Sample records for tight-binding pair potentials

  1. Atomic scale simulations of pyrochlore oxides with a tight-binding variable-charge model: implications for radiation tolerance.

    PubMed

    Sattonnay, G; Tétot, R

    2014-02-05

    Atomistic simulations with new interatomic potentials derived from a tight-binding variable-charge model were performed in order to investigate the lattice properties and the defect formation energies in Gd2Ti2O7 and Gd2Zr2O7 pyrochlores. The main objective was to determine the role played by the defect stability on the radiation tolerance of these compounds. Calculations show that the titanate has a more covalent character than the zirconate. Moreover, the properties of oxygen Frenkel pairs, cation antisite defects and cation Frenkel pairs were studied. In Gd2Ti2O7 the cation antisite defect and the Ti-Frenkel pair are not stable: they evolve towards more stable defect configurations during the atomic relaxation process. This phenomenon is driven by a decrease of the Ti coordination number down to five which leads to a local atomic reorganization and strong structural distortions around the defects. These kinds of atomic rearrangements are not observed around defects in Gd2Zr2O7. Therefore, the defect stability in A2B2O7 depends on the ability of B atoms to accommodate high coordination number (higher than six seems impossible for Ti). The accumulation of structural distortions around Ti-defects due to this phenomenon could drive the Gd2Ti2O7 amorphization induced by irradiation.

  2. Spin fluctuations and superconductivity in a 3D tight-binding model for BaFe2As2

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Graser, Siegfried; Kemper, Alexander F; Maier, Thomas A

    2010-01-01

    Despite the wealth of experimental data on the Fe-pnictide compounds of the KFe2As2 type, K=Ba, Ca, or Sr, the main theoretical work based on multiorbital tight-binding models has been restricted so far to the study of the related 1111 compounds. This can be ascribed to the more three-dimensional electronic structure found by ab initio calculations for the 122 materials, making this system less amenable to model development. In addition, the more complicated Brillouin zone BZ of the body-centered tetragonal symmetry does not allow a straightforward unfolding of the electronic band structure into an effective 1Fe/unit cell BZ. Here we presentmore » an effective five-orbital tight-binding fit of the full density functional theory band structure for BaFe2As2 including the kz dispersions. We compare the five-orbital spin fluctuation model to one previously studied for LaOFeAs and calculate the random-phase approximation enhanced susceptibility. Using the fluctuation ex- change approximation to determine the leading pairing instability, we then examine the differences between a strictly two-dimensional model calculation over a single kz cut of the BZ and a completely three-dimensional approach. We find pairing states quite similar to the 1111 materials, with generic quasi-isotropic pairing on the hole sheets and nodal states on the electron sheets at kz=0, which however are gapped as the system is hole doped. On the other hand, a substantial kz dependence of the order parameter remains, with most of the pairing strength deriving from processes near kz=?. These states exhibit a tendency for an enhanced anisotropy on the hole sheets and a reduced anisotropy on the electron sheets near the top of the BZ.« less

  3. Molecular recognition of pyr mRNA by the Bacillus subtilis attenuation regulatory protein PyrR

    PubMed Central

    Bonner, Eric R.; D’Elia, John N.; Billips, Benjamin K.; Switzer, Robert L.

    2001-01-01

    The pyrimidine nucleotide biosynthesis (pyr) operon in Bacillus subtilis is regulated by transcriptional attenuation. The PyrR protein binds in a uridine nucleotide-dependent manner to three attenuation sites at the 5′-end of pyr mRNA. PyrR binds an RNA-binding loop, allowing a terminator hairpin to form and repressing the downstream genes. The binding of PyrR to defined RNA molecules was characterized by a gel mobility shift assay. Titration indicated that PyrR binds RNA in an equimolar ratio. PyrR bound more tightly to the binding loops from the second (BL2 RNA) and third (BL3 RNA) attenuation sites than to the binding loop from the first (BL1 RNA) attenuation site. PyrR bound BL2 RNA 4–5-fold tighter in the presence of saturating UMP or UDP and 150- fold tighter with saturating UTP, suggesting that UTP is the more important co-regulator. The minimal RNA that bound tightly to PyrR was 28 nt long. Thirty-one structural variants of BL2 RNA were tested for PyrR binding affinity. Two highly conserved regions of the RNA, the terminal loop and top of the upper stem and a purine-rich internal bulge and the base pairs below it, were crucial for tight binding. Conserved elements of RNA secondary structure were also required for tight binding. PyrR protected conserved areas of the binding loop in hydroxyl radical footprinting experiments. PyrR likely recognizes conserved RNA sequences, but only if they are properly positioned in the correct secondary structure. PMID:11726695

  4. Nonmagnetic impurity resonances as a signature of sign-reversal pairing in FeAs-based superconductors.

    PubMed

    Zhang, Degang

    2009-10-30

    The energy band structure of FeAs-based superconductors is fitted by a tight-binding model with two Fe ions per unit cell and two degenerate orbitals per Fe ion. Based on this, superconductivity with extended s-wave pairing symmetry of the form cosk(x)+cosk(y) is examined. The local density of states near an impurity is also investigated by using the T-matrix approach. For the nonmagnetic scattering potential, we found that there exist two major resonances inside the gap. The height of the resonance peaks depends on the strength of the impurity potential. These in-gap resonances are originated in the Andreev's bound states due to the quasiparticle scattering between the hole Fermi surfaces around Gamma point with positive order parameter and the electron Fermi surfaces around M point with negative order parameter.

  5. A general intermolecular force field based on tight-binding quantum chemical calculations

    NASA Astrophysics Data System (ADS)

    Grimme, Stefan; Bannwarth, Christoph; Caldeweyher, Eike; Pisarek, Jana; Hansen, Andreas

    2017-10-01

    A black-box type procedure is presented for the generation of a molecule-specific, intermolecular potential energy function. The method uses quantum chemical (QC) information from our recently published extended tight-binding semi-empirical scheme (GFN-xTB) and can treat non-covalently bound complexes and aggregates with almost arbitrary chemical structure. The necessary QC information consists of the equilibrium structure, Mulliken atomic charges, charge centers of localized molecular orbitals, and also of frontier orbitals and orbital energies. The molecular pair potential includes model density dependent Pauli repulsion, penetration, as well as point charge electrostatics, the newly developed D4 dispersion energy model, Drude oscillators for polarization, and a charge-transfer term. Only one element-specific and about 20 global empirical parameters are needed to cover systems with nuclear charges up to radon (Z = 86). The method is tested for standard small molecule interaction energy benchmark sets where it provides accurate intermolecular energies and equilibrium distances. Examples for structures with a few hundred atoms including charged systems demonstrate the versatility of the approach. The method is implemented in a stand-alone computer code which enables rigid-body, global minimum energy searches for molecular aggregation or alignment.

  6. Extended Lagrangian formulation of charge-constrained tight-binding molecular dynamics.

    PubMed

    Cawkwell, M J; Coe, J D; Yadav, S K; Liu, X-Y; Niklasson, A M N

    2015-06-09

    The extended Lagrangian Born-Oppenheimer molecular dynamics formalism [Niklasson, Phys. Rev. Lett., 2008, 100, 123004] has been applied to a tight-binding model under the constraint of local charge neutrality to yield microcanonical trajectories with both precise, long-term energy conservation and a reduced number of self-consistent field optimizations at each time step. The extended Lagrangian molecular dynamics formalism restores time reversal symmetry in the propagation of the electronic degrees of freedom, and it enables the efficient and accurate self-consistent optimization of the chemical potential and atomwise potential energy shifts in the on-site elements of the tight-binding Hamiltonian that are required when enforcing local charge neutrality. These capabilities are illustrated with microcanonical molecular dynamics simulations of a small metallic cluster using an sd-valent tight-binding model for titanium. The effects of weak dissipation on the propagation of the auxiliary degrees of freedom for the chemical potential and on-site Hamiltonian matrix elements that is used to counteract the accumulation of numerical noise during trajectories was also investigated.

  7. Control of the Ability of Profilin to Bind and Facilitate Nucleotide Exchange from G-actin*

    PubMed Central

    Wen, Kuo-Kuang; McKane, Melissa; Houtman, Jon C. D.; Rubenstein, Peter A.

    2008-01-01

    A major factor in profilin regulation of actin cytoskeletal dynamics is its facilitation of G-actin nucleotide exchange. However, the mechanism of this facilitation is unknown. We studied the interaction of yeast (YPF) and human profilin 1 (HPF1) with yeast and mammalian skeletal muscle actins. Homologous pairs (YPF and yeast actin, HPF1 and muscle actin) bound more tightly to one another than heterologous pairs. However, with saturating profilin, HPF1 caused a faster etheno-ATP exchange with both yeast and muscle actins than did YPF. Based on the -fold change in ATP exchange rate/Kd, however, the homologous pairs are more efficient than the heterologous pairs. Thus, strength of binding of profilin to actin and nucleotide exchange rate are not tightly coupled. Actin/HPF interactions were entropically driven, whereas YPF interactions were enthalpically driven. Hybrid yeast actins containing subdomain 1 (sub1) or subdomain 1 and 2 (sub12) muscle actin residues bound more weakly to YPF than did yeast actin (Kd = 2 μm versus 0.6 μm). These hybrids bound even more weakly to HPF than did yeast actin (Kd = 5 μm versus 3.2 μm). sub1/YPF interactions were entropically driven, whereas the sub12/YPF binding was enthalpically driven. Compared with WT yeast actin, YPF binding to sub1 occurred with a 5 times faster koff and a 2 times faster kon. sub12 bound with a 3 times faster koff and a 1.5 times slower kon. Profilin controls the energetics of its interaction with nonhybrid actin, but interactions between actin subdomains 1 and 2 affect the topography of the profilin binding site. PMID:18223293

  8. Multiply Reduced Oligofluorenes: Their Nature and Pairing with THF-Solvated Sodium Ions

    DOE PAGES

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet; ...

    2016-07-01

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  9. Tight-binding calculation studies of vacancy and adatom defects in graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Wei; Lu, Wen-Cai; Zhang, Hong-Xing

    2016-02-19

    Computational studies of complex defects in graphene usually need to deal with a larger number of atoms than the current first-principles methods can handle. We show a recently developed three-center tight-binding potential for carbon is very efficient for large scale atomistic simulations and can accurately describe the structures and energies of various defects in graphene. Using the three-center tight-binding potential, we have systematically studied the stable structures and formation energies of vacancy and embedded-atom defects of various sizes up to 4 vacancies and 4 embedded atoms in graphene. In conclusion, our calculations reveal low-energy defect structures and provide a moremore » comprehensive understanding of the structures and stability of defects in graphene.« less

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Qin; Zaikowski, Lori; Kaur, Parmeet

    Conjugated oligofluorenes are chemically reduced up to five charges in tetrahydrofuran solvent and confirmed with clear spectroscopic evidence. Stimulated by these experimental results, we have conducted a comprehensive computational study of the electronic structure and the solvation structure of representative oligofluorene anions with a focus on the pairing between sodium ions and these multianions. In addition, using density functional theory (DFT) methods and a solvation model of both explicit solvent molecules and implicit polarizable continuum, we first elucidate the structure of tightly solvated free sodium ions, and then explore the pairing of sodium ions either in contact with reduced oligofluorenesmore » or as solvent-separated ion pairs. Computed time-dependent-DFT absorption spectra are compared with experiments to assign the dominant ion pairing structure for each multianion. Computed ion pair binding energies further support our assignment. Lastly, the availability of different length and reducing level of oligofluorenes enables us to investigate the effects of total charge and charge density on the binding with sodium ions, and our results suggest both factors play important roles in ion pairing for small molecules. However, as the oligofluorene size grows, its charge density determines the binding strength with the sodium ion.« less

  11. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  12. Numerical Optimization of Density Functional Tight Binding Models: Application to Molecules Containing Carbon, Hydrogen, Nitrogen, and Oxygen

    DOE PAGES

    Krishnapriyan, A.; Yang, P.; Niklasson, A. M. N.; ...

    2017-10-17

    New parametrizations for semiempirical density functional tight binding (DFTB) theory have been developed by the numerical optimization of adjustable parameters to minimize errors in the atomization energy and interatomic forces with respect to ab initio calculated data. Initial guesses for the radial dependences of the Slater- Koster bond integrals and overlap integrals were obtained from minimum basis density functional theory calculations. The radial dependences of the pair potentials and the bond and overlap integrals were represented by simple analytic functions. The adjustable parameters in these functions were optimized by simulated annealing and steepest descent algorithms to minimize the value ofmore » an objective function that quantifies the error between the DFTB model and ab initio calculated data. The accuracy and transferability of the resulting DFTB models for the C, H, N, and O system were assessed by comparing the predicted atomization energies and equilibrium molecular geometries of small molecules that were not included in the training data from DFTB to ab initio data. The DFTB models provide accurate predictions of the properties of hydrocarbons and more complex molecules containing C, H, N, and O.« less

  13. The X3LYP extended density functional accurately describes H-bonding but fails completely for stacking.

    PubMed

    Cerný, Jirí; Hobza, Pavel

    2005-04-21

    The performance of the recently introduced X3LYP density functional which was claimed to significantly improve the accuracy for H-bonded and van der Waals complexes was tested for extended H-bonded and stacked complexes (nucleic acid base pairs and amino acid pairs). In the case of planar H-bonded complexes (guanine...cytosine, adenine...thymine) the DFT results nicely agree with accurate correlated ab initio results. For the stacked pairs (uracil dimer, cytosine dimer, adenine...thymine and guanine...cytosine) the DFT fails completely and it was even not able to localize any minimum at the stacked subspace of the potential energy surface. The geometry optimization of all these stacked clusters leads systematically to the planar H-bonded pairs. The amino acid pairs were investigated in the crystal geometry. DFT again strongly underestimates the accurate correlated ab initio stabilization energies and usually it was not able to describe the stabilization of a pair. The X3LYP functional thus behaves similarly to other current functionals. Stacking of nucleic acid bases as well as interaction of amino acids was described satisfactorily by using the tight-binding DFT method, which explicitly covers the London dispersion energy.

  14. d +i d chiral superconductivity in a triangular lattice from trigonal bipyramidal complexes

    NASA Astrophysics Data System (ADS)

    Lu, Chen; Zhang, Li-Da; Wu, Xianxin; Yang, Fan; Hu, Jiangping

    2018-04-01

    We model the newly predicted high-Tc superconducting candidates constructed by corner-shared trigonal bipyramidal complexes with an effective three-orbital tight-binding Hamiltonian and investigate the pairing symmetry of their superconducting states driven by electron-electron interactions. Our combined weak- and strong-coupling-based calculations consistently identify the chiral d +i d superconductivity as the leading pairing symmetry in a wide doping range with realistic interaction parameters. This pairing state has a nontrivial topological Chern number and can host gapless chiral edge modes, and the vortex cores under magnetic field can carry Majorana zero modes.

  15. Peptide Beacons: A New Design for Polypeptide-Based Optical Biosensors

    PubMed Central

    Oh, Kenneth J.; Cash, Kevin J.; Hugenberg, Verena; Plaxco, Kevin W.

    2008-01-01

    Phage display and other in vitro selection techniques produce short polypeptides that tightly and specifically bind to any of a wide range of macromolecular targets. Here we demonstrate a potentially general means of converting such polypeptides into optical biosensors. The sensing architecture we have developed, termed peptide beacons, is based on the observation that, whereas short peptides are almost invariably unfolded and highly dynamic, they become rigid when complexed to their target. Using this effect to segregate a long-lived fluorophore from an electron transfer-based contact quencher, both covalently attached to the peptide, we have produced a robust optical sensor for anti-HIV antibodies. The binding-induced segregation of the fluorophore-quencher pair produces a six-fold increase in sensor emission, thus allowing us to readily detect as low as ∼250 pM of the target antibody. Because the sensor is based on binding-induced folding and a visible-light fluorophore, it is sufficiently selective to work directly in complex, contaminant-ridden samples such as saliva and blood. PMID:17461545

  16. Potential of mean force for ion pairs in non-aqueous solvents. Comparison of polarizable and non-polarizable MD simulations

    NASA Astrophysics Data System (ADS)

    Odinokov, A. V.; Leontyev, I. V.; Basilevsky, M. V.; Petrov, N. Ch.

    2011-01-01

    Potentials of mean force (PMF) are calculated for two model ion pairs in two non-aqueous solvents. Standard non-polarizable molecular dynamics simulation (NPMD) and approximate polarizable simulation (PMD) are implemented and compared as tools for monitoring PMF profiles. For the polar solvent (dimethylsulfoxide, DMSO) the PMF generated in terms of the NPMD reproduces fairly well the refined PMD-PMF profile. For the non-polar solvent (benzene) the conventional NPMD computation proves to be deficient. The validity of the correction found in terms of the approximate PMD approach is verified by its comparison with the result of the explicit PMD computation in benzene. The shapes of the PMF profiles in DMSO and in benzene are quite different. In DMSO, owing to dielectric screening, the PMF presents a flat plot with a shallow minimum positioned in the vicinity of the van der Waals contact of the ion pair. For the benzene case, the observed minimum proves to be unexpectedly deep, which manifests the formation of a tightly-binded contact ion pair. This remarkable effect arises owing to the strong electrostatic interaction that is incompletely screened by a non-polar medium. The PMFs for the binary benzene/DMSO mixtures display intermediate behaviour depending on the DMSO content.

  17. Tight-binding tunneling amplitude of an optical lattice

    NASA Astrophysics Data System (ADS)

    Arzamasovs, Maksims; Liu, Bo

    2017-11-01

    The particle in a periodic potential is an important topic in an undergraduate quantum mechanics curriculum and a stepping stone on the way to more advanced topics, such as courses on interacting electrons in crystalline solids, and graduate-level research in solid-state and condensed matter physics. The interacting many-body phenomena are usually described in terms of the second quantized lattice Hamiltonians which treat single-particle physics on the level of tight-binding approximation and add interactions on top of it. The aim of this paper is to show how the tight-binding tunneling amplitude can be related to the strength of the periodic potential for the case of a cosine potential used in the burgeoning field of ultracold atoms. We show how to approach the problem of computing the tunneling amplitude of a deep lattice using the JWKB (Jeffreys-Wentzel-Kramers-Brillouin, also known as semiclassical) approximation. We also point out that care should be taken when applying the method of the linear combination of atomic orbitals (LCAO) in an optical lattice context. A summary of the exact solution in terms of Mathieu functions is also given.

  18. Synthesis, DNA binding, topoisomerase inhibition and cytotoxic properties of 2-chloroethylnitrosourea derivatives of hoechst 33258.

    PubMed

    Bielawski, Krzysztof; Bielawska, Anna; Anchim, Tomasz; Wołczyński, Sławomir

    2005-06-01

    A number of novel 2-chloroethylnitrosourea derivatives of Hoechst 33258 were synthesized and examined for cytotoxicity in breast cancer cell cultures and for inhibition of topoisomerases I and II. Evaluation of the cytotoxicity of these compounds employing a MTT assay and inhibition of [3H]thymidine incorporation into DNA in both MDA-MB-231 and MCF-7 breast cancer cells demonstrated that these compounds were more active than Hoechst 33258. The DNA-binding ability of these compounds was evaluated by an ultrafiltration method using calf thymus DNA, poly(dA-dT)2 and poly(dG-dC)2, indicated that these compounds as well as Hoechst 33258 well interact with AT base pair compared with GC pair. Binding studies indicate that these compounds bind more tightly to double-stranded DNA than the parent compound Hoechst 33258. The degree to which these compounds inhibited cell growth breast cancer cells was generally consistent with their relative DNA binding affinity. Mechanistic studies revealed that these compounds act as topoisomerase I (topo I) or topoisomerase II (topo II) inhibitors in plasmid relaxation assays.

  19. Atomic and electronic structure transformations of silver nanoparticles under rapid cooling conditions.

    PubMed

    Lobato, I; Rojas, J; Landauro, C V; Torres, J

    2009-02-04

    The structural evolution and dynamics of silver nanodrops Ag(2869) (4.4 nm in diameter) under rapid cooling conditions have been studied by means of molecular dynamics simulations and electronic density of state calculations. The interaction of silver atoms is modelled by a tight-binding semiempirical interatomic potential proposed by Cleri and Rosato. The pair correlation functions and the pair analysis technique are used to reveal the structural transition in the process of solidification. It is shown that Ag nanoparticles evolve into different nanostructures under different cooling processes. At a cooling rate of 1.5625 × 10(13) K s(-1) the nanoparticles preserve an amorphous-like structure containing a large amount of 1551 and 1541 pairs which correspond to icosahedral symmetry. For a lower cooling rate (1.5625 × 10(12) K s(-1)), the nanoparticles transform into a crystal-like structure consisting mainly of 1421 and 1422 pairs which correspond to the face centred cubic and hexagonal close packed structures, respectively. The variations of the electronic density of states for the differently cooled nanoparticles are small, but in correspondence with the structural changes.

  20. An Expanding Range of Functions for the Copper Chaperone/Antioxidant Protein Atox1

    PubMed Central

    Hatori, Yuta

    2013-01-01

    Abstract Significance: Antioxidant protein 1 (Atox1 in human cells) is a copper chaperone for the copper export pathway with an essential role in cellular copper distribution. In vitro, Atox1 binds and transfers copper to the copper-transporting ATPases, stimulating their catalytic activity. Inactivation of Atox1 in cells inhibits maturation of secreted cuproenzymes as well as copper export from cells. Recent Advances: Accumulating data suggest that cellular functions of Atox1 are not limited to its copper-trafficking role and may include storage of labile copper, modulation of transcription, and antioxidant defense. The conserved metal binding site of Atox1, CxGC, differs from the metal-binding sites of copper-transporting ATPases and has a physiologically relevant redox potential that equilibrates with the GSH:GSSG pair. Critical Issues: Tight relationship appears to exist between intracellular copper levels and glutathione (GSH) homeostasis. The biochemical properties of Atox1 place it at the intersection of cellular networks that regulate copper distribution and cellular redox balance. Mechanisms through which Atox1 facilitates copper export and contributes to oxidative defense are not fully understood. Future Directions: The current picture of cellular redox homeostasis and copper physiology will be enhanced by further mechanistic studies of functional interactions between the GSH:GSSG pair and copper-trafficking machinery. Antioxid. Redox Signal. 19, 945–957. PMID:23249252

  1. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    NASA Astrophysics Data System (ADS)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  2. Hyper-Binding across Time: Age Differences in the Effect of Temporal Proximity on Paired-Associate Learning

    ERIC Educational Resources Information Center

    Campbell, Karen L.; Trelle, Alexandra; Hasher, Lynn

    2014-01-01

    Older adults show hyper- (or excessive) binding effects for simultaneously and sequentially presented distraction. Here, we addressed the potential role of hyper-binding in paired-associate learning. Older and younger adults learned a list of word pairs and then received an associative recognition task in which rearranged pairs were formed from…

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Su, Minfei; Li, Yue; Wyborny, Shane

    ATG14 binding to BECN/Beclin homologs is essential for autophagy, a critical catabolic homeostasis pathway. Here, we show that the α-helical, coiled-coil domain (CCD) of BECN2, a recently identified mammalian BECN1 paralog, forms an antiparallel, curved homodimer with seven pairs of nonideal packing interactions, while the BECN2 CCD and ATG14 CCD form a parallel, curved heterodimer stabilized by multiple, conserved polar interactions. Compared to BECN1, the BECN2 CCD forms a weaker homodimer, but binds more tightly to the ATG14 CCD. Mutation of nonideal BECN2 interface residues to more ideal pairs improves homodimer self-association and thermal stability. Unlike BECN1, all BECN2 CCDmore » mutants bind ATG14, although more weakly than wild type. Thus, polar BECN2 CCD interface residues result in a metastable homodimer, facilitating dissociation, but enable better interactions with polar ATG14 residues stabilizing the BECN2:ATG14 heterodimer. These structure-based mechanistic differences in BECN1 and BECN2 homodimerization and heterodimerization likely dictate competitive ATG14 recruitment.« less

  4. Transferable tight-binding model for strained group IV and III-V materials and heterostructures

    NASA Astrophysics Data System (ADS)

    Tan, Yaohua; Povolotskyi, Michael; Kubis, Tillmann; Boykin, Timothy B.; Klimeck, Gerhard

    2016-07-01

    It is critical to capture the effect due to strain and material interface for device level transistor modeling. We introduce a transferable s p3d5s* tight-binding model with nearest-neighbor interactions for arbitrarily strained group IV and III-V materials. The tight-binding model is parametrized with respect to hybrid functional (HSE06) calculations for varieties of strained systems. The tight-binding calculations of ultrasmall superlattices formed by group IV and group III-V materials show good agreement with the corresponding HSE06 calculations. The application of the tight-binding model to superlattices demonstrates that the transferable tight-binding model with nearest-neighbor interactions can be obtained for group IV and III-V materials.

  5. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription.

    PubMed

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J; Naef, Félix; Shore, David

    2014-08-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and -1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these "fragile" nucleosomes play an important role in regulating RPG transcriptional output. © 2014 Knight et al.; Published by Cold Spring Harbor Laboratory Press.

  6. Two distinct promoter architectures centered on dynamic nucleosomes control ribosomal protein gene transcription

    PubMed Central

    Knight, Britta; Kubik, Slawomir; Ghosh, Bhaswar; Bruzzone, Maria Jessica; Geertz, Marcel; Martin, Victoria; Dénervaud, Nicolas; Jacquet, Philippe; Ozkan, Burak; Rougemont, Jacques; Maerkl, Sebastian J.; Naef, Félix

    2014-01-01

    In yeast, ribosome production is controlled transcriptionally by tight coregulation of the 138 ribosomal protein genes (RPGs). RPG promoters display limited sequence homology, and the molecular basis for their coregulation remains largely unknown. Here we identify two prevalent RPG promoter types, both characterized by upstream binding of the general transcription factor (TF) Rap1 followed by the RPG-specific Fhl1/Ifh1 pair, with one type also binding the HMG-B protein Hmo1. We show that the regulatory properties of the two promoter types are remarkably similar, suggesting that they are determined to a large extent by Rap1 and the Fhl1/Ifh1 pair. Rapid depletion experiments allowed us to define a hierarchy of TF binding in which Rap1 acts as a pioneer factor required for binding of all other TFs. We also uncovered unexpected features underlying recruitment of Fhl1, whose forkhead DNA-binding domain is not required for binding at most promoters, and Hmo1, whose binding is supported by repeated motifs. Finally, we describe unusually micrococcal nuclease (MNase)-sensitive nucleosomes at all RPG promoters, located between the canonical +1 and −1 nucleosomes, which coincide with sites of Fhl1/Ifh1 and Hmo1 binding. We speculate that these “fragile” nucleosomes play an important role in regulating RPG transcriptional output. PMID:25085421

  7. Microscopic theory of the superconducting gap in the quasi-one-dimensional organic conductor (TMTSF) 2ClO4 : Model derivation and two-particle self-consistent analysis

    NASA Astrophysics Data System (ADS)

    Aizawa, Hirohito; Kuroki, Kazuhiko

    2018-03-01

    We present a first-principles band calculation for the quasi-one-dimensional (Q1D) organic superconductor (TMTSF) 2ClO4 . An effective tight-binding model with the TMTSF molecule to be regarded as the site is derived from a calculation based on maximally localized Wannier orbitals. We apply a two-particle self-consistent (TPSC) analysis by using a four-site Hubbard model, which is composed of the tight-binding model and an onsite (intramolecular) repulsive interaction, which serves as a variable parameter. We assume that the pairing mechanism is mediated by the spin fluctuation, and the sign of the superconducting gap changes between the inner and outer Fermi surfaces, which correspond to a d -wave gap function in a simplified Q1D model. With the parameters we adopt, the critical temperature for superconductivity estimated by the TPSC approach is approximately 1 K, which is consistent with experiment.

  8. Impurity bound states in fully gapped d-wave superconductors with subdominant order parameters

    PubMed Central

    Mashkoori, Mahdi; Björnson, Kristofer; Black-Schaffer, Annica M.

    2017-01-01

    Impurities in superconductors and their induced bound states are important both for engineering novel states such as Majorana zero-energy modes and for probing bulk properties of the superconducting state. The high-temperature cuprates offer a clear advantage in a much larger superconducting order parameter, but the nodal energy spectrum of a pure d-wave superconductor only allows virtual bound states. Fully gapped d-wave superconducting states have, however, been proposed in several cuprate systems thanks to subdominant order parameters producing d + is- or d + id′-wave superconducting states. Here we study both magnetic and potential impurities in these fully gapped d-wave superconductors. Using analytical T-matrix and complementary numerical tight-binding lattice calculations, we show that magnetic and potential impurities behave fundamentally different in d + is- and d + id′-wave superconductors. In a d + is-wave superconductor, there are no bound states for potential impurities, while a magnetic impurity produces one pair of bound states, with a zero-energy level crossing at a finite scattering strength. On the other hand, a d + id′-wave symmetry always gives rise to two pairs of bound states and only produce a reachable zero-energy level crossing if the normal state has a strong particle-hole asymmetry. PMID:28281570

  9. Non-collinear magnetism with analytic Bond-Order Potentials

    NASA Astrophysics Data System (ADS)

    Ford, Michael E.; Pettifor, D. G.; Drautz, Ralf

    2015-03-01

    The theory of analytic Bond-Order Potentials as applied to non-collinear magnetic structures of transition metals is extended to take into account explicit rotations of Hamiltonian and local moment matrix elements between locally and globally defined spin-coordinate systems. Expressions for the gradients of the energy with respect to the Hamiltonian matrix elements, the interatomic forces and the magnetic torques are derived. The method is applied to simulations of the rotation of magnetic moments in α iron, as well as α and β manganese, based on d-valent orthogonal tight-binding parametrizations of the electronic structure. A new weighted-average terminator is introduced to improve the convergence of the Bond-Order Potential energies and torques with respect to tight-binding reference values, although the general behavior is qualitatively correct for low-moment expansions.

  10. Tight-binding study of stacking fault energies and the Rice criterion of ductility in the fcc metals

    NASA Astrophysics Data System (ADS)

    Mehl, Michael J.; Papaconstantopoulos, Dimitrios A.; Kioussis, Nicholas; Herbranson, M.

    2000-02-01

    We have used the Naval Research Laboratory (NRL) tight-binding (TB) method to calculate the generalized stacking fault energy and the Rice ductility criterion in the fcc metals Al, Cu, Rh, Pd, Ag, Ir, Pt, Au, and Pb. The method works well for all classes of metals, i.e., simple metals, noble metals, and transition metals. We compared our results with full potential linear-muffin-tin orbital and embedded atom method (EAM) calculations, as well as experiment, and found good agreement. This is impressive, since the NRL-TB approach only fits to first-principles full-potential linearized augmented plane-wave equations of state and band structures for cubic systems. Comparable accuracy with EAM potentials can be achieved only by fitting to the stacking fault energy.

  11. Dielectric response of molecules in empirical tight-binding theory

    NASA Astrophysics Data System (ADS)

    Boykin, Timothy B.; Vogl, P.

    2002-01-01

    In this paper we generalize our previous approach to electromagnetic interactions within empirical tight-binding theory to encompass molecular solids and isolated molecules. In order to guarantee physically meaningful results, we rederive the expressions for relevant observables using commutation relations appropriate to the finite tight-binding Hilbert space. In carrying out this generalization, we examine in detail the consequences of various prescriptions for the position and momentum operators in tight binding. We show that attempting to fit parameters of the momentum matrix directly generally results in a momentum operator which is incompatible with the underlying tight-binding model, while adding extra position parameters results in numerous difficulties, including the loss of gauge invariance. We have applied our scheme, which we term the Peierls-coupling tight-binding method, to the optical dielectric function of the molecular solid PPP, showing that this approach successfully predicts its known optical properties even in the limit of isolated molecules.

  12. Bacterial actin MreB forms antiparallel double filaments

    PubMed Central

    van den Ent, Fusinita; Izoré, Thierry; Bharat, Tanmay AM; Johnson, Christopher M; Löwe, Jan

    2014-01-01

    Filaments of all actin-like proteins known to date are assembled from pairs of protofilaments that are arranged in a parallel fashion, generating polarity. In this study, we show that the prokaryotic actin homologue MreB forms pairs of protofilaments that adopt an antiparallel arrangement in vitro and in vivo. We provide an atomic view of antiparallel protofilaments of Caulobacter MreB as apparent from crystal structures. We show that a protofilament doublet is essential for MreB's function in cell shape maintenance and demonstrate by in vivo site-specific cross-linking the antiparallel orientation of MreB protofilaments in E. coli. 3D cryo-EM shows that pairs of protofilaments of Caulobacter MreB tightly bind to membranes. Crystal structures of different nucleotide and polymerisation states of Caulobacter MreB reveal conserved conformational changes accompanying antiparallel filament formation. Finally, the antimicrobial agents A22/MP265 are shown to bind close to the bound nucleotide of MreB, presumably preventing nucleotide hydrolysis and destabilising double protofilaments. DOI: http://dx.doi.org/10.7554/eLife.02634.001 PMID:24843005

  13. Bacterial actin MreB forms antiparallel double filaments.

    PubMed

    van den Ent, Fusinita; Izoré, Thierry; Bharat, Tanmay Am; Johnson, Christopher M; Löwe, Jan

    2014-05-02

    Filaments of all actin-like proteins known to date are assembled from pairs of protofilaments that are arranged in a parallel fashion, generating polarity. In this study, we show that the prokaryotic actin homologue MreB forms pairs of protofilaments that adopt an antiparallel arrangement in vitro and in vivo. We provide an atomic view of antiparallel protofilaments of Caulobacter MreB as apparent from crystal structures. We show that a protofilament doublet is essential for MreB's function in cell shape maintenance and demonstrate by in vivo site-specific cross-linking the antiparallel orientation of MreB protofilaments in E. coli. 3D cryo-EM shows that pairs of protofilaments of Caulobacter MreB tightly bind to membranes. Crystal structures of different nucleotide and polymerisation states of Caulobacter MreB reveal conserved conformational changes accompanying antiparallel filament formation. Finally, the antimicrobial agents A22/MP265 are shown to bind close to the bound nucleotide of MreB, presumably preventing nucleotide hydrolysis and destabilising double protofilaments.DOI: http://dx.doi.org/10.7554/eLife.02634.001. Copyright © 2014, van den Ent et al.

  14. Fullerene Derived Molecular Electronic Devices

    NASA Technical Reports Server (NTRS)

    Menon, Madhu; Srivastava, Deepak; Saini, Subbash

    1998-01-01

    The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale electronic devices. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal grapheme sheet, more complex joints require other mechanisms. In this work we explore structural and electronic properties of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme.

  15. Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

    2016-10-15

    Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

  16. Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

    PubMed Central

    Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

    2013-01-01

    Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

  17. Effect of Fermi surface nesting on resonant spin excitations in Ba{<_1-x}K{<_x}Fe{<_2}As{<_2}.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Castellan, J.-P.; Rosenkranz, S.; Goremychkin, E.A.

    2011-01-01

    We report inelastic neutron scattering measurements of the resonant spin excitations in Ba{sub 1-x}K{sub x}Fe{sub 2}As{sub 2} over a broad range of electron band filling. The fall in the superconducting transition temperature with hole doping coincides with the magnetic excitations splitting into two incommensurate peaks because of the growing mismatch in the hole and electron Fermi surface volumes, as confirmed by a tight-binding model with s{sub {+-}}-symmetry pairing. The reduction in Fermi surface nesting is accompanied by a collapse of the resonance binding energy and its spectral weight, caused by the weakening of electron-electron correlations.

  18. Design of graphene nanoparticle undergoing axial compression: quantum study

    NASA Astrophysics Data System (ADS)

    Glukhova, O. E.; Kirillova, I. V.; Saliy, I. N.; Kolesnikova, A. S.; Slepchenkov, M. M.

    2011-03-01

    We report the results of quantum mechanical investigations of the atomic structure and deformations of graphene nanoparticle undergoing axial compression. We applied the tight-binding (TB) method. Our transferable tightbinding potential correctly reproduced tight-binding changes in the electronic configuration as a function of the local bonding geometry around each carbon atom. The tight-binding method applied provided the consideration and calculation of the rehybridization between σ- and π-orbitals. To research nanoribbons using tight-binding potential our own program was used. We adapted TB method to be able to run the algorithm on a parallel computing machine (computer cluster). To simulate axial compression of graphene nanoparticles the atoms on the ends were fixed on the plates. The plates were moved towards each other to decrease the length at some percent. Plane atomic network undergoing axial compression became wave-like. The amplitude of wave and its period were not constant and changed along axis. This is a phase transition. The strain energy collapse occurs at the value of axial compression 0.03-0.04. The strain energy increased up to the quantity compression 0.03, then collapsed sharply and decreased. So according to our theoretical investigation, the elasticity of graphene nanoparticles is more than the elasticity of nanotubes the same width and length. The curvature of the atomic network because of compression will decrease the reactivity of graphene nanoparticles. We have calculated the atomic structure and electronic structure of the compression graphene nanopaticle at each step of strain of axial compression. We have come to the conclusion that the wave-like graphenes adsorbing protein and nucleic acid are the effective nanosensors and bionanosensors.

  19. Band warping, band non-parabolicity, and Dirac points in electronic and lattice structures

    NASA Astrophysics Data System (ADS)

    Resca, Lorenzo; Mecholsky, Nicholas A.; Pegg, Ian L.

    2017-10-01

    We illustrate at a fundamental level the physical and mathematical origins of band warping and band non-parabolicity in electronic and vibrational structures. We point out a robust presence of pairs of topologically induced Dirac points in a primitive-rectangular lattice using a p-type tight-binding approximation. We analyze two-dimensional primitive-rectangular and square Bravais lattices with implications that are expected to generalize to more complex structures. Band warping is shown to arise at the onset of a singular transition to a crystal lattice with a larger symmetry group, which allows the possibility of irreducible representations of higher dimensions, hence band degeneracy, at special symmetry points in reciprocal space. Band warping is incompatible with a multi-dimensional Taylor series expansion, whereas band non-parabolicities are associated with multi-dimensional Taylor series expansions to all orders. Still band non-parabolicities may merge into band warping at the onset of a larger symmetry group. Remarkably, while still maintaining a clear connection with that merging, band non-parabolicities may produce pairs of conical intersections at relatively low-symmetry points. Apparently, such conical intersections are robustly maintained by global topology requirements, rather than any local symmetry protection. For two p-type tight-binding bands, we find such pairs of conical intersections drifting along the edges of restricted Brillouin zones of primitive-rectangular Bravais lattices as lattice constants vary relatively to each other, until these conical intersections merge into degenerate warped bands at high-symmetry points at the onset of a square lattice. The conical intersections that we found appear to have similar topological characteristics as Dirac points extensively studied in graphene and other topological insulators, even though our conical intersections have none of the symmetry complexity and protection afforded by the latter more complex structures.

  20. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  1. Spin–orbit coupling, minimal model and potential Cooper-pairing from repulsion in BiS2-superconductors

    NASA Astrophysics Data System (ADS)

    Cobo-Lopez, Sergio; Saeed Bahramy, Mohammad; Arita, Ryotaro; Akbari, Alireza; Eremin, Ilya

    2018-04-01

    We develop the realistic minimal electronic model for recently discovered BiS2 superconductors including the spin–orbit (SO) coupling based on the first-principles band structure calculations. Due to strong SO coupling, characteristic for the Bi-based systems, the tight-binding low-energy model necessarily includes p x , p y , and p z orbitals. We analyze a potential Cooper-pairing instability from purely repulsive interaction for the moderate electronic correlations using the so-called leading angular harmonics approximation. For small and intermediate doping concentrations we find the dominant instabilities to be {d}{x2-{y}2}-wave, and s ±-wave symmetries, respectively. At the same time, in the absence of the sizable spin fluctuations the intra and interband Coulomb repulsions are of the same strength, which yield the strongly anisotropic behavior of the superconducting gaps on the Fermi surface. This agrees with recent angle resolved photoemission spectroscopy findings. In addition, we find that the Fermi surface topology for BiS2 layered systems at large electron doping can resemble the doped iron-based pnictide superconductors with electron and hole Fermi surfaces maintaining sufficient nesting between them. This could provide further boost to increase T c in these systems.

  2. Intermediate band formation in a δ-doped like QW superlattices of GaAs/AlxGa1-xAs for solar cell design

    NASA Astrophysics Data System (ADS)

    Del Río-De Santiago, A.; Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Contreras-Solorio, D. A.; Rodríguez-Vargas, I.; Ungan, F.

    2018-03-01

    It is reported a numerical computation of the local density of states for a δ-doped like QW superlattices of AlxGa1-xAs, as a possible heterostructure that, being integrated into a solar cell device design, can provide an intermediate band of allowed states to assist the absorption of photons with lower energies than that of the energy gap of the solar-cell constituent materials. This work was performed using the nearest neighbors sp3s* tight-binding model including spin. The confining potential caused by the ionized donor impurities in δ-doped impurities seeding that was obtained analytically within the lines of the Thomas-Fermi approximation was reproduced here by the Al concentration x variation. This potential is considered as an external perturbation in the tight-binding methodology and it is included in the diagonal terms of the tight-binding Hamiltonian. Special attention is paid to the width of the intermediate band caused by the change in the considered aluminium concentration x, the inter-well distance between δ-doped like QW wells and the number of them in the superlattice. In general we can conclude that this kind of superlattices can be suitable for intermediate band formation for possible intermediate-band solar cell design.

  3. How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

    PubMed

    Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

    2014-04-02

    A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

  4. Most of the tight positional conservation of transcription factor binding sites near the transcription start site reflects their co-localization within regulatory modules.

    PubMed

    Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L

    2016-11-21

    Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.

  5. Binding in pair potentials of liquid simple metals from nonlocality in electronic kinetic energy

    NASA Technical Reports Server (NTRS)

    Perrot, F.; March, N. H.

    1990-01-01

    The paper presents an explicit expression for the pair potential in liquid simple metals from low-order density-gradient theory when the superposition of single-center displaced charges is employed. Numerical results are presented for the gradient expansion pair interaction in liquid Na and Be. The low-order density-gradient equation for the pair potential is presented.

  6. Envisaging quantum transport phenomenon in a muddled base pair of DNA

    NASA Astrophysics Data System (ADS)

    Vohra, Rajan; Sawhney, Ravinder Singh

    2018-05-01

    The effect of muddled base pair on electron transfer through a deoxyribonucleic acid (DNA) molecule connected to the gold electrodes has been elucidated using tight binding model. The effect of hydrogen and nitrogen bonds on the resistance of the base pair has been minutely observed. Using the semiempirical extended Huckel approach within NEGF regime, we have determined the current and conductance vs. bias voltage for disordered base pairs of DNA made of thymine (T) and adenine (A). The asymmetrical behaviour amid five times depreciation in the current characteristics has been observed for deviated Au-AT base pair-Au devices. An interesting revelation is that the conductance of the intrinsic AT base pair configuration attains dramatically high values with the symmetrical zig-zag pattern of current, which clearly indicates the transformation of the bond length within the strands of base pair when compared with other samples. A thorough investigation of the transmission coefficients T( E) and HOMO-LUMO gap reveals the misalignment of the strands in base pairs of DNA. The observed results present an insight to extend this work to build biosensing devices to predict the abnormality with the DNA.

  7. Pressure dependence of critical temperature of bulk FeSe from spin fluctuation theory

    NASA Astrophysics Data System (ADS)

    Hirschfeld, Peter; Kreisel, Andreas; Wang, Yan; Tomic, Milan; Jeschke, Harald; Jacko, Anthony; Valenti, Roser; Maier, Thomas; Scalapino, Douglas

    2013-03-01

    The critical temperature of the 8K superconductor FeSe is extremely sensitive to pressure, rising to a maximum of 40K at about 10GPa. We test the ability of the current generation of fluctuation exchange pairing theories to account for this effect, by downfolding the density functional theory electronic structure for each pressure to a tight binding model. The Fermi surface found in such a procedure is then used with fixed Hubbard parameters to determine the pairing strength using the random phase approximation for the spin singlet pairing vertex. We find that the evolution of the Fermi surface captured by such an approach is alone not sufficient to explain the observed pressure dependence, and discuss alternative approaches. PJH, YW, AK were supported by DOE DE-FG02-05ER46236, the financial support of MT, HJ, and RV from the DFG Schwerpunktprogramm 1458 is kindly acknowledged.

  8. Spectroscopic signatures of different symmetries of the superconducting order parameter in metal-decorated graphene

    NASA Astrophysics Data System (ADS)

    Saari, Timo; Nieminen, Jouko; Bansil, Arun

    2017-06-01

    Motivated by the recent experiments indicating superconductivity in metal-decorated graphene sheets, we investigate their quasi-particle structure within the framework of an effective tight-binding Hamiltonian augmented by appropriate BCS-like pairing terms for p-type order parameter. The normal state band structure of graphene is modified not only through interaction with adsorbed metal atoms, but also due to the folding of bands at Brillouin zone boundaries resulting from a \\sqrt{3}× \\sqrt{3}R{{30}\\circ} reconstruction. Several different types of pairing symmetries are analyzed utilizing Nambu-Gorkov Green’s function techniques to show that p+\\text{i}p -symmetric nearest-neighbor pairing yields the most enhanced superconducting gap. The character of the order parameter depends on the nature of the atomic orbitals involved in the pairing process and exhibits interesting angular and radial asymmetries. Finally, we suggest a method to distinguish between singlet and triplet type superconductivity in the presence of magnetic substitutional impurities using scanning tunneling spectroscopy.

  9. Molecular dynamics simulations of dense plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Collins, L.A.; Kress, J.D.; Kwon, I.

    1993-12-31

    We have performed quantum molecular dynamics simulations of hot, dense plasmas of hydrogen over a range of temperatures(0.1-5eV) and densities(0.0625-5g/cc). We determine the forces quantum mechanically from density functional, extended Huckel, and tight binding techniques and move the nuclei according to the classical equations of motion. We determine pair-correlation functions, diffusion coefficients, and electrical conductivities. We find that many-body effects predominate in this regime. We begin to obtain agreement with the OCP and Thomas-Fermi models only at the higher temperatures and densities.

  10. Closing loop base pairs in RNA loop-loop complexes: structural behavior, interaction energy and solvation analysis through molecular dynamics simulations.

    PubMed

    Golebiowski, Jérôme; Antonczak, Serge; Fernandez-Carmona, Juan; Condom, Roger; Cabrol-Bass, Daniel

    2004-12-01

    Nanosecond molecular dynamics using the Ewald summation method have been performed to elucidate the structural and energetic role of the closing base pair in loop-loop RNA duplexes neutralized by Mg2+ counterions in aqueous phases. Mismatches GA, CU and Watson-Crick GC base pairs have been considered for closing the loop of an RNA in complementary interaction with HIV-1 TAR. The simulations reveal that the mismatch GA base, mediated by a water molecule, leads to a complex that presents the best compromise between flexibility and energetic contributions. The mismatch CU base pair, in spite of the presence of an inserted water molecule, is too short to achieve a tight interaction at the closing-loop junction and seems to force TAR to reorganize upon binding. An energetic analysis has allowed us to quantify the strength of the interactions of the closing and the loop-loop pairs throughout the simulations. Although the water-mediated GA closing base pair presents an interaction energy similar to that found on fully geometry-optimized structure, the water-mediated CU closing base pair energy interaction reaches less than half the optimal value.

  11. Proposed truncated Cu-Hf tight-binding potential to study the crystal-to-amorphous phase transition

    NASA Astrophysics Data System (ADS)

    Cui, Yuanyuan; Li, Jiahao; Dai, Ye; Liu, Baixin

    2010-09-01

    Proposed truncated Cu-Hf tight-binding potential was constructed by fitting the physical properties of Cu, Hf, and their stable compounds, i.e., Cu5Hf, Cu8Hf3, Cu10Hf7, and CuHf2. Based on the constructed potentials, molecular dynamics simulations were carried out to compare the relative stability of the crystalline solid solution and the disordered state. Simulation results not only reveal that the physical origin of crystal-to-amorphous transition is the crystalline lattice collapsing when the solute atoms exceeding the critical concentration, but also predict that the glass forming range (GFR) of the Cu-Hf system is 21-77 at. % Cu, which covers the GFRs determined by various metallic glass-producing techniques. Ion beam mixing experiments of the Cu-Hf system were conducted using 200 keV xenon ions and the results show that a uniform amorphous phase can be obtained in the Cu23Hf77 sample, matching well with the GFR determined by the interatomic potential, which, in turn, provides additional evidence to the relevance of the constructed Cu-Hf potential.

  12. Theory of the interplay between the superconductivity and the blocked antiferromagnetic order in A(y)Fe(2-x)Se2.

    PubMed

    Jiang, Hong-Min

    2012-09-26

    Based on an effective two-orbital tight-binding model, we examine the possible superconducting states in iron-vacancy-ordered A(y)Fe(2-x)Se(2). In the presence of ordered vacancies and blocked antiferromagnetic order, it is shown that the emergent SC pairing is the nodeless next-nearest-neighbor (NNN)-pairing due to the dominant antiferromagnetic (AFM) interaction between the inter-block NNN sites. In particular, we show that due to the ordered vacancies and the associated blocked AFM order, the interplay between the superconducting and AFM states results in three distinct states in the phase diagram as doping is varied. The divergent experimental observations can be accounted for by considering the different charge carrier concentrations in their respective compounds.

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Morris, J.R.; Lu, Z.; Ring, D.M.

    We have examined a variety of structures for the {l_brace}510{r_brace} symmetric tilt boundary in Si and Ge, using tight-binding and first-principles calculations. These calculations show that the observed structure in Si is the lowest-energy structure, despite the fact that it is more complicated than what is necessary to preserve fourfold coordination. Contrary to calculations using a Tersoff potential, first-principles calculations show that the energy depends strongly upon the structure. A recently developed tight-binding model for Si produces results in very good agreement with the first-principles calculations. Electronic density of states calculations based upon this model show no evidence of midgapmore » states and little evidence of electronic states localized to the grain boundary. {copyright} {ital 1998} {ital The American Physical Society}« less

  14. A close-pair binary in a distant triple supermassive black hole system.

    PubMed

    Deane, R P; Paragi, Z; Jarvis, M J; Coriat, M; Bernardi, G; Fender, R P; Frey, S; Heywood, I; Klöckner, H-R; Grainge, K; Rumsey, C

    2014-07-03

    Galaxies are believed to evolve through merging, which should lead to some hosting multiple supermassive black holes. There are four known triple black hole systems, with the closest black hole pair being 2.4 kiloparsecs apart (the third component in this system is at 3 kiloparsecs), which is far from the gravitational sphere of influence (about 100 parsecs for a black hole with mass one billion times that of the Sun). Previous searches for compact black hole systems concluded that they were rare, with the tightest binary system having a separation of 7 parsecs (ref. 10). Here we report observations of a triple black hole system at redshift z = 0.39, with the closest pair separated by about 140 parsecs and significantly more distant from Earth than any other known binary of comparable orbital separation. The effect of the tight pair is to introduce a rotationally symmetric helical modulation on the structure of the large-scale radio jets, which provides a useful way to search for other tight pairs without needing extremely high resolution observations. As we found this tight pair after searching only six galaxies, we conclude that tight pairs are more common than hitherto believed, which is an important observational constraint for low-frequency gravitational wave experiments.

  15. Electronic properties of long DNA nanowires in dry and wet conditions

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Khodadadi, Jabbar; Grabowski, Marek

    2015-11-01

    The electronic behavior of the long disordered DNA nanowires in both dry and wet conditions is investigated through the band structure and density of states of a tight-binding Hamiltonian model for π-electrons of the backbone, using Green's functions approach. For a chosen set of parameters in the dry case, semiconducting behavior is reproduced. It is also shown that for sufficiently long strands, the order of the base pairs has no noticeable effect on the energy band-gap. Moreover, this semiconducting duplex shows metallic tendencies when interacting with the environment of polar molecules.

  16. Tight-binding calculation of single-band and generalized Wannier functions of graphene

    NASA Astrophysics Data System (ADS)

    Ribeiro, Allan Victor; Bruno-Alfonso, Alexys

    Recent work has shown that a tight-binding approach associated with Wannier functions (WFs) provides an intuitive physical image of the electronic structure of graphene. Regarding the case of graphene, Marzari et al. displayed the calculated WFs and presented a comparison between the Wannier-interpolated bands and the bands generated by using the density-functional code. Jung and MacDonald provided a tight-binding model for the π-bands of graphene that involves maximally localized Wannier functions (MLWFs). The mixing of the bands yields better localized WFs. In the present work, the MLWFs of graphene are calculated by combining the Quantum-ESPRESSO code and tight-binding approach. The MLWFs of graphene are calculated from the Bloch functions obtained through a tight binding approach that includes interactions and overlapping obtained by partially fitting the DFT bands. The phase of the Bloch functions of each band is appropriately chosen to produce MLWFs. The same thing applies to the coefficients of their linear combination in the generalized case. The method allows for an intuitive understanding of the maximally localized WFs of graphene and shows excellent agreement with the literature. Moreover, it provides accurate results at reduced computational cost.

  17. RIM-BPs Mediate Tight Coupling of Action Potentials to Ca(2+)-Triggered Neurotransmitter Release.

    PubMed

    Acuna, Claudio; Liu, Xinran; Gonzalez, Aneysis; Südhof, Thomas C

    2015-09-23

    Ultrafast neurotransmitter release requires tight colocalization of voltage-gated Ca(2+) channels with primed, release-ready synaptic vesicles at the presynaptic active zone. RIM-binding proteins (RIM-BPs) are multidomain active zone proteins that bind to RIMs and to Ca(2+) channels. In Drosophila, deletion of RIM-BPs dramatically reduces neurotransmitter release, but little is known about RIM-BP function in mammalian synapses. Here, we generated double conditional knockout mice for RIM-BP1 and RIM-BP2, and analyzed RIM-BP-deficient synapses in cultured hippocampal neurons and the calyx of Held. Surprisingly, we find that in murine synapses, RIM-BPs are not essential for neurotransmitter release as such, but are selectively required for high-fidelity coupling of action potential-induced Ca(2+) influx to Ca(2+)-stimulated synaptic vesicle exocytosis. Deletion of RIM-BPs decelerated action-potential-triggered neurotransmitter release and rendered it unreliable, thereby impairing the fidelity of synaptic transmission. Thus, RIM-BPs ensure optimal organization of the machinery for fast release in mammalian synapses without being a central component of the machinery itself. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Landau level splitting due to graphene superlattices

    NASA Astrophysics Data System (ADS)

    Pal, G.; Apel, W.; Schweitzer, L.

    2012-06-01

    The Landau level spectrum of graphene superlattices is studied using a tight-binding approach. We consider noninteracting particles moving on a hexagonal lattice with an additional one-dimensional superlattice made up of periodic square potential barriers, which are oriented along the zigzag or along the armchair directions of graphene. In the presence of a perpendicular magnetic field, such systems can be described by a set of one-dimensional tight-binding equations, the Harper equations. The qualitative behavior of the energy spectrum with respect to the strength of the superlattice potential depends on the relation between the superlattice period and the magnetic length. When the potential barriers are oriented along the armchair direction of graphene, we find for strong magnetic fields that the zeroth Landau level of graphene splits into two well-separated sublevels, if the width of the barriers is smaller than the magnetic length. In this situation, which persists even in the presence of disorder, a plateau with zero Hall conductivity can be observed around the Dirac point. This Landau level splitting is a true lattice effect that cannot be obtained from the generally used continuum Dirac-fermion model.

  19. Microwave emulations and tight-binding calculations of transport in polyacetylene

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Ortiz, Yenni P.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    A novel approach to investigate the electron transport of cis- and trans-polyacetylene chains in the single-electron approximation is presented by using microwave emulation measurements and tight-binding calculations. In the emulation we take into account the different electronic couplings due to the double bonds leading to coupled dimer chains. The relative coupling constants are adjusted by DFT calculations. For sufficiently long chains a transport band gap is observed if the double bonds are present, whereas for identical couplings no band gap opens. The band gap can be observed also in relatively short chains, if additional edge atoms are absent, which cause strong resonance peaks within the band gap. The experimental results are in agreement with our tight-binding calculations using the nonequilibrium Green's function method. The tight-binding calculations show that it is crucial to include third nearest neighbor couplings to obtain the gap in the cis-polyacetylene.

  20. Asteroid clusters similar to asteroid pairs

    NASA Astrophysics Data System (ADS)

    Pravec, Petr; Vokrouhlicky, David; Fatka, Petr; Kusnirák, Peter; Hornoch, Kamil; Galád, Adrián

    2016-10-01

    We study five small, tight and young clusters of asteroids. They are placed around following largest (primary) bodies: (11842) Kap'bos, (14627) Emilkowalski, (16598) 1992 YC2, (21509) Lucascavin and (39991) 1998 HR37. Each cluster has 2-4 secondaries that are tightly clustered around the primary body, with distance in the 5-dimensional space of mean orbital elements mostly within 10 m/s, and always < 23 m/s. Backward orbital integrations indicate that they formed between 105 and 106 yr ago. In the P1-q space, where P1 is the primary's spin period and q = Σ Mj/M1 is the total secondary-to-primary mass ratio, the clusters lie in the same range as asteroid pairs formed by rotational fission. We have extended the model of a proto-system separation after rotational fission by Pravec et al. (2010) for application to systems with more than one secondary and found a perfect match for the five tight clusters. We find these clusters to be similar to asteroid pairs and we suggest that they are "extended pairs", having 2-4 escaped secondaries rather than just one secondary as in the case of an asteroid pair. We compare them to six young mini-families (1270) Datura, (2384) Schulhof, (3152) Jones, (6825) Irvine, (10321) Rampo and (20674) 1999 VT1. These mini-families have similar ages, but they have a higher number of members and/or they show a significantly larger spread in the mean orbital elements (dmean on an order of tens m/s) than the five tight clusters. In the P1-q space, all but one of the mini-families lie in the same range as asteroid pairs and the tight clusters; the exception is the mini-family of (3152) Jones which appears to be a collisional family. A possibility that the other five mini-families were also formed by rotational fission as we suggest for the tight clusters ("extended asteroid pairs") is being explored.Reference:Pravec, P., et al. Formation of asteroid pairs by rotational fission. Nature 466, 1085-1088.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez-Morales, A.; Martínez-Orozco, J. C.; Rodríguez-Vargas, I.

    The main characteristics of the quantum confined Stark effect (QCSE) are studied theoretically in quantum wells of Gaussian profile. The semi-empirical tight-binding model and the Green function formalism are applied in the numerical calculations. A comparison of the QCSE in quantum wells with different kinds of confining potential is presented.

  2. The tight junction protein ZO-1 and an interacting transcription factor regulate ErbB-2 expression

    PubMed Central

    Balda, Maria S.; Matter, Karl

    2000-01-01

    Epithelial tight junctions regulate paracellular diffusion and restrict the intermixing of apical and basolateral plasma membrane components. We now identify a Y-box transcription factor, ZONAB (ZO-1-associated nucleic acid-binding protein), that binds to the SH3 domain of ZO-1, a submembrane protein of tight junctions. ZONAB localizes to the nucleus and at tight junctions, and binds to sequences of specific promoters containing an inverted CCAAT box. In reporter assays, ZONAB and ZO-1 functionally interact in the regulation of the ErbB-2 promoter in a cell density-dependent manner. In stably transfected overexpressing cells, ZO-1 and ZONAB control expression of endogenous ErbB-2 and function in the regulation of paracellular permeability. These data indicate that tight junctions directly participate in the control of gene expression and suggest that they function in the regulation of epithelial cell differentiation. PMID:10790369

  3. Enantiospecific adsorption of propranolol enantiomers on naturally chiral copper surface: A molecular dynamics simulation investigation

    NASA Astrophysics Data System (ADS)

    Sedghamiz, Tahereh; Bahrami, Maryam; Ghatee, Mohammad Hadi

    2017-04-01

    Adsorption of propranolol enantiomers on naturally chiral copper (Cu(3,1,17)S) and achiral copper (Cu(100)) surfaces were studied by molecular dynamics simulation to unravel the features of adsorbate-adsorbent enantioselectivity. Adsorption of S- and R-propranolol on Cu(3,1,17)S terraces (with 100 plane) leads mainly to endo- and exo-conformers, respectively. Simulated pair correlation function (g(r)) and mean square displacement (MSD) were analyzed to identify adsorption sites of enantiomers on Cu(3,1,17)S substrate surface, and their simulated binding energies were used to access the adsorption strength. According to (g(r)), R-propranolol adsorbs via naphtyl group while S-propranolol mainly adsorbs through chain group. R-enantiomer binds more tightly to the chiral substrate surface than S-enantiomer as indicated by a higher simulated binding energy by 2.74 kJ mol-1 per molecule. The difference in binding energies of propranolol enantiomers on naturally chiral Cu(3,1,17)S is almost six times larger than on the achiral Cu(100) surface, which substantiates the appreciably strong specific enantioselective adsorption on the former surface.

  4. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  5. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point.

    PubMed

    Quan, Yundi; Pickett, Warren E

    2018-02-21

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ±[Formula: see text] form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  6. A maximally particle-hole asymmetric spectrum emanating from a semi-Dirac point

    NASA Astrophysics Data System (ADS)

    Quan, Yundi; Pickett, Warren E.

    2018-02-01

    Tight binding models have proven an effective means of revealing Dirac (massless) dispersion, flat bands (infinite mass), and intermediate cases such as the semi-Dirac (sD) dispersion. This approach is extended to a three band model that yields, with chosen parameters in a two-band limit, a closed line with maximally asymmetric particle-hole dispersion: infinite mass holes, zero mass particles. The model retains the sD points for a general set of parameters. Adjacent to this limiting case, hole Fermi surfaces are tiny and needle-like. A pair of large electron Fermi surfaces at low doping merge and collapse at half filling to a flat (zero energy) closed contour with infinite mass along the contour and enclosing no carriers on either side, while the hole Fermi surface has shrunk to a point at zero energy, also containing no carriers. The tight binding model is used to study several characteristics of the dispersion and density of states. The model inspired generalization of sD dispersion to a general  ± \\sqrt{k_x2n +k_y2m} form, for which analysis reveals that both n and m must be odd to provide a diabolical point with topological character. Evolution of the Hofstadter spectrum of this three band system with interband coupling strength is presented and discussed.

  7. Effect of impurity doping on tunneling conductance in AB-stacked bi-layer graphene: A tight-binding study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rout, G. C., E-mail: siva1987@iopb.res.in, E-mail: skp@iopb.res.in, E-mail: gcr@iopb.res.in; Sahu, Sivabrata; Panda, S. K.

    2016-04-13

    We report here a microscopic tight-binding model calculation for AB-stacked bilayer graphene in presence of biasing potential between the two layers and the impurity effects to study the evolution of the total density of states with special emphasis on opening of band gap near Dirac point. We have calculated the electron Green’s functions for both the A and B sub-lattices by Zubarev technique. The imaginary part of the Green’s function gives the partial and total density of states of electrons. The density of states are computed numerically for 1000 × 1000 grid points of the electron momentum. The evolution ofmore » the opening of band gap near van-Hove singularities as well as near Dirac point is investigated by varying the different interlayer hoppings and the biasing potentials. The inter layer hopping splits the density of states at van-Hove singularities and produces a V-shaped gap near Dirac point. Further the biasing potential introduces a U shaped gap near Dirac point with a density minimum at the applied potential(i.e. at V/2).« less

  8. Tight-Binding study of Boron structures

    NASA Astrophysics Data System (ADS)

    McGrady, Joseph W.; Papaconstantopoulos, Dimitrios A.; Mehl, Michael J.

    2014-10-01

    We have performed Linearized Augmented Plane Wave (LAPW) calculations for five crystal structures (alpha, dhcp, sc, fcc, bcc) of Boron which we then fitted to a non-orthogonal tight-binding model following the Naval Research Laboratory Tight-Binding (NRL-TB) method. The predictions of the NRL-TB approach for complicated Boron structures such as R105 (or β-rhombohedral) and T190 are in agreement with recent first-principles calculations. Fully utilizing the computational speed of the NRL-TB method we calculated the energy differences of various structures, including those containing vacancies using supercells with up to 5000 atoms.

  9. Carbon Nanotubes: Molecular Electronic Components

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Saini, Subhash; Menon, Madhu

    1997-01-01

    The carbon Nanotube junctions have recently emerged as excellent candidates for use as the building blocks in the formation of nanoscale molecular electronic networks. While the simple joint of two dissimilar tubes can be generated by the introduction of a pair of heptagon-pentagon defects in an otherwise perfect hexagonal graphene sheet, more complex joints require other mechanisms. In this work we explore structural characteristics of complex 3-point junctions of carbon nanotubes using a generalized tight-binding molecular-dynamics scheme. The study of pi-electron local densities of states (LDOS) of these junctions reveal many interesting features, most prominent among them being the defect-induced states in the gap.

  10. Molecular Recognition of 6′-N-5-Hexynoate Kanamyin A and RNA 1×1 Internal Loops Containing CA Mismatches

    PubMed Central

    Tran, Tuan; Disney, Matthew D.

    2011-01-01

    In our previous study to identify the RNA internal loops that bind an aminoglycoside derivative, we determined that 6′-N-5-hexynoate kanamycin A prefers to bind 1×1 nucleotide internal loops containing C•A mismatches. In this present study, the molecular recognition between a variety of RNAs that are mutated around the C•A loop and the ligand was investigated. Studies show that both loop nucleotides and loop closing pairs affect binding affinity. Most interestingly, it was shown that there is a correlation between the thermodynamic stability of the C•A internal loops and ligand affinity. Specifically, C•A loops that had relatively high or low stability bound the ligand most weakly whereas loops with intermediate stability bound the ligand most tightly. In contrast, there is no correlation between the likelihood that a loop forms a C-A+ pair at lower pH and ligand affinity. It was also found that a 1×1 nucleotide C•A loop that bound to the ligand with the highest affinity is identical to the consensus site in RNAs that are edited by adenosine deaminases acting on RNA type 2 (ADAR2). These studies provide a detailed investigation of factors affecting small molecule recognition of internal loops containing C•A mismatches, which are present in a variety of RNAs that cause disease. PMID:21207945

  11. Functional dissection of the paired domain of Pax6 reveals molecular mechanisms of coordinating neurogenesis and proliferation

    PubMed Central

    Walcher, Tessa; Xie, Qing; Sun, Jian; Irmler, Martin; Beckers, Johannes; Öztürk, Timucin; Niessing, Dierk; Stoykova, Anastassia; Cvekl, Ales; Ninkovic, Jovica; Götz, Magdalena

    2013-01-01

    To achieve adequate organ development and size, cell proliferation and differentiation have to be tightly regulated and coordinated. The transcription factor Pax6 regulates patterning, neurogenesis and proliferation in forebrain development. The molecular basis of this regulation is not well understood. As the bipartite DNA-binding paired domain of Pax6 regulates forebrain development, we examined mice with point mutations in its individual DNA-binding subdomains PAI (Pax6Leca4, N50K) and RED (Pax6Leca2, R128C). This revealed distinct roles in regulating proliferation in the developing cerebral cortex, with the PAI and RED subdomain mutations reducing and increasing, respectively, the number of mitoses. Conversely, neurogenesis was affected only by the PAI subdomain mutation, phenocopying the neurogenic defects observed in full Pax6 mutants. Genome-wide expression profiling identified molecularly discrete signatures of Pax6Leca4 and Pax6Leca2 mutations. Comparison to Pax6 targets identified by chromatin immunoprecipitation led to the identification and functional characterization of distinct DNA motifs in the promoters of target genes dysregulated in the Pax6Leca2 or Pax6Leca4 mutants, further supporting the distinct regulatory functions of the DNA-binding subdomains. Thus, Pax6 achieves its key roles in the developing forebrain by utilizing particular subdomains to coordinate patterning, neurogenesis and proliferation simultaneously. PMID:23404109

  12. Organometallic DNA-B12 Conjugates as Potential Oligonucleotide Vectors: Synthesis and Structural and Binding Studies with Human Cobalamin-Transport Proteins.

    PubMed

    Mutti, Elena; Hunger, Miriam; Fedosov, Sergey; Nexo, Ebba; Kräutler, Bernhard

    2017-11-16

    The synthesis and structural characterization of Co-(dN) 25 -Cbl (Cbl: cobalamin; dN: deoxynucleotide) and Co-(dN) 39 -Cbl, which are organometallic DNA-B 12 conjugates with single DNA strands consisting of 25 and 39 deoxynucleotides, respectively, and binding studies of these two DNA-Cbl conjugates to three homologous human Cbl transporting proteins, transcobalamin (TC), intrinsic factor (IF), and haptocorrin (HC), are reported. This investigation tests the suitability of such DNA-Cbls for the task of eventual in vivo oligonucleotide delivery. The binding of DNA-Cbl to TC, IF, and HC was investigated in competition with either a fluorescent Cbl derivative and Co-(dN) 25 -Cbl, or radiolabeled vitamin B 12 ( 57 Co-CNCbl) and Co-(dN) 25 -Cbl or Co-(dN) 39 -Cbl. Binding of the new DNA-Cbl conjugates was fast and tight with TC, but poorer with HC and IF, which extends a similar original finding with the simpler DNA-Cbl, Co-(dN) 18 -Cbl. The contrasting affinities of TC versus IF and HC for the DNA-Cbl conjugates are rationalized herein by a stepwise mechanism of Cbl binding. Critical contributions to overall affinity result from gradual conformational adaptations of the Cbl-binding proteins to the DNA-Cbl, which is first bound to the respective β domains. This transition is fast with TC, but slow with IF and HC, with which weaker binding results. The invariably tight interaction of the DNA-Cbl conjugates with TC makes the Cbl moiety a potential natural vector for the specific delivery of oligonucleotide loads from the blood into cells. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. De novo design of a transmembrane Zn²⁺-transporting four-helix bundle.

    PubMed

    Joh, Nathan H; Wang, Tuo; Bhate, Manasi P; Acharya, Rudresh; Wu, Yibing; Grabe, Michael; Hong, Mei; Grigoryan, Gevorg; DeGrado, William F

    2014-12-19

    The design of functional membrane proteins from first principles represents a grand challenge in chemistry and structural biology. Here, we report the design of a membrane-spanning, four-helical bundle that transports first-row transition metal ions Zn(2+) and Co(2+), but not Ca(2+), across membranes. The conduction path was designed to contain two di-metal binding sites that bind with negative cooperativity. X-ray crystallography and solid-state and solution nuclear magnetic resonance indicate that the overall helical bundle is formed from two tightly interacting pairs of helices, which form individual domains that interact weakly along a more dynamic interface. Vesicle flux experiments show that as Zn(2+) ions diffuse down their concentration gradients, protons are antiported. These experiments illustrate the feasibility of designing membrane proteins with predefined structural and dynamic properties. Copyright © 2014, American Association for the Advancement of Science.

  14. Discovery of binding proteins for a protein target using protein-protein docking-based virtual screening.

    PubMed

    Zhang, Changsheng; Tang, Bo; Wang, Qian; Lai, Luhua

    2014-10-01

    Target structure-based virtual screening, which employs protein-small molecule docking to identify potential ligands, has been widely used in small-molecule drug discovery. In the present study, we used a protein-protein docking program to identify proteins that bind to a specific target protein. In the testing phase, an all-to-all protein-protein docking run on a large dataset was performed. The three-dimensional rigid docking program SDOCK was used to examine protein-protein docking on all protein pairs in the dataset. Both the binding affinity and features of the binding energy landscape were considered in the scoring function in order to distinguish positive binding pairs from negative binding pairs. Thus, the lowest docking score, the average Z-score, and convergency of the low-score solutions were incorporated in the analysis. The hybrid scoring function was optimized in the all-to-all docking test. The docking method and the hybrid scoring function were then used to screen for proteins that bind to tumor necrosis factor-α (TNFα), which is a well-known therapeutic target for rheumatoid arthritis and other autoimmune diseases. A protein library containing 677 proteins was used for the screen. Proteins with scores among the top 20% were further examined. Sixteen proteins from the top-ranking 67 proteins were selected for experimental study. Two of these proteins showed significant binding to TNFα in an in vitro binding study. The results of the present study demonstrate the power and potential application of protein-protein docking for the discovery of novel binding proteins for specific protein targets. © 2014 Wiley Periodicals, Inc.

  15. Development of acetophenone ligands as potential neuroimaging agents for cholinesterases.

    PubMed

    Jollymore-Hughes, Courtney T; Pottie, Ian R; Martin, Earl; Rosenberry, Terrone L; Darvesh, Sultan

    2016-11-01

    Association of cholinesterase with β-amyloid plaques and tau neurofibrillary tangles in Alzheimer's disease offers an opportunity to detect disease pathology during life. Achieving this requires development of radiolabelled cholinesterase ligands with high enzyme affinity. Various fluorinated acetophenone derivatives bind to acetylcholinesterase with high affinity, including 2,2,2-trifluoro-1-(3-dimethylaminophenyl)ethanone (1) and 1-(3-tert-butylphenyl)-2,2,2-trifluoroethanone (2). Such compounds also offer potential for incorporation of radioactive fluorine ( 18 F) for Positron Emission Tomography (PET) imaging of cholinesterases in association with Alzheimer's disease pathology in the living brain. Here we describe the synthesis of two meta-substituted chlorodifluoroacetophenones using a Weinreb amide strategy and their rapid conversion to the corresponding trifluoro derivatives through nucleophilic substitution by fluoride ion, in a reaction amenable to incorporating 18 F for PET imaging. In vitro kinetic analysis indicates tight binding of the trifluoro derivatives to cholinesterases. Compound 1 has a K i value of 7nM for acetylcholinesterase and 1300nM for butyrylcholinesterase while for compound 2 these values are 0.4nM and 26nM, respectively. Tight binding of these compounds to cholinesterase encourages their development for PET imaging detection of cholinesterase associated with Alzheimer's disease pathology. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

    PubMed Central

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-01-01

    Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

  17. Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

    PubMed

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-08-09

    The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

  18. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids.

    PubMed

    Aradi, Bálint; Niklasson, Anders M N; Frauenheim, Thomas

    2015-07-14

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born-Oppenheimer molecular dynamics. For systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can be applied to a broad range of problems in materials science, chemistry, and biology.

  19. Collaborative Enhancement of Endothelial Targeting of Nanocarriers by Modulating Platelet-Endothelial Cell Adhesion Molecule-1/CD31 Epitope Engagement.

    PubMed

    Chacko, Ann-Marie; Han, Jingyan; Greineder, Colin F; Zern, Blaine J; Mikitsh, John L; Nayak, Madhura; Menon, Divya; Johnston, Ian H; Poncz, Mortimer; Eckmann, David M; Davies, Peter F; Muzykantov, Vladimir R

    2015-07-28

    Nanocarriers (NCs) coated with antibodies (Abs) to extracellular epitopes of the transmembrane glycoprotein PECAM (platelet endothelial cell adhesion molecule-1/CD31) enable targeted drug delivery to vascular endothelial cells. Recent studies revealed that paired Abs directed to adjacent, yet distinct epitopes of PECAM stimulate each other's binding to endothelial cells in vitro and in vivo ("collaborative enhancement"). This phenomenon improves targeting of therapeutic fusion proteins, yet its potential role in targeting multivalent NCs has not been addressed. Herein, we studied the effects of Ab-mediated collaborative enhancement on multivalent NC spheres coated with PECAM Abs (Ab/NC, ∼180 nm diameter). We found that PECAM Abs do mutually enhance endothelial cell binding of Ab/NC coated by paired, but not "self" Ab. In vitro, collaborative enhancement of endothelial binding of Ab/NC by paired Abs is modulated by Ab/NC avidity, epitope selection, and flow. Cell fixation, but not blocking of endocytosis, obliterated collaborative enhancement of Ab/NC binding, indicating that the effect is mediated by molecular reorganization of PECAM molecules in the endothelial plasmalemma. The collaborative enhancement of Ab/NC binding was affirmed in vivo. Intravascular injection of paired Abs enhanced targeting of Ab/NC to pulmonary vasculature in mice by an order of magnitude. This stimulatory effect greatly exceeded enhancement of Ab targeting by paired Abs, indicating that '"collaborative enhancement"' effect is even more pronounced for relatively large multivalent carriers versus free Abs, likely due to more profound consequences of positive alteration of epitope accessibility. This phenomenon provides a potential paradigm for optimizing the endothelial-targeted nanocarrier delivery of therapeutic agents.

  20. Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.

    PubMed

    Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng

    2015-05-22

    Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.

  1. Glucocorticoids induce transactivation of tight junction genes occludin and claudin-5 in retinal endothelial cells via a novel cis-element.

    PubMed

    Felinski, Edward A; Cox, Amy E; Phillips, Brett E; Antonetti, David A

    2008-06-01

    Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205bp sequence responsible for the glucocorticoid response. However, this region does not possess a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40bp occludin enhancer element (OEE), containing two highly conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression.

  2. GLUCOCORTICOIDS INDUCE TRANSACTIVATION OF TIGHT JUNCTION GENES OCCLUDIN AND CLAUDIN-5 IN RETINAL ENDOTHELIAL CELLS VIA A NOVEL CIS-ELEMENT

    PubMed Central

    Felinski, Edward A.; Cox, Amy E.; Phillips, Brett E.; Antonetti, David A.

    2008-01-01

    Tight junctions between vascular endothelial cells help to create the blood-brain and blood-retinal barriers. Breakdown of the retinal tight junction complex is problematic in several disease states including diabetic retinopathy. Glucocorticoids can restore and/or preserve the endothelial barrier to paracellular permeability, although the mechanism remains unclear. We show that glucocorticoid treatment of primary retinal endothelial cells increases content of the tight junction proteins occludin and claudin-5, co-incident with an increase in barrier properties of endothelial monolayers. The glucocorticoid receptor antagonist RU486 reverses both the glucocorticoid-stimulated increase in occludin content and the increase in barrier properties. Transcriptional activity from the human occludin and claudin-5 promoters increases in retinal endothelial cells upon glucocorticoid treatment, and is dependent on the glucocorticoid receptor (GR) as demonstrated by siRNA. Deletion analysis of the occludin promoter reveals a 205 bp sequence responsible for the glucocorticoid response. However, this region does not posses a canonical glucocorticoid response element and does not bind to the GR in a chromatin immunoprecipitation (ChIP) assay. Mutational analysis of this region revealed a novel 40 bp occludin enhancer element (OEE), containing two highly-conserved regions of 10 and 13 base pairs, that is both necessary and sufficient for glucocorticoid-induced gene expression in retinal endothelial cells. These data suggest a novel mechanism for glucocorticoid induction of vascular endothelial barrier properties through increased occludin and claudin-5 gene expression. PMID:18501346

  3. Structural and functional insights into 5'-ppp RNA pattern recognition by the innate immune receptor RIG-I.

    PubMed

    Wang, Yanli; Ludwig, Janos; Schuberth, Christine; Goldeck, Marion; Schlee, Martin; Li, Haitao; Juranek, Stefan; Sheng, Gang; Micura, Ronald; Tuschl, Thomas; Hartmann, Gunther; Patel, Dinshaw J

    2010-07-01

    RIG-I is a cytosolic helicase that senses 5'-ppp RNA contained in negative-strand RNA viruses and triggers innate antiviral immune responses. Calorimetric binding studies established that the RIG-I C-terminal regulatory domain (CTD) binds to blunt-end double-stranded 5'-ppp RNA a factor of 17 more tightly than to its single-stranded counterpart. Here we report on the crystal structure of RIG-I CTD bound to both blunt ends of a self-complementary 5'-ppp dsRNA 12-mer, with interactions involving 5'-pp clearly visible in the complex. The structure, supported by mutation studies, defines how a lysine-rich basic cleft within the RIG-I CTD sequesters the observable 5'-pp of the bound RNA, with a stacked phenylalanine capping the terminal base pair. Key intermolecular interactions observed in the crystalline state are retained in the complex of 5'-ppp dsRNA 24-mer and full-length RIG-I under in vivo conditions, as evaluated from the impact of binding pocket RIG-I mutations and 2'-OCH(3) RNA modifications on the interferon response.

  4. Visualization of atomic-scale phenomena in superconductors: application to FeSe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas

    Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

  5. Visualization of atomic-scale phenomena in superconductors: application to FeSe

    DOE PAGES

    Choubey, Peayush; Berlijn, Tom; Kreisel, Andreas; ...

    2014-10-31

    Here we propose a simple method of calculating inhomogeneous, atomic-scale phenomena in superconductors which makes use of the wave function information traditionally discarded in the construction of tight-binding models used in the Bogoliubov-de Gennes equations. The method uses symmetry- based first principles Wannier functions to visualize the effects of superconducting pairing on the distribution of electronic states over atoms within a crystal unit cell. Local symmetries lower than the global lattice symmetry can thus be exhibited as well, rendering theoretical comparisons with scanning tunneling spectroscopy data much more useful. As a simple example, we discuss the geometric dimer states observedmore » near defects in superconducting FeSe.« less

  6. Structural Mechanism behind Distinct Efficiency of Oct4/Sox2 Proteins in Differentially Spaced DNA Complexes

    PubMed Central

    Yesudhas, Dhanusha; Anwar, Muhammad Ayaz; Panneerselvam, Suresh; Durai, Prasannavenkatesh; Shah, Masaud; Choi, Sangdun

    2016-01-01

    The octamer-binding transcription factor 4 (Oct4) and sex-determining region Y (SRY)-box 2 (Sox2) proteins induce various transcriptional regulators to maintain cellular pluripotency. Most Oct4/Sox2 complexes have either 0 base pairs (Oct4/Sox20bp) or 3 base pairs (Oct4/Sox23bp) separation between their DNA-binding sites. Results from previous biochemical studies have shown that the complexes separated by 0 base pairs are associated with a higher pluripotency rate than those separated by 3 base pairs. Here, we performed molecular dynamics (MD) simulations and calculations to determine the binding free energy and per-residue free energy for the Oct4/Sox20bp and Oct4/Sox23bp complexes to identify structural differences that contribute to differences in induction rate. Our MD simulation results showed substantial differences in Oct4/Sox2 domain movements, as well as secondary-structure changes in the Oct4 linker region, suggesting a potential reason underlying the distinct efficiencies of these complexes during reprogramming. Moreover, we identified key residues and hydrogen bonds that potentially facilitate protein-protein and protein-DNA interactions, in agreement with previous experimental findings. Consequently, our results confess that differential spacing of the Oct4/Sox2 DNA binding sites can determine the magnitude of transcription of the targeted genes during reprogramming. PMID:26790000

  7. Crossmodal binding rivalry: A "race" for integration between unequal sensory inputs.

    PubMed

    Kostaki, Maria; Vatakis, Argiro

    2016-10-01

    Exposure to multiple but unequal (in number) sensory inputs often leads to illusory percepts, which may be the product of a conflict between those inputs. To test this conflict, we utilized the classic sound induced visual fission and fusion illusions under various temporal configurations and timing presentations. This conflict between unequal numbers of sensory inputs (i.e., crossmodal binding rivalry) depends on the binding of the first audiovisual pair and its temporal proximity to the upcoming unisensory stimulus. We, therefore, expected that tight coupling of the first audiovisual pair would lead to higher rivalry with the upcoming unisensory stimulus and, thus, weaker illusory percepts. Loose coupling, on the other hand, would lead to lower rivalry and higher illusory percepts. Our data showed the emergence of two different participant groups, those with low discrimination performance and strong illusion reports (particularly for fusion) and those with the exact opposite pattern, thus extending previous findings on the effect of visual acuity in the strength of the illusion. Most importantly, our data revealed differential illusory strength across different temporal configurations for the fission illusion, while for the fusion illusion these effects were only noted for the largest stimulus onset asynchronies tested. These findings support that the optimal integration theory for the double flash illusion should be expanded so as to also take into account the multisensory temporal interactions of the stimuli presented (i.e., temporal sequence and configuration). Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  9. Extended Lagrangian Density Functional Tight-Binding Molecular Dynamics for Molecules and Solids

    DOE PAGES

    Aradi, Bálint; Niklasson, Anders M. N.; Frauenheim, Thomas

    2015-06-26

    A computationally fast quantum mechanical molecular dynamics scheme using an extended Lagrangian density functional tight-binding formulation has been developed and implemented in the DFTB+ electronic structure program package for simulations of solids and molecular systems. The scheme combines the computational speed of self-consistent density functional tight-binding theory with the efficiency and long-term accuracy of extended Lagrangian Born–Oppenheimer molecular dynamics. Furthermore, for systems without self-consistent charge instabilities, only a single diagonalization or construction of the single-particle density matrix is required in each time step. The molecular dynamics simulation scheme can also be applied to a broad range of problems in materialsmore » science, chemistry, and biology.« less

  10. Order, criticality, and excitations in the extended Falicov-Kimball model.

    PubMed

    Ejima, S; Kaneko, T; Ohta, Y; Fehske, H

    2014-01-17

    Using exact numerical techniques, we investigate the nature of excitonic (electron-hole) bound states and the development of exciton coherence in the one-dimensional half-filled extended Falicov-Kimball model. The ground-state phase diagram of the model exhibits, besides band-insulator and staggered orbital ordered phases, an excitonic insulator (EI) with power-law correlations. The criticality of the EI state shows up in the von Neumann entropy. The anomalous spectral function and condensation amplitude provide the binding energy and coherence length of the electron-hole pairs which, on their part, point towards a Coulomb interaction driven crossover from BCS-like electron-hole pairing fluctuations to tightly bound excitons. We show that while a mass imbalance between electrons and holes does not affect the location of the BCS-BEC crossover regime, it favors staggered orbital ordering to the disadvantage of the EI. Within the Bose-Einstein condensation (BEC) regime, the quasiparticle dispersion develops a flat valence-band top, in accord with the experimental finding for Ta2NiSe5.

  11. Chemisorption of hydrogen atoms and hydroxyl groups on stretched graphene: A coupled QM/QM study

    NASA Astrophysics Data System (ADS)

    Katin, Konstantin P.; Prudkovskiy, Vladimir S.; Maslov, Mikhail M.

    2017-09-01

    Using the density functional theory coupled with the nonorthogonal tight-binding model, we analyze the chemisorption of hydrogen atoms and hydroxyl groups on the unstrained and stretched graphene sheets. Drawback of finite cluster model of graphene for the chemisorption energy calculation in comparison with the QM/QM approach applied is discussed. It is shown that the chemisorption energy for the hydroxyl group is sufficiently lower than for hydrogen at stretching up to 7.5%. The simultaneous paired chemisorption of hydrogen and hydroxyl groups on the same hexagon has also been examined. Adsorption of two radicals in ortho and para positions is found to be more energetically favorable than those in meta position at any stretching considered. In addition the energy difference between adsorbent pairs in ortho and para positions decreases as the stretching rises. It could be concluded that the graphene stretching leads to the loss of preferred mutual arrangement of two radicals on its surface.

  12. Theoretical approach to resonant inelastic x-ray scattering in iron-based superconductors at the energy scale of the superconducting gap

    PubMed Central

    Marra, Pasquale; van den Brink, Jeroen; Sykora, Steffen

    2016-01-01

    We develop a phenomenological theory to predict the characteristic features of the momentum-dependent scattering amplitude in resonant inelastic x-ray scattering (RIXS) at the energy scale of the superconducting gap in iron-based super-conductors. Taking into account all relevant orbital states as well as their specific content along the Fermi surface we evaluate the charge and spin dynamical structure factors for the compounds LaOFeAs and LiFeAs, based on tight-binding models which are fully consistent with recent angle-resolved photoemission spectroscopy (ARPES) data. We find a characteristic intensity redistribution between charge and spin dynamical structure factors which discriminates between sign-reversing and sign-preserving quasiparticle excitations. Consequently, our results show that RIXS spectra can distinguish between s± and s++ wave gap functions in the singlet pairing case. In addition, we find that an analogous intensity redistribution at small momenta can reveal the presence of a chiral p-wave triplet pairing. PMID:27151253

  13. Pairing phase diagram of three holes in the generalized Hubbard model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Navarro, O.; Espinosa, J.E.

    Investigations of high-{Tc} superconductors suggest that the electronic correlation may play a significant role in the formation of pairs. Although the main interest is on the physic of two-dimensional highly correlated electron systems, the one-dimensional models related to high temperature superconductivity are very popular due to the conjecture that properties of the 1D and 2D variants of certain models have common aspects. Within the models for correlated electron systems, that attempt to capture the essential physics of high-temperature superconductors and parent compounds, the Hubbard model is one of the simplest. Here, the pairing problem of a three electrons system hasmore » been studied by using a real-space method and the generalized Hubbard Hamiltonian. This method includes the correlated hopping interactions as an extension of the previously proposed mapping method, and is based on mapping the correlated many body problem onto an equivalent site- and bond-impurity tight-binding one in a higher dimensional space, where the problem was solved in a non-perturbative way. In a linear chain, the authors analyzed the pairing phase diagram of three correlated holes for different values of the Hamiltonian parameters. For some value of the hopping parameters they obtain an analytical solution for all kind of interactions.« less

  14. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency.more » The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.« less

  15. Mobile spin impurity in an optical lattice

    NASA Astrophysics Data System (ADS)

    Duncan, C. W.; Bellotti, F. F.; Öhberg, P.; Zinner, N. T.; Valiente, M.

    2017-07-01

    We investigate the Fermi polaron problem in a spin-1/2 Fermi gas in an optical lattice for the limit of both strong repulsive contact interactions and one dimension. In this limit, a polaronic-like behaviour is not expected, and the physics is that of a magnon or impurity. While the charge degrees of freedom of the system are frozen, the resulting tight-binding Hamiltonian for the impurity’s spin exhibits an intriguing structure that strongly depends on the filling factor of the lattice potential. This filling dependency also transfers to the nature of the interactions for the case of two magnons and the important spin balanced case. At low filling, and up until near unit filling, the single impurity Hamiltonian faithfully reproduces a single-band, quasi-homogeneous tight-binding problem. As the filling is increased and the second band of the single particle spectrum of the periodic potential is progressively filled, the impurity Hamiltonian, at low energies, describes a single particle trapped in a multi-well potential. Interestingly, once the first two bands are fully filled, the impurity Hamiltonian is a near-perfect realisation of the Su-Schrieffer-Heeger model. Our studies, which go well beyond the single-band approximation, that is, the Hubbard model, pave the way for the realisation of interacting one-dimensional models of condensed matter physics.

  16. A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library.

    PubMed

    Adler, Adam S; Bedinger, Daniel; Adams, Matthew S; Asensio, Michael A; Edgar, Robert C; Leong, Renee; Leong, Jackson; Mizrahi, Rena A; Spindler, Matthew J; Bandi, Srinivasa Rao; Huang, Haichun; Tawde, Pallavi; Brams, Peter; Johnson, David S

    2018-04-01

    Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of "randomly paired" scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs.

  17. Heteroditopic receptors for ion-pair recognition.

    PubMed

    McConnell, Anna J; Beer, Paul D

    2012-05-21

    Ion-pair recognition is a new field of research emerging from cation and anion coordination chemistry. Specific types of heteroditopic receptor designs for ion pairs and the complexity of ion-pair binding are discussed to illustrate key concepts such as cooperativity. The importance of this area of research is reflected by the wide variety of potential applications of ion-pair receptors, including applications as membrane transport and salt solubilization agents and sensors. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Dpb11 may function with RPA and DNA to initiate DNA replication.

    PubMed

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P; Kaplan, Daniel L

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation.

  19. Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy.

    PubMed

    Stadnik, Yevgeny V

    2018-06-01

    The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1/r^{5} potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s-wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

  20. Probing Long-Range Neutrino-Mediated Forces with Atomic and Nuclear Spectroscopy

    NASA Astrophysics Data System (ADS)

    Stadnik, Yevgeny V.

    2018-06-01

    The exchange of a pair of low-mass neutrinos between electrons, protons, and neutrons produces a "long-range" 1 /r5 potential, which can be sought for in phenomena originating on the atomic and subatomic length scales. We calculate the effects of neutrino-pair exchange on transition and binding energies in atoms and nuclei. In the case of atomic s -wave states, there is a large enhancement of the induced energy shifts due to the lack of a centrifugal barrier and the highly singular nature of the neutrino-mediated potential. We derive limits on neutrino-mediated forces from measurements of the deuteron binding energy and transition energies in positronium, muonium, hydrogen, and deuterium, as well as isotope-shift measurements in calcium ions. Our limits improve on existing constraints on neutrino-mediated forces from experiments that search for new macroscopic forces by 18 orders of magnitude. Future spectroscopy experiments have the potential to probe long-range forces mediated by the exchange of pairs of standard-model neutrinos and other weakly charged particles.

  1. A natively paired antibody library yields drug leads with higher sensitivity and specificity than a randomly paired antibody library

    PubMed Central

    Adler, Adam S.; Bedinger, Daniel; Adams, Matthew S.; Asensio, Michael A.; Edgar, Robert C.; Leong, Renee; Leong, Jackson; Mizrahi, Rena A.; Spindler, Matthew J.; Bandi, Srinivasa Rao; Huang, Haichun; Brams, Peter; Johnson, David S.

    2018-01-01

    ABSTRACT Deep sequencing and single-chain variable fragment (scFv) yeast display methods are becoming more popular for discovery of therapeutic antibody candidates in mouse B cell repertoires. In this study, we compare a deep sequencing and scFv display method that retains native heavy and light chain pairing with a related method that randomly pairs heavy and light chain. We performed the studies in a humanized mouse, using interleukin 21 receptor (IL-21R) as a test immunogen. We identified 44 high-affinity binder scFv with the native pairing method and 100 high-affinity binder scFv with the random pairing method. 30% of the natively paired scFv binders were also discovered with the randomly paired method, and 13% of the randomly paired binders were also discovered with the natively paired method. Additionally, 33% of the scFv binders discovered only in the randomly paired library were initially present in the natively paired pre-sort library. Thus, a significant proportion of “randomly paired” scFv were actually natively paired. We synthesized and produced 46 of the candidates as full-length antibodies and subjected them to a panel of binding assays to characterize their therapeutic potential. 87% of the antibodies were verified as binding IL-21R by at least one assay. We found that antibodies with native light chains were more likely to bind IL-21R than antibodies with non-native light chains, suggesting a higher false positive rate for antibodies from the randomly paired library. Additionally, the randomly paired method failed to identify nearly half of the true natively paired binders, suggesting a higher false negative rate. We conclude that natively paired libraries have critical advantages in sensitivity and specificity for antibody discovery programs. PMID:29376776

  2. Effect of redox partner binding on CYP101D1 conformational dynamics.

    PubMed

    Batabyal, Dipanwita; Poulos, Thomas L

    2018-06-01

    We have compared the thermodynamics of substrate and redox partner binding of P450cam to its close homologue, CYP101D1, using isothermal titration calorimetry (ITC). CYP101D1 binds camphor about 10-fold more weakly than P450cam which is consistent with the inability of camphor to cause a complete low- to high-spin shift in CYP101D1. Even so molecular dynamics simulations show that camphor is very stable in the CYP101D1 active site similar to P450cam. ITC data on the binding of the CYP101D1 ferredoxin redox partner (abbreviated Arx) shows that the substrate-bound closed state of CYP101D1 binds Arx more tightly than the substrate-free open form. This is just the opposite to P450cam where Pdx (ferredoxin redox partner of P450cam) favors binding to the P450cam open state. In addition, CYP101D1-Arx binding has a large negative ΔS while the P450cam-Pdx has a much smaller ΔS indicating that interactions at the docking interface are different. The most obvious difference is that PDX D38 which forms an important ion pair with P450cam R112 at the center of the interface is Arx L39 in Arx. This suggests that Arx may adopt a different orientation than Pdx in order to optimize nonpolar interactions with Arx L39 . Copyright © 2018. Published by Elsevier Inc.

  3. Spin-orbit coupling, electron transport and pairing instabilities in two-dimensional square structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kocharian, Armen N.; Fernando, Gayanath W.; Fang, Kun

    Rashba spin-orbit effects and electron correlations in the two-dimensional cylindrical lattices of square geometries are assessed using mesoscopic two-, three- and four-leg ladder structures. Here the electron transport properties are systematically calculated by including the spin-orbit coupling in tight binding and Hubbard models threaded by a magnetic flux. These results highlight important aspects of possible symmetry breaking mechanisms in square ladder geometries driven by the combined effect of a magnetic gauge field spin-orbit interaction and temperature. The observed persistent current, spin and charge polarizations in the presence of spin-orbit coupling are driven by separation of electron and hole charges andmore » opposite spins in real-space. The modeled spin-flip processes on the pairing mechanism induced by the spin-orbit coupling in assembled nanostructures (as arrays of clusters) engineered in various two-dimensional multi-leg structures provide an ideal playground for understanding spatial charge and spin density inhomogeneities leading to electron pairing and spontaneous phase separation instabilities in unconventional superconductors. Such studies also fall under the scope of current challenging problems in superconductivity and magnetism, topological insulators and spin dependent transport associated with numerous interfaces and heterostructures.« less

  4. Particle dynamics and pair production in tightly focused standing wave

    NASA Astrophysics Data System (ADS)

    Jirka, M.; Klimo, O.; Vranić, M.; Weber, S.; Korn, G.

    2017-05-01

    With the advent of 10 PW laser facilities, new regimes of laser-matter interaction are opening since effects of quantum electrodynamics, such as electron-positron pair production and cascade development, start to be important. The dynamics of light charged particles, such as electrons and positrons, is affected by the radiation reaction force. This effect can strongly influence the interaction of intense laser pulses with matter since it lowers the energy of emitting particles and transforms their energy to the gamma radiation. Consequently, electron-positron pairs can be generated via Breit-Wheeler process. To study this new regime of interaction, numerical simulations are required. With their help it is possible to predict and study quantum effects which may occur in future experiments at modern laser facilities. In this work we present results of electron interaction with an intense standing wave formed by two colliding laser pulses. Due to the necessity to achieve ultra intense laser field, the laser beam has to be focused to a μm-diameter spot. Since the paraxial approximation is not valid for tight focusing, the appropriate model describing the tightly focused laser beam has to be employed. In tightly focused laser beam the longitudinal component of the electromagnetic field becomes significant and together with the ponderomotive force they affect the dynamics of interacting electrons and also newly generated Breit-Wheeler electron-positron pairs. Using the Particle-In-Cell code we study electron dynamics, gamma radiation and pair production in such a configuration for linear polarization and different types of targets.

  5. Non-hermitian quantum thermodynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardas, Bartłomiej; Deffner, Sebastian; Saxena, Avadh

    Thermodynamics is the phenomenological theory of heat and work. Here we analyze to what extent quantum thermodynamic relations are immune to the underlying mathematical formulation of quantum mechanics. As a main result, we show that the Jarzynski equality holds true for all non-hermitian quantum systems with real spectrum. This equality expresses the second law of thermodynamics for isothermal processes arbitrarily far from equilibrium. In the quasistatic limit however, the second law leads to the Carnot bound which is fulfilled even if some eigenenergies are complex provided they appear in conjugate pairs. Lastly, we propose two setups to test our predictions,more » namely with strongly interacting excitons and photons in a semiconductor microcavity and in the non-hermitian tight-binding model.« less

  6. Non-hermitian quantum thermodynamics

    DOE PAGES

    Gardas, Bartłomiej; Deffner, Sebastian; Saxena, Avadh

    2016-03-22

    Thermodynamics is the phenomenological theory of heat and work. Here we analyze to what extent quantum thermodynamic relations are immune to the underlying mathematical formulation of quantum mechanics. As a main result, we show that the Jarzynski equality holds true for all non-hermitian quantum systems with real spectrum. This equality expresses the second law of thermodynamics for isothermal processes arbitrarily far from equilibrium. In the quasistatic limit however, the second law leads to the Carnot bound which is fulfilled even if some eigenenergies are complex provided they appear in conjugate pairs. Lastly, we propose two setups to test our predictions,more » namely with strongly interacting excitons and photons in a semiconductor microcavity and in the non-hermitian tight-binding model.« less

  7. Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

    PubMed

    Hong, Seung Hwan; Choi, Han-Yong

    2013-09-11

    We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

  8. Three pillars for achieving quantum mechanical molecular dynamics simulations of huge systems: Divide-and-conquer, density-functional tight-binding, and massively parallel computation.

    PubMed

    Nishizawa, Hiroaki; Nishimura, Yoshifumi; Kobayashi, Masato; Irle, Stephan; Nakai, Hiromi

    2016-08-05

    The linear-scaling divide-and-conquer (DC) quantum chemical methodology is applied to the density-functional tight-binding (DFTB) theory to develop a massively parallel program that achieves on-the-fly molecular reaction dynamics simulations of huge systems from scratch. The functions to perform large scale geometry optimization and molecular dynamics with DC-DFTB potential energy surface are implemented to the program called DC-DFTB-K. A novel interpolation-based algorithm is developed for parallelizing the determination of the Fermi level in the DC method. The performance of the DC-DFTB-K program is assessed using a laboratory computer and the K computer. Numerical tests show the high efficiency of the DC-DFTB-K program, a single-point energy gradient calculation of a one-million-atom system is completed within 60 s using 7290 nodes of the K computer. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Mechanistic Basis Of Calmodulin Mediated Estrogen Receptor Alpha Activation and Antiestrogen Resistance

    DTIC Science & Technology

    2010-06-01

    for solubility (Figure 5). We call this protein Trx -ERA241-320. We also produced a similar protein construct, but with only residues 241-273 of...ERa, as a “control” (Figure 5). We call this protein Trx -ERA241-273. Because CaM binds tightly to the N-terminal extended ligand binding domain of...ERa (residues 286- 552, see above), we hypothesized that Trx - ERA241-320 would bind tightly to CaM, but that Trx -ERA241-273 would not. The genetic

  10. Substrate-Triggered Exosite Binding: Synergistic Dendrimer/Folic Acid Action for Achieving Specific, Tight-Binding to Folate Binding Protein.

    PubMed

    Chen, Junjie; van Dongen, Mallory A; Merzel, Rachel L; Dougherty, Casey A; Orr, Bradford G; Kanduluru, Ananda Kumar; Low, Philip S; Marsh, E Neil G; Banaszak Holl, Mark M

    2016-03-14

    Polymer-ligand conjugates are designed to bind proteins for applications as drugs, imaging agents, and transport scaffolds. In this work, we demonstrate a folic acid (FA)-triggered exosite binding of a generation five poly(amidoamine) (G5 PAMAM) dendrimer scaffold to bovine folate binding protein (bFBP). The protein exosite is a secondary binding site on the protein surface, separate from the FA binding pocket, to which the dendrimer binds. Exosite binding is required to achieve the greatly enhanced binding constants and protein structural change observed in this study. The G5Ac-COG-FA1.0 conjugate bound tightly to bFBP, was not displaced by a 28-fold excess of FA, and quenched roughly 80% of the initial fluorescence. Two-step binding kinetics were measured using the intrinsic fluorescence of the FBP tryptophan residues to give a KD in the low nanomolar range for formation of the initial G5Ac-COG-FA1.0/FBP* complex, and a slow conversion to the tight complex formed between the dendrimer and the FBP exosite. The extent of quenching was sensitive to the choice of FA-dendrimer linker chemistry. Direct amide conjugation of FA to G5-PAMAM resulted in roughly 50% fluorescence quenching of the FBP. The G5Ac-COG-FA, which has a longer linker containing a 1,2,3-triazole ring, exhibited an ∼80% fluorescence quenching. The binding of the G5Ac-COG-FA1.0 conjugate was compared to poly(ethylene glycol) (PEG) conjugates of FA (PEGn-FA). PEG2k-FA had a binding strength similar to that of FA, whereas other PEG conjugates with higher molecular weight showed weaker binding. However, no PEG conjugates gave an increased degree of total fluorescence quenching.

  11. Supramolecular latching system based on ultrastable synthetic binding pairs as versatile tools for protein imaging.

    PubMed

    Kim, Kyung Lock; Sung, Gihyun; Sim, Jaehwan; Murray, James; Li, Meng; Lee, Ara; Shrinidhi, Annadka; Park, Kyeng Min; Kim, Kimoon

    2018-04-27

    Here we report ultrastable synthetic binding pairs between cucurbit[7]uril (CB[7]) and adamantyl- (AdA) or ferrocenyl-ammonium (FcA) as a supramolecular latching system for protein imaging, overcoming the limitations of protein-based binding pairs. Cyanine 3-conjugated CB[7] (Cy3-CB[7]) can visualize AdA- or FcA-labeled proteins to provide clear fluorescence images for accurate and precise analysis of proteins. Furthermore, controllability of the system is demonstrated by treating with a stronger competitor guest. At low temperature, this allows us to selectively detach Cy3-CB[7] from guest-labeled proteins on the cell surface, while leaving Cy3-CB[7] latched to the cytosolic proteins for spatially conditional visualization of target proteins. This work represents a non-protein-based bioimaging tool which has inherent advantages over the widely used protein-based techniques, thereby demonstrating the great potential of this synthetic system.

  12. Total-energy Assisted Tight-binding Method Based on Local Density Approximation of Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Fujiwara, Takeo; Nishino, Shinya; Yamamoto, Susumu; Suzuki, Takashi; Ikeda, Minoru; Ohtani, Yasuaki

    2018-06-01

    A novel tight-binding method is developed, based on the extended Hückel approximation and charge self-consistency, with referring the band structure and the total energy of the local density approximation of the density functional theory. The parameters are so adjusted by computer that the result reproduces the band structure and the total energy, and the algorithm for determining parameters is established. The set of determined parameters is applicable to a variety of crystalline compounds and change of lattice constants, and, in other words, it is transferable. Examples are demonstrated for Si crystals of several crystalline structures varying lattice constants. Since the set of parameters is transferable, the present tight-binding method may be applicable also to molecular dynamics simulations of large-scale systems and long-time dynamical processes.

  13. Accurate modeling of defects in graphene transport calculations

    NASA Astrophysics Data System (ADS)

    Linhart, Lukas; Burgdörfer, Joachim; Libisch, Florian

    2018-01-01

    We present an approach for embedding defect structures modeled by density functional theory into large-scale tight-binding simulations. We extract local tight-binding parameters for the vicinity of the defect site using Wannier functions. In the transition region between the bulk lattice and the defect the tight-binding parameters are continuously adjusted to approach the bulk limit far away from the defect. This embedding approach allows for an accurate high-level treatment of the defect orbitals using as many as ten nearest neighbors while keeping a small number of nearest neighbors in the bulk to render the overall computational cost reasonable. As an example of our approach, we consider an extended graphene lattice decorated with Stone-Wales defects, flower defects, double vacancies, or silicon substitutes. We predict distinct scattering patterns mirroring the defect symmetries and magnitude that should be experimentally accessible.

  14. DFTBaby: A software package for non-adiabatic molecular dynamics simulations based on long-range corrected tight-binding TD-DFT(B)

    NASA Astrophysics Data System (ADS)

    Humeniuk, Alexander; Mitrić, Roland

    2017-12-01

    A software package, called DFTBaby, is published, which provides the electronic structure needed for running non-adiabatic molecular dynamics simulations at the level of tight-binding DFT. A long-range correction is incorporated to avoid spurious charge transfer states. Excited state energies, their analytic gradients and scalar non-adiabatic couplings are computed using tight-binding TD-DFT. These quantities are fed into a molecular dynamics code, which integrates Newton's equations of motion for the nuclei together with the electronic Schrödinger equation. Non-adiabatic effects are included by surface hopping. As an example, the program is applied to the optimization of excited states and non-adiabatic dynamics of polyfluorene. The python and Fortran source code is available at http://www.dftbaby.chemie.uni-wuerzburg.de.

  15. Dpb11 may function with RPA and DNA to initiate DNA replication

    PubMed Central

    Bruck, Irina; Dhingra, Nalini; Martinez, Matthew P.

    2017-01-01

    Dpb11 is required for the initiation of DNA replication in budding yeast. We found that Dpb11 binds tightly to single-stranded DNA (ssDNA) or branched DNA structures, while its human homolog, TopBP1, binds tightly to branched-DNA structures. We also found that Dpb11 binds stably to CDK-phosphorylated RPA, the eukaryotic ssDNA binding protein, in the presence of branched DNA. A Dpb11 mutant specifically defective for DNA binding did not exhibit tight binding to RPA in the presence of DNA, suggesting that Dpb11-interaction with DNA may promote the recruitment of RPA to melted DNA. We then characterized a mutant of Dpb11 that is specifically defective in DNA binding in budding yeast cells. Expression of dpb11-m1,2,3,5,ΔC results in a substantial decrease in RPA recruitment to origins, suggesting that Dpb11 interaction with DNA may be required for RPA recruitment to origins. Expression of dpb11-m1,2,3,5,ΔC also results in diminished GINS interaction with Mcm2-7 during S phase, while Cdc45 interaction with Mcm2-7 is like wild-type. The reduced GINS interaction with Mcm2-7 may be an indirect consequence of diminished origin melting. We propose that the tight interaction between Dpb11, CDK-phosphorylated RPA, and branched-DNA may be required for the essential function of stabilizing melted origin DNA in vivo. We also propose an alternative model, wherein Dpb11-DNA interaction is required for some other function in DNA replication initiation, such as helicase activation. PMID:28467467

  16. Complex absorbing potential based Lorentzian fitting scheme and time dependent quantum transport.

    PubMed

    Xie, Hang; Kwok, Yanho; Jiang, Feng; Zheng, Xiao; Chen, GuanHua

    2014-10-28

    Based on the complex absorbing potential (CAP) method, a Lorentzian expansion scheme is developed to express the self-energy. The CAP-based Lorentzian expansion of self-energy is employed to solve efficiently the Liouville-von Neumann equation of one-electron density matrix. The resulting method is applicable for both tight-binding and first-principles models and is used to simulate the transient currents through graphene nanoribbons and a benzene molecule sandwiched between two carbon-atom chains.

  17. Rational and Modular Design of Potent Ligands Targeting the RNA that Causes Myotonic Dystrophy 2

    PubMed Central

    Lee, Melissa M.; Pushechnikov, Alexei; Disney, Matthew D.

    2009-01-01

    Most ligands targeting RNA are identified through screening a therapeutic target for binding members of a ligand library. A potential alternative way to construct RNA binders is through rational design using information about the RNA motifs ligands prefer to bind. Herein, we describe such an approach to design modularly assembled ligands targeting the RNA that causes myotonic dystrophy type 2 (DM2), a currently untreatable disease. A previous study identified that 6′-N-5-hexynoate kanamycin A (1) prefers to bind 2×2 nucleotide, pyrimidine-rich RNA internal loops. Multiple copies of such loops were found in the RNA hairpin that causes DM2. The 1 ligand was then modularly displayed on a peptoid scaffold with varied number and spacing to target several internal loops simultaneously. Modularly assembled ligands were tested for binding to a series of RNAs and for inhibiting the formation of the toxic DM2 RNA-muscleblind protein (MBNL-1) interaction. The most potent ligand displays three 1 modules, each separated by four spacing submonomers, and inhibits the formation of the RNA-protein complex with an IC50 of 25 nM. This ligand is higher affinity and more specific for binding DM2 RNA than MBNL-1. It binds the DM2 RNA at least 20-times more tightly than related RNAs and 15-fold more tightly than MBNL-1. A related control peptoid displaying 6′-N-5-hexynoate neamine (2) is >100-fold less potent at inhibiting the RNA-protein interaction and binds to DM2 RNA >125-fold more weakly. Uptake studies into a mouse myoblast cell line also show that the most potent ligand is cell permeable. PMID:19348464

  18. Potential Protein Toxicity of Synthetic Pigments: Binding of Poncean S to Human Serum Albumin☆

    PubMed Central

    Gao, Hong-Wen; Xu, Qing; Chen, Ling; Wang, Shi-Long; Wang, Yuan; Wu, Ling-Ling; Yuan, Yuan

    2008-01-01

    Using various methods, e.g., spectrophotometry, circular dichroism, and isothermal titration calorimetry, the interaction of poncean S (PS) with human serum albumin (HSA) was characterized at pH 1.81, 3.56, and 7.40 using the spectral correction technique, and Langmuir and Temkin isothermal models. The consistency among results concerning, e.g., binding number, binding energy, and type of binding, showed that ion pair electrostatic attraction fixed the position of PS in HSA and subsequently induced a combination of multiple noncovalent bonds such as H-bonds, hydrophobic interactions, and van der Waals forces. Ion pair attraction and H-bonds produced a stable PS-HSA complex and led to a marked change in the secondary structure of HSA in acidic media. The PS-HSA binding pattern and the process of change in HSA conformation were also investigated. The potentially toxic effect of PS on the transport function of HSA in a normal physiological environment was analyzed. This work provides a useful experimental strategy for studying the interaction of organic substances with biomacromolecules, helping us to understand the activity or mechanism of toxicity of an organic compound. PMID:17905844

  19. Perfect transmission at oblique incidence by trigonal warping in graphene P-N junctions

    NASA Astrophysics Data System (ADS)

    Zhang, Shu-Hui; Yang, Wen

    2018-01-01

    We develop an analytical mode-matching technique for the tight-binding model to describe electron transport across graphene P-N junctions. This method shares the simplicity of the conventional mode-matching technique for the low-energy continuum model and the accuracy of the tight-binding model over a wide range of energies. It further reveals an interesting phenomenon on a sharp P-N junction: the disappearance of the well-known Klein tunneling (i.e., perfect transmission) at normal incidence and the appearance of perfect transmission at oblique incidence due to trigonal warping at energies beyond the linear Dirac regime. We show that this phenomenon arises from the conservation of a generalized pseudospin in the tight-binding model. We expect this effect to be experimentally observable in graphene and other Dirac fermions systems, such as the surface of three-dimensional topological insulators.

  20. The characterisation of atomic structure and glass-forming ability of the Zr-Cu-Co metallic glasses studied by molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Celtek, M.; Sengul, S.

    2018-03-01

    In the present work, the glass formation process and structural properties of Zr50Cu50-xCox (0 ≤ x ≤ 50) bulk metallic glasses were investigated by a molecular dynamics simulation with the many body tight-binding potentials. The evolution of structure and glass formation process with temperature were discussed using the coordination number, the radial distribution functions, the volume-temperature curve, icosahedral short-range order, glass transition temperature, Voronoi analysis, Honeycutt-Andersen pair analysis technique and the distribution of bond-angles. Results indicate that adding Co causes similar responses on the nature of the Zr50Cu50-xCox (0 ≤ x ≤ 50) alloys except for higher glass transition temperature and ideal icosahedral type ordered local atomic environment. Also, the differences of the atomic radii play the key role in influencing the atomic structure of these alloys. Both Cu and Co atoms play a significant role in deciding the chemical and topological short-range orders of the Zr50Cu50-xCox ternary liquids and amorphous alloys. The glass-forming ability of these alloys is supported by the experimental observations reported in the literature up to now.

  1. Chirality Characterization of Dispersed Single Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Namkung, Min; Williams, Phillip A.; Mayweather, Candis D.; Wincheski, Buzz; Park, Cheol; Namkung, Juock S.

    2005-01-01

    Raman scattering and optical absorption spectroscopy are used for the chirality characterization of HiPco single wall carbon nanotubes (SWNTs) dispersed in aqueous solution with the surfactant sodium dodecylbenzene sulfonate. Radial breathing mode (RBM) Raman peaks for semiconducting and metallic SWNTs are identified by directly comparing the Raman spectra with the Kataura plot. The SWNT diameters are calculated from these resonant peak positions. Next, a list of (n, m) pairs, yielding the SWNT diameters within a few percent of that obtained from each resonant peak position, is established. The interband transition energies for the list of SWNT (n, m) pairs are calculated based on the tight binding energy expression for each list of the (n, m) pairs, and the pairs yielding the closest values to the corresponding experimental optical absorption peaks are selected. The results reveal that (1, 11), (4, 11), and (0, 11) as the most probable chiralities of the semiconducting nanotubes. The results also reveal that (4, 16), (6, 12) and (8, 8) are the most probable chiralities for the metallic nanotubes. Directly relating the Raman scattering data to the optical absorption spectra, the present method is considered the simplest technique currently available. Another advantage of this technique is the use of the E(sup 8)(sub 11) peaks in the optical absorption spectrum in the analysis to enhance the accuracy in the results.

  2. Binding of manganese(II) to a tertiary stabilized hammerhead ribozyme as studied by electron paramagnetic resonance spectroscopy

    PubMed Central

    KISSELEVA, NATALIA; KHVOROVA, ANASTASIA; WESTHOF, ERIC; SCHIEMANN, OLAV

    2005-01-01

    Electron paramagnetic resonance (EPR) spectroscopy is used to study the binding of MnII ions to a tertiary stabilized hammer-head ribozyme (tsHHRz) and to compare it with the binding to the minimal hammerhead ribozyme (mHHRz). Continuous wave EPR measurements show that the tsHHRz possesses a single high-affinity MnII binding site with a KD of ≤10 nM at an NaCl concentration of 0.1 M. This dissociation constant is at least two orders of magnitude smaller than the KD determined previously for the single high-affinity MnII site in the mHHRz. In addition, whereas the high-affinity MnII is displaced from the mHHRz upon binding of the aminoglycoside antibiotic neomycin B, it is not from the tsHHRz. Despite these pronounced differences in binding, a comparison between the electron spin echo envelope modulation and hyperfine sublevel correlation spectra of the minimal and tertiary stabilized HHRz demonstrates that the structure of both binding sites is very similar. This suggests that the MnII is located in both ribozymes between the bases A9 and G10.1 of the sheared G · A tandem base pair, as shown previously and in detail for the mHHRz. Thus, the much stronger MnII binding in the tsHHRz is attributed to the interaction between the two external loops, which locks in the RNA fold, trapping the MnII in the tightly bound conformation, whereas the absence of long-range loop–loop interactions in the mHHRz leads to more dynamical and open conformations, decreasing MnII binding. PMID:15611296

  3. The behavior of exciplex decay processes and interplay of radiationless transition and preliminary reorganization mechanisms of electron transfer in loose and tight pairs of reactants.

    PubMed

    Kuzmin, Michael G; Soboleva, Irina V; Dolotova, Elena V

    2007-01-18

    Exciplex emission spectra and rate constants of their decay via internal conversion and intersystem crossing are studied and discussed in terms of conventional radiationless transition approach. Exciplexes of 9-cyanophenanthrene with 1,2,3-trimethoxybenzene and 1,3,5-trimethoxybenzene were studied in heptane, toluene, butyl acetate, dichloromethane, butyronitrile, and acetonitrile. A better description of spectra and rate constants is obtained using 0-0 transition energy and Gauss broadening of vibrational bands rather than the free energy of electron transfer and reorganization energy. The coincidence of parameters describing exciplex emission spectra and dependence of exciplex decay rate constants on energy gap gives the evidence of radiationless quantum transition mechanism rather than thermally activated medium reorganization mechanism of charge recombination in exciplexes and excited charge transfer complexes (contact radical ion pairs) as well as in solvent separated radical ion pairs. Radiationless quantum transition mechanism is shown to provide an appropriate description also for the main features of exergonic excited-state charge separation reactions if fast mutual transformations of loose and tight pairs of reactants are considered. In particular, very fast electron transfer (ET) in tight pairs of reactants with strong electronic coupling of locally excited and charge transfer states can prevent the observation of an inverted region in bimolecular excited-state charge separation even for highly exergonic reactions.

  4. Effective mass in bilayer graphene at low carrier densities: The role of potential disorder and electron-electron interaction

    NASA Astrophysics Data System (ADS)

    Li, J.; Tan, L. Z.; Zou, K.; Stabile, A. A.; Seiwell, D. J.; Watanabe, K.; Taniguchi, T.; Louie, Steven G.; Zhu, J.

    2016-10-01

    In a two-dimensional electron gas, the electron-electron interaction generally becomes stronger at lower carrier densities and renormalizes the Fermi-liquid parameters, such as the effective mass of carriers. We combine experiment and theory to study the effective masses of electrons and holes me* and mh* in bilayer graphene in the low carrier density regime on the order of 1 ×1011c m-2 . Measurements use temperature-dependent low-field Shubnikov-de Haas oscillations observed in high-mobility hexagonal boron nitride supported samples. We find that while me* follows a tight-binding description in the whole density range, mh* starts to drop rapidly below the tight-binding description at a carrier density of n =6 ×1011c m-2 and exhibits a strong suppression of 30% when n reaches 2 ×1011c m-2 . Contributions from the electron-electron interaction alone, evaluated using several different approximations, cannot explain the experimental trend. Instead, the effect of the potential fluctuation and the resulting electron-hole puddles play a crucial role. Calculations including both the electron-electron interaction and disorder effects explain the experimental data qualitatively and quantitatively. This Rapid Communication reveals an unusual disorder effect unique to two-dimensional semimetallic systems.

  5. Physical and metabolic requirements for early interaction of poliovirus and human rhinovirus with HeLa cells.

    PubMed Central

    Lonberg-Holm, K; Whiteley, N M

    1976-01-01

    Attachment, ""tight binding'' and eclipse of radioactive poliovirus 2 (P2) and human rhinovirus 2 (HRV 2) were investigated. The activation energy for attachment of both HRV2 and P2 was about 13 kcal/mol. HRV2 differed from P2 in two respects: the Arrhenius plot for attachment of HRV2 showed a break at 15 to 19 degrees C when the cells were first treated several hours at 0 degrees C, and attachment of HRV2 was inhibited by treatment of cells with metabolic poisons able to reduce cellular ATP by more than 90%. Tight binding was determined by isolation of a specific P2-membrane complex or by loss of EDTA dissociability of HRV2. Tight binding of both viruses was slowed by 0.01 M iodoacetamide but not by 0.02 M F-; F- plus 0.002 M CN- slowed tight binding of HRV2 but not of P2. Eclipse, the irreversible alteration of parental virions, was detected by isolation of cell-associated subviral particles or by loss of cell-associated infectious virus. Eclipse of both viruses is slowed by iodoacetamide or F-. It seems likely that the early steps of infection with picornaviruses may be sensitive to alterations in the cell membrane produced by metabolic inhibitors or by treatment at low temperature. PMID:184301

  6. Edge currents in frustrated Josephson junction ladders

    NASA Astrophysics Data System (ADS)

    Marques, A. M.; Santos, F. D. R.; Dias, R. G.

    2016-09-01

    We present a numerical study of quasi-1D frustrated Josephson junction ladders with diagonal couplings and open boundary conditions, in the large capacitance limit. We derive a correspondence between the energy of this Josephson junction ladder and the expectation value of the Hamiltonian of an analogous tight-binding model, and show how the overall superconducting state of the chain is equivalent to the minimum energy state of the tight-binding model in the subspace of one-particle states with uniform density. To satisfy the constraint of uniform density, the superconducting state of the ladder is written as a linear combination of the allowed k-states of the tight-binding model with open boundaries. Above a critical value of the parameter t (ratio between the intra-rung and inter-rung Josephson couplings) the ladder spontaneously develops currents at the edges, which spread to the bulk as t is increased until complete coverage is reached. Above a certain value of t, which varies with ladder size (t = 1 for an infinite-sized ladder), the edge currents are destroyed. The value t = 1 corresponds, in the tight-binding model, to the opening of a gap between two bands. We argue that the disappearance of the edge currents with this gap opening is not coincidental, and that this points to a topological origin for these edge current states.

  7. Bak Conformational Changes Induced by Ligand Binding: Insight into BH3 Domain Binding and Bak Homo-Oligomerization

    PubMed Central

    Pang, Yuan-Ping; Dai, Haiming; Smith, Alyson; Meng, X. Wei; Schneider, Paula A.; Kaufmann, Scott H.

    2012-01-01

    Recently we reported that the BH3-only proteins Bim and Noxa bind tightly but transiently to the BH3-binding groove of Bak to initiate Bak homo-oligomerization. However, it is unclear how such tight binding can induce Bak homo-oligomerization. Here we report the ligand-induced Bak conformational changes observed in 3D models of Noxa·Bak and Bim·Bak refined by molecular dynamics simulations. In particular, upon binding to the BH3-binding groove, Bim and Noxa induce a large conformational change of the loop between helices 1 and 2 and in turn partially expose a remote groove between helices 1 and 6 in Bak. These observations, coupled with the reported experimental data, suggest formation of a pore-forming Bak octamer, in which the BH3-binding groove is at the interface on one side of each monomer and the groove between helices 1 and 6 is at the interface on the opposite side, initiated by ligand binding to the BH3-binding groove. PMID:22355769

  8. Equilibrium structure and atomic vibrations of Nin clusters

    NASA Astrophysics Data System (ADS)

    Borisova, Svetlana D.; Rusina, Galina G.

    2017-12-01

    The equilibrium bond lengths and binding energy, second differences in energy and vibrational frequencies of free clusters Nin (2 ≤ n ≤ 20) were calculated with the use of the interaction potential obtained in the tight-binding approximation (TBA). The results show that the minimum vibration frequency plays a significant role in the evaluation of the dynamic stability of the clusters. A nonmonotonic dependence of the minimum vibration frequency of clusters on their size and the extreme values for the number of atoms in a cluster n = 4, 6, 13, and 19 are demonstrated. This result agrees with the theoretical and experimental data on stable structures of small metallic clusters.

  9. A new approach to the method of source-sink potentials for molecular conduction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pickup, Barry T., E-mail: B.T.Pickup@sheffield.ac.uk, E-mail: P.W.Fowler@sheffield.ac.uk; Fowler, Patrick W., E-mail: B.T.Pickup@sheffield.ac.uk, E-mail: P.W.Fowler@sheffield.ac.uk; Borg, Martha

    2015-11-21

    We re-derive the tight-binding source-sink potential (SSP) equations for ballistic conduction through conjugated molecular structures in a form that avoids singularities. This enables derivation of new results for families of molecular devices in terms of eigenvectors and eigenvalues of the adjacency matrix of the molecular graph. In particular, we define the transmission of electrons through individual molecular orbitals (MO) and through MO shells. We make explicit the behaviour of the total current and individual MO and shell currents at molecular eigenvalues. A rich variety of behaviour is found. A SSP device has specific insulation or conduction at an eigenvalue ofmore » the molecular graph (a root of the characteristic polynomial) according to the multiplicities of that value in the spectra of four defined device polynomials. Conduction near eigenvalues is dominated by the transmission curves of nearby shells. A shell may be inert or active. An inert shell does not conduct at any energy, not even at its own eigenvalue. Conduction may occur at the eigenvalue of an inert shell, but is then carried entirely by other shells. If a shell is active, it carries all conduction at its own eigenvalue. For bipartite molecular graphs (alternant molecules), orbital conduction properties are governed by a pairing theorem. Inertness of shells for families such as chains and rings is predicted by selection rules based on node counting and degeneracy.« less

  10. Grain boundaries in bcc-Fe: a density-functional theory and tight-binding study

    NASA Astrophysics Data System (ADS)

    Wang, Jingliang; Madsen, Georg K. H.; Drautz, Ralf

    2018-02-01

    Grain boundaries (GBs) have a significant influence on material properties. In the present paper, we calculate the energies of eleven low-Σ ({{Σ }}≤slant 13) symmetrical tilt GBs and two twist GBs in ferromagnetic bcc iron using first-principles density functional theory (DFT) calculations. The results demonstrate the importance of a sufficient sampling of initial rigid body translations in all three directions. We show that the relative GB energies can be explained by the miscoordination of atoms at the GB region. While the main features of the studied GB structures were captured by previous empirical interatomic potential calculations, it is shown that the absolute values of GB energies calculated were substantially underestimated. Based on DFT-calculated GB structures and energies, we construct a new d-band orthogonal tight-binding (TB) model for bcc iron. The TB model is validated by its predictive power on all the studied GBs. We apply the TB model to block boundaries in lath martensite and demonstrate that the experimentally observed GB character distribution can be explained from the viewpoint of interface energy.

  11. Implementation and benchmark of a long-range corrected functional in the density functional based tight-binding method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lutsker, V.; Niehaus, T. A., E-mail: thomas.niehaus@physik.uni-regensburg.de; Aradi, B.

    2015-11-14

    Bridging the gap between first principles methods and empirical schemes, the density functional based tight-binding method (DFTB) has become a versatile tool in predictive atomistic simulations over the past years. One of the major restrictions of this method is the limitation to local or gradient corrected exchange-correlation functionals. This excludes the important class of hybrid or long-range corrected functionals, which are advantageous in thermochemistry, as well as in the computation of vibrational, photoelectron, and optical spectra. The present work provides a detailed account of the implementation of DFTB for a long-range corrected functional in generalized Kohn-Sham theory. We apply themore » method to a set of organic molecules and compare ionization potentials and electron affinities with the original DFTB method and higher level theory. The new scheme cures the significant overpolarization in electric fields found for local DFTB, which parallels the functional dependence in first principles density functional theory (DFT). At the same time, the computational savings with respect to full DFT calculations are not compromised as evidenced by numerical benchmark data.« less

  12. Diffraction catastrophes and semiclassical quantum mechanics for Veselago lensing in graphene

    NASA Astrophysics Data System (ADS)

    Reijnders, K. J. A.; Katsnelson, M. I.

    2017-07-01

    We study the effect of trigonal warping on the focusing of electrons by n-p junctions in graphene. We find that perfect focusing, which was predicted for massless Dirac fermions, is only preserved for one specific lattice orientation. In the general case, trigonal warping leads to the formation of cusp caustics, with a different position of the focus for graphene's two valleys. We develop a semiclassical theory to compute these positions and find very good agreement with tight-binding simulations. Considering the transmission as a function of potential strength, we find that trigonal warping splits the single Dirac peak into two distinct peaks, leading to valley polarization. We obtain the transmission curves from tight-binding simulations and find that they are in very good agreement with the results of a billiard model that incorporates trigonal warping. Furthermore, the positions of the transmission maxima and the scaling of the peak width are accurately predicted by our semiclassical theory. Our semiclassical analysis can easily be carried over to other Dirac materials, which generally have different Fermi surface distortions.

  13. Nonlocal torque operators in ab initio theory of the Gilbert damping in random ferromagnetic alloys

    NASA Astrophysics Data System (ADS)

    Turek, I.; Kudrnovský, J.; Drchal, V.

    2015-12-01

    We present an ab initio theory of the Gilbert damping in substitutionally disordered ferromagnetic alloys. The theory rests on introduced nonlocal torques which replace traditional local torque operators in the well-known torque-correlation formula and which can be formulated within the atomic-sphere approximation. The formalism is sketched in a simple tight-binding model and worked out in detail in the relativistic tight-binding linear muffin-tin orbital method and the coherent potential approximation (CPA). The resulting nonlocal torques are represented by nonrandom, non-site-diagonal, and spin-independent matrices, which simplifies the configuration averaging. The CPA-vertex corrections play a crucial role for the internal consistency of the theory and for its exact equivalence to other first-principles approaches based on the random local torques. This equivalence is also illustrated by the calculated Gilbert damping parameters for binary NiFe and FeCo random alloys, for pure iron with a model atomic-level disorder, and for stoichiometric FePt alloys with a varying degree of L 10 atomic long-range order.

  14. GABAB receptor cell surface export is controlled by an endoplasmic reticulum gatekeeper

    PubMed Central

    Doly, Stéphane; Shirvani, Hamasseh; Gäta, Gabriel; Meye, Frank; Emerit, Michel-Boris; Enslen, Hervé; Achour, Lamia; Pardo-Lopez, Liliana; Kwon, Yang Seung; Armand, Vincent; Gardette, Robert; Giros, Bruno; Gassmann, Martin; Bettler, Bernhard; Mameli, Manuel; Darmon, Michèle; Marullo, Stefano

    2016-01-01

    Summary Endoplasmic reticulum (ER) release and cell surface export of many G protein-coupled receptors (GPCRs), are tightly regulated. For GABAB receptors of GABA, the major mammalian inhibitory neurotransmitter, the ligand-binding GB1 subunit is maintained in the ER by unknown mechanisms in the absence of hetero-dimerization with the GB2 subunit. We report that GB1 retention is regulated by a specific gatekeeper, PRAF2. This ER resident transmembrane protein binds to GB1, preventing its progression in the biosynthetic pathway. GB1 release occurs upon competitive displacement from PRAF2 by GB2. PRAF2 concentration, relative to that of GB1 and GB2, tightly controls cell surface receptor density and controls GABAB function in neurons. Experimental perturbation of PRAF2 levels in vivo caused marked hyperactivity disorders in mice. These data reveal an unanticipated major impact of specific ER gate-keepers on GPCR function and identify PRAF2 as a new molecular target with therapeutic potential for psychiatric and neurological diseases involving GABAB function. PMID:26033241

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ho, M.; Shi, W; Rinaldo-Mathis, A

    Inhibition of human purine nucleoside phosphorylase (PNP) stops growth of activated T-cells and the formation of 6-oxypurine bases, making it a target for leukemia, autoimmune disorders, and gout. Four generations of ribocation transition-state mimics bound to PNP are structurally characterized. Immucillin-H (K*{sub i} = 58 pM, first-generation) contains an iminoribitol cation with four asymmetric carbons. DADMe-Immucillin-H (K*{sub i} = 9 pM, second-generation), uses a methylene-bridged dihydroxypyrrolidine cation with two asymmetric centers. DATMe-Immucillin-H (K*{sub i} = 9 pM, third-generation) contains an open-chain amino alcohol cation with two asymmetric carbons. SerMe-ImmH (K*{sub i} = 5 pM, fourth-generation) uses achiral dihydroxyaminoalcohol seramide asmore » the ribocation mimic. Crystal structures of PNPs establish features of tight binding to be; (1) ion-pair formation between bound phosphate (or its mimic) and inhibitor cation, (2) leaving-group interactions to N1, O6, and N7 of 9-deazahypoxanthine, (3) interaction between phosphate and inhibitor hydroxyl groups, and (4) His257 interacting with the 5{prime}-hydroxyl group. The first generation analogue is an imperfect fit to the catalytic site with a long ion pair distance between the iminoribitol and bound phosphate and weaker interactions to the leaving group. Increasing the ribocation to leaving-group distance in the second- to fourth-generation analogues provides powerful binding interactions and a facile synthetic route to powerful inhibitors. Despite chemical diversity in the four generations of transition-state analogues, the catalytic site geometry is almost the same for all analogues. Multiple solutions in transition-state analogue design are available to convert the energy of catalytic rate enhancement to binding energy in human PNP.« less

  16. Schematic baryon models, their tight binding description and their microwave realization

    NASA Astrophysics Data System (ADS)

    Sadurní, E.; Franco-Villafañe, J. A.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-12-01

    A schematic model for baryon excitations is presented in terms of a symmetric Dirac gyroscope, a relativistic model solvable in closed form, that reduces to a rotor in the non-relativistic limit. The model is then mapped on a nearest neighbour tight binding model. In its simplest one-dimensional form this model yields a finite equidistant spectrum. This is experimentally implemented as a chain of dielectric resonators under conditions where their coupling is evanescent and a good agreement with the prediction is achieved.

  17. Magnetic susceptibilities of actinide 3d-metal intermetallic compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muniz, R.B.; d'Albuquerque e Castro, J.; Troper, A.

    1988-04-15

    We have numerically calculated the magnetic susceptibilities which appear in the Hartree--Fock instability criterion for actinide 3d transition-metal intermetallic compounds. This calculation is based on a previous tight-binding description of these actinide-based compounds (A. Troper and A. A. Gomes, Phys. Rev. B 34, 6487 (1986)). The parameters of the calculation, which starts from simple tight-binding d and f bands are (i) occupation numbers, (ii) ratio of d-f hybridization to d bandwidth, and (iii) electron-electron Coulomb-type interactions.

  18. The brown adipocyte protein CIDEA promotes lipid droplet fusion via a phosphatidic acid-binding amphipathic helix

    PubMed Central

    Barneda, David; Planas-Iglesias, Joan; Gaspar, Maria L; Mohammadyani, Dariush; Prasannan, Sunil; Dormann, Dirk; Han, Gil-Soo; Jesch, Stephen A; Carman, George M; Kagan, Valerian; Parker, Malcolm G; Ktistakis, Nicholas T; Klein-Seetharaman, Judith; Dixon, Ann M; Henry, Susan A; Christian, Mark

    2015-01-01

    Maintenance of energy homeostasis depends on the highly regulated storage and release of triacylglycerol primarily in adipose tissue, and excessive storage is a feature of common metabolic disorders. CIDEA is a lipid droplet (LD)-protein enriched in brown adipocytes promoting the enlargement of LDs, which are dynamic, ubiquitous organelles specialized for storing neutral lipids. We demonstrate an essential role in this process for an amphipathic helix in CIDEA, which facilitates embedding in the LD phospholipid monolayer and binds phosphatidic acid (PA). LD pairs are docked by CIDEA trans-complexes through contributions of the N-terminal domain and a C-terminal dimerization region. These complexes, enriched at the LD–LD contact site, interact with the cone-shaped phospholipid PA and likely increase phospholipid barrier permeability, promoting LD fusion by transference of lipids. This physiological process is essential in adipocyte differentiation as well as serving to facilitate the tight coupling of lipolysis and lipogenesis in activated brown fat. DOI: http://dx.doi.org/10.7554/eLife.07485.001 PMID:26609809

  19. Crumbs3 Is Essential for Proper Epithelial Development and Viability

    PubMed Central

    Whiteman, Eileen L.; Fan, Shuling; Harder, Jennifer L.; Walton, Katherine D.; Liu, Chia-Jen; Soofi, Abdul; Fogg, Vanessa C.; Hershenson, Marc B.; Dressler, Gregory R.; Deutsch, Gail H.; Gumucio, Deborah L.

    2014-01-01

    First identified in Drosophila, the Crumbs (Crb) proteins are important in epithelial polarity, apical membrane formation, and tight junction (TJ) assembly. The conserved Crb intracellular region includes a FERM (band 4.1/ezrin/radixin/moesin) binding domain (FBD) whose mammalian binding partners are not well understood and a PDZ binding motif that interacts with mammalian Pals1 (protein associated with lin seven) (also known as MPP5). Pals1 binds Patj (Pals1-associated tight-junction protein), a multi-PDZ-domain protein that associates with many tight junction proteins. The Crb complex also binds the conserved Par3/Par6/atypical protein kinase C (aPKC) polarity cassette that restricts migration of basolateral proteins through phosphorylation. Here, we describe a Crb3 knockout mouse that demonstrates extensive defects in epithelial morphogenesis. The mice die shortly after birth, with cystic kidneys and proteinaceous debris throughout the lungs. The intestines display villus fusion, apical membrane blebs, and disrupted microvilli. These intestinal defects phenocopy those of Ezrin knockout mice, and we demonstrate an interaction between Crumbs3 and ezrin. Taken together, our data indicate that Crumbs3 is crucial for epithelial morphogenesis and plays a role in linking the apical membrane to the underlying ezrin-containing cytoskeleton. PMID:24164893

  20. Improved Density Functional Tight Binding Potentials for Metalloid Aluminum Clusters

    DTIC Science & Technology

    2016-06-01

    simulations of the oxidation of Al4Cp * 4 show reasonable comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers...comparison with a DFT-based Car -Parrinello method, including correct prediction of hydride transfers from Cp* to the metal centers during the...initio molecular dynamics of the oxidation of Al4Cp * 4 using a DFT-based Car -Parrinello method. This simulation, which 43 several months on the

  1. Electronic transport in methylated fragments of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  2. Electronic transport in methylated fragments of DNA

    NASA Astrophysics Data System (ADS)

    de Almeida, M. L.; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; de Moura, F. A. B. F.; Lyra, M. L.

    2015-11-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  3. Investigation of electronic transport through a ladder-like graphene nanoribbon including random distributed impurities

    NASA Astrophysics Data System (ADS)

    Esmaili, Esmat; Mardaani, Mohammad; Rabani, Hassan

    2018-01-01

    The electronic transport of a ladder-like graphene nanoribbon which the on-site or hopping energies of a small part of it can be random is modeled by using the Green's function technique within the nearest neighbor tight-binding approach. We employ a unitary transformation in order to convert the Hamiltonian of the nanoribbon to the Hamiltonian of a tight-binding ladder-like network. In this case, the disturbed part of the system includes the second neighbor hopping interactions. While, the converted Hamiltonian of each ideal part is equivalent to the Hamiltonian of two periodic on-site chains. Therefore, we can insert the self-energies of the alternative on-site tight-binding chains to the inverse of the Green's function matrix of the ladder-like part. In this viewpoint, the conductance is constructed from two trans and cis contributions. The results show that increasing the disorder strength causes the increase and decrease of the conductance of the trans and cis contributions, respectively.

  4. Efficient RNA pseudouridylation by eukaryotic H/ACA ribonucleoproteins requires high affinity binding and correct positioning of guide RNA

    PubMed Central

    Caton, Evan A; Kelly, Erin K; Kamalampeta, Rajashekhar

    2018-01-01

    Abstract H/ACA ribonucleoproteins (H/ACA RNPs) are responsible for introducing many pseudouridines into RNAs, but are also involved in other cellular functions. Utilizing a purified and reconstituted yeast H/ACA RNP system that is active in pseudouridine formation under physiological conditions, we describe here the quantitative characterization of H/ACA RNP formation and function. This analysis reveals a surprisingly tight interaction of H/ACA guide RNA with the Cbf5p–Nop10p–Gar1p trimeric protein complex whereas Nhp2p binds comparably weakly to H/ACA guide RNA. Substrate RNA is bound to H/ACA RNPs with nanomolar affinity which correlates with the GC content in the guide-substrate RNA base pairing. Both Nhp2p and the conserved Box ACA element in guide RNA are required for efficient pseudouridine formation, but not for guide RNA or substrate RNA binding. These results suggest that Nhp2p and the Box ACA motif indirectly facilitate loading of the substrate RNA in the catalytic site of Cbf5p by correctly positioning the upper and lower parts of the H/ACA guide RNA on the H/ACA proteins. In summary, this study provides detailed insight into the molecular mechanism of H/ACA RNPs. PMID:29177505

  5. Binding of trivalent chromium to serum transferrin is sufficiently rapid to be physiologically relevant.

    PubMed

    Deng, Ge; Wu, Kristi; Cruce, Alex A; Bowman, Michael K; Vincent, John B

    2015-02-01

    Transferrin, the major iron transport protein in the blood, also transports trivalent chromium in vivo. Recent in vitro studies have, however, suggested that the binding of chromic ions to apotransferrin is too slow to be biologically relevant. Nevertheless, the in vitro studies have generally failed to adequately take physiological bicarbonate concentrations into account. In aqueous buffer (with ambient (bi)carbonate concentrations), the binding of chromium to transferrin is too slow to be physiologically relevant, taking days to reach equilibrium with the protein's associated conformational changes. However, in the presence of 25mM (bi)carbonate, the concentration in human blood, chromic ions bind rapidly and tightly to transferrin. Details of the kinetics of chromium binding to human serum transferrin and conalbumin (egg white transferrin) in the presence of bicarbonate and other major potential chromium ligands are described and are consistent with transferrin being the major chromic ion transporter from the blood to tissues. Copyright © 2014 Elsevier Inc. All rights reserved.

  6. Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

    PubMed

    Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

    2018-05-08

    Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  7. Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

    2016-07-28

    The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

  8. Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies

    NASA Astrophysics Data System (ADS)

    Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

    2017-03-01

    An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift ( 10 nm) and smaller Stokes' shift ( 5980 cm- 1) in BSA than HSA (Stokes'shift 6600 cm- 1), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (Ka 5.2 × 106 M- 1) than the DMOBA-HSA complex (Ka 1.0 × 106 M- 1). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5 Å) than HSA (25.4 Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (- 2.09 kcal/mol) compared to BSA (- 0.47 kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA.

  9. Tight-binding molecular-dynamics study of point defects in GaAs

    NASA Astrophysics Data System (ADS)

    Seong, Hyangsuk; Lewis, Laurent J.

    1995-08-01

    Tight-binding molecular-dynamics simulations at 0 K have been performed in order to study the effect of defects (vacancies and antisites) in different states of charge on the electronic and structural properties of GaAs. Relaxations are fully included in the model, and for each defect we calculate the local atomic structure, the volume change upon relaxing, the formation energy (including chemical potential contributions), and the ionization levels. We find Ga vacancies to relax by an amount which is independent of the state of charge, consistent with positron lifetime measurements. Our calculations also predict Ga vacancies to exhibit a negative-U effect, and to assume a triply negative charge state for most values of the electron chemical potential. The relaxation of As vacancies, on the contrary, depends sensitively on the state of charge. The model confirms the two experimentally observed ionization levels for this defect, just below the conduction-band minimum. Likewise, Ga antisites exhibit large relaxations. In fact, in the neutral state, relaxation is so large that it leads to a ``broken-bond'' configuration, in excellent accord with the first-principles calculations of Zhang and Chadi [Phys. Rev. Lett. 64, 1789 (1990)]. This system also exhibits a negative-U effect, for values of the electron chemical potential near midgap. For As antisites, we find only a weak relaxation, independent of the charge. The model predicts the neutral state of the defect to be the ground state for values of the electron chemical potential near and above midgap, which supports the view that the EL2 defect is a neutral As antisite. Upon comparing the formation energies of the various defects we finally find that, for all values of the atomic chemical potentials, antisites are most likely to occur than vacancies.

  10. Finite temperature magnon spectra in yttrium iron garnet from a mean field approach in a tight-binding model

    NASA Astrophysics Data System (ADS)

    Shen, Ka

    2018-04-01

    We study magnon spectra at finite temperature in yttrium iron garnet using a tight-binding model with nearest-neighbor exchange interaction. The spin reduction due to thermal magnon excitation is taken into account via the mean field approximation to the local spin and is found to be different at two sets of iron atoms. The resulting temperature dependence of the spin wave gap shows good agreement with experiment. We find that only two magnon modes are relevant to the ferromagnetic resonance.

  11. Tight-binding calculation of radiation loss in photonic crystal CROW.

    PubMed

    Ma, Jing; Martínez, Luis Javier; Fan, Shanhui; Povinelli, Michelle L

    2013-01-28

    The tight binding approximation (TBA) is used to relate the intrinsic, radiation loss of a coupled resonator optical waveguide (CROW) to that of a single constituent resonator within a light cone picture. We verify the validity of the TBA via direct, full-field simulation of CROWs based on the L2 photonic crystal cavity. The TBA predicts that the quality factor of the CROW increases with that of the isolated cavity. Moreover, our results provide a method to design CROWs with low intrinsic loss across the entire waveguide band.

  12. OLIFE: Tight Binding Code for Transmission Coefficient Calculation

    NASA Astrophysics Data System (ADS)

    Mijbil, Zainelabideen Yousif

    2018-05-01

    A new and human friendly transport calculation code has been developed. It requires a simple tight binding Hamiltonian as the only input file and uses a convenient graphical user interface to control calculations. The effect of magnetic field on junction has also been included. Furthermore the transmission coefficient can be calculated between any two points on the scatterer which ensures high flexibility to check the system. Therefore Olife can highly be recommended as an essential tool for pretesting studying and teaching electron transport in molecular devices that saves a lot of time and effort.

  13. Electronic Structure of Alpha-Quartz and the Influence of Some Local Disorder: A Tight Binding Study,

    DTIC Science & Technology

    1977-01-01

    An s extended summary of the theoretical and ex- perimental work on Si02 is to be found in that paper. The tight-binding basis con- sists of the four... theoretical and experimental works contained therein. 4. B. Fischer, R. A. Pollak, T. H. Distefano and W. D. Grobman, "Electronic Structure of SiO 2, SixGe 1 x...and GeO 2 from Photoemission Spectroscopy," Phys. Rev. BI5, 3193 (1977), and references to earlier works therein. 5. J. H. Scofield , "Hartree-Slater

  14. Electron doping effects on the electrical conductivity of zigzag carbon nanotubes and corresponding unzipped armchair graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Mousavi, Hamze; Jalilvand, Samira; Kurdestany, Jamshid Moradi; Grabowski, Marek

    2017-10-01

    The Kubo formula is used to extract the electrical conductivity (EC) of different diameters of doped zigzag carbon nanotubes and their corresponding unzipped armchair graphene nanoribbons, as a function of temperature and chemical potential, within the tight-binding Hamiltonian model and Green's functions approach. The results reveal more sensitivity to temperature for semiconducting systems in addition to a decrease in EC of all systems with increasing cross-sections.

  15. Ti(IV) and the Siderophore Desferrioxamine B: A Tight Complex Has Biological and Environmental Implications.

    PubMed

    Jones, Kayleigh E; Batchler, Kathleen L; Zalouk, Célia; Valentine, Ann M

    2017-02-06

    The siderophore desferrioxamine B (DFOB) binds Ti(IV) tightly and precludes its hydrolytic precipitation under biologically and environmentally relevant conditions. This interaction of DFOB with Ti(IV) is investigated by using spectro-potentiometric and spectro-photometric titrations, mass spectrometry, isothermal titration calorimetry (ITC), and computational modeling. The data from pH 2-10 suggest two one-proton equilibria among three species, with one species predominating below pH 3.5, a second from pH 3.5 to 8, and a third above pH 8. The latter species is prone to slow hydrolytic precipitation. Electrospray mass spectrometry allowed the detection of [Ti(IV) (HDFOB)] 2+ and [Ti(DFOB)] + ; these species were assigned as the pH < 3.5 and the 3.5 < pH < 8 species, respectively. The stability constant for Ti(IV)-DFOB was determined by using UV/vis-monitored competition with ethylenediaminetetraacetic acid (EDTA). Taking into consideration the available binding constant of Ti(IV) and EDTA, the data reveal values of log β 111 = 41.7, log β 110 = 38.1, and log β 11-1 = 30.1. The former value was supported by ITC, with the transfer of Ti(IV) from EDTA to DFOB determined to be both enthalpically and entropically favorable. Computational methods yielded a model of Ti-DFOB. The physiological and environmental implications of this tight interaction and the potential role of DFOB in solubilizing Ti(IV) are discussed.

  16. Electrostatic Interactions in the Binding Pathway of a Transient Protein Complex Studied by NMR and Isothermal Titration Calorimetry*

    PubMed Central

    Meneses, Erick; Mittermaier, Anthony

    2014-01-01

    Much of our knowledge of protein binding pathways is derived from extremely stable complexes that interact very tightly, with lifetimes of hours to days. Much less is known about weaker interactions and transient complexes because these are challenging to characterize experimentally. Nevertheless, these types of interactions are ubiquitous in living systems. The combination of NMR relaxation dispersion Carr–Purcell–Meiboom–Gill (CPMG) experiments and isothermal titration calorimetry allows the quantification of rapid binding kinetics for complexes with submillisecond lifetimes that are difficult to study using conventional techniques. We have used this approach to investigate the binding pathway of the Src homology 3 (SH3) domain from the Fyn tyrosine kinase, which forms complexes with peptide targets whose lifetimes are on the order of about a millisecond. Long range electrostatic interactions have been shown to play a critical role in the binding pathways of tightly binding complexes. The role of electrostatics in the binding pathways of transient complexes is less well understood. Similarly to previously studied tight complexes, we find that SH3 domain association rates are enhanced by long range electrostatics, whereas short range interactions are formed late in the docking process. However, the extent of electrostatic association rate enhancement is several orders of magnitudes less, whereas the electrostatic-free basal association rate is significantly greater. Thus, the SH3 domain is far less reliant on electrostatic enhancement to achieve rapid association kinetics than are previously studied systems. This suggests that there may be overall differences in the role played by electrostatics in the binding pathways of extremely stable versus transient complexes. PMID:25122758

  17. Rubisco Activity: Effects of Drought Stress

    PubMed Central

    PARRY, MARTIN A. J.; ANDRALOJC, P. JOHN; KHAN, SHAHNAZ; LEA, PETER J.; KEYS, ALFRED J.

    2002-01-01

    Ribulose‐1,5‐bisphosphate carboxylase/oxygenase (Rubisco) activity is modulated in vivo either by reaction with CO2 and Mg2+ to carbamylate a lysine residue in the catalytic site, or by the binding of inhibitors within the catalytic site. Binding of inhibitors blocks either activity or the carbamylation of the lysine residue that is essential for activity. At night, in many species, 2‐carboxyarabinitol‐1‐phosphate (CA1P) is formed which binds tightly to Rubisco, inhibiting catalytic activity. Recent work has shown that tight‐binding inhibitors can also decrease Rubisco activity in the light and contribute to the regulation of Rubisco activity. Here we determine the influence that such inhibitors of Rubisco exert on catalytic activity during drought stress. In tobacco plants, ‘total Rubisco activity’, i.e. the activity following pre‐incubation with CO2 and Mg2+, was positively correlated with leaf relative water content. However, ‘total Rubisco activity’ in extracts from leaves with low water potential increased markedly when tightly bound inhibitors were removed, thus increasing the number of catalytic sites available. This suggests that in tobacco the decrease of Rubisco activity under drought stress is not primarily the result of changes in activation by CO2 and Mg2+ but due rather to the presence of tight‐binding inhibitors. The amounts of inhibitor present in leaves of droughted tobacco based on the decrease in Rubisco activity per mg soluble protein were usually much greater than the amounts of the known inhibitors (CA1P and ‘daytime inhibitor’) that can be recovered in acid extracts. Alternative explanations for the difference between maximal and total activities are discussed. PMID:12102509

  18. Fibrinogen and fibrin.

    PubMed

    Weisel, John W

    2005-01-01

    Fibrinogen is a large, complex, fibrous glycoprotein with three pairs of polypeptide chains linked together by 29 disulfide bonds. It is 45 nm in length, with globular domains at each end and in the middle connected by alpha-helical coiled-coil rods. Both strongly and weakly bound calcium ions are important for maintenance of fibrinogen's structure and functions. The fibrinopeptides, which are in the central region, are cleaved by thrombin to convert soluble fibrinogen to insoluble fibrin polymer, via intermolecular interactions of the "knobs" exposed by fibrinopeptide removal with "holes" always exposed at the ends of the molecules. Fibrin monomers polymerize via these specific and tightly controlled binding interactions to make half-staggered oligomers that lengthen into protofibrils. The protofibrils aggregate laterally to make fibers, which then branch to yield a three-dimensional network-the fibrin clot-essential for hemostasis. X-ray crystallographic structures of portions of fibrinogen have provided some details on how these interactions occur. Finally, the transglutaminase, Factor XIIIa, covalently binds specific glutamine residues in one fibrin molecule to lysine residues in another via isopeptide bonds, stabilizing the clot against mechanical, chemical, and proteolytic insults. The gene regulation of fibrinogen synthesis and its assembly into multichain complexes proceed via a series of well-defined steps. Alternate splicing of two of the chains yields common variant molecular isoforms. The mechanical properties of clots, which can be quite variable, are essential to fibrin's functions in hemostasis and wound healing. The fibrinolytic system, with the zymogen plasminogen binding to fibrin together with tissue-type plasminogen activator to promote activation to the active enzyme plasmin, results in digestion of fibrin at specific lysine residues. Fibrin(ogen) also specifically binds a variety of other proteins, including fibronectin, albumin, thrombospondin, von Willebrand factor, fibulin, fibroblast growth factor-2, vascular endothelial growth factor, and interleukin-1. Studies of naturally occurring dysfibrinogenemias and variant molecules have increased our understanding of fibrinogen's functions. Fibrinogen binds to activated alphaIIbbeta3 integrin on the platelet surface, forming bridges responsible for platelet aggregation in hemostasis, and also has important adhesive and inflammatory functions through specific interactions with other cells. Fibrinogen-like domains originated early in evolution, and it is likely that their specific and tightly controlled intermolecular interactions are involved in other aspects of cellular function and developmental biology.

  19. Identification of protein-ligand binding sites by the level-set variational implicit-solvent approach.

    PubMed

    Guo, Zuojun; Li, Bo; Cheng, Li-Tien; Zhou, Shenggao; McCammon, J Andrew; Che, Jianwei

    2015-02-10

    Protein–ligand binding is a key biological process at the molecular level. The identification and characterization of small-molecule binding sites on therapeutically relevant proteins have tremendous implications for target evaluation and rational drug design. In this work, we used the recently developed level-set variational implicit-solvent model (VISM) with the Coulomb field approximation (CFA) to locate and characterize potential protein–small-molecule binding sites. We applied our method to a data set of 515 protein–ligand complexes and found that 96.9% of the cocrystallized ligands bind to the VISM-CFA-identified pockets and that 71.8% of the identified pockets are occupied by cocrystallized ligands. For 228 tight-binding protein–ligand complexes (i.e, complexes with experimental pKd values larger than 6), 99.1% of the cocrystallized ligands are in the VISM-CFA-identified pockets. In addition, it was found that the ligand binding orientations are consistent with the hydrophilic and hydrophobic descriptions provided by VISM. Quantitative characterization of binding pockets with topological and physicochemical parameters was used to assess the “ligandability” of the pockets. The results illustrate the key interactions between ligands and receptors and can be very informative for rational drug design.

  20. The role of cytosine methylation on charge transport through a DNA strand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu; Govind, Niranjan, E-mail: niri.govind@pnnl.gov

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance throughmore » the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.« less

  1. The role of cytosine methylation on charge transport through a DNA strand

    NASA Astrophysics Data System (ADS)

    Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

    2015-09-01

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  2. Structural analysis of a class III preQ1 riboswitch reveals an aptamer distant from a ribosome-binding site regulated by fast dynamics

    PubMed Central

    Liberman, Joseph A.; Suddala, Krishna C.; Aytenfisu, Asaminew; Chan, Dalen; Belashov, Ivan A.; Salim, Mohammad; Mathews, David H.; Spitale, Robert C.; Walter, Nils G.; Wedekind, Joseph E.

    2015-01-01

    PreQ1-III riboswitches are newly identified RNA elements that control bacterial genes in response to preQ1 (7-aminomethyl-7-deazaguanine), a precursor to the essential hypermodified tRNA base queuosine. Although numerous riboswitches fold as H-type or HLout-type pseudoknots that integrate ligand-binding and regulatory sequences within a single folded domain, the preQ1-III riboswitch aptamer forms a HLout-type pseudoknot that does not appear to incorporate its ribosome-binding site (RBS). To understand how this unusual organization confers function, we determined the crystal structure of the class III preQ1 riboswitch from Faecalibacterium prausnitzii at 2.75 Å resolution. PreQ1 binds tightly (KD,app 6.5 ± 0.5 nM) between helices P1 and P2 of a three-way helical junction wherein the third helix, P4, projects orthogonally from the ligand-binding pocket, exposing its stem-loop to base pair with the 3′ RBS. Biochemical analysis, computational modeling, and single-molecule FRET imaging demonstrated that preQ1 enhances P4 reorientation toward P1–P2, promoting a partially nested, H-type pseudoknot in which the RBS undergoes rapid docking (kdock ∼0.6 s−1) and undocking (kundock ∼1.1 s−1). Discovery of such dynamic conformational switching provides insight into how a riboswitch with bipartite architecture uses dynamics to modulate expression platform accessibility, thus expanding the known repertoire of gene control strategies used by regulatory RNAs. PMID:26106162

  3. Binding of serum response factor to cystic fibrosis transmembrane conductance regulator CArG-like elements, as a new potential CFTR transcriptional regulation pathway

    PubMed Central

    René, Céline; Taulan, Magali; Iral, Florence; Doudement, Julien; L'Honoré, Aurore; Gerbon, Catherine; Demaille, Jacques; Claustres, Mireille; Romey, Marie-Catherine

    2005-01-01

    CFTR expression is tightly controlled by a complex network of ubiquitous and tissue-specific cis-elements and trans-factors. To better understand mechanisms that regulate transcription of CFTR, we examined transcription factors that specifically bind a CFTR CArG-like motif we have previously shown to modulate CFTR expression. Gel mobility shift assays and chromatin immunoprecipitation analyses demonstrated the CFTR CArG-like motif binds serum response factor both in vitro and in vivo. Transient co-transfections with various SRF expression vector, including dominant-negative forms and small interfering RNA, demonstrated that SRF significantly increases CFTR transcriptional activity in bronchial epithelial cells. Mutagenesis studies suggested that in addition to SRF other co-factors, such as Yin Yang 1 (YY1) previously shown to bind the CFTR promoter, are potentially involved in the CFTR regulation. Here, we show that functional interplay between SRF and YY1 might provide interesting perspectives to further characterize the underlying molecular mechanism of the basal CFTR transcriptional activity. Furthermore, the identification of multiple CArG binding sites in highly conserved CFTR untranslated regions, which form specific SRF complexes, provides direct evidence for a considerable role of SRF in the CFTR transcriptional regulation into specialized epithelial lung cells. PMID:16170155

  4. Identification of Tight-Binding Plasmepsin II and Falcipain 2 Inhibitors in Aqueous Extracts of Marine Invertebrates by the Combination of Enzymatic and Interaction-Based Assays

    PubMed Central

    Salas-Sarduy, Emir; Guerra, Yasel; Covaleda Cortés, Giovanni; Avilés, Francesc Xavier; Chávez Planes, María A.

    2017-01-01

    Natural products from marine origin constitute a very promising and underexplored source of interesting compounds for modern biotechnological and pharmaceutical industries. However, their evaluation is quite challenging and requires specifically designed assays to reliably identify the compounds of interest in a highly heterogeneous and interfering context. In the present study, we describe a general strategy for the confident identification of tight-binding protease inhibitors in the aqueous extracts of 62 Cuban marine invertebrates, using Plasmodium falciparum hemoglobinases Plasmepsin II and Falcipain 2 as model enzymes. To this end, we first developed a screening strategy that combined enzymatic with interaction-based assays and then validated screening conditions using five reference extracts. Interferences were evaluated and minimized. The results from the massive screening of such extracts, the validation of several hits by a variety of interaction-based assays and the purification and functional characterization of PhPI, a multifunctional and reversible tight-binding inhibitor for Plasmepsin II and Falcipain 2 from the gorgonian Plexaura homomalla, are presented. PMID:28430158

  5. Analytical excited state forces for the time-dependent density-functional tight-binding method.

    PubMed

    Heringer, D; Niehaus, T A; Wanko, M; Frauenheim, Th

    2007-12-01

    An analytical formulation for the geometrical derivatives of excitation energies within the time-dependent density-functional tight-binding (TD-DFTB) method is presented. The derivation is based on the auxiliary functional approach proposed in [Furche and Ahlrichs, J Chem Phys 2002, 117, 7433]. To validate the quality of the potential energy surfaces provided by the method, adiabatic excitation energies, excited state geometries, and harmonic vibrational frequencies were calculated for a test set of molecules in excited states of different symmetry and multiplicity. According to the results, the TD-DFTB scheme surpasses the performance of configuration interaction singles and the random phase approximation but has a lower quality than ab initio time-dependent density-functional theory. As a consequence of the special form of the approximations made in TD-DFTB, the scaling exponent of the method can be reduced to three, similar to the ground state. The low scaling prefactor and the satisfactory accuracy of the method makes TD-DFTB especially suitable for molecular dynamics simulations of dozens of atoms as well as for the computation of luminescence spectra of systems containing hundreds of atoms. (c) 2007 Wiley Periodicals, Inc.

  6. Self-Consistent Optimization of Excited States within Density-Functional Tight-Binding.

    PubMed

    Kowalczyk, Tim; Le, Khoa; Irle, Stephan

    2016-01-12

    We present an implementation of energies and gradients for the ΔDFTB method, an analogue of Δ-self-consistent-field density functional theory (ΔSCF) within density-functional tight-binding, for the lowest singlet excited state of closed-shell molecules. Benchmarks of ΔDFTB excitation energies, optimized geometries, Stokes shifts, and vibrational frequencies reveal that ΔDFTB provides a qualitatively correct description of changes in molecular geometries and vibrational frequencies due to excited-state relaxation. The accuracy of ΔDFTB Stokes shifts is comparable to that of ΔSCF-DFT, and ΔDFTB performs similarly to ΔSCF with the PBE functional for vertical excitation energies of larger chromophores where the need for efficient excited-state methods is most urgent. We provide some justification for the use of an excited-state reference density in the DFTB expansion of the electronic energy and demonstrate that ΔDFTB preserves many of the properties of its parent ΔSCF approach. This implementation fills an important gap in the extended framework of DFTB, where access to excited states has been limited to the time-dependent linear-response approach, and affords access to rapid exploration of a valuable class of excited-state potential energy surfaces.

  7. The early mature part of bacterial twin-arginine translocation (Tat) precursor proteins contributes to TatBC receptor binding.

    PubMed

    Ulfig, Agnes; Freudl, Roland

    2018-05-11

    The twin-arginine translocation (Tat) pathway transports folded proteins across bacterial membranes. Tat precursor proteins possess a conserved twin-arginine (RR) motif in their signal peptides that is involved in the binding of the proteins to the membrane-associated TatBC receptor complex. In addition, the hydrophobic region in the Tat signal peptides also contributes to TatBC binding, but whether regions beyond the signal-peptide cleavage site are involved in this process is unknown. Here, we analyzed the contribution of the early mature protein part of the Escherichia coli trimethylamine N -oxide reductase (TorA) to productive TatBC receptor binding. We identified substitutions in the 30 amino acids immediately following the TorA signal peptide (30aa-region) that restored export of a transport-defective TorA[KQ]-30aa-MalE precursor, in which the RR residues had been replaced by a lysine-glutamine pair. Some of these substitutions increased the hydrophobicity of the N-terminal part of the 30aa-region and thereby likely enhanced hydrophobic substrate-receptor interactions within the hydrophobic TatBC substrate-binding cavity. Another class of substitutions increased the positive net charge of the region's C-terminal part, presumably leading to strengthened electrostatic interactions between the mature substrate part and the cytoplasmic TatBC regions. Furthermore, we identified substitutions in the C-terminal domains of TatB following the transmembrane segment that restored transport of various transport-defective TorA-MalE derivatives. Some of these substitutions most likely affected the orientation or conformation of the flexible, carboxy-proximal helices of TatB. Therefore, we propose that a tight accommodation of the folded mature region by TatB contributes to productive binding of Tat substrates to TatBC. © 2018 Ulfig and Freudl.

  8. Positively charged mini-protein Zbasic2 as a highly efficient silica binding module: opportunities for enzyme immobilization on unmodified silica supports.

    PubMed

    Bolivar, Juan M; Nidetzky, Bernd

    2012-07-03

    Silica is a highly attractive support material for protein immobilization in a wide range of biotechnological and biomedical-analytical applications. Without suitable derivatization, however, the silica surface is not generally usable for attachment of proteins. We show here that Z(basic2) (a three α-helix bundle mini-protein of 7 kDa size that exposes clustered positive charges from multiple arginine residues on one side) functions as highly efficient silica binding module (SBM), allowing chimeras of target protein with SBM to become very tightly attached to underivatized glass at physiological pH conditions. We used two enzymes, d-amino acid oxidase and sucrose phosphorylase, to demonstrate direct immobilization of Z(basic2) protein from complex biological samples with extremely high selectivity. Immobilized enzymes displayed full biological activity, suggesting that their binding to the glass surface had occurred in a preferred orientation via the SBM. We also show that charge complementarity was the main principle of affinity between SBM and glass surface, and Z(basic2) proteins were bound in a very strong, yet fully reversible manner, presumably through multipoint noncovalent interactions. Z(basic2) proteins were immobilized on porous glass in a loading of 30 mg protein/g support or higher, showing that attachment via the SBM combines excellent binding selectivity with a technically useful binding capacity. Therefore, Z(basic2) and silica constitute a fully orthogonal pair of binding module and insoluble support for oriented protein immobilization, and this opens up new opportunities for the application of silica-based materials in the development of supported heterogeneous biocatalysts.

  9. III-Nitride, SiC and Diamond Materials for Electronic Devices. Symposium Held April 8-12 1996, San Francisco, California, U.S.A. Volume 423.

    DTIC Science & Technology

    1996-12-01

    gallium, nitrogen and gallium nitride structures. Thus it can be shown to be transferable and efficient for predictive molecular -dynamic simulations on...potentials and forces for the molecular dynamics simulations are derived by means of a density-functional based nonorthogonal tight-binding (DF-TB) scheme...LDA). Molecular -dynamics simulations for determining the different reconstructions of the SiC surface use the slab method (two-dimensional periodic

  10. Potential ligand-binding residues in rat olfactory receptors identified by correlated mutation analysis

    NASA Technical Reports Server (NTRS)

    Singer, M. S.; Oliveira, L.; Vriend, G.; Shepherd, G. M.

    1995-01-01

    A family of G-protein-coupled receptors is believed to mediate the recognition of odor molecules. In order to identify potential ligand-binding residues, we have applied correlated mutation analysis to receptor sequences from the rat. This method identifies pairs of sequence positions where residues remain conserved or mutate in tandem, thereby suggesting structural or functional importance. The analysis supported molecular modeling studies in suggesting several residues in positions that were consistent with ligand-binding function. Two of these positions, dominated by histidine residues, may play important roles in ligand binding and could confer broad specificity to mammalian odor receptors. The presence of positive (overdominant) selection at some of the identified positions provides additional evidence for roles in ligand binding. Higher-order groups of correlated residues were also observed. Each group may interact with an individual ligand determinant, and combinations of these groups may provide a multi-dimensional mechanism for receptor diversity.

  11. A small cellulose binding domain protein (CBD1) is highly variable in the nonbinding amino terminus

    USDA-ARS?s Scientific Manuscript database

    The small cellulose binding domain protein CBD1 is tightly bound to the cellulosic cell wall of the plant pathogenic stramenophile Phytophthora infestans. Transgene expression of the protein in plants has also demonstrated binding to plant cell walls. A study was undertaken using 47 isolates of P. ...

  12. Rationalizing Tight Ligand Binding through Cooperative Interaction Networks

    PubMed Central

    2011-01-01

    Small modifications of the molecular structure of a ligand sometimes cause strong gains in binding affinity to a protein target, rendering a weakly active chemical series suddenly attractive for further optimization. Our goal in this study is to better rationalize and predict the occurrence of such interaction hot-spots in receptor binding sites. To this end, we introduce two new concepts into the computational description of molecular recognition. First, we take a broader view of noncovalent interactions and describe protein–ligand binding with a comprehensive set of favorable and unfavorable contact types, including for example halogen bonding and orthogonal multipolar interactions. Second, we go beyond the commonly used pairwise additive treatment of atomic interactions and use a small world network approach to describe how interactions are modulated by their environment. This approach allows us to capture local cooperativity effects and considerably improves the performance of a newly derived empirical scoring function, ScorpionScore. More importantly, however, we demonstrate how an intuitive visualization of key intermolecular interactions, interaction networks, and binding hot-spots supports the identification and rationalization of tight ligand binding. PMID:22087588

  13. Like-Charge Guanidinium Pairing between Ligand and Receptor: An Unusual Interaction for Drug Discovery and Design?

    PubMed

    Yang, Yang; Xu, Zhijian; Zhang, Zhengyan; Yang, Zhuo; Liu, Yingtao; Wang, Jinan; Cai, Tingting; Li, Shujin; Chen, Kaixian; Shi, Jiye; Zhu, Weiliang

    2015-09-10

    A database survey in this study revealed for the first time that there are 227 counterintuitive like-charge guanidinium pairings (Gdm(+)-Arg pairings) between ligands and receptors in the Protein Data Bank, implying the potential guanidinium-arginine binding between guanidine-containing drugs and their target proteins. Furthermore, there are 145 guanidine-containing molecules in the DrugBank, showing the prevalence of guanidinium groups in drugs. It has also been reported that the introduction of a guanidinium group forming Gdm(+)-Arg pairing improved the potency of the drug by more than 8-fold in a typical case. On the basis of the survey, six ligand-protein complexes with typical Gdm(+)-Arg pairings were chosen for QM/MM calculations. The calculations at the B97-D/6-311++g(d,p) level revealed that the interaction could be as strong as -1.0 to -2.5 kcal/mol in DMSO and water, comparable to common intermolecular interactions. The calculations also unveiled that the Gdm(+)-Arg pairing interactions change from repulsive to attractive with the increase of dielectric constant, suggesting that the dielectric constant has a general stabilization effect on the Gdm(+)-Arg pairing. This study suggested that the like-charge guanidinium pairing interaction could be used not only for tuning the physical and chemical properties of drug leads but also for improving ligand binding affinity.

  14. First Experimental Realization of the Dirac Oscillator

    NASA Astrophysics Data System (ADS)

    Franco-Villafañe, J. A.; Sadurní, E.; Barkhofen, S.; Kuhl, U.; Mortessagne, F.; Seligman, T. H.

    2013-10-01

    We present the first experimental microwave realization of the one-dimensional Dirac oscillator, a paradigm in exactly solvable relativistic systems. The experiment relies on a relation of the Dirac oscillator to a corresponding tight-binding system. This tight-binding system is implemented as a microwave system by a chain of coupled dielectric disks, where the coupling is evanescent and can be adjusted appropriately. The resonances of the finite microwave system yield the spectrum of the one-dimensional Dirac oscillator with and without a mass term. The flexibility of the experimental setup allows the implementation of other one-dimensional Dirac-type equations.

  15. A tight binding model study of tunneling conductance spectra of spin and orbitally ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Panda, Saswati; Sahoo, D. D.; Rout, G. C.

    2018-04-01

    We report here a tight binding model for colossal magnetoresistive (CMR) manganites to study the pseudo gap (PG) behavior near Fermi level. In the Kubo-Ohata type DE model, we consider first and second nearest neighbor interactions for transverse spin fluctuations in core band and hopping integrals in conduction band, in the presence of static band Jahn-Teller distortion. The model Hamiltonian is solved using Zubarev's Green's function technique. The electron density of states (DOS) is found out from the Green's functions. We observe clear PG near Fermi level in the electron DOS.

  16. DFTB+ and lanthanides

    NASA Astrophysics Data System (ADS)

    Hourahine, B.; Aradi, B.; Frauenheim, T.

    2010-07-01

    DFTB+ is a recent general purpose implementation of density-functional based tight binding. One of the early motivators to develop this code was to investigate lanthanide impurities in nitride semiconductors, leading to a series of successful studies into structure and electrical properties of these systems. Here we describe our general framework to treat the physical effects needed for these problematic impurities within a tight-binding formalism, additionally discussing forces and stresses in DFTB. We also present an approach to evaluate the general case of Slater-Koster transforms and all of their derivatives in Cartesian coordinates. These developments are illustrated by simulating isolated Gd impurities in GaN.

  17. Objective Molecular Dynamics with Self-consistent Charge Density Functional Tight-Binding (SCC-DFTB) Method

    NASA Astrophysics Data System (ADS)

    Dumitrica, Traian; Hourahine, Ben; Aradi, Balint; Frauenheim, Thomas

    We discus the coupling of the objective boundary conditions into the SCC density functional-based tight binding code DFTB+. The implementation is enabled by a generalization to the helical case of the classical Ewald method, specifically by Ewald-like formulas that do not rely on a unit cell with translational symmetry. The robustness of the method in addressing complex hetero-nuclear nano- and bio-fibrous systems is demonstrated with illustrative simulations on a helical boron nitride nanotube, a screw dislocated zinc oxide nanowire, and an ideal double-strand DNA. Work supported by NSF CMMI 1332228.

  18. The tight binding model study of the role of band filling on the charge gap in graphene-on-substrate in paramagnetic state

    NASA Astrophysics Data System (ADS)

    Panda, Rudrashish; Sahu, Sivabrata; Rout, G. C.

    2017-05-01

    We communicate here a tight binding theoretical model study of the band filling effect on the charge gap in graphene-on-substrate. The Hamiltonian consists of nearest neighbor electron hopping and substrate induced gap. Besides this the Coulomb interaction is considered here within mean-field approximation in the paramagnetic limit. The electron occupancies at two sublattices are calculated by Green's function technique and are solved self consistently. Finally the charge gap i.e. Δ ¯=U [ < na > -< nb > ] is calculated and computed numerically. The results are reported.

  19. Scattering matrix of arbitrary tight-binding Hamiltonians

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ramírez, C., E-mail: carlos@ciencias.unam.mx; Medina-Amayo, L.A.

    2017-03-15

    A novel efficient method to calculate the scattering matrix (SM) of arbitrary tight-binding Hamiltonians is proposed, including cases with multiterminal structures. In particular, the SM of two kinds of fundamental structures is given, which can be used to obtain the SM of bigger systems iteratively. Also, a procedure to obtain the SM of layer-composed periodic leads is described. This method allows renormalization approaches, which permits computations over macroscopic length systems without introducing additional approximations. Finally, the transmission coefficient of a ring-shaped multiterminal system and the transmission function of a square-lattice nanoribbon with a reduced width region are calculated.

  20. Tight-binding model for borophene and borophane

    NASA Astrophysics Data System (ADS)

    Nakhaee, M.; Ketabi, S. A.; Peeters, F. M.

    2018-03-01

    Starting from the simplified linear combination of atomic orbitals method in combination with first-principles calculations, we construct a tight-binding (TB) model in the two-centre approximation for borophene and hydrogenated borophene (borophane). The Slater and Koster approach is applied to calculate the TB Hamiltonian of these systems. We obtain expressions for the Hamiltonian and overlap matrix elements between different orbitals for the different atoms and present the SK coefficients in a nonorthogonal basis set. An anisotropic Dirac cone is found in the band structure of borophane. We derive a Dirac low-energy Hamiltonian and compare the Fermi velocities with that of graphene.

  1. S-adenosylmethionine directly inhibits binding of 30S ribosomal subunits to the SMK box translational riboswitch RNA

    PubMed Central

    Fuchs, Ryan T.; Grundy, Frank J.; Henkin, Tina M.

    2007-01-01

    The SMK box is a conserved riboswitch motif found in the 5′ untranslated region of metK genes [encoding S-adenosylmethionine (SAM) synthetase] in lactic acid bacteria, including Enterococcus, Streptococcus, and Lactococcus sp. Previous studies showed that this RNA element binds SAM in vitro, and SAM binding causes a structural rearrangement that sequesters the Shine–Dalgarno (SD) sequence by pairing with an anti-SD (ASD) element. A model was proposed in which SAM binding inhibits metK translation by preventing binding of the ribosome to the SD region of the mRNA. In the current work, the addition of SAM was shown to inhibit binding of 30S ribosomal subunits to SMK box RNA; in contrast, the addition of S-adenosylhomocysteine (SAH) had no effect. A mutant RNA, which has a disrupted SD-ASD pairing, was defective in SAM binding and showed no reduction of ribosome binding in the presence of SAM, whereas a compensatory mutation that restored SD-ASD pairing restored the response to SAM. Primer extension inhibition assays provided further evidence for SD-ASD pairing in the presence of SAM. These results strongly support the model that SMK box translational repression operates through occlusion of the ribosome binding site and that SAM binding requires the SD-ASD pairing. PMID:17360376

  2. Disposable and removable nucleic acid extraction and purification cartridges for automated flow-through systems

    DOEpatents

    Regan, John Frederick

    2014-09-09

    Removable cartridges are used on automated flow-through systems for the purpose of extracting and purifying genetic material from complex matrices. Different types of cartridges are paired with specific automated protocols to concentrate, extract, and purifying pathogenic or human genetic material. Their flow-through nature allows large quantities sample to be processed. Matrices may be filtered using size exclusion and/or affinity filters to concentrate the pathogen of interest. Lysed material is ultimately passed through a filter to remove the insoluble material before the soluble genetic material is delivered past a silica-like membrane that binds the genetic material, where it is washed, dried, and eluted. Cartridges are inserted into the housing areas of flow-through automated instruments, which are equipped with sensors to ensure proper placement and usage of the cartridges. Properly inserted cartridges create fluid- and air-tight seals with the flow lines of an automated instrument.

  3. Temperature and magnetic field effects on electron transport through DNA molecules in a two-dimensional four-channel system.

    PubMed

    Joe, Yong S; Lee, Sun H; Hedin, Eric R; Kim, Young D

    2013-06-01

    We utilize a two-dimensional four-channel DNA model, with a tight-binding (TB) Hamiltonian, and investigate the temperature and the magnetic field dependence of the transport behavior of a short DNA molecule. Random variation of the hopping integrals due to the thermal structural disorder, which partially destroy phase coherence of electrons and reduce quantum interference, leads to a reduction of the localization length and causes suppressed overall transmission. We also incorporate a variation of magnetic field flux density into the hopping integrals as a phase factor and observe Aharonov-Bohm (AB) oscillations in the transmission. It is shown that for non-zero magnetic flux, the transmission zero leaves the real-energy axis and moves up into the complex-energy plane. We also point out that the hydrogen bonds between the base pair with flux variations play a role to determine the periodicity of AB oscillations in the transmission.

  4. Specific interaction of mutant p53 with regions of matrix attachment region DNA elements (MARs) with a high potential for base-unpairing

    PubMed Central

    Will, Katrin; Warnecke, Gabriele; Wiesmüller, Lisa; Deppert, Wolfgang

    1998-01-01

    Mutant, but not wild-type p53 binds with high affinity to a variety of MAR-DNA elements (MARs), suggesting that MAR-binding of mutant p53 relates to the dominant-oncogenic activities proposed for mutant p53. MARs recognized by mutant p53 share AT richness and contain variations of an AATATATTT “DNA-unwinding motif,” which enhances the structural dynamics of chromatin and promotes regional DNA base-unpairing. Mutant p53 specifically interacted with MAR-derived oligonucleotides carrying such unwinding motifs, catalyzing DNA strand separation when this motif was located within a structurally labile sequence environment. Addition of GC-clamps to the respective MAR-oligonucleotides or introducing mutations into the unwinding motif strongly reduced DNA strand separation, but supported the formation of tight complexes between mutant p53 and such oligonucleotides. We conclude that the specific interaction of mutant p53 with regions of MAR-DNA with a high potential for base-unpairing provides the basis for the high-affinity binding of mutant p53 to MAR-DNA. PMID:9811860

  5. Molecular Bases of cyclodextrin Adapter Interactions with Engineered Protein Nanopores

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, A.; Mikhailova, E; Cheley, S

    2010-01-01

    Engineered protein pores have several potential applications in biotechnology: as sensor elements in stochastic detection and ultrarapid DNA sequencing, as nanoreactors to observe single-molecule chemistry, and in the construction of nano- and micro-devices. One important class of pores contains molecular adapters, which provide internal binding sites for small molecules. Mutants of the {alpha}-hemolysin ({alpha}HL) pore that bind the adapter {beta}-cyclodextrin ({beta}CD) {approx}10{sup 4} times more tightly than the wild type have been obtained. We now use single-channel electrical recording, protein engineering including unnatural amino acid mutagenesis, and high-resolution x-ray crystallography to provide definitive structural information on these engineered protein nanoporesmore » in unparalleled detail.« less

  6. On the binding of indeno[1,2-c]isoquinolines in the DNA-topoisomerase I cleavage complex.

    PubMed

    Xiao, Xiangshu; Antony, Smitha; Pommier, Yves; Cushman, Mark

    2005-05-05

    An ab initio quantum mechanics calculation is reported which predicts the orientation of indenoisoquinoline 4 in the ternary cleavage complex formed from DNA and topoisomerase I (top1). The results of this calculation are consistent with the hypothetical structures previously proposed for the indenoisoquinoline-DNA-top1 ternary complexes based on molecular modeling, the crystal structure of a recently reported ternary complex, and the biological results obtained with a pair of diaminoalkyl-substituted indenoisoquinoline enantiomers. The results of these studies indicate that the pi-pi stacking interactions between the indenoisoquinolines and the neighboring DNA base pairs play a major role in determining binding orientation. The calculation of the electrostatic potential surface maps of the indenoisoquinolines and the adjacent DNA base pairs shows electrostatic complementarity in the observed binding orientation, leading to the conclusion that electrostatic attraction between the intercalators and the base pairs in the cleavage complex plays a major stabilizing role. On the other hand, the calculation of LUMO and HOMO energies of indenoisoquinoline 13b and neighboring DNA base pairs in conjunction with NBO analysis indicates that charge transfer complex formation plays a relatively minor role in stabilizing the ternary complexes derived from indenoisoquinolines, DNA, and top1. The results of these studies are important in understanding the existing structure-activity relationships for the indenoisoquinolines as top1 inhibitors and as anticancer agents, and they will be important in the future design of indenoisoquinoline-based top1 inhibitors.

  7. Nanohashtag structures based on carbon nanotubes and molecular linkers

    NASA Astrophysics Data System (ADS)

    Frye, Connor W.; Rybolt, Thomas R.

    2018-03-01

    Molecular mechanics was used to study the noncovalent interactions between single-walled carbon nanotubes and molecular linkers. Groups of nanotubes have the tendency to form tight, parallel bundles (||||). Molecular linkers were introduced into our models to stabilize nanostructures with carbon nanotubes held in perpendicular orientations. Molecular mechanics makes it possible to estimate the strength of noncovalent interactions holding these structures together and to calculate the overall binding energy of the structures. A set of linkers were designed and built around a 1,3,5,7-cyclooctatetraene tether with two corannulene containing pincers that extend in opposite directions from the central cyclooctatetraene portion. Each pincer consists of a pairs of "arms." These molecular linkers were modified so that the "hand" portions of each pair of "arms" could close together to grab and hold two carbon nanotubes in a perpendicular arrangement. To illustrate the possibility of more complicated and open perpendicular CNTs structures, our primary goal was to create a model of a nanohashtag (#) CNT conformation that is more stable than any parallel CNT arrangements with bound linker molecules forming clumps of CNTs and linkers in non-hashtag arrangements. This goal was achieved using a molecular linker (C280H96) that utilizes van der Waals interactions to two perpendicular oriented CNTs. Hydrogen bonding was then added between linker molecules to augment the stability of the hashtag structure. In the hashtag structure with hydrogen bonding, four (5,5) CNTs of length 4.46 nm (18 rings) and four linkers (C276H92N8O8) stabilized the hashtag so that the average binding energy per pincer was 118 kcal/mol.

  8. Biochemical and structural characterization of a novel cooperative binding mode by Pit-1 with CATT repeats in the macrophage migration inhibitory factor promoter

    PubMed Central

    Agarwal, Sorabh

    2018-01-01

    Abstract Overexpression of the proinflammatory cytokine macrophage migration inhibitory factor (MIF) is linked to a number of autoimmune diseases and cancer. MIF production has been correlated to the number of CATT repeats in a microsatellite region upstream of the MIF gene. We have characterized the interaction of pituitary-specific positive transcription factor 1 (Pit-1) with a portion of the MIF promoter region flanking a microsatellite polymorphism (−794 CATT5–8). Using fluorescence anisotropy, we quantified tight complex formation between Pit-1 and an oligonucleotide consisting of eight consecutive CATT repeats (8xCATT) with an apparent Kd of 35 nM. Using competition experiments we found a 23 base pair oligonucleotide with 4xCATT repeats to be the minimum DNA sequence necessary for high affinity interaction with Pit-1. The stoichiometry of the Pit-1 DNA interaction was determined to be 2:1 and binding is cooperative in nature. We subsequently structurally characterized the complex and discovered a completely novel binding mode for Pit-1 in contrast to previously described Pit-1 complex structures. The affinity of Pit-1 for the CATT target sequence was found to be highly dependent on cooperativity. This work lays the groundwork for understanding transcriptional regulation of MIF and pursuing Pit-1 as a therapeutic target to treat MIF-mediated inflammatory disorders. PMID:29186613

  9. Role of metal ions in catalysis by HIV integrase analyzed using a quantitative PCR disintegration assay.

    PubMed

    Diamond, Tracy L; Bushman, Frederic D

    2006-01-01

    Paired metal ions have been proposed to be central to the catalytic mechanisms of RNase H nucleases, bacterial transposases, Holliday junction resolvases, retroviral integrases and many other enzymes. Here we present a sensitive assay for DNA transesterification in which catalysis by human immunodeficiency virus-type 1 (HIV-1) integrase (IN) connects two DNA strands (disintegration reaction), allowing detection using quantitative PCR (qPCR). We present evidence suggesting that the three acidic residues of the IN active site function through metal binding using metal rescue. In this method, the catalytic acidic residues were each substituted with cysteines. Mn2+ binds tightly to the sulfur atoms of the cysteine residues, but Mg2+ does not. We found that Mn2+, but not Mg2+, could rescue catalysis of each cysteine-substituted enzyme, providing evidence for functionally important metal binding by all three residues. We also used the PCR-boosted assay to show that HIV-1 IN could carry out transesterification reactions involving DNA 5' hydroxyl groups as well as 3' hydroxyls as nucleophiles. Lastly, we show that Mn2+ by itself (i.e. without enzyme) can catalyze formation of a low level of PCR-amplifiable product under extreme conditions, allowing us to estimate the rate enhancement due to the IN-protein scaffold as at least 60 million-fold.

  10. Role of metal ions in catalysis by HIV integrase analyzed using a quantitative PCR disintegration assay

    PubMed Central

    Diamond, Tracy L.; Bushman, Frederic D.

    2006-01-01

    Paired metal ions have been proposed to be central to the catalytic mechanisms of RNase H nucleases, bacterial transposases, Holliday junction resolvases, retroviral integrases and many other enzymes. Here we present a sensitive assay for DNA transesterification in which catalysis by human immunodeficiency virus-type 1 (HIV-1) integrase (IN) connects two DNA strands (disintegration reaction), allowing detection using quantitative PCR (qPCR). We present evidence suggesting that the three acidic residues of the IN active site function through metal binding using metal rescue. In this method, the catalytic acidic residues were each substituted with cysteines. Mn2+ binds tightly to the sulfur atoms of the cysteine residues, but Mg2+ does not. We found that Mn2+, but not Mg2+, could rescue catalysis of each cysteine-substituted enzyme, providing evidence for functionally important metal binding by all three residues. We also used the PCR-boosted assay to show that HIV-1 IN could carry out transesterification reactions involving DNA 5′ hydroxyl groups as well as 3′ hydroxyls as nucleophiles. Lastly, we show that Mn2+ by itself (i.e. without enzyme) can catalyze formation of a low level of PCR-amplifiable product under extreme conditions, allowing us to estimate the rate enhancement due to the IN-protein scaffold as at least 60 million-fold. PMID:17085478

  11. Evaluation of the grand-canonical partition function using expanded Wang-Landau simulations. IV. Performance of many-body force fields and tight-binding schemes for the fluid phases of silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Desgranges, Caroline; Delhommelle, Jerome

    We extend Expanded Wang-Landau (EWL) simulations beyond classical systems and develop the EWL method for systems modeled with a tight-binding Hamiltonian. We then apply the method to determine the partition function and thus all thermodynamic properties, including the Gibbs free energy and entropy, of the fluid phases of Si. We compare the results from quantum many-body (QMB) tight binding models, which explicitly calculate the overlap between the atomic orbitals of neighboring atoms, to those obtained with classical many-body (CMB) force fields, which allow to recover the tetrahedral organization in condensed phases of Si through, e.g., a repulsive 3-body term thatmore » favors the ideal tetrahedral angle. Along the vapor-liquid coexistence, between 3000 K and 6000 K, the densities for the two coexisting phases are found to vary significantly (by 5 orders of magnitude for the vapor and by up to 25% for the liquid) and to provide a stringent test of the models. Transitions from vapor to liquid are predicted to occur for chemical potentials that are 10%–15% higher for CMB models than for QMB models, and a ranking of the force fields is provided by comparing the predictions for the vapor pressure to the experimental data. QMB models also reveal the formation of a gap in the electronic density of states of the coexisting liquid at high temperatures. Subjecting Si to a nanoscopic confinement has a dramatic effect on the phase diagram with, e.g. at 6000 K, a decrease in liquid densities by about 50% for both CMB and QMB models and an increase in vapor densities between 90% (CMB) and 170% (QMB). The results presented here provide a full picture of the impact of the strategy (CMB or QMB) chosen to model many-body effects on the thermodynamic properties of the fluid phases of Si.« less

  12. Excitons in boron nitride single layer

    NASA Astrophysics Data System (ADS)

    Galvani, Thomas; Paleari, Fulvio; Miranda, Henrique P. C.; Molina-Sánchez, Alejandro; Wirtz, Ludger; Latil, Sylvain; Amara, Hakim; Ducastelle, François

    2016-09-01

    Boron nitride single layer belongs to the family of two-dimensional materials whose optical properties are currently receiving considerable attention. Strong excitonic effects have already been observed in the bulk and still stronger effects are predicted for single layers. We present here a detailed study of these properties by combining ab initio calculations and a tight-binding Wannier analysis in both real and reciprocal space. Due to the simplicity of the band structure with single valence (π ) and conduction (π*) bands the tight-binding analysis becomes quasiquantitative with only two adjustable parameters and provides tools for a detailed analysis of the exciton properties. Strong deviations from the usual hydrogenic model are evidenced. The ground-state exciton is not a genuine Frenkel exciton, but a very localized tightly bound one. The other ones are similar to those found in transition-metal dichalcogenides and, although more localized, can be described within a Wannier-Mott scheme.

  13. Tight binding simulation study on zigzag single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Sharma, Deepa; Jaggi, Neena; Gupta, Vishu

    2018-01-01

    Tight binding simulation studies using the density functional tight binding (DFTB) model have been performed on various zigzag single-walled carbon-nanotubes (SWCNTs) to investigate their electronic properties using DFTB module of the Material Studio Software version 7.0. Various combinations of different eigen-solvers and charge mixing schemes available in the DFTB Module have been tried to chalk out the electronic structure. The analytically deduced values of the bandgap of (9, 0) SWCNT were compared with the experimentally determined value reported in the literature. On comparison, it was found that the tight binding approximations tend to drastically underestimate the bandgap values. However, the combination of Anderson charge mixing method with standard eigensolver when implemented using the smart algorithm was found to produce fairly close results. These optimized model parameters were then used to determine the band structures of various zigzag SWCNTs. (9, 0) Single-walled Nanotube which is extensively being used for sensing NH3, CH4 and NO2 has been picked up as a reference material since its experimental bandgap value has been reported in the literature. It has been found to exhibit a finite energy bandgap in contrast to its expected metallic nature. The study is of utmost significance as it not only probes and validates the simulation route for predicting suitable properties of nanomaterials but also throws light on the comparative efficacy of the different approximation and rationalization quantum mechanical techniques used in simulation studies. Such simulation studies if used intelligently prove to be immensely useful to the material scientists as they not only save time and effort but also pave the way to new experiments by making valuable predictions.

  14. Thermodynamics and kinetics of Na+/K+-formate ion pairs association in polarizable water: A molecular dynamics study

    NASA Astrophysics Data System (ADS)

    Nguyen, Phuong T. M.; Nguyen, Van T.; Annapureddy, Harsha V. R.; Dang, Liem X.; Do, D. D.

    2012-12-01

    To enhance our understanding of ion specific activity in biological systems, the potential of mean force approach was utilized to study solvent effects on the interactions between two alkali cations (Na+ and K+) with a formate anion in water. A very complex free energy landscape was observed, much more so than alkali-halide ion pairs. Furthermore, a stronger binding between the Na+-formate pair was found in comparison to the K+-formate pair in water, which is in agreement with experimental and theoretical studies [1-4]. The kinetics of ion-pair inter-conversions was studied using the transition rate theory, along with a number of theoretical approaches such as the Kramers and Grote-Hynes theories. These kinetic results were used to predict solvent effects on dynamical features of ion-pair association, in which we have found that the dynamics of K+-formate pairs is faster than Na+-formate pairs.

  15. Structural and optical manipulation of colloidal Ge1-xSnx nanocrystals with experimentally synthesized sizes: Atomistic tight-binding theory

    NASA Astrophysics Data System (ADS)

    Sukkabot, Worasak

    2017-02-01

    Nontoxic, maintainable and cost-effective group IV semiconductors are gorgeous for an expansive range of electronic and optoelectronic applications, even though the presence of the indirect band gap obstructs the optical performance. However, band structures can be modified from indirect to direct band gaps by constructing the nanostructures or by alloying with tin (Sn) material. In the study presented here, I investigate the impact of ion-centred types, Sn compositions and dimensions on the electronic structures and optical properties in Ge1-xSnx diamond cubic nanocrystals of the experimentally synthesized Sn contents and diameters using the atomistic tight-binding theory (TB) in the conjunction with the configuration interaction description (CI). The analysis of the mechanism suggests that the physical properties are mainly sensitive with ion-centred types (anion (a) and cation (c)), Sn compositions and dimensions of Ge1-xSnx diamond cubic nanocrystals. The reduction of optical band gaps is reported with the increasing diameters and Sn alloying contents. The visible spectral range is obtained allowing for the applications in bio imaging and chemical sensing. The optical band gaps based on tight-binding calculations are in close agreement with the experimental data for Ge1-xSnx nanocrystals with diameter of 2.1 nm, while for Ge1-xSnx nanocrystals with diameter of 2.7 nm there is a discrepancy of 0.4 eV with experimental results and first-principles calculations. An improvement in the luminescence properties of such Ge1-xSnx nanocrystals becomes possible in the presence of the Sn contents. The electron-hole coulomb interaction is reduced with the increasing Sn components, while the electron-hole exchange interaction is increased with the increasing Sn contents. In addition, I have to point out an astonishing phenomenon, stokes shift and fine structure splitting, with the aim for the realization of the entangled source. The stokes shift and fine structure splitting are enhanced with the increasing Sn contents and decreasing diameters as can be elucidated by the trend of ground electron-hole wave function overlaps. Ge1-xSnx nanocrystal with Sn-free content and large size is the best candidate to be a source of entangled photon pairs. Finally, the combinations of direct band gap character and broad tunable visible spectra advise the promise for use in optoelectronic devices as well as solar cells.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sahu, Sivabrata, E-mail: siva1987@iopb.res.in; Parashar, S. K. S., E-mail: sksparashar@yahoo.com; Rout, G. C., E-mail: gcr@iopb.res.in

    We address here a tight-binding theoretical model calculation for AA-stacked bi-layer graphene taking into account of a biased potential between two layers to study the density of states and the band dispersion within the total Brillouin zone. We have calculated the electronic Green’s function for electron operator corresponding to A and B sub lattices by Zubarev’s Green’s function technique from which the electronic density of states and the electron band energy dispersion are calculated. The numerically computed density of states and band energy dispersions are investigated by tuning the biased potential to exhibit the band gap by varying the differentmore » physical parameters.« less

  17. Computational predictions of zinc oxide hollow structures

    NASA Astrophysics Data System (ADS)

    Tuoc, Vu Ngoc; Huan, Tran Doan; Thao, Nguyen Thi

    2018-03-01

    Nanoporous materials are emerging as potential candidates for a wide range of technological applications in environment, electronic, and optoelectronics, to name just a few. Within this active research area, experimental works are predominant while theoretical/computational prediction and study of these materials face some intrinsic challenges, one of them is how to predict porous structures. We propose a computationally and technically feasible approach for predicting zinc oxide structures with hollows at the nano scale. The designed zinc oxide hollow structures are studied with computations using the density functional tight binding and conventional density functional theory methods, revealing a variety of promising mechanical and electronic properties, which can potentially find future realistic applications.

  18. Transparent lattices and their solitary waves.

    PubMed

    Sadurní, E

    2014-09-01

    We provide a family of transparent tight-binding models with nontrivial potentials and site-dependent hopping parameters. Their feasibility is discussed in electromagnetic resonators, dielectric slabs, and quantum-mechanical traps. In the second part of the paper, the arrays are obtained through a generalization of supersymmetric quantum mechanics in discrete variables. The formalism includes a finite-difference Darboux transformation applied to the scattering matrix of a periodic array. A procedure for constructing a hierarchy of discrete Hamiltonians is indicated and a particular biparametric family is given. The corresponding potentials and hopping functions are identified as solitary waves, pointing to a discrete spinorial generalization of the Korteweg-deVries family.

  19. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  20. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  1. Incorporating a guanidine-modified cytosine base into triplex-forming PNAs for the recognition of a C-G pyrimidine–purine inversion site of an RNA duplex

    PubMed Central

    Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang

    2016-01-01

    RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599

  2. Tight-binding modeling and low-energy behavior of the semi-Dirac point.

    PubMed

    Banerjee, S; Singh, R R P; Pardo, V; Pickett, W E

    2009-07-03

    We develop a tight-binding model description of semi-Dirac electronic spectra, with highly anisotropic dispersion around point Fermi surfaces, recently discovered in electronic structure calculations of VO2-TiO2 nanoheterostructures. We contrast their spectral properties with the well-known Dirac points on the honeycomb lattice relevant to graphene layers and the spectra of bands touching each other in zero-gap semiconductors. We also consider the lowest order dispersion around one of the semi-Dirac points and calculate the resulting electronic energy levels in an external magnetic field. In spite of apparently similar electronic structures, Dirac and semi-Dirac systems support diverse low-energy physics.

  3. Hybrid k .p tight-binding model for intersubband optics in atomically thin InSe films

    NASA Astrophysics Data System (ADS)

    Magorrian, S. J.; Ceferino, A.; Zólyomi, V.; Fal'ko, V. I.

    2018-04-01

    We propose atomic films of n -doped γ -InSe as a platform for intersubband optics in the infrared and far-infrared range, coupled to out-of-plane polarized light. Depending on the film thickness (number of layers) and the amount of n -doping of the InSe film, these transitions span from ˜0.7 eV for bilayer to ˜0.05 eV for 15-layer InSe. We use a hybrid k .p theory and tight-binding model, fully parametrized using density-functional theory, to predict their oscillator strengths and thermal linewidths at room temperature.

  4. The tight binding model study of the role of anisotropic AFM spin ordering in the charge ordered CMR manganites

    NASA Astrophysics Data System (ADS)

    Kar, J. K.; Panda, Saswati; Rout, G. C.

    2017-05-01

    We propose here a tight binding model study of the interplay between charge and spin orderings in the CMR manganites taking anisotropic effect due to electron hoppings and spin exchanges. The Hamiltonian consists of the kinetic energies of eg and t2g electrons of manganese ion. It further includes double exchange and Heisenberg interactions. The charge density wave interaction (CDW) describes an extra mechanism for the insulating character of the system. The CDW gap and spin parameters are calculated using Zubarev's Green's function technique and computed self-consistently. The results are reported in this communication.

  5. HIV-1 gp120 Glycoprotein Interacting with Dendritic Cell-specific Intercellular Adhesion Molecule 3-grabbing Non-integrin (DC-SIGN) Down-Regulates Tight Junction Proteins to Disrupt the Blood Retinal Barrier and Increase Its Permeability.

    PubMed

    Qian, Yi-Wen; Li, Chuan; Jiang, Ai-Ping; Ge, Shengfang; Gu, Ping; Fan, Xianqun; Li, Tai-Sheng; Jin, Xia; Wang, Jian-Hua; Wang, Zhi-Liang

    2016-10-28

    Approximately 70% of HIV-1 infected patients acquire ocular opportunistic infections and manifest eye disorders during the course of their illness. The mechanisms by which pathogens invade the ocular site, however, are unclear. Under normal circumstances, vascular endothelium and retinal pigment epithelium (RPE), which possess a well developed tight junction complex, form the blood-retinal barrier (BRB) to prevent pathogen invasion. We hypothesize that disruption of the BRB allows pathogen entry into ocular sites. The hypothesis was tested using in vitro models. We discovered that human RPE cells could bind to either HIV-1 gp120 glycoproteins or HIV-1 viral particles. Furthermore, the binding was mediated by dendritic cell-specific intercellular adhesion molecule 3-grabbing non-integrin (DC-SIGN) expressed on RPE cells. Upon gp120 binding to DC-SIGN, cellular NF-κB signaling was triggered, leading to the induction of matrix metalloproteinases, which subsequently degraded tight junction proteins and disrupted the BRB integrity. DC-SIGN knockdown or prior blocking with a specific antibody abolished gp120-induced matrix metalloproteinase expression and reduced the degradation of tight junction proteins. This study elucidates a novel mechanism by which HIV, type 1 invades ocular tissues and provides additional insights into the translocation or invasion process of ocular complication-associated pathogens. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. HLaffy: estimating peptide affinities for Class-1 HLA molecules by learning position-specific pair potentials.

    PubMed

    Mukherjee, Sumanta; Bhattacharyya, Chiranjib; Chandra, Nagasuma

    2016-08-01

    T-cell epitopes serve as molecular keys to initiate adaptive immune responses. Identification of T-cell epitopes is also a key step in rational vaccine design. Most available methods are driven by informatics and are critically dependent on experimentally obtained training data. Analysis of a training set from Immune Epitope Database (IEDB) for several alleles indicates that the sampling of the peptide space is extremely sparse covering a tiny fraction of the possible nonamer space, and also heavily skewed, thus restricting the range of epitope prediction. We present a new epitope prediction method that has four distinct computational modules: (i) structural modelling, estimating statistical pair-potentials and constraint derivation, (ii) implicit modelling and interaction profiling, (iii) feature representation and binding affinity prediction and (iv) use of graphical models to extract peptide sequence signatures to predict epitopes for HLA class I alleles. HLaffy is a novel and efficient epitope prediction method that predicts epitopes for any Class-1 HLA allele, by estimating the binding strengths of peptide-HLA complexes which is achieved through learning pair-potentials important for peptide binding. It relies on the strength of the mechanistic understanding of peptide-HLA recognition and provides an estimate of the total ligand space for each allele. The performance of HLaffy is seen to be superior to the currently available methods. The method is made accessible through a webserver http://proline.biochem.iisc.ernet.in/HLaffy : nchandra@biochem.iisc.ernet.in Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  7. Structural analysis of a class III preQ 1 riboswitch reveals an aptamer distant from a ribosome-binding site regulated by fast dynamics

    DOE PAGES

    Liberman, Joseph A.; Suddala, Krishna C.; Aytenfisu, Asaminew; ...

    2015-06-23

    PreQ 1-III riboswitches are newly identified RNA elements that control bacterial genes in response to preQ 1 (7-aminomethyl-7-deazaguanine), a precursor to the essential hypermodified tRNA base queuosine. Although numerous riboswitches fold as H-type or HL out-type pseudoknots that integrate ligand-binding and regulatory sequences within a single folded domain, the preQ 1-III riboswitch aptamer forms a HL out-type pseudoknot that does not appear to incorporate its ribosome-binding site (RBS). To understand how this unusual organization confers function, in this paper we determined the crystal structure of the class III preQ 1 riboswitch from Faecalibacterium prausnitzii at 2.75 Å resolution. PreQ 1more » binds tightly (K D,app 6.5 ± 0.5 nM) between helices P1 and P2 of a three-way helical junction wherein the third helix, P4, projects orthogonally from the ligand-binding pocket, exposing its stem-loop to base pair with the 3' RBS. Biochemical analysis, computational modeling, and single-molecule FRET imaging demonstrated that preQ 1 enhances P4 reorientation toward P1–P2, promoting a partially nested, H-type pseudoknot in which the RBS undergoes rapid docking (k dock ~0.6 s -1) and undocking (k undock ~1.1 s -1). Finally, discovery of such dynamic conformational switching provides insight into how a riboswitch with bipartite architecture uses dynamics to modulate expression platform accessibility, thus expanding the known repertoire of gene control strategies used by regulatory RNAs.« less

  8. Environment sensitive fluorescent analogue of biologically active oxazoles differentially recognizes human serum albumin and bovine serum albumin: Photophysical and molecular modeling studies.

    PubMed

    Maiti, Jyotirmay; Biswas, Suman; Chaudhuri, Ankur; Chakraborty, Sandipan; Chakraborty, Sibani; Das, Ranjan

    2017-03-15

    An environment sensitive fluorophore, 4-(5-(4-(dimethylamino)phenyl)oxazol-2-yl)benzoic acid (DMOBA), that closely mimics biologically active 2,5-disubstituited oxazoles has been designed to probe two homologous serum proteins, human serum albumin (HSA) and bovine serum albumin (BSA) by means of photophysical and molecular modeling studies. This fluorescent analogue exhibits solvent polarity sensitive fluorescence due to an intramolecular charge transfer in the excited state. In comparison to water, the steady state emission spectra of DMOBA in BSA is characterized by a greater blue shift (~10nm) and smaller Stokes' shift (~5980cm -1 ) in BSA than HSA (Stokes'shift~6600cm -1 ), indicating less polar and more hydrophobic environment of the dye in the former than the latter. The dye-protein binding interactions are remarkably stronger for BSA than HSA which is evident from higher value of the association constant for the DMOBA-BSA complex (K a ~5.2×10 6 M -1 ) than the DMOBA-HSA complex (K a ~1.0×10 6 M -1 ). Fӧrster resonance energy transfer studies revealed remarkably less efficient energy transfer (8%) between the donor tryptophans in BSA and the acceptor DMOBA dye than that (30%) between the single tryptophan moiety in HSA and the dye, which is consistent with a much larger distance between the donor (tryptophan)-acceptor (dye) pair in BSA (34.5Å) than HSA (25.4Å). Site specific competitive binding assays have confirmed on the location of the dye in Sudlow's site II of BSA and in Sudlow's site I of HSA, respectively. Molecular modeling studies have shown that the fluorescent analogue is tightly packed in the binding site of BSA due to strong steric complementarity, where, binding of DMOBA to BSA is primarily dictated by the van der Waals and hydrogen bonding interactions. In contrast, in HSA the steric complementarity is less significant and binding is primarily guided by polar interactions and van der Waals interactions appear to be less significant in the formation of the HSA-DMOBA complex. Electrostatic interactions contribute significantly in the binding of DMOBA to HSA (-2.09kcal/mol) compared to BSA (-0.47kcal/mol). Electrostatic surface potential calculation reveals that the DMOBA binding site within HSA is highly charged compared to BSA. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. DFTB3: Extension of the self-consistent-charge density-functional tight-binding method (SCC-DFTB).

    PubMed

    Gaus, Michael; Cui, Qiang; Elstner, Marcus

    2012-04-10

    The self-consistent-charge density-functional tight-binding method (SCC-DFTB) is an approximate quantum chemical method derived from density functional theory (DFT) based on a second-order expansion of the DFT total energy around a reference density. In the present study we combine earlier extensions and improve them consistently with, first, an improved Coulomb interaction between atomic partial charges, and second, the complete third-order expansion of the DFT total energy. These modifications lead us to the next generation of the DFTB methodology called DFTB3, which substantially improves the description of charged systems containing elements C, H, N, O, and P, especially regarding hydrogen binding energies and proton affinities. As a result, DFTB3 is particularly applicable to biomolecular systems. Remaining challenges and possible solutions are also briefly discussed.

  10. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  11. Scattering of particles in the presence of harmonic confinement perturbed by a complex absorbing potential

    NASA Astrophysics Data System (ADS)

    Maghari, A.; Kermani, M. M.

    2018-04-01

    A system of two interacting atoms confined in 1D harmonic trap and perturbed by an absorbing boundary potential is studied using the Lippmann-Schwinger formalism. The atom-atom interaction potential was considered as a nonlocal separable model. The perturbed absorbing boundary potential was also assumed in the form of Scarf II complex absorbing potential. The model is used for the study of 1D optical lattices that support the trapping of a pair atom within a unit cell. Moreover, it allows to describe the scattering particles in a tight smooth trapping surface and to analyze the bound and resonance states. The analytical expressions for wavefunctions and transition matrix as well as the absorption probabilities are calculated. A demonstration of how the complex absorbing potential affecting the bound states and resonances of particles confined in a harmonic trap is described.

  12. Design of a bioactive small molecule that targets r(AUUCU) repeats in spinocerebellar ataxia 10.

    PubMed

    Yang, Wang-Yong; Gao, Rui; Southern, Mark; Sarkar, Partha S; Disney, Matthew D

    2016-06-01

    RNA is an important target for chemical probes of function and lead therapeutics; however, it is difficult to target with small molecules. One approach to tackle this problem is to identify compounds that target RNA structures and utilize them to multivalently target RNA. Here we show that small molecules can be identified to selectively bind RNA base pairs by probing a library of RNA-focused small molecules. A small molecule that selectively binds AU base pairs informed design of a dimeric compound (2AU-2) that targets the pathogenic RNA, expanded r(AUUCU) repeats, that causes spinocerebellar ataxia type 10 (SCA10) in patient-derived cells. Indeed, 2AU-2 (50 nM) ameliorates various aspects of SCA10 pathology including improvement of mitochondrial dysfunction, reduced activation of caspase 3, and reduction of nuclear foci. These studies provide a first-in-class chemical probe to study SCA10 RNA toxicity and potentially define broadly applicable compounds targeting RNA AU base pairs in cells.

  13. Physics and performances of III-V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations.

    PubMed

    Afzalian, A; Vasen, T; Ramvall, P; Shen, T-M; Wu, J; Passlack, M

    2018-06-27

    We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III-V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III-V GAA nanowire HTFETs including the effect of electron-phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

  14. Physics and performances of III–V nanowire broken-gap heterojunction TFETs using an efficient tight-binding mode-space NEGF model enabling million-atom nanowire simulations

    NASA Astrophysics Data System (ADS)

    Afzalian, A.; Vasen, T.; Ramvall, P.; Shen, T.-M.; Wu, J.; Passlack, M.

    2018-06-01

    We report the capability to simulate in a quantum-mechanical atomistic fashion record-large nanowire devices, featuring several hundred to millions of atoms and a diameter up to 18.2 nm. We have employed a tight-binding mode-space NEGF technique demonstrating by far the fastest (up to 10 000  ×  faster) but accurate (error  <  1%) atomistic simulations to date. Such technique and capability opens new avenues to explore and understand the physics of nanoscale and mesoscopic devices dominated by quantum effects. In particular, our method addresses in an unprecedented way the technologically-relevant case of band-to-band tunneling (BTBT) in III–V nanowire broken-gap heterojunction tunnel-FETs (HTFETs). We demonstrate an accurate match of simulated BTBT currents to experimental measurements in a 12 nm diameter InAs NW and in an InAs/GaSb Esaki tunneling diode. We apply our TB MS simulations and report the first in-depth atomistic study of the scaling potential of III–V GAA nanowire HTFETs including the effect of electron–phonon scattering and discrete dopant impurity band tails, quantifying the benefits of this technology for low-power low-voltage CMOS applications.

  15. DFTB Parameters for the Periodic Table: Part 1, Electronic Structure.

    PubMed

    Wahiduzzaman, Mohammad; Oliveira, Augusto F; Philipsen, Pier; Zhechkov, Lyuben; van Lenthe, Erik; Witek, Henryk A; Heine, Thomas

    2013-09-10

    A parametrization scheme for the electronic part of the density-functional based tight-binding (DFTB) method that covers the periodic table is presented. A semiautomatic parametrization scheme has been developed that uses Kohn-Sham energies and band structure curvatures of real and fictitious homoatomic crystal structures as reference data. A confinement potential is used to tighten the Kohn-Sham orbitals, which includes two free parameters that are used to optimize the performance of the method. The method is tested on more than 100 systems and shows excellent overall performance.

  16. Polarizable atomistic calculation of site energy disorder in amorphous Alq3.

    PubMed

    Nagata, Yuki

    2010-02-01

    A polarizable molecular dynamics simulation and calculation scheme for site energy disorder is presented in amorphous tris(8-hydroxyquinolinato)aluminum (Alq(3)) by means of the charge response kernel (CRK) method. The CRK fit to the electrostatic potential and the tight-binding approximation are introduced, which enables modeling of the polarizable electrostatic interaction for a large molecule systematically from an ab initio calculation. The site energy disorder for electron and hole transfers is calculated in amorphous Alq(3) and the effect of the polarization on the site energy disorder is discussed.

  17. Lattice distortion and electron charge redistribution induced by defects in graphene

    DOE PAGES

    Zhang, Wei; Lu, Wen -Cai; Zhang, Hong -Xing; ...

    2016-09-14

    Lattice distortion and electronic charge localization induced by vacancy and embedded-atom defects in graphene were studied by tight-binding (TB) calculations using the recently developed three-center TB potential model. We showed that the formation energies of the defects are strongly correlated with the number of dangling bonds and number of embedded atoms, as well as the magnitude of the graphene lattice distortion induced by the defects. Lastly, we also showed that the defects introduce localized electronic states in the graphene which would affect the electron transport properties of graphene.

  18. Towards vast libraries of scaffold-diverse, conformationally constrained oligomers.

    PubMed

    Kodadek, Thomas; McEnaney, Patrick J

    2016-05-04

    There is great interest in the development of probe molecules and drug leads that would bind tightly and selectively to protein surfaces that are difficult to target with traditional molecules, such as those involved in protein-protein interactions. The currently available evidence suggests that this will require molecules that are larger and have quite different chemical properties than typical Lipinski-compliant molecules that target enzyme active sites. We describe here efforts to develop vast libraries of conformationally constrained oligomers as a potentially rich source of these molecules.

  19. Nonlinear properties of gated graphene in a strong electromagnetic field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avetisyan, A. A., E-mail: artakav@ysu.am; Djotyan, A. P., E-mail: adjotyan@ysu.am; Moulopoulos, K., E-mail: cos@ucy.ac.cy

    We develop a microscopic theory of a strong electromagnetic field interaction with gated bilayer graphene. Quantum kinetic equations for density matrix are obtained using a tight binding approach within second quantized Hamiltonian in an intense laser field. We show that adiabatically changing the gate potentials with time may produce (at resonant photon energy) a full inversion of the electron population with high density between valence and conduction bands. In the linear regime, excitonic absorption of an electromagnetic radiation in a graphene monolayer with opened energy gap is also studied.

  20. Investigation of the effect of scattering centers on low dimensional nanowire channel

    NASA Astrophysics Data System (ADS)

    Cariappa, K. S.; Shukla, Raja; Sarkar, Niladri

    2018-05-01

    In this work, we studied the effect of scattering centers on the electron density profiles of a one dimensional Nanowire channel. Density Matrix Formalism is used for calculating the local electron densities at room temperature. Various scattering centers have been simulated in the channel. The nearest neighbor tight binding method is applied to construct the Hamiltonian of nanoscale devices. We invoke scattering centers by adding local scattering potentials to the Hamiltonian. This analysis could give an insight into the understanding and utilization of defects for device engineering.

  1. Towards Vast Libraries of Scaffold-Diverse, Conformationally Constrained Oligomers

    PubMed Central

    Kodadek, Thomas; McEnaney, Patrick

    2016-01-01

    There is great interest in the development of probe molecules and drug leads that would bind tightly and selectively to protein surfaces that are difficult to target with traditional molecules, such as those involved in protein-protein interactions. The currently available evidence suggests that this will require molecules that are larger and have quite different chemical properties than typical Lipinski-compliant molecules that target enzyme active sites. We describe here efforts to develop vast libraries of conformationally constrained oligomers as a potentially rich source of these molecules. PMID:26996593

  2. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  3. Optimal self-cleavage activity of the hepatitis delta virus RNA is dependent on a homopurine base pair in the ribozyme core.

    PubMed Central

    Been, M D; Perrotta, A T

    1995-01-01

    A non-Watson-Crick G.G interaction within the core region of the hepatitis delta virus (HDV) antigenomic ribozyme is required for optimal rates of self-cleavage activity. Base substitutions for either one or both G's revealed that full activity was obtained only when both G's were replaced with A's. At those positions, substitutions that generate potential Watson-Crick, G.U, heteropurine, or homopyrimidine combinations resulted in dramatically lower cleavage activity. A homopurine symmetric base pair, of the same type identified in the high-affinity binding site of the HIV RRE, is most consistent with this data. Additional features shared between the antigenomic ribozyme and the Rev binding site in the vicinity of the homopurine pairs suggest some structural similarity for this region of the two RNAs and a possible motif associated with this homopurine interaction. Evidence for a homopurine pair at the equivalent position in a modified form of the HDV genomic ribozyme was also found. With the postulated symmetric pairing scheme, large distortions in the nucleotide conformation, the sugar-phosphate backbone, or both would be necessary to accommodate this interaction at the end of a helix; we hypothesize that this distortion is critical to the structure of the active site of the ribozyme and it is stabilized by the homopurine base pair. PMID:8595561

  4. Complex equiangular tight frames

    NASA Astrophysics Data System (ADS)

    Tropp, Joel A.

    2005-08-01

    A complex equiangular tight frame (ETF) is a tight frame consisting of N unit vectors in Cd whose absolute inner products are identical. One may view complex ETFs as a natural geometric generalization of an orthonormal basis. Numerical evidence suggests that these objects do not arise for most pairs (d, N). The goal of this paper is to develop conditions on (d, N) under which complex ETFs can exist. In particular, this work concentrates on the class of harmonic ETFs, in which the components of the frame vectors are roots of unity. In this case, it is possible to leverage field theory to obtain stringent restrictions on the possible values for (d, N).

  5. Interface Schottky barrier engineering via strain in metal-semiconductor composites

    NASA Astrophysics Data System (ADS)

    Ma, Xiangchao; Dai, Ying; Yu, Lin; Huang, Baibiao

    2016-01-01

    The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures.The interfacial carrier transfer property, which is dominated by the interface Schottky barrier height (SBH), plays a crucial role in determining the performance of metal-semiconductor heterostructures in a variety of applications. Therefore, artificially controlling the interface SBH is of great importance for their industrial applications. As a model system, the Au/TiO2 (001) heterostructure is studied using first-principles calculations and the tight-binding method in the present study. Our investigation demonstrates that strain can be an effective way to decrease the interface SBH and that the n-type SBH can be more effectively decreased than the p-type SBH. Astonishingly, strain affects the interface SBH mainly by changing the intrinsic properties of Au and TiO2, whereas the interfacial potential alignment is almost independent of strain due to two opposite effects, which are induced by strain at the interfacial region. These observed trends can be understood on the basis of the general free-electron gas model of typical metals, the tight-binding theory and the crystal-field theory, which suggest that similar trends may be generalized for many other metal-semiconductor heterostructures. Given the commonness and tunability of strain in typical heterostructures, we anticipate that the tunability of the interface SBH with strain described here can provide an alternative effective way for realizing more efficient applications of relevant heterostructures. Electronic supplementary information (ESI) available: The changes of Au 5d DOS, valence bands of TiO2, the interfacial bond length and interfacial energy with strain, and the local DOS results for the change of SBH with strain. See DOI: 10.1039/c5nr05583k

  6. The relationship between water binding and desiccation tolerance in tissues

    NASA Technical Reports Server (NTRS)

    Vertucci, C. W.; Leopold, A. C.

    1987-01-01

    In an effort to define the nature of desiccation tolerance, a comparison of the water sorption characteristics was made between tissues that were resistant and tissues that were sensitive to desiccation. Water sorption isotherms were constructed for germinated and ungerminated soybean axes and also for fronds of several species of Polypodium with varying tolerance to dehydration. The strength of water binding was determined by van't Hoff as well as D'Arcy/Watt analyses of the isotherms at 5, 15, and/or 25 degrees C. Tissues which were sensitive to desiccation had a poor capacity to bind water tightly. Tightly bound water can be removed from soybean and pea seeds by equilibration at 35 degrees C over very low relative humidities; this results in a reduction in the viability of the seed. We suggest that region 1 water (i.e. water bound with very negative enthalpy values) is an important component of desiccation tolerance.

  7. The tightly bound nuclei in the liquid drop model

    NASA Astrophysics Data System (ADS)

    Sree Harsha, N. R.

    2018-05-01

    In this paper, we shall maximise the binding energy per nucleon function in the semi-empirical mass formula of the liquid drop model of the atomic nuclei to analytically prove that the mean binding energy per nucleon curve has local extrema at A ≈ 58.6960, Z ≈ 26.3908 and at A ≈ 62.0178, Z ≈ 27.7506. The Lagrange method of multipliers is used to arrive at these results, while we have let the values of A and Z take continuous fractional values. The shell model that shows why 62Ni is the most tightly bound nucleus is outlined. A brief account on stellar nucleosynthesis is presented to show why 56Fe is more abundant than 62Ni and 58Fe. We believe that the analytical proof presented in this paper can be a useful tool to the instructors to introduce the nucleus with the highest mean binding energy per nucleon.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pogosov, Walter V.; Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, Izhorskaya 13, 125412 Moscow; Combescot, Monique

    While the one-Cooper-pair problem is now a textbook exercise, the energy of two pairs of electrons with opposite spins and zero total momentum has not been derived yet, the exact handling of Pauli blocking between bound pairs being not that easy for N=2 already. The two-Cooper-pair problem however is quite enlightening to understand the very peculiar role played by the Pauli exclusion principle in superconductivity. Pauli blocking is known to drive the change from 1 to N pairs but no precise description of this continuous change has been given so far. Using Richardson's procedure, we here prove that Pauli blockingmore » increases the free part of the two-pair ground-state energy but decreases the binding part when compared to two isolated pairs--the excitation gap to break a pair however increasing from one to two pairs. When extrapolated to the dense BCS regime, the decrease in the pair binding while the gap increases strongly indicates that at odd with common belief, the average pair binding energy cannot be on the order of the gap.« less

  9. Tight-binding model of the photosystem II reaction center: application to two-dimensional electronic spectroscopy

    NASA Astrophysics Data System (ADS)

    Gelzinis, Andrius; Valkunas, Leonas; Fuller, Franklin D.; Ogilvie, Jennifer P.; Mukamel, Shaul; Abramavicius, Darius

    2013-07-01

    We propose an optimized tight-binding electron-hole model of the photosystem II (PSII) reaction center (RC). Our model incorporates two charge separation pathways and spatial correlations of both static disorder and fast fluctuations of energy levels. It captures the main experimental features observed in time-resolved two-dimensional (2D) optical spectra at 77 K: peak pattern, lineshapes and time traces. Analysis of 2D spectra kinetics reveals that specific regions of the 2D spectra of the PSII RC are sensitive to the charge transfer states. We find that the energy disorder of two peripheral chlorophylls is four times larger than the other RC pigments.

  10. FAST TRACK COMMUNICATION: Finite-temperature magnetism in bcc Fe under compression

    NASA Astrophysics Data System (ADS)

    Sha, Xianwei; Cohen, R. E.

    2010-09-01

    We investigate the contributions of finite-temperature magnetic fluctuations to the thermodynamic properties of bcc Fe as functions of pressure. First, we apply a tight-binding total-energy model parameterized to first-principles linearized augmented plane-wave computations to examine various ferromagnetic, anti-ferromagnetic, and noncollinear spin spiral states at zero temperature. The tight-binding data are fit to a generalized Heisenberg Hamiltonian to describe the magnetic energy functional based on local moments. We then use Monte Carlo simulations to compute the magnetic susceptibility, the Curie temperature, heat capacity, and magnetic free energy. Including the finite-temperature magnetism improves the agreement with experiment for the calculated thermal expansion coefficients.

  11. Instability of superfluid Fermi gases induced by a rotonlike density mode in optical lattices

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yunomae, Yoshihiro; Yamamoto, Daisuke; Danshita, Ippei

    2009-12-15

    We study the stability of superfluid Fermi gases in deep optical lattices in the BCS-Bose-Einstein condensation (BEC) crossover at zero temperature. Within the tight-binding attractive Hubbard model, we calculate the spectrum of the low-energy Anderson-Bogoliubov (AB) mode as well as the single-particle excitations in the presence of superfluid flow in order to determine the critical velocities. To obtain the spectrum of the AB mode, we calculate the density response function in the generalized random-phase approximation applying the Green's function formalism developed by Cote and Griffin to the Hubbard model. We find that the spectrum of the AB mode is separatedmore » from the particle-hole continuum having the characteristic rotonlike minimum at short wavelength due to the strong charge-density-wave fluctuations. The energy of the rotonlike minimum decreases with increasing the lattice velocity and it reaches zero at the critical velocity which is smaller than the pair-breaking velocity. This indicates that the superfluid state is energetically unstable due to the spontaneous emission of the short-wavelength rotonlike excitations of the AB mode instead due to pair breaking. We determine the critical velocities as functions of the interaction strength across the BCS-BEC crossover regime.« less

  12. Dynamical Localization for Discrete and Continuous Random Schrödinger Operators

    NASA Astrophysics Data System (ADS)

    Germinet, F.; De Bièvre, S.

    We show for a large class of random Schrödinger operators Ho on and on that dynamical localization holds, i.e. that, with probability one, for a suitable energy interval I and for q a positive real, Here ψ is a function of sufficiently rapid decrease, and PI(Ho) is the spectral projector of Ho corresponding to the interval I. The result is obtained through the control of the decay of the eigenfunctions of Ho and covers, in the discrete case, the Anderson tight-binding model with Bernoulli potential (dimension ν = 1) or singular potential (ν > 1), and in the continuous case Anderson as well as random Landau Hamiltonians.

  13. Rat Muc4 (sialomucin complex) reduces binding of anti-ErbB2 antibodies to tumor cell surfaces, a potential mechanism for herceptin resistance.

    PubMed

    Price-Schiavi, Shari A; Jepson, Scott; Li, Peter; Arango, Maria; Rudland, Philip S; Yee, Lisa; Carraway, Kermit L

    2002-06-20

    Muc4 (also called sialomucin complex), the rat homolog of human MUC4, is a heterodimeric glycoprotein complex that consists of a peripheral O-glycosylated mucin subunit, ASGP-1, tightly but noncovalently linked to a N-glycosylated transmembrane subunit, ASGP-2. The complex is expressed in a number of normal, vulnerable epithelial tissues, including mammary gland, uterus, colon, cornea and trachea. Muc4/SMC is also overexpressed or aberrantly expressed on a number of human tumors including breast tumors. Overexpression of Muc4/SMC has been shown to block cell-cell and cell-matrix interactions, protect tumor cells from immune surveillance and promote metastasis. In addition, as a ligand for ErbB2, Muc4/SMC can potentiate phosphorylation of ErbB2 and potentially alter signals generated from this receptor. Using A375 human melanoma cells and MCF7 human breast adenocarcinoma cells stably transfected with tetracycline regulatable Muc4, we have investigated whether overexpression of Muc4/SMC can repress antibody binding to cell surface-expressed ErbB2. Overexpression of Muc4/SMC does not affect the level of ErbB2 expression in either cell line, but it does reduce binding of a number of anti-ErbB2 antibodies, including Herceptin. Interestingly, overexpression of ErbB2 does not block binding of other unrelated antibodies of the same isotype, suggesting that the reduction in ErbB2 antibody binding is due to complex formation of Muc4/SMC and ErbB2. Furthermore, capping of Muc4/SMC with anti-Muc4/SMC antibodies reduces antibody binding to ErbB2 instead of increasing binding, again suggesting that reduced antibody binding to ErbB2 is due to steric hindrance from complex formation of Muc4/SMC and ErbB2. Thus, overexpression of Muc4/SMC on tumor cells may have both prognostic and therapeutic relevance. Copyright 2002 Wiley-Liss, Inc.

  14. Dynamics and molecular determinants of cytoplasmic lipid droplet clustering and dispersion.

    PubMed

    Orlicky, David J; Monks, Jenifer; Stefanski, Adrianne L; McManaman, James L

    2013-01-01

    Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps.

  15. Cooper-pair size and binding energy for unconventional superconducting systems

    NASA Astrophysics Data System (ADS)

    Dinóla Neto, F.; Neto, Minos A.; Salmon, Octavio D. Rodriguez

    2018-06-01

    The main proposal of this paper is to analyze the size of the Cooper pairs composed by unbalanced mass fermions from different electronic bands along the BCS-BEC crossover and study the binding energy of the pairs. We are considering an interaction between fermions with different masses leading to an inter-band pairing. In addiction to the attractive interaction we have an hybridization term to couple both bands, which in general acts unfavorable for the pairing between the electrons. We get first order phase transitions as the hybridization breaks the Cooper pairs for the s-wave symmetry of the gap amplitude. The results show the dependence of the Cooper-pair size as a function of the hybridization for T = 0 . We also propose the structure of the binding energy of the inter-band system as a function of the two-bands quasi-particle energies.

  16. Time-dependent density-functional tight-binding method with the third-order expansion of electron density

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishimoto, Yoshio, E-mail: nishimoto.yoshio@fukui.kyoto-u.ac.jp

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of themore » third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.« less

  17. Time-dependent density-functional tight-binding method with the third-order expansion of electron density.

    PubMed

    Nishimoto, Yoshio

    2015-09-07

    We develop a formalism for the calculation of excitation energies and excited state gradients for the self-consistent-charge density-functional tight-binding method with the third-order contributions of a Taylor series of the density functional theory energy with respect to the fluctuation of electron density (time-dependent density-functional tight-binding (TD-DFTB3)). The formulation of the excitation energy is based on the existing time-dependent density functional theory and the older TD-DFTB2 formulae. The analytical gradient is computed by solving Z-vector equations, and it requires one to calculate the third-order derivative of the total energy with respect to density matrix elements due to the inclusion of the third-order contributions. The comparison of adiabatic excitation energies for selected small and medium-size molecules using the TD-DFTB2 and TD-DFTB3 methods shows that the inclusion of the third-order contributions does not affect excitation energies significantly. A different set of parameters, which are optimized for DFTB3, slightly improves the prediction of adiabatic excitation energies statistically. The application of TD-DFTB for the prediction of absorption and fluorescence energies of cresyl violet demonstrates that TD-DFTB3 reproduced the experimental fluorescence energy quite well.

  18. Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots.

    PubMed

    Douglas-Gallardo, Oscar A; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

    2018-04-14

    Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

  19. Communication: Photoinduced carbon dioxide binding with surface-functionalized silicon quantum dots

    NASA Astrophysics Data System (ADS)

    Douglas-Gallardo, Oscar A.; Sánchez, Cristián Gabriel; Vöhringer-Martinez, Esteban

    2018-04-01

    Nowadays, the search for efficient methods able to reduce the high atmospheric carbon dioxide concentration has turned into a very dynamic research area. Several environmental problems have been closely associated with the high atmospheric level of this greenhouse gas. Here, a novel system based on the use of surface-functionalized silicon quantum dots (sf-SiQDs) is theoretically proposed as a versatile device to bind carbon dioxide. Within this approach, carbon dioxide trapping is modulated by a photoinduced charge redistribution between the capping molecule and the silicon quantum dots (SiQDs). The chemical and electronic properties of the proposed SiQDs have been studied with a Density Functional Theory and Density Functional Tight-Binding (DFTB) approach along with a time-dependent model based on the DFTB framework. To the best of our knowledge, this is the first report that proposes and explores the potential application of a versatile and friendly device based on the use of sf-SiQDs for photochemically activated carbon dioxide fixation.

  20. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  1. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  2. Theoretical study on the binding mechanism between N6-methyladenine and natural DNA bases.

    PubMed

    Song, Qi-Xia; Ding, Zhen-Dong; Liu, Jian-Hua; Li, Yan; Wang, Hai-Jun

    2013-03-01

    N6-methyladenine (m(6)A) is a rare base naturally occurring in DNA. It is different from the base adenine due to its N-CH(3). Therefore, the base not only pairs with thymine, but also with other DNA bases (cytosine, adenine and guanine). In this work, Møller-Plesset second-order (MP2) method has been used to investigate the binding mechanism between m(6)A and natural DNA bases in gas phase and in aqueous solution. The results show that N-CH(3) changed the way of N6-methyladenine binding to natural DNA bases. The binding style significantly influences the stability of base pairs. The trans-m(6)A:G and trans-m(6)A:C conformers are the most stable among all the base pairs. The existence of solvent can remarkably reduce the stability of the base pairs, and the DNA bases prefer pairing with trans-m(6)A to cis-m(6)A. Besides, the properties of these hydrogen bonds have been analyzed by atom in molecules (AIM) theory, natural bond orbital (NBO) analysis and Wiberg bond indexes (WBI). In addition, pairing with m(6)A decreases the binding energies compared to the normal Watson-Crick base pairs, it may explain the instability of the N6 site methylated DNA in theory.

  3. Calcium ion binding to a soil fulvic acid using a donnan potential model

    USGS Publications Warehouse

    Marinsky, J.A.; Mathuthu, A.; Ephraim, J.H.; Reddy, M.M.

    1999-01-01

    Calcium ion binding to a soil fulvic acid (Armadale Bh Horizon) was evaluated over a range of calcium ion concentrations, from pH 3.8 to 7.3, using potentiometric titrations and calcium ion electrode measurements. Fulvic acid concentration was constant (100 milligrams per liter) and calcium ion concentration varied up to 8 X 10-4 moles per liter. Experiments discussed here included: (1) titrations of fulvic acid-calcium ion containing solutions with sodium hydroxide; and (2) titrations of fully neutralized fulvic acid with calcium chloride solutions. Apparent binding constants (expressed as the logarithm of the value, log ??app) vary with solution pH, calcium ion concentration, degree of acid dissociation, and ionic strength (from log ??app = 2.5 to 3.9) and are similar to those reported by others. Fulvic acid charge, and the associated Donnan Potential, influences calcium ion-fulvic acid ion pair formation. A Donnan Potential corrrection term allowed calculation of intrinsic calcium ion-fulvic acid binding constants. Intrinsic binding constants vary from 1.2 to 2.5 (the average value is about log??= 1.6) and are similar to, but somewhat higher than, stability constants for calcium ion-carboxylic acid monodentate complexes. ?? by Oldenbourg Wissenschaftsverlag, Mu??nchen.

  4. How actin binds and assembles onto plasma membranes from Dictyostelium discoideum

    PubMed Central

    1988-01-01

    We have shown previously (Schwartz, M. A., and E. J. Luna. 1986. J. Cell Biol. 102: 2067-2075) that actin binds with positive cooperativity to plasma membranes from Dictyostelium discoideum. Actin is polymerized at the membrane surface even at concentrations well below the critical concentration for polymerization in solution. Low salt buffer that blocks actin polymerization in solution also prevents actin binding to membranes. To further explore the relationship between actin polymerization and binding to membranes, we prepared four chemically modified actins that appear to be incapable of polymerizing in solution. Three of these derivatives also lost their ability to bind to membranes. The fourth derivative (EF actin), in which histidine-40 is labeled with ethoxyformic anhydride, binds to membranes with reduced affinity. Binding curves exhibit positive cooperativity, and cross- linking experiments show that membrane-bound actin is multimeric. Thus, binding and polymerization are tightly coupled, and the ability of these membranes to polymerize actin is dramatically demonstrated. EF actin coassembles weakly with untreated actin in solution, but coassembles well on membranes. Binding by untreated actin and EF actin are mutually competitive, indicating that they bind to the same membrane sites. Hill plots indicate that an actin trimer is the minimum assembly state required for tight binding to membranes. The best explanation for our data is a model in which actin oligomers assemble by binding to clustered membrane sites with successive monomers on one side of the actin filament bound to the membrane. Individual binding affinities are expected to be low, but the overall actin-membrane avidity is high, due to multivalency. Our results imply that extracellular factors that cluster membrane proteins may create sites for the formation of actin nuclei and thus trigger actin polymerization in the cell. PMID:3392099

  5. DNA binding studies of a new dicationic porphyrin. Insights into interligand interactions.

    PubMed

    Shelton, Alexander H; Rodger, Alison; McMillin, David R

    2007-08-07

    Cationic porphyrins have an affinity for DNA and potential for applications in the fields of photodynamic therapy and cellular imaging. This report describes a new dicationic porphyrin, 5,15-dimethyl-10,20-di(N-methylpyridinium-4-yl)porphyrin, abbreviated H2tMe2D4. Although tetrasubstituted, H2tMe2D4 presents modest steric requirements and forms in reasonable yield by a "2+2" synthetic method. Accordingly, studies of the zinc(II)- and copper(II)-containing derivatives, Zn(tMe2D4) and Cu(tMe2D4), have also been possible. Methods used to characterize DNA-binding motifs include absorption, emission, linear, and circular dichroism spectroscopies, as well as viscometry. An unusually detailed picture of porphyrin uptake emerges. As the ratio of DNA to porphyrin increases during a typical titration, H2tMe2D4 or Cu(tMe2D4) initially aggregates on the host and then shifts to intercalative binding at close quarters before finally dispersing into non-interacting intercalation sites of the host. Emission studies of the copper(II) porphyrin have been very valuable. The existence of a measurable signal is diagnostic of intercalative binding, and the saturation behavior establishes that internalization typically monopolizes approximately three base pairs. In the moderate loading regime, emission data are most telling because dipole-dipole interactions between near-neighbor porphyrins tend to confuse other spectroscopic assays. The third ligand, Zn(tMe2D4), behaves differently in that the uptake is a strictly cooperative process. The mode of binding also varies with the base content of the DNA host. When the DNA is rich in A=T base pairs, the porphyrin remains five-coordinate and binds externally; however, Zn(tMe2D4) loses its axial ligand and binds by intercalation if the host contains only G[triple bond]C base pairs.

  6. Self-Consistent Charge Density Functional Tight-Binding Study of Poly(3,4-ethylenedioxythiophene): Poly(styrenesulfonate) Ammonia Gas Sensor.

    PubMed

    Marutaphan, Ampaiwan; Seekaew, Yotsarayuth; Wongchoosuk, Chatchawal

    2017-12-01

    Geometric and electronic properties of 3,4-ethylenedioxythiophene (EDOT), styrene sulfonate (SS), and EDOT: SS oligomers up to 10 repeating units were studied by the self-consistent charge density functional tight-binding (SCC-DFTB) method. An application of PEDOT:PSS for ammonia (NH 3 ) detection was highlighted and investigated both experimentally and theoretically. The results showed an important role of H-bonds in EDOT:SS oligomers complex conformation. Electrical conductivity of EDOT increased with increasing oligomers and doping SS due to enhancement of π conjugation. Printed PEDOT:PSS gas sensor exhibited relatively high response and selectivity to NH 3 . The SCC-DFTB calculation suggested domination of direct charge transfer process in changing of PEDOT:PSS conductivity upon NH 3 exposure at room temperature. The NH 3 molecules preferred to bind with PEDOT:PSS via physisorption. The most favorable adsorption site for PEDOT:PSS-NH 3 interaction was found to be at the nitrogen atom of NH 3 and hydrogen atoms of SS with an average optimal binding distance of 2.00 Å.

  7. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones

    PubMed Central

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-01-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous ‘polyamide amino acids’ (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy–entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets. PMID:23605042

  8. Thermodynamic studies of a series of homologous HIV-1 TAR RNA ligands reveal that loose binders are stronger Tat competitors than tight ones.

    PubMed

    Pascale, Lise; Azoulay, Stéphane; Di Giorgio, Audrey; Zenacker, Laura; Gaysinski, Marc; Clayette, Pascal; Patino, Nadia

    2013-06-01

    RNA is a major drug target, but the design of small molecules that modulate RNA function remains a great challenge. In this context, a series of structurally homologous 'polyamide amino acids' (PAA) was studied as HIV-1 trans-activating response (TAR) RNA ligands. An extensive thermodynamic study revealed the occurence of an enthalpy-entropy compensation phenomenon resulting in very close TAR affinities for all PAA. However, their binding modes and their ability to compete with the Tat fragment strongly differ according to their structure. Surprisingly, PAA that form loose complexes with TAR were shown to be stronger Tat competitors than those forming tight ones, and thermal denaturation studies demonstrated that loose complexes are more stable than tight ones. This could be correlated to the fact that loose and tight ligands induce distinct RNA conformational changes as revealed by circular dichroism experiments, although nuclear magnetic resonance (NMR) experiments showed that the TAR binding site is the same in all cases. Finally, some loose PAA also display promising inhibitory activities on HIV-infected cells. Altogether, these results lead to a better understanding of RNA interaction modes that could be very useful for devising new ligands of relevant RNA targets.

  9. The Role of Cytosine Methylation on Charge Transport through a DNA Strand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modifi-cation remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Buttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. Specifically, we compare the results generated with the widely used B3LYP exchange-correlation (XC) functional and CAM-B3LYP based tuned range-separated hybrid density functional. We first analyze the effectmore » of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that with both functionals, the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and interstrand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital (HOMO) level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with both functionals. We also study the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit. Our results suggest that the effect of the two different functionals is to alter the on-site energies of the DNA bases at the HOMO level, while the transport properties don't depend much on the two functionals.« less

  10. Demons and superconductivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ihm, J.; Cohen, M.L.; Tuan, S.F.

    1981-04-01

    Model calculations are used to explore the role of demons (acoustic plasmons involving light and heavy mass carriers) in superconductivity. Heavy d electrons and light s and p electrons in a transition metal are used for discussion, but the calculation presented is more general, and the results can be applied to other systems. The analysis is based on the dielectric-function approach and the Bardeen-Cooper-Schrieffer theory. The dielectric function includes intraband and interband s-d scattering, and a tight-binding model is used to examine the role of s-d hybridization. The demon contribution generally reduces the Coulomb interaction between the electrons. Under suitablemore » conditions, the model calculations indicate that the electron-electron interaction via demons can be attractive, but the results also suggest that this mechanism is probably not dominant in transition metals and transition-metal compounds. An attractive interband contribution is found, and it is proposed that this effect may lead to pairing in suitable systems.« less

  11. Holes influence the mutation spectrum of human mitochondrial DNA

    NASA Astrophysics Data System (ADS)

    Villagran, Martha; Miller, John

    Mutations drive evolution and disease, showing highly non-random patterns of variant frequency vs. nucleotide position. We use computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)] to reveal sites of enhanced hole probability in selected regions of human mitochondrial DNA. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. The hole spectra are quantum mechanically computed using a two-stranded tight binding model of DNA. We observe significant correlation between spectra of hole probabilities and of genetic variation frequencies from the MITOMAP database. These results suggest that hole-enhanced mutation mechanisms exert a substantial, perhaps dominant, influence on mutation patterns in DNA. One example is where a trapped hole induces a hydrogen bond shift, known as tautomerization, which then triggers a base-pair mismatch during replication. Our results deepen overall understanding of sequence specific mutation rates, encompassing both hotspots and cold spots, which drive molecular evolution.

  12. The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

    NASA Astrophysics Data System (ADS)

    Lee, Sunhee; Hedin, Eric; Joe, Yong

    2010-03-01

    The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

  13. Quantum transport through single and multilayer icosahedral fullerenes

    NASA Astrophysics Data System (ADS)

    Lovey, Daniel A.; Romero, Rodolfo H.

    2013-10-01

    We use a tight-binding Hamiltonian and Green functions methods to calculate the quantum transmission through single-wall fullerenes and bilayered and trilayered onions of icosahedral symmetry attached to metallic leads. The electronic structure of the onion-like fullerenes takes into account the curvature and finite size of the fullerenes layers as well as the strength of the intershell interactions depending on to the number of interacting atom pairs belonging to adjacent shells. Misalignment of the symmetry axes of the concentric iscosahedral shells produces breaking of the level degeneracies of the individual shells, giving rise some narrow quasi-continuum bands instead of the localized discrete peaks of the individual fullerenes. As a result, the transmission function for non symmetrical onions is rapidly varying functions of the Fermi energy. Furthermore, we found that most of the features of the transmission through the onions are due to the electronic structure of the outer shell with additional Fano-like antiresonances arising from coupling with or between the inner shells.

  14. Diverse magnetic quantization in bilayer silicene

    NASA Astrophysics Data System (ADS)

    Do, Thi-Nga; Shih, Po-Hsin; Gumbs, Godfrey; Huang, Danhong; Chiu, Chih-Wei; Lin, Ming-Fa

    2018-03-01

    The generalized tight-binding model is developed to investigate the rich and unique electronic properties of A B -bt (bottom-top) bilayer silicene under uniform perpendicular electric and magnetic fields. The first pair of conduction and valence bands, with an observable energy gap, displays unusual energy dispersions. Each group of conduction/valence Landau levels (LLs) is further classified into four subgroups, i.e., the sublattice- and spin-dominated LL subgroups. The magnetic-field-dependent LL energy spectra exhibit irregular behavior corresponding to the critical points of the band structure. Moreover, the electric field can induce many LL anticrossings. The main features of the LLs are uncovered with many van Hove singularities in the density-of-states and nonuniform delta-function-like peaks in the magnetoabsorption spectra. The feature-rich magnetic quantization directly reflects the geometric symmetries, intralayer and interlayer atomic interactions, spin-orbital couplings, and field effects. The results of this work can be applied to novel designs of Si-based nanoelectronics and nanodevices with enhanced mobilities.

  15. Universal Sign Control of Coupling in Tight-Binding Lattices

    NASA Astrophysics Data System (ADS)

    Keil, Robert; Poli, Charles; Heinrich, Matthias; Arkinstall, Jake; Weihs, Gregor; Schomerus, Henning; Szameit, Alexander

    2016-05-01

    We present a method of locally inverting the sign of the coupling term in tight-binding systems, by means of inserting a judiciously designed ancillary site and eigenmode matching of the resulting vertex triplet. Our technique can be universally applied to all lattice configurations, as long as the individual sites can be detuned. We experimentally verify this method in laser-written photonic lattices and confirm both the magnitude and the sign of the coupling by interferometric measurements. Based on these findings, we demonstrate how such universal sign-flipped coupling links can be embedded into extended lattice structures to impose a Z2-gauge transformation. This opens a new avenue for investigations on topological effects arising from magnetic fields with aperiodic flux patterns or in disordered systems.

  16. Assessment of the Density Functional Tight Binding Method for Protic Ionic Liquids

    PubMed Central

    2015-01-01

    Density functional tight binding (DFTB), which is ∼100–1000 times faster than full density functional theory (DFT), has been used to simulate the structure and properties of protic ionic liquid (IL) ions, clusters of ions and the bulk liquid. Proton affinities for a wide range of IL cations and anions determined using DFTB generally reproduce G3B3 values to within 5–10 kcal/mol. The structures and thermodynamic stabilities of n-alkyl ammonium nitrate clusters (up to 450 quantum chemical atoms) predicted with DFTB are in excellent agreement with those determined using DFT. The IL bulk structure simulated using DFTB with periodic boundary conditions is in excellent agreement with published neutron diffraction data. PMID:25328497

  17. Grain-Boundary Resistance in Copper Interconnects: From an Atomistic Model to a Neural Network

    NASA Astrophysics Data System (ADS)

    Valencia, Daniel; Wilson, Evan; Jiang, Zhengping; Valencia-Zapata, Gustavo A.; Wang, Kuang-Chung; Klimeck, Gerhard; Povolotskyi, Michael

    2018-04-01

    Orientation effects on the specific resistance of copper grain boundaries are studied systematically with two different atomistic tight-binding methods. A methodology is developed to model the specific resistance of grain boundaries in the ballistic limit using the embedded atom model, tight- binding methods, and nonequilibrium Green's functions. The methodology is validated against first-principles calculations for thin films with a single coincident grain boundary, with 6.4% deviation in the specific resistance. A statistical ensemble of 600 large, random structures with grains is studied. For structures with three grains, it is found that the distribution of specific resistances is close to normal. Finally, a compact model for grain-boundary-specific resistance is constructed based on a neural network.

  18. Structure and electronic properties of ion pairs accompanying cyclic morpholinium cation and alkylphosphite anion based ionic liquids

    NASA Astrophysics Data System (ADS)

    Verma, Prakash L.; Singh, Priti; Gejji, Shridhar P.

    2017-07-01

    Molecular insights for the formation of ion pairs accompanying the cyclic ammonium cation based room temperature ionic liquids (RTILs) composed of alkyl substituted N-methylmorpholinium (RMMor) and alkylphosphite [(Rsbnd O)2PHdbnd O] (Rdbnd ethyl, butyl, hexyl, octyl) anion have been derived from the M06-2x level of theory. Electronic structures, binding energies, and spectral characteristics of the ion pairs underlying these RTILs have been characterized. The ion pair formation is largely governed by Csbnd H⋯O and other intermolecular interactions. Calculated binding energies increase with the increasing alkyl chain on either cation or alkylphosphite anion. The cation-anion binding reveals signature in the frequency down-(red) shift of the characteristic anionic Pdbnd O stretching whereas the Psbnd H stretching exhibits a shift in the opposite direction in vibrational spectra which has further been rationalized through molecular electron density topography. Correlations of measured electrochemical stability with the separation of frontier orbital energies and binding energies in the ion pairs have further been established.

  19. Molecular Dynamics Simulation of the Complex PBP-2x with Drug Cefuroxime to Explore the Drug Resistance Mechanism of Streptococcus suis R61

    PubMed Central

    Xia, Yingjie; Yang, Ming; Xiao, Jingfa; Yu, Jun

    2012-01-01

    Drug resistance of Streptococcus suis strains is a worldwide problem for both humans and pigs. Previous studies have noted that penicillin-binding protein (PBPs) mutation is one important cause of β-lactam antibiotic resistance. In this study, we used the molecular dynamics (MD) method to study the interaction differences between cefuroxime (CES) and PBP2x within two newly sequenced Streptococcus suis: drug-sensitive strain A7, and drug-resistant strain R61. The MM-PBSA results proved that the drug bound much more tightly to PBP2x in A7 (PBP2x-A7) than to PBP2x in R61 (PBP2x-R61). This is consistent with the evidently different resistances of the two strains to cefuroxime. Hydrogen bond analysis indicated that PBP2x-A7 preferred to bind to cefuroxime rather than to PBP2x-R61. Three stable hydrogen bonds were formed by the drug and PBP2x-A7, while only one unstable bond existed between the drug and PBP2x-R61. Further, we found that the Gln569, Tyr594, and Gly596 residues were the key mutant residues contributing directly to the different binding by pair wise energy decomposition comparison. By investigating the binding mode of the drug, we found that mutant residues Ala320, Gln553, and Thr595 indirectly affected the final phenomenon by topological conformation alteration. Above all, our results revealed some details about the specific interaction between the two PBP2x proteins and the drug cefuroxime. To some degree, this explained the drug resistance mechanism of Streptococcus suis and as a result could be helpful for further drug design or improvement. PMID:22563422

  20. Molecular dynamics simulation of the complex PBP-2x with drug cefuroxime to explore the drug resistance mechanism of Streptococcus suis R61.

    PubMed

    Ge, Yan; Wu, Jiayan; Xia, Yingjie; Yang, Ming; Xiao, Jingfa; Yu, Jun

    2012-01-01

    Drug resistance of Streptococcus suis strains is a worldwide problem for both humans and pigs. Previous studies have noted that penicillin-binding protein (PBPs) mutation is one important cause of β-lactam antibiotic resistance. In this study, we used the molecular dynamics (MD) method to study the interaction differences between cefuroxime (CES) and PBP2x within two newly sequenced Streptococcus suis: drug-sensitive strain A7, and drug-resistant strain R61. The MM-PBSA results proved that the drug bound much more tightly to PBP2x in A7 (PBP2x-A7) than to PBP2x in R61 (PBP2x-R61). This is consistent with the evidently different resistances of the two strains to cefuroxime. Hydrogen bond analysis indicated that PBP2x-A7 preferred to bind to cefuroxime rather than to PBP2x-R61. Three stable hydrogen bonds were formed by the drug and PBP2x-A7, while only one unstable bond existed between the drug and PBP2x-R61. Further, we found that the Gln569, Tyr594, and Gly596 residues were the key mutant residues contributing directly to the different binding by pair wise energy decomposition comparison. By investigating the binding mode of the drug, we found that mutant residues Ala320, Gln553, and Thr595 indirectly affected the final phenomenon by topological conformation alteration. Above all, our results revealed some details about the specific interaction between the two PBP2x proteins and the drug cefuroxime. To some degree, this explained the drug resistance mechanism of Streptococcus suis and as a result could be helpful for further drug design or improvement.

  1. Matrix metalloproteinase-10/TIMP-2 structure and analyses define conserved core interactions and diverse exosite interactions in MMP/TIMP complexes.

    PubMed

    Batra, Jyotica; Soares, Alexei S; Mehner, Christine; Radisky, Evette S

    2013-01-01

    Matrix metalloproteinases (MMPs) play central roles in vertebrate tissue development, remodeling, and repair. The endogenous tissue inhibitors of metalloproteinases (TIMPs) regulate proteolytic activity by binding tightly to the MMP active site. While each of the four TIMPs can inhibit most MMPs, binding data reveal tremendous heterogeneity in affinities of different TIMP/MMP pairs, and the structural features that differentiate stronger from weaker complexes are poorly understood. Here we report the crystal structure of the comparatively weakly bound human MMP-10/TIMP-2 complex at 2.1 Å resolution. Comparison with previously reported structures of MMP-3/TIMP-1, MT1-MMP/TIMP-2, MMP-13/TIMP-2, and MMP-10/TIMP-1 complexes offers insights into the structural basis of binding selectivity. Our analyses identify a group of highly conserved contacts at the heart of MMP/TIMP complexes that define the conserved mechanism of inhibition, as well as a second category of diverse adventitious contacts at the periphery of the interfaces. The AB loop of the TIMP N-terminal domain and the contact loops of the TIMP C-terminal domain form highly variable peripheral contacts that can be considered as separate exosite interactions. In some complexes these exosite contacts are extensive, while in other complexes the AB loop or C-terminal domain contacts are greatly reduced and appear to contribute little to complex stability. Our data suggest that exosite interactions can enhance MMP/TIMP binding, although in the relatively weakly bound MMP-10/TIMP-2 complex they are not well optimized to do so. Formation of highly variable exosite interactions may provide a general mechanism by which TIMPs are fine-tuned for distinct regulatory roles in biology.

  2. Effects of Emotion on Associative Recognition: Valence and Retention Interval Matter

    PubMed Central

    Pierce, Benton H.; Kensinger, Elizabeth A.

    2011-01-01

    In two experiments, we examined the effects of emotional valence and arousal on associative binding. Participants studied negative, positive, and neutral word pairs, followed by an associative recognition test. In Experiment 1, with a short-delayed test, accuracy for intact pairs was equivalent across valences, whereas accuracy for rearranged pairs was lower for negative than for positive and neutral pairs. In Experiment 2, we tested participants after a one-week delay and found that accuracy was greater for intact negative than for intact neutral pairs, whereas rearranged pair accuracy was equivalent across valences. These results suggest that, although negative emotional valence impairs associative binding after a short delay, it may improve binding after a longer delay. The results also suggest that valence, as well as arousal, needs to be considered when examining the effects of emotion on associative memory. PMID:21401233

  3. In-surface confinement of topological insulator nanowire surface states

    NASA Astrophysics Data System (ADS)

    Chen, Fan W.; Jauregui, Luis A.; Tan, Yaohua; Manfra, Michael; Klimeck, Gerhard; Chen, Yong P.; Kubis, Tillmann

    2015-09-01

    The bandstructures of [110] and [001] Bi2Te3 nanowires are solved with the atomistic 20 band tight binding functionality of NEMO5. The theoretical results reveal: The popular assumption that all topological insulator (TI) wire surfaces are equivalent is inappropriate. The Fermi velocity of chemically distinct wire surfaces differs significantly which creates an effective in-surface confinement potential. As a result, topological insulator surface states prefer specific surfaces. Therefore, experiments have to be designed carefully not to probe surfaces unfavorable to the surface states (low density of states) and thereby be insensitive to the TI-effects.

  4. Force-field and quantum-mechanical binding study of selected SAMPL3 host-guest complexes

    NASA Astrophysics Data System (ADS)

    Hamaguchi, Nobuko; Fusti-Molnar, Laszlo; Wlodek, Stanislaw

    2012-05-01

    A Merck molecular force field classical potential combined with Poisson-Boltzmann electrostatics (MMFF/PB) has been used to estimate the binding free energy of seven guest molecules (six tertiary amines and one primary amine) into a synthetic receptor (acyclic cucurbit[4]uril congener) and two benzimidazoles into cyclic cucurbit[7]uril (CB[7]) and cucurbit[8]uril (CB[8]) hosts. In addition, binding enthalpies for the benzimidazoles were calculated with density functional theory (DFT) using the B3LYP functional and a polarizable continuum model (PCM). Although in most cases the MMFF/PB approach returned reasonable agreements with the experiment (±2 kcal/mol), significant, much larger deviations were reported in the case of three host-guest pairs. All four binding enthalpy predictions with the DFT/PCM method suffered 70% or larger deviations from the calorimetry data. Results are discussed in terms of the molecular models used for guest-host complexation and the quality of the intermolecular potentials.

  5. Regulatory coiled-coil domains promote head-to-head assemblies of AAA+ chaperones essential for tunable activity control.

    PubMed

    Carroni, Marta; Franke, Kamila B; Maurer, Michael; Jäger, Jasmin; Hantke, Ingo; Gloge, Felix; Linder, Daniela; Gremer, Sebastian; Turgay, Kürşad; Bukau, Bernd; Mogk, Axel

    2017-11-22

    Ring-forming AAA+ chaperones exert ATP-fueled substrate unfolding by threading through a central pore. This activity is potentially harmful requiring mechanisms for tight repression and substrate-specific activation. The AAA+ chaperone ClpC with the peptidase ClpP forms a bacterial protease essential to virulence and stress resistance. The adaptor MecA activates ClpC by targeting substrates and stimulating ClpC ATPase activity. We show how ClpC is repressed in its ground state by determining ClpC cryo-EM structures with and without MecA. ClpC forms large two-helical assemblies that associate via head-to-head contacts between coiled-coil middle domains (MDs). MecA converts this resting state to an active planar ring structure by binding to MD interaction sites. Loss of ClpC repression in MD mutants causes constitutive activation and severe cellular toxicity. These findings unravel an unexpected regulatory concept executed by coiled-coil MDs to tightly control AAA+ chaperone activity.

  6. A Bayesian mixture model for chromatin interaction data.

    PubMed

    Niu, Liang; Lin, Shili

    2015-02-01

    Chromatin interactions mediated by a particular protein are of interest for studying gene regulation, especially the regulation of genes that are associated with, or known to be causative of, a disease. A recent molecular technique, Chromatin interaction analysis by paired-end tag sequencing (ChIA-PET), that uses chromatin immunoprecipitation (ChIP) and high throughput paired-end sequencing, is able to detect such chromatin interactions genomewide. However, ChIA-PET may generate noise (i.e., pairings of DNA fragments by random chance) in addition to true signal (i.e., pairings of DNA fragments by interactions). In this paper, we propose MC_DIST based on a mixture modeling framework to identify true chromatin interactions from ChIA-PET count data (counts of DNA fragment pairs). The model is cast into a Bayesian framework to take into account the dependency among the data and the available information on protein binding sites and gene promoters to reduce false positives. A simulation study showed that MC_DIST outperforms the previously proposed hypergeometric model in terms of both power and type I error rate. A real data study showed that MC_DIST may identify potential chromatin interactions between protein binding sites and gene promoters that may be missed by the hypergeometric model. An R package implementing the MC_DIST model is available at http://www.stat.osu.edu/~statgen/SOFTWARE/MDM.

  7. Transformation and fate of 2,4,6-trinitrotoluene (TNT) in anaerobic bioslurry reactors under various aeration schemes: implications for the decontamination of soils.

    PubMed

    Newcombe, David A; Crawford, Ronald L

    2007-12-01

    Energetic compounds have been used in a variety of industrial and military applications worldwide leading to widespread environmental contamination. Many of these compounds are toxic and resist degradation by oxidative enzymes resulting in a need for alternative remediation methods. It has been shown that trinitrotoluene (TNT)-contaminated soil subjected to treatment in strictly anaerobic bioreactors results in tight binding of TNT transformation products to soil organic matter. The research presented here examined the fate of TNT and its metabolites in bioreactors under three different aeration regimes. In all treatment regimes, the typical metabolites of aminodinitrotoluenes and diaminonitrotoluenes were observed prior to irreversible binding into the soil fraction of the slurry. Significant transformation of TNT into organic acids or simple diols, as others report in prior work, was not observed in any of the treatments and is an unlikely fate of TNT in anaerobic soil slurries. These results indicate that aeration does not dramatically affect transformation or fate of TNT in reactor systems that receive a rich carbon source but does affect the rate at which metabolites become tightly bound to the soil. The most rapid transformations and lowest redox potentials were observed in reactors in which an aerobic headspace was maintained suggesting that aerobes play a role in establishing conditions that are most conducive to TNT reduction.

  8. Improving Density Functional Tight Binding Predictions of Free Energy Surfaces for Slow Chemical Reactions in Solution

    NASA Astrophysics Data System (ADS)

    Kroonblawd, Matthew; Goldman, Nir

    2017-06-01

    First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for reactions that are fast relative to DFT simulation times (<10 ps), but the effects on slow reactions and the free energy surface are not well-known. We present a force matching approach to improve the chemical accuracy of DFTB. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  9. Improving density functional tight binding predictions of free energy surfaces for peptide condensation reactions in solution

    NASA Astrophysics Data System (ADS)

    Kroonblawd, Matthew; Goldman, Nir

    First principles molecular dynamics using highly accurate density functional theory (DFT) is a common tool for predicting chemistry, but the accessible time and space scales are often orders of magnitude beyond the resolution of experiments. Semi-empirical methods such as density functional tight binding (DFTB) offer up to a thousand-fold reduction in required CPU hours and can approach experimental scales. However, standard DFTB parameter sets lack good transferability and calibration for a particular system is usually necessary. Force matching the pairwise repulsive energy term in DFTB to short DFT trajectories can improve the former's accuracy for chemistry that is fast relative to DFT simulation times (<10 ps), but the effects on slow chemistry and the free energy surface are not well-known. We present a force matching approach to increase the accuracy of DFTB predictions for free energy surfaces. Accelerated sampling techniques are combined with path collective variables to generate the reference DFT data set and validate fitted DFTB potentials without a priori knowledge of transition states. Accuracy of force-matched DFTB free energy surfaces is assessed for slow peptide-forming reactions by direct comparison to DFT results for particular paths. Extensions to model prebiotic chemistry under shock conditions are discussed. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  10. Dynamics and Molecular Determinants of Cytoplasmic Lipid Droplet Clustering and Dispersion

    PubMed Central

    Stefanski, Adrianne L.; McManaman, James L.

    2013-01-01

    Perilipin-1 (Plin1), a prominent cytoplasmic lipid droplet (CLD) binding phosphoprotein and key physiological regulator of triglyceride storage and lipolysis in adipocytes, is thought to regulate the fragmentation and dispersion of CLD that occurs in response to β-adrenergic activation of adenylate cyclase. Here we investigate the dynamics and molecular determinants of these processes using cell lines stably expressing recombinant forms of Plin1 and/or other members of the perilipin family. Plin1 and a C-terminal CLD-binding fragment of Plin1 (Plin1CT) induced formation of single dense CLD clusters near the microtubule organizing center, whereas neither an N-terminal CLD-binding fragment of Plin1, nor Plin2 or Plin3 induced clustering. Clustered CLD coated by Plin1, or Plin1CT, dispersed in response to isoproterenol, or other agents that activate adenylate cyclase, in a process inhibited by the protein kinase A inhibitor, H89, and blocked by microtubule disruption. Isoproterenol-stimulated phosphorylation of CLD-associated Plin1 on serine 492 preceded their dispersion, and live cell imaging showed that cluster dispersion involved initial fragmentation of tight clusters into multiple smaller clusters, which then fragmented into well-dispersed individual CLD. siRNA knockdown of the cortical actin binding protein, moesin, induced disaggregation of tight clusters into multiple smaller clusters, and inhibited the reaggregation of dispersed CLD into tight clusters. Together these data suggest that the clustering and dispersion processes involve a complex orchestration of phosphorylation-dependent, microtubule-dependent and independent, and microfilament dependent steps. PMID:23825572

  11. Development of tight-binding based GW algorithm and its computational implementation for graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Majidi, Muhammad Aziz; NUSNNI-NanoCore, Department of Physics, National University of Singapore; Singapore Synchrotron Light Source

    Graphene has been a hot subject of research in the last decade as it holds a promise for various applications. One interesting issue is whether or not graphene should be classified into a strongly or weakly correlated system, as the optical properties may change upon several factors, such as the substrate, voltage bias, adatoms, etc. As the Coulomb repulsive interactions among electrons can generate the correlation effects that may modify the single-particle spectra (density of states) and the two-particle spectra (optical conductivity) of graphene, we aim to explore such interactions in this study. The understanding of such correlation effects ismore » important because eventually they play an important role in inducing the effective attractive interactions between electrons and holes that bind them into excitons. We do this study theoretically by developing a GW method implemented on the basis of the tight-binding (TB) model Hamiltonian. Unlike the well-known GW method developed within density functional theory (DFT) framework, our TB-based GW implementation may serve as an alternative technique suitable for systems which Hamiltonian is to be constructed through a tight-binding based or similar models. This study includes theoretical formulation of the Green’s function G, the renormalized interaction function W from random phase approximation (RPA), and the corresponding self energy derived from Feynman diagrams, as well as the development of the algorithm to compute those quantities. As an evaluation of the method, we perform calculations of the density of states and the optical conductivity of graphene, and analyze the results.« less

  12. Behavioural evidence for separate mechanisms of audiovisual temporal binding as a function of leading sensory modality.

    PubMed

    Cecere, Roberto; Gross, Joachim; Thut, Gregor

    2016-06-01

    The ability to integrate auditory and visual information is critical for effective perception and interaction with the environment, and is thought to be abnormal in some clinical populations. Several studies have investigated the time window over which audiovisual events are integrated, also called the temporal binding window, and revealed asymmetries depending on the order of audiovisual input (i.e. the leading sense). When judging audiovisual simultaneity, the binding window appears narrower and non-malleable for auditory-leading stimulus pairs and wider and trainable for visual-leading pairs. Here we specifically examined the level of independence of binding mechanisms when auditory-before-visual vs. visual-before-auditory input is bound. Three groups of healthy participants practiced audiovisual simultaneity detection with feedback, selectively training on auditory-leading stimulus pairs (group 1), visual-leading stimulus pairs (group 2) or both (group 3). Subsequently, we tested for learning transfer (crossover) from trained stimulus pairs to non-trained pairs with opposite audiovisual input. Our data confirmed the known asymmetry in size and trainability for auditory-visual vs. visual-auditory binding windows. More importantly, practicing one type of audiovisual integration (e.g. auditory-visual) did not affect the other type (e.g. visual-auditory), even if trainable by within-condition practice. Together, these results provide crucial evidence that audiovisual temporal binding for auditory-leading vs. visual-leading stimulus pairs are independent, possibly tapping into different circuits for audiovisual integration due to engagement of different multisensory sampling mechanisms depending on leading sense. Our results have implications for informing the study of multisensory interactions in healthy participants and clinical populations with dysfunctional multisensory integration. © 2016 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  13. Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif

    PubMed Central

    Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.

    2011-01-01

    We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761

  14. BIPAD: A web server for modeling bipartite sequence elements

    PubMed Central

    Bi, Chengpeng; Rogan, Peter K

    2006-01-01

    Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

  15. Perfect Spin Filter by Periodic Drive of a Ferromagnetic Quantum Barrier

    NASA Astrophysics Data System (ADS)

    Thuberg, Daniel; Muñoz, Enrique; Eggert, Sebastian; Reyes, Sebastián A.

    2017-12-01

    We consider the problem of particle tunneling through a periodically driven ferromagnetic quantum barrier connected to two leads. The barrier is modeled by an impurity site representing a ferromagnetic layer or a quantum dot in a tight-binding Hamiltonian with a local magnetic field and an ac-driven potential, which is solved using the Floquet formalism. The repulsive interactions in the quantum barrier are also taken into account. Our results show that the time-periodic potential causes sharp resonances of perfect transmission and reflection, which can be tuned by the frequency, the driving strength, and the magnetic field. We demonstrate that a device based on this configuration could act as a highly tunable spin valve for spintronic applications.

  16. Before the Smashup Artist Concept

    NASA Image and Video Library

    2010-08-23

    This artist concept illustrates an imminent planetary collision around a pair of double stars. NASA Spitzer Space Telescope found evidence that such collisions could be common around a certain type of tight double, or binary, star system.

  17. Energy profile of nanobody-GFP complex under force.

    PubMed

    Klamecka, Kamila; Severin, Philip M; Milles, Lukas F; Gaub, Hermann E; Leonhardt, Heinrich

    2015-09-10

    Nanobodies (Nbs)-the smallest known fully functional and naturally occuring antigen-binding fragments-have attracted a lot of attention throughout the last two decades. Exploring their potential beyond the current use requires more detailed characterization of their binding forces as those cannot be directly derived from the binding affinities. Here we used atomic force microscope to measure rupture force of the Nb-green fluorescent protein (GFP) complex in various pulling geometries and derived the energy profile characterizing the interaction along the direction of the pulling force. We found that-despite identical epitopes-the Nb binds stronger (41-56 pN) to enhanced GFP than to wild-type GFP (28-45 pN). Measured forces make the Nb-GFP pair a potent reference for investigating molecular forces in living systems both in and ex vivo.

  18. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  19. Structure and Ligand Binding Properties of the Epoxidase Component of Styrene Monooxygenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ukaegbu, Uchechi E.; Kantz, Auric; Beaton, Michelle

    2010-07-23

    Styrene monooxygenase (SMO) is a two-component flavoprotein monooxygenase that transforms styrene to styrene oxide in the first step of the styrene catabolic and detoxification pathway of Pseudomonas putida S12. The crystal structure of the N-terminally histidine-tagged epoxidase component of this system, NSMOA, determined to 2.3 {angstrom} resolution, indicates the enzyme exists as a homodimer in which each monomer forms two distinct domains. The overall architecture is most similar to that of p-hydroxybenzoate hydroxylase (PHBH), although there are some significant differences in secondary structure. Structural comparisons suggest that a large cavity open to the surface forms the FAD binding site. Atmore » the base of this pocket is another cavity that likely represents the styrene binding site. Flavin binding and redox equilibria are tightly coupled such that reduced FAD binds apo NSMOA {approx}8000 times more tightly than the oxidized coenzyme. Equilibrium fluorescence and isothermal titration calorimetry data using benzene as a substrate analogue indicate that the oxidized flavin and substrate analogue binding equilibria of NSMOA are linked such that the binding affinity of each is increased by 60-fold when the enzyme is saturated with the other. A much weaker {approx}2-fold positive cooperative interaction is observed for the linked binding equilibria of benzene and reduced FAD. The low affinity of the substrate analogue for the reduced FAD complex of NSMOA is consistent with a preferred reaction order in which flavin reduction and reaction with oxygen precede the binding of styrene, identifying the apoenzyme structure as the key catalytic resting state of NSMOA poised to bind reduced FAD and initiate the oxygen reaction.« less

  20. The heat-shock protein Apg-2 binds to the tight junction protein ZO-1 and regulates transcriptional activity of ZONAB.

    PubMed

    Tsapara, Anna; Matter, Karl; Balda, Maria S

    2006-03-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1-ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G(1)/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1-ZONAB signaling in epithelial cells in response to cellular stress.

  1. The Heat-Shock Protein Apg-2 Binds to the Tight Junction Protein ZO-1 and Regulates Transcriptional Activity of ZONAB

    PubMed Central

    Tsapara, Anna; Matter, Karl; Balda, Maria S.

    2006-01-01

    The tight junction adaptor protein ZO-1 regulates intracellular signaling and cell proliferation. Its Src homology 3 (SH3) domain is required for the regulation of proliferation and binds to the Y-box transcription factor ZO-1-associated nucleic acid binding protein (ZONAB). Binding of ZO-1 to ZONAB results in cytoplasmic sequestration and hence inhibition of ZONAB's transcriptional activity. Here, we identify a new binding partner of the SH3 domain that modulates ZO-1–ZONAB signaling. Expression screening of a cDNA library with a fusion protein containing the SH3 domain yielded a cDNA coding for Apg-2, a member of the heat-shock protein 110 (Hsp 110) subfamily of Hsp70 heat-shock proteins, which is overexpressed in carcinomas. Regulated depletion of Apg-2 in Madin-Darby canine kidney cells inhibits G1/S phase progression. Apg-2 coimmunoprecipitates with ZO-1 and partially localizes to intercellular junctions. Junctional recruitment and coimmunoprecipitation with ZO-1 are stimulated by heat shock. Apg-2 competes with ZONAB for binding to the SH3 domain in vitro and regulates ZONAB's transcriptional activity in reporter gene assays. Our data hence support a model in which Apg-2 regulates ZONAB function by competing for binding to the SH3 domain of ZO-1 and suggest that Apg-2 functions as a regulator of ZO-1–ZONAB signaling in epithelial cells in response to cellular stress. PMID:16407410

  2. The bioreactivity of the sub-10 μm component of volcanic ash: Soufrière Hills volcano, Montserrat.

    PubMed

    Jones, Timothy; Bérubé, Kelly

    2011-10-30

    With the recent eruption of the Icelandic volcano Eyafallajökull and resulting ash cloud over much of Europe there was considerable concern about possible respiratory hazards. Volcanic ash can contain minerals that are known human respiratory health hazards such as cristobalite. Short-term ash exposures can cause skin sores, respiratory and ocular irritations and exacerbation of pre-existing lung conditions such as asthma. Long-term occupational level exposures to crystalline silicon dioxide can cause lung inflammation, oedema, fibrosis and cancer. The potential health effects would be dependent on factors including mineralogy, surface chemistry, size, and levels and duration of exposure. Bulk ash from the Soufrière Hills volcano was sourced and inhalable (<2.5 μm) ash samples prepared and physicochemically characterised. The fine ash samples were tested for bioreactivity by SDS-PAGE which determined the strength of binding between mineral grains and lung proteins. Selected proteins bound tightly to cristobalite, and bound loosely to other ash components. A positive correlation was seen between the amount of SiO(2) in the sample and the strength of the binding. The strength of binding is a function of the mineral's bioreactivity, and therefore, a potential geo-biomarker of respiratory risk. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Pseudo-magnetic fields of strongly-curved graphene nanobubbles

    NASA Astrophysics Data System (ADS)

    Liu, Li-Chi

    2018-04-01

    We use the π-orbital axis vector (POAV) analysis to deal with large curvature effect of graphene in the tight-binding model. To test the validities of pseudo-magnetic fields (PMFs) derived from the tight-binding model and the model with Dirac equation coupled to a curved surface, we propose two types of spatially constant-field topographies for strongly-curved graphene nanobubbles, which correspond to these two models, respectively. It is shown from the latter model that the PMF induced by any spherical graphene nanobubble is always equivalent to the magnetic field caused by one magnetic monopole charge distributed on a complete spherical surface with the same radius. Such a PMF might be attributed to the isometry breaking of a graphene layer attached conformably to a spherical substrate with adhesion.

  4. Surface Passivation in Empirical Tight Binding

    NASA Astrophysics Data System (ADS)

    He, Yu; Tan, Yaohua; Jiang, Zhengping; Povolotskyi, Michael; Klimeck, Gerhard; Kubis, Tillmann

    2016-03-01

    Empirical Tight Binding (TB) methods are widely used in atomistic device simulations. Existing TB methods to passivate dangling bonds fall into two categories: 1) Method that explicitly includes passivation atoms is limited to passivation with atoms and small molecules only. 2) Method that implicitly incorporates passivation does not distinguish passivation atom types. This work introduces an implicit passivation method that is applicable to any passivation scenario with appropriate parameters. This method is applied to a Si quantum well and a Si ultra-thin body transistor oxidized with SiO2 in several oxidation configurations. Comparison with ab-initio results and experiments verifies the presented method. Oxidation configurations that severely hamper the transistor performance are identified. It is also shown that the commonly used implicit H atom passivation overestimates the transistor performance.

  5. Tight-binding approximations to time-dependent density functional theory — A fast approach for the calculation of electronically excited states

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rüger, Robert, E-mail: rueger@scm.com; Department of Theoretical Chemistry, Vrije Universiteit Amsterdam, De Boelelaan 1083, 1081 HV Amsterdam; Wilhelm-Ostwald-Institut für Physikalische und Theoretische Chemie, Linnéstr. 2, 04103 Leipzig

    2016-05-14

    We propose a new method of calculating electronically excited states that combines a density functional theory based ground state calculation with a linear response treatment that employs approximations used in the time-dependent density functional based tight binding (TD-DFTB) approach. The new method termed time-dependent density functional theory TD-DFT+TB does not rely on the DFTB parametrization and is therefore applicable to systems involving all combinations of elements. We show that the new method yields UV/Vis absorption spectra that are in excellent agreement with computationally much more expensive TD-DFT calculations. Errors in vertical excitation energies are reduced by a factor of twomore » compared to TD-DFTB.« less

  6. Rapid calculation method for Frenkel-type two-exciton states in one to three dimensions

    NASA Astrophysics Data System (ADS)

    Ajiki, Hiroshi

    2014-07-01

    Biexciton and two-exciton dissociated states of Frenkel-type excitons are well described by a tight-binding model with a nearest-neighbor approximation. Such two-exciton states in a finite-size lattice are usually calculated by numerical diagonalization of the Hamiltonian, which requires an increasing amount of computational time and memory as the lattice size increases. I develop here a rapid, memory-saving method to calculate the energies and wave functions of two-exciton states by employing a bisection method. In addition, an attractive interaction between two excitons in the tight-binding model can be obtained directly so that the biexciton energy agrees with the observed energy, without the need for the trial-and-error procedure implemented in the numerical diagonalization method.

  7. Gaussian polarizable-ion tight binding.

    PubMed

    Boleininger, Max; Guilbert, Anne Ay; Horsfield, Andrew P

    2016-10-14

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  8. Gaussian polarizable-ion tight binding

    NASA Astrophysics Data System (ADS)

    Boleininger, Max; Guilbert, Anne AY; Horsfield, Andrew P.

    2016-10-01

    To interpret ultrafast dynamics experiments on large molecules, computer simulation is required due to the complex response to the laser field. We present a method capable of efficiently computing the static electronic response of large systems to external electric fields. This is achieved by extending the density-functional tight binding method to include larger basis sets and by multipole expansion of the charge density into electrostatically interacting Gaussian distributions. Polarizabilities for a range of hydrocarbon molecules are computed for a multipole expansion up to quadrupole order, giving excellent agreement with experimental values, with average errors similar to those from density functional theory, but at a small fraction of the cost. We apply the model in conjunction with the polarizable-point-dipoles model to estimate the internal fields in amorphous poly(3-hexylthiophene-2,5-diyl).

  9. Multi-orbit tight binding calculations for spin transfer torque in magnetic tunneling junctions

    NASA Astrophysics Data System (ADS)

    You, Chun-Yeol; Han, Jae-Ho; Lee, Hyun-Woo

    2012-04-01

    We investigate the spin transfer torque (STT) with multi-orbit tight binding model in the magnetic tunneling junctions (MTJs). So far, most of the theoretical works based on the non-equilibrium Keldysh Green's function method employ a single band model for the simplicity, except a few first principle studies. Even though the single band model captures main physics of STT in MTJ, multi-band calculation reveals new features of the STT that depend on band parameters, such as insulator bandgap, inter-band hopping energy of the ferromagnetic layer. We find that the sign change of perpendicular torkance with bandgap of the insulator layer, and when we allow the inter-band hopping, the bias dependences of perpendicular STT are dramatically changed, while no noticeable changes in parallel STT are found.

  10. The electrostatic characteristics of G·U wobble base pairs

    PubMed Central

    Xu, Darui; Landon, Theresa; Greenbaum, Nancy L.; Fenley, Marcia O.

    2007-01-01

    G·U wobble base pairs are the most common and highly conserved non-Watson–Crick base pairs in RNA. Previous surface maps imply uniformly negative electrostatic potential at the major groove of G·U wobble base pairs embedded in RNA helices, suitable for entrapment of cationic ligands. In this work, we have used a Poisson–Boltzmann approach to gain a more detailed and accurate characterization of the electrostatic profile. We found that the major groove edge of an isolated G·U wobble displays distinctly enhanced negativity compared with standard GC or AU base pairs; however, in the context of different helical motifs, the electrostatic pattern varies. G·U wobbles with distinct widening have similar major groove electrostatic potentials to their canonical counterparts, whereas those with minimal widening exhibit significantly enhanced electronegativity, ranging from 0.8 to 2.5 kT/e, depending upon structural features. We propose that the negativity at the major groove of G·U wobble base pairs is determined by the combined effect of the base atoms and the sugar-phosphate backbone, which is impacted by stacking pattern and groove width as a result of base sequence. These findings are significant in that they provide predictive power with respect to which G·U sites in RNA are most likely to bind cationic ligands. PMID:17526525

  11. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  12. Hfq restructures RNA-IN and RNA-OUT and facilitates antisense pairing in the Tn10/IS10 system

    PubMed Central

    Ross, Joseph A.; Ellis, Michael J.; Hossain, Shahan; Haniford, David B.

    2013-01-01

    Hfq functions in post-transcriptional gene regulation in a wide range of bacteria, usually by promoting base-pairing of mRNAs and trans-encoded sRNAs that share partial sequence complementarity. It is less clear if Hfq is required for pairing of cis-encoded RNAs (i.e., antisense RNAs) with their target mRNAs. In the current work, we have characterized the interactions between Escherichia coli Hfq and the components of the Tn10/IS10 antisense system, RNA-IN and RNA-OUT. We show that Hfq interacts with RNA-OUT through its proximal RNA-binding surface, as is typical for Hfq and trans-encoded sRNAs. In contrast, RNA-IN binds both proximal and distal RNA-binding surfaces in Hfq with a higher affinity for the latter, as is typical for mRNA interactions in canonical sRNA-mRNA pairs. Importantly, an amino acid substitution in Hfq that interferes with RNA binding to the proximal site negatively impacts RNA-IN:OUT pairing in vitro and suppresses the ability of Hfq to negatively regulate IS10 transposition in vivo. We also show that Hfq binding to RNA-IN and RNA-OUT alters secondary structure elements in both of these RNAs and speculate that this could be important in how Hfq facilitates RNA-IN:OUT pairing. Based on the results presented here, we suggest that Hfq could be involved in regulating RNA pairing in other antisense systems, including systems encoded by other transposable elements. PMID:23510801

  13. Identification of stepped changes of binding affinity during interactions between the disintegrin rhodostomin and integrin αIIbβ3 in living cells using optical tweezers

    NASA Astrophysics Data System (ADS)

    Hsieh, Chia-Fen; Chang, Bo-Jui; Pai, Chyi-Huey; Chen, Hsuan-Yi; Chi, Sien; Hsu, Long; Tsai, Jin-Wu; Lin, Chi-Hung

    2004-10-01

    Integrin receptors serve as both mechanical links and signal transduction mediators between the cell and its environment. Experimental evidence demonstrates that conformational changes and lateral clustering of the integrin proteins may affect their binding to ligands and regulate downstream cellular responses; however, experimental links between the structural and functional correlations of the ligand-receptor interactions are not yet elucidated. In the present report, we utilized optical tweezers to measure the dynamic binding between the snake venom rhodostomin, coated on a microparticle and functioned as a ligand, and the membrane receptor integrin alpha(IIb)beta(3) expressed on a Chinese Hamster Ovary (CHO) cell. A progressive increase of total binding affinity was found between the bead and CHO cell in the first 300 sec following optical tweezers-guided contact. Further analysis of the cumulative data revealed the presence of "unit binding force" presumably exerted by a single rhodostomin-integrin pair. Interestingly, two such units were found. Among the measurements of less total binding forces, presumably taken at the early stage of ligand-receptor interactions, a unit of 4.15 pN per molecule pair was derived. This unit force dropped to 2.54 pN per molecule pair toward the later stage of interactions when the total binding forces were relatively large. This stepped change of single molecule pair binding affinity was not found when mutant rhodostomin proteins were used as ligands (a single unit of 1.81 pN per pair was found). These results were interpreted along with the current knowledge about the conformational changes of integrins during the "molecule activation" process.

  14. Ni2+-binding RNA motifs with an asymmetric purine-rich internal loop and a G-A base pair.

    PubMed Central

    Hofmann, H P; Limmer, S; Hornung, V; Sprinzl, M

    1997-01-01

    RNA molecules with high affinity for immobilized Ni2+ were isolated from an RNA pool with 50 randomized positions by in vitro selection-amplification. The selected RNAs preferentially bind Ni2+ and Co2+ over other cations from first series transition metals. Conserved structure motifs, comprising about 15 nt, were identified that are likely to represent the Ni2+ binding sites. Two conserved motifs contain an asymmetric purine-rich internal loop and probably a mismatch G-A base pair. The structure of one of these motifs was studied with proton NMR spectroscopy and formation of the G-A pair at the junction of helix and internal loop was demonstrated. Using Ni2+ as a paramagnetic probe, a divalent metal ion binding site near this G-A base pair was identified. Ni2+ ions bound to this motif exert a specific stabilization effect. We propose that small asymmetric purine-rich loops that contain a G-A interaction may represent a divalent metal ion binding site in RNA. PMID:9409620

  15. Mojo Hand, a TALEN design tool for genome editing applications.

    PubMed

    Neff, Kevin L; Argue, David P; Ma, Alvin C; Lee, Han B; Clark, Karl J; Ekker, Stephen C

    2013-01-16

    Recent studies of transcription activator-like (TAL) effector domains fused to nucleases (TALENs) demonstrate enormous potential for genome editing. Effective design of TALENs requires a combination of selecting appropriate genetic features, finding pairs of binding sites based on a consensus sequence, and, in some cases, identifying endogenous restriction sites for downstream molecular genetic applications. We present the web-based program Mojo Hand for designing TAL and TALEN constructs for genome editing applications (http://www.talendesign.org). We describe the algorithm and its implementation. The features of Mojo Hand include (1) automatic download of genomic data from the National Center for Biotechnology Information, (2) analysis of any DNA sequence to reveal pairs of binding sites based on a user-defined template, (3) selection of restriction-enzyme recognition sites in the spacer between the TAL monomer binding sites including options for the selection of restriction enzyme suppliers, and (4) output files designed for subsequent TALEN construction using the Golden Gate assembly method. Mojo Hand enables the rapid identification of TAL binding sites for use in TALEN design. The assembly of TALEN constructs, is also simplified by using the TAL-site prediction program in conjunction with a spreadsheet management aid of reagent concentrations and TALEN formulation. Mojo Hand enables scientists to more rapidly deploy TALENs for genome editing applications.

  16. Perspectives from ab-initio and tight-binding: Applications to transition metal compounds and superlattices

    NASA Astrophysics Data System (ADS)

    Venkataraman, Vijay Shankar

    The experimental and theoretical study of transition metal compounds have occupied condensed matter physicists for the best part of the last century. The rich variety of physical behaviour exhibited by these compounds owes its origin to the subtle balance of the energy scales at play for the d orbitals. In this thesis, we study three different systems comprised of transition metal atoms from the third, the fourth, and the fifth group of the periodic table using a combination of ab-initio density functional theory (DFT) computations and effective tight-binding models for the electronic properties. We first consider the electronic properties of artificially fabricated perovskite superlattices of the form [(SrIrO3)m / SrTiO3] with integer m denoting the number of layers of SrIrO3. After discussing the results of experiments undertaken by our collaborators, we present the results of our DFT calculations and build tight-binding models for the m = 1 and m = 2 superlattices. The active ingredient is found to be the 5d orbitals with significant spin-orbit coupling. We then study the energies of magnetic ground states within DFT and compare and contrast our results with those obtained for the bulk Ruddlesden-Popper iridates. Together with experimental measurements, our results suggest that these superlattices are an exciting venue to probe the magnetism and metal-insulator transitions that occur from the intricate balance of the spin-orbit coupling and electron interactions, as has been reported for their bulk counterparts. Next, we consider alpha-RuCl3, a honeycomb lattice compound. We first show using DFT calculations in conjunction with experiments performed by our collaborators, how spin-orbit coupling in the 4d orbitals of Ru is essential to understand the insulating state realized in this compound. Then, in the latter half of the chapter, we study the magnetic ground states of a two-dimensional analogue of alpha-RuCl3 in weak and strong-coupling regimes obtained from a tight-binding model for the 4d orbitals. We further compare these results with energies obtained from DFT calculations. We obtain a zig-zag magnetic ground state for this compound, in all the three approaches. Within DFT, we find that correlations enhance the spin-orbit coupling in this compound and that the anisotropic Kitaev interactions between the spins are dominant in a strong-coupling model. Then, we move on to study the electronic band structures of the higher manganese silicides, which are good thermoelectric materials. Using results from DFT calculations on Mn4Si7 and structural arguments, we construct an effective tight-binding model for the first three members of this series - Mn4Si7, Mn11Si19, and Mn15Si26.

  17. Efficient self-consistency for magnetic tight binding

    NASA Astrophysics Data System (ADS)

    Soin, Preetma; Horsfield, A. P.; Nguyen-Manh, D.

    2011-06-01

    Tight binding can be extended to magnetic systems by including an exchange interaction on an atomic site that favours net spin polarisation. We have used a published model, extended to include long-ranged Coulomb interactions, to study defects in iron. We have found that achieving self-consistency using conventional techniques was either unstable or very slow. By formulating the problem of achieving charge and spin self-consistency as a search for stationary points of a Harris-Foulkes functional, extended to include spin, we have derived a much more efficient scheme based on a Newton-Raphson procedure. We demonstrate the capabilities of our method by looking at vacancies and self-interstitials in iron. Self-consistency can indeed be achieved in a more efficient and stable manner, but care needs to be taken to manage this. The algorithm is implemented in the code PLATO. Program summaryProgram title:PLATO Catalogue identifier: AEFC_v2_0 Program summary URL:http://cpc.cs.qub.ac.uk/summaries/AEFC_v2_0.html Program obtainable from: CPC Program Library, Queen's University, Belfast, N. Ireland Licensing provisions: Standard CPC licence, http://cpc.cs.qub.ac.uk/licence/licence.html No. of lines in distributed program, including test data, etc.: 228 747 No. of bytes in distributed program, including test data, etc.: 1 880 369 Distribution format: tar.gz Programming language: C and PERL Computer: Apple Macintosh, PC, Unix machines Operating system: Unix, Linux, Mac OS X, Windows XP Has the code been vectorised or parallelised?: Yes. Up to 256 processors tested RAM: Up to 2 Gbytes per processor Classification: 7.3 External routines: LAPACK, BLAS and optionally ScaLAPACK, BLACS, PBLAS, FFTW Catalogue identifier of previous version: AEFC_v1_0 Journal reference of previous version: Comput. Phys. Comm. 180 (2009) 2616 Does the new version supersede the previous version?: Yes Nature of problem: Achieving charge and spin self-consistency in magnetic tight binding can be very difficult. Our existing schemes failed altogether, or were very slow. Solution method: A new scheme for achieving self-consistency in orthogonal tight binding has been introduced that explicitly evaluates the first and second derivatives of the energy with respect to input charge and spin, and then uses these to search for stationary values of the energy. Reasons for new version: Bug fixes and new functionality. Summary of revisions: New charge and spin mixing scheme for orthogonal tight binding. Numerous small bug fixes. Restrictions: The new mixing scheme scales poorly with system size. In particular the memory usage scales as number of atoms to the power 4. It is restricted to systems with about 200 atoms or less. Running time: Test cases will run in a few minutes, large calculations may run for several days.

  18. Differences in binding and monitoring mechanisms contribute to lifespan age differences in false memory.

    PubMed

    Fandakova, Yana; Shing, Yee Lee; Lindenberger, Ulman

    2013-10-01

    Based on a 2-component framework of episodic memory development across the lifespan (Shing & Lindenberger, 2011), we examined the contribution of memory-related binding and monitoring processes to false memory susceptibility in childhood and old age. We administered a repeated continuous recognition task to children (N = 20, 10-12 years), younger adults (N = 20, 20-27 years), and older adults (N = 21, 68-76 years). Participants saw the same set of unrelated word pairs in 3 consecutive runs and their task was to identify pair reoccurrences within runs. Across runs, correct detection of repeated pairs decreased in children only, whereas false recognition of lure pairs showed a greater increase in older adults than in children or younger adults. False recognition of rearranged pairs decreased across runs for all participants. This decrease was most pronounced in children, in particular for high-confidence memory errors. We conclude that memory binding mechanisms are sufficiently developed in children to facilitate memory monitoring and reduce false memory for associative information. In contrast, older adults show senescent impairments in both binding and monitoring mechanisms that both contribute to elevated illusory recollections in old age. We conclude that binding and monitoring processes during memory performance follow different developmental trajectories from childhood to old age.

  19. Loosenin, a novel protein with cellulose-disrupting activity from Bjerkandera adusta.

    PubMed

    Quiroz-Castañeda, Rosa E; Martínez-Anaya, Claudia; Cuervo-Soto, Laura I; Segovia, Lorenzo; Folch-Mallol, Jorge L

    2011-02-11

    Expansins and expansin-like proteins loosen cellulose microfibrils, possibly through the rupture of intramolecular hydrogen bonds. Together with the use of lignocellulolytic enzymes, these proteins are potential molecular tools to treat plant biomass to improve saccharification yields. Here we describe a new type of expansin-related fungal protein that we have called loosenin. Its corresponding gene, loos1, from the basidiomycete Bjerkandera adusta, was cloned and heterologously expressed in Saccharomyces cerevisiae. LOOS1 is distantly related to plant expansins through the shared presence of a DPBB domain, however domain II found in plant expansins is absent. LOOS1 binds tightly to cellulose and chitin, and we demonstrate that cotton fibers become susceptible to the action of a commercial cellulase following treatment with LOOS1. Natural fibers of Agave tequilana also become susceptible to hydrolysis by cellulases after loosenin treatment. LOOS1 is a new type of protein with disrupting activity on cellulose. LOOS1 binds polysaccharides, and given its enhancing properties on the action of hydrolytic enzymes, LOOS1 represents a potential additive in the production of fermentable sugars from lignocellulose.

  20. Loosenin, a novel protein with cellulose-disrupting activity from Bjerkandera adusta

    PubMed Central

    2011-01-01

    Background Expansins and expansin-like proteins loosen cellulose microfibrils, possibly through the rupture of intramolecular hydrogen bonds. Together with the use of lignocellulolytic enzymes, these proteins are potential molecular tools to treat plant biomass to improve saccharification yields. Results Here we describe a new type of expansin-related fungal protein that we have called loosenin. Its corresponding gene, loos1, from the basidiomycete Bjerkandera adusta, was cloned and heterologously expressed in Saccharomyces cerevisiae. LOOS1 is distantly related to plant expansins through the shared presence of a DPBB domain, however domain II found in plant expansins is absent. LOOS1 binds tightly to cellulose and chitin, and we demonstrate that cotton fibers become susceptible to the action of a commercial cellulase following treatment with LOOS1. Natural fibers of Agave tequilana also become susceptible to hydrolysis by cellulases after loosenin treatment. Conclusions LOOS1 is a new type of protein with disrupting activity on cellulose. LOOS1 binds polysaccharides, and given its enhancing properties on the action of hydrolytic enzymes, LOOS1 represents a potential additive in the production of fermentable sugars from lignocellulose. PMID:21314954

  1. Carbon Nanotube Based Molecular Electronics

    NASA Technical Reports Server (NTRS)

    Srivastava, Deepak; Saini, Subhash; Menon, Madhu

    1998-01-01

    Carbon nanotubes and the nanotube heterojunctions have recently emerged as excellent candidates for nanoscale molecular electronic device components. Experimental measurements on the conductivity, rectifying behavior and conductivity-chirality correlation have also been made. While quasi-one dimensional simple heterojunctions between nanotubes with different electronic behavior can be generated by introduction of a pair of heptagon-pentagon defects in an otherwise all hexagon graphene sheet. Other complex 3- and 4-point junctions may require other mechanisms. Structural stability as well as local electronic density of states of various nanotube junctions are investigated using a generalized tight-binding molecular dynamics (GDBMD) scheme that incorporates non-orthogonality of the orbitals. The junctions investigated include straight and small angle heterojunctions of various chiralities and diameters; as well as more complex 'T' and 'Y' junctions which do not always obey the usual pentagon-heptagon pair rule. The study of local density of states (LDOS) reveal many interesting features, most prominent among them being the defect-induced states in the gap. The proposed three and four pointjunctions are one of the smallest possible tunnel junctions made entirely of carbon atoms. Furthermore the electronic behavior of the nanotube based device components can be taylored by doping with group III-V elements such as B and N, and BN nanotubes as a wide band gap semiconductor has also been realized in experiments. Structural properties of heteroatomic nanotubes comprising C, B and N will be discussed.

  2. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway.

    PubMed

    Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse

    2017-06-19

    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.

  3. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway

    PubMed Central

    2017-01-01

    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N2-dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the “pre-flipped” base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [MuH., (2015) Biochemistry, 54(34), 5263−726270861]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER. PMID:28460163

  4. Isoelectronic bound-exciton photoluminescence in strained beryllium-doped Si0.92Ge0.08 epilayers and Si0.92Ge0.08/Si superlattices at ambient and elevated hydrostatic pressure

    NASA Astrophysics Data System (ADS)

    Kim, Sangsig; Chang, Ganlin; Herman, Irving P.; Bevk, Joze; Moore, Karen L.; Hall, Dennis G.

    1997-03-01

    Photoluminescence (PL) from a beryllium-doped Si0.92Ge0.08 epilayer and three different beryllium-doped Si0.92Ge0.08/Si superlattices (SL's) commensurately grown on Si(100) substrates is examined at 9 K at ambient pressure and, for the epilayer and one SL, as a function of hydrostatic pressure. In each structure, excitons bind to the isoelectronic Be pairs in the strained Si0.92Ge0.08 layers. The zero-phonon PL peaks of the epilayer and the in situ doped 50-Å Si0.92Ge0.08/100-Å Si SL shift linearly with pressure toward lower energy at the rate of 0.68+/-0.03 and 0.97+/-0.03 meV/kbar, respectively, which are near the 0.77-meV/kbar value for Si:Be. The PL energies at ambient and elevated pressure are analyzed by accounting for strain, quantum confinement, and exciton binding. A modified Hopfield-Thomas-Lynch model is used to model exciton binding to the Be pairs. This model, in which potential wells bind electrons to a site (that then trap holes), predicts a distribution of electron binding energies when an inhomogeneous distribution of potential-well depths is used. This accounts for the large PL linewidth and the decrease of linewidth with increasing pressure, among other observations. In SL's, the exciton binding energy is shown to depend on the width of the wells as well as the spatial distribution of Be dopants in the superlattice. Also, at and above 58 kbar a very unusual peak is observed in one of the SL's, which is associated with a free-exciton peak in Si, that shifts very fast with pressure (-6.02+/-0.03 meV/kbar).

  5. Error estimates for (semi-)empirical dispersion terms and large biomacromolecules.

    PubMed

    Korth, Martin

    2013-10-14

    The first-principles modeling of biomaterials has made tremendous advances over the last few years with the ongoing growth of computing power and impressive developments in the application of density functional theory (DFT) codes to large systems. One important step forward was the development of dispersion corrections for DFT methods, which account for the otherwise neglected dispersive van der Waals (vdW) interactions. Approaches at different levels of theory exist, with the most often used (semi-)empirical ones based on pair-wise interatomic C6R(-6) terms. Similar terms are now also used in connection with semiempirical QM (SQM) methods and density functional tight binding methods (SCC-DFTB). Their basic structure equals the attractive term in Lennard-Jones potentials, common to most force field approaches, but they usually use some type of cutoff function to make the mixing of the (long-range) dispersion term with the already existing (short-range) dispersion and exchange-repulsion effects from the electronic structure theory methods possible. All these dispersion approximations were found to perform accurately for smaller systems, but error estimates for larger systems are very rare and completely missing for really large biomolecules. We derive such estimates for the dispersion terms of DFT, SQM and MM methods using error statistics for smaller systems and dispersion contribution estimates for the PDBbind database of protein-ligand interactions. We find that dispersion terms will usually not be a limiting factor for reaching chemical accuracy, though some force fields and large ligand sizes are problematic.

  6. Effect of Watson-Crick and Hoogsteen base pairing on the conformational stability of C8-phenoxyl-2'-deoxyguanosine adducts.

    PubMed

    Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D

    2010-10-14

    Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which implies that the anti orientation of the damaged base will be favored by hydrogen bonding in DNA helices. Additionally, regardless of the hydrogen-bonding face involved, cytosine forms the most stable base pair with the ortho adduct, which implies that misincorporation due to this type of damage is unlikely. Similarly, cytosine is the preferred binding partner for the Watson-Crick face of the para adduct. However, Hoogsteen interactions with the para adduct are stronger than those with natural 2'-deoxyguanosine or the ortho adduct, and this form of damage binds with nearly equal stability to both cytosine and guanine in the Hoogsteen orientation. Therefore, the para adduct may adopt multiple orientations in DNA helices and potentially cause mutations by forming pairs with different natural bases. Models of oligonucleotide duplexes must be used in future work to further evaluate other factors (stacking, major groove contacts) that may influence the conformation and binding preference of these adducts in DNA helices.

  7. Density-functional tight-binding investigation of the structure, stability and material properties of nickel hydroxide nanotubes

    NASA Astrophysics Data System (ADS)

    Jahangiri, Soran; Mosey, Nicholas J.

    2018-01-01

    Nickel hydroxide is a material composed of two-dimensional layers that can be rolled up to form cylindrical nanotubes belonging to a class of inorganic metal hydroxide nanotubes that are candidates for applications in catalysis, energy storage, and microelectronics. The stabilities and other properties of this class of inorganic nanotubes have not yet been investigated in detail. The present study uses self-consistent-charge density-functional tight-binding calculations to examine the stabilities, mechanical properties, and electronic properties of nickel hydroxide nanotubes along with the energetics associated with the adsorption of water by these systems. The tight-binding model was parametrized for this system based on the results of first-principles calculations. The stabilities of the nanotubes were examined by calculating strain energies and performing molecular dynamics simulations. The results indicate that single-walled nickel hydroxide nanotubes are stable at room temperature, which is consistent with experimental investigations. The nanotubes possess size-dependent mechanical properties that are similar in magnitude to those of other inorganic nanotubes. The electronic properties of the nanotubes were also found to be size-dependent and small nickel oxyhydroxide nanotubes are predicted to be semiconductors. Despite this size-dependence, both the mechanical and electronic properties were found to be almost independent of the helical structure of the nanotubes. The calculations also show that water molecules have higher adsorption energies when binding to the interior of the nickel hydroxide nanotubes when compared to adsorption in nanotubes formed from other two-dimensional materials such as graphene. The increased adsorption energy is due to the hydrophilic nature of nickel hydroxide. Due to the broad applications of nickel hydroxide, the nanotubes investigated here are also expected to be used in catalysis, electronics, and clean energy production.

  8. Resonant scattering due to adatoms in graphene: Top, bridge, and hollow positions

    NASA Astrophysics Data System (ADS)

    Irmer, Susanne; Kochan, Denis; Lee, Jeongsu; Fabian, Jaroslav

    2018-02-01

    We present a theoretical study of resonance characteristics in graphene from adatoms with s or pz character binding in top, bridge, and hollow positions. The adatoms are described by two tight-binding parameters: on-site energy and hybridization strength. We explore a wide range of different magnitudes of these parameters by employing T -matrix calculations in the single adatom limit and by tight-binding supercell calculations for dilute adatom coverage. We calculate the density of states and the momentum relaxation rate and extract the resonance level and resonance width. The top position with a large hybridization strength or, equivalently, small on-site energy, induces resonances close to zero energy. The bridge position, compared to top, is more sensitive to variation in the orbital tight-binding parameters. Resonances within the experimentally relevant energy window are found mainly for bridge adatoms with negative on-site energies. The effect of resonances from the top and bridge positions on the density of states and momentum relaxation rate is comparable and both positions give rise to a power-law decay of the resonant state in graphene. The hollow position with s orbital character is affected from destructive interference, which is seen from the very narrow resonance peaks in the density of states and momentum relaxation rate. The resonant state shows no clear tendency to a power-law decay around the impurity and its magnitude decreases strongly with lowering the adatom content in the supercell calculations. This is in contrast to the top and bridge positions. We conclude our study with a comparison to models of pointlike vacancies and strong midgap scatterers. The latter model gives rise to significantly higher momentum relaxation rates than caused by single adatoms.

  9. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  10. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  11. Synaptic plasticity in a cerebellum-like structure depends on temporal order

    NASA Astrophysics Data System (ADS)

    Bell, Curtis C.; Han, Victor Z.; Sugawara, Yoshiko; Grant, Kirsty

    1997-05-01

    Cerebellum-like structures in fish appear to act as adaptive sensory processors, in which learned predictions about sensory input are generated and subtracted from actual sensory input, allowing unpredicted inputs to stand out1-3. Pairing sensory input with centrally originating predictive signals, such as corollary discharge signals linked to motor commands, results in neural responses to the predictive signals alone that are Negative images' of the previously paired sensory responses. Adding these 'negative images' to actual sensory inputs minimizes the neural response to predictable sensory features. At the cellular level, sensory input is relayed to the basal region of Purkinje-like cells, whereas predictive signals are relayed by parallel fibres to the apical dendrites of the same cells4. The generation of negative images could be explained by plasticity at parallel fibre synapses5-7. We show here that such plasticity exists in the electrosensory lobe of mormyrid electric fish and that it has the necessary properties for such a model: it is reversible, anti-hebbian (excitatory postsynaptic potentials (EPSPs) are depressed after pairing with a postsynaptic spike) and tightly dependent on the sequence of pre- and postsynaptic events, with depression occurring only if the postsynaptic spike follows EPSP onset within 60 ms.

  12. Unsupervised image matching based on manifold alignment.

    PubMed

    Pei, Yuru; Huang, Fengchun; Shi, Fuhao; Zha, Hongbin

    2012-08-01

    This paper challenges the issue of automatic matching between two image sets with similar intrinsic structures and different appearances, especially when there is no prior correspondence. An unsupervised manifold alignment framework is proposed to establish correspondence between data sets by a mapping function in the mutual embedding space. We introduce a local similarity metric based on parameterized distance curves to represent the connection of one point with the rest of the manifold. A small set of valid feature pairs can be found without manual interactions by matching the distance curve of one manifold with the curve cluster of the other manifold. To avoid potential confusions in image matching, we propose an extended affine transformation to solve the nonrigid alignment in the embedding space. The comparatively tight alignments and the structure preservation can be obtained simultaneously. The point pairs with the minimum distance after alignment are viewed as the matchings. We apply manifold alignment to image set matching problems. The correspondence between image sets of different poses, illuminations, and identities can be established effectively by our approach.

  13. Structure-informed insights for NLR functioning in plant immunity.

    PubMed

    Sukarta, Octavina C A; Slootweg, Erik J; Goverse, Aska

    2016-08-01

    To respond to foreign invaders, plants have evolved a cell autonomous multilayered immune system consisting of extra- and intracellular immune receptors. Nucleotide binding and oligomerization domain (NOD)-like receptors (NLRs) mediate recognition of pathogen effectors inside the cell and trigger a host specific defense response, often involving controlled cell death. NLRs consist of a central nucleotide-binding domain, which is flanked by an N-terminal CC or TIR domain and a C-terminal leucine-rich repeat domain (LRR). These multidomain proteins function as a molecular switch and their activity is tightly controlled by intra and inter-molecular interactions. In contrast to metazoan NLRs, the structural basis underlying NLR functioning as a pathogen sensor and activator of immune responses in plants is largely unknown. However, the first crystal structures of a number of plant NLR domains were recently obtained. In addition, biochemical and structure-informed analyses revealed novel insights in the cooperation between NLR domains and the formation of pre- and post activation complexes, including the coordinated activity of NLR pairs as pathogen sensor and executor of immune responses. Moreover, the discovery of novel integrated domains underscores the structural diversity of NLRs and provides alternative models for how these immune receptors function in plants. In this review, we will highlight these recent advances to provide novel insights in the structural, biochemical and molecular aspects involved in plant NLR functioning. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Resonant enhancement of band-to-band tunneling in in-plane MoS2/WS2 heterojunctions

    NASA Astrophysics Data System (ADS)

    Kuroda, Tatsuya; Mori, Nobuya

    2018-04-01

    The band-to-band (BTB) tunneling current J through in-plane MoS2/WS2 heterojunctions is calculated by the nonequilibrium Green function method combined with tight-binding approximation. Types A and B of band configurations are considered. For type-A (type-B) heterojunctions, a potential notch exists (or is absent) at the heterointerface. Both type-A and type-B MoS2/WS2 heterojunctions can support a higher BTB current than MoS2 and WS2 homojunctions. For type-A heterojunctions, the resonant enhancement of J occurs resulting in a significantly higher BTB tunneling current.

  15. Electronic structure and exchange interactions in diluted semimagnetic semiconductors (Zn,Co)Se and (Zn,Mn)Se

    NASA Astrophysics Data System (ADS)

    Mašek, J.

    1991-05-01

    A comparative study of the electronic structure of (Zn,Co)Se and (Zn,Mn)Se is done by using a tight-binding version of the coherent potential approximation. The densities of states, relevant for a photoemission experiment, are calculated for a magnetically disordered phase. The exchange constant Jpd is obtained from the splitting of the valence band top in the ferromagnetic phase of the mixed crystal; Jdd is estimated from the energy of a spin reversal. We explain the large exchange constant in the Co-based systems as a result of efficient hybridization of the d-states with the valence band.

  16. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  17. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  18. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  19. Cooperativity and complexity in the binding of anions and cations to a tetratopic ion-pair host.

    PubMed

    Howe, Ethan N W; Bhadbhade, Mohan; Thordarson, Pall

    2014-05-21

    Cooperative interactions play a very important role in both natural and synthetic supramolecular systems. We report here on the cooperative binding properties of a tetratopic ion-pair host 1. This host combines two isophthalamide anion recognition sites with two unusual "half-crown/two carbonyl" cation recognition sites as revealed by the combination of single-crystal X-ray analysis of the free host and the 1:2 host:calcium cation complex, together with two-dimensional NMR and computational studies. By systematically comparing all of the binding data to several possible binding models and focusing on four different variants of the 1:2 binding model, it was in most cases possible to quantify these complex cooperative interactions. The data showed strong negative cooperativity (α = 0.01-0.05) of 1 toward chloride and acetate anions, while for cations the results were more variable. Interestingly, in the competitive (CDCl3/CD3OD (9:1, v/v)) solvent, the addition of calcium cations to the tetratopic ion-pair host 1 allosterically switched "on" chloride binding that is otherwise not present in this solvent system. The insight into the complexity of cooperative interactions revealed in this study of the tetratopic ion-pair host 1 can be used to design better cooperative supramolecular systems for information transfer and catalysis.

  20. Temporal texture of associative encoding modulates recall processes.

    PubMed

    Tibon, Roni; Levy, Daniel A

    2014-02-01

    Binding aspects of an experience that are distributed over time is an important element of episodic memory. In the current study, we examined how the temporal complexity of an experience may govern the processes required for its retrieval. We recorded event-related potentials during episodic cued recall following pair associate learning of concurrently and sequentially presented object-picture pairs. Cued recall success effects over anterior and posterior areas were apparent in several time windows. In anterior locations, these recall success effects were similar for concurrently and sequentially encoded pairs. However, in posterior sites clustered over parietal scalp the effect was larger for the retrieval of sequentially encoded pairs. We suggest that anterior aspects of the mid-latency recall success effects may reflect working-with-memory operations or direct access recall processes, while more posterior aspects reflect recollective processes which are required for retrieval of episodes of greater temporal complexity. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Analytical solutions of the two-dimensional Dirac equation for a topological channel intersection

    NASA Astrophysics Data System (ADS)

    Anglin, J. R.; Schulz, A.

    2017-01-01

    Numerical simulations in a tight-binding model have shown that an intersection of topologically protected one-dimensional chiral channels can function as a beam splitter for noninteracting fermions on a two-dimensional lattice [Qiao, Jung, and MacDonald, Nano Lett. 11, 3453 (2011), 10.1021/nl201941f; Qiao et al., Phys. Rev. Lett. 112, 206601 (2014), 10.1103/PhysRevLett.112.206601]. Here we confirm this result analytically in the corresponding continuum k .p model, by solving the associated two-dimensional Dirac equation, in the presence of a "checkerboard" potential that provides a right-angled intersection between two zero-line modes. The method by which we obtain our analytical solutions is systematic and potentially generalizable to similar problems involving intersections of one-dimensional systems.

  2. Relaxation dynamics of C60

    NASA Astrophysics Data System (ADS)

    Walsh, Tiffany R.; Wales, David J.

    1998-10-01

    The relaxation dynamics of C60 from high-energy isomers to Buckminsterfullerene is examined using a master equation approach. An exhaustive catalog of the C60 fullerene isomers containing only five- and six-membered rings is combined with knowledge of the Stone-Wales rearrangements that connect all such isomers. Full geometry optimizations have been performed for all the minima and the transition states which connect them up to six Stone-Wales steps away from the global minimum. A density-functional tight-binding potential was employed to provide a quantum mechanical description of the bonding. The resulting picture of the potential energy landscape reveals a "weeping willow" structure which offers a clear explanation for the relatively long relaxation times observed experimentally. We also predict the most important transient local minima on the annealing pathway.

  3. Dynamics simulations for engineering macromolecular interactions

    NASA Astrophysics Data System (ADS)

    Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

    2013-06-01

    The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

  4. Dynamics simulations for engineering macromolecular interactions.

    PubMed

    Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A; Way, Jeffrey

    2013-06-01

    The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20,000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions.

  5. Transport gap engineering by contact geometry in graphene nanoribbons: Experimental and theoretical studies on artificial materials

    NASA Astrophysics Data System (ADS)

    Stegmann, Thomas; Franco-Villafañe, John A.; Kuhl, Ulrich; Mortessagne, Fabrice; Seligman, Thomas H.

    2017-01-01

    Electron transport in small graphene nanoribbons is studied by microwave emulation experiments and tight-binding calculations. In particular, it is investigated under which conditions a transport gap can be observed. Our experiments provide evidence that armchair ribbons of width 3 m +2 with integer m are metallic and otherwise semiconducting, whereas zigzag ribbons are metallic independent of their width. The contact geometry, defining to which atoms at the ribbon edges the source and drain leads are attached, has strong effects on the transport. If leads are attached only to the inner atoms of zigzag edges, broad transport gaps can be observed in all armchair ribbons as well as in rhomboid-shaped zigzag ribbons. All experimental results agree qualitatively with tight-binding calculations using the nonequilibrium Green's function method.

  6. Electronic Properties of SiNTs Under External Electric and Magnetic Fields Using the Tight-Binding Method

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We investigated the electronic properties of silicon nanotubes (SiNTs) under external transverse electric fields and axial magnetic fields using the tight-binding approximation. It was found that, after switching on the electric and magnetic fields, band modifications such as distortion of degeneracy, change in energy dispersion and subband spacing, and bandgap size reduction occur. The bandgap of silicon gear-like nanotubes (Si g-NTs) decreases linearly with increasing electric field strength, but the bandgap for silicon hexagonal nanotubes (Si h-NTs) first increases and then decreases (metallic) or first remains constant and then decreases (semiconducting). Our results show that the bandgap of Si h-NTs is very sensitive to both electric and magnetic fields, unlike Si g-NTs, which are more sensitive to electric than magnetic fields.

  7. Conductance of three-terminal molecular bridge based on tight-binding theory

    NASA Astrophysics Data System (ADS)

    Wang, Li-Guang; Li, Yong; Yu, Ding-Wen; Katsunori, Tagami; Masaru, Tsukada

    2005-05-01

    The quantum transmission characteristic of three-benzene ring nano-molecular bridge is investigated theoretically by using Green's function approach based on tight-binding theory with only a π orbital per carbon atom at the site. The transmission probabilities that electrons transport through the molecular bridge from one terminal to the other two terminals are obtained. The electronic current distributions inside the molecular bridge are calculated and shown in graphical analogy by the current density method based on Fisher-Lee formula at the energy points E = ±0.42, ±1.06 and ±1.5, respectively, where the transmission spectra appear peaks. We find that the transmission spectra are related to the incident electronic energy and the molecular levels strongly and the current distributions agree well with Kirchhoff quantum current momentum conservation law.

  8. Tight-Binding Study of Polarons in Two-Dimensional Systems: Implications for Organic Field-Effect Transistor Materials

    NASA Astrophysics Data System (ADS)

    Lei, Jie

    2011-03-01

    In order to understand the electronic and transport properties of organic field-effect transistor (FET) materials, we theoretically studied the polarons in two-dimensional systems using a tight-binding model with the Holstein type and Su--Schrieffer--Heeger type electron--lattice couplings. By numerical calculations, it was found that a carrier accepts four kinds of localization, which are named the point polaron, two-dimensional polaron, one-dimensional polaron, and the extended state. The degree of localization is sensitive to the following parameters in the model: the strength and type of electron--lattice couplings, and the signs and relative magnitudes of transfer integrals. When a parameter set for a single-crystal phase of pentacene is applied within the Holstein model, a considerably delocalized hole polaron is found, consistent with the bandlike transport mechanism.

  9. Improved nonorthogonal tight-binding Hamiltonian for molecular-dynamics simulations of silicon clusters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordejon, P.; Lebedenko, D.; Menon, M.

    1994-08-15

    We present an improvement over the nonorthogonal tight-binding molecular-dynamics scheme recently proposed by Menon and Subbaswamy [Phys. Rev. B 47, 12 754 (1993)]. The proper treatment of the nonorthogonality and its effect on the Hamiltonian matrix elements has been found to obviate the need for a bond-counting term, leaving only two adjustable parameters in the formalism. With the improved parametrization we obtain values of the energies and bonding distances which are in better agreement with the available [ital ab] [ital initio] results for clusters of size up to [ital N]=10. Additionally, we have identified a lowest energy structure for themore » Si[sub 9] cluster, which to our knowledge has not been considered to date. We show that this structure (a distorted tricapped trigonal prism with [ital C][sub 2[ital v

  10. Universal tight binding model for chemical reactions in solution and at surfaces. II. Water.

    PubMed

    Lozovoi, A Y; Sheppard, T J; Pashov, D L; Kohanoff, J J; Paxton, A T

    2014-07-28

    A revised water model intended for use in condensed phase simulations in the framework of the self consistent polarizable ion tight binding theory is constructed. The model is applied to water monomer, dimer, hexamers, ice, and liquid, where it demonstrates good agreement with theoretical results obtained by more accurate methods, such as DFT and CCSD(T), and with experiment. In particular, the temperature dependence of the self diffusion coefficient in liquid water predicted by the model, closely reproduces experimental curves in the temperature interval between 230 K and 350 K. In addition, and in contrast to standard DFT, the model properly orders the relative densities of liquid water and ice. A notable, but inevitable, shortcoming of the model is underestimation of the static dielectric constant by a factor of two. We demonstrate that the description of inter and intramolecular forces embodied in the tight binding approximation in quantum mechanics leads to a number of valuable insights which can be missing from ab initio quantum chemistry and classical force fields. These include a discussion of the origin of the enhanced molecular electric dipole moment in the condensed phases, and a detailed explanation for the increase of coordination number in liquid water as a function of temperature and compared with ice--leading to insights into the anomalous expansion on freezing. The theory holds out the prospect of an understanding of the currently unexplained density maximum of water near the freezing point.

  11. A Model for Predicting Thermoelectric Properties of Bi2Te3

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; VonAllmen, Paul

    2009-01-01

    A parameterized orthogonal tight-binding mathematical model of the quantum electronic structure of the bismuth telluride molecule has been devised for use in conjunction with a semiclassical transport model in predicting the thermoelectric properties of doped bismuth telluride. This model is expected to be useful in designing and analyzing Bi2Te3 thermoelectric devices, including ones that contain such nano - structures as quantum wells and wires. In addition, the understanding gained in the use of this model can be expected to lead to the development of better models that could be useful for developing other thermoelectric materials and devices having enhanced thermoelectric properties. Bi2Te3 is one of the best bulk thermoelectric materials and is widely used in commercial thermoelectric devices. Most prior theoretical studies of the thermoelectric properties of Bi2Te3 have involved either continuum models or ab-initio models. Continuum models are computationally very efficient, but do not account for atomic-level effects. Ab-initio models are atomistic by definition, but do not scale well in that computation times increase excessively with increasing numbers of atoms. The present tight-binding model bridges the gap between the well-scalable but non-atomistic continuum models and the atomistic but poorly scalable ab-initio models: The present tight-binding model is atomistic, yet also computationally efficient because of the reduced (relative to an ab-initio model) number of basis orbitals and flexible parameterization of the Hamiltonian.

  12. Generation of a pair of independently binding DNA aptamers in a single round of selection using proximity ligation.

    PubMed

    Chumphukam, O; Le, T T; Piletsky, S; Cass, A E G

    2015-05-28

    The ability to rapidly generate a pair of aptamers that bind independently to a protein target would greatly extend their use as reagents for two site ('sandwich') assays. We describe here a method to achieve this through proximity ligation. Using lysozyme as a target we demonstrate that under optimal conditions such a pair of aptamers, with nanomolar affinities, can be generated in a single round.

  13. Rotationally adiabatic pair interactions of para- and ortho-hydrogen with the halogen molecules F2, Cl2, and Br2.

    PubMed

    Berg, Matthias; Accardi, Antonio; Paulus, Beate; Schmidt, Burkhard

    2014-08-21

    The present work is concerned with the weak interactions between hydrogen and halogen molecules, i.e., the interactions of pairs H2-X2 with X = F, Cl, Br, which are dominated by dispersion and quadrupole-quadrupole forces. The global minimum of the four-dimensional (4D) coupled cluster with singles and doubles and perturbative triples (CCSD(T)) pair potentials is always a T shaped structure where H2 acts as the hat of the T, with well depths (De) of 1.3, 2.4, and 3.1 kJ/mol for F2, Cl2, and Br2, respectively. MP2/AVQZ results, in reasonable agreement with CCSD(T) results extrapolated to the basis set limit, are used for detailed scans of the potentials. Due to the large difference in the rotational constants of the monomers, in the adiabatic approximation, one can solve the rotational Schrödinger equation for H2 in the potential of the X2 molecule. This yields effective two-dimensional rotationally adiabatic potential energy surfaces where pH2 and oH2 are point-like particles. These potentials for the H2-X2 complexes have global and local minima for effective linear and T-shaped complexes, respectively, which are separated by 0.4-1.0 kJ/mol, where oH2 binds stronger than pH2 to X2, due to higher alignment to minima structures of the 4D-pair potential. Further, we provide fits of an analytical function to the rotationally adiabatic potentials.

  14. Surface passivation for tight-binding calculations of covalent solids.

    PubMed

    Bernstein, N

    2007-07-04

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp(3) hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  15. Surface passivation for tight-binding calculations of covalent solids

    NASA Astrophysics Data System (ADS)

    Bernstein, N.

    2007-07-01

    Simulation of a cluster representing a finite portion of a larger covalently bonded system requires the passivation of the cluster surface. We compute the effects of an explicit hybrid orbital passivation (EHOP) on the atomic structure in a model bulk, three-dimensional, narrow gap semiconductor, which is very different from the wide gap, quasi-one-dimensional organic molecules where most passivation schemes have been studied in detail. The EHOP approach is directly applicable to minimal atomic orbital basis methods such as tight-binding. Each broken bond is passivated by a hybrid created from an explicitly expressed linear combination of basis orbitals, chosen to represent the contribution of the missing neighbour, e.g. a sp3 hybrid for a single bond. The method is tested by computing the forces on atoms near a point defect as a function of cluster geometry. We show that, compared to alternatives such as pseudo-hydrogen passivation, the force on an atom converges to the correct bulk limit more quickly as a function of cluster radius, and that the force is more stable with respect to perturbations in the position of the cluster centre. The EHOP method also obviates the need for parameterizing the interactions between the system atoms and the passivating atoms. The method is useful for cluster calculations of non-periodic defects in large systems and for hybrid schemes that simulate large systems by treating finite regions with a quantum-mechanical model, coupled to an interatomic potential description of the rest of the system.

  16. An Innovative Sensing Approach Using Carbon Nanotube-Based Composites for Structural Health Monitoring of Concrete Structures

    NASA Astrophysics Data System (ADS)

    Dwivedi, Vatsal

    This thesis presents some work on two quite disparate kinds of dynamical systems described by Hamiltonian dynamics. The first part describes a computation of gauge anomalies and their macroscopic effects in a semiclassical picture. The geometric (symplectic) formulation of classical mechanics is used to describe the dynamics of Weyl fermions in even spacetime dimensions, the only quantum input to the symplectic form being the Berry curvature that encodes the spin-momentum locking. The (semi-)classical equations of motion are used in a kinetic theory setup to compute the gauge and singlet currents, whose conservation laws reproduce the nonabelian gauge and singlet anomalies. Anomalous contributions to the hydrodynamic currents for a gas of Weyl fermions at a finite temperature and chemical potential are also calculated, and are in agreement with similar results in literature which were obtained using thermodynamic and/or quantum field theoretical arguments. The second part describes a generalized transfer matrix formalism for noninteracting tight-binding models. The formalism is used to study the bulk and edge spectra, both of which are encoded in the spectrum of the transfer matrices, for some of the common tight-binding models for noninteracting electronic topological phases of matter. The topological invariants associated with the boundary states are interpreted as winding numbers for windings around noncontractible loops on a Riemann sheet constructed using the algebraic structure of the transfer matrices, as well as with a Maslov index on a symplectic group manifold, which is the space of transfer matrices.

  17. Thermodynamics and Kinetics of Na+/K+-Formate Ion Pairs Association in Polarizable Water: A Molecular Dynamics Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nguyen, Phuong T.; Nguyen, Van T.; Annapureddy, Harsha V.

    2012-12-03

    To elevate our understanding of ion specific activity in biological systems, the potential of mean force approach was utilized to study solvent effects on interactions between two alkali cations (Na+ and K+) with a formate anion in water. A very complex free energy landscape was observed, much more so than alkali-halide ion pairs. Furthermore, stronger binding between the Na+-formate pair was found in comparison to the K+-formate pair in water, a finding that agrees with experimental and theoretical studies of these systems. The kinetics of ion-pair interconversions were studied using transition rate theory, along with a variety of theoretical approachesmore » such as the Kramers and Grote Hynes theories. These rate results were used to predict solvent effects on dynamical features of contact ion-pair association, in which faster dynamics were found for K+-formate pairs than for Na+-formate pairs. This work was supported by the U.S. Department of Energy (DOE), Office of Basic Energy Sciences (BES), Division of Chemical Sciences, Geosciences and Biosciences. Pacific Northwest National Laboratory is a multiprogram national laboratory operated for DOE by Battelle.« less

  18. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    PubMed Central

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  19. Boson-boson effective nonrelativistic potential for higher-derivative electromagnetic theories in D dimensions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Accioly, Antonio; Dias, Marco

    2004-11-15

    The problem of computing the effective nonrelativistic potential U{sub D} for the interaction of charged-scalar bosons, within the context of D-dimensional electromagnetism with a cutoff, is reduced to quadratures. It is shown that U{sub 3} cannot bind a pair of identical charged-scalar bosons; nevertheless, numerical calculations indicate that boson-boson bound states do exist in the framework of three-dimensional higher-derivative electromagnetism augmented by a topological Chern-Simons term.

  20. PceRBase: a database of plant competing endogenous RNA.

    PubMed

    Yuan, Chunhui; Meng, Xianwen; Li, Xue; Illing, Nicola; Ingle, Robert A; Wang, Jingjing; Chen, Ming

    2017-01-04

    Competition for microRNA (miRNA) binding between RNA molecules has emerged as a novel mechanism for the regulation of eukaryotic gene expression. Competing endogenous RNA (ceRNA) can act as decoys for miRNA binding, thereby forming a ceRNA network by regulating the abundance of other RNA transcripts which share the same or similar microRNA response elements. Although this type of RNA cross talk was first described in Arabidopsis, and was subsequently shown to be active in animal models, there is no database collecting potential ceRNA data for plants. We have developed a Plant ceRNA database (PceRBase, http://bis.zju.edu.cn/pcernadb/index.jsp) which contains potential ceRNA target-target, and ceRNA target-mimic pairs from 26 plant species. For example, in Arabidopsis lyrata, 311 candidate ceRNAs are identified which could affect 2646 target-miRNA-target interactions. Predicted pairing structure between miRNAs and their target mRNA transcripts, expression levels of ceRNA pairs and associated GO annotations are also stored in the database. A web interface provides convenient browsing and searching for specific genes of interest. Tools are available for the visualization and enrichment analysis of genes in the ceRNA networks. Moreover, users can use PceRBase to predict novel competing mimic-target and target-target interactions from their own data. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Binding neutral information to emotional contexts: Brain dynamics of long-term recognition memory.

    PubMed

    Ventura-Bort, Carlos; Löw, Andreas; Wendt, Julia; Moltó, Javier; Poy, Rosario; Dolcos, Florin; Hamm, Alfons O; Weymar, Mathias

    2016-04-01

    There is abundant evidence in memory research that emotional stimuli are better remembered than neutral stimuli. However, effects of an emotionally charged context on memory for associated neutral elements is also important, particularly in trauma and stress-related disorders, where strong memories are often activated by neutral cues due to their emotional associations. In the present study, we used event-related potentials (ERPs) to investigate long-term recognition memory (1-week delay) for neutral objects that had been paired with emotionally arousing or neutral scenes during encoding. Context effects were clearly evident in the ERPs: An early frontal ERP old/new difference (300-500 ms) was enhanced for objects encoded in unpleasant compared to pleasant and neutral contexts; and a late central-parietal old/new difference (400-700 ms) was observed for objects paired with both pleasant and unpleasant contexts but not for items paired with neutral backgrounds. Interestingly, objects encoded in emotional contexts (and novel objects) also prompted an enhanced frontal early (180-220 ms) positivity compared to objects paired with neutral scenes indicating early perceptual significance. The present data suggest that emotional--particularly unpleasant--backgrounds strengthen memory for items encountered within these contexts and engage automatic and explicit recognition processes. These results could help in understanding binding mechanisms involved in the activation of trauma-related memories by neutral cues.

  2. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi

    2014-01-01

    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  3. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  4. Tight-binding approach to overdamped Brownian motion on a bichromatic periodic potential.

    PubMed

    Nguyen, P T T; Challis, K J; Jack, M W

    2016-02-01

    We present a theoretical treatment of overdamped Brownian motion on a time-independent bichromatic periodic potential with spatially fast- and slow-changing components. In our approach, we generalize the Wannier basis commonly used in the analysis of periodic systems to define a basis of S states that are localized at local minima of the potential. We demonstrate that the S states are orthonormal and complete on the length scale of the periodicity of the fast-changing potential, and we use the S-state basis to transform the continuous Smoluchowski equation for the system to a discrete master equation describing hopping between local minima. We identify the parameter regime where the master equation description is valid and show that the interwell hopping rates are well approximated by Kramers' escape rate in the limit of deep potential minima. Finally, we use the master equation to explore the system dynamics and determine the drift and diffusion for the system.

  5. Barrier tunneling of the loop-nodal semimetal in the hyperhoneycomb lattice

    NASA Astrophysics Data System (ADS)

    Guan, Ji-Huan; Zhang, Yan-Yang; Lu, Wei-Er; Xia, Yang; Li, Shu-Shen

    2018-05-01

    We theoretically investigate the barrier tunneling in the 3D model of the hyperhoneycomb lattice, which is a nodal-line semimetal with a Dirac loop at zero energy. In the presence of a rectangular potential, the scattering amplitudes for different injecting states around the nodal loop are calculated, by using analytical treatments of the effective model, as well as numerical simulations of the tight binding model. In the low energy regime, states with remarkable transmissions are only concentrated in a small range around the loop plane. When the momentum of the injecting electron is coplanar with the nodal loop, nearly perfect transmissions can occur for a large range of injecting azimuthal angles if the potential is not high. For higher potential energies, the transmission shows a resonant oscillation with the potential, but still with peaks being perfect transmissions that do not decay with the potential width. These strikingly robust transports of the loop-nodal semimetal can be approximately explained by a momentum dependent Dirac Hamiltonian.

  6. The role of JAM-A in inflammatory bowel disease: unrevealing the ties that bind.

    PubMed

    Vetrano, Stefania; Danese, Silvio

    2009-05-01

    Tight junctions (TJ) are junctional proteins whose function is to maintain an intact intestinal epithelial barrier and regulate the paracellular movement of water and solutes. Altered TJ structure and epithelial permeability are observed in inflammatory bowel disease and seem to have an important role in the pathogenesis of these diseases. Junctional adhesion molecule-A (JAM-A) is a protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. Its function at tight junctions appears to be crucial as an extracellular adhesive molecule in the direct regulation of intestinal barrier function. This review focuses on the role of JAM-A in controlling mucosal homeostasis by regulating the integrity and permeability of epithelial barrier function.

  7. Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

    PubMed

    Aslanoglu, Mehmet

    2006-03-01

    The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

  8. Tool For Installation Of Seal In Tube Fitting

    NASA Technical Reports Server (NTRS)

    Trevathan, Joseph R.

    1993-01-01

    Plierslike tool helps secure repair seal in fitting. Tool crimps repair seal into tube fitting, ensuring tight fit every time. Modified pair of snapring pliers to which knife-edge jaws have been added. Spring added between handles. Also includes separate, accompanying support ring.

  9. Final Technical Report: Targeting DOE-Relevant Ions with Supramolecular Strategies, DE-SC0010555

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman-James, Kristin

    The effectiveness of three popular supramolecular strategies to selectively target negatively charged ions (anions) was evaluated. Ions of interest included oxo anions, particularly sulfate, that hamper nuclear waste remediation. Three objectives were pursued using a simple building block strategies and by strategically placing anion-binding sites at appropriate positions on organic host molecules. The goal of the first objective was to assess the influence of secondary, tertiary and quaternized amines on binding tetrahedral anions using mixed amide/amine macrocyclic and urea/amine hosts containing aromatic or heteroaromatic spacers. Objective 2 focused on the design of ion pair hosts, using mixed macrocyclic anion hostsmore » joined through polyether linkages. Objective 3 was to explore the synthesis of new metal-linked extended macrocyclic frameworks to leverage anion binding. Key findings were that smaller 24-membered macrocycles provided the most complementary binding for sulfate ion and mixed urea/amine chelates showed enhanced binding over amide corollaries in addition to being highly selective for SO 4 2- in the presence of small quantities of water. In addition to obtaining prototype metal-linked macrocyclic anion hosts, a new dipincer ligand was designed that can be used to link macrocyclic or other supramolecular hosts in extended frameworks. When the tetraamide-based pincers are bound to two metal ions, an interesting phenomenon occurs. Upon deprotonation of the amides, two new protons appear between adjacent carbonyl pairs on the ligand, which may modify the chemistry, and metal-metal interactions in the complexes. Gel formation occurred for some of these extended hosts, and the physical properties are currently under investigation. The new tetracarboxamide-based pincers can also provide basic frameworks for double macrocycles capable of binding ion pairs as well as for binding metal ions and exploring intermetallic interactions through the pyrazine π system. Additionally appendages capable of influencing solvation effects can be introduced, and a number of other potential applications can be realized in areas such as soft materials chemistry, catalysis, sensing, and proton switches, the latter for binding and release of targeted guests. These findings provide a better foundation for understanding the selective binding of anions by targeted placement of hydrogen binding sites, and the strengths and weaknesses of various functional groups, that will allow for more the design of more effective anion sequestering agents. Our design strategy also used simple, cost-effective building blocks for host synthesis to allow for scale-up should real-world applications be forthcoming.« less

  10. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  11. Early events in herpes simplex virus lifecycle with implications for an infection of lifetime.

    PubMed

    Salameh, Sarah; Sheth, Urmi; Shukla, Deepak

    2012-01-01

    Affecting a large percentage of human population herpes simplex virus (HSV) types -1 and -2 mainly cause oral, ocular, and genital diseases. Infection begins with viral entry into a host cell, which may be preceded by viral "surfing" along filopodia. Viral glycoproteins then bind to one or more of several cell surface receptors, such as herpesvirus entry mediator (HVEM), nectin-1, 3-O sulfated heparan sulfate (3-OS HS), paired immunoglobulin-like receptor α, and non-muscle myosin-IIA. At least five viral envelope glycoproteins participate in entry and these include gB, gC, gD and gH-gL. Post-entry, these glycoproteins may also facilitate cell-to-cell spread of the virus, which helps in the evasion of physical barriers as well as several components of the innate and adaptive immune responses. The spread may be facilitated by membrane fusion, movement across tight junctions, transfer across neuronal synapses, or the recruitment of actin-containing structures. This review summarizes some of the recent advances in our understanding of HSV entry and cell-to-cell spread.

  12. Superfluid-Mott insulator transition of spin-1 bosons in an optical lattice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsuchiya, Shunji; Department of Physics, University of Toronto, Toronto, Ontario, M5S 1A7; Kurihara, Susumu

    2004-10-01

    We study the superfluid-Mott insulator (SF-MI) transition of spin-1 bosons interacting antiferromagnetically in an optical lattice. Starting from a Bose-Hubbard tight-binding model for spin-1 bosons, we obtain the zero-temperature phase diagram by a mean-field approximation. We find that the MI phase with an even number of atoms per site is a spin singlet state, while the MI phase with an odd number of atoms per site has spin 1 at each site in the limit of t=0, where t is the hopping matrix element. We also show that the superfluid phase is a polar state as in the case formore » a spin-1 Bose condensate in a harmonic trap. It is found that the MI phase is strongly stabilized against the SF-MI transition when the number of atoms per site is even, due to the formation of singlet pairs. We derive the effective spin Hamiltonian for the MI phase with one atom per site and briefly discuss the spin order in the MI phase.« less

  13. Extra-domain B in oncofetal fibronectin structurally promotes fibrillar head-to-tail dimerization of extracellular matrix protein.

    PubMed

    Schiefner, André; Gebauer, Michaela; Skerra, Arne

    2012-05-18

    The type III extra-domain B (ED-B) is specifically spliced into fibronectin (Fn) during embryogenesis and neoangiogenesis, including many cancers. The x-ray structure of the recombinant four-domain fragment Fn(III)7B89 reveals a tightly associated, extended head-to-tail dimer, which is stabilized via pair-wise shape and charge complementarity. A tendency toward ED-B-dependent dimer formation in solution was supported by size exclusion chromatography and analytical ultracentrifugation. When amending the model with the known three-dimensional structure of the Fn(III)10 domain, its RGD loop as well as the adhesion synergy region in Fn(III)9-10 become displayed on the same face of the dimer; this should allow simultaneous binding of at least two integrins and, thus, receptor clustering on the cell surface and intracellular signaling. Insertion of ED-B appears to stabilize overall head-to-tail dimerization of two separate Fn chains, which, together with alternating homodimer formation via disulfide bridges at the C-terminal Fn tail, should lead to the known macromolecular fibril formation.

  14. Modeling electronic trap state distributions in nanocrystalline anatase

    NASA Astrophysics Data System (ADS)

    Le, Nam; Schweigert, Igor

    The charge transport properties of nanocrystalline TiO2 films, and thus the catalytic performance of devices that incorporate them, are affected strongly by the spatial and energetic distribution of localized electronic trap states. Such traps may arise from a variety of defects: Ti interstitials, O vacancies, step edges at surfaces, and grain boundaries. We have developed a procedure for applying density functional theory (DFT) and density functional tight binding (DFTB) calculations to characterize distributions of localized states arising from multiple types of defects. We have applied the procedure to investigate how the morphologies of interfaces between pairs of attached anatase nanoparticles determine the energies of trap states therein. Our results complement recent experimental findings that subtle changes in the morphology of highly porous TiO2 aerogel networks can have a dramatic effect on catalytic performance, which was attributed to changes in the distribution of trap states. This work was supported by the U.S. Naval Research Laboratory via the National Research Council and by the Office of Naval Research through the U.S. Naval Research Laboratory.

  15. Study of the effects of implantation on the high Fe-Ni-Cr and Ni-Cr-Al alloys

    NASA Technical Reports Server (NTRS)

    Ribarsky, M. W.

    1985-01-01

    A theoretical study of the effects of implantation on the corrosion resistance of Fe-Ni-Cr and Ni-Cr-Al alloys was undertaken. The purpose was to elucidate the process by which corrosion scales form on alloy surfaces. The experiments dealt with Ni implanted with Al, exposed to S at high temperatures, and then analyzed using scanning electron microscopy, scanning Auger spectroscopy and X-ray fluorescence spectroscopy. Pair bonding and tight-binding models were developed to study the compositions of the alloys and as a result, a new surface ordering effect was found which may exist in certain real alloys. With these models, the behavior of alloy constituents in the presence of surface concentrations of O or S was also studied. Improvements of the models to take into account the important effects of long- and short-range ordering were considered. The diffusion kinetics of implant profiles at various temperatures were investigated, and it was found that significant non-equilibrium changes in the profiles can take place which may affect the implants' performance in the presence of surface contaminants.

  16. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  17. Tunneling conductance in semiconductor-superconductor hybrid structures

    NASA Astrophysics Data System (ADS)

    Stenger, John; Stanescu, Tudor D.

    2017-12-01

    We study the differential conductance for charge tunneling into a semiconductor wire-superconductor hybrid structure, which is actively investigated as a possible scheme for realizing topological superconductivity and Majorana zero modes. The calculations are done based on a tight-binding model of the heterostructure using both a Blonder-Tinkham-Klapwijk approach and a Keldysh nonequilibrium Green's function method. The dependence of various tunneling conductance features on the coupling strength between the semiconductor and the superconductor, the tunnel barrier height, and temperature is systematically investigated. We find that treating the parent superconductor as an active component of the system, rather than a passive source of Cooper pairs, has qualitative consequences regarding the low-energy behavior of the differential conductance. In particular, the presence of subgap states in the parent superconductor, due to disorder and finite magnetic fields, leads to characteristic particle-hole asymmetric features and to the breakdown of the quantization of the zero-bias peak associated with the presence of Majorana zero modes localized at the ends of the wire. The implications of these findings for the effort toward the realization of Majorana bound states with true non-Abelian properties are discussed.

  18. Ubiquitin-specific Protease 11 (USP11) Deubiquitinates Hybrid Small Ubiquitin-like Modifier (SUMO)-Ubiquitin Chains to Counteract RING Finger Protein 4 (RNF4)*

    PubMed Central

    Hendriks, Ivo A.; Schimmel, Joost; Eifler, Karolin; Olsen, Jesper V.; Vertegaal, Alfred C. O.

    2015-01-01

    Ring finger protein 4 (RNF4) is a SUMO-targeted ubiquitin E3 ligase with a pivotal function in the DNA damage response (DDR). SUMO interaction motifs (SIMs) in the N-terminal part of RNF4 tightly bind to SUMO polymers, and RNF4 can ubiquitinate these polymers in vitro. Using a proteomic approach, we identified the deubiquitinating enzyme ubiquitin-specific protease 11 (USP11), a known DDR-component, as a functional interactor of RNF4. USP11 can deubiquitinate hybrid SUMO-ubiquitin chains to counteract RNF4. SUMO-enriched nuclear bodies are stabilized by USP11, which functions downstream of RNF4 as a counterbalancing factor. In response to DNA damage induced by methyl methanesulfonate, USP11 could counteract RNF4 to inhibit the dissolution of nuclear bodies. Thus, we provide novel insight into cross-talk between ubiquitin and SUMO and uncover USP11 and RNF4 as a balanced SUMO-targeted ubiquitin ligase/protease pair with a role in the DDR. PMID:25969536

  19. Nuclear magnetic resonance and restrained molecular dynamics studies of the interaction of an epidermal growth factor-derived peptide with protein tyrosine phosphatase 1B.

    PubMed

    Glover, N R; Tracey, A S

    1999-04-20

    The epidermal growth factor-derived (EGFR988) fluorophosphonate peptide, DADE(F2Pmp)L, is a potent (30 pM) inhibitor of the protein tyrosine phosphatase PTP1B. Nuclear magnetic resonance (NMR) transferred nuclear Overhauser effect (nOe) experiments have been used to determine the conformation of DADE(F2Pmp)L while bound in the active site of PTP1B. When bound, the peptide adopts an extended beta-strand conformation. Molecular modeling and molecular dynamics simulations allowed the elucidation of the sources of many of the interactions leading to binding of this inhibitor. Electrostatic, hydrophobic, and hydrogen-bonding interactions were all found to contribute significantly to its binding. However, despite the overall tight binding of this inhibitor, the N-terminal and adjacent residue of the peptide were virtually unrestrained in their motion. The major contributions to binding arose from hydrophobic interactions at the leucine and at the aromatic center, hydrogen bonding to the pro-R fluorine of the fluorophosphonomethyl group, and electrostatic interactions involving the carboxylate functionalities of the aspartate and glutamate residues. These latter two residues were found to form tight contacts with surface recognition elements (arginine and lysine) situated near the active-site cleft.

  20. Comparison of calculation and experiment implicates significant electrostatic contributions to the binding stability of barnase and barstar.

    PubMed

    Dong, Feng; Vijayakumar, M; Zhou, Huan-Xiang

    2003-07-01

    The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (epsilon (p)) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with epsilon (p) = 4; and c), "SE + epsilon (p) = 20." The "vdW + epsilon (p) = 4" and "SE + epsilon (p) = 20" protocols predicted an overall electrostatic stabilization whereas the "SE + epsilon (p) = 4" protocol predicted an overall electrostatic destabilization. The "vdW + epsilon (p) = 4" protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the "SE + epsilon (p) = 4" protocol predicted significantly larger coupling energies of charge pairs whereas the "SE + epsilon (p) = 20" protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol.

  1. Computational prediction and biochemical characterization of novel RNA aptamers to Rift Valley fever virus nucleocapsid protein.

    PubMed

    Ellenbecker, Mary; St Goddard, Jeremy; Sundet, Alec; Lanchy, Jean-Marc; Raiford, Douglas; Lodmell, J Stephen

    2015-10-01

    Rift Valley fever virus (RVFV) is a potent human and livestock pathogen endemic to sub-Saharan Africa and the Arabian Peninsula that has potential to spread to other parts of the world. Although there is no proven effective and safe treatment for RVFV infections, a potential therapeutic target is the virally encoded nucleocapsid protein (N). During the course of infection, N binds to viral RNA, and perturbation of this interaction can inhibit viral replication. To gain insight into how N recognizes viral RNA specifically, we designed an algorithm that uses a distance matrix and multidimensional scaling to compare the predicted secondary structures of known N-binding RNAs, or aptamers, that were isolated and characterized in previous in vitro evolution experiment. These aptamers did not exhibit overt sequence or predicted structure similarity, so we employed bioinformatic methods to propose novel aptamers based on analysis and clustering of secondary structures. We screened and scored the predicted secondary structures of novel randomly generated RNA sequences in silico and selected several of these putative N-binding RNAs whose secondary structures were similar to those of known N-binding RNAs. We found that overall the in silico generated RNA sequences bound well to N in vitro. Furthermore, introduction of these RNAs into cells prior to infection with RVFV inhibited viral replication in cell culture. This proof of concept study demonstrates how the predictive power of bioinformatics and the empirical power of biochemistry can be jointly harnessed to discover, synthesize, and test new RNA sequences that bind tightly to RVFV N protein. The approach would be easily generalizable to other applications. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

    PubMed Central

    Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

    2011-01-01

    RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

  3. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple turnover.

    PubMed

    Rawlings, Renata A; Krishnan, Vishalakshi; Walter, Nils G

    2011-04-29

    RNA interference is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response to viruses and retrotransposons. During viral infection, the RNase-III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs) 21-24 nucleotides in length and helps load them into the RNA-induced silencing complex (RISC) to guide the cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressors (RSS) that tightly, and presumably quantitatively, bind siRNAs to thwart RNA-interference-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus, as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding [(1.69 ± 0.07) × 10(8) M(-)(1) s(-1)] and marked dissociation (k(off)=0.062 ± 0.002 s(-1)). We also observe that p19 efficiently competes with recombinant Dicer and inhibits the formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Simulation optimization of spherical non-polar guest recognition by deep-cavity cavitands

    PubMed Central

    Wanjari, Piyush P.; Gibb, Bruce C.; Ashbaugh, Henry S.

    2013-01-01

    Biomimetic deep-cavity cavitand hosts possess unique recognition and encapsulation properties that make them capable of selectively binding a range of non-polar guests within their hydrophobic pocket. Adamantane based derivatives which snuggly fit within the pocket of octa-acid deep cavity cavitands exhibit some of the strongest host binding. Here we explore the roles of guest size and attractiveness on optimizing guest binding to form 1:1 complexes with octa-acid cavitands in water. Specifically we simulate the water-mediated interactions of the cavitand with adamantane and a range of simple Lennard-Jones guests of varying diameter and attractive well-depth. Initial simulations performed with methane indicate hydrated methanes preferentially reside within the host pocket, although these guests frequently trade places with water and other methanes in bulk solution. The interaction strength of hydrophobic guests increases with increasing size from sizes slightly smaller than methane to Lennard-Jones guests comparable in size to adamantane. Over this guest size range the preferential guest binding location migrates from the bottom of the host pocket upwards. For guests larger than adamantane, however, binding becomes less favorable as the minimum in the potential-of-mean force shifts to the cavitand face around the portal. For a fixed guest diameter, the Lennard-Jones well-depth is found to systematically shift the guest-host potential-of-mean force to lower free energies, however, the optimal guest size is found to be insensitive to increasing well-depth. Ultimately our simulations show that adamantane lies within the optimal range of guest sizes with significant attractive interactions to match the most tightly bound Lennard-Jones guests studied. PMID:24359375

  5. Crystal structure correlations with the intrinsic thermodynamics of human carbonic anhydrase inhibitor binding

    PubMed Central

    Smirnov, Alexey; Zubrienė, Asta; Manakova, Elena; Gražulis, Saulius

    2018-01-01

    The structure-thermodynamics correlation analysis was performed for a series of fluorine- and chlorine-substituted benzenesulfonamide inhibitors binding to several human carbonic anhydrase (CA) isoforms. The total of 24 crystal structures of 16 inhibitors bound to isoforms CA I, CA II, CA XII, and CA XIII provided the structural information of selective recognition between a compound and CA isoform. The binding thermodynamics of all structures was determined by the analysis of binding-linked protonation events, yielding the intrinsic parameters, i.e., the enthalpy, entropy, and Gibbs energy of binding. Inhibitor binding was compared within structurally similar pairs that differ by para- or meta-substituents enabling to obtain the contributing energies of ligand fragments. The pairs were divided into two groups. First, similar binders—the pairs that keep the same orientation of the benzene ring exhibited classical hydrophobic effect, a less exothermic enthalpy and a more favorable entropy upon addition of the hydrophobic fragments. Second, dissimilar binders—the pairs of binders that demonstrated altered positions of the benzene rings exhibited the non-classical hydrophobic effect, a more favorable enthalpy and variable entropy contribution. A deeper understanding of the energies contributing to the protein-ligand recognition should lead toward the eventual goal of rational drug design where chemical structures of ligands could be designed based on the target protein structure. PMID:29503769

  6. Structural modification of P-glycoprotein induced by OH radicals: Insights from atomistic simulations

    NASA Astrophysics Data System (ADS)

    Khosravian, N.; Kamaraj, B.; Neyts, E. C.; Bogaerts, A.

    2016-02-01

    This study reports on the possible effects of OH radical impact on the transmembrane domain 6 of P-glycoprotein, TM6, which plays a crucial role in drug binding in human cells. For the first time, we employ molecular dynamics (MD) simulations based on the self-consistent charge density functional tight binding (SCC-DFTB) method to elucidate the potential sites of fragmentation and mutation in this domain upon impact of OH radicals, and to obtain fundamental information about the underlying reaction mechanisms. Furthermore, we apply non-reactive MD simulations to investigate the long-term effect of this mutation, with possible implications for drug binding. Our simulations indicate that the interaction of OH radicals with TM6 might lead to the breaking of C-C and C-N peptide bonds, which eventually cause fragmentation of TM6. Moreover, according to our simulations, the OH radicals can yield mutation in the aromatic ring of phenylalanine in TM6, which in turn affects its structure. As TM6 plays an important role in the binding of a range of cytotoxic drugs with P-glycoprotein, any changes in its structure are likely to affect the response of the tumor cell in chemotherapy. This is crucial for cancer therapies based on reactive oxygen species, such as plasma treatment.

  7. Docking, molecular dynamics, binding energy-MM-PBSA studies of naphthofuran derivatives to identify potential dual inhibitors against BACE-1 and GSK-3β.

    PubMed

    Kumar, Akhil; Srivastava, Gaurava; Negi, Arvind S; Sharma, Ashok

    2018-01-19

    BACE-1 and GSK-3β both are potential therapeutic drug targets for Alzheimer's disease. Recently, both these targets received attention for designing dual inhibitors. Till now only two scaffolds (triazinone and curcumin) derivatives have been reported as BACE-1 and GSK-3β dual inhibitors. In our previous work, we have reported first in class dual inhibitor for BACE-1 and GSK-3β. In this study, we have explored other naphthofuran derivatives for their potential to inhibit BACE-1 and GSK-3β through docking, molecular dynamics, binding energy (MM-PBSA). These computational methods were performed to estimate the binding affinity of naphthofuran derivatives towards the BACE-1 and GSK-3β. In the docking results, two derivatives (NS7 and NS9) showed better binding affinity as compared to previously reported inhibitors. Hydrogen bond occupancy of NS7 and NS9 generated from MD trajectories showed good interaction with the flap residues Gln73, Thr72 of BACE-1 and Arg141, Thr138 residues of GSK-3β. MM-PBSA and energy decomposition per residue revealed different components of binding energy and relative importance of amino acid involved in binding. The results showed that the binding of inhibitors was majorly governed by the hydrophobic interactions and suggesting that hydrophobic interactions might be the key to design dual inhibitors for BACE1-1 and GSK-3β. Distance between important pair of amino acid residues indicated that BACE-1 and GSK-3β adopt closed conformation and become inactive after ligand binding. The results suggested that naphthofuran derivatives might act as dual inhibitor against BACE-1 and GSK-3β.

  8. A New Class of Orthosteric uPAR•uPA Small-Molecule Antagonists Are Allosteric Inhibitors of the uPAR•Vitronectin Interaction

    PubMed Central

    Liu, Degang; Zhou, Donghui; Wang, Bo; Knabe, William Eric; Meroueh, Samy O.

    2015-01-01

    The urokinase receptor (uPAR) is a GPI-anchored cell surface receptor that is at the center of an intricate network of protein-protein interactions. Its immediate binding partners are the serine proteinase urokinase (uPA), and vitronectin (VTN), a component of the extracellular matrix. uPA and VTN bind at distinct sites on uPAR to promote extracellular matrix degradation and integrin signaling, respectively. Here, we report the discovery of a new class of pyrrolone small-molecule inhibitors of the tight ∼1 nM uPAR•uPA protein-protein interaction. These compounds were designed to bind to the uPA pocket on uPAR. The highest affinity compound, namely 7, displaced a fluorescently-labeled α-helical peptide (AE147-FAM) with an inhibition constant Ki of 0.7 µM and inhibited the tight uPAR•uPAATF interaction with an IC50 of 18 µM. Biophysical studies with surface plasmon resonance showed that VTN binding is highly dependent on uPA. This cooperative binding was confirmed as 7, which binds at the uPAR•uPA interface, also inhibited the distal VTN•uPAR interaction. In cell culture, 7 blocked the uPAR•uPA interaction in uPAR-expressing human embryonic kidney (HEK-293) cells, and impaired cell adhesion to VTN, a process that is mediated by integrins. As a result, 7 inhibited integrin signaling in MDA-MB-231 cancer cells as evidenced by a decrease in focal adhesion kinase (FAK) phosphorylation and Rac1 GTPase activation. Consistent with these results, 7 blocked breast MDA-MB-231 cancer cell invasion with IC50 values similar to those observed in ELISA and surface plasmon resonance competition studies. Explicit-solvent molecular dynamics simulations show that the cooperativity between uPA and VTN is attributed to stabilization of uPAR motion by uPA. In addition, free energy calculations revealed that uPA stabilizes the VTN•uPARSMB interaction through more favorable electrostatics and entropy. Disruption of the uPAR•VTNSMB interaction by 7 is consistent with the cooperative binding to uPAR by uPA and VTN. Interestingly, the VTNSMB•uPAR interaction was less favorable in the VTNSMB•uPAR•7 complex suggesting potential cooperativity between 7 and VTN. Compound 7 provides an excellent starting point for the development of more potent derivatives to explore uPAR biology. PMID:25671694

  9. A new class of orthosteric uPAR·uPA small-molecule antagonists are allosteric inhibitors of the uPAR·vitronectin interaction.

    PubMed

    Liu, Degang; Zhou, Donghui; Wang, Bo; Knabe, William Eric; Meroueh, Samy O

    2015-06-19

    The urokinase receptor (uPAR) is a GPI-anchored cell surface receptor that is at the center of an intricate network of protein-protein interactions. Its immediate binding partners are the serine proteinase urokinase (uPA), and vitronectin (VTN), a component of the extracellular matrix. uPA and VTN bind at distinct sites on uPAR to promote extracellular matrix degradation and integrin signaling, respectively. Here, we report the discovery of a new class of pyrrolone small-molecule inhibitors of the tight ∼1 nM uPAR·uPA protein-protein interaction. These compounds were designed to bind to the uPA pocket on uPAR. The highest affinity compound, namely 7, displaced a fluorescently labeled α-helical peptide (AE147-FAM) with an inhibition constant Ki of 0.7 μM and inhibited the tight uPAR·uPAATF interaction with an IC50 of 18 μM. Biophysical studies with surface plasmon resonance showed that VTN binding is highly dependent on uPA. This cooperative binding was confirmed as 7, which binds at the uPAR·uPA interface, also inhibited the distal VTN·uPAR interaction. In cell culture, 7 blocked the uPAR·uPA interaction in uPAR-expressing human embryonic kidney (HEK-293) cells and impaired cell adhesion to VTN, a process that is mediated by integrins. As a result, 7 inhibited integrin signaling in MDA-MB-231 cancer cells as evidenced by a decrease in focal adhesion kinase (FAK) phosphorylation and Rac1 GTPase activation. Consistent with these results, 7 blocked breast MDA-MB-231 cancer cell invasion with IC50 values similar to those observed in ELISA and surface plasmon resonance competition studies. Explicit-solvent molecular dynamics simulations show that the cooperativity between uPA and VTN is attributed to stabilization of uPAR motion by uPA. In addition, free energy calculations revealed that uPA stabilizes the VTNSMB·uPAR interaction through more favorable electrostatics and entropy. Disruption of the uPAR·VTNSMB interaction by 7 is consistent with the cooperative binding to uPAR by uPA and VTN. Interestingly, the VTNSMB·uPAR interaction was less favorable in the VTNSMB·uPAR·7 complex suggesting potential cooperativity between 7 and VTN. Compound 7 provides an excellent starting point for the development of more potent derivatives to explore uPAR biology.

  10. A construction of unimodular equiangular tight frames from resolvable Steiner systems

    NASA Astrophysics Data System (ADS)

    Jasper, John

    2013-09-01

    An equiangular tight frame (ETF) is an M x N matrix which has orthogonal equal norm rows, equal norm columns, and the inner products of all pairs of columns have the same modulus. In this paper we study ETFs in which all of the entries are unimodular, and in particular pth roots of unity. A new construction of unimodular ETFs based on resolvable Steiner systems is presented. This construction gives many new examples of unimodular ETFs. In particular, an new infinite class of ETFs with entries in f1;-1g is presented.

  11. Lacosamide Inhibition of Nav1.7 Voltage-Gated Sodium Channels: Slow Binding to Fast-Inactivated States

    PubMed Central

    Jo, Sooyeon

    2017-01-01

    Lacosamide is an antiseizure agent that targets voltage-dependent sodium channels. Previous experiments have suggested that lacosamide is unusual in binding selectively to the slow-inactivated state of sodium channels, in contrast to drugs like carbamazepine and phenytoin, which bind tightly to fast-inactivated states. Using heterologously expressed human Nav1.7 sodium channels, we examined the state-dependent effects of lacosamide. Lacosamide induced a reversible shift in the voltage dependence of fast inactivation studied with 100-millisecond prepulses, suggesting binding to fast-inactivated states. Using steady holding potentials, lacosamide block was very weak at −120 mV (3% inhibition by 100 µM lacosamide) but greatly enhanced at −80 mV (43% inhibition by 100 µM lacosamide), where there is partial fast inactivation but little or no slow inactivation. During long depolarizations, lacosamide slowly (over seconds) put channels into states that recovered availability slowly (hundreds of milliseconds) at −120 mV. This resembles enhancement of slow inactivation, but the effect was much more pronounced at −40 mV, where fast inactivation is complete, but slow inactivation is not, than at 0 mV, where slow inactivation is maximal, more consistent with slow binding to fast-inactivated states than selective binding to slow-inactivated states. Furthermore, inhibition by lacosamide was greatly reduced by pretreatment with 300 µM lidocaine or 300 µM carbamazepine, suggesting that lacosamide, lidocaine, and carbamazepine all bind to the same site. The results suggest that lacosamide binds to fast-inactivated states in a manner similar to other antiseizure agents but with slower kinetics of binding and unbinding. PMID:28119481

  12. CsrA Represses Translation of sdiA, Which Encodes the N-Acylhomoserine-l-Lactone Receptor of Escherichia coli, by Binding Exclusively within the Coding Region of sdiA mRNA ▿ †

    PubMed Central

    Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul

    2011-01-01

    The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661

  13. Lacosamide Inhibition of Nav1.7 Voltage-Gated Sodium Channels: Slow Binding to Fast-Inactivated States.

    PubMed

    Jo, Sooyeon; Bean, Bruce P

    2017-04-01

    Lacosamide is an antiseizure agent that targets voltage-dependent sodium channels. Previous experiments have suggested that lacosamide is unusual in binding selectively to the slow-inactivated state of sodium channels, in contrast to drugs like carbamazepine and phenytoin, which bind tightly to fast-inactivated states. Using heterologously expressed human Nav1.7 sodium channels, we examined the state-dependent effects of lacosamide. Lacosamide induced a reversible shift in the voltage dependence of fast inactivation studied with 100-millisecond prepulses, suggesting binding to fast-inactivated states. Using steady holding potentials, lacosamide block was very weak at -120 mV (3% inhibition by 100 µ M lacosamide) but greatly enhanced at -80 mV (43% inhibition by 100 µ M lacosamide), where there is partial fast inactivation but little or no slow inactivation. During long depolarizations, lacosamide slowly (over seconds) put channels into states that recovered availability slowly (hundreds of milliseconds) at -120 mV. This resembles enhancement of slow inactivation, but the effect was much more pronounced at -40 mV, where fast inactivation is complete, but slow inactivation is not, than at 0 mV, where slow inactivation is maximal, more consistent with slow binding to fast-inactivated states than selective binding to slow-inactivated states. Furthermore, inhibition by lacosamide was greatly reduced by pretreatment with 300 µ M lidocaine or 300 µ M carbamazepine, suggesting that lacosamide, lidocaine, and carbamazepine all bind to the same site. The results suggest that lacosamide binds to fast-inactivated states in a manner similar to other antiseizure agents but with slower kinetics of binding and unbinding. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  14. Enhanced Ligand Sampling for Relative Protein–Ligand Binding Free Energy Calculations

    PubMed Central

    2016-01-01

    Free energy calculations are used to study how strongly potential drug molecules interact with their target receptors. The accuracy of these calculations depends on the accuracy of the molecular dynamics (MD) force field as well as proper sampling of the major conformations of each molecule. However, proper sampling of ligand conformations can be difficult when there are large barriers separating the major ligand conformations. An example of this is for ligands with an asymmetrically substituted phenyl ring, where the presence of protein loops hinders the proper sampling of the different ring conformations. These ring conformations become more difficult to sample when the size of the functional groups attached to the ring increases. The Adaptive Integration Method (AIM) has been developed, which adaptively changes the alchemical coupling parameter λ during the MD simulation so that conformations sampled at one λ can aid sampling at the other λ values. The Accelerated Adaptive Integration Method (AcclAIM) builds on AIM by lowering potential barriers for specific degrees of freedom at intermediate λ values. However, these methods may not work when there are very large barriers separating the major ligand conformations. In this work, we describe a modification to AIM that improves sampling of the different ring conformations, even when there is a very large barrier between them. This method combines AIM with conformational Monte Carlo sampling, giving improved convergence of ring populations and the resulting free energy. This method, called AIM/MC, is applied to study the relative binding free energy for a pair of ligands that bind to thrombin and a different pair of ligands that bind to aspartyl protease β-APP cleaving enzyme 1 (BACE1). These protein–ligand binding free energy calculations illustrate the improvements in conformational sampling and the convergence of the free energy compared to both AIM and AcclAIM. PMID:25906170

  15. Binding of DNA hairpins to an assembler-strand as part of a primordial translation device

    NASA Astrophysics Data System (ADS)

    Baumann, Ulrich

    1987-09-01

    A crucial event in the process leading to the origin of life is the emergence of a simple translation device. To approach experimental realization of this device the binding ability of short DNA hairpins to complementary oligonucleotides fixed on a solid support was investigated. The binding is achieved by base pairing between the loop nucleotides of the hairpins containing different numbers of adenosine residues and oligothymidylates covalently linked to cellulose. The loop has to consist of at least five nucleotides to achieve binding. The exact number of established base pairs was determined in two ways. First, the elution temperatures of hairpins and those of oligoadenylates which had the length of the loop were compared. Secondly, the architecture of the loop was analyzed by means of the single-strand-specific nuclease from mung bean acting as structural probe. Onlyn-2 of n loop nucleotides of a hairpin are able to form base pairs. Therefore, a strong evidence for the formation of a triplet of base pairs between primeval tRNA and mRNA sufficient to stabilize the complex enzyme-free is given.

  16. Tight-binding calculation of the magnetic moment of CrAs under pressure

    NASA Astrophysics Data System (ADS)

    Autieri, Carmine; Cuono, Giuseppe; Forte, Filomena; Noce, Canio

    2018-03-01

    We analyze the evolution of the local magnetic moment of the newly discovered pressure-induced superconductor CrAs, as a function of the applied pressure. Our theoretical method is based on a combination of the tight-binding approximation and the Löwdin down-folding procedure, which enables us to derive a low-energy effective Hamiltonian projected onto the Cr-subsector. We set up our calculations by considering several sets of ab initio derived hopping parameters, corresponding to different volumes of the unit cell, and use them to obtain the simulated pressure-dependence of the Cr magnetic moment, which is evaluated within a mean-field treatment of the Coulomb repulsion between the electrons at the Cr sites. Our calculations show good agreement with available experimental data, both for the normal phase measured 1.7 µB for Cr magnetic moment, and concerning the observed reduction of its amplitude for values that exceed the characteristic critical pressure.

  17. Exact evaluation of the causal spectrum and localization properties of electronic states on a scale-free network

    NASA Astrophysics Data System (ADS)

    Xie, Pinchen; Yang, Bingjia; Zhang, Zhongzhi; Andrade, Roberto F. S.

    2018-07-01

    A deterministic network with tree structure is considered, for which the spectrum of its adjacency matrix can be exactly evaluated by a recursive renormalization approach. It amounts to successively increasing number of contributions at any finite step of construction of the tree, resulting in a causal chain. The resulting eigenvalues can be related the full energy spectrum of a nearest-neighbor tight-binding model defined on this structure. Given this association, it turns out that further properties of the eigenvectors can be evaluated, like the degree of quantum localization of the tight-binding eigenstates, expressed by the inverse participation ratio (IPR). It happens that, for the current model, the IPR's are also suitable to be analytically expressed in terms in corresponding eigenvalue chain. The resulting IPR scaling behavior is expressed by the tails of eigenvalue chains as well.

  18. Density functional tight-binding and infrequent metadynamics can capture entropic effects in intramolecular hydrogen transfer reactions

    NASA Astrophysics Data System (ADS)

    Oliveira, Luiz F. L.; Fu, Christopher D.; Pfaendtner, Jim

    2018-04-01

    Infrequent metadynamics uses biased simulations to estimate the unbiased kinetics of a system, facilitating the calculation of rates and barriers. Here the method is applied to study intramolecular hydrogen transfer reactions involving peroxy radicals, a class of reactions that is challenging to model due to the entropic contributions of the formation of ring structures in the transition state. Using the self-consistent charge density-functional based tight-binding (DFTB) method, we applied infrequent metadynamics to the study of four intramolecular H-transfer reactions, demonstrating that the method can qualitatively reproduce these high entropic contributions, as observed in experiments and those predicted by transition state theory modeled by higher levels of theory. We also show that infrequent metadynamics and DFTB are successful in describing the relationship between transition state ring size and kinetic coefficients (e.g., activation energies and the pre-exponential factors).

  19. Magnetic quantization in monolayer bismuthene

    NASA Astrophysics Data System (ADS)

    Chen, Szu-Chao; Chiu, Chih-Wei; Lin, Hui-Chi; Lin, Ming-Fa

    The magnetic quantization in monolayer bismuthene is investigated by the generalized tight-binding model. The quite large Hamiltonian matrix is built from the tight-binding functions of the various sublattices, atomic orbitals and spin states. Due to the strong spin orbital coupling and sp3 bonding, monolayer bismuthene has the diverse low-lying energy bands such as the parabolic, linear and oscillating energy bands. The main features of band structures are further reflected in the rich magnetic quantization. Under a uniform perpendicular magnetic field (Bz) , three groups of Landau levels (LLs) with distinct features are revealed near the Fermi level. Their Bz-dependent energy spectra display the linear, square-root and non-monotonous dependences, respectively. These LLs are dominated by the combinations of the 6pz orbital and (6px,6py) orbitals as a result of strong sp3 bonding. Specifically, the LL anti-crossings only occur between LLs originating from the oscillating energy band.

  20. Chirality dependence of dipole matrix element of carbon nanotubes in axial magnetic field: A third neighbor tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2014-02-01

    We have studied the electronic structure and dipole matrix element, D, of carbon nanotubes (CNTs) under magnetic field, using the third nearest neighbor tight binding model. It is shown that the 1NN and 3NN-TB band structures show differences such as the spacing and mixing of neighbor subbands. Applying the magnetic field leads to breaking the degeneracy behavior in the D transitions and creates new allowed transitions corresponding to the band modifications. It is found that |D| is proportional to the inverse tube radius and chiral angle. Our numerical results show that amount of filed induced splitting for the first optical peak is proportional to the magnetic field by the splitting rate ν11. It is shown that ν11 changes linearly and parabolicly with the chiral angle and radius, respectively.

  1. Electro-optical properties of zigzag and armchair boron nitride nanotubes under a transverse electric field: Tight binding calculations

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2012-02-01

    The electro-optical properties of zigzag and armchair BNNTs in a uniform transverse electric field are investigated within tight binding approximation. It is found that the electric field modifies the band structure and splits band degeneracy where these effects reflect in the DOS and JDOS spectra. A decrease in the band gap, as a function of the electric field, is observed. This gap reduction increases with the diameter and it is independent of chirality. An analytic function to estimate the electric field needed for band gap closing is proposed which is in good agreement with DFT results. In additional, we show that the larger diameter tubes are more sensitive than small ones. Number and position of peaks in DOS and JDOS spectra for armchair and zigzag tubes with similar radius are dependent on electric field strength.

  2. An environment-dependent semi-empirical tight binding model suitable for electron transport in bulk metals, metal alloys, metallic interfaces, and metallic nanostructures. II. Application—Effect of quantum confinement and homogeneous strain on Cu conductance

    NASA Astrophysics Data System (ADS)

    Hegde, Ganesh; Povolotskyi, Michael; Kubis, Tillmann; Charles, James; Klimeck, Gerhard

    2014-03-01

    The Semi-Empirical tight binding model developed in Part I Hegde et al. [J. Appl. Phys. 115, 123703 (2014)] is applied to metal transport problems of current relevance in Part II. A systematic study of the effect of quantum confinement, transport orientation, and homogeneous strain on electronic transport properties of Cu is carried out. It is found that quantum confinement from bulk to nanowire boundary conditions leads to significant anisotropy in conductance of Cu along different transport orientations. Compressive homogeneous strain is found to reduce resistivity by increasing the density of conducting modes in Cu. The [110] transport orientation in Cu nanowires is found to be the most favorable for mitigating conductivity degradation since it shows least reduction in conductance with confinement and responds most favorably to compressive strain.

  3. Quasiclassical analysis of Bloch oscillations in non-Hermitian tight-binding lattices

    NASA Astrophysics Data System (ADS)

    Graefe, E. M.; Korsch, H. J.; Rush, A.

    2016-07-01

    Many features of Bloch oscillations in one-dimensional quantum lattices with a static force can be described by quasiclassical considerations for example by means of the acceleration theorem, at least for Hermitian systems. Here the quasiclassical approach is extended to non-Hermitian lattices, which are of increasing interest. The analysis is based on a generalised non-Hermitian phase space dynamics developed recently. Applications to a single-band tight-binding system demonstrate that many features of the quantum dynamics can be understood from this classical description qualitatively and even quantitatively. Two non-Hermitian and PT-symmetric examples are studied, a Hatano-Nelson lattice with real coupling constants and a system with purely imaginary couplings, both for initially localised states in space or in momentum. It is shown that the time-evolution of the norm of the wave packet and the expectation values of position and momentum can be described in a classical picture.

  4. ProbeZT: Simulation of transport coefficients of molecular electronic junctions under environmental effects using Büttiker's probes

    NASA Astrophysics Data System (ADS)

    Korol, Roman; Kilgour, Michael; Segal, Dvira

    2018-03-01

    We present our in-house quantum transport package, ProbeZT. This program provides linear response coefficients: electrical and electronic thermal conductances, as well as the thermopower of molecular junctions in which electrons interact with the surrounding thermal environment. Calculations are performed based on the Büttiker probe method, which introduces decoherence, energy exchange and dissipation effects phenomenologically using virtual electrode terminals called probes. The program can realize different types of probes, each introducing various environmental effects, including elastic and inelastic scattering of electrons. The molecular system is described by an arbitrary tight-binding Hamiltonian, allowing the study of different geometries beyond simple one-dimensional wires. Applications of the program to study the thermoelectric performance of molecular junctions are illustrated. The program also has a built-in functionality to simulate electron transport in double-stranded DNA molecules based on a tight-binding (ladder) description of the junction.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuevas, F.A.; Curilef, S., E-mail: scurilef@ucn.cl; Plastino, A.R., E-mail: arplastino@ugr.es

    The spread of a wave-packet (or its deformation) is a very important topic in quantum mechanics. Understanding this phenomenon is relevant in connection with the study of diverse physical systems. In this paper we apply various 'spreading measures' to characterize the evolution of an initially localized wave-packet in a tight-binding lattice, with special emphasis on information-theoretical measures. We investigate the behavior of both the probability distribution associated with the wave packet and the concomitant probability current. Complexity measures based upon Renyi entropies appear to be particularly good descriptors of the details of the delocalization process. - Highlights: > Spread ofmore » highly localized wave-packet in the tight-binding lattice. > Entropic and information-theoretical characterization is used to understand the delocalization. > The behavior of both the probability distribution and the concomitant probability current is investigated. > Renyi entropies appear to be good descriptors of the details of the delocalization process.« less

  6. Communication: Charge-population based dispersion interactions for molecules and materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stöhr, Martin; Department Chemie, Technische Universität München, Lichtenbergstr. 4, D-85748 Garching; Michelitsch, Georg S.

    2016-04-21

    We introduce a system-independent method to derive effective atomic C{sub 6} coefficients and polarizabilities in molecules and materials purely from charge population analysis. This enables the use of dispersion-correction schemes in electronic structure calculations without recourse to electron-density partitioning schemes and expands their applicability to semi-empirical methods and tight-binding Hamiltonians. We show that the accuracy of our method is en par with established electron-density partitioning based approaches in describing intermolecular C{sub 6} coefficients as well as dispersion energies of weakly bound molecular dimers, organic crystals, and supramolecular complexes. We showcase the utility of our approach by incorporation of the recentlymore » developed many-body dispersion method [Tkatchenko et al., Phys. Rev. Lett. 108, 236402 (2012)] into the semi-empirical density functional tight-binding method and propose the latter as a viable technique to study hybrid organic-inorganic interfaces.« less

  7. Generalized virial theorem for massless electrons in graphene and other Dirac materials

    NASA Astrophysics Data System (ADS)

    Sokolik, A. A.; Zabolotskiy, A. D.; Lozovik, Yu. E.

    2016-05-01

    The virial theorem for a system of interacting electrons in a crystal, which is described within the framework of the tight-binding model, is derived. We show that, in the particular case of interacting massless electrons in graphene and other Dirac materials, the conventional virial theorem is violated. Starting from the tight-binding model, we derive the generalized virial theorem for Dirac electron systems, which contains an additional term associated with a momentum cutoff at the bottom of the energy band. Additionally, we derive the generalized virial theorem within the Dirac model using the minimization of the variational energy. The obtained theorem is illustrated by many-body calculations of the ground-state energy of an electron gas in graphene carried out in Hartree-Fock and self-consistent random-phase approximations. Experimental verification of the theorem in the case of graphene is discussed.

  8. Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

    NASA Astrophysics Data System (ADS)

    Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

    2017-03-01

    Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

  9. Quantifying domain-ligand affinities and specificities by high-throughput holdup assay

    PubMed Central

    Vincentelli, Renaud; Luck, Katja; Poirson, Juline; Polanowska, Jolanta; Abdat, Julie; Blémont, Marilyne; Turchetto, Jeremy; Iv, François; Ricquier, Kevin; Straub, Marie-Laure; Forster, Anne; Cassonnet, Patricia; Borg, Jean-Paul; Jacob, Yves; Masson, Murielle; Nominé, Yves; Reboul, Jérôme; Wolff, Nicolas; Charbonnier, Sebastian; Travé, Gilles

    2015-01-01

    Many protein interactions are mediated by small linear motifs interacting specifically with defined families of globular domains. Quantifying the specificity of a motif requires measuring and comparing its binding affinities to all its putative target domains. To this aim, we developed the high-throughput holdup assay, a chromatographic approach that can measure up to a thousand domain-motif equilibrium binding affinities per day. Extracts of overexpressed domains are incubated with peptide-coated resins and subjected to filtration. Binding affinities are deduced from microfluidic capillary electrophoresis of flow-throughs. After benchmarking the approach on 210 PDZ-peptide pairs with known affinities, we determined the affinities of two viral PDZ-binding motifs derived from Human Papillomavirus E6 oncoproteins for 209 PDZ domains covering 79% of the human PDZome. We obtained exquisite sequence-dependent binding profiles, describing quantitatively the PDZome recognition specificity of each motif. This approach, applicable to many categories of domain-ligand interactions, has a wide potential for quantifying the specificities of interactomes. PMID:26053890

  10. Adaptation of H9N2 AIV in guinea pigs enables efficient transmission by direct contact and inefficient transmission by respiratory droplets

    PubMed Central

    Sang, Xiaoyu; Wang, Airong; Ding, Jie; Kong, Huihui; Gao, Xiaolong; Li, Lin; Chai, Tongjie; Li, Yuanguo; Zhang, Kun; Wang, Chengyu; Wan, Zhonghai; Huang, Geng; Wang, Tiecheng; Feng, Na; Zheng, Xuexing; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Qian, Jun; Hu, Guixue; Gao, Yuwei; Xia, Xianzhu

    2015-01-01

    H9N2 avian influenza viruses circulate worldwide in poultry and have sporadically infected humans, raising concern whether H9N2 viruses have pandemic potential. Here, we use a guinea pig model to examine whether serial passage results in adaptive viral changes that confer a transmissible phenotype to a wild-type H9N2 virus. After nine serial passages of an H9N2 virus through guinea pigs, productive transmission by direct contact occurred in 2/3 guinea pig pairs. The efficiency of transmission by direct contact increased following the fifteenth passage and occurred in 3/3 guinea pig pairs. In contrast, airborne transmission of the passaged virus was less efficient and occurred in 1/6 guinea pig pairs and 0/6 ferret pairs after the fifteenth passage. Three amino acid substitutions, HA1-Q227P, HA2-D46E, and NP-E434K, were sufficient for contact transmission in guinea pigs (2/3 pairs). The two HA amino acid substitutions enhanced receptor binding to α2,3-linked sialic acid receptors. Additionally, the HA2-D46E substitution increased virus thermostability whereas the NP-E434K mutation enhanced viral RNA polymerase activity in vitro. Our findings suggest that adaptive changes that enhance viral receptor binding, thermostability, and replicative capacity in mammalian cells can collectively enhance the transmissibility of H9N2 AIVs by direct contact in the guinea pig model. PMID:26552719

  11. Structure-function analyses reveal the molecular architecture and neutralization mechanism of a bacterial HEPN-MNT toxin-antitoxin system.

    PubMed

    Jia, Xuanyan; Yao, Jianyun; Gao, Zengqiang; Liu, Guangfeng; Dong, Yu-Hui; Wang, Xiaoxue; Zhang, Heng

    2018-05-04

    Toxin-antitoxin (TA) loci in bacteria are small genetic modules that regulate various cellular activities, including cell growth and death. The two-gene module encoding a HEPN (higher eukaryotes and prokaryotes nucleotide-binding) domain and a cognate MNT (minimal nucleotidyltransferase) domain have been predicted to represent a novel type II TA system prevalent in archaea and bacteria. However, the neutralization mechanism and cellular targets of the TA family remain unclear. The toxin SO_3166 having a HEPN domain and its cognate antitoxin SO_3165 with an MNT domain constitute a typical type II TA system that regulates cell motility and confers plasmid stability in the bacterium Shewanella oneidensis Here, we report the crystal structure and solution conformation of the SO_3166-SO_3165 pair, representing the first complex structures in this TA family. The structures revealed that SO_3165 and SO_3166 form a tight heterooctamer (at a 2:6 ratio), an organization that is very rare in other TA systems. We also observed that SO_3166 dimerization enables the formation of a deep cleft at the HEPN-domain interface harboring a composite R X 4-6H active site that functions as an RNA-cleaving RNase. SO_3165 bound SO_3166 mainly through its two α-helices (α2 and α4), functioning as molecular recognition elements. Moreover, their insertion into the SO_3166 cleft sterically blocked the R X 4-6H site or narrowed the cleft to inhibit RNA substrate binding. Structure-based mutagenesis confirmed the important roles of these α-helices in SO_3166 binding and inhibition. Our structure-function analysis provides first insights into the neutralization mechanism of the HEPN-MNT TA family. © 2018 Jia et al.

  12. Consequences of Energetic Frustration on the Ligand-Coupled Folding/Dimerization Dynamics of Allosteric Protein S100A12.

    PubMed

    Ren, Weitong; Li, Wenfei; Wang, Jun; Zhang, Jian; Wang, Wei

    2017-10-26

    Allosteric proteins are featured by energetic degeneracy of two (or more) functionally relevant conformations, therefore their energy landscapes are often locally frustrated. How such frustration affects the protein folding/binding dynamics is not well understood. Here, by using molecular simulations we study the consequences of local frustration in the dimerization dynamics of allosteric proteins based on a homodimer protein S100A12. Despite of the structural symmetry of the two EF-hand motifs in the three-dimensional structures, the S100A12 homodimer shows allosteric behaviors and local frustration only in half of its structural elements, i.e., the C-terminal EF-hand. We showed that such spatially asymmetric location of frustration leads to asymmetric dimerization pathways, in which the dimerization is dominantly initiated by the interchain binding of the minimally frustrated N-terminal EF-hands, achieving optimal balance between the requirements of rapid conformational switching and interchain assembling to the energy landscapes. We also showed that the local frustration, as represented by the double-basin topography of the energy landscape, gives rise to multiple cross-linked dimerization pathways, in which the dimerization is coupled with the allosteric motions of the C-terminal EF-hands. Binding of metal ions tends to reshape the energy landscape and modulate the dimerization pathways. In addition, by employing the frustratometer method, we showed that the highly frustrated residue-pairs in the C-terminal EF-hand are partially unfolded during the conformational transitions of the native homodimer, leading to lowing of free energy barrier. Our results revealed tight interplay between the local frustration of the energy landscape and the dimerization dynamics for allosteric proteins.

  13. Transition States and transition state analogue interactions with enzymes.

    PubMed

    Schramm, Vern L

    2015-04-21

    Enzymatic transition states have lifetimes of a few femtoseconds (fs). Computational analysis of enzyme motions leading to transition state formation suggests that local catalytic site motions on the fs time scale provide the mechanism to locate transition states. An experimental test of protein fs motion and its relation to transition state formation can be provided by isotopically heavy proteins. Heavy enzymes have predictable mass-altered bond vibration states without altered electrostatic properties, according to the Born-Oppenheimer approximation. On-enzyme chemistry is slowed in most heavy proteins, consistent with altered protein bond frequencies slowing the search for the transition state. In other heavy enzymes, structural changes involved in reactant binding and release are also influenced. Slow protein motions associated with substrate binding and catalytic site preorganization are essential to allow the subsequent fs motions to locate the transition state and to facilitate the efficient release of products. In the catalytically competent geometry, local groups move in stochastic atomic motion on the fs time scale, within transition state-accessible conformations created by slower protein motions. The fs time scale for the transition state motions does not permit thermodynamic equilibrium between the transition state and stable enzyme states. Isotopically heavy enzymes provide a diagnostic tool for fast coupled protein motions to transition state formation and mass-dependent conformational changes. The binding of transition state analogue inhibitors is the opposite in catalytic time scale to formation of the transition state but is related by similar geometries of the enzyme-transition state and enzyme-inhibitor interactions. While enzymatic transition states have lifetimes as short as 10(-15) s, transition state analogues can bind tightly to enzymes with release rates greater than 10(3) s. Tight-binding transition state analogues stabilize the rare but evolved enzymatic geometry to form the transition state. Evolution to efficient catalysis optimized this geometry and its stabilization by a transition state mimic results in tight binding. Release rates of transition state analogues are orders of magnitude slower than product release in normal catalytic function. During catalysis, product release is facilitated by altered chemistry. Compared to the weak associations found in Michaelis complexes, transition state analogues involve strong interactions related to those in the transition state. Optimum binding of transition state analogues occurs when the complex retains the system motions intrinsic to transition state formation. Conserved dynamic motion retains the entropic components of inhibitor complexes, improving the thermodynamics of analogue binding.

  14. Comparative studies of human and chicken retinol-binding proteins and prealbumins.

    PubMed

    Kopelman, M; Mokady, S; Cogan, U

    1976-08-09

    Microheterogeneity of retinol-binding proteins of human plasma and urine, and of chicken plasma was studied by polyacrylamide gel electrophoresis. All three protein systems were found microheterogenous. Incorporation of retinol into the protein preparations on the one hand, and depletion of these proteins from retinol on the other hand, enabled us to clarify the extent to which the presence or absence of the ligand affects the apparent heterogeneity. Upon electrophoresis, each of the native proteins displayed two pairs of protein zones. It appeared that within each pair the fast moving band corresponded to aporetinol-binding protein which upon binding of retinol was converted to a holoprotein with a slightly lower mobility. However, it did not seem that proteins of one pair were converted to proteins of the second pair upon binding of retinol, substantiating ghe microheterogenous character of this protein system. A rapid, two step procedure for isolation of prealbumins from plasma is described. The method which consists of DEAE-cellulose chromatography follwed by preparative electrophoresis was utilized to separate human and chicken prealbumins. Routine dodecyl sulphate electrophoresis resulted in partial dissociation of human prealbumin but in no dissociation of the chicken protein. More drastic treatments prior to electrophoresis were needed to effect complete disruption of both proteins into subunits.

  15. Inhibition of ATP Synthase by Chlorinated Adenosine Analogue

    PubMed Central

    Chen, Lisa S.; Nowak, Billie J.; Ayres, Mary L.; Krett, Nancy L.; Rosen, Steven T.; Zhang, Shuxing; Gandhi, Varsha

    2009-01-01

    8-Chloroadenosine (8-Cl-Ado) is a ribonucleoside analogue that is currently in clinical trial for chronic lymphocytic leukemia. Based on the decline in cellular ATP pool following 8-Cl-Ado treatment, we hypothesized that 8-Cl-ADP and 8-Cl-ATP may interfere with ATP synthase, a key enzyme in ATP production. Mitochondrial ATP synthase is composed of two major parts; FO intermembrane base and F1 domain, containing α and β subunits. Crystal structures of both α and β subunits that bind to the substrate, ADP, are known in tight binding (αdpβdp) and loose binding (αtpβtp) states. Molecular docking demonstrated that 8-Cl-ADP/8-Cl-ATP occupied similar binding modes as ADP/ATP in the tight and loose binding sites of ATP synthase, respectively, suggesting that the chlorinated nucleotide metabolites may be functional substrates and inhibitors of the enzyme. The computational predictions were consistent with our whole cell biochemical results. Oligomycin, an established pharmacological inhibitor of ATP synthase, decreased both ATP and 8-Cl-ATP formation from exogenous substrates, however, did not affect pyrimidine nucleoside analogue triphosphate accumulation. Synthesis of ATP from ADP was inhibited in cells loaded with 8-Cl-ATP. These biochemical studies are in consent with the computational modeling; in the αtpβtp state 8-Cl-ATP occupies similar binding as ANP, a non-hydrolyzable ATP mimic that is a known inhibitor. Similarly, in the substrate binding site (αdpβdp) 8-Cl-ATP occupies a similar position as ATP mimic ADP-BeF3 −. Collectively, our current work suggests that 8-Cl-ADP may serve as a substrate and the 8-Cl-ATP may be an inhibitor of ATP synthase. PMID:19477165

  16. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    PubMed

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  17. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

    PubMed Central

    Kondo, Jiro; Westhof, Eric

    2011-01-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

  18. Density function theory study of the adsorption and dissociation of carbon monoxide on tungsten nanoparticles.

    PubMed

    Weng, Meng-Hsiung; Ju, Shin-Pon; Chen, Hsin-Tsung; Chen, Hui-Lung; Lu, Jian-Ming; Lin, Ken-Huang; Lin, Jenn-Sen; Hsieh, Jin-Yuan; Yang, Hsi-Wen

    2013-02-01

    The adsorption and dissociation properties of carbon monoxide (CO) molecule on tungsten W(n) (n = 10-15) nanoparticles have been investigated by density-functional theory (DFT) calculations. The lowest-energy structures for W(n) (n = 10-15) nanoparticles are found by the basin-hopping method and big-bang method with the modified tight-binding many-body potential. We calculated the corresponding adsorption energies, C-O bond lengths and dissociation barriers for adsorption of CO on nanoparticles. The electronic properties of CO on nanoparticles are studied by the analysis of density of state and charge density. The characteristic of CO on W(n) nanoparticles are also compared with that of W bulk.

  19. Thermodynamically accessible titanium clusters TiN, N = 2-32.

    PubMed

    Lazauskas, Tomas; Sokol, Alexey A; Buckeridge, John; Catlow, C Richard A; Escher, Susanne G E T; Farrow, Matthew R; Mora-Fonz, David; Blum, Volker W; Phaahla, Tshegofatso M; Chauke, Hasani R; Ngoepe, Phuti E; Woodley, Scott M

    2018-05-10

    We have performed a genetic algorithm search on the tight-binding interatomic potential energy surface (PES) for small TiN (N = 2-32) clusters. The low energy candidate clusters were further refined using density functional theory (DFT) calculations with the PBEsol exchange-correlation functional and evaluated with the PBEsol0 hybrid functional. The resulting clusters were analysed in terms of their structural features, growth mechanism and surface area. The results suggest a growth mechanism that is based on forming coordination centres by interpenetrating icosahedra, icositetrahedra and Frank-Kasper polyhedra. We identify centres of coordination, which act as centres of bulk nucleation in medium sized clusters and determine the morphological features of the cluster.

  20. Strain-induced fundamental optical transition in (In,Ga)As/GaP quantum dots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert, C., E-mail: cedric.robert@insa-rennes.fr, E-mail: cedric.robert@tyndall.ie; Pedesseau, L.; Cornet, C.

    The nature of the ground optical transition in an (In,Ga)As/GaP quantum dot is thoroughly investigated through a million atoms supercell tight-binding simulation. Precise quantum dot morphology is deduced from previously reported scanning-tunneling-microscopy images. The strain field is calculated with the valence force field method and has a strong influence on the confinement potentials, principally, for the conduction band states. Indeed, the wavefunction of the ground electron state is spatially confined in the GaP matrix, close to the dot apex, in a large tensile strain region, having mainly Xz character. Photoluminescence experiments under hydrostatic pressure strongly support the theoretical conclusions.

  1. Multiple mobility edges in a 1D Aubry chain with Hubbard interaction in presence of electric field: Controlled electron transport

    NASA Astrophysics Data System (ADS)

    Saha, Srilekha; Maiti, Santanu K.; Karmakar, S. N.

    2016-09-01

    Electronic behavior of a 1D Aubry chain with Hubbard interaction is critically analyzed in presence of electric field. Multiple energy bands are generated as a result of Hubbard correlation and Aubry potential, and, within these bands localized states are developed under the application of electric field. Within a tight-binding framework we compute electronic transmission probability and average density of states using Green's function approach where the interaction parameter is treated under Hartree-Fock mean field scheme. From our analysis we find that selective transmission can be obtained by tuning injecting electron energy, and thus, the present model can be utilized as a controlled switching device.

  2. Antifreeze Protein Binds Irreversibly to Ice

    NASA Astrophysics Data System (ADS)

    Braslavsky, I.; Pertaya, N.; di Prinzio, C. L.; Wilen, L.; Thomson, E.; Wettlaufer, J. S.; Marshall, C. B.; Davies, P. L.

    2006-03-01

    Many organisms are protected from freezing by antifreeze proteins (AFPs), which bind to ice and prevent its growth by a mechanism not completely understood. Although it has been postulated that AFPs would have to bind irreversibly to arrest the growth of an ice crystal bathed in excess liquid water, the binding forces seem insufficient to support such a tight interaction. By putting a fluorescent tag on a fish AFP, we were able to visualize AFP binding to ice and demonstrate, by lack of recovery after photo-bleaching, that it is indeed irreversible. Because even the most avid protein/ligand interactions exhibit reversibility, this finding is key to understanding the mechanism of antifreeze proteins, which are becoming increasingly valuable in cryopreservation and improving the frost tolerance of crops.

  3. A global reaction route mapping-based kinetic Monte Carlo algorithm

    NASA Astrophysics Data System (ADS)

    Mitchell, Izaac; Irle, Stephan; Page, Alister J.

    2016-07-01

    We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

  4. A global reaction route mapping-based kinetic Monte Carlo algorithm.

    PubMed

    Mitchell, Izaac; Irle, Stephan; Page, Alister J

    2016-07-14

    We propose a new on-the-fly kinetic Monte Carlo (KMC) method that is based on exhaustive potential energy surface searching carried out with the global reaction route mapping (GRRM) algorithm. Starting from any given equilibrium state, this GRRM-KMC algorithm performs a one-step GRRM search to identify all surrounding transition states. Intrinsic reaction coordinate pathways are then calculated to identify potential subsequent equilibrium states. Harmonic transition state theory is used to calculate rate constants for all potential pathways, before a standard KMC accept/reject selection is performed. The selected pathway is then used to propagate the system forward in time, which is calculated on the basis of 1st order kinetics. The GRRM-KMC algorithm is validated here in two challenging contexts: intramolecular proton transfer in malonaldehyde and surface carbon diffusion on an iron nanoparticle. We demonstrate that in both cases the GRRM-KMC method is capable of reproducing the 1st order kinetics observed during independent quantum chemical molecular dynamics simulations using the density-functional tight-binding potential.

  5. AFRRI Reports, Second Quarter 1994

    DTIC Science & Technology

    1994-08-01

    the antrum wete immediately placed in sterile 0.9% NaCl, kept on ice, coded, and then prepared for culture, smears, and urease assay by homogeniza...high urease specific activity (>1 |J.mol- min-1 ■ mg protein-1) plus high-affinity substrate binding (Mi- chaelis constant [K^\\ < 1 mmol/L),27 in at...031, respectively), and the characteristic bacterial growth with high-activity product.on of a urease with tight substrate binding " was found in

  6. Triazole biotin: a tight-binding biotinidase-resistant conjugate.

    PubMed

    Germeroth, Anne I; Hanna, Jill R; Karim, Rehana; Kundel, Franziska; Lowther, Jonathan; Neate, Peter G N; Blackburn, Elizabeth A; Wear, Martin A; Campopiano, Dominic J; Hulme, Alison N

    2013-11-28

    The natural amide bond found in all biotinylated proteins has been replaced with a triazole through CuAAC reaction of an alkynyl biotin derivative. The resultant triazole-linked adducts are shown to be highly resistant to the ubiquitous hydrolytic enzyme biotinidase and to bind avidin with dissociation constants in the low pM range. Application of this strategy to the production of a series of biotinidase-resistant biotin-Gd-DOTA contrast agents is demonstrated.

  7. Combined first-principles and model Hamiltonian study of the perovskite series R MnO 3 (R =La ,Pr ,Nd ,Sm ,Eu , and Gd )

    NASA Astrophysics Data System (ADS)

    Kováčik, Roman; Murthy, Sowmya Sathyanarayana; Quiroga, Carmen E.; Ederer, Claude; Franchini, Cesare

    2016-02-01

    We merge advanced ab initio schemes (standard density functional theory, hybrid functionals, and the G W approximation) with model Hamiltonian approaches (tight-binding and Heisenberg Hamiltonian) to study the evolution of the electronic, magnetic, and dielectric properties of the manganite family R MnO3 (R =La,Pr,Nd,Sm,Eu, and Gd) . The link between first principles and tight binding is established by downfolding the physically relevant subset of 3 d bands with eg character by means of maximally localized Wannier functions (MLWFs) using the VASP2WANNIER90 interface. The MLWFs are then used to construct a general tight-binding Hamiltonian written as a sum of the kinetic term, the Hund's rule coupling, the JT coupling, and the electron-electron interaction. The dispersion of the tight-binding (TB) eg bands at all levels are found to match closely the MLWFs. We provide a complete set of TB parameters which can serve as guidance for the interpretation of future studies based on many-body Hamiltonian approaches. In particular, we find that the Hund's rule coupling strength, the Jahn-Teller coupling strength, and the Hubbard interaction parameter U remain nearly constant for all the members of the R MnO3 series, whereas the nearest-neighbor hopping amplitudes show a monotonic attenuation as expected from the trend of the tolerance factor. Magnetic exchange interactions, computed by mapping a large set of hybrid functional total energies onto an Heisenberg Hamiltonian, clarify the origin of the A-type magnetic ordering observed in the early rare-earth manganite series as arising from a net negative out-of-plane interaction energy. The obtained exchange parameters are used to estimate the Néel temperature by means of Monte Carlo simulations. The resulting data capture well the monotonic decrease of the ordering temperature down the series from R =La to Gd, in agreement with experiments. This trend correlates well with the modulation of structural properties, in particular with the progressive reduction of the Mn-O-Mn bond angle which is associated with the quenching of the volume and the decrease of the tolerance factor due to the shrinkage of the ionic radii of R going from La to Gd.

  8. Targeted inhibition of mutant IDH2 in leukemia cells induces cellular differentiation.

    PubMed

    Wang, Fang; Travins, Jeremy; DeLaBarre, Byron; Penard-Lacronique, Virginie; Schalm, Stefanie; Hansen, Erica; Straley, Kimberly; Kernytsky, Andrew; Liu, Wei; Gliser, Camelia; Yang, Hua; Gross, Stefan; Artin, Erin; Saada, Veronique; Mylonas, Elena; Quivoron, Cyril; Popovici-Muller, Janeta; Saunders, Jeffrey O; Salituro, Francesco G; Yan, Shunqi; Murray, Stuart; Wei, Wentao; Gao, Yi; Dang, Lenny; Dorsch, Marion; Agresta, Sam; Schenkein, David P; Biller, Scott A; Su, Shinsan M; de Botton, Stephane; Yen, Katharine E

    2013-05-03

    A number of human cancers harbor somatic point mutations in the genes encoding isocitrate dehydrogenases 1 and 2 (IDH1 and IDH2). These mutations alter residues in the enzyme active sites and confer a gain-of-function in cancer cells, resulting in the accumulation and secretion of the oncometabolite (R)-2-hydroxyglutarate (2HG). We developed a small molecule, AGI-6780, that potently and selectively inhibits the tumor-associated mutant IDH2/R140Q. A crystal structure of AGI-6780 complexed with IDH2/R140Q revealed that the inhibitor binds in an allosteric manner at the dimer interface. The results of steady-state enzymology analysis were consistent with allostery and slow-tight binding by AGI-6780. Treatment with AGI-6780 induced differentiation of TF-1 erythroleukemia and primary human acute myelogenous leukemia cells in vitro. These data provide proof-of-concept that inhibitors targeting mutant IDH2/R140Q could have potential applications as a differentiation therapy for cancer.

  9. Physical Foundations of PTEN/Phosphoinositide Interaction

    NASA Astrophysics Data System (ADS)

    Gericke, Arne; Jiang, Zhiping; Redfern, Roberta E.; Kooijman, Edgar E.; Ross, Alonzo H.

    2009-03-01

    Phosphoinositides act as signaling molecules by recruiting critical effectors to specific subcellular membranes to regulate cell proliferation, apoptosis and cytoskeletal reorganization, which requires a tight regulation of phosphoinositide generation and turnover as well as a high degree of compartmentalization. PTEN is a phosphatase specific for the 3 position of the phosophoinositide ring that is deleted or mutated in many different disease states. PTEN association with membranes requires the interaction of its C2 domain with phosphatidylserine and the interaction of its N-terminal end with phosphatidylinositol-4,5-bisphophate (PI(4,5)P2). We have investigated PTEN/PI(4,5)P2 interaction and found that Lys13 is crucial for the observed binding. We also found that the presence of cholesterol enhances PTEN binding to mixed PI(4,5)P2/POPC vesicles. Fluorescence microscopy experiments utilizing GUVs yielded results consistent with enhanced phosphoinositide domain formation in the presence of cholesterol. These experiments were accompanied by zeta potential measurements and solid state MAS ^31P-NMR experiments aimed at investigating the ionization behavior of phosphoinositides.

  10. Bimodal Exciplex Formation in Bimolecular Photoinduced Electron Transfer Revealed by Ultrafast Time-Resolved Infrared Absorption.

    PubMed

    Koch, Marius; Licari, Giuseppe; Vauthey, Eric

    2015-09-03

    The dynamics of a moderately exergonic photoinduced charge separation has been investigated by ultrafast time-resolved infrared absorption with the dimethylanthracene/phthalonitrile donor/acceptor pair in solvents covering a broad range of polarity. A distinct spectral signature of an exciplex could be identified in the -C≡N stretching region. On the basis of quantum chemistry calculations, the 4-5 times larger width of this band compared to those of the ions and of the locally excited donor bands is explained by a dynamic distribution of exciplex geometry with different mutual orientations and distances of the constituents and, thus, with varying charge-transfer character. Although spectrally similar, two types of exciplexes could be distinguished by their dynamics: short-lived, "tight", exciplexes generated upon static quenching and longer-lived, "loose", exciplexes formed upon dynamic quenching in parallel with ion pairs. Tight exciplexes were observed in all solvents, except in the least polar diethyl ether where quenching is slower than diffusion. The product distribution of the dynamic quenching depends strongly on the solvent polarity: whereas no significant loose exciplex population could be detected in acetonitrile, both exciplex and ion pair are generated in less polar solvents, with the relative population of exciplex increasing with decreasing solvent polarity. These results are compared with those reported previously with donor/acceptor pairs in different driving force regimes to obtain a comprehensive picture of the role of the exciplexes in bimolecular photoinduced charge separation.

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  12. Gamma-ray generation in the interaction of two tightly focused laser pulses with a low-density target composed of electrons

    NASA Astrophysics Data System (ADS)

    Jirka, M.; Klimo, O.; Weber, S.; Bulanov, Sergei V.; Esirkepov, Timur Zh.; Korn, G.

    2015-05-01

    With the continuing development of laser systems, new important and so-far unexplored fields of research related to interaction of ultra-intense laser beams with matter are opening. At intensities of the order of 1022 W=cm2, electrons may be accelerated in the electromagnetic field of the laser wave and achieve such a high energy that they can enter the regime affected by the radiation reaction. Due to the non-linear Thomson and Compton scattering the accelerated electrons emit photons. The interaction of emitted photons with the laser field may result in effective generation of electron-positron pairs by means of the Breit-Wheeler process. In this work we study the influence of laser pulse polarization on gamma-ray generation during interaction of two colliding and tightly focused laser pulses with a low density target composed of electrons. This paper focuses on evolution of electron trajectories and key parameters χe (probability of photon emission) and χγ(probability of pair generation) in the laser field. These interactions are studied using 2D PIC simulations. It is shown that in the case of circularly polarized and tightly focused laser beams, electrons are not following circular trajectories at the magnetic node of the standing wave established in the focus, which leads to lowering the radiation emission efficiency.

  13. Effects of autoshaping procedures on 3H-8-OH-DPAT-labeled 5-HT1a binding and 125I-LSD-labeled 5-HT2a binding in rat brain.

    PubMed

    Tomie, Arthur; Di Poce, Jason; Aguado, Allison; Janes, Amy; Benjamin, Daniel; Pohorecky, Larissa

    2003-06-13

    Effects of experience with Pavlovian autoshaping procedures on lever-press autoshaping conditioned response (CR) performance and 3H-8-OH-DPAT-labeled binding of 5-HT(1a) receptors as well as 125I-LSD-labeled binding of 5-HT(2a) receptors were evaluated in four groups of male Long-Evans hooded rats. Two groups of rats (Group Paired High CR and Group Paired Low CR) received Pavlovian autoshaping procedures wherein the presentation of a lever (conditioned stimulus, CS) was followed by the response-independent presentation of food (unconditioned stimulus, US). Rats in Group Paired High CR (n=12) showed more rapid CR acquisition and higher asymptotic levels of lever-press autoshaping CR performance relative to rats in Group Low CR (n=12). Group Omission (n=9) received autoshaping with an omission contingency, such that performing the lever-press autoshaping CR resulted in the cancellation the food US, while Group Random (n=9) received presentations of lever CS and food US randomly with respect to one another. Though Groups Omission and Random did not differ in lever-press autoshaping CR performance, Group Omission showed significantly lower levels of 3H-8-OH-DPAT-labeled 5-HT(1a) binding in post-synaptic areas (frontal cortex, septum, caudate putamen), as well as significantly higher plasma corticosterone levels than Group Random. In addition, Group Random showed higher levels of 3H-8-OH-DPAT-labeled 5-HT(1a) binding in pre-synaptic somatodendritic autoreceptors on dorsal raphe nucleus relative to each of the other three groups. Autoradiographic analysis of 125I-LSD-labeled 5-HT(2a) receptor binding revealed no significant differences between Groups Paired High CR and Paired Low CR or between Groups Omission and Random in any brain regions.

  14. The three-dimensional structure of a T-cell antigen receptor V alpha V beta heterodimer reveals a novel arrangement of the V beta domain.

    PubMed Central

    Housset, D; Mazza, G; Grégoire, C; Piras, C; Malissen, B; Fontecilla-Camps, J C

    1997-01-01

    The crystal structure of a mouse T-cell antigen receptor (TCR) Fv fragment complexed to the Fab fragment of a specific anti-clonotypic antibody has been determined to 2.6 A resolution. The polypeptide backbone of the TCR V alpha domain is very similar to those of other crystallographically determined V alphas, whereas the V beta structure is so far unique among TCR V beta domains in that it displays a switch of the c" strand from the inner to the outer beta-sheet. The beta chain variable region of this TCR antigen-binding site is characterized by a rather elongated third complementarity-determining region (CDR3beta) that packs tightly against the CDR3 loop of the alpha chain, without leaving any intervening hydrophobic pocket. Thus, the conformation of the CDR loops with the highest potential diversity distinguishes the structure of this TCR antigen-binding site from those for which crystallographic data are available. On the basis of all these results, we infer that a significant conformational change of the CDR3beta loop found in our TCR is required for binding to its cognate peptide-MHC ligand. PMID:9250664

  15. Label-free imaging of the native, living cellular nanoarchitecture using partial-wave spectroscopic microscopy

    PubMed Central

    Almassalha, Luay M.; Bauer, Greta M.; Chandler, John E.; Gladstein, Scott; Cherkezyan, Lusik; Stypula-Cyrus, Yolanda; Weinberg, Samuel; Zhang, Di; Thusgaard Ruhoff, Peder; Roy, Hemant K.; Subramanian, Hariharan; Chandel, Navdeep S.; Szleifer, Igal; Backman, Vadim

    2016-01-01

    The organization of chromatin is a regulator of molecular processes including transcription, replication, and DNA repair. The structures within chromatin that regulate these processes span from the nucleosomal (10-nm) to the chromosomal (>200-nm) levels, with little known about the dynamics of chromatin structure between these scales due to a lack of quantitative imaging technique in live cells. Previous work using partial-wave spectroscopic (PWS) microscopy, a quantitative imaging technique with sensitivity to macromolecular organization between 20 and 200 nm, has shown that transformation of chromatin at these length scales is a fundamental event during carcinogenesis. As the dynamics of chromatin likely play a critical regulatory role in cellular function, it is critical to develop live-cell imaging techniques that can probe the real-time temporal behavior of the chromatin nanoarchitecture. Therefore, we developed a live-cell PWS technique that allows high-throughput, label-free study of the causal relationship between nanoscale organization and molecular function in real time. In this work, we use live-cell PWS to study the change in chromatin structure due to DNA damage and expand on the link between metabolic function and the structure of higher-order chromatin. In particular, we studied the temporal changes to chromatin during UV light exposure, show that live-cell DNA-binding dyes induce damage to chromatin within seconds, and demonstrate a direct link between higher-order chromatin structure and mitochondrial membrane potential. Because biological function is tightly paired with structure, live-cell PWS is a powerful tool to study the nanoscale structure–function relationship in live cells. PMID:27702891

  16. First-principles modeling of the thermoelectric properties of SrTiO3/SrRuO3 superlattices

    NASA Astrophysics Data System (ADS)

    García-Fernández, Pablo; Verissimo-Alves, Marcos; Bilc, Daniel I.; Ghosez, Philippe; Junquera, Javier

    2012-08-01

    Using a combination of first-principles simulations, based on density functional theory and Boltzmann's semiclassical theory, we have calculated the transport and thermoelectric properties of the half-metallic two-dimensional electron gas confined in single SrRuO3 layers of SrTiO3/SrRuO3 periodic superlattices. Close to the Fermi energy, we find that the semiconducting majority-spin channel displays a very large in-plane component of the Seebeck tensor at room temperature, S˜ 1500 μV/K, and the minority-spin channel shows good in-plane conductivity, σ=2.5 (mΩ cm)-1. However, we find that the total power factor and thermoelectric figure of merit for reduced doping is too small for practical applications. Our results support that the confinement of the electronic motion is not the only thing that matters to describe the main features of the transport and thermoelectric properties with respect the chemical doping, but the shape of the electronic density of states, which in our case departs from the free-electron behavior, is also important. The evolution of the electronic structure, electrical conductivity, Seebeck coefficient, and power factor as a function of the chemical potential is explained by a simplified tight-binding model. We find that the electron gas in our system is composed by a pair of one-dimensional electron gases orthogonal to each other. This reflects the fact the physical dimensionality of the electronic system (1D) can be even smaller than that of the spacial confinement of the carriers (2D).

  17. Imino proton exchange and base-pair kinetics in the AMP-RNA aptamer complex.

    PubMed

    Nonin, S; Jiang, F; Patel, D J

    1997-05-02

    We report on the dynamics of base-pair opening in the ATP-binding asymmetric internal loop and flanking base-pairs of the AMP-RNA aptamer complex by monitoring the exchange characteristics of the extremely well resolved imino protons in the NMR spectrum of the complex. The kinetics of imino proton exchange as a function of basic pH or added ammonia catalyst are used to measure the apparent base-pair dissociation constants and lifetimes of Watson-Crick and mismatched base-pairs, as well as the solvent accessibility of the unpaired imino protons in the complex. The exchange characteristics of the imino protons identify the existence of four additional hydrogen bonds stabilizing the conformation of the asymmetric ATP-binding internal loop that were not detected by NOEs and coupling constants alone, but are readily accommodated in the previously reported solution structure of the AMP-RNA aptamer complex published from our laboratory. The hydrogen exchange kinetics of the non-Watson-Crick pairs in the asymmetric internal loop of the AMP-RNA aptamer complex have been characterized and yield apparent dissociation constants (alphaKd) that range from 10(-2) to 10(-7). Surprisingly, three of these alphaKd values are amongst the lowest measured for all base-pairs in the AMP-RNA aptamer complex. Comparative studies of hydrogen exchange of the imino protons in the free RNA aptamer and the AMP-RNA aptamer complex establish that complexation stabilizes not only the bases within the ATP-binding asymmetric internal loop, but also the flanking stem base-pairs (two pairs on either side) of the binding site. We also outline some preliminary results related to the exchange properties of a sugar 2'-hydroxyl proton of a guanosine residue involved in a novel hydrogen bond that has been shown to contribute to the immobilization of the bound AMP by the RNA aptamer, and whose resonance is narrow and downfield shifted in the spectrum.

  18. Oriented covalent immobilization of antibodies for measurement of intermolecular binding forces between zipper-like contact surfaces of split inteins.

    PubMed

    Sorci, Mirco; Dassa, Bareket; Liu, Hongwei; Anand, Gaurav; Dutta, Amit K; Pietrokovski, Shmuel; Belfort, Marlene; Belfort, Georges

    2013-06-18

    In order to measure the intermolecular binding forces between two halves (or partners) of naturally split protein splicing elements called inteins, a novel thiol-hydrazide linker was designed and used to orient immobilized antibodies specific for each partner. Activation of the surfaces was achieved in one step, allowing direct intermolecular force measurement of the binding of the two partners of the split intein (called protein trans-splicing). Through this binding process, a whole functional intein is formed resulting in subsequent splicing. Atomic force microscopy (AFM) was used to directly measure the split intein partner binding at 1 μm/s between native (wild-type) and mixed pairs of C- and N-terminal partners of naturally occurring split inteins from three cyanobacteria. Native and mixed pairs exhibit similar binding forces within the error of the measurement technique (~52 pN). Bioinformatic sequence analysis and computational structural analysis discovered a zipper-like contact between the two partners with electrostatic and nonpolar attraction between multiple aligned ion pairs and hydrophobic residues. Also, we tested the Jarzynski's equality and demonstrated, as expected, that nonequilibrium dissipative measurements obtained here gave larger energies of interaction as compared with those for equilibrium. Hence, AFM coupled with our immobilization strategy and computational studies provides a useful analytical tool for the direct measurement of intermolecular association of split inteins and could be extended to any interacting protein pair.

  19. Structure-guided design of an engineered streptavidin with reusability to purify streptavidin-binding peptide tagged proteins or biotinylated proteins.

    PubMed

    Wu, Sau-Ching; Wong, Sui-Lam

    2013-01-01

    Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3-4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4 × 10(-14) M to 4.45 × 10(-10) M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible.

  20. Structure-Guided Design of an Engineered Streptavidin with Reusability to Purify Streptavidin-Binding Peptide Tagged Proteins or Biotinylated Proteins

    PubMed Central

    Wu, Sau-Ching; Wong, Sui-Lam

    2013-01-01

    Development of a high-affinity streptavidin-binding peptide (SBP) tag allows the tagged recombinant proteins to be affinity purified using the streptavidin matrix without the need of biotinylation. The major limitation of this powerful technology is the requirement to use biotin to elute the SBP-tagged proteins from the streptavidin matrix. Tight biotin binding by streptavidin essentially allows the matrix to be used only once. To address this problem, differences in interactions of biotin and SBP with streptavidin were explored. Loop3–4 which serves as a mobile lid for the biotin binding pocket in streptavidin is in the closed state with biotin binding. In contrast, this loop is in the open state with SBP binding. Replacement of glycine-48 with a bulkier residue (threonine) in this loop selectively reduces the biotin binding affinity (Kd) from 4×10−14 M to 4.45×10−10 M without affecting the SBP binding affinity. Introduction of a second mutation (S27A) to the first mutein (G48T) results in the development of a novel engineered streptavidin SAVSBPM18 which could be recombinantly produced in the functional form from Bacillus subtilis via secretion. To form an intact binding pocket for tight binding of SBP, two diagonally oriented subunits in a tetrameric streptavidin are required. It is vital for SAVSBPM18 to be stably in the tetrameric state in solution. This was confirmed using an HPLC/Laser light scattering system. SAVSBPM18 retains high binding affinity to SBP but has reversible biotin binding capability. The SAVSBPM18 matrix can be applied to affinity purify SBP-tagged proteins or biotinylated molecules to homogeneity with high recovery in a reusable manner. A mild washing step is sufficient to regenerate the matrix which can be reused for multiple rounds. Other applications including development of automated protein purification systems, lab-on-a-chip micro-devices, reusable biosensors, bioreactors and microarrays, and strippable detection agents for various blots are possible. PMID:23874971

  1. Modified Hydra Bioassay to Evaluate the Toxicity of Multiple Mycotoxins and Predict the Detoxification Efficacy of a Clay-Based Sorbent

    PubMed Central

    Brown, KA; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, NJ; Elmore, SE; Phillips, TD

    2013-01-01

    Food shortages and lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B1 (AFB1) and fumonisin B1 (FB1). A refined calcium montmorillonite clay (i.e. UPSN) has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present work were to examine the ability of UPSN to bind mixtures of AFB1 and FB1at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB1 and FB1 toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB1 binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB1 bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB1, AFB1 and FB1/AFB1 combinations with and without UPSN. Toxic response over 92 hours was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 μg/mLfor AFB1, while the MEC for FB1 was not reached. The MEC for co-exposure was 400 μg/mL FB1 + 10 μg/mL AFB1. This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin binding agents. PMID:23047854

  2. Modified hydra bioassay to evaluate the toxicity of multiple mycotoxins and predict the detoxification efficacy of a clay-based sorbent.

    PubMed

    Brown, K A; Mays, T; Romoser, A; Marroquin-Cardona, A; Mitchell, N J; Elmore, S E; Phillips, T D

    2014-01-01

    Food shortages and a lack of food supply regulation in developing countries often leads to chronic exposure of vulnerable populations to hazardous mixtures of mycotoxins, including aflatoxin B(1) (AFB(1)) and fumonisin B(1) (FB(1)). A refined calcium montmorillonite clay [i.e. uniform particle size NovaSil (UPSN)] has been reported to tightly bind these toxins, thereby decreasing bioavailability in humans and animals. Hence, our objectives in the present study were to examine the ability of UPSN to bind mixtures of AFB(1) and FB(1) at gastrointestinally relevant pH in vitro, and to utilize a rapid in vivo bioassay to evaluate AFB(1) and FB(1) toxicity and UPSN efficacy. Isothermal sorption data indicated tight AFB(1) binding to UPSN surfaces at both pH 2.0 and 6.5, but substantially more FB(1) bound at pH 2.0 than 6.5. Site-specific competition occurred between the toxins when exposed to UPSN in combination. Importantly, treatment with UPSN resulted in significant protection to mycotoxin-exposed hydra maintained at pH 6.9-7.0. Hydra were exposed to FB(1), AFB(1) and FB(1) /AFB(1) combinations with and without UPSN. A toxic response over 92 h was rated based on morphology and mortality. Hydra assay results indicated a minimum effective concentration (MEC) of 20 µg ml(-1) for AFB(1), whereas the MEC for FB(1) was not reached. The MEC for co-exposure was 400 µg ml(-1) FB(1) + 10 µg ml(-1) AFB(1). This study demonstrates that UPSN sorbs both mycotoxins tightly at physiologically relevant pH levels, resulting in decreased bioavailability, and that a modified hydra bioassay can be used as an initial screen in vivo to predict efficacy of toxin-binding agents. Copyright © 2012 John Wiley & Sons, Ltd.

  3. Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

    PubMed Central

    Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

    2008-01-01

    Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

  4. Slow-binding inhibition of sialidase from influenza virus.

    PubMed

    Pegg, M S; von Itzstein, M

    1994-04-01

    Sialidase from influenza virus A (Tokyo/3/67, N2) is inhibited in slow-binding fashion by 2,3-didehydro-2,4-dideoxy-4-guanidino-N-acetyl-D-neuraminic acid. The Ki observed for the tightly-bound form at steady-state is 3 x 10(-11) M. Slow-binding, which is a consequence of the guanidinyl moiety of the inhibitor, is observed only for influenza virus A sialidase and not for influenza virus B or any other viral, bacterial, or mammalian sialidase investigated. The different results obtained for sialidases from influenza virus A and B, whose active sites are conserved, point to the involvement of the expulsion of a structural water molecule in the slow-binding mechanism.

  5. Theory of K-edge resonant inelastic x-ray scattering and its application for La0.5Sr1.5MnO4

    NASA Astrophysics Data System (ADS)

    Seman, T. F.; Liu, X.; Hill, J. P.; van Veenendaal, M.; Ahn, K. H.

    2013-03-01

    We present a formula based on tight-binding approach for the calculation of K-edge resonant inelastic x-ray scattering spectrum for transition metal oxides, by extending the previous result [K. H. Ahn, A. J. Fedro, and M. van Veenendaal, Phys. Rev. B 79, 045103 (2009).] to include explicit momentum dependence and a basis with multiple core hole sites. We apply this formula to layered charge, orbital, and spin ordered manganites, La0.5Sr1.5MnO4. The K-edge RIXS spectrum is found not periodic with respect to the actual reciprocal lattice, but approximately periodic with respect to the reciprocal lattice for the hypothetical unit cell with one core hole site. With experimental strcuture and reasonable tight-binding parameters, we obtain good agreement with experimental data, in particular, with regards to the large variation of the intensity with momentum. We find that the screening in La0.5Sr1.5MnO4 is highly localized around the core hole site and demonstrate the potential of K-edge RIXS as a probe for the screening dynamics in materials. Work supported by US.DOE Contr. DE-AC02-98CH10886 (X.L.,J.H.), US.DOE Award DE-FG02-03ER46097 (M.v.V.), CMCSN under Grants DE-FG02-08ER46540 & DE-SC0007091 (T.S.,K.A.,M.v.V.), Argonne XSD Visitor Prog.(K.A.), US.DOE Contr. DE-AC02-06CH11357 (X.L.,J.H).

  6. Biophysical characterization of interactions between the C-termini of peripheral nerve claudins and the PDZ₁ domain of zonula occludens.

    PubMed

    Wu, Jiawen; Peng, Dungeng; Zhang, Yang; Lu, Zhenwei; Voehler, Markus; Sanders, Charles R; Li, Jun

    2015-03-27

    Our recent study has shown that cellular junctions in myelin and in the epi-/perineruium that encase nerve fibers regulate the permeability of the peripheral nerves. This permeability may affect propagation of the action potential. Direct interactions between the PDZ₁ domain of zonula occludens (ZO₁ or ZO₂) and the C-termini of claudins are known to be crucial for the formation of tight junctions. Using the purified PDZ₁ domain of ZO₂ and a variety of C-terminal mutants of peripheral nerve claudins (claudin-1, claudin-2, claudin-3, claudin-5 in epi-/perineurium; claudin-19 in myelin), we have utilized NMR spectroscopy to determine specific roles of the 3 C-terminal claudin residues (position -2, -1, 0) for their interactions with PDZ₁ of ZO₂. In contrast to the canonical model that emphasizes the importance of residues at the -2 and 0 positions, our results demonstrate that, for peripheral nerve claudins, the residue at position -1 plays a critical role in association with PDZ₁, while the side-chain of residue 0 plays a significant but lesser role. Surprisingly, claudin-19, the most abundant claudin in myelin, exhibited no binding to ZO₂. These findings reveal that the binding mechanism of claudin/ZO in epi-/perineurium is distinct from the canonical interactions between non-ZO PDZ-containing proteins with their ligands. This observation provides the molecular basis for a strategy to develop drugs that target tight junctions in the epi-/perineurium of peripheral nerves. Published by Elsevier Inc.

  7. Potential of mean force between like-charged nanoparticles: Many-body effect

    NASA Astrophysics Data System (ADS)

    Zhang, Xi; Zhang, Jin-Si; Shi, Ya-Zhou; Zhu, Xiao-Long; Tan, Zhi-Jie

    2016-03-01

    Ion-mediated interaction is important for the properties of polyelectrolytes such as colloids and nucleic acids. The effective pair interactions between two polyelectrolytes have been investigated extensively, but the many-body effect for multiple polyelectrolytes still remains elusive. In this work, the many-body effect in potential of mean force (PMF) between like-charged nanoparticles in various salt solutions has been comprehensively examined by Monte Carlo simulation and the nonlinear Poisson-Boltzmann theory. Our calculations show that, at high 1:1 salt, the PMF is weakly repulsive and appears additive, while at low 1:1 salt, the additive assumption overestimates the repulsive many-body PMF. At low 2:2 salt, the pair PMF appears weakly repulsive while the many-body PMF can become attractive. In contrast, at high 2:2 salt, the pair PMF is apparently attractive while the many-body effect can cause a weaker attractive PMF than that from the additive assumption. Our microscopic analyses suggest that the elusive many-body effect is attributed to ion-binding which is sensitive to ion concentration, ion valence, number of nanoparticles and charges on nanoparticles.

  8. Structural and Biophysical Characterization of the Mycobacterium tuberculosis Protein Rv0577, a Protein Associated with Neutral Red Staining of Virulent Tuberculosis Strains and Homologue of the Streptomyces coelicolor Protein KbpA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchko, Garry W.; Echols, Nathaniel; Flynn, E. Megan

    The 261-residue Mycobacterium tuberculosis protein Rv0577 is a prominent antigen in tuberculosis patients, the responsible component for neutral red staining of virulent strains of M. tuberculosis, a putative component in a methylglyoxal detoxification pathway, and an agonist of toll-like receptor 2. It also has 36% sequence identity to AfsK-binding protein A (KbpA), a component in the complex secondary metabolite pathways in the Streptomycetes genus from which many commercial antibiotics are derived. To gain insight into the biological function of Rv0577 and the family of KpbA kinase regulators, the crystal structure for Rv0577 was determined to a resolution of 1.75 Åmore » (3OXH), binding properties with neutral red and deoxyadenosine (Ado) surveyed, backbone dynamics measured, and thermal stability assayed by CD spectroscopy. The protein is composed of four approximate repeats with an topology arranged radially in consecutive pairs to form two continuous eight-strand -sheets capped on both ends with an -helix. The two -sheets intersect in the center at roughly a right angle and form an asymmetric deep “saddle” on both sides of the protein, saddle one (P11 to A129) and saddle two (L143 to A258), that may serve to bind ligands. NMR chemical shift perturbation experiments show that neutral red binds to Rv0577, further cementing the role of Rv0577 in the neutral red staining of virulent strains of M. tuberculosis. Similar experiments show that adenosine also bind to Rv0577, although less tightly, with estimated dissociation constants of 4.1 ± 0.3 mM for saddle one and > 1 M for saddle two. Heteronuclear steady-state {1H}-15N NOE, T1, and T2 values were generally uniform through-out the sequence with only a few modest pockets of differences suggestive of slightly different motion in loops between -strands in saddle 1. Circular dichroism spectroscopy characterization of the thermal stability of Rv0577 indicated irreversible unfolding upon heating with an estimated melting temperature of 56 °C. While it is not known if Rv0577 has a kinase regulatory role similar to its Streptomyces homolog KbpA, protein kinase and phosphatase signaling help M. tuberculosis adapt to the hostile host environment during infections. Consequently, new anti-tuberculosis drugs targeting Rv0577 may act by interfering with multiple mechanisms; a potential signaling machinery as well as toll-like receptor 2 activation and the methylglyoxal detoxification pathway.« less

  9. The Excess Chemical Potential of Water at the Interface with a Protein from End Point Simulations.

    PubMed

    Zhang, Bin W; Cui, Di; Matubayasi, Nobuyuki; Levy, Ronald M

    2018-05-03

    We use end point simulations to estimate the excess chemical potential of water in the homogeneous liquid and at the interface with a protein in solution. When the pure liquid is taken as the reference, the excess chemical potential of interfacial water is the difference between the solvation free energy of a water molecule at the interface and in the bulk. Using the homogeneous liquid as an example, we show that the solvation free energy for growing a water molecule can be estimated by applying UWHAM to the simulation data generated from the initial and final states (i.e., "the end points") instead of multistate free energy perturbation simulations because of the possible overlaps of the configurations sampled at the end points. Then end point simulations are used to estimate the solvation free energy of water at the interface with a protein in solution. The estimate of the solvation free energy at the interface from two simulations at the end points agrees with the benchmark using 32 states within a 95% confidence interval for most interfacial locations. The ability to accurately estimate the excess chemical potential of water from end point simulations facilitates the statistical thermodynamic analysis of diverse interfacial phenomena. Our focus is on analyzing the excess chemical potential of water at protein receptor binding sites with the goal of using this information to assist in the design of tight binding ligands.

  10. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  11. Determinants for Tight and Selective Binding of a Medicinal Dicarbene Gold(I) Complex to a Telomeric DNA G-Quadruplex: a Joint ESI MS and XRD Investigation.

    PubMed

    Bazzicalupi, Carla; Ferraroni, Marta; Papi, Francesco; Massai, Lara; Bertrand, Benoît; Messori, Luigi; Gratteri, Paola; Casini, Angela

    2016-03-18

    The dicarbene gold(I) complex [Au(9-methylcaffein-8-ylidene)2 ]BF4 is an exceptional organometallic compound of profound interest as a prospective anticancer agent. This gold(I) complex was previously reported to be highly cytotoxic toward various cancer cell lines in vitro and behaves as a selective G-quadruplex stabilizer. Interactions of the gold complex with various telomeric DNA models have been analyzed by a combined ESI MS and X-ray diffraction (XRD) approach. ESI MS measurements confirmed formation of stable adducts between the intact gold(I) complex and Tel 23 DNA sequence. The crystal structure of the adduct formed between [Au(9-methylcaffein-8-ylidene)2 ](+) and Tel 23 DNA G-quadruplex was solved. Tel 23 maintains a characteristic propeller conformation while binding three gold(I) dicarbene moieties at two distinct sites. Stacking interactions appear to drive noncovalent binding of the gold(I) complex. The structural basis for tight gold(I) complex/G-quadruplex recognition and its selectivity are described. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Tight-Binding Inhibition of Human Monoamine Oxidase B by Chromone Analogs: A Kinetic, Crystallographic, and Biological Analysis.

    PubMed

    Reis, Joana; Manzella, Nicola; Cagide, Fernando; Mialet-Perez, Jeanne; Uriarte, Eugenio; Parini, Angelo; Borges, Fernanda; Binda, Claudia

    2018-05-10

    Monoamine oxidase B (MAO-B) is a validated drug target for Parkinson's disease. Chromone derivatives were identified as novel potent and reversible MAO-B inhibitors, and herewith we report on a crystallographic and biochemical analysis to investigate their inhibition mechanism. The crystal structures of human MAO-B in complex with three chromone analogs bearing different substituents on the exocyclic aromatic ring (determined at 1.6-1.8 Å resolution) showed that they all bind in the active site cavity of the protein with the chromone moiety located in front of the FAD cofactor. These inhibitors form two hydrogen bonds with Tyr435 and Cys172 and perfectly fit the hydrophobic flat active site of human MAO-B. This is reflected in their tight-binding mechanism of inhibition with K i values of 55, 17, and 31 nM for N-(3',4'-dimethylphenyl)-4-oxo-4 H-chromene-3-carboxamide (1), N-(3'-chlorophenyl)-4-oxo-4 H-chromene-3-carboxamide (2), and N-(3'-fluorophenyl)-4-oxo-4 H-chromene-3-carboxamide (3), respectively. These compounds were also 1000-fold more effective than l-deprenyl in reducing the cellular levels of reactive oxygen species (ROS).

  13. The K-turn motif in riboswitches and other RNA species☆

    PubMed Central

    Lilley, David M.J.

    2014-01-01

    The kink turn is a widespread structure motif that introduces a tight bend into the axis of duplex RNA. This generally functions to mediate tertiary interactions, and to serve as a specific protein binding site. K-turns or closely related structures are found in at least seven different riboswitch structures, where they function as key architectural elements that help generate the ligand binding pocket. This article is part of a Special Issue entitled: Riboswitches. PMID:24798078

  14. Simulation studies of carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    John, David Llewellyn

    Simulation studies of carbon nanotube field-effect transistors (CNFETs) are presented using models of increasing rigour and versatility that have been systematically developed. Firstly, it is demonstrated how one may compute the standard tight-binding band structure. From this foundation, a self-consistent solution for computing the equilibrium energy band diagram of devices with Schottky-barrier source and drain contacts is developed. While this does provide insight into the likely behaviour of CNFETs, a non-equilibrium model is required in order to predict the current-voltage relation. To this end, the effective-mass approximation is utilized, where a parabolic fit to the band structure is used in order to develop a Schrodinger-Poisson solver. This model is employed to predict both DC behaviour and switching times for CNFETs, and was one of the first models that captured quantum effects, such as tunneling and resonance, in these devices. In addition, this model has been used in order to validate compact models that incorporated tunneling via the WKB approximation. A modified WKB derivation is provided in order to account for the non-zero reflection of carriers above a potential energy step. In order to allow for greater flexibility in the CNFET geometries, and to lift the effective-mass approximation, a non-equilibrium Green's function method is finally developed, which uses an atomistic tight-binding Hamiltonian to model doped-contact, as opposed to Schottky-barrier-contact, devices. This approach benefits by being able to account for both inter- and intra-band tunneling, and by utilizing a quadratic matrix equation in order to improve the computation time for the required self-energy matrices. Within this technique, an expression for the local inter-atomic current is derived in order to provide more detailed information than the usual compact expression for the terminal current. With this final model, an investigation is presented into the effects of geometrical variations, contact thicknesses, and azimuthal variation in the surface potential of the nanotube.

  15. Nickel binding and [NiFe]-hydrogenase maturation by the metallochaperone SlyD with a single metal-binding site in Escherichia coli.

    PubMed

    Kaluarachchi, Harini; Altenstein, Matthias; Sugumar, Sonia R; Balbach, Jochen; Zamble, Deborah B; Haupt, Caroline

    2012-03-16

    SlyD (sensitive to lysis D) is a nickel metallochaperone involved in the maturation of [NiFe]-hydrogenases in Escherichia coli (E. coli) and specifically contributes to the nickel delivery step during enzyme biosynthesis. This protein contains a C-terminal metal-binding domain that is rich in potential metal-binding residues that enable SlyD to bind multiple nickel ions with high affinity. The SlyD homolog from Thermus thermophilus does not contain the extended cysteine- and histidine-rich C-terminal tail of the E. coli protein, yet it binds a single Ni(II) ion tightly. To investigate whether a single metal-binding motif can functionally replace the full-length domain, we generated a truncation of E. coli SlyD, SlyD155. Ni(II) binding to SlyD155 was investigated by using isothermal titration calorimetry, NMR and electrospray ionization mass spectrometry measurements. This in vitro characterization revealed that SlyD155 contains a single metal-binding motif with high affinity for nickel. Structural characterization by X-ray absorption spectroscopy and NMR indicated that nickel was coordinated in an octahedral geometry with at least two histidines as ligands. Heterodimerization between SlyD and another hydrogenase accessory protein, HypB, is essential for optimal hydrogenase maturation and was confirmed for SlyD155 via cross-linking experiments and NMR titrations, as were conserved chaperone and peptidyl-prolyl isomerase activities. Although these properties of SlyD are preserved in the truncated version, it does not modulate nickel binding to HypB in vitro or contribute to the maturation of [NiFe]-hydrogenases in vivo, unlike the full-length protein. This study highlights the importance of the unusual metal-binding domain of E. coli SlyD in hydrogenase biogenesis. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Mechanism of calmodulin recognition of the binding domain of isoform 1b of the plasma membrane Ca2+-ATPase: kinetic pathway and effects of methionine oxidation

    PubMed Central

    Slaughter, Brian D.; Bieber Urbauer, Ramona J.; Urbauer, Jeffrey L.; Johnson, Carey K.

    2008-01-01

    Calmodulin (CaM) binds to a domain near the C-terminus of the plasma-membrane Ca2+-ATPase (PMCA), causing the release of this domain and relief of its autoinhibitory function. We investigated the kinetics of dissociation and binding of Ca2+-CaM with a 28-residue peptide (C28W(1b)) corresponding to the CaM binding domain of isoform 1b of PMCA. CaM was labeled with a fluorescent probe on either the N-terminal domain at residue 34 or on the C-terminal domain at residue 110. Formation of complexes of CaM with C28W(1b) results in a decrease in the fluorescence yield of the fluorophore, allowing the kinetics of dissociation or binding to be detected. Using a maximum entropy method, we determined the minimum number and magnitudes of rate constants required to fit the data. Comparison of the fluorescence changes for CaM labeled on the C-terminal or N-terminal domain suggests sequential and ordered binding of the C-terminal and N-terminal domains of CaM with C28W(1b). For dissociation of C28W(1b) from CaM labeled on the N-terminal domain, we observed three time constants, indicating the presence of two intermediate states in the dissociation pathway. However, for CaM labeled on the C-terminal domain, we observed only two time constants, suggesting that the fluorescence label on the C-terminal domain was not sensitive to one of the kinetic steps. The results were modeled by a kinetic mechanism where an initial complex forms upon binding of the C-terminal domain of CaM to C28W(1b), followed by binding of the N-terminal domain, and then formation of a tight binding complex. Oxidation of methionine residues in CaM resulted in significant perturbations to the binding kinetics. The rate of formation of a tight binding complex was reduced, consistent with the lower effectiveness of oxidized CaM in activating the Ca2+ pump. PMID:17343368

  17. Comparison of Calculation and Experiment Implicates Significant Electrostatic Contributions to the Binding Stability of Barnase and Barstar

    PubMed Central

    Dong, Feng; Vijayakumar, M.; Zhou, Huan-Xiang

    2003-01-01

    The contributions of electrostatic interactions to the binding stability of barnase and barstar were studied by the Poisson-Boltzmann model with three different protocols: a), the dielectric boundary specified as the van der Waals (vdW) surface of the protein along with a protein dielectric constant (ɛp) of 4; b), the dielectric boundary specified as the molecular (i.e., solvent-exclusion (SE)) surface along with ɛp = 4; and c), “SE + ɛp = 20.” The “vdW + ɛp = 4” and “SE + ɛp = 20” protocols predicted an overall electrostatic stabilization whereas the “SE + ɛp = 4” protocol predicted an overall electrostatic destabilization. The “vdW + ɛp = 4” protocol was most consistent with experiment. It quantitatively reproduced the observed effects of 17 mutations neutralizing charged residues lining the binding interface and the measured coupling energies of six charge pairs across the interface and reasonably rationalized the experimental ionic strength and pH dependences of the binding constant. In contrast, the “SE + ɛp = 4” protocol predicted significantly larger coupling energies of charge pairs whereas the “SE + ɛp = 20” protocol did not predict any pH dependence. This study calls for further scrutiny of the different Poisson-Boltzmann protocols and demonstrates potential danger in drawing conclusions on electrostatic contributions based on a particular calculation protocol. PMID:12829463

  18. A binary plasmid system for shuffling combinatorial antibody libraries.

    PubMed

    Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

    1992-11-01

    We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis.

  19. A binary plasmid system for shuffling combinatorial antibody libraries.

    PubMed Central

    Collet, T A; Roben, P; O'Kennedy, R; Barbas, C F; Burton, D R; Lerner, R A

    1992-01-01

    We have used a binary system of replicon-compatible plasmids to test the potential for promiscuous recombination of heavy and light chains within sets of human Fab fragments isolated from combinatorial antibody libraries. Antibody molecules showed a surprising amount of promiscuity in that a particular heavy chain could recombine with multiple light chains with retention of binding to a protein antigen. The degree to which a given heavy chain productively paired with any light chain to bind antigen varied from 43% to 100% and depended strongly on the heavy-chain sequence. Such productive crosses resulted in a set of Fab fragments of similar apparent binding constants, which seemed to differ mainly in the amount of active Fab fragment produced in the bacterial cell. The dominance of the heavy chain in the antibody-antigen interaction was further explored in a set of directed crosses, in which heavy and light chains derived from antigen-specific clones were crossed with nonrelated heavy and light chains. In these crosses, an Fab fragment retained antigen binding only if it contained a heavy chain from an antigen-specific clone. In no case did the light chain confer detectable affinity when paired with indifferent heavy chains. The surprising promiscuity of heavy chains has ramifications for the evaluation of the diversity of combinatorial libraries made against protein antigens and should allow the combination of one such promiscuous heavy chain with an engineered light chain to form an Fab fragment carrying synthetic cofactors to assist in antibody catalysis. Images PMID:1438192

  20. Dynamics simulations for engineering macromolecular interactions

    PubMed Central

    Robinson-Mosher, Avi; Shinar, Tamar; Silver, Pamela A.; Way, Jeffrey

    2013-01-01

    The predictable engineering of well-behaved transcriptional circuits is a central goal of synthetic biology. The artificial attachment of promoters to transcription factor genes usually results in noisy or chaotic behaviors, and such systems are unlikely to be useful in practical applications. Natural transcriptional regulation relies extensively on protein-protein interactions to insure tightly controlled behavior, but such tight control has been elusive in engineered systems. To help engineer protein-protein interactions, we have developed a molecular dynamics simulation framework that simplifies features of proteins moving by constrained Brownian motion, with the goal of performing long simulations. The behavior of a simulated protein system is determined by summation of forces that include a Brownian force, a drag force, excluded volume constraints, relative position constraints, and binding constraints that relate to experimentally determined on-rates and off-rates for chosen protein elements in a system. Proteins are abstracted as spheres. Binding surfaces are defined radially within a protein. Peptide linkers are abstracted as small protein-like spheres with rigid connections. To address whether our framework could generate useful predictions, we simulated the behavior of an engineered fusion protein consisting of two 20 000 Da proteins attached by flexible glycine/serine-type linkers. The two protein elements remained closely associated, as if constrained by a random walk in three dimensions of the peptide linker, as opposed to showing a distribution of distances expected if movement were dominated by Brownian motion of the protein domains only. We also simulated the behavior of fluorescent proteins tethered by a linker of varying length, compared the predicted Förster resonance energy transfer with previous experimental observations, and obtained a good correspondence. Finally, we simulated the binding behavior of a fusion of two ligands that could simultaneously bind to distinct cell-surface receptors, and explored the landscape of linker lengths and stiffnesses that could enhance receptor binding of one ligand when the other ligand has already bound to its receptor, thus, addressing potential mechanisms for improving targeted signal transduction proteins. These specific results have implications for the design of targeted fusion proteins and artificial transcription factors involving fusion of natural domains. More broadly, the simulation framework described here could be extended to include more detailed system features such as non-spherical protein shapes and electrostatics, without requiring detailed, computationally expensive specifications. This framework should be useful in predicting behavior of engineered protein systems including binding and dissociation reactions. PMID:23822508

  1. Synergistic effects of ATP and RNA binding to human DEAD-box protein DDX1.

    PubMed

    Kellner, Julian N; Reinstein, Jochen; Meinhart, Anton

    2015-03-11

    RNA helicases of the DEAD-box protein family form the largest group of helicases. The human DEAD-box protein 1 (DDX1) plays an important role in tRNA and mRNA processing, is involved in tumor progression and is also hijacked by several virus families such as HIV-1 for replication and nuclear export. Although important in many cellular processes, the mechanism of DDX1's enzymatic function is unknown. We have performed equilibrium titrations and transient kinetics to determine affinities for nucleotides and RNA. We find an exceptional tight binding of DDX1 to adenosine diphosphate (ADP), one of the strongest affinities observed for DEAD-box helicases. ADP binds tighter by three orders of magnitude when compared to adenosine triphosphate (ATP), arresting the enzyme in a potential dead-end ADP conformation under physiological conditions. We thus suggest that a nucleotide exchange factor leads to DDX1 recycling. Furthermore, we find a strong cooperativity in binding of RNA and ATP to DDX1 that is also reflected in ATP hydrolysis. We present a model in which either ATP or RNA binding alone can partially shift the equilibrium from an 'open' to a 'closed'-state; this shift appears to be not further pronounced substantially even in the presence of both RNA and ATP as the low rate of ATP hydrolysis does not change. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Drug search for leishmaniasis: a virtual screening approach by grid computing

    NASA Astrophysics Data System (ADS)

    Ochoa, Rodrigo; Watowich, Stanley J.; Flórez, Andrés; Mesa, Carol V.; Robledo, Sara M.; Muskus, Carlos

    2016-07-01

    The trypanosomatid protozoa Leishmania is endemic in 100 countries, with infections causing 2 million new cases of leishmaniasis annually. Disease symptoms can include severe skin and mucosal ulcers, fever, anemia, splenomegaly, and death. Unfortunately, therapeutics approved to treat leishmaniasis are associated with potentially severe side effects, including death. Furthermore, drug-resistant Leishmania parasites have developed in most endemic countries. To address an urgent need for new, safe and inexpensive anti-leishmanial drugs, we utilized the IBM World Community Grid to complete computer-based drug discovery screens (Drug Search for Leishmaniasis) using unique leishmanial proteins and a database of 600,000 drug-like small molecules. Protein structures from different Leishmania species were selected for molecular dynamics (MD) simulations, and a series of conformational "snapshots" were chosen from each MD trajectory to simulate the protein's flexibility. A Relaxed Complex Scheme methodology was used to screen 2000 MD conformations against the small molecule database, producing >1 billion protein-ligand structures. For each protein target, a binding spectrum was calculated to identify compounds predicted to bind with highest average affinity to all protein conformations. Significantly, four different Leishmania protein targets were predicted to strongly bind small molecules, with the strongest binding interactions predicted to occur for dihydroorotate dehydrogenase (LmDHODH; PDB:3MJY). A number of predicted tight-binding LmDHODH inhibitors were tested in vitro and potent selective inhibitors of Leishmania panamensis were identified. These promising small molecules are suitable for further development using iterative structure-based optimization and in vitro/in vivo validation assays.

  3. Drug search for leishmaniasis: a virtual screening approach by grid computing.

    PubMed

    Ochoa, Rodrigo; Watowich, Stanley J; Flórez, Andrés; Mesa, Carol V; Robledo, Sara M; Muskus, Carlos

    2016-07-01

    The trypanosomatid protozoa Leishmania is endemic in ~100 countries, with infections causing ~2 million new cases of leishmaniasis annually. Disease symptoms can include severe skin and mucosal ulcers, fever, anemia, splenomegaly, and death. Unfortunately, therapeutics approved to treat leishmaniasis are associated with potentially severe side effects, including death. Furthermore, drug-resistant Leishmania parasites have developed in most endemic countries. To address an urgent need for new, safe and inexpensive anti-leishmanial drugs, we utilized the IBM World Community Grid to complete computer-based drug discovery screens (Drug Search for Leishmaniasis) using unique leishmanial proteins and a database of 600,000 drug-like small molecules. Protein structures from different Leishmania species were selected for molecular dynamics (MD) simulations, and a series of conformational "snapshots" were chosen from each MD trajectory to simulate the protein's flexibility. A Relaxed Complex Scheme methodology was used to screen ~2000 MD conformations against the small molecule database, producing >1 billion protein-ligand structures. For each protein target, a binding spectrum was calculated to identify compounds predicted to bind with highest average affinity to all protein conformations. Significantly, four different Leishmania protein targets were predicted to strongly bind small molecules, with the strongest binding interactions predicted to occur for dihydroorotate dehydrogenase (LmDHODH; PDB:3MJY). A number of predicted tight-binding LmDHODH inhibitors were tested in vitro and potent selective inhibitors of Leishmania panamensis were identified. These promising small molecules are suitable for further development using iterative structure-based optimization and in vitro/in vivo validation assays.

  4. Structural and Biochemical Basis for Ubiquitin Ligase Recruitment by Arrestin-related Domain-containing Protein-3 (ARRDC3)*

    PubMed Central

    Qi, Shiqian; O'Hayre, Morgan; Gutkind, J. Silvio; Hurley, James H.

    2014-01-01

    After protracted stimulation, the β2-adrenergic receptor and many other G-protein-coupled receptors are ubiquitinated and down-regulated. Arrestin-related domain-containing protein-3 (ARRDC3) has been proposed to recruit the ubiquitin ligase Nedd4 to the β2-adrenergic receptor. ARRDC3 contains two PPXY motifs that could potentially interact with any of the four WW domains of Nedd4. Here we dissect the interaction determinants. ARRDC3 PPXY-Nedd4 WW dissociation constants vary from unmeasurable to Kd = 3 μm for the third WW domain of Nedd4 binding to the first PPXY motif of ARRDC3. Structures of the uncomplexed and PPXY1-bound WW3 domain were determined at 1.1 and 1.7 Å resolution. The structures revealed conformational changes upon binding and the hydrogen bonding network in exquisite detail. Tight packing of ARRDC3 Val-352′, part of a 310 helix at the C terminus of PPXY1, is important for high affinity binding to WW3. Although no single WW domain is strictly essential for the binding of Nedd4 and ARRDC3 expressed in HEK293 cells, high affinity binding of full-length ARRDC3 and Nedd4 is driven by the avid interaction of both PPXY motifs with either the WW2-WW3 or WW3-WW4 combinations, with Kd values as low as 300 nm. PMID:24379409

  5. Structural and biochemical basis for ubiquitin ligase recruitment by arrestin-related domain-containing protein-3 (ARRDC3).

    PubMed

    Qi, Shiqian; O'Hayre, Morgan; Gutkind, J Silvio; Hurley, James H

    2014-02-21

    After protracted stimulation, the β2-adrenergic receptor and many other G-protein-coupled receptors are ubiquitinated and down-regulated. Arrestin-related domain-containing protein-3 (ARRDC3) has been proposed to recruit the ubiquitin ligase Nedd4 to the β2-adrenergic receptor. ARRDC3 contains two PPXY motifs that could potentially interact with any of the four WW domains of Nedd4. Here we dissect the interaction determinants. ARRDC3 PPXY-Nedd4 WW dissociation constants vary from unmeasurable to Kd = 3 μM for the third WW domain of Nedd4 binding to the first PPXY motif of ARRDC3. Structures of the uncomplexed and PPXY1-bound WW3 domain were determined at 1.1 and 1.7 Å resolution. The structures revealed conformational changes upon binding and the hydrogen bonding network in exquisite detail. Tight packing of ARRDC3 Val-352', part of a 310 helix at the C terminus of PPXY1, is important for high affinity binding to WW3. Although no single WW domain is strictly essential for the binding of Nedd4 and ARRDC3 expressed in HEK293 cells, high affinity binding of full-length ARRDC3 and Nedd4 is driven by the avid interaction of both PPXY motifs with either the WW2-WW3 or WW3-WW4 combinations, with Kd values as low as 300 nM.

  6. Photoinduced Bandgap Renormalization and Exciton Binding Energy Reduction in WS2.

    PubMed

    Cunningham, Paul D; Hanbicki, Aubrey T; McCreary, Kathleen M; Jonker, Berend T

    2017-12-26

    Strong Coulomb attraction in monolayer transition metal dichalcogenides gives rise to tightly bound excitons and many-body interactions that dominate their optoelectronic properties. However, this Coulomb interaction can be screened through control of the surrounding dielectric environment as well as through applied voltage, which provides a potential means of tuning the bandgap, exciton binding energy, and emission wavelength. Here, we directly show that the bandgap and exciton binding energy can be optically tuned by means of the intensity of the incident light. Using transient absorption spectroscopy, we identify a sub-picosecond decay component in the excited-state dynamics of WS 2 that emerges for incident photon energies above the A-exciton resonance, which originates from a nonequilibrium population of charge carriers that form excitons as they cool. The generation of this charge-carrier population exhibits two distinct energy thresholds. The higher threshold is coincident with the onset of continuum states and therefore provides a direct optical means of determining both the bandgap and exciton binding energy. Using this technique, we observe a reduction in the exciton binding energy from 310 ± 30 to 220 ± 20 meV as the excitation density is increased from 3 × 10 11 to 1.2 × 10 12 photons/cm 2 . This reduction is due to dynamic dipolar screening of Coulomb interactions by excitons, which is the underlying physical process that initiates bandgap renormalization and leads to the insulator-metal transition in monolayer transition metal dichalcogenides.

  7. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  8. Planetary nebula progenitors that swallow binary systems

    NASA Astrophysics Data System (ADS)

    Soker, Noam

    2016-01-01

    I propose that some irregular messy planetary nebulae (PNe) owe their morphologies to triple-stellar evolution where tight binary systems evolve inside and/or on the outskirts of the envelope of asymptotic giant branch (AGB) stars. In some cases, the tight binary system can survive, in others, it is destroyed. The tight binary system might break up with one star leaving the system. In an alternative evolution, one of the stars of the broken-up tight binary system falls towards the AGB envelope with low specific angular momentum, and drowns in the envelope. In a different type of destruction process, the drag inside the AGB envelope causes the tight binary system to merge. This releases gravitational energy within the AGB envelope, leading to a very asymmetrical envelope ejection, with an irregular and messy PN as a descendant. The evolution of the triple-stellar system can be in a full common envelope evolution or in a grazing envelope evolution. Both before and after destruction (if destruction takes place), the system might launch pairs of opposite jets. One pronounced signature of triple-stellar evolution might be a large departure from axisymmetrical morphology of the descendant PN. I estimate that about one in eight non-spherical PNe is shaped by one of these triple-stellar evolutionary routes.

  9. Loss of G-A base pairs is insufficient for achieving a large opening of U4 snRNA K-turn motif.

    PubMed

    Cojocaru, Vlad; Klement, Reinhard; Jovin, Thomas M

    2005-01-01

    Upon binding to the 15.5K protein, two tandem-sheared G-A base pairs are formed in the internal loop of the kink-turn motif of U4 snRNA (Kt-U4). We have reported that the folding of Kt-U4 is assisted by protein binding. Unstable interactions that contribute to a large opening of the free RNA ('k-e motion') were identified using locally enhanced sampling molecular dynamics simulations, results that agree with experiments. A detailed analysis of the simulations reveals that the k-e motion in Kt-U4 is triggered both by loss of G-A base pairs in the internal loop and backbone flexibility in the stems. Essential dynamics show that the loss of G-A base pairs is correlated along the first mode but anti-correlated along the third mode with the k-e motion. Moreover, when enhanced sampling was confined to the internal loop, the RNA adopted an alternative conformation characterized by a sharper kink, opening of G-A base pairs and modified stacking interactions. Thus, loss of G-A base pairs is insufficient for achieving a large opening of the free RNA. These findings, supported by previously published RNA structure probing experiments, suggest that G-A base pair formation occurs upon protein binding, thereby stabilizing a selective orientation of the stems.

  10. Pairing tendencies in a two-orbital Hubbard model in one dimension

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, Niravkumar D.; Nocera, Adriana; Alvarez, Gonzalo

    The recent discovery of superconductivity under high pressure in the ladder compound BaFe2S3 has opened a new field of research in iron-based superconductors with focus on quasi-one-dimensional geometries. In this publication, using the density matrix renormalization group technique, we study a two-orbital Hubbard model defined in one-dimensional chains. Our main result is the presence of hole binding tendencies at intermediate Hubbard U repulsion and robust Hund coupling JH / U = 0.25. Binding does not occur either in weak coupling or at very strong coupling. The pair-pair correlations that are dominant near half-filling, or of similar strength as the chargemore » and spin correlation channels, involve hole-pair operators that are spin singlets, use nearest-neighbor sites, and employ different orbitals for each hole. As a result, the Hund coupling strength, presence of robust magnetic moments, and antiferromagnetic correlations among them are important for the binding tendencies found here.« less

  11. Alignment of RNA molecules: Binding energy and statistical properties of random sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valba, O. V., E-mail: valbaolga@gmail.com; Nechaev, S. K., E-mail: sergei.nechaev@gmail.com; Tamm, M. V., E-mail: thumm.m@gmail.com

    2012-02-15

    A new statistical approach to the problem of pairwise alignment of RNA sequences is proposed. The problem is analyzed for a pair of interacting polymers forming an RNA-like hierarchical cloverleaf structures. An alignment is characterized by the numbers of matches, mismatches, and gaps. A weight function is assigned to each alignment; this function is interpreted as a free energy taking into account both direct monomer-monomer interactions and a combinatorial contribution due to formation of various cloverleaf secondary structures. The binding free energy is determined for a pair of RNA molecules. Statistical properties are discussed, including fluctuations of the binding energymore » between a pair of RNA molecules and loop length distribution in a complex. Based on an analysis of the free energy per nucleotide pair complexes of random RNAs as a function of the number of nucleotide types c, a hypothesis is put forward about the exclusivity of the alphabet c = 4 used by nature.« less

  12. Conductance of AFM Deformed Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Svizhenko, Alexei; Maiti, Amitesh; Anatram, M. P.; Biegel, Bryan (Technical Monitor)

    2002-01-01

    This viewgraph presentation provides information on the electrical conductivity of carbon nanotubes upon deformation by atomic force microscopy (AFM). The density of states and conductance were computed using four orbital tight-binding method with various parameterizations. Different chiralities develop bandgap that varies with chirality.

  13. Chromosome painting reveals asynaptic full alignment of homologs and HIM-8-dependent remodeling of X chromosome territories during Caenorhabditis elegans meiosis.

    PubMed

    Nabeshima, Kentaro; Mlynarczyk-Evans, Susanna; Villeneuve, Anne M

    2011-08-01

    During early meiotic prophase, a nucleus-wide reorganization leads to sorting of chromosomes into homologous pairs and to establishing associations between homologous chromosomes along their entire lengths. Here, we investigate global features of chromosome organization during this process, using a chromosome painting method in whole-mount Caenorhabditis elegans gonads that enables visualization of whole chromosomes along their entire lengths in the context of preserved 3D nuclear architecture. First, we show that neither spatial proximity of premeiotic chromosome territories nor chromosome-specific timing is a major factor driving homolog pairing. Second, we show that synaptonemal complex-independent associations can support full lengthwise juxtaposition of homologous chromosomes. Third, we reveal a prominent elongation of chromosome territories during meiotic prophase that initiates prior to homolog association and alignment. Mutant analysis indicates that chromosome movement mediated by association of chromosome pairing centers (PCs) with mobile patches of the nuclear envelope (NE)-spanning SUN-1/ZYG-12 protein complexes is not the primary driver of territory elongation. Moreover, we identify new roles for the X chromosome PC (X-PC) and X-PC binding protein HIM-8 in promoting elongation of X chromosome territories, separable from their role(s) in mediating local stabilization of pairing and association of X chromosomes with mobile SUN-1/ZYG-12 patches. Further, we present evidence that HIM-8 functions both at and outside of PCs to mediate chromosome territory elongation. These and other data support a model in which synapsis-independent elongation of chromosome territories, driven by PC binding proteins, enables lengthwise juxtaposition of chromosomes, thereby facilitating assessment of their suitability as potential pairing partners.

  14. Chromosome Painting Reveals Asynaptic Full Alignment of Homologs and HIM-8–Dependent Remodeling of X Chromosome Territories during Caenorhabditis elegans Meiosis

    PubMed Central

    Nabeshima, Kentaro; Mlynarczyk-Evans, Susanna; Villeneuve, Anne M.

    2011-01-01

    During early meiotic prophase, a nucleus-wide reorganization leads to sorting of chromosomes into homologous pairs and to establishing associations between homologous chromosomes along their entire lengths. Here, we investigate global features of chromosome organization during this process, using a chromosome painting method in whole-mount Caenorhabditis elegans gonads that enables visualization of whole chromosomes along their entire lengths in the context of preserved 3D nuclear architecture. First, we show that neither spatial proximity of premeiotic chromosome territories nor chromosome-specific timing is a major factor driving homolog pairing. Second, we show that synaptonemal complex-independent associations can support full lengthwise juxtaposition of homologous chromosomes. Third, we reveal a prominent elongation of chromosome territories during meiotic prophase that initiates prior to homolog association and alignment. Mutant analysis indicates that chromosome movement mediated by association of chromosome pairing centers (PCs) with mobile patches of the nuclear envelope (NE)–spanning SUN-1/ZYG-12 protein complexes is not the primary driver of territory elongation. Moreover, we identify new roles for the X chromosome PC (X-PC) and X-PC binding protein HIM-8 in promoting elongation of X chromosome territories, separable from their role(s) in mediating local stabilization of pairing and association of X chromosomes with mobile SUN-1/ZYG-12 patches. Further, we present evidence that HIM-8 functions both at and outside of PCs to mediate chromosome territory elongation. These and other data support a model in which synapsis-independent elongation of chromosome territories, driven by PC binding proteins, enables lengthwise juxtaposition of chromosomes, thereby facilitating assessment of their suitability as potential pairing partners. PMID:21876678

  15. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  16. Membrane Association of the PTEN Tumor Suppressor: Electrostatic Interaction with Phos-phatidylserine-Containing Bilayers and Regulatory Role of the C-Terminal Tail

    PubMed Central

    Shenoy, Siddharth S.; Nanda, Hirsh; Lösche, Mathias

    2012-01-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN’s C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN’s C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN’s unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN’s membrane binding and activity. PMID:23073177

  17. Membrane association of the PTEN tumor suppressor: electrostatic interaction with phosphatidylserine-containing bilayers and regulatory role of the C-terminal tail.

    PubMed

    Shenoy, Siddharth S; Nanda, Hirsh; Lösche, Mathias

    2012-12-01

    The phosphatidylinositolphosphate phosphatase PTEN is the second most frequently mutated protein in human tumors. Its membrane association, allosteric activation and membrane dissociation are poorly understood. We recently reported PTEN binding affinities to membranes of different compositions (Shenoy et al., 2012, PLoS ONE 7, e32591) and a preliminary investigation of the protein-membrane complex with neutron reflectometry (NR). Here we use NR to validate molecular dynamics (MD) simulations of the protein and study conformational differences of the protein in solution and on anionic membranes. NR shows that full-length PTEN binds to such membranes roughly in the conformation and orientation suggested by the crystal structure of a truncated PTEN protein, in contrast with a recently presented model which suggested that membrane binding depends critically on the SUMOylation of the CBR3 loop of PTEN's C2 domain. Our MD simulations confirm that PTEN is peripherally bound to the bilayer surface and show slight differences of the protein structure in solution and in the membrane-bound state, where the protein body flattens against the bilayer surface. PTEN's C2 domain binds phosphatidylserine (PS) tightly through its CBR3 loop, and its phosphatase domain also forms electrostatic interactions with PS. NR and MD results show consistently that PTEN's unstructured, anionic C-terminal tail is repelled from the bilayer surface. In contrast, this tail is tightly tugged against the C2 domain in solution, partially obstructing the membrane-binding interface of the protein. Arresting the C-terminal tail in this conformation by phosphorylation may provide a control mechanism for PTEN's membrane binding and activity. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. Changes in the zero-point energy of the protons as the source of the binding energy of water to A-phase DNA.

    PubMed

    Reiter, G F; Senesi, R; Mayers, J

    2010-10-01

    The measured changes in the zero-point kinetic energy of the protons are entirely responsible for the binding energy of water molecules to A phase DNA at the concentration of 6  water molecules/base pair. The changes in kinetic energy can be expected to be a significant contribution to the energy balance in intracellular biological processes and the properties of nano-confined water. The shape of the momentum distribution in the dehydrated A phase is consistent with coherent delocalization of some of the protons in a double well potential, with a separation of the wells of 0.2 Å.

  19. Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

    PubMed Central

    Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

    2018-01-01

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

  20. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE PAGES

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; ...

    2016-09-09

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  1. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing

    In this paper, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesizedmore » by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated p-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. Finally, these four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.« less

  2. Tight-binding study of Si2Cn (n = 3 to 42) fullerene-like or nanodiamonds microclusters: are Si atoms isolated or adjacent?

    NASA Astrophysics Data System (ADS)

    Leleyter, M.; Olivi-Tran, N.

    2008-12-01

    We studied in tight-binding approximation involving spν hybridization (ν=2,3), some Si2Cn (n=3 to 42) microclusters. We then investigated, on one hand, fragments of fullerene-like structures (sp2), and on the other hand, nanodiamonds (sp3) of adamantane-type or a 44-atom nanodiamond (with 2 inner atoms which are assumed to play the role of bulk atoms). We compared the stabilities, i.e. the electronic energies of these clusters, according to the various positions of the 2 Si atoms. Results are very different in the two kinds of hybridization. Besides, they can be analysed according to two different points of view: either the clusters are considered as small particles with limited sizes, or they are assumed to be used as models in order to simulate the Si-atom behaviour in very larger systems. In sp2 hybridization (fullerene-like geometries), the most stable isomer is always encountered when the 2 Si atoms build a Si2 group, and this result holds for both viewpoints quoted above. Conversely, in sp3 hybridization (nanodiamonds), since Si atoms “prefer” sites having the minimum connectivity, they are never found in adjacent sites. We see that with a simple and fast computational method we can explain an experimental fact which is very interesting such as the relative position of two heteroatoms in the cluster. This enhances the generality and the fecondity in the tight binding approximation due essentially to the link between this model and the graph theory, link based on the topology of the clusters.

  3. Electronic Coupling Calculations for Bridge-Mediated Charge Transfer Using Constrained Density Functional Theory (CDFT) and Effective Hamiltonian Approaches at the Density Functional Theory (DFT) and Fragment-Orbital Density Functional Tight Binding (FODFTB) Level.

    PubMed

    Gillet, Natacha; Berstis, Laura; Wu, Xiaojing; Gajdos, Fruzsina; Heck, Alexander; de la Lande, Aurélien; Blumberger, Jochen; Elstner, Marcus

    2016-10-11

    In this article, four methods to calculate charge transfer integrals in the context of bridge-mediated electron transfer are tested. These methods are based on density functional theory (DFT). We consider two perturbative Green's function effective Hamiltonian methods (first, at the DFT level of theory, using localized molecular orbitals; second, applying a tight-binding DFT approach, using fragment orbitals) and two constrained DFT implementations with either plane-wave or local basis sets. To assess the performance of the methods for through-bond (TB)-dominated or through-space (TS)-dominated transfer, different sets of molecules are considered. For through-bond electron transfer (ET), several molecules that were originally synthesized by Paddon-Row and co-workers for the deduction of electronic coupling values from photoemission and electron transmission spectroscopies, are analyzed. The tested methodologies prove to be successful in reproducing experimental data, the exponential distance decay constant and the superbridge effects arising from interference among ET pathways. For through-space ET, dedicated π-stacked systems with heterocyclopentadiene molecules were created and analyzed on the basis of electronic coupling dependence on donor-acceptor distance, structure of the bridge, and ET barrier height. The inexpensive fragment-orbital density functional tight binding (FODFTB) method gives similar results to constrained density functional theory (CDFT) and both reproduce the expected exponential decay of the coupling with donor-acceptor distances and the number of bridging units. These four approaches appear to give reliable results for both TB and TS ET and present a good alternative to expensive ab initio methodologies for large systems involving long-range charge transfers.

  4. A Wsbnd Ne interatomic potential for simulation of neon implantation in tungsten

    NASA Astrophysics Data System (ADS)

    Backman, Marie; Juslin, Niklas; Huang, Guiyang; Wirth, Brian D.

    2016-08-01

    An interatomic pair potential for Wsbnd Ne is developed for atomistic molecular dynamics simulations of neon implantation in tungsten. The new potential predicts point defect energies and binding energies of small clusters that are in good agreement with electronic structure calculations. Molecular dynamics simulations of small neon clusters in tungsten show that trap mutation, in which an interstitial neon cluster displaces a tungsten atom from its lattice site, occurs for clusters of three or more neon atoms. However, near a free surface, trap mutation can occur at smaller sizes, including even a single neon interstitial in close proximity to a (100) or (110) surface.

  5. Affimer proteins for F-actin: novel affinity reagents that label F-actin in live and fixed cells.

    PubMed

    Lopata, Anna; Hughes, Ruth; Tiede, Christian; Heissler, Sarah M; Sellers, James R; Knight, Peter J; Tomlinson, Darren; Peckham, Michelle

    2018-04-26

    Imaging the actin cytoskeleton in cells uses a wide range of approaches. Typically, a fluorescent derivative of the small cyclic peptide phalloidin is used to image F-actin in fixed cells. Lifeact and F-tractin are popular for imaging the cytoskeleton in live cells. Here we characterised novel affinity reagents called Affimers that specifically bind to F-actin in vitro to determine if they are suitable alternatives as eGFP-fusion proteins, to label actin in live cells, or for labeling F-actin in fixed cells. In vitro experiments showed that 3 out of the 4 Affimers (Affimers 6, 14 and 24) tested bind tightly to purified F-actin, and appear to have overlapping binding sites. As eGFP-fusion proteins, the same 3 Affimers label F-actin in live cells. FRAP experiments suggest that eGFP-Affimer 6 behaves most similarly to F-tractin and Lifeact. However, it does not colocalise with mCherry-actin in dynamic ruffles, and may preferentially bind stable actin filaments. All 4 Affimers label F-actin in methanol fixed cells, while only Affimer 14 labels F-actin after paraformaldehyde fixation. eGFP-Affimer 6 has potential for use in selectively imaging the stable actin cytoskeleton in live cells, while all 4 Affimers are strong alternatives to phalloidin for labelling F-actin in fixed cells.

  6. Structural basis of recognition of farnesylated and methylated KRAS4b by PDEδ.

    PubMed

    Dharmaiah, Srisathiyanarayanan; Bindu, Lakshman; Tran, Timothy H; Gillette, William K; Frank, Peter H; Ghirlando, Rodolfo; Nissley, Dwight V; Esposito, Dominic; McCormick, Frank; Stephen, Andrew G; Simanshu, Dhirendra K

    2016-11-01

    Farnesylation and carboxymethylation of KRAS4b (Kirsten rat sarcoma isoform 4b) are essential for its interaction with the plasma membrane where KRAS-mediated signaling events occur. Phosphodiesterase-δ (PDEδ) binds to KRAS4b and plays an important role in targeting it to cellular membranes. We solved structures of human farnesylated-methylated KRAS4b in complex with PDEδ in two different crystal forms. In these structures, the interaction is driven by the C-terminal amino acids together with the farnesylated and methylated C185 of KRAS4b that binds tightly in the central hydrophobic pocket present in PDEδ. In crystal form II, we see the full-length structure of farnesylated-methylated KRAS4b, including the hypervariable region. Crystal form I reveals structural details of farnesylated-methylated KRAS4b binding to PDEδ, and crystal form II suggests the potential binding mode of geranylgeranylated-methylated KRAS4b to PDEδ. We identified a 5-aa-long sequence motif (Lys-Ser-Lys-Thr-Lys) in KRAS4b that may enable PDEδ to bind both forms of prenylated KRAS4b. Structure and sequence analysis of various prenylated proteins that have been previously tested for binding to PDEδ provides a rationale for why some prenylated proteins, such as KRAS4a, RalA, RalB, and Rac1, do not bind to PDEδ. Comparison of all four available structures of PDEδ complexed with various prenylated proteins/peptides shows the presence of additional interactions due to a larger protein-protein interaction interface in KRAS4b-PDEδ complex. This interface might be exploited for designing an inhibitor with minimal off-target effects.

  7. Role of water mediated interactions in protein-protein recognition landscapes.

    PubMed

    Papoian, Garegin A; Ulander, Johan; Wolynes, Peter G

    2003-07-30

    The energy landscape picture of protein folding and binding is employed to optimize a number of pair potentials for direct and water-mediated interactions in protein complex interfaces. We find that water-mediated interactions greatly complement direct interactions in discriminating against various types of trap interactions that model those present in the cell. We highlight the context dependent nature of knowledge-based binding potentials, as contrasted with the situation for autonomous folding. By performing a Principal Component Analysis (PCA) of the corresponding interaction matrixes, we rationalize the strength of the recognition signal for each combination of the contact type and reference trap states using the differential in the idealized "canonical" amino acid compositions of native and trap layers. The comparison of direct and water-mediated contact potential matrixes emphasizes the importance of partial solvation in stabilizing charged groups in the protein interfaces. Specific water-mediated interresidue interactions are expected to influence significantly the kinetics as well as thermodynamics of protein association.

  8. Role of Cysteines in Stabilizing the Randomized Receptor Binding Domains within Feline Leukemia Virus Envelope Proteins.

    PubMed

    Valdivieso-Torres, Leonardo; Sarangi, Anindita; Whidby, Jillian; Marcotrigiano, Joseph; Roth, Monica J

    2015-12-30

    Retargeting of gammaretroviral envelope proteins has shown promising results in the isolation of novel isolates with therapeutic potential. However, the optimal conditions required to obtain high-affinity retargeted envelope proteins with narrow tropism are not understood. This study highlights the advantage of constrained peptides within receptor binding domains and validates the random library screening technique of obtaining novel retargeted Env proteins. Using a modified vector backbone to screen the envelope libraries on 143B osteosarcoma cells, three novel and unique retargeted envelopes were isolated. The use of complex disulfide bonds within variable regions required for receptor binding is found within natural gammaretroviral envelope isolates. Interestingly, two of the isolates, named AII and BV2, have a pair of cysteines located within the randomized region of 11 amino acids similar to that identified within the CP Env, an isolate identified in a previous Env library screen on the human renal carcinoma Caki-1 cell line. The amino acids within the randomized region of AII and BV2 envelopes that are essential for viral infection have been identified in this study and include these cysteine residues. Through mutagenesis studies, the putative disulfide bond pairs including and beyond the randomized region were examined. In parallel, the disulfide bonds of CP Env were identified using mass spectrometry. The results indicate that this pair of cysteines creates the structural context to position key hydrophobic (F and W) and basic (K and H) residues critical for viral titer and suggest that AII, BV2, and CP internal cysteines bond together in distinct ways. Retargeted gammaretroviral particles have broad applications for therapeutic use. Although great advances have been achieved in identifying new Env-host cell receptor pairs, the rules for designing optimal Env libraries are still unclear. We have found that isolates with an additional pair of cysteines within the randomized region have the highest transduction efficiencies. This emphasizes the importance of considering cysteine pairs in the design of new libraries. Furthermore, our data clearly indicate that these cysteines are essential for viral infectivity by presenting essential residues to the host cell receptor. These studies facilitate the screening of Env libraries for functional entry into target cells, allowing the identification of novel gammaretroviral Envs targeting alternative host cell receptors for gene and protein delivery. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Tailoring Dirac Fermions in Molecular Graphene

    NASA Astrophysics Data System (ADS)

    Gomes, Kenjiro K.; Mar, Warren; Ko, Wonhee; Camp, Charlie D.; Rastawicki, Dominik K.; Guinea, Francisco; Manoharan, Hari C.

    2012-02-01

    The dynamics of electrons in solids is tied to the band structure created by a periodic atomic potential. The design of artificial lattices, assembled through atomic manipulation, opens the door to engineer electronic band structure and to create novel quantum states. We present scanning tunneling spectroscopic measurements of a nanoassembled honeycomb lattice displaying a Dirac fermion band structure. The artificial lattice is created by atomic manipulation of single CO molecules with the scanning tunneling microscope on the surface of Cu(111). The periodic potential generated by the assembled CO molecules reshapes the band structure of the two-dimensional electron gas, present as a surface state of Cu(111), into a ``molecular graphene'' system. We create local defects in the lattice to observe the quasiparticle interference patterns that unveil the underlying band structure. We present direct comparison between the tunneling data, first-principles calculations of the band structure, and tight-binding models.

  10. Formation of fivefold axes in the FCC-metal nanoclusters

    NASA Astrophysics Data System (ADS)

    Myasnichenko, Vladimir S.; Starostenkov, Mikhail D.

    2012-11-01

    Formation of atomistic structures of metallic Cu, Au, Ag clusters and bimetallic Cu-Au clusters was studied with the help of molecular dynamics using the many-body tight-binding interatomic potential. The simulation of the crystallization process of clusters with the number of atoms ranging from 300 to 1092 was carried out. The most stable configurations of atoms in the system, corresponding to the minimum of potential energy, was found during super-fast cooling from 1000 K. Atoms corresponding to fcc, hcp, and Ih phases were identified by the method of common neighbor analysis. Incomplete icosahedral core can be discovered at the intersection of one of the Ih axes with the surface of monometallic cluster. The decahedron-shaped structure of bimetallic Cu-Au cluster with seven completed icosahedral cores was obtained. The principles of the construction of small bimetallic clusters with icosahedral symmetry and increased fractal dimensionality were offered.

  11. Sensory Organ Like Response of Zigzag Edge Graphene Nanoribbons

    NASA Astrophysics Data System (ADS)

    Shenoy, Vijay; Bhowmick, Somnath

    2011-03-01

    Using a continuum Dirac theory, we study the density and spin response of zigzag edge terminated graphene ribbons subjected to edge potentials and Zeeman fields. Our analytical calculations of the density and spin responses of the closed system (fixed particle number) to the static edge fields, show a highly nonlinear Weber-Fechner type behavior where the response depends logarithmically on the edge potential. The dependence of the response on the size of the system (e.g.~width of a nanoribbon) is also uncovered. Zigzag edge graphene nanoribbons, therefore, provide a realization of response of organs such as the eye and ear that obey Weber-Fechner law. We validate our analytical results with tight binding calculations. These results are crucial in understanding important effects of electron-electron interactions in graphene nanoribbons such as edge magnetism etc., and also suggest possibilities for device applications of graphene nanoribbons. Work supported by DST, India through MONAMI and Ramanujan grants.

  12. Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

    NASA Astrophysics Data System (ADS)

    E, Lotfi; H, Rezania; B, Arghavaninia; M, Yarmohammadi

    2016-07-01

    We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength.

  13. Mahan excitons in Weyl semimetals

    NASA Astrophysics Data System (ADS)

    Garate, Ion; Bertrand, Simon; Côté, René

    We report on a theoretical study of excitons in weakly doped Weyl semimetals. Solving a two-body Coulomb problem in the presence of a monopole Berry vector potential, we obtain the binding energies of electron-hole pairs and establish their dependence on the monopole charge and on the sign of the magnetic quantum number. We discuss the implications of our results for optical absorption experiments. This research has been supported by Canada's NSERC and Québec's RQMP.

  14. Pairing mechanism in Bi-O superconductors: A finite-size chain calculation

    NASA Astrophysics Data System (ADS)

    Aligia, A. A.; Nuez Regueiro, M. D.; Gagliano, E. R.

    1989-09-01

    We have studied the pairing mechanism in BiO3 systems by calculating the binding energy of a pair of holes in finite Bi-O chains, for parameters that simulate three-dimensional behavior. In agreement with previous results using perturbation theory in the hopping t, for covalent Bi-O binding and parameters for which the parent compound has a disproportionate ground state, pairing induced by the presence of biexcitons is obtained for sufficiently large interatomic Coulomb repulsion. The analysis of appropriate correlation functions shows a rapid metallization of the system as t and the number of holes increase. This fact shrinks the region of parameters for which the finite-size calculations can be trusted without further study. The same model for other parameters yields pairing in two other regimes: bipolaronic and magnetic excitonic.

  15. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    PubMed Central

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  16. Molecular recognition of DNA base pairs by the formamido/pyrrole and formamido/imidazole pairings in stacked polyamides.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Uthe, Peter B; Howard, Cameron M; Pacheco, Kimberly A O; Cox, Kari K; Henry, James A; Bailey, Suzanna L; Horick, Sarah M; Nguyen, Binh; Wilson, W David; Lee, Moses

    2005-01-01

    Polyamides containing an N-terminal formamido (f) group bind to the minor groove of DNA as staggered, antiparallel dimers in a sequence-specific manner. The formamido group increases the affinity and binding site size, and it promotes the molecules to stack in a staggered fashion thereby pairing itself with either a pyrrole (Py) or an imidazole (Im). There has not been a systematic study on the DNA recognition properties of the f/Py and f/Im terminal pairings. These pairings were analyzed here in the context of f-ImPyPy, f-ImPyIm, f-PyPyPy and f-PyPyIm, which contain the central pairing modes, -ImPy- and -PyPy-. The specificity of these triamides towards symmetrical recognition sites allowed for the f/Py and f/Im terminal pairings to be directly compared by SPR, CD and DeltaT (M) experiments. The f/Py pairing, when placed next to the -ImPy- or -PyPy- central pairings, prefers A/T and T/A base pairs to G/C base pairs, suggesting that f/Py has similar DNA recognition specificity to Py/Py. With -ImPy- central pairings, f/Im prefers C/G base pairs (>10 times) to the other Watson-Crick base pairs; therefore, f/Im behaves like the Py/Im pair. However, the f/Im pairing is not selective for the C/G base pair when placed next to the -PyPy- central pairings.

  17. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    PubMed

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Near transferable phenomenological n-body potentials for noble metals

    NASA Astrophysics Data System (ADS)

    Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

    2017-09-01

    We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.

  19. Near transferable phenomenological n-body potentials for noble metals.

    PubMed

    Pontikis, Vassilis; Baldinozzi, Gianguido; Luneville, Laurence; Simeone, David

    2017-09-06

    We present a semi-empirical model of cohesion in noble metals with suitable parameters reproducing a selected set of experimental properties of perfect and defective lattices in noble metals. It consists of two short-range, n-body terms accounting respectively for attractive and repulsive interactions, the former deriving from the second moment approximation of the tight-binding scheme and the latter from the gas approximation of the kinetic energy of electrons. The stability of the face centred cubic versus the hexagonal compact stacking is obtained via a long-range, pairwise function of customary use with ionic pseudo-potentials. Lattice dynamics, molecular statics, molecular dynamics and nudged elastic band calculations show that, unlike previous potentials, this cohesion model reproduces and predicts quite accurately thermodynamic properties in noble metals. In particular, computed surface energies, largely underestimated by existing empirical cohesion models, compare favourably with measured values, whereas predicted unstable stacking-fault energy profiles fit almost perfectly ab initio evaluations from the literature. All together the results suggest that this semi-empirical model is nearly transferable.

  20. Maximum group velocity in a one-dimensional model with a sinusoidally varying staggered potential

    NASA Astrophysics Data System (ADS)

    Nag, Tanay; Sen, Diptiman; Dutta, Amit

    2015-06-01

    We use Floquet theory to study the maximum value of the stroboscopic group velocity in a one-dimensional tight-binding model subjected to an on-site staggered potential varying sinusoidally in time. The results obtained by numerically diagonalizing the Floquet operator are analyzed using a variety of analytical schemes. In the low-frequency limit we use adiabatic theory, while in the high-frequency limit the Magnus expansion of the Floquet Hamiltonian turns out to be appropriate. When the magnitude of the staggered potential is much greater or much less than the hopping, we use degenerate Floquet perturbation theory; we find that dynamical localization occurs in the former case when the maximum group velocity vanishes. Finally, starting from an "engineered" initial state where the particles (taken to be hard-core bosons) are localized in one part of the chain, we demonstrate that the existence of a maximum stroboscopic group velocity manifests in a light-cone-like spreading of the particles in real space.

  1. Automodification of PARP-1 mediates its tight binding to the nuclear matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaalishvili, Giorgi, E-mail: giozaal@gmail.com; Margiani, Dina; Kutalia, Ketevan

    2010-02-26

    Poly(ADP-ribose) polymerase-1 (PARP-1), a nuclear enzyme that catalyzes the NAD{sup +}-dependent addition of ADP-ribose polymers on a variety of nuclear proteins, has been shown to be associated with the nuclear matrix. As yet, the properties and conditions of this association are unclear. Here, we show the existence of two PARP-1 pools associated with the nuclear matrix of rat liver and the ability of PARP-1 automodification to facilitate its binding to the nuclear matrix.

  2. Data key to quest for quality.

    PubMed

    Chang, Florence S; Nielsen, Jon; Macias, Charles

    2013-11-01

    Late-binding data warehousing reduces the time it takes to obtain data needed to make crucial decisions. Late binding refers to when and how tightly data from the source applications are bound to the rules and vocabularies that make it useful. In some cases, data can be seen in real time. In historically paper-driven environments where data-driven decisions may be a new concept, buy-in from clinicians, physicians, and hospital leaders is key to success in using data to improve outcomes.

  3. Insights into an original pocket-ligand pair classification: a promising tool for ligand profile prediction.

    PubMed

    Pérot, Stéphanie; Regad, Leslie; Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A; Villoutreix, Bruno O; Camproux, Anne-Claude

    2013-01-01

    Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding.

  4. Insights into an Original Pocket-Ligand Pair Classification: A Promising Tool for Ligand Profile Prediction

    PubMed Central

    Reynès, Christelle; Spérandio, Olivier; Miteva, Maria A.; Villoutreix, Bruno O.; Camproux, Anne-Claude

    2013-01-01

    Pockets are today at the cornerstones of modern drug discovery projects and at the crossroad of several research fields, from structural biology to mathematical modeling. Being able to predict if a small molecule could bind to one or more protein targets or if a protein could bind to some given ligands is very useful for drug discovery endeavors, anticipation of binding to off- and anti-targets. To date, several studies explore such questions from chemogenomic approach to reverse docking methods. Most of these studies have been performed either from the viewpoint of ligands or targets. However it seems valuable to use information from both ligands and target binding pockets. Hence, we present a multivariate approach relating ligand properties with protein pocket properties from the analysis of known ligand-protein interactions. We explored and optimized the pocket-ligand pair space by combining pocket and ligand descriptors using Principal Component Analysis and developed a classification engine on this paired space, revealing five main clusters of pocket-ligand pairs sharing specific and similar structural or physico-chemical properties. These pocket-ligand pair clusters highlight correspondences between pocket and ligand topological and physico-chemical properties and capture relevant information with respect to protein-ligand interactions. Based on these pocket-ligand correspondences, a protocol of prediction of clusters sharing similarity in terms of recognition characteristics is developed for a given pocket-ligand complex and gives high performances. It is then extended to cluster prediction for a given pocket in order to acquire knowledge about its expected ligand profile or to cluster prediction for a given ligand in order to acquire knowledge about its expected pocket profile. This prediction approach shows promising results and could contribute to predict some ligand properties critical for binding to a given pocket, and conversely, some key pocket properties for ligand binding. PMID:23840299

  5. Bandstructure modulation for Si-h and Si-g nanotubes in a transverse electric field: Tight binding approach

    NASA Astrophysics Data System (ADS)

    Chegel, Raad; Behzad, Somayeh

    2013-11-01

    We have investigated the electronic properties of SiNTs, under the external electric field, using Tight Binding (TB) approximation. It was found that the energy levels, energy gaps, and density of states (DOS) strongly depend on the electric field strength. The large electric strength leads to coupling the neighbor subbands and induce destruction of subband degeneracy, increase of low-energy states, and strong modulation of energy gap which these effects reflect in the DOS spectrum. It has been shown that, the band gap reduction of Si g-NTs is linearly proportional to the electric field strength. The band gap variation for Si h-NTs increases first and later decreases (Metallic) or first remains constant and then decreases (semiconductor). Also we show that the larger diameter tubes are more sensitive to the field strength than smaller ones. The semiconducting metallic transition or vice versa can be achieved through an increasing of applied fields. Number and position of peaks in DOS spectrum are dependent on electric field strength.

  6. Dirac fermions and pseudomagnetic fields in two-dimensional electron gases with triangular antidot lattices

    NASA Astrophysics Data System (ADS)

    Li, Yun-Mei; Zhou, Xiaoying; Zhang, Yan-Yang; Zhang, Dong; Chang, Kai

    2017-07-01

    We investigate theoretically the electronic properties of two-dimensional electron gases (2DEGs) with regular and distorted triangular antidot lattices. We show that the triangular antidot lattices embedded in 2DEGs behave like artificial graphene and host Dirac fermions. By introducing the Wannier representation, we obtain a tight-binding Hamiltonian including the second-nearest-neighboring hopping, which agrees well with the numerically exact solutions. Based on the tight-binding model, we find that spatially nonuniform distortions of the antidot lattices strongly modify the electronic structures, generate pseudomagnetic fields and the well-defined Landau levels. In contrast to graphene, we can design the nonuniform distortions to generate various configurations of pseudomagnetic fields. We show that the snake orbital states arise by designing the ±B pseudomagnetic field configuration. We find that the disorders of antidot lattices during fabrication would not affect the basic feature of the Dirac electrons, but they lead to a reduction in conductance in strong disorder cases.

  7. Quantitative analysis on electric dipole energy in Rashba band splitting.

    PubMed

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-09-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime.

  8. Quantitative analysis on electric dipole energy in Rashba band splitting

    PubMed Central

    Hong, Jisook; Rhim, Jun-Won; Kim, Changyoung; Ryong Park, Seung; Hoon Shim, Ji

    2015-01-01

    We report on quantitative comparison between the electric dipole energy and the Rashba band splitting in model systems of Bi and Sb triangular monolayers under a perpendicular electric field. We used both first-principles and tight binding calculations on p-orbitals with spin-orbit coupling. First-principles calculation shows Rashba band splitting in both systems. It also shows asymmetric charge distributions in the Rashba split bands which are induced by the orbital angular momentum. We calculated the electric dipole energies from coupling of the asymmetric charge distribution and external electric field, and compared it to the Rashba splitting. Remarkably, the total split energy is found to come mostly from the difference in the electric dipole energy for both Bi and Sb systems. A perturbative approach for long wave length limit starting from tight binding calculation also supports that the Rashba band splitting originates mostly from the electric dipole energy difference in the strong atomic spin-orbit coupling regime. PMID:26323493

  9. Band gap engineering for poly(p-phenylene) and poly(p-phenylene vinylene) copolymers using the tight-binding approach

    NASA Astrophysics Data System (ADS)

    Giro, R.; Caldas, M. J.; Galvão, D. S.

    The interest in poly(p-phenylene) (PPP) and poly(p-phenylene vinylene) (PPV) copolymers stems from the fact that these homopolymers present interesting optical and electronic properties that allow a great variety of technological applications. Combining different numbers of PPP and PPV units it is possible, in principle, to obtain new structures presenting intermediate gap values (2.8 eV and 2.4 eV for PPP and PPV, respectively). For this study we used a Hückel Hamiltonian tight-binding coupled to the negative factor counting (NFC) technique. We carried out a systematic search to determine optimum relative concentrations for disordered binary polymeric alloys with predefined gap values. Once these structures were obtained, we used the semiempirical methods AM1/PM3 and ZINDO/S-CI for geometrical and optical studies, respectively. Our theoretical results show that it is possible to obtain copolymers of PPP and PPV with intermediate gap values of their parent structures.

  10. Modeling Magnetic Properties in EZTB

    NASA Technical Reports Server (NTRS)

    Lee, Seungwon; vonAllmen, Paul

    2007-01-01

    A software module that calculates magnetic properties of a semiconducting material has been written for incorporation into, and execution within, the Easy (Modular) Tight-Binding (EZTB) software infrastructure. [EZTB is designed to model the electronic structures of semiconductor devices ranging from bulk semiconductors, to quantum wells, quantum wires, and quantum dots. EZTB implements an empirical tight-binding mathematical model of the underlying physics.] This module can model the effect of a magnetic field applied along any direction and does not require any adjustment of model parameters. The module has thus far been applied to study the performances of silicon-based quantum computers in the presence of magnetic fields and of miscut angles in quantum wells. The module is expected to assist experimentalists in fabricating a spin qubit in a Si/SiGe quantum dot. This software can be executed in almost any Unix operating system, utilizes parallel computing, can be run as a Web-portal application program. The module has been validated by comparison of its predictions with experimental data available in the literature.

  11. Structure and Stability of Molecular Crystals with Many-Body Dispersion-Inclusive Density Functional Tight Binding.

    PubMed

    Mortazavi, Majid; Brandenburg, Jan Gerit; Maurer, Reinhard J; Tkatchenko, Alexandre

    2018-01-18

    Accurate prediction of structure and stability of molecular crystals is crucial in materials science and requires reliable modeling of long-range dispersion interactions. Semiempirical electronic structure methods are computationally more efficient than their ab initio counterparts, allowing structure sampling with significant speedups. We combine the Tkatchenko-Scheffler van der Waals method (TS) and the many-body dispersion method (MBD) with third-order density functional tight-binding (DFTB3) via a charge population-based method. We find an overall good performance for the X23 benchmark database of molecular crystals, despite an underestimation of crystal volume that can be traced to the DFTB parametrization. We achieve accurate lattice energy predictions with DFT+MBD energetics on top of vdW-inclusive DFTB3 structures, resulting in a speedup of up to 3000 times compared with a full DFT treatment. This suggests that vdW-inclusive DFTB3 can serve as a viable structural prescreening tool in crystal structure prediction.

  12. The apical scaffold big bang binds to spectrins and regulates the growth of Drosophila melanogaster wing discs.

    PubMed

    Forest, Elodie; Logeay, Rémi; Géminard, Charles; Kantar, Diala; Frayssinoux, Florence; Heron-Milhavet, Lisa; Djiane, Alexandre

    2018-03-05

    During development, cell numbers are tightly regulated, ensuring that tissues and organs reach their correct size and shape. Recent evidence has highlighted the intricate connections between the cytoskeleton and the regulation of the key growth control Hippo pathway. Looking for apical scaffolds regulating tissue growth, we describe that Drosophila melanogaster big bang (Bbg), a poorly characterized multi-PDZ scaffold, controls epithelial tissue growth without affecting epithelial polarity and architecture. bbg -mutant tissues are smaller, with fewer cells that are less apically constricted than normal. We show that Bbg binds to and colocalizes tightly with the β-heavy-Spectrin/Kst subunit at the apical cortex and promotes Yki activity, F-actin enrichment, and the phosphorylation of the myosin II regulatory light chain Spaghetti squash. We propose a model in which the spectrin cytoskeleton recruits Bbg to the cortex, where Bbg promotes actomyosin contractility to regulate epithelial tissue growth. © 2018 Forest et al.

  13. Actinide electronic structure and atomic forces

    NASA Astrophysics Data System (ADS)

    Albers, R. C.; Rudin, Sven P.; Trinkle, Dallas R.; Jones, M. D.

    2000-07-01

    We have developed a new method[1] of fitting tight-binding parameterizations based on functional forms developed at the Naval Research Laboratory.[2] We have applied these methods to actinide metals and report our success using them (see below). The fitting procedure uses first-principles local-density-approximation (LDA) linear augmented plane-wave (LAPW) band structure techniques[3] to first calculate an electronic-structure band structure and total energy for fcc, bcc, and simple cubic crystal structures for the actinide of interest. The tight-binding parameterization is then chosen to fit the detailed energy eigenvalues of the bands along symmetry directions, and the symmetry of the parameterization is constrained to agree with the correct symmetry of the LDA band structure at each eigenvalue and k-vector that is fit to. By fitting to a range of different volumes and the three different crystal structures, we find that the resulting parameterization is robust and appears to accurately calculate other crystal structures and properties of interest.

  14. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE PAGES

    Zhang, Hong; Zapol, Peter; Dixon, David A.; ...

    2015-11-17

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  15. Tight-binding model for materials at mesoscale

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tai, Yuan-Yen; Choi, Hongchul; Zhu, Wei

    2016-12-21

    TBM3 is an open source package for computational simulations of quantum materials at multiple scales in length and time. The project originated to investigate the multiferroic behavior in transition-metal oxide heterostructures. The framework has also been designed to study emergent phemona in other quantum materials like 2-dimensional transition-metal dichalcogenides, graphene, topological insulators, and skyrmion in materials, etc. In the long term, we will enable the package for transport and time-resolved phenomena. TBM3 is currently a C++ based numerical tool package and framework for the design and construction of any kind of lattice structures with multi-orbital and spin degrees of freedom.more » The fortran based portion of the package will be added in the near future. The design of TBM3 is in a highly flexible and reusable framework and the tight-binding parameters can be modeled or informed by DFT calculations. It is currently GPU enabled and feature of CPU enabled MPI will be added in the future.« less

  16. Detecting sign-changing superconducting gap in LiFeAs using quasiparticle interference

    NASA Astrophysics Data System (ADS)

    Altenfeld, D.; Hirschfeld, P. J.; Mazin, I. I.; Eremin, I.

    2018-02-01

    Using a realistic ten-orbital tight-binding model Hamiltonian fitted to the angle-resolved photoemission spectroscopy data on LiFeAs, we analyze the temperature, frequency, and momentum dependencies of quasiparticle interference to identify gap sign changes in a qualitative way, following our original proposal [Phys. Rev. B 92, 184513 (2015), 10.1103/PhysRevB.92.184513]. We show that all features present for the simple two-band model for the sign-changing s+--wave superconducting gap employed previously are still present in the realistic tight-binding approximation and gap values observed experimentally. We discuss various superconducting gap structures proposed for LiFeAs and identify various features of these superconducting gap functions in the quasiparticle interference patterns. On the other hand, we show that it will be difficult to identify the more complicated possible sign structures of the hole pocket gaps in LiFeAs due to the smallness of the pockets and the near proximity of two of the gap energies.

  17. Shift-and-invert parallel spectral transformation eigensolver: Massively parallel performance for density-functional based tight-binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hong; Zapol, Peter; Dixon, David A.

    The Shift-and-invert parallel spectral transformations (SIPs), a computational approach to solve sparse eigenvalue problems, is developed for massively parallel architectures with exceptional parallel scalability and robustness. The capabilities of SIPs are demonstrated by diagonalization of density-functional based tight-binding (DFTB) Hamiltonian and overlap matrices for single-wall metallic carbon nanotubes, diamond nanowires, and bulk diamond crystals. The largest (smallest) example studied is a 128,000 (2000) atom nanotube for which ~330,000 (~5600) eigenvalues and eigenfunctions are obtained in ~190 (~5) seconds when parallelized over 266,144 (16,384) Blue Gene/Q cores. Weak scaling and strong scaling of SIPs are analyzed and the performance of SIPsmore » is compared with other novel methods. Different matrix ordering methods are investigated to reduce the cost of the factorization step, which dominates the time-to-solution at the strong scaling limit. As a result, a parallel implementation of assembling the density matrix from the distributed eigenvectors is demonstrated.« less

  18. Adaptive frozen orbital treatment for the fragment molecular orbital method combined with density-functional tight-binding

    NASA Astrophysics Data System (ADS)

    Nishimoto, Yoshio; Fedorov, Dmitri G.

    2018-02-01

    The exactly analytic gradient is derived and implemented for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB) using adaptive frozen orbitals. The response contributions which arise from freezing detached molecular orbitals on the border between fragments are computed by solving Z-vector equations. The accuracy of the energy, its gradient, and optimized structures is verified on a set of representative inorganic materials and polypeptides. FMO-DFTB is applied to optimize the structure of a silicon nano-wire, and the results are compared to those of density functional theory and experiment. FMO accelerates the DFTB calculation of a boron nitride nano-ring with 7872 atoms by a factor of 406. Molecular dynamics simulations using FMO-DFTB applied to a 10.7 μm chain of boron nitride nano-rings, consisting of about 1.2 × 106 atoms, reveal the rippling and twisting of nano-rings at room temperature.

  19. Activation mechanism of erythrocyte cathepsin E. evidence for the occurrence of the membrane-associated active enzyme.

    PubMed

    Ueno, E; Sakai, H; Kato, Y; Yamamoto, K

    1989-06-01

    Activation of the erythrocyte cathepsin E located on the cytoplasmic surface of the membrane in a latent form was studied in stripped inside-out membrane vesicles prepared from human erythrocyte membranes. Incubation of the vesicles at 40 degrees C at pH 4 resulted in increased degradation of the membrane proteins, especially band 3. This proteolysis was selectively inhibited by the inclusion of pepstatin (isovaleryl-Val-Val-statyl-Ala-statine) or H 297 [Pro-Thr-Glu-Phe(CH2-NH)Nle-Arg-Leu] in the incubation mixtures, indicating that cathepsin E, as the only aspartic proteinase in erythrocytes, is responsible for the proteolysis. Two potential active-site-directed inhibitors of aspartic proteinases, pepstatin and H 297, were used to prove the occurrence of the membrane-associated active enzyme. To minimize potential errors arising from non-specific binding, the concentrations of the inhibitors used in the binding assay (pepstatin, 5 x 10(-8) M; H 297, 1 x 10(-5) M) were determined by calibration for purified and membrane-associated cathepsin E. The inhibition of the membrane-associated cathepsin E by each inhibitor, which showed the binding of the inhibitor to the activated enzyme, was temperature- and time-dependent. The binding of each inhibitor to the enzyme on the exposed surface of the membrane at pH 4 was highly specific, saturable, and reversible. The present study thus provides the first evidence that cathepsin E tightly bound to the membrane is converted to the active enzyme in the membrane-associated form, and suggests that this enzyme may be responsible for the degradation of band 3.

  20. Magnetic field effects on charge structure factors of gapped graphene structure

    NASA Astrophysics Data System (ADS)

    Rezania, Hamed; Tawoose, Nasrin

    2018-02-01

    We present the behaviors of dynamical and static charge susceptibilities of undoped gapped graphene using the Green's function approach in the context of tight binding model Hamiltonian. Specially, the effects of magnetic field on the plasmon modes of gapped graphene structure are investigated via calculating correlation function of charge density operators. Our results show the increase of magnetic field leads to disappear high frequency plasmon mode for gapped case. We also show that low frequency plasmon mode has not affected by increase of magnetic field and chemical potential. Finally the temperature dependence of static charge structure factor of gapp graphene structure is studied. The effects of both magnetic field and gap parameter on the static structure factor are discusses in details.

Top