:28362432

Evaluation of vibrated fluidized bed techniques in coating hemosorbents.

PubMed

Morley, D B

1991-06-01

A coating technique employing a vibrated fluidized bed was used to apply an ultrathin (2 microns) cellulose nitrate coating to synthetic bead activated charcoal. In vitro characteristics of the resulting coated sorbent, including permeability to model small and middle molecules, and mechanical integrity, were evaluated to determine the suitability of the process in coating granular sorbents used in hemoperfusion. Initial tests suggest the VFB-applied CN coating is both highly uniform and tightly adherent and warrants further investigation as a hemosorbent coating.

Electrical design of InAs-Sb/GaSb superlattices for optical detectors using full bandstructure sp3s* tight-binding method and Bloch boundary conditions

NASA Astrophysics Data System (ADS)

Mir, Raja N.; Frensley, William R.

2013-10-01

InAs-Sb/GaSb type-II strain compensated superlattices (SLS) are currently being used in mid-wave and long-wave infrared photodetectors. The electronic bandstructure of InSb and GaSb shows very strong anisotropy and non-parabolicity close to the Γ-point for the conduction band (CB) minimum and the valence band (VB) maximum. Particularly around the energy range of 45-80 meV from band-edge we observe strong non-parabolicity in the CB and light hole VB. The band-edge dispersion determines the electrical properties of a material. When the bulk materials are combined to form a superlattice we need a model of bandstructure which takes into account the full bandstructure details of the constituents and also the strong interaction between the conduction band of InAs and valence bands of GaSb. There can also be contact potentials near the interface between two dissimilar superlattices which will not be captured unless a full bandstructure calculation is done. In this study, we have done a calculation using second nearest neighbor tight binding model in order to accurately reproduce the effective masses. The calculation of mini-band structure is done by finding the wavefunctions within one SL period subject to Bloch boundary conditions ψ(L)=ψ(0)eikL. We demonstrate in this paper how a calculation of carrier concentration as a function of the position of the Fermi level (EF) within bandgap(Eg) should be done in order to take into account the full bandstructure of broken-bandgap material systems. This calculation is key for determining electron transport particularly when we have an interface between two dissimilar superlattices.

Majorana quasiparticles in semiconducting carbon nanotubes

NASA Astrophysics Data System (ADS)

Marganska, Magdalena; Milz, Lars; Izumida, Wataru; Strunk, Christoph; Grifoni, Milena

2018-02-01

Engineering effective p -wave superconductors hosting Majorana quasiparticles (MQPs) is nowadays of particular interest, also in view of the possible utilization of MQPs in fault-tolerant topological quantum computation. In quasi-one-dimensional systems, the parameter space for topological superconductivity is significantly reduced by the coupling between transverse modes. Together with the requirement of achieving the topological phase under experimentally feasible conditions, this strongly restricts in practice the choice of systems which can host MQPs. Here, we demonstrate that semiconducting carbon nanotubes (CNTs) in proximity with ultrathin s -wave superconductors, e.g., exfoliated NbSe2, satisfy these needs. By precise numerical tight-binding calculations in the real space, we show the emergence of localized zero-energy states at the CNT ends above a critical value of the applied magnetic field, of which we show the spatial evolution. Knowing the microscopic wave functions, we unequivocally demonstrate the Majorana nature of the localized states. An effective four-band model in the k -space, with parameters determined from the numerical spectrum, is used to calculate the topological phase diagram and its phase boundaries in analytic form. Finally, the impact of symmetry breaking contributions, like disorder and an axial component of the magnetic field, is investigated.

Wavefunctions, quantum diffusion, and scaling exponents in golden-mean quasiperiodic tilings.

PubMed

Thiem, Stefanie; Schreiber, Michael

2013-02-20

We study the properties of wavefunctions and the wavepacket dynamics in quasiperiodic tight-binding models in one, two, and three dimensions. The atoms in the one-dimensional quasiperiodic chains are coupled by weak and strong bonds aligned according to the Fibonacci sequence. The associated d-dimensional quasiperiodic tilings are constructed from the direct product of d such chains, which yields either the hypercubic tiling or the labyrinth tiling. This approach allows us to consider fairly large systems numerically. We show that the wavefunctions of the system are multifractal and that their properties can be related to the structure of the system in the regime of strong quasiperiodic modulation by a renormalization group (RG) approach. We also study the dynamics of wavepackets to get information about the electronic transport properties. In particular, we investigate the scaling behaviour of the return probability of the wavepacket with time. Applying again the RG approach we show that in the regime of strong quasiperiodic modulation the return probability is governed by the underlying quasiperiodic structure. Further, we also discuss lower bounds for the scaling exponent of the width of the wavepacket and propose a modified lower bound for the absolute continuous regime.

Following the Viterbi Path to Deduce Flagellar Actin-Interacting Proteins of Leishmania spp.: Report on Cofilins and Twinfilins

NASA Astrophysics Data System (ADS)

Pacheco, Ana Carolina L.; Araújo, Fabiana F.; Kamimura, Michel T.; Medeiros, Sarah R.; Viana, Daniel A.; Oliveira, Fátima de Cássia E.; Filho, Raimundo Araújo; Costa, Marcília P.; Oliveira, Diana M.

2007-11-01

For performing vital cellular processes, such as motility, eukaryotic cells rely on the actin cytoskeleton, whose structure and dynamics are tightly controlled by a large number of actin-interacting (AIP) or actin-related/regulating (ARP) proteins. Trypanosomatid protozoa, such as Leishmania, rely on their flagellum for motility and sensory reception, which are believed to allow parasite migration, adhesion, invasion and even persistence on mammalian host tissues to cause disease. Actin can determine cell stiffness and transmit force during mechanotransduction, cytokinesis, cell motility and other cellular shape changes, while the identification and analyses of AIPs can help to improve understanding of their mechanical properties on physiological architectures, such as the present case regarding Leishmania flagellar apparatus. This work conveniently apply bioinformatics tools in some refined pattern recognition techniques (such as hidden Markov models (HMMs) through the Viterbi algorithm/path) in order to improve the recognition of actin-binding/interacting activity through identification of AIPs in genomes, transcriptomes and proteomes of Leishmania species. We here report cofilin and twinfilin as putative components of the flagellar apparatus, a direct bioinformatics contribution in the secondary annotation of Leishmania and trypanosomatid genomes.

Master equation for open two-band systems and its applications to Hall conductance

NASA Astrophysics Data System (ADS)

Shen, H. Z.; Zhang, S. S.; Dai, C. M.; Yi, X. X.

2018-02-01

Hall conductivity in the presence of a dephasing environment has recently been investigated with a dissipative term introduced phenomenologically. In this paper, we study the dissipative topological insulator (TI) and its topological transition in the presence of quantized electromagnetic environments. A Lindblad-type equation is derived to determine the dynamics of a two-band system. When the two-band model describes TIs, the environment may be the fluctuations of radiation that surround the TIs. We find the dependence of decay rates in the master equation on Bloch vectors in the two-band system, which leads to a mixing of the band occupations. Hence the environment-induced current is in general not perfectly topological in the presence of coupling to the environment, although deviations are small in the weak limit. As an illustration, we apply the Bloch-vector-dependent master equation to TIs and calculate the Hall conductance of tight-binding electrons in a two-dimensional lattice. The influence of environments on the Hall conductance is presented and discussed. The calculations show that the phase transition points of the TIs are robust against the quantized electromagnetic environment. The results might bridge the gap between quantum optics and topological photonic materials.

Downstream DNA Tension Regulates the Stability of the T7 RNA Polymerase Initiation Complex

PubMed Central

Skinner, Gary M.; Kalafut, Bennett S.; Visscher, Koen

2011-01-01

Gene transcription by the enzyme RNA polymerase is tightly regulated. In many cases, such as in the lac operon in Escherichia coli, this regulation is achieved through the action of protein factors on DNA. Because DNA is an elastic polymer, its response to enzymatic processing can lead to mechanical perturbations (e.g., linear stretching and supercoiling) that can affect the operation of other DNA processing complexes acting elsewhere on the same substrate molecule. Using an optical-tweezers assay, we measured the binding kinetics between single molecules of bacteriophage T7 RNA polymerase and DNA, as a function of tension. We found that increasing DNA tension under conditions that favor formation of the open complex results in destabilization of the preinitiation complex. Furthermore, with zero ribonucleotides present, when the closed complex is favored, we find reduced tension sensitivity, implying that it is predominantly the open complex that is sensitive. This result strongly supports the “scrunching” model for T7 transcription initiation, as the applied tension acts against the movement of the DNA into the scrunched state, and introduces linear DNA tension as a potential regulatory quantity for transcription initiation. PMID:21320448

Playing relativistic billiards beyond graphene

NASA Astrophysics Data System (ADS)

Sadurní, E.; Seligman, T. H.; Mortessagne, F.

2010-05-01

The possibility of using hexagonal structures in general, and graphene in particular, to emulate the Dirac equation is the topic under consideration here. We show that Dirac oscillators with or without rest mass can be emulated by distorting a tight-binding model on a hexagonal structure. In the quest to make a toy model for such relativistic equations, we first show that a hexagonal lattice of attractive potential wells would be a good candidate. Firstly, we consider the corresponding one-dimensional (1D) model giving rise to a 1D Dirac oscillator and then construct explicitly the deformations needed in the 2D case. Finally, we discuss how such a model can be implemented as an electromagnetic billiard using arrays of dielectric resonators between two conducting plates that ensure evanescent modes outside the resonators for transversal electric modes, and we describe a feasible experimental setup.

Analysis of molecular assemblies by flow cytometry: determinants of Gi1 and by binding

NASA Astrophysics Data System (ADS)

Sarvazyan, Noune A.; Neubig, Richard R.

1998-05-01

We report here a novel application of flow cytometry for the quantitative analysis of the high affinity interaction between membrane proteins both in detergent solutions and when reconstituted into lipid vesicles. The approach is further advanced to permit the analysis of binding to expressed protein complexes in native cell membranes. The G protein heterotrimer signal transduction function links the extracellularly activated transmembrane receptors and intracellular effectors. Upon activation, (alpha) and (beta) (gamma) subunits of G protein undergo a dissociation/association cycle on the cell membrane interface. The binding parameters of solubilized G protein (alpha) and (beta) (gamma) subunits have been defined but little is known quantitatively about their interactions in the membrane. Using a novel flow cytometry approach, the binding of low nanomolar concentrations of fluorescein-labeled G(alpha) i1 (F- (alpha) ) to (beta) (gamma) both in detergent solution and in a lipid environment was quantitatively compared. Unlabeled (beta) $gama reconstituted in biotinylated phospholipid vesicles bound F-(alpha) tightly (Kd 6 - 12 nM) while the affinity for biotinylated-(beta) (gamma) in Lubrol was even higher (Kd of 2.9 nM). The application of this approach to proteins expressed in native cell membranes will advance our understanding of G protein function in context of receptor and effector interaction. More generally, this approach can be applied to study the interaction of any fluorescently labeled protein with a membrane protein which can be expressed in Sf9 plasma membranes.

In vivo imaging of hepatocellular carcinoma using a glypican-3-binding peptide based probe

NASA Astrophysics Data System (ADS)

Zhang, Qi; Han, Zhihao; Zhang, Wancun; Qian, Zhiyu; Gu, Yueqing

2017-02-01

Hepatocellular carcinoma (HCC) has been the third most common cause of cancer-related death worldwide. Glypican-3 (GPC3) is a heparin sulfate proteoglycan linked to the cell membrane by a glycosyl-phosphatidylinositol anchor (GPI) and is expressed by 75% of all hepatocellular carcinomas but undetectable in healthy liver tissue or liver with focal lesions. What's more, GPC3 has been gradually applied in clinical applications as a specific indicator for the early detection and prognosis of HCC. As GPC3 can also regulate many pathways in HCC pathogenesis including Wnt, Hh and Yap signaling, it has been shown that GPC3 knockdown can inhibit HCC growth, reinforcing the important roles of GPC3 in HCC development. For HCC early detection, we designed a peptide targeting GPC3 that allows to establish a fluorescent dyes-labeled probe. Firstly, according to the structure of the GPC3 antibody GC33 and the positive peptide reported in the literature, we generated a peptide consisting of twelve amino acids named 12P that may bind to GPC3 with tight binding ability and specificity. In vitro testing, we utilized FCM and laser confocal microscopy to verify its specificity of targeting to the high expression cells of GPC3. What's more, we linked 12P with a near infrared dye to verify its in vivo targeting ability. All results indicated that 12P possessed potent binding capacity which could be used as a targeting module in GPC3 detection probe.

Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

PubMed Central

Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

2013-01-01

Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

PubMed

Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

2014-01-01

Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria

2016-08-15

Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP 2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL -) with a distinct second site is required for high PIP 2sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP 2sensitivity, even in the absence of PL -. Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP 2(2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domainmore » (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL -binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP 2site and explaining the positive allostery between PL -binding and PIP 2sensitivity.« less

Increasing the potency of an alhydrogel-formulated anthrax vaccine by minimizing antigen-adjuvant interactions.

PubMed

Watkinson, Allan; Soliakov, Andrei; Ganesan, Ashok; Hirst, Karie; Lebutt, Chris; Fleetwood, Kelly; Fusco, Peter C; Fuerst, Thomas R; Lakey, Jeremy H

2013-11-01

Aluminum salts are the most widely used vaccine adjuvants, and phosphate is known to modulate antigen-adjuvant interactions. Here we report an unexpected role for phosphate buffer in an anthrax vaccine (SparVax) containing recombinant protective antigen (rPA) and aluminum oxyhydroxide (AlOH) adjuvant (Alhydrogel). Phosphate ions bind to AlOH to produce an aluminum phosphate surface with a reduced rPA adsorption coefficient and binding capacity. However, these effects continued to increase as the free phosphate concentration increased, and the binding of rPA changed from endothermic to exothermic. Crucially, phosphate restored the thermostability of bound rPA so that it resembled the soluble form, even though it remained tightly bound to the surface. Batches of vaccine with either 0.25 mM (subsaturated) or 4 mM (saturated) phosphate were tested in a disease model at batch release, which showed that the latter was significantly more potent. Both formulations retained their potency for 3 years. The strongest aluminum adjuvant effects are thus likely to be via weakly attached or easily released native-state antigen proteins.

Ubiquitin-like domains can target to the proteasome but proteolysis requires a disordered region.

PubMed

Yu, Houqing; Kago, Grace; Yellman, Christopher M; Matouschek, Andreas

2016-07-15

Ubiquitin and some of its homologues target proteins to the proteasome for degradation. Other ubiquitin-like domains are involved in cellular processes unrelated to the proteasome, and proteins containing these domains remain stable in the cell. We find that the 10 yeast ubiquitin-like domains tested bind to the proteasome, and that all 11 identified domains can target proteins for degradation. Their apparent proteasome affinities are not directly related to their stabilities or functions. That is, ubiquitin-like domains in proteins not part of the ubiquitin proteasome system may bind the proteasome more tightly than domains in proteins that are bona fide components. We propose that proteins with ubiquitin-like domains have properties other than proteasome binding that confer stability. We show that one of these properties is the absence of accessible disordered regions that allow the proteasome to initiate degradation. In support of this model, we find that Mdy2 is degraded in yeast when a disordered region in the protein becomes exposed and that the attachment of a disordered region to Ubp6 leads to its degradation. © 2016 The Authors.

Structural basis of control of inward rectifier Kir2 channel gating by bulk anionic phospholipids.

PubMed

Lee, Sun-Joo; Ren, Feifei; Zangerl-Plessl, Eva-Maria; Heyman, Sarah; Stary-Weinzinger, Anna; Yuan, Peng; Nichols, Colin G

2016-09-01

Inward rectifier potassium (Kir) channel activity is controlled by plasma membrane lipids. Phosphatidylinositol-4,5-bisphosphate (PIP2) binding to a primary site is required for opening of classic inward rectifier Kir2.1 and Kir2.2 channels, but interaction of bulk anionic phospholipid (PL(-)) with a distinct second site is required for high PIP2 sensitivity. Here we show that introduction of a lipid-partitioning tryptophan at the second site (K62W) generates high PIP2 sensitivity, even in the absence of PL(-) Furthermore, high-resolution x-ray crystal structures of Kir2.2[K62W], with or without added PIP2 (2.8- and 2.0-Å resolution, respectively), reveal tight tethering of the C-terminal domain (CTD) to the transmembrane domain (TMD) in each condition. Our results suggest a refined model for phospholipid gating in which PL(-) binding at the second site pulls the CTD toward the membrane, inducing the formation of the high-affinity primary PIP2 site and explaining the positive allostery between PL(-) binding and PIP2 sensitivity. © 2016 Lee et al.

Slow-binding inhibition of sialidase from influenza virus.

PubMed

Pegg, M S; von Itzstein, M

1994-04-01

Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

Implementing the SU(2) Symmetry for the DMRG

NASA Astrophysics Data System (ADS)

Alvarez, Gonzalo

2010-03-01

In the Density Matrix Renormalization Group (DMRG) algorithm (White, 1992), Hamiltonian symmetries play an important role. Using symmetries, the matrix representation of the Hamiltonian can be blocked. Diagonalizing each matrix block is more efficient than diagonalizing the original matrix. This talk will explain how the DMRG++ codefootnotetextarXiv:0902.3185 or Computer Physics Communications 180 (2009) 1572-1578. has been extended to handle the non-local SU(2) symmetry in a model independent way. Improvements in CPU times compared to runs with only local symmetries will be discussed for typical tight-binding models of strongly correlated electronic systems. The computational bottleneck of the algorithm, and the use of shared memory parallelization will also be addressed. Finally, a roadmap for future work on DMRG++ will be presented.

The Biotin/Avidin complex adhesion force

NASA Astrophysics Data System (ADS)

Balsera, Manel A.; Izrailev, Sergei; Stepaniants, Sergey; Oono, Yoshitsugu; Schulten, Klaus

1997-03-01

The vitamin Biotin and the protein avidin form one of the strongest non-covalent bonds between biological molecules. We have performed molecular and stochastic dynamic modeling of the unbinding of this complex(Izrailev et al., Biophysical Journal, In press). These simulations provide insight into the effect of particular residues and water on the tight binding of the system. With the aid of simple phenomenological models we have related qualitatively our results to Atomic Force Microscopy adhesion force measurements (E.-L. Florin, V. T. Moy and H. E. Gaub Science) 264:415-417 and kinetic dissociation experiments( A. Chilcotti and P. S. Stayton, J. Am. Chem. Soc.) 117:10622-10628. We will discuss the difficulties preventing a more quantitative understanding of the unbinding force and kinetics.

Intermediate activity of midge antifreeze protein is due to a tyrosine-rich ice-binding site and atypical ice plane affinity.

PubMed

Basu, Koli; Wasserman, Samantha S; Jeronimo, Paul S; Graham, Laurie A; Davies, Peter L

2016-04-01

An antifreeze protein (AFP) from a midge (Chironomidae) was recently discovered and modelled as a tightly wound disulfide-braced solenoid with a surface-exposed rank of stacked tyrosines. New isoforms of the midge AFP have been identified from RT-PCR and are fully consistent with the model. Although they differ in the number of 10-residue coils, the row of tyrosines that form the putative ice-binding site is conserved. Recombinant midge AFP has been produced, and the properly folded form purified by ice affinity. This monomeric AFP has a distinct circular dichroism spectrum, a melting temperature between 35 and 50 °C and is fully renaturable on cooling. Mutagenesis of the middle tyrosine in the rank of seven eliminates antifreeze activity, whereas mutation of a tyrosine off this predicted ice-binding face had no such effect. This AFP has unusual properties compared to other known AFPs. First, its freezing-point depression activity is intermediate between that of the hyperactive and moderately active AFPs. As with hyperactive AFPs, when midge AFP-bound ice crystals exceed their freezing-point depression, ice grows explosively perpendicular to the c-axis. However, midge AFP does not bind to the basal plane of ice as do hyperactive AFPs, but rather to a pyramidal plane that is at a shallower angle relative to the basal plane than binding planes of moderate AFPs. These properties distinguish midge AFP from all other ice-binding proteins and the intermediate activity level fits well to the modest challenge of protecting newly emerged adult insects from late spring frosts. Nucleotide sequences of new midge AFP isoforms are available in the GenBank database under accession numbers KU094814-8. Sequences will be released after publication. © 2016 Federation of European Biochemical Societies.

Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

PubMed

Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

2018-05-10

Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

Using affinity capillary electrophoresis and computational models for binding studies of heparinoids with p-selectin and other proteins.

PubMed

Mozafari, Mona; Balasupramaniam, Shantheya; Preu, Lutz; El Deeb, Sami; Reiter, Christian G; Wätzig, Hermann

2017-06-01

A fast and precise affinity capillary electrophoresis (ACE) method has been developed and applied for the investigation of the binding interactions between P-selectin and heparinoids as potential P-selectin inhibitors in the presence and absence of calcium ions. Furthermore, model proteins and vitronectin were used to appraise the binding behavior of P-selectin. The normalized mobility ratios (∆R/R f ), which provided information about the binding strength and the overall charge of the protein-ligand complex, were used to evaluate the binding affinities. It was found that P-selectin interacts more strongly with heparinoids in the presence of calcium ions. P-selectin was affected by heparinoids at the concentration of 3 mg/L. In addition, the results of the ACE experiments showed that among other investigated proteins, albumins and vitronectin exhibited strong interactions with heparinoids. Especially with P-selectin and vitronectin, the interaction may additionally induce conformational changes. Subsequently, computational models were applied to interpret the ACE experiments. Docking experiments explained that the binding of heparinoids on P-selectin is promoted by calcium ions. These docking models proved to be particularly well suited to investigate the interaction of charged compounds, and are therefore complementary to ACE experiments. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The K-turn motif in riboswitches and other RNA species☆

PubMed Central

Lilley, David M.J.

2014-01-01

The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

Optimization of binding electrostatics: Charge complementarity in the barnase-barstar protein complex

PubMed Central

lee, Lee-Peng; Tidor, Bruce

2001-01-01

Theoretical and experimental studies have shown that the large desolvation penalty required for polar and charged groups frequently precludes their involvement in electrostatic interactions that contribute strongly to net stability in the folding or binding of proteins in aqueous solution near room temperature. We have previously developed a theoretical framework for computing optimized electrostatic interactions and illustrated use of the algorithm with simplified geometries. Given a receptor and model assumptions, the method computes the ligand-charge distribution that provides the most favorable balance of desolvation and interaction effects on binding. In this paper the method has been extended to treat complexes using actual molecular shapes. The barnase-barstar protein complex was investigated with barnase treated as a target receptor. The atomic point charges of barstar were varied to optimize the electrostatic binding free energy. Barnase and natural barstar form a tight complex (Kd ∼ 10−14 M) with many charged and polar groups near the interface that make this a particularly relevant system for investigating the role of electrostatic effects on binding. The results show that sets of barstar charges (resulting from optimization with different constraints) can be found that give rise to relatively large predicted improvements in electrostatic binding free energy. Principles for enhancing the effect of electrostatic interactions in molecular binding in aqueous environments are discussed in light of the optima. Our findings suggest that, in general, the enhancements in electrostatic binding free energy resulting from modification of polar and charged groups can be substantial. Moreover, a recently proposed definition of electrostatic complementarity is shown to be a useful tool for examining binding interfaces. Finally, calculational results suggest that wild-type barstar is closer to being affinity optimized than is barnase for their mutual binding, consistent with the known roles of these proteins. PMID:11266622

Co-occurrence of medical conditions: Exposing patterns through probabilistic topic modeling of snomed codes.

PubMed

Bhattacharya, Moumita; Jurkovitz, Claudine; Shatkay, Hagit

2018-04-12

Patients associated with multiple co-occurring health conditions often face aggravated complications and less favorable outcomes. Co-occurring conditions are especially prevalent among individuals suffering from kidney disease, an increasingly widespread condition affecting 13% of the general population in the US. This study aims to identify and characterize patterns of co-occurring medical conditions in patients employing a probabilistic framework. Specifically, we apply topic modeling in a non-traditional way to find associations across SNOMED-CT codes assigned and recorded in the EHRs of >13,000 patients diagnosed with kidney disease. Unlike most prior work on topic modeling, we apply the method to codes rather than to natural language. Moreover, we quantitatively evaluate the topics, assessing their tightness and distinctiveness, and also assess the medical validity of our results. Our experiments show that each topic is succinctly characterized by a few highly probable and unique disease codes, indicating that the topics are tight. Furthermore, inter-topic distance between each pair of topics is typically high, illustrating distinctiveness. Last, most coded conditions grouped together within a topic, are indeed reported to co-occur in the medical literature. Notably, our results uncover a few indirect associations among conditions that have hitherto not been reported as correlated in the medical literature. Copyright © 2018. Published by Elsevier Inc.

Increasing the affinity of selective bZIP-binding peptides through surface residue redesign.

PubMed

Kaplan, Jenifer B; Reinke, Aaron W; Keating, Amy E

2014-07-01

The coiled-coil dimer is a prevalent protein interaction motif that is important for many cellular processes. The basic leucine-zipper (bZIP) transcription factors are one family of proteins for which coiled-coil mediated dimerization is essential for function, and misregulation of bZIPs can lead to disease states including cancer. This makes coiled coils attractive protein-protein interaction targets to disrupt using engineered molecules. Previous work designing peptides to compete with native coiled-coil interactions focused primarily on designing the core residues of the interface to achieve affinity and specificity. However, folding studies on the model bZIP GCN4 show that coiled-coil surface residues also contribute to binding affinity. Here we extend a prior study in which peptides were designed to bind tightly and specifically to representative members of each of 20 human bZIP families. These "anti-bZIP" peptides were designed with an emphasis on target-binding specificity, with contributions to design-target specificity and affinity engineered considering only the coiled-coil core residues. High-throughput testing using peptide arrays indicated many successes. We have now measured the binding affinities and specificities of anti-bZIPs that bind to FOS, XBP1, ATF6, and CREBZF in solution and tested whether redesigning the surface residues can increase design-target affinity. Incorporating residues that favor helix formation into the designs increased binding affinities in all cases, providing low-nanomolar binders of each target. However, changes in surface electrostatic interactions sometimes changed the binding specificity of the designed peptides. © 2014 The Protein Society.

Modeling the evolution of regulatory elements by simultaneous detection and alignment with phylogenetic pair HMMs.

PubMed

Majoros, William H; Ohler, Uwe

2010-12-16

The computational detection of regulatory elements in DNA is a difficult but important problem impacting our progress in understanding the complex nature of eukaryotic gene regulation. Attempts to utilize cross-species conservation for this task have been hampered both by evolutionary changes of functional sites and poor performance of general-purpose alignment programs when applied to non-coding sequence. We describe a new and flexible framework for modeling binding site evolution in multiple related genomes, based on phylogenetic pair hidden Markov models which explicitly model the gain and loss of binding sites along a phylogeny. We demonstrate the value of this framework for both the alignment of regulatory regions and the inference of precise binding-site locations within those regions. As the underlying formalism is a stochastic, generative model, it can also be used to simulate the evolution of regulatory elements. Our implementation is scalable in terms of numbers of species and sequence lengths and can produce alignments and binding-site predictions with accuracy rivaling or exceeding current systems that specialize in only alignment or only binding-site prediction. We demonstrate the validity and power of various model components on extensive simulations of realistic sequence data and apply a specific model to study Drosophila enhancers in as many as ten related genomes and in the presence of gain and loss of binding sites. Different models and modeling assumptions can be easily specified, thus providing an invaluable tool for the exploration of biological hypotheses that can drive improvements in our understanding of the mechanisms and evolution of gene regulation.

Postprocessing of docked protein-ligand complexes using implicit solvation models.

PubMed

Lindström, Anton; Edvinsson, Lotta; Johansson, Andreas; Andersson, C David; Andersson, Ida E; Raubacher, Florian; Linusson, Anna

2011-02-28

Molecular docking plays an important role in drug discovery as a tool for the structure-based design of small organic ligands for macromolecules. Possible applications of docking are identification of the bioactive conformation of a protein-ligand complex and the ranking of different ligands with respect to their strength of binding to a particular target. We have investigated the effect of implicit water on the postprocessing of binding poses generated by molecular docking using MM-PB/GB-SA (molecular mechanics Poisson-Boltzmann and generalized Born surface area) methodology. The investigation was divided into three parts: geometry optimization, pose selection, and estimation of the relative binding energies of docked protein-ligand complexes. Appropriate geometry optimization afforded more accurate binding poses for 20% of the complexes investigated. The time required for this step was greatly reduced by minimizing the energy of the binding site using GB solvation models rather than minimizing the entire complex using the PB model. By optimizing the geometries of docking poses using the GB(HCT+SA) model then calculating their free energies of binding using the PB implicit solvent model, binding poses similar to those observed in crystal structures were obtained. Rescoring of these poses according to their calculated binding energies resulted in improved correlations with experimental binding data. These correlations could be further improved by applying the postprocessing to several of the most highly ranked poses rather than focusing exclusively on the top-scored pose. The postprocessing protocol was successfully applied to the analysis of a set of Factor Xa inhibitors and a set of glycopeptide ligands for the class II major histocompatibility complex (MHC) A(q) protein. These results indicate that the protocol for the postprocessing of docked protein-ligand complexes developed in this paper may be generally useful for structure-based design in drug discovery.

Conductance of AFM Deformed Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

2002-01-01

This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

The Performance Analysis of a Real-Time Integrated INS/GPS Vehicle Navigation System with Abnormal GPS Measurement Elimination

PubMed Central

Chiang, Kai-Wei; Duong, Thanh Trung; Liao, Jhen-Kai

2013-01-01

The integration of an Inertial Navigation System (INS) and the Global Positioning System (GPS) is common in mobile mapping and navigation applications to seamlessly determine the position, velocity, and orientation of the mobile platform. In most INS/GPS integrated architectures, the GPS is considered to be an accurate reference with which to correct for the systematic errors of the inertial sensors, which are composed of biases, scale factors and drift. However, the GPS receiver may produce abnormal pseudo-range errors mainly caused by ionospheric delay, tropospheric delay and the multipath effect. These errors degrade the overall position accuracy of an integrated system that uses conventional INS/GPS integration strategies such as loosely coupled (LC) and tightly coupled (TC) schemes. Conventional tightly coupled INS/GPS integration schemes apply the Klobuchar model and the Hopfield model to reduce pseudo-range delays caused by ionospheric delay and tropospheric delay, respectively, but do not address the multipath problem. However, the multipath effect (from reflected GPS signals) affects the position error far more significantly in a consumer-grade GPS receiver than in an expensive, geodetic-grade GPS receiver. To avoid this problem, a new integrated INS/GPS architecture is proposed. The proposed method is described and applied in a real-time integrated system with two integration strategies, namely, loosely coupled and tightly coupled schemes, respectively. To verify the effectiveness of the proposed method, field tests with various scenarios are conducted and the results are compared with a reliable reference system. PMID:23955434

Real-time Kinematic Positioning of INS Tightly Aided Multi-GNSS Ionospheric Constrained PPP

PubMed Central

Gao, Zhouzheng; Shen, Wenbin; Zhang, Hongping; Niu, Xiaoji; Ge, Maorong

2016-01-01

Real-time Precise Point Positioning (PPP) technique is being widely applied for providing precise positioning services with the significant improvement on satellite precise products accuracy. With the rapid development of the multi-constellation Global Navigation Satellite Systems (multi-GNSS), currently, about 80 navigation satellites are operational in orbit. Obviously, PPP performance is dramatically improved with all satellites compared to that of GPS-only PPP. However, the performance of PPP could be evidently affected by unexpected and unavoidable severe observing environments, especially in the dynamic applications. Consequently, we apply Inertial Navigation System (INS) to the Ionospheric-Constrained (IC) PPP to overcome such drawbacks. The INS tightly aided multi-GNSS IC-PPP model can make full use of GNSS and INS observations to improve the PPP performance in terms of accuracy, availability, continuity, and convergence speed. Then, a set of airborne data is analyzed to evaluate and validate the improvement of multi-GNSS and INS on the performance of IC-PPP. PMID:27470270

Real-time Kinematic Positioning of INS Tightly Aided Multi-GNSS Ionospheric Constrained PPP.

PubMed

Gao, Zhouzheng; Shen, Wenbin; Zhang, Hongping; Niu, Xiaoji; Ge, Maorong

2016-07-29

Real-time Precise Point Positioning (PPP) technique is being widely applied for providing precise positioning services with the significant improvement on satellite precise products accuracy. With the rapid development of the multi-constellation Global Navigation Satellite Systems (multi-GNSS), currently, about 80 navigation satellites are operational in orbit. Obviously, PPP performance is dramatically improved with all satellites compared to that of GPS-only PPP. However, the performance of PPP could be evidently affected by unexpected and unavoidable severe observing environments, especially in the dynamic applications. Consequently, we apply Inertial Navigation System (INS) to the Ionospheric-Constrained (IC) PPP to overcome such drawbacks. The INS tightly aided multi-GNSS IC-PPP model can make full use of GNSS and INS observations to improve the PPP performance in terms of accuracy, availability, continuity, and convergence speed. Then, a set of airborne data is analyzed to evaluate and validate the improvement of multi-GNSS and INS on the performance of IC-PPP.

Processing Impact on Monoclonal Antibody Drug Products: Protein Subvisible Particulate Formation Induced by Grinding Stress.

PubMed

Gikanga, Benson; Eisner, Devon Roshan; Ovadia, Robert; Day, Eric S; Stauch, Oliver B; Maa, Yuh-Fun

2017-01-01

Subvisible particle formation in monoclonal antibody drug product resulting from mixing and filling operations represents a significant processing risk that can lead to filter fouling and thereby lead to process delays or failures. Several previous studies from our lab and others demonstrated the formation of subvisible particulates in mAb formulations resulting from mixing operations using some bottom-mounted mixers or stirrer bars. It was hypothesized that the stress (e.g., shear/cavitation) derived from tight clearance and/or close contact between the impeller and shaft was responsible for protein subvisible particulate generation. These studies, however, could not distinguish between the two surfaces without contact (tight clearance) or between two contacting surfaces (close contact). In the present study we expand on those findings and utilize small-scale mixing models that are able to, for the first time, distinguish between tight clearances and tight contact. In this study we evaluated different mixer types including a top-mounted mixer, several impeller-based bottom-mounted mixers, and a rotary piston pump. The impact of tight clearance/close contact on subvisible particle formation in at-scale mixing platforms was demonstrated in the gap between the impeller and drive unit as well as between the piston and the housing of the pump. Furthermore, small-scale mixing models based on different designs of magnetic stir bars that mimic the tight clearance/close contact of the manufacturing-scale mixers also induced subvisible particles in mAb formulations. Additional small-scale models that feature tight clearance but no close contact (grinding) suggested that it is the repeated grinding/contacting of the moving parts and not the presence of tight clearance in the processing equipment that is the root cause of protein subvisible particulate formation. When multiple mAbs, Fabs (fragment antigen binding), or non-antibody related proteins were mixed in the small-scale mixing model, for molecules investigated, it was observed that mAbs and Fabs appear to be more susceptible to particle formation than non-antibody-related proteins. In the grinding zone, mAb/Fab molecules aggregated into insoluble particles with neither detectable soluble aggregates nor fragmented species. This investigation represents a step closer to the understanding of the underlying stress mechanism leading to mAb subvisible particulate formation as the result of drug product processing. LAY ABSTRACT: Mixing and fill finish are important unit operations in drug product manufacturing for compounding (dilution, pooling, homogenization, etc.) and filling into primary packaging containers (vials, pre-filled syringes, etc.), respectively. The current trend in adopting bottom-mounted mixers as well as low fill-volume filling systems has raised concerns about their impact on drug product quality and process performance. However, investigations into the effects of their use for biopharmaceutical products, particularly monoclonal antibody formulations, are rarely published. The purpose of this study is three-fold: (1) to revisit the impact of bottom-mounted mixer design on monoclonal antibody subvisible particle formation; (2) to identify the root cause for subvisible particle formation; and (3) to fully utilize available particle analysis tools to demonstrate the correlation between particle count in the solution and filter fouling during sterile filtration. The outcomes of this study will benefit scientists and engineers who develop biologic product manufacturing processes by providing a better understanding of drug product process challenges. © PDA, Inc. 2017.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in

We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less

Gate-Controllable Magneto-optic Kerr Effect in Layered Collinear Antiferromagnets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sivadas, Nikhil; Okamoto, Satoshi; Xiao, Di

2016-12-23

In this paper, using symmetry arguments and a tight-binding model, we show that for layered collinear antiferromagnets, magneto-optic effects can be generated and manipulated by controlling crystal symmetries through a gate voltage. This provides a promising route for electric field manipulation of the magneto-optic effects without modifying the underlying magnetic structure. We further demonstrate the gate control of the magneto-optic Kerr effect (MOKE) in bilayer MnPSe 3 using first-principles calculations. Finally, the field-induced inversion symmetry breaking effect leads to gate-controllable MOKE, whose direction of rotation can be switched by the reversal of the gate voltage.

Conductance of single microRNAs chains related to the autism spectrum disorder

NASA Astrophysics Data System (ADS)

Oliveira, J. I. N.; Albuquerque, E. L.; Fulco, U. L.; Mauriz, P. W.; Sarmento, R. G.; Caetano, E. W. S.; Freire, V. N.

2014-09-01

The charge transport properties of single-stranded microRNAs (miRNAs) chains associated to autism disorder were investigated. The computations were performed within a tight-binding model, together with a transfer matrix technique, with ionization energies and hopping parameters obtained by quantum chemistry method. Current-voltage (I× V) curves of twelve miRNA chains related to the autism spectrum disorders were calculated and analysed. We have obtained both semiconductor and insulator behavior, and a relationship between the current intensity and the autism-related miRNA bases sequencies, suggesting that a kind of electronic biosensor can be developed to distinguish different profiles of autism disorders.

Twisting dirac fermions: circular dichroism in bilayer graphene

NASA Astrophysics Data System (ADS)

Suárez Morell, E.; Chico, Leonor; Brey, Luis

2017-09-01

Twisted bilayer graphene is a chiral system which has been recently shown to present circular dichroism. In this work we show that the origin of this optical activity is the rotation of the Dirac fermions’ helicities in the top and bottom layer. Starting from the Kubo formula, we obtain a compact expression for the Hall conductivity that takes into account the dephasing of the electromagnetic field between the top and bottom layers and gathers all the symmetries of the system. Our results are based in both a continuum and a tight-binding model, and they can be generalized to any two-dimensional Dirac material with a chiral stacking between layers.

Influence of gap states on the nonresonant second hyperpolarizabilities of conjugated organic polymers

NASA Technical Reports Server (NTRS)

Beratan, David N.

1989-01-01

The presence of conjugation and substitution defects introduces gap states in finite polyenes that are shown to influence the size and sign of the second molecular hyperpolarizability (SMH). Using a one-electron tight-binding model, the dependence of SMH on the defect-state occupancy and energy in finite polyenes is calculated. Defects can cause a significant decrease or enhancement of SMH by impeding charge delocalization or by creating partly filled bands (mimicking the one-band limit), respectively. Concomitant sign changes in SMH are predicted. Calculation results suggest strategies for designing molecules that can be either photochemically or electrochemically switched between states with considerably different SMHs.

Electron Spin Dephasing and Decoherence by Interaction with Nuclear Spins in Self-Assembled Quantum Dots

NASA Technical Reports Server (NTRS)

Lee, Seungwon; vonAllmen, Paul; Oyafuso, Fabiano; Klimeck, Gerhard; Whale, K. Birgitta

2004-01-01

Electron spin dephasing and decoherence by its interaction with nuclear spins in self-assembled quantum dots are investigated in the framework of the empirical tight-binding model. Electron spin dephasing in an ensemble of dots is induced by the inhomogeneous precession frequencies of the electron among dots, while electron spin decoherence in a single dot arises from the inhomogeneous precession frequencies of nuclear spins in the dot. For In(x)Ga(1-x) As self-assembled dots containing 30000 nuclei, the dephasing and decoherence times are predicted to be on the order of 100 ps and 1 (micro)s.

Exciton intrachain transport induced by interchain packing configurations in conjugated polymers.

PubMed

Meng, Ruixuan; Gao, Kun; Zhang, Gaiyan; Han, Shixuan; Yang, Fujiang; Li, Yuan; Xie, Shijie

2015-07-28

Based on a tight binding model combined with a nonadiabatic dynamics approach, we theoretically investigate the exciton intrachain transport in conjugated polymers with different interchain packing configurations. We construct two different interchain packing configurations, i.e. linear and exponential forms, and simulate the dynamical processes of the exciton transport in these systems. We find that, in both cases, there exists a distribution of driving force for exciton transport, which stems from the gradient of the exciton creation energy along the chains. This finding enriches the picture of exciton transport in polymers and provides a new idea to improve the exciton transport length in polymeric photovoltaic devices.

Pressure Effects on the Magnetic Phase Transition of Mn3SnC1-xNx (x = 0, 0.5)

NASA Astrophysics Data System (ADS)

Hu, Jing-Yu; Wen, Yong-Chun; Yao, Yuan; Wang, Cong; Zhao, Qing; Jin, Chang-Qing; Yu, Ri-Cheng

2012-08-01

The electronic transport properties of Mn3SnC and Mn3SnC0.5N0.5 were measured under pressures up to 1.8 GPa. At ambient pressure, an abrupt increase of resistance occurs around the temperature of magnetic phase transition in both samples. The transition temperature Tc from paramagnetic to ferrimagnetic state decreases linearly at rates of 12.6 and 6.3K/GPa with pressure for Mn3SnC and Mn3SnC0.5N0.5, respectively. This phenomenon could be understood by the Labbe-Jardin tight binding approximation model.

Structural basis of kynurenine 3-monooxygenase inhibition

PubMed Central

Amaral, Marta; Levy, Colin; Heyes, Derren J.; Lafite, Pierre; Outeiro, Tiago F.; Giorgini, Flaviano; Leys, David; Scrutton, Nigel S.

2013-01-01

Inhibition of kynurenine 3-monooxygenase (KMO), an enzyme in the eukaryotic tryptophan catabolic pathway (i.e. kynurenine pathway), leads to amelioration of Huntington’s disease-relevant phenotypes in yeast, fruit fly, and mouse models1–5, as well as a mouse model of Alzheimer’s disease3. KMO is a FAD-dependent monooxygenase, and is located in the outer mitochondrial membrane where it converts L-kynurenine to 3-hydroxykynurenine. Perturbations in the levels of kynurenine pathway metabolites have been linked to the pathogenesis of a spectrum of brain disorders6, as well as cancer7,8, and several peripheral inflammatory conditions9. Despite the importance of KMO as a target for neurodegenerative disease, the molecular basis of KMO inhibition by available lead compounds has remained hitherto unknown. Here we report the first crystal structure of KMO, in the free form and in complex with the tight-binding inhibitor UPF 648. UPF 648 binds close to the FAD cofactor and perturbs the local active site structure, preventing productive binding of the substrate kynurenine. Functional assays and targeted mutagenesis revealed that the active site architecture and UPF 648 binding are essentially identical in human KMO, validating the yeast KMO:UPF 648 structure as a template for structure-based drug design. This will inform the search for new KMO inhibitors that are able to cross the blood-brain barrier in targeted therapies against neurodegenerative diseases such as Huntington’s, Alzheimer’s, and Parkinson’s diseases. PMID:23575632

Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

PubMed Central

Warfield, Becka M.

2017-01-01

RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

Two-electron states of a group-V donor in silicon from atomistic full configuration interactions

NASA Astrophysics Data System (ADS)

Tankasala, Archana; Salfi, Joseph; Bocquel, Juanita; Voisin, Benoit; Usman, Muhammad; Klimeck, Gerhard; Simmons, Michelle Y.; Hollenberg, Lloyd C. L.; Rogge, Sven; Rahman, Rajib

2018-05-01

Two-electron states bound to donors in silicon are important for both two-qubit gates and spin readout. We present a full configuration interaction technique in the atomistic tight-binding basis to capture multielectron exchange and correlation effects taking into account the full band structure of silicon and the atomic-scale granularity of a nanoscale device. Excited s -like states of A1 symmetry are found to strongly influence the charging energy of a negative donor center. We apply the technique on subsurface dopants subjected to gate electric fields and show that bound triplet states appear in the spectrum as a result of decreased charging energy. The exchange energy, obtained for the two-electron states in various confinement regimes, may enable engineering electrical control of spins in donor-dot hybrid qubits.

Recent findings and technological advances in phosphoproteomics for cells and tissues.

PubMed

von Stechow, Louise; Francavilla, Chiara; Olsen, Jesper V

2015-01-01

Site-specific phosphorylation is a fast and reversible covalent post-translational modification that is tightly regulated in cells. The cellular machinery of enzymes that write, erase and read these modifications (kinases, phosphatases and phospho-binding proteins) is frequently deregulated in different diseases, including cancer. Large-scale studies of phosphoproteins - termed phosphoproteomics - strongly rely on the use of high-performance mass spectrometric instrumentation. This powerful technology has been applied to study a great number of phosphorylation-based phenotypes. Nevertheless, many technical and biological challenges have to be overcome to identify biologically relevant phosphorylation sites in cells and tissues. This review describes different technological strategies to identify and quantify phosphorylation sites with high accuracy, without significant loss of analysis speed and reproducibility in tissues and cells. Moreover, computational tools for analysis, integration and biological interpretation of phosphorylation events are discussed.

Improved Characterization and Modeling of Tight Oil Formations for CO 2 Enhanced Oil Recovery Potential and Storage Capacity Estimation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sorensen, James; Smith, Steven; Kurz, Bethany

Tight oil formations such as those in the Bakken petroleum system are known to hold hundreds of billions of barrels of oil in place; however, the primary recovery factor for these plays is typically less than 10%. Tight oil formations, including the Bakken Formation, therefore, may be attractive candidates for enhanced oil recovery (EOR) using CO 2. Multiphase fluid behavior and flow in fluid-rich shales can vary substantially depending on the size of pore throats, and properties such as fluid viscosity and density are much different in nanoscale pores than in macroscale pores. Thus it is critical to understand themore » nature and distribution of nano-, micro-, and macroscale pores and fracture networks. To address these issues, the Energy & Environmental Research Center (EERC) has been conducting a research program entitled “Improved Characterization and Modeling of Tight Oil Formations for CO 2 Enhanced Oil Recovery Potential and Storage Capacity Estimation.” The objectives of the project are 1) the use of advanced characterization methods to better understand and quantify the petrophysical and geomechanical factors that control CO 2 and oil mobility within tight oil formation samples, 2) the determination of CO 2 permeation and oil extraction rates in tight reservoir rocks and organic-rich shales of the Bakken, and 3) the integration of the laboratory-based CO 2 permeation and oil extraction data and the characterization data into geologic models and dynamic simulations to develop predictions of CO 2 storage resource and EOR in the Bakken tight oil formation. A combination of standard and advanced petrophysical characterization techniques were applied to characterize samples of Bakken Formation tight reservoir rock and shales from multiple wells. Techniques included advanced computer tomography (CT) imaging, scanning electron microscopy (SEM) techniques, whole-core and micro x-ray CT imaging, field emission (FE) SEM, and focused ion beam (FIB) SEM. Selected samples were also analyzed for geomechanical properties. X-ray CT imaging yielded information on the occurrence of fractures, bedding planes, fossils, and bioturbation in core, as well as data on bulk density and photoelectric factor logs, which were used to interpret porosity, organic content, and mineralogy. FESEM was used for characterization of nano- and microscale features, including nanoscale pore visualization and micropore and pore throat mineralogy. FIBSEM yielded micro- to nanoscale visualization of fracture networks, porosity and pore-size distribution, connected versus isolated porosity, and distribution of organics. Results from the characterization activities provide insight on nanoscale fracture properties, pore throat mineralogy and connectivity, rock matrix characteristics, mineralogy, and organic content. Laboratory experiments demonstrated that CO 2 can permeate the tight matrix of Bakken shale and nonshale reservoir samples and mobilize oil from those samples. Geologic models were created at scales ranging from the core plug to the reservoir, and dynamic simulations were conducted. The data from the characterization and laboratory-based activities were integrated into modeling research activities to determine the fundamental mechanisms controlling fluid transport in the Bakken, which support EOR scheme design and estimation of CO 2 storage potential in tight oil formations. Simulation results suggest a CO 2 storage resource estimate range of 169 million to 1.5 billion tonnes for the Bakken in North Dakota, possibly resulting in 1.8 billion to 16 billion barrels of incremental oil.« less

Rapid surface-biostructure interaction analysis using strong metal-based nanomagnets.

PubMed

Rotzetter, Aline C C; Schumacher, Christoph M; Zako, Tamotsu; Stark, Wendelin J; Maeda, Mizuo

2013-11-19

Nanomaterials are increasingly suggested for the selective adsorption and extraction of complex compounds in biomedicine. Binding of the latter requires specific surface modifications of the nanostructures. However, even complicated macromolecules such as proteins can afford affinities toward basic surface characteristics such as hydrophobicity, topology, and electrostatic charge. In this study, we address these more basic physical interactions. In a model system, the interaction of bovine serum albumin and amyloid β 42 fibrillar aggregates with carbon-coated cobalt nanoparticles, functionalized with various polymers differing in character, was studied. The possibility of rapid magnetic separation upon binding to the surface represents a valuable tool for studying surface interactions and selectivities. We find that the surface interaction of Aβ 42 fibrillar aggregates is mostly hydrophobic in nature. Because bovine serum albumin (BSA) is conformationally adaptive, it is known to bind surfaces with widely differing properties (charge, topology, and hydrophobicity). However, the rate of tight binding (no desorption upon washing) can vary largely depending on the extent of necessary conformational changes for a specific surface. We found that BSA can only bind slowly to polyethylenimine-coated nanomagnets. Under competitive conditions (high excess BSA compared to that for β 42 fibrillar aggregates), this effect is beneficial for targeting the fibrillar species. These findings highlight the possibility of selective extractions from complex media when advantageous basic physical surface properties are chosen.

The iron uptake repressor Fep1 in the fission yeast binds Fe-S cluster through conserved cysteines.

PubMed

Kim, Hyo-Jin; Lee, Kang-Lok; Kim, Kyoung-Dong; Roe, Jung-Hye

2016-09-09

Iron homeostasis is tightly regulated since iron is an essential but toxic element in the cell. The GATA-type transcription factor Fep1 and its orthologs contribute to iron homeostasis in many fungi by repressing genes for iron uptake when intracellular iron is high. Even though the function and interaction partners of Fep1 have been elucidated extensively In Schizosaccharomyces pombe, the mechanism behind iron-sensing by Fep1 remains elusive. It has been reported that Fep1 interacts with Fe-S-containing monothiol glutaredoxin Grx4 and Grx4-Fra2 complex. In this study, we demonstrate that Fep1 also binds iron, in the form of Fe-S cluster. Spectroscopic and biochemical analyses of as isolated and reconstituted Fep1 suggest that the dimeric Fep1 binds Fe-S clusters. The mutation study revealed that the cluster-binding depended on the conserved cysteines located between the two zinc fingers in the DNA binding domain. EPR analyses revealed [Fe-S]-specific peaks indicative of mixed presence of [2Fe-2S], [3Fe-4S], or [4Fe-4S]. The finding that Fep1 is an Fe-S protein fits nicely with the model that the Fe-S-trafficking Grx4 senses intracellular iron environment and modulates the activity of Fep1. Copyright © 2016 Elsevier Inc. All rights reserved.

Specific cardiolipin binding interferes with labeling of sulfhydryl residues in the adenosine diphosphate/adenosine triphosphate carrier protein from beef heart mitochondria.

PubMed

Beyer, K; Nuscher, B

1996-12-10

The interaction of cardiolipin with the isolated ADP/ATP carrier protein from beef heart mitochondria has been studied by means of the unmasking of a single cysteinyl residue, Cys56, which accompanies the conformational transition of the protein [Leblanc, P., & Clauser, H, (1972) FEBS Lett. 23, 107-113]. The unmasking was monitored by using the static fluorescence of the sulfhydryl reagent N-(1-pyrenyl)maleimide (PYM). The rate of PYM binding that was observed after initiation of the conformational transition by ADP was drastically reduced in the presence of cardiolipin (CL). Phospholipids other than CL were much less effective. It can be shown that the conformational transition and the binding reaction are both affected by CL, although to varying extents. An enhancement of the rate of the ADP-dependent PYM binding was observed upon digestion of the protein bound phospholipid by phospholipase A2. The phospholipase treatment also led to an increased ADP-independent PYM binding, thus indicating that the ADP control of the carrier transition was gradually lost. The ADP control could be fully restored through the addition of CL, provided that the phospholipase incubation had been terminated after approximately 1 h. These results will be discussed in relation to an earlier report of tight cardiolipin binding [Beyer, K., & Klingenberg, M. (1985) Biochemistry 24, 3821-3826] and to current structural models of the ADP/ATP carrier protein.

Automodification of PARP-1 mediates its tight binding to the nuclear matrix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

2010-02-26

Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

Data key to quest for quality.

PubMed

Chang, Florence S; Nielsen, Jon; Macias, Charles

2013-11-01

Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

Is DNA a metal, semiconductor or insulator? A theoretical approach

NASA Astrophysics Data System (ADS)

Rey-Gonzalez, Rafael; Fonseca-Romero, Karen; Plazas, Carlos; Grupo de Óptica e Información Cuántica Team

Over the last years, scientific interest for designing and making low dimensional electronic devices with traditional or novel materials has been increased. These experimental and theoretical researches in electronic properties at molecular scale are looking for developing efficient devices able to carry out tasks which are currently done by silicon transistors and devices. Among the new materials DNA strands are highlighted, but the experimental results have been contradictories pointing to behaviors as conductor, semiconductor or insulator. To contribute to the understanding of the origin of the disparity of the measurements, we perform a numerical calculation of the electrical conductance of DNA segments, modeled as 1D disordered finite chains. The system is described into a Tight binding model with nearest neighbor interactions and a s orbital per site. Hydration effects are included as random variations of self-energies. The electronic current as a function of applied bias is calculated using Launder formalism, where the transmission probability is determined into the transfer matrix formalism. We find a conductor-to-semiconductor-to-insulator transition as a function of the three effects taken into account: chain size, intrinsic disorder, and hydration We thank Fundación para la Promoción de la Investigación y la Tecnología, Colombia, and Dirección de Investigación de Bogotá, Universidad Nacional de Colombia, for partial financial support.

Optical properties of InAs/GaAs quantum dot superlattice structures

NASA Astrophysics Data System (ADS)

Imran, Ali; Jiang, Jianliang; Eric, Deborah; Zahid, M. Noaman; Yousaf, M.; Shah, Z. H.

2018-06-01

Quantum dot (QD) structure has potential applications in modern highly efficient optoelectronic devices due to their band-tuning. The device dimensions have been miniatured with increased efficiencies by virtue of this discovery. In this research, we have presented modified analytical and simulation results of InAs/GaAs QD superlattice (QDSL). We have applied tight binding model for the investigation of ground state energies using timeindependent Schrödinger equation (SE) with effective mass approximation. It has been investigated that the electron energies are confined due to wave function delocalization in closely coupled QD structures. The minimum ground state energy can be obtained by increasing the periodicity and decreasing the barrier layer thickness. We have calculated electronics and optical properties which includes ground state energies, transition energies, density of states (DOS), absorption coefficient and refractive index, which can be tuned by structure modification. In our results, the minimum ground state energy of QDSL is achieved to be 0.25 eV with a maximum period of 10 QDs. The minimum band to band and band to continuum transition energies are 63 meV and 130 meV with 2 nm barrier layer thickness respectively. The absorption coefficient of our proposed QDSL model is found to be maximum 1.2 × 104 cm-1 and can be used for highly sensitive infrared detector and high efficiency solar cells.

Influence of Coherent Tunneling and Incoherent Hopping on the Charge Transfer Mechanism in Linear Donor-Bridge-Acceptor Systems.

PubMed

Li, Guangqi; Govind, Niranjan; Ratner, Mark A; Cramer, Christopher J; Gagliardi, Laura

2015-12-17

The mechanism of charge transfer has been observed to change from tunneling to hopping with increasing numbers of DNA base pairs in polynucleotides and with the length of molecular wires. The aim of this paper is to investigate this transition by examining the population dynamics using a tight-binding Hamiltonian with model parameters to describe a linear donor-bridge-acceptor (D-B-A) system. The model includes a primary vibration and an electron-vibration coupling at each site. A further coupling of the primary vibration with a secondary phonon bath allows the system to dissipate energy to the environment and reach a steady state. We apply the quantum master equation (QME) approach, based on second-order perturbation theory in a quantum dissipative system, to examine the dynamical processes involved in charge-transfer and follow the population transfer rate at the acceptor, ka, to shed light on the transition from tunneling to hopping. With a small tunneling parameter, V, the on-site population tends to localize and form polarons, and the hopping mechanism dominates the transfer process. With increasing V, the population tends to be delocalized and the tunneling mechanism dominates. The competition between incoherent hopping and coherent tunneling governs the mechanism of charge transfer. By varying V and the total number of sites, we also examine the onset of the transition from tunneling to hopping with increasing length.

Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

NASA Astrophysics Data System (ADS)

Giro, R.; Caldas, M. J.; Galvão, D. S.

The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE PAGES

Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

2015-11-17

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Hong; Zapol, Peter; Dixon, David A.

The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

Donor states in inverse opals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mahan, G. D.

We calculate the binding energy of an electron bound to a donor in a semiconductor inverse opal. Inverse opals have two kinds of cavities, which we call octahedral and tetrahedral, according to their group symmetry. We put the donor in the center of each of these two cavities and obtain the binding energy. The binding energies become very large when the inverse opal is made from templates with small spheres. For spheres less than 50 nm in diameter, the donor binding can increase to several times its unconfined value. Then electrons become tightly bound to the donor and are unlikelymore » to be thermally activated to the semiconductor conduction band. This conclusion suggests that inverse opals will be poor conductors.« less

Competitive folding of RNA structures at a termination–antitermination site

PubMed Central

Ait-Bara, Soraya; Clerté, Caroline; Declerck, Nathalie; Margeat, Emmanuel

2017-01-01

Antitermination is a regulatory process based on the competitive folding of terminator–antiterminator structures that can form in the leader region of nascent transcripts. In the case of the Bacillus subtilis licS gene involved in β-glucosides utilization, the binding of the antitermination protein LicT to a short RNA hairpin (RAT) prevents the formation of an overlapping terminator and thereby allows transcription to proceed. Here, we monitored in vitro the competition between termination and antitermination by combining bulk and single-molecule fluorescence-based assays using labeled RNA oligonucleotide constructs of increasing length that mimic the progressive transcription of the terminator invading the antiterminator hairpin. Although high affinity binding is abolished as soon as the antiterminator basal stem is disrupted by the invading terminator, LicT can still bind and promote closing of the partially unfolded RAT hairpin. However, binding no longer occurs once the antiterminator structure has been disrupted by the full-length terminator. Based on these findings, we propose a kinetic competition model for the sequential events taking place at the termination–antitermination site, where LicT needs to capture its RAT target before completion of the terminator to remain tightly bound during RNAP pausing, before finally dissociating irreversibly from the elongated licS transcript. PMID:28235843

Soluble Aβ aggregates can inhibit prion propagation.

PubMed

Sarell, Claire J; Quarterman, Emma; Yip, Daniel C-M; Terry, Cassandra; Nicoll, Andrew J; Wadsworth, Jonathan D F; Farrow, Mark A; Walsh, Dominic M; Collinge, John

2017-11-01

Mammalian prions cause lethal neurodegenerative diseases such as Creutzfeldt-Jakob disease (CJD) and consist of multi-chain assemblies of misfolded cellular prion protein (PrP C ). Ligands that bind to PrP C can inhibit prion propagation and neurotoxicity. Extensive prior work established that certain soluble assemblies of the Alzheimer's disease (AD)-associated amyloid β-protein (Aβ) can tightly bind to PrP C , and that this interaction may be relevant to their toxicity in AD. Here, we investigated whether such soluble Aβ assemblies might, conversely, have an inhibitory effect on prion propagation. Using cellular models of prion infection and propagation and distinct Aβ preparations, we found that the form of Aβ assemblies which most avidly bound to PrP in vitro also inhibited prion infection and propagation. By contrast, forms of Aβ which exhibit little or no binding to PrP were unable to attenuate prion propagation. These data suggest that soluble aggregates of Aβ can compete with prions for binding to PrP C and emphasize the bidirectional nature of the interplay between Aβ and PrP C in Alzheimer's and prion diseases. Such inhibitory effects of Aβ on prion propagation may contribute to the apparent fall-off in the incidence of sporadic CJD at advanced age where cerebral Aβ deposition is common. © 2017 The Authors.

A phosphoinositide-binding cluster in cavin1 acts as a molecular sensor for cavin1 degradation

PubMed Central

Tillu, Vikas A.; Kovtun, Oleksiy; McMahon, Kerrie-Ann; Collins, Brett M.; Parton, Robert G.

2015-01-01

Caveolae are abundant surface organelles implicated in a range of cellular processes. Two classes of proteins work together to generate caveolae: integral membrane proteins termed caveolins and cytoplasmic coat proteins called cavins. Caveolae respond to membrane stress by releasing cavins into the cytosol. A crucial aspect of this model is tight regulation of cytosolic pools of cavin under resting conditions. We now show that a recently identified region of cavin1 that can bind phosphoinositide (PI) lipids is also a major site of ubiquitylation. Ubiquitylation of lysines within this site leads to rapid proteasomal degradation. In cells that lack caveolins and caveolae, cavin1 is cytosolic and rapidly degraded as compared with cells in which cavin1 is associated with caveolae. Membrane stretching causes caveolar disassembly, release of cavin complexes into the cytosol, and increased proteasomal degradation of wild-type cavin1 but not mutant cavin1 lacking the major ubiquitylation site. Release of cavin1 from caveolae thus leads to exposure of key lysine residues in the PI-binding region, acting as a trigger for cavin1 ubiquitylation and down-regulation. This mutually exclusive PI-binding/ubiquitylation mechanism may help maintain low levels of cytosolic cavin1 in resting cells, a prerequisite for cavins acting as signaling modules following release from caveolae. PMID:26269585

[Effect of self-microemulsifying system on cell tight junctions].

PubMed

Sha, Xian-Yi; Fang, Xiao-Ling

2006-01-01

To study the effect of negatively charged and positively charged self-microemulsifying systems (SMES) on the cellular tight junction complex was to be investigated at molecular cell level. Human intestinal epithelial Caco-2 cell model was established. Effect of formulations on the transepithelial electrical resistance (TEER) and permeability of the paracellular transport marker mannitol were measured to evaluate the cell integrity. Changes in subcellular localization of the tight junction protein zona occludens 1 (ZO-1) and cytoskeleton protein actin by immunofluorescence were also assessed after treatment of two SMESs in different dilutions. The TEER of cell monolayers was not markedly affected by negatively charged SMES in different dilutions. The positively charged SMES could significantly decrease the TEER (P < 0.05) in three dilutions. The full recovery of TEER was found after the treatment of lower dilution for 2 h, then cultured for 48 h, while the recovery of TEER was 81.3% of control in 1 : 50 dilution. Two SMESs could enhance the apparent permeability coefficient of mannitol (2.9 - 64.6 folds), which depended on the dilution times. The immunofluorescent results indicated that the distribution of ZO-1 and actin were discrete in cell membrane after the treatment of formulation. Since the positively charged microemulsion could bind to the epithelial cell membrane by electrostatic interaction, the actin of the cells undergone some kind of stress stimulated by the higher concentration of microemulsion was more markedly affected than the negatively charged SMES. Effect of formulations on ZO-1 and actin relied on the dilution. SMES is able to enhance the paracellular transport marker mannitol. The mechanism of opening of tight junctions by SMES might be the change of distribution of ZO-1 and actin.

Force and Stress along Simulated Dissociation Pathways of Cucurbituril-Guest Systems.

PubMed

Velez-Vega, Camilo; Gilson, Michael K

2012-03-13

The field of host-guest chemistry provides computationally tractable yet informative model systems for biomolecular recognition. We applied molecular dynamics simulations to study the forces and mechanical stresses associated with forced dissociation of aqueous cucurbituril-guest complexes with high binding affinities. First, the unbinding transitions were modeled with constant velocity pulling (steered dynamics) and a soft spring constant, to model atomic force microscopy (AFM) experiments. The computed length-force profiles yield rupture forces in good agreement with available measurements. We also used steered dynamics with high spring constants to generate paths characterized by a tight control over the specified pulling distance; these paths were then equilibrated via umbrella sampling simulations and used to compute time-averaged mechanical stresses along the dissociation pathways. The stress calculations proved to be informative regarding the key interactions determining the length-force profiles and rupture forces. In particular, the unbinding transition of one complex is found to be a stepwise process, which is initially dominated by electrostatic interactions between the guest's ammoniums and the host's carbonyl groups, and subsequently limited by the extraction of the guest's bulky bicyclooctane moiety; the latter step requires some bond stretching at the cucurbituril's extraction portal. Conversely, the dissociation of a second complex with a more slender guest is mainly driven by successive electrostatic interactions between the different guest's ammoniums and the host's carbonyl groups. The calculations also provide information on the origins of thermodynamic irreversibilities in these forced dissociation processes.

Valley density-wave (VDW) and Superconductivity in Iron-Pnictides

NASA Astrophysics Data System (ADS)

Cvetkovic, Vladimir; Tesanovic, Zlatko

2009-03-01

One of the experimentally observed features of iron-pnictide superconductors is the structural transition and SDW ordering occurring at almost the same temperature. Starting from a tight-binding model [1], we construct an effective theory for iron-pnictides with the distinctive two hole and two electron Fermi surfaces. This theory is then mapped onto a negative-U Hubbard model with additional orbital and spin flavors [2]. We demonstrate that the superconducting instability of the attractive Hubbard model --- valley density-wave (VDW) --- corresponds to the observed structural and SDW orders. The deviations from perfect nesting between the hole and electron Fermi surfaces are mapped onto the Zeeman field which causes portions of Fermi surface to remain ungapped. The origin of pnictide superconductivity in this model, and its ties to the VDW are discussed. [1] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0804.4678. [2] V. Cvetkovic and Z. Tesanovic, http://arxiv.org/abs/0808.3742.

Identification of a ZP3-binding protein on acrosome-intact mouse sperm by photoaffinity crosslinking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bleil, J.D.; Wassarman, P.M.

1990-07-01

During the process of fertilization in mammals, sperm bind in a relatively species-specific manner to the zona pellucida (ZP) of ovulated eggs. ZP3, a glycoprotein found in the mouse egg zona pellucida, serves as receptor for sperm during gamete adhesion. We report here that a Mr 56,000 protein found on mouse sperm has properties expected for a sperm component that recognizes and binds to ZP3. This sperm protein is radiolabeled preferentially by a photoactivatable heterobifunctional crosslinker (Denny-Jaffee reagent) covalently linked to purified ZP3, binds very tightly to ZP3-affinity columns, and is localized to heads of acrosome-intact but not acrosome-reacted sperm.more » These and other findings suggest that this protein may be a ZP3-binding protein that, together with the sperm receptor, supports species-specific binding of mouse sperm to unfertilized eggs.« less

Ultra-fast computation of electronic spectra for large systems by tight-binding based simplified Tamm-Dancoff approximation (sTDA-xTB)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grimme, Stefan, E-mail: grimme@thch.uni-bonn.de; Bannwarth, Christoph

2016-08-07

The computational bottleneck of the extremely fast simplified Tamm-Dancoff approximated (sTDA) time-dependent density functional theory procedure [S. Grimme, J. Chem. Phys. 138, 244104 (2013)] for the computation of electronic spectra for large systems is the determination of the ground state Kohn-Sham orbitals and eigenvalues. This limits such treatments to single structures with a few hundred atoms and hence, e.g., sampling along molecular dynamics trajectories for flexible systems or the calculation of chromophore aggregates is often not possible. The aim of this work is to solve this problem by a specifically designed semi-empirical tight binding (TB) procedure similar to the wellmore » established self-consistent-charge density functional TB scheme. The new special purpose method provides orbitals and orbital energies of hybrid density functional character for a subsequent and basically unmodified sTDA procedure. Compared to many previous semi-empirical excited state methods, an advantage of the ansatz is that a general eigenvalue problem in a non-orthogonal, extended atomic orbital basis is solved and therefore correct occupied/virtual orbital energy splittings as well as Rydberg levels are obtained. A key idea for the success of the new model is that the determination of atomic charges (describing an effective electron-electron interaction) and the one-particle spectrum is decoupled and treated by two differently parametrized Hamiltonians/basis sets. The three-diagonalization-step composite procedure can routinely compute broad range electronic spectra (0-8 eV) within minutes of computation time for systems composed of 500-1000 atoms with an accuracy typical of standard time-dependent density functional theory (0.3-0.5 eV average error). An easily extendable parametrization based on coupled-cluster and density functional computed reference data for the elements H–Zn including transition metals is described. The accuracy of the method termed sTDA-xTB is first benchmarked for vertical excitation energies of open- and closed-shell systems in comparison to other semi-empirical methods and applied to exemplary problems in electronic spectroscopy. As side products of the development, a robust and efficient valence electron TB method for the accurate determination of atomic charges as well as a more accurate calculation scheme of dipole rotatory strengths within the Tamm-Dancoff approximation is proposed.« less

The ZO-1–associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density

PubMed Central

Balda, Maria S.; Garrett, Michelle D.; Matter, Karl

2003-01-01

Epithelial tight junctions regulate paracellular permeability, restrict apical/basolateral intramembrane diffusion of lipids, and have been proposed to participate in the control of epithelial cell proliferation and differentiation. Previously, we have identified ZO-1–associated nucleic acid binding proteins (ZONAB), a Y-box transcription factor whose nuclear localization and transcriptional activity is regulated by the tight junction–associated candidate tumor suppressor ZO-1. Now, we found that reduction of ZONAB expression using an antisense approach or by RNA interference strongly reduced proliferation of MDCK cells. Transfection of wild-type or ZONAB-binding fragments of ZO-1 reduced proliferation as well as nuclear ZONAB pools, indicating that promotion of proliferation by ZONAB requires its nuclear accumulation. Overexpression of ZONAB resulted in increased cell density in mature monolayers, and depletion of ZONAB or overexpression of ZO-1 reduced cell density. ZONAB was found to associate with cell division kinase (CDK) 4, and reduction of nuclear ZONAB levels resulted in reduced nuclear CDK4. Thus, our data indicate that tight junctions can regulate epithelial cell proliferation and cell density via a ZONAB/ZO-1–based pathway. Although this regulatory process may also involve regulation of transcription by ZONAB, our data suggest that one mechanism by which ZONAB and ZO-1 influence proliferation is by regulating the nuclear accumulation of CDK4. PMID:12566432

Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

PubMed Central

Yonetani, Yoshiteru; Kono, Hidetoshi

2009-01-01

Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nageswara Rao, B.D.; Kemple, M.D.; Prendergast, F.G.

Aequorin is a protein of low molecular weight (20,000) isolated from the jellyfish Aequorea forskalea which emits blue light upon the binding of Ca/sup 2 +/ ions. This bioluminescence requires neither exogenous oxygen nor any other cofactors. The light emission occurs from an excited state of a chromophore (an imidazolopyrazinone) which is tightly and noncovalently bound to the protein. Apparently the binding of Ca/sup 2 +/ by the protein induces changes in the protein conformation which allow oxygen, already bound or otherwise held by the protein, to react with and therein oxidize the chromophore. The resulting discharged protein remains intact,more » with the Ca/sup 2 +/ and the chromophore still bound, but is incapable of further luminescence. The fluorescence spectrum of this discharged protein and the bioluminescence spectrum of the original charged aequorin are identical. A green fluorescent protein (GFP) of approx. 30,000 mol wt isolated from the same organism, functions in vivo as an acceptor of energy from aequorin and subsequently emits green light. We are applying proton nuclear magnetic resonance (NMR) spectroscopy and fluorescence spectroscopy to examine structural details of, and fluctuations associated with the luminescent reaction of aequorin and the in vivo energy transfer from aequorin to the GFP.« less

An ensemble model of competitive multi-factor binding of the genome

PubMed Central

Wasson, Todd; Hartemink, Alexander J.

2009-01-01

Hundreds of different factors adorn the eukaryotic genome, binding to it in large number. These DNA binding factors (DBFs) include nucleosomes, transcription factors (TFs), and other proteins and protein complexes, such as the origin recognition complex (ORC). DBFs compete with one another for binding along the genome, yet many current models of genome binding do not consider different types of DBFs together simultaneously. Additionally, binding is a stochastic process that results in a continuum of binding probabilities at any position along the genome, but many current models tend to consider positions as being either binding sites or not. Here, we present a model that allows a multitude of DBFs, each at different concentrations, to compete with one another for binding sites along the genome. The result is an “occupancy profile,” a probabilistic description of the DNA occupancy of each factor at each position. We implement our model efficiently as the software package COMPETE. We demonstrate genome-wide and at specific loci how modeling nucleosome binding alters TF binding, and vice versa, and illustrate how factor concentration influences binding occupancy. Binding cooperativity between nearby TFs arises implicitly via mutual competition with nucleosomes. Our method applies not only to TFs, but also recapitulates known occupancy profiles of a well-studied replication origin with and without ORC binding. Importantly, the sequence preferences our model takes as input are derived from in vitro experiments. This ensures that the calculated occupancy profiles are the result of the forces of competition represented explicitly in our model and the inherent sequence affinities of the constituent DBFs. PMID:19720867

Applied metrology in the production of superconducting model magnets for particle accelerators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ferradas Troitino, Jose; Bestmann, Patrick; Bourcey, Nicolas

2017-12-22

The production of superconducting magnets for particle accelerators involves high precision assemblies and tight tolerances, in order to achieve the requirements for their appropriate performance. It is therefore essential to have a strict control and traceability over the geometry of each component of the system, and also to be able to compensate possible inherent deviations coming from the production process.

Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

NASA Astrophysics Data System (ADS)

Anglin, J. R.; Schulz, A.

2017-01-01

Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

Descriptions of carbon isotopes within the energy density functional theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ismail, Atef; Cheong, Lee Yen; Yahya, Noorhana

2014-10-24

Within the energy density functional (EDF) theory, the structure properties of Carbon isotopes are systematically studied. The shell model calculations are done for both even-A and odd-A nuclei, to study the structure of rich-neutron Carbon isotopes. The EDF theory indicates the single-neutron halo structures in {sup 15}C, {sup 17}C and {sup 19}C, and the two-neutron halo structures in {sup 16}C and {sup 22}C nuclei. It is also found that close to the neutron drip-line, there exist amazing increase in the neutron radii and decrease on the binding energies BE, which are tightly related with the blocking effect and correspondingly themore » blocking effect plays a significant role in the shell model configurations.« less

Dissociation of the Tubulin-sequestering and Microtubule Catastrophe-promoting Activities of Oncoprotein 18/Stathmin

PubMed Central

Howell, Bonnie; Larsson, Niklas; Gullberg, Martin; Cassimeris, Lynne

1999-01-01

Oncoprotein 18/stathmin (Op18) has been identified recently as a protein that destabilizes microtubules, but the mechanism of destabilization is currently controversial. Based on in vitro microtubule assembly assays, evidence has been presented supporting conflicting destabilization models of either tubulin sequestration or promotion of microtubule catastrophes. We found that Op18 can destabilize microtubules by both of these mechanisms and that these activities can be dissociated by changing pH. At pH 6.8, Op18 slowed microtubule elongation and increased catastrophes at both plus and minus ends, consistent with a tubulin-sequestering activity. In contrast, at pH 7.5, Op18 promoted microtubule catastrophes, particularly at plus ends, with little effect on elongation rates at either microtubule end. Dissociation of tubulin-sequestering and catastrophe-promoting activities of Op18 was further demonstrated by analysis of truncated Op18 derivatives. Lack of a C-terminal region of Op18 (aa 100–147) resulted in a truncated protein that lost sequestering activity at pH 6.8 but retained catastrophe-promoting activity. In contrast, lack of an N-terminal region of Op18 (aa 5–25) resulted in a truncated protein that still sequestered tubulin at pH 6.8 but was unable to promote catastrophes at pH 7.5. At pH 6.8, both the full length and the N-terminal–truncated Op18 bound tubulin, whereas truncation at the C-terminus resulted in a pronounced decrease in tubulin binding. Based on these results, and a previous study documenting a pH-dependent change in binding affinity between Op18 and tubulin, it is likely that tubulin sequestering observed at lower pH resulted from the relatively tight interaction between Op18 and tubulin and that this tight binding requires the C-terminus of Op18; however, under conditions in which Op18 binds weakly to tubulin (pH 7.5), Op18 stimulated catastrophes without altering tubulin subunit association or dissociation rates, and Op18 did not depolymerize microtubules capped with guanylyl (α, β)-methylene diphosphonate–tubulin subunits. We hypothesize that weak binding between Op18 and tubulin results in free Op18, which is available to interact with microtubule ends and thereby promote catastrophes by a mechanism that likely involves GTP hydrolysis. PMID:9880330

Confounding compression: the effects of posture, sizing and garment type on measured interface pressure in sports compression clothing.

PubMed

Brophy-Williams, Ned; Driller, Matthew William; Shing, Cecilia Mary; Fell, James William; Halson, Shona Leigh; Halson, Shona Louise

2015-01-01

The purpose of this investigation was to measure the interface pressure exerted by lower body sports compression garments, in order to assess the effect of garment type, size and posture in athletes. Twelve national-level boxers were fitted with sports compression garments (tights and leggings), each in three different sizes (undersized, recommended size and oversized). Interface pressure was assessed across six landmarks on the lower limb (ranging from medial malleolus to upper thigh) as athletes assumed sitting, standing and supine postures. Sports compression leggings exerted a significantly higher mean pressure than sports compression tights (P < 0.001). Oversized tights applied significantly less pressure than manufacturer-recommended size or undersized tights (P < 0.001), yet no significant differences were apparent between different-sized leggings. Standing posture resulted in significantly higher mean pressure application than a seated posture for both tights and leggings (P < 0.001 and P = 0.002, respectively). Pressure was different across landmarks, with analyses revealing a pressure profile that was neither strictly graduated nor progressive in nature. The pressure applied by sports compression garments is significantly affected by garment type, size and posture assumed by the wearer.

In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization.

PubMed

Cording, Jimmi; Berg, Johanna; Käding, Nadja; Bellmann, Christian; Tscheik, Christian; Westphal, Julie K; Milatz, Susanne; Günzel, Dorothee; Wolburg, Hartwig; Piontek, Jörg; Huber, Otmar; Blasig, Ingolf Ernst

2013-01-15

Tight junctions seal the paracellular cleft of epithelia and endothelia, form vital barriers between tissue compartments and consist of tight-junction-associated marvel proteins (TAMPs) and claudins. The function of TAMPs and the interaction with claudins are not understood. We therefore investigated the binding between the TAMPs occludin, tricellulin, and marvelD3 and their interaction with claudins in living tight-junction-free human embryonic kidney-293 cells. In contrast to claudins and occludin, tricellulin and marvelD3 showed no enrichment at cell-cell contacts indicating lack of homophilic trans-interaction between two opposing cell membranes. However, occludin, marvelD3 and tricellulin exhibited homophilic cis-interactions, along one plasma membrane, as measured by fluorescence resonance energy transfer. MarvelD3 also cis-interacted with occludin and tricellulin heterophilically. Classic claudins, such as claudin-1 to -5 may show cis-oligomerization with TAMPs, whereas the non-classic claudin-11 did not. Claudin-1 and -5 improved enrichment of occludin and tricellulin at cell-cell contacts. The low mobile claudin-1 reduced the membrane mobility of the highly mobile occludin and tricellulin, as studied by fluorescence recovery after photobleaching. Co-transfection of claudin-1 with TAMPs led to changes of the tight junction strand network of this claudin to a more physiological morphology, depicted by freeze-fracture electron microscopy. The results demonstrate multilateral interactions between the tight junction proteins, in which claudins determine the function of TAMPs and vice versa, and provide deeper insights into the tight junction assembly.

Envelopes of Sets of Measures, Tightness, and Markov Control Processes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gonzalez-Hernandez, J.; Hernandez-Lerma, O.

1999-11-15

We introduce upper and lower envelopes for sets of measures on an arbitrary topological space, which are then used to give a tightness criterion. These concepts are applied to show the existence of optimal policies for a class of Markov control processes.

Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

PubMed

Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

2016-11-01

Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural basis for the inhibition of bacterial multidrug exporters.

PubMed

Nakashima, Ryosuke; Sakurai, Keisuke; Yamasaki, Seiji; Hayashi, Katsuhiko; Nagata, Chikahiro; Hoshino, Kazuki; Onodera, Yoshikuni; Nishino, Kunihiko; Yamaguchi, Akihito

2013-08-01

The multidrug efflux transporter AcrB and its homologues are important in the multidrug resistance of Gram-negative pathogens. However, despite efforts to develop efflux inhibitors, clinically useful inhibitors are not available at present. Pyridopyrimidine derivatives are AcrB- and MexB-specific inhibitors that do not inhibit MexY; MexB and MexY are principal multidrug exporters in Pseudomonas aeruginosa. We have previously determined the crystal structure of AcrB in the absence and presence of antibiotics. Drugs were shown to be exported by a functionally rotating mechanism through tandem proximal and distal multisite drug-binding pockets. Here we describe the first inhibitor-bound structures of AcrB and MexB, in which these proteins are bound by a pyridopyrimidine derivative. The pyridopyrimidine derivative binds tightly to a narrow pit composed of a phenylalanine cluster located in the distal pocket and sterically hinders the functional rotation. This pit is a hydrophobic trap that branches off from the substrate-translocation channel. Phe 178 is located at the edge of this trap in AcrB and MexB and contributes to the tight binding of the inhibitor molecule through a π-π interaction with the pyridopyrimidine ring. The voluminous side chain of Trp 177 located at the corresponding position in MexY prevents inhibitor binding. The structure of the hydrophobic trap described in this study will contribute to the development of universal inhibitors of MexB and MexY in P. aeruginosa.

Amino acid analogues bind to carbon nanotube via π-π interactions: Comparison of molecular mechanical and quantum mechanical calculations

NASA Astrophysics Data System (ADS)

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-01

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

Amino acid analogues bind to carbon nanotube via π-π interactions: comparison of molecular mechanical and quantum mechanical calculations.

PubMed

Yang, Zaixing; Wang, Zhigang; Tian, Xingling; Xiu, Peng; Zhou, Ruhong

2012-01-14

Understanding the interaction between carbon nanotubes (CNTs) and biomolecules is essential to the CNT-based nanotechnology and biotechnology. Some recent experiments have suggested that the π-π stacking interactions between protein's aromatic residues and CNTs might play a key role in their binding, which raises interest in large scale modeling of protein-CNT complexes and associated π-π interactions at atomic detail. However, there is concern on the accuracy of classical fixed-charge molecular force fields due to their classical treatments and lack of polarizability. Here, we study the binding of three aromatic residue analogues (mimicking phenylalanine, tyrosine, and tryptophan) and benzene to a single-walled CNT, and compare the molecular mechanical (MM) calculations using three popular fixed-charge force fields (OPLSAA, AMBER, and CHARMM), with quantum mechanical (QM) calculations using the density-functional tight-binding method with the inclusion of dispersion correction (DFTB-D). Two typical configurations commonly found in π-π interactions are used, one with the aromatic rings parallel to the CNT surface (flat), and the other perpendicular (edge). Our calculations reveal that compared to the QM results the MM approaches can appropriately reproduce the strength of π-π interactions for both configurations, and more importantly, the energy difference between them, indicating that the various contributions to π-π interactions have been implicitly included in the van der Waals parameters of the standard MM force fields. Meanwhile, these MM models are less accurate in predicting the exact structural binding patterns (matching surface), meaning there are still rooms to be improved. In addition, we have provided a comprehensive and reliable QM picture for the π-π interactions of aromatic molecules with CNTs in gas phase, which might be used as a benchmark for future force field developments.

DC conductivity of twisted bilayer graphene: Angle-dependent transport properties and effects of disorder

NASA Astrophysics Data System (ADS)

Andelković, M.; Covaci, L.; Peeters, F. M.

2018-03-01

The in-plane dc conductivity of twisted bilayer graphene is calculated using an expansion of the real-space Kubo-Bastin conductivity in terms of Chebyshev polynomials. We investigate within a tight-binding approach the transport properties as a function of rotation angle, applied perpendicular electric field, and vacancy disorder. We find that for high-angle twists, the two layers are effectively decoupled, and the minimum conductivity at the Dirac point corresponds to double the value observed in monolayer graphene. This remains valid even in the presence of vacancies, hinting that chiral symmetry is still preserved. On the contrary, for low twist angles, the conductivity at the Dirac point depends on the twist angle and is not protected in the presence of disorder. Furthermore, for low angles and in the presence of an applied electric field, we find that the chiral boundary states emerging between AB and BA regions contribute to the dc conductivity, despite the appearance of localized states in the AA regions. The results agree qualitatively with recent transport experiments in low-angle twisted bilayer graphene.

Limited angle CT reconstruction by simultaneous spatial and Radon domain regularization based on TV and data-driven tight frame

NASA Astrophysics Data System (ADS)

Zhang, Wenkun; Zhang, Hanming; Wang, Linyuan; Cai, Ailong; Li, Lei; Yan, Bin

2018-02-01

Limited angle computed tomography (CT) reconstruction is widely performed in medical diagnosis and industrial testing because of the size of objects, engine/armor inspection requirements, and limited scan flexibility. Limited angle reconstruction necessitates usage of optimization-based methods that utilize additional sparse priors. However, most of conventional methods solely exploit sparsity priors of spatial domains. When CT projection suffers from serious data deficiency or various noises, obtaining reconstruction images that meet the requirement of quality becomes difficult and challenging. To solve this problem, this paper developed an adaptive reconstruction method for limited angle CT problem. The proposed method simultaneously uses spatial and Radon domain regularization model based on total variation (TV) and data-driven tight frame. Data-driven tight frame being derived from wavelet transformation aims at exploiting sparsity priors of sinogram in Radon domain. Unlike existing works that utilize pre-constructed sparse transformation, the framelets of the data-driven regularization model can be adaptively learned from the latest projection data in the process of iterative reconstruction to provide optimal sparse approximations for given sinogram. At the same time, an effective alternating direction method is designed to solve the simultaneous spatial and Radon domain regularization model. The experiments for both simulation and real data demonstrate that the proposed algorithm shows better performance in artifacts depression and details preservation than the algorithms solely using regularization model of spatial domain. Quantitative evaluations for the results also indicate that the proposed algorithm applying learning strategy performs better than the dual domains algorithms without learning regularization model

Atomistic simulations of the optical absorption of type-II CdSe/ZnTe superlattices

PubMed Central

2012-01-01

We perform accurate tight binding simulations to design type-II short-period CdSe/ZnTe superlattices suited for photovoltaic applications. Absorption calculations demonstrate a very good agreement with optical results with threshold strongly depending on the chemical species near interfaces. PMID:23031315

The Receptor Binding Domain of Botulinum Neurotoxin Stereotype C Binds Phosphoinositides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Varnum, Susan M.

2012-03-01

Botulinum neurotoxins (BoNTs) are the most toxic proteins known for humans and animals with an extremely low LD50 of {approx} 1 ng/kg. BoNTs generally require a protein and a ganglioside on the cell membrane surface for binding, which is known as a 'dual receptor' mechanism for host intoxication. Recent studies have suggested that in addition to gangliosides, other membrane lipids such as phosphoinositides may be involved in the interactions with the receptor binding domain (HCR) of BoNTs for better membrane penetration. Here, using two independent lipid-binding assays, we tested the interactions of BoNT/C-HCR with lipids in vitro. BoNT/C-HCR was foundmore » to bind negatively charged phospholipids, preferentially phosphoinositides. Additional interactions to phosphoinositides may help BoNT/C bind membrane more tightly and transduct signals for subsequent steps of intoxication. Our results provide new insights into the mechanisms of host cell membrane recognition by BoNTs.« less

Tight swimming trunks to prevent post scrotal surgery: an experimental justification.

PubMed

Al-Abed, Yahya A; Carr, Thomas W

2013-01-01

To conduct a study to measure the pressure effects of the different scrotal supports applied on a simulated expanding scrotal hematoma. We created a model of an expanding hematoma with simultaneous pressure recording using a urodynamics system. Pressures were recorded independently first without application of any support. Then, three types of scrotal supports were tested, including Euron Net Knickers, scrotal suspensory bandage, and tight swimming trunks brand Speedo® brief and shorts. Subsequent pressures were recorded using the model created, which was applied inside the supports worn by two male volunteers A and B. Without any external compression, the pressure inside the simulated expanding hematoma "balloon" reached a maximum of 15 cmH2O. The pressures measured whilst wearing "Netelast knickers" in both subjects A and B reached a maximum of 15 cmH2O suggesting that this garment exerted no measurable compression. The suspensory scrotal support was then tested in both subjects. As the balloon started to fill with saline, the simulated hematoma pushed the scrotal support forward resulting in falling of the balloon outside the scrotal support. Subsequently, Speedo® briefs and shorts were tested. With Speedo® briefs, maximum filling pressures of 49 cmH2O and 40 cmH2O were reached in subjects A and B, respectively. When using Speedo® shorts, however, maximum pressures of 55 cmH2O in subject A and 54 cmH2O in subject B were reached at the end of the balloon filling to 300 mL of saline. The use of tight swimming trunks (Speedo®) has led to satisfactory results in the prevention of hematoma post scrotal surgery.

Surface-Bound Casein Modulates the Adsorption and Activity of Kinesin on SiO2 Surfaces

PubMed Central

Ozeki, Tomomitsu; Verma, Vivek; Uppalapati, Maruti; Suzuki, Yukiko; Nakamura, Mikihiko; Catchmark, Jeffrey M.; Hancock, William O.

2009-01-01

Abstract Conventional kinesin is routinely adsorbed to hydrophilic surfaces such as SiO2. Pretreatment of surfaces with casein has become the standard protocol for achieving optimal kinesin activity, but the mechanism by which casein enhances kinesin surface adsorption and function is poorly understood. We used quartz crystal microbalance measurements and microtubule gliding assays to uncover the role that casein plays in enhancing the activity of surface-adsorbed kinesin. On SiO2 surfaces, casein adsorbs as both a tightly bound monolayer and a reversibly bound second layer that has a dissociation constant of 500 nM and can be desorbed by washing with casein-free buffer. Experiments using truncated kinesins demonstrate that in the presence of soluble casein, kinesin tails bind well to the surface, whereas kinesin head binding is blocked. Removing soluble casein reverses these binding profiles. Surprisingly, reversibly bound casein plays only a moderate role during kinesin adsorption, but it significantly enhances kinesin activity when surface-adsorbed motors are interacting with microtubules. These results point to a model in which a dynamic casein bilayer prevents reversible association of the heads with the surface and enhances association of the kinesin tail with the surface. Understanding protein-surface interactions in this model system should provide a framework for engineering surfaces for functional adsorption of other motor proteins and surface-active enzymes. PMID:19383474

Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

DOE PAGES

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

2016-07-01

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

Biophysical characterization of interactions between the C-termini of peripheral nerve claudins and the PDZ₁ domain of zonula occludens.

PubMed

Wu, Jiawen; Peng, Dungeng; Zhang, Yang; Lu, Zhenwei; Voehler, Markus; Sanders, Charles R; Li, Jun

2015-03-27

Our recent study has shown that cellular junctions in myelin and in the epi-/perineruium that encase nerve fibers regulate the permeability of the peripheral nerves. This permeability may affect propagation of the action potential. Direct interactions between the PDZ₁ domain of zonula occludens (ZO₁ or ZO₂) and the C-termini of claudins are known to be crucial for the formation of tight junctions. Using the purified PDZ₁ domain of ZO₂ and a variety of C-terminal mutants of peripheral nerve claudins (claudin-1, claudin-2, claudin-3, claudin-5 in epi-/perineurium; claudin-19 in myelin), we have utilized NMR spectroscopy to determine specific roles of the 3 C-terminal claudin residues (position -2, -1, 0) for their interactions with PDZ₁ of ZO₂. In contrast to the canonical model that emphasizes the importance of residues at the -2 and 0 positions, our results demonstrate that, for peripheral nerve claudins, the residue at position -1 plays a critical role in association with PDZ₁, while the side-chain of residue 0 plays a significant but lesser role. Surprisingly, claudin-19, the most abundant claudin in myelin, exhibited no binding to ZO₂. These findings reveal that the binding mechanism of claudin/ZO in epi-/perineurium is distinct from the canonical interactions between non-ZO PDZ-containing proteins with their ligands. This observation provides the molecular basis for a strategy to develop drugs that target tight junctions in the epi-/perineurium of peripheral nerves. Published by Elsevier Inc.

Electronic transport across a junction between armchair graphene nanotube and zigzag nanoribbon. Transmission in an armchair nanotube without a zigzag half-line of dimers

NASA Astrophysics Data System (ADS)

Sharma, Basant Lal

2018-05-01

Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.

Three-dimensional structure and dynamics of wine tannin-saliva protein complexes. A multitechnique approach.

PubMed

Simon, Cécile; Barathieu, Karine; Laguerre, Michel; Schmitter, Jean-Marie; Fouquet, Eric; Pianet, Isabelle; Dufourc, Erick J

2003-09-09

The interactions between the B3 (catechin-4alpha,8-catechin) red wine tannin and the human salivary protein fragment IB7(14) (SPPGKPQGPPPQGG) were monitored by (1)H magic angle spinning NMR, circular dichroism, electrospray ionization mass spectrometry, and molecular modeling. It is found that the secondary structure of IB7(14) is made of a type II helix (collagen helix) and random coil. The central glycine 8 appears to act as a flexible rotula separating two helix II regions. Three tannin molecules tightly complex the peptide, without modifying its secondary structure, but seem to reduce its conformational dynamics. The binding dissociation constant is in the millimolar range. B3 tannins with a "tweezers" conformation bind to the hydrophilic side of the saliva peptide, suggesting that the principal driving forces toward association are governed by hydrogen bonding between the carbonyl functions of proline residues and both the phenol and catechol OH groups. These findings are further discussed in the frame of an astringency phenomenon.

Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma

PubMed Central

Naz, Anam; Obaid, Ayesha; Awan, Faryal M.; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

2017-01-01

Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells. PMID:28932213

Petri Net-Based Model of Helicobacter pylori Mediated Disruption of Tight Junction Proteins in Stomach Lining during Gastric Carcinoma.

PubMed

Naz, Anam; Obaid, Ayesha; Awan, Faryal M; Ikram, Aqsa; Ahmad, Jamil; Ali, Amjad

2017-01-01

Tight junctions help prevent the passage of digestive enzymes and microorganisms through the space between adjacent epithelial cells lining. However, Helicobacter pylori encoded virulence factors negatively regulate these tight junctions and contribute to dysfunction of gastric mucosa. Here, we have predicted the regulation of important tight junction proteins, such as Zonula occludens-1, Claudin-2 and Connexin32 in the presence of pathogenic proteins. Molecular events such as post translational modifications and crosstalk between phosphorylation, O-glycosylation, palmitoylation and methylation are explored which may compromise the integrity of these tight junction proteins. Furthermore, the signaling pathways disrupted by dysregulated kinases, proteins and post-translational modifications are reviewed to design an abstracted computational model showing the situation-dependent dynamic behaviors of these biological processes and entities. A qualitative hybrid Petri Net model is therefore constructed showing the altered host pathways in the presence of virulence factor cytotoxin-associated gene A, leading to the disruption of tight junction proteins. The model is qualitative logic-based, which does not depend on any kinetic parameter and quantitative data and depends on knowledge derived from experiments. The designed model provides insights into the tight junction disruption and disease progression. Model is then verified by the available experimental data, nevertheless formal in vitro experimentation is a promising way to ensure its validation. The major findings propose that H. pylori activated kinases are responsible to trigger specific post translational modifications within tight junction proteins, at specific sites. These modifications may favor alterations in gastric barrier and provide a route to bacterial invasion into host cells.

Structural analysis of the binding modes of minor groove ligands comprised of disubstituted benzenes

PubMed Central

Hawkins, Cheryl A.; Watson, Charles; Yan, Yinfa; Gong, Bing; Wemmer, David E.

2001-01-01

Two-dimensional homonuclear NMR was used to characterize synthetic DNA minor groove-binding ligands in complexes with oligonucleotides containing three different A-T binding sites. The three ligands studied have a C2 axis of symmetry and have the same general structural motif of a central para-substituted benzene ring flanked by two meta-substituted rings, giving the molecules a crescent shape. As with other ligands of this shape, specificity seems to arise from a tight fit in the narrow minor groove of the preferred A-T-rich sequences. We found that these ligands slide between binding subsites, behavior attributed to the fact that all of the amide protons in the ligand backbone cannot hydrogen bond to the minor groove simultaneously. PMID:11160926

Role of Electrostatic Interactions in Binding of Peptides and Intrinsically Disordered Proteins to Their Folded Targets: 2. The Model of Encounter Complex Involving the Double Mutant of the c-Crk N-SH3 Domain and Peptide Sos.

PubMed

Yuwen, Tairan; Xue, Yi; Skrynnikov, Nikolai R

2016-03-29

In the first part of this work (paper 1, Xue, Y. et al. Biochemistry 2014 , 53 , 6473 ), we have studied the complex between the 10-residue peptide Sos and N-terminal SH3 domain from adaptor protein c-Crk. In the second part (this paper), we designed the double mutant of the c-Crk N-SH3 domain, W169F/Y186L, with the intention to eliminate the interactions responsible for tight peptide-protein binding, while retaining the interactions that create the initial electrostatic encounter complex. The resulting system was characterized experimentally by measuring the backbone and side-chain (15)N relaxation rates, as well as binding shifts and (1)H(N) temperature coefficients. In addition, it was also modeled via a series of ∼5 μs molecular dynamics (MD) simulations recorded in a large water box under an Amber ff99SB*-ILDN force field. Similar to paper 1, we have found that the strength of arginine-aspartate and arginine-glutamate salt bridges is overestimated in the original force field. To address this problem we have applied the empirical force-field correction described in paper 1. Specifically, the Lennard-Jones equilibrium distance for the nitrogen-oxygen pair across Arg-to-Asp/Glu salt bridges has been increased by 3%. This modification led to MD models in good agreement with the experimental data. The emerging picture is that of a fuzzy complex, where the peptide "dances" over the surface of the protein, making transient contacts via salt-bridge interactions. Every once in a while the peptide assumes a certain more stable binding pose, assisted by a number of adventitious polar and nonpolar contacts. On the other hand, occasionally Sos flies off the protein surface; it is then guided by electrostatic steering to quickly reconnect with the protein. The dynamic interaction between Sos and the double mutant of c-Crk N-SH3 gives rise to only small binding shifts. The peptide retains a high degree of conformational mobility, although it is appreciably slowed down due to its (loose) association with the protein. Note that spin relaxation data are indispensable in determining the dynamic status of the peptide. Such data can be properly modeled only on a basis of bona fide MD simulations, as shown in our study. We anticipate that in future the field will move away from the ensemble view of protein disorder and toward more sophisticated MD models. This will require further optimization of force fields, aimed specifically at disordered systems. Efforts in this direction have been recently initiated by several research groups; the empirical salt-bridge correction proposed in our work falls in the same category. MD models obtained with the help of suitably refined force fields and guided by experimental NMR data will provide a powerful insight into an intricate world of disordered biomolecules.

Rubisco Activity: Effects of Drought Stress

PubMed Central

PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

2002-01-01

Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

PubMed Central

Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

2008-01-01

A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

Coxibs interfere with the action of aspirin by binding tightly to one monomer of cyclooxygenase-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rimon, Gilad; Sidhu, Ranjinder S.; Lauver, D. Adam

Pain associated with inflammation involves prostaglandins synthesized from arachidonic acid (AA) through cyclooxygenase-2 (COX-2) pathways while thromboxane A{sub 2} formed by platelets from AA via cyclooxygenase-1 (COX-1) mediates thrombosis. COX-1 and COX-2 are both targets of nonselective nonsteroidal antiinflammatory drugs (nsNSAIDs) including aspirin whereas COX-2 activity is preferentially blocked by COX-2 inhibitors called coxibs. COXs are homodimers composed of identical subunits, but we have shown that only one subunit is active at a time during catalysis; moreover, many nsNSAIDS bind to a single subunit of a COX dimer to inhibit the COX activity of the entire dimer. Here, we reportmore » the surprising observation that celecoxib and other coxibs bind tightly to a subunit of COX-1. Although celecoxib binding to one monomer of COX-1 does not affect the normal catalytic processing of AA by the second, partner subunit, celecoxib does interfere with the inhibition of COX-1 by aspirin in vitro. X-ray crystallographic results obtained with a celecoxib/COX-1 complex show how celecoxib can bind to one of the two available COX sites of the COX-1 dimer. Finally, we find that administration of celecoxib to dogs interferes with the ability of a low dose of aspirin to inhibit AA-induced ex vivo platelet aggregation. COX-2 inhibitors such as celecoxib are widely used for pain relief. Because coxibs exhibit cardiovascular side effects, they are often prescribed in combination with low-dose aspirin to prevent thrombosis. Our studies predict that the cardioprotective effect of low-dose aspirin on COX-1 may be blunted when taken with coxibs.« less

Dynamical Localization for Discrete and Continuous Random Schrödinger Operators

NASA Astrophysics Data System (ADS)

Germinet, F.; De Bièvre, S.

We show for a large class of random Schrödinger operators Ho on and on that dynamical localization holds, i.e. that, with probability one, for a suitable energy interval I and for q a positive real, Here ψ is a function of sufficiently rapid decrease, and PI(Ho) is the spectral projector of Ho corresponding to the interval I. The result is obtained through the control of the decay of the eigenfunctions of Ho and covers, in the discrete case, the Anderson tight-binding model with Bernoulli potential (dimension ν = 1) or singular potential (ν > 1), and in the continuous case Anderson as well as random Landau Hamiltonians.

Excitonic fine-structure splitting in telecom-wavelength InAs/GaAs quantum dots: Statistical distribution and height-dependence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Goldmann, Elias, E-mail: goldmann@itp.uni-bremen.de; Barthel, Stefan; Florian, Matthias

The variation of the excitonic fine-structure splitting is studied for semiconductor quantum dots under the influence of a strain-reducing layer, utilized to shift the emission wavelength of the excitonic transition into the telecom-wavelength regime of 1.3–1.5 μm. By means of a sp{sup 3}s{sup *}-tight-binding model and configuration interaction, we calculate wavelength shifts and fine-structure splittings for various quantum dot geometries. We find the splittings remaining small and even decreasing with strain-reducing layer composition for quantum dots with large height. Combined with an observed increased emission efficiency, the applicability for generation of entanglement photons is persistent.

Analytic expression for the giant fieldlike spin torque in spin-filter magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Tang, Y.-H.; Huang, Z.-W.; Huang, B.-H.

2017-08-01

We propose analytic expressions for fieldlike, T⊥, and spin-transfer, T∥, spin torque components in the spin-filter-based magnetic tunnel junction (SFMTJ), by using the single-band tight-binding model with the nonequilibrium Keldysh formalism. In consideration of multireflection processes between noncollinear magnetization of the spin-filter (SF) barrier and the ferromagnetic (FM) electrode, the central spin-selective SF barrier plays an active role in the striking discovery T⊥≫T∥ , which can be further identified by the unusual barrier thickness dependence of giant T⊥. Our general expressions reveal the sinusoidal angular dependence of both spin torque components, even in the presence of the SF barrier.

Spin-Swapping Transport and Torques in Ultrathin Magnetic Bilayers

NASA Astrophysics Data System (ADS)

Saidaoui, Hamed Ben Mohamed; Manchon, A.

2016-07-01

Planar spin transport in disordered ultrathin magnetic bilayers comprising a ferromagnet and a normal metal (typically used for spin pumping, spin Seebeck and spin-orbit torque experiments) is investigated theoretically. Using a tight-binding model that puts the extrinsic spin Hall effect and spin swapping on equal footing, we show that the nature of spin-orbit coupled transport dramatically depends on the ratio between the layer thickness d and the mean free path λ . While the spin Hall effect dominates in the diffusive limit (d ≫λ ), spin swapping dominates in the Knudsen regime (d ≲λ ). A remarkable consequence is that spin swapping induces a substantial fieldlike torque in the Knudsen regime.