Causal structure of oscillations in gene regulatory networks: Boolean analysis of ordinary differential equation attractors.

PubMed

Sun, Mengyang; Cheng, Xianrui; Socolar, Joshua E S

2013-06-01

A common approach to the modeling of gene regulatory networks is to represent activating or repressing interactions using ordinary differential equations for target gene concentrations that include Hill function dependences on regulator gene concentrations. An alternative formulation represents the same interactions using Boolean logic with time delays associated with each network link. We consider the attractors that emerge from the two types of models in the case of a simple but nontrivial network: a figure-8 network with one positive and one negative feedback loop. We show that the different modeling approaches give rise to the same qualitative set of attractors with the exception of a possible fixed point in the ordinary differential equation model in which concentrations sit at intermediate values. The properties of the attractors are most easily understood from the Boolean perspective, suggesting that time-delay Boolean modeling is a useful tool for understanding the logic of regulatory networks.

Timing of Locomotor Recovery from Anoxia Modulated by the white Gene in Drosophila

PubMed Central

Xiao, Chengfeng; Robertson, R. Meldrum

2016-01-01

Locomotor recovery from anoxia follows the restoration of disordered ion distributions and neuronal excitability. The time taken for locomotor recovery after 30 sec anoxia (around 10 min) is longer than the time for the propagation of action potentials to be restored (<1 min) in Drosophila wild type. We report here that the white (w) gene modulates the timing of locomotor recovery. Wild-type flies displayed fast and consistent recovery of locomotion from anoxia, whereas mutants of w showed significantly delayed and more variable recovery. Genetic analysis including serial backcrossing revealed a strong association between the w locus and the timing of locomotor recovery, and haplo-insufficient function of w+ in promoting fast recovery. The locomotor recovery phenotype was independent of classic eye pigmentation, although both are associated with the w gene. Introducing up to four copies of mini-white (mw+) into w1118 was insufficient to promote fast and consistent locomotor recovery. However, flies carrying w+ duplicated to the Y chromosome showed wild-type-like fast locomotor recovery. Furthermore, Knockdown of w by RNA interference (RNAi) in neurons but not glia delayed locomotor recovery, and specifically, knockdown of w in subsets of serotonin neurons was sufficient to delay the locomotor recovery. These data reveal an additional role for w in modulating the timing of locomotor recovery from anoxia. PMID:27029736

An efficient hybrid method for stochastic reaction-diffusion biochemical systems with delay

NASA Astrophysics Data System (ADS)

Sayyidmousavi, Alireza; Ilie, Silvana

2017-12-01

Many chemical reactions, such as gene transcription and translation in living cells, need a certain time to finish once they are initiated. Simulating stochastic models of reaction-diffusion systems with delay can be computationally expensive. In the present paper, a novel hybrid algorithm is proposed to accelerate the stochastic simulation of delayed reaction-diffusion systems. The delayed reactions may be of consuming or non-consuming delay type. The algorithm is designed for moderately stiff systems in which the events can be partitioned into slow and fast subsets according to their propensities. The proposed algorithm is applied to three benchmark problems and the results are compared with those of the delayed Inhomogeneous Stochastic Simulation Algorithm. The numerical results show that the new hybrid algorithm achieves considerable speed-up in the run time and very good accuracy.

Lysis delay and burst shrinkage of coliphage T7 by deletion of terminator Tφ reversed by deletion of early genes.

PubMed

Nguyen, Huong Minh; Kang, Changwon

2014-02-01

Bacteriophage T7 terminator Tϕ is a class I intrinsic terminator coding for an RNA hairpin structure immediately followed by oligo(U), which has been extensively studied in terms of its transcription termination mechanism, but little is known about its physiological or regulatory functions. In this study, using a T7 mutant phage, where a 31-bp segment of Tϕ was deleted from the genome, we discovered that deletion of Tϕ from T7 reduces the phage burst size but delays lysis timing, both of which are disadvantageous for the phage. The burst downsizing could directly result from Tϕ deletion-caused upregulation of gene 17.5, coding for holin, among other Tϕ downstream genes, because infection of gp17.5-overproducing Escherichia coli by wild-type T7 phage showed similar burst downsizing. However, the lysis delay was not associated with cellular levels of holin or lysozyme or with rates of phage adsorption. Instead, when allowed to evolve spontaneously in five independent adaptation experiments, the Tϕ-lacking mutant phage, after 27 or 29 passages, recovered both burst size and lysis time reproducibly by deleting early genes 0.5, 0.6, and 0.7 of class I, among other mutations. Deletion of genes 0.5 to 0.7 from the Tϕ-lacking mutant phage decreased expression of several Tϕ downstream genes to levels similar to that of the wild-type phage. Accordingly, phage T7 lysis timing is associated with cellular levels of Tϕ downstream gene products. This suggests the involvement of unknown factor(s) besides the known lysis proteins, lysozyme and holin, and that Tϕ plays a role of optimizing burst size and lysis time during T7 infection. IMPORTANCE Bacteriophages are bacterium-infecting viruses. After producing numerous progenies inside bacteria, phages lyse bacteria using their lysis protein(s) to get out and start a new infection cycle. Normally, lysis is tightly controlled to ensure phage progenies are maximally produced and released at an optimal time. Here, we have discovered that phage T7, besides employing its known lysis proteins, additionally uses its transcription terminator Tϕ to guarantee the optimal lysis of the E. coli host. Tϕ, positioned in the middle of the T7 genome, must be inactivated at least partially to allow for transcription-driven translocation of T7 DNA into hosts and expression of Tϕ downstream but promoter-lacking genes. What role is played by Tϕ before inactivation? Without Tϕ, not only was lysis time delayed but also the number of progenies was reduced in this study. Furthermore, T7 can overcome Tϕ deletion by further deleting some genes, highlighting that a phage has multiple strategies for optimizing lysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Huys, Otti, E-mail: otti.dhuys@phy.duke.edu; Haynes, Nicholas D.; Lohmann, Johannes

Autonomous Boolean networks are commonly used to model the dynamics of gene regulatory networks and allow for the prediction of stable dynamical attractors. However, most models do not account for time delays along the network links and noise, which are crucial features of real biological systems. Concentrating on two paradigmatic motifs, the toggle switch and the repressilator, we develop an experimental testbed that explicitly includes both inter-node time delays and noise using digital logic elements on field-programmable gate arrays. We observe transients that last millions to billions of characteristic time scales and scale exponentially with the amount of time delaysmore » between nodes, a phenomenon known as super-transient scaling. We develop a hybrid model that includes time delays along network links and allows for stochastic variation in the delays. Using this model, we explain the observed super-transient scaling of both motifs and recreate the experimentally measured transient distributions.« less

Molecular genetic analysis of circadian timekeeping in Drosophila

PubMed Central

Hardin, Paul E.

2014-01-01

A genetic screen for mutants that alter circadian rhythms in Drosophila identified the first clock gene - the period (per) gene. The per gene is a central player within a transcriptional feedback loop that represents the core mechanism for keeping circadian time in Drosophila and other animals. The per feedback loop, or core loop, is interlocked with the Clock (Clk) feedback loop, but whether the Clk feedback loop contributes to circadian timekeeping is not known. A series of distinct molecular events are thought to control transcriptional feedback in the core loop. The time it takes to complete these events should take much less than 24h, thus delays must be imposed at different steps within the core loop. As new clock genes are identified, the molecular mechanisms responsible for these delays have been revealed in ever-increasing detail, and provide an in depth accounting of how transcriptional feedback loops keep circadian time. The phase of these feedback loops shift to maintain synchrony with environmental cycles, the most reliable of which is light. Although a great deal is known about cell-autonomous mechanisms of light-induced phase shifting by CRYPTOCHROME (CRY), much less is known about non-cell autonomous mechanisms. CRY mediates phase shifts through an uncharacterized mechanism in certain brain oscillator neurons, and carries out a dual role as a photoreceptor and transcription factor in other tissues. Here I will review how transcriptional feedback loops function to keep time in Drosophila, how they impose delays to maintain a 24h cycle, and how they maintain synchrony with environmental light:dark cycles. The transcriptional feedback loops that keep time in Drosophila are well conserved in other animals, thus what we learn about these loops in Drosophila should continue to provide insight into the operation of analogous transcriptional feedback loops in other animals. PMID:21924977

Hopf Bifurcation Analysis of a Gene Regulatory Network Mediated by Small Noncoding RNA with Time Delays and Diffusion

NASA Astrophysics Data System (ADS)

Li, Chengxian; Liu, Haihong; Zhang, Tonghua; Yan, Fang

2017-12-01

In this paper, a gene regulatory network mediated by small noncoding RNA involving two time delays and diffusion under the Neumann boundary conditions is studied. Choosing the sum of delays as the bifurcation parameter, the stability of the positive equilibrium and the existence of spatially homogeneous and spatially inhomogeneous periodic solutions are investigated by analyzing the corresponding characteristic equation. It is shown that the sum of delays can induce Hopf bifurcation and the diffusion incorporated into the system can effect the amplitude of periodic solutions. Furthermore, the spatially homogeneous periodic solution always exists and the spatially inhomogeneous periodic solution will arise when the diffusion coefficients of protein and mRNA are suitably small. Particularly, the small RNA diffusion coefficient is more robust and its effect on model is much less than protein and mRNA. Finally, the explicit formulae for determining the direction of Hopf bifurcation and the stability of the bifurcating periodic solutions are derived by employing the normal form theory and center manifold theorem for partial functional differential equations. Finally, numerical simulations are carried out to illustrate our theoretical analysis.

RNA splicing regulates the temporal order of TNF-induced gene expression.

PubMed

Hao, Shengli; Baltimore, David

2013-07-16

When cells are induced to express inflammatory genes by treatment with TNF, the mRNAs for the induced genes appear in three distinct waves, defining gene groups I, II, and III, or early, intermediate, and late genes. To examine the basis for these different kinetic classes, we have developed a PCR-based procedure to distinguish pre-mRNAs from mRNAs. It shows that the three groups initiate transcription virtually simultaneously but that delays in splicing characterize groups II and III. We also examined the elongation times, concluding that pre-mRNA synthesis is coordinate but splicing differences directly regulate the timing of mRNA production.

Regulation of gene expression in plasmid ColE1: delayed expression of the kil gene.

PubMed Central

Zhang, S P; Yan, L F; Zubay, G

1988-01-01

cea, imm, and kil are a cluster of three functionally related genes of the plasmid ColE1. The cea and kil genes are in the same inducible operon, with transcription being initiated from a promoter adjacent to the cea gene. The imm gene is located between the cea and kil genes, but it is transcribed in the opposite direction. Complementary interaction between the imm mRNA and the anti-imm sequences in the middle of the cea-kil transcript causes a pronounced delay in expression of the kil gene when the cea-kil operon is induced. A segment in the overlapping region between the cea and imm genes causes delayed expression of the kil gene in the absence of imm gene transcription. This delay effect increases the yields of colicin synthesized in induced cells. Images PMID:3142845

Delayed blastocyst formation or an extra day culture increases apoptosis in pig blastocysts.

PubMed

Lin, Tao; Lee, Jae Eun; Oqani, Reza K; Kim, So Yeon; Cho, Eun Seok; Jeong, Yong Dae; Baek, Jun Jong; Jin, Dong Il

2017-10-01

In the present study, the timing was examined of blastocyst collection/formation or of how the duration of post-blastulation culture affected the quality and developmental competence of in vitro-produced pig parthenogenetic embryos. The earliest apoptotic signals were observed at the morula stage while the earliest cytoplasmic fragmentation was observed before the 4- to 8-cell stage of embryo development. Nuclear condensation was detected in morulae and blastocysts, but not all condensed nuclei were positive for the apoptotic signal (TUNEL staining). The mean blastocyst diameter increased with delayed blastocyst collection or extended post-blastulation culture, but decreased with delayed blastocyst formation. Delayed blastocyst collection/formation or an additional day of post-blastulation culture increased the frequencies of apoptosis, condensed nuclei, and low quality blastocysts (those showing a nuclear destruction that negated counting of the nuclei); increased the expression of the pro-apoptotic BAX gene; and reduced the ratio of ICM (inner cell mass) cells to TE (trophectoderm) cells. In addition, delayed blastocyst formation decreased POU5F1 gene expression. These results suggest that a delay in blastocyst collection/formation or an additional day of culture could increase the incidence of apoptosis, decrease the ICM:TE cell ratio, and influence the gene expression and diameter of blastocysts derived from in vitro-produced pig embryos. These findings provide a useful reference for improving the quality of in vitro-produced embryos. Copyright © 2017 Elsevier B.V. All rights reserved.

The Genetic Control of Reproductive Development under High Ambient Temperature.

PubMed

Ejaz, Mahwish; von Korff, Maria

2017-01-01

Ambient temperature has a large impact on reproductive development and grain yield in temperate cereals. However, little is known about the genetic control of development under different ambient temperatures. Here, we demonstrate that in barley (Hordeum vulgare), high ambient temperatures accelerate or delay reproductive development depending on the photoperiod response gene PHOTOPERIOD1 (Ppd-H1) and its upstream regulator EARLY FLOWERING3 (HvELF3). A natural mutation in Ppd-H1 prevalent in spring barley delayed floral development and reduced the number of florets and seeds per spike, while the wild-type Ppd-H1 or a mutant Hvelf3 allele accelerated floral development and maintained the seed number under high ambient temperatures. High ambient temperature delayed the expression phase and reduced the amplitude of clock genes and repressed the floral integrator gene FLOWERING LOCUS T1 independently of the genotype. Ppd-H1-dependent variation in flowering time under different ambient temperatures correlated with relative expression levels of the BARLEY MADS-box genes VERNALIZATION1 (HvVRN1), HvBM3, and HvBM8 in the leaf. Finally, we show that Ppd-H1 interacts with regulatory variation at HvVRN1. Ppd-H1 only accelerated floral development in the background of a spring HvVRN1 allele with a deletion in the regulatory intron. The full-length winter Hvvrn1 allele was strongly down-regulated, and flowering was delayed by high temperatures irrespective of Ppd-H1 Our findings demonstrate that the photoperiodic and vernalization pathways interact to control flowering time and floret fertility in response to ambient temperature in barley. © 2017 American Society of Plant Biologists. All Rights Reserved.

The Genetic Control of Reproductive Development under High Ambient Temperature1[OPEN

PubMed Central

2017-01-01

Ambient temperature has a large impact on reproductive development and grain yield in temperate cereals. However, little is known about the genetic control of development under different ambient temperatures. Here, we demonstrate that in barley (Hordeum vulgare), high ambient temperatures accelerate or delay reproductive development depending on the photoperiod response gene PHOTOPERIOD1 (Ppd-H1) and its upstream regulator EARLY FLOWERING3 (HvELF3). A natural mutation in Ppd-H1 prevalent in spring barley delayed floral development and reduced the number of florets and seeds per spike, while the wild-type Ppd-H1 or a mutant Hvelf3 allele accelerated floral development and maintained the seed number under high ambient temperatures. High ambient temperature delayed the expression phase and reduced the amplitude of clock genes and repressed the floral integrator gene FLOWERING LOCUS T1 independently of the genotype. Ppd-H1-dependent variation in flowering time under different ambient temperatures correlated with relative expression levels of the BARLEY MADS-box genes VERNALIZATION1 (HvVRN1), HvBM3, and HvBM8 in the leaf. Finally, we show that Ppd-H1 interacts with regulatory variation at HvVRN1. Ppd-H1 only accelerated floral development in the background of a spring HvVRN1 allele with a deletion in the regulatory intron. The full-length winter Hvvrn1 allele was strongly down-regulated, and flowering was delayed by high temperatures irrespective of Ppd-H1. Our findings demonstrate that the photoperiodic and vernalization pathways interact to control flowering time and floret fertility in response to ambient temperature in barley. PMID:28049855

Putative sugarcane FT/TFL1 genes delay flowering time and alter reproductive architecture in Arabidopsis.

PubMed

Coelho, Carla P; Minow, Mark A A; Chalfun-Júnior, Antonio; Colasanti, Joseph

2014-01-01

Agriculturally important grasses such as rice, maize, and sugarcane are evolutionarily distant from Arabidopsis, yet some components of the floral induction process are highly conserved. Flowering in sugarcane is an important factor that negatively affects cane yield and reduces sugar/ethanol production from this important perennial bioenergy crop. Comparative studies have facilitated the identification and characterization of putative orthologs of key flowering time genes in sugarcane, a complex polyploid plant whose genome has yet to be sequenced completely. Using this approach we identified phosphatidylethanolamine-binding protein (PEBP) gene family members in sugarcane that are similar to the archetypical FT and TFL1 genes of Arabidopsis that play an essential role in controlling the transition from vegetative to reproductive growth. Expression analysis of ScTFL1, which falls into the TFL1-clade of floral repressors, showed transcripts in developing leaves surrounding the shoot apex but not at the apex itself. ScFT1 was detected in immature leaves and apical regions of vegetatively growing plants and, after the floral transition, expression also occurred in mature leaves. Ectopic over-expression of ScTFL1 in Arabidopsis caused delayed flowering in Arabidopsis, as might be expected for a gene related to TFL1. In addition, lines with the latest flowering phenotype exhibited aerial rosette formation. Unexpectedly, over-expression of ScFT1, which has greatest similarity to the florigen-encoding FT, also caused a delay in flowering. This preliminary analysis of divergent sugarcane FT and TFL1 gene family members from Saccharum spp. suggests that their expression patterns and roles in the floral transition has diverged from the predicted role of similar PEBP family members.

Elongator promotes germination and early post-germination growth.

PubMed

Woloszynska, Magdalena; Gagliardi, Olimpia; Vandenbussche, Filip; Van Lijsebettens, Mieke

2018-01-02

The Elongator complex interacts with RNA polymerase II and via histone acetylation and DNA demethylation facilitates epigenetically the transcription of genes involved in diverse processes in plants, including growth, development, and immune response. Recently, we have shown that the Elongator complex promotes hypocotyl elongation and photomorphogenesis in Arabidopsis thaliana by regulating the photomorphogenesis and growth-related gene network that converges on genes implicated in cell wall biogenesis and hormone signaling. Here, we report that germination in the elo mutant was delayed by 6 h in the dark when compared to the wild type in a time lapse and germination assay. A number of germination-correlated genes were down-regulated in the elo transcriptome, suggesting a transcriptional regulation by Elongator. We also show that the hypocotyl elongation defect observed in the elo mutants in darkness originates very early in the post-germination development and is independent from the germination delay.

Transcriptomic changes reveal gene networks responding to the overexpression of a blueberry DWARF AND DELAYED FLOWERING 1 gene in transgenic blueberry plants.

PubMed

Song, Guo-Qing; Gao, Xuan

2017-06-19

Constitutive expression of the CBF/DREB1 for increasing freezing tolerance in woody plants is often associated with other phenotypic changes including dwarf plant and delayed flowering. These phenotypic changes have been observed when Arabidopsis DWARF AND DELAYED FLOWERING 1 (DDF1) was overexpressed in A. thaliana plants. To date, the DDF1 orthologues have not been studied in woody plants. The aim of this study is to investigate transcriptomic responses to the overexpression of blueberry (Vaccinium corymbosum) DDF1 (herein, VcDDF1-OX). The VcDDF1-OX resulted in enhanced freezing tolerance in tetraploid blueberry plants and did not result in significant changes in plant size, chilling requirement, and flowering time. Comparative transcriptome analysis of transgenic 'Legacy-VcDDF1-OX' plants containing an overexpressed VcDDF1 with non-transgenic highbush blueberry 'Legacy' plants revealed the VcDDF1-OX derived differentially expressed (DE) genes and transcripts in the pathways of cold-response, plant flowering, DELLA proteins, and plant phytohormones. The increase in freezing tolerance was associated to the expression of cold-regulated genes (CORs) and the ethylene pathway genes. The unchanged plant size, dormancy and flowering were due to the minimal effect of the VcDDF1-OX on the expression of DELLA proteins, flowering pathway genes, and the other phytohormone genes related to plant growth and development. The DE genes in auxin and cytokinin pathways suggest that the VcDDF1-OX has also altered plant tolerance to drought and high salinity. A DDF1 orthologue in blueberry functioned differently from the DDF1 reported in Arabidopsis. The overexpression of VcDDF1 or its orthologues is a new approach to increase freezing tolerance of deciduous woody plant species with no obvious effect on plant size and plant flowering time.

Ogura-CMS in Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed expression of many nuclear genes.

PubMed

Dong, Xiangshu; Kim, Wan Kyu; Lim, Yong-Pyo; Kim, Yeon-Ki; Hur, Yoonkang

2013-02-01

We investigated the mechanism regulating cytoplasmic male sterility (CMS) in Brassica rapa ssp. pekinensis using floral bud transcriptome analyses of Ogura-CMS Chinese cabbage and its maintainer line in B. rapa 300-K oligomeric probe (Br300K) microarrays. Ogura-CMS Chinese cabbage produced few and infertile pollen grains on indehiscent anthers. Compared to the maintainer line, CMS plants had shorter filaments and plant growth, and delayed flowering and pollen development. In microarray analysis, 4646 genes showed different expression, depending on floral bud size, between Ogura-CMS and its maintainer line. We found 108 and 62 genes specifically expressed in Ogura-CMS and its maintainer line, respectively. Ogura-CMS line-specific genes included stress-related, redox-related, and B. rapa novel genes. In the maintainer line, genes related to pollen coat and germination were specifically expressed in floral buds longer than 3mm, suggesting insufficient expression of these genes in Ogura-CMS is directly related to dysfunctional pollen. In addition, many nuclear genes associated with auxin response, ATP synthesis, pollen development and stress response had delayed expression in Ogura-CMS plants compared to the maintainer line, which is consistent with the delay in growth and development of Ogura-CMS plants. Delayed expression may reduce pollen grain production and/or cause sterility, implying that mitochondrial, retrograde signaling delays nuclear gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

The mRNA cap-binding protein Cbc1 is required for high and timely expression of genes by promoting the accumulation of gene-specific activators at promoters.

PubMed

Li, Tianlu; De Clercq, Nikki; Medina, Daniel A; Garre, Elena; Sunnerhagen, Per; Pérez-Ortín, José E; Alepuz, Paula

2016-02-01

The highly conserved Saccharomyces cerevisiae cap-binding protein Cbc1/Sto1 binds mRNA co-transcriptionally and acts as a key coordinator of mRNA fate. Recently, Cbc1 has also been implicated in transcription elongation and pre-initiation complex (PIC) formation. Previously, we described Cbc1 to be required for cell growth under osmotic stress and to mediate osmostress-induced translation reprogramming. Here, we observe delayed global transcription kinetics in cbc1Δ during osmotic stress that correlates with delayed recruitment of TBP and RNA polymerase II to osmo-induced promoters. Interestingly, we detect an interaction between Cbc1 and the MAPK Hog1, which controls most gene expression changes during osmostress, and observe that deletion of CBC1 delays the accumulation of the activator complex Hot1-Hog1 at osmostress promoters. Additionally, CBC1 deletion specifically reduces transcription rates of highly transcribed genes under non-stress conditions, such as ribosomal protein (RP) genes, while having low impact on transcription of weakly expressed genes. For RP genes, we show that recruitment of the specific activator Rap1, and subsequently TBP, to promoters is Cbc1-dependent. Altogether, our results indicate that binding of Cbc1 to the capped mRNAs is necessary for the accumulation of specific activators as well as PIC components at the promoters of genes whose expression requires high and rapid transcription. Copyright © 2016 Elsevier B.V. All rights reserved.

The sensitivity of Turing self-organization to biological feedback delays: 2D models of fish pigmentation.

PubMed

Gaffney, E A; Lee, S Seirin

2015-03-01

Turing morphogen models have been extensively explored in the context of large-scale self-organization in multicellular biological systems. However, reconciling the detailed biology of morphogen dynamics, while accounting for time delays associated with gene expression, reveals aberrant behaviours that are not consistent with early developmental self-organization, especially the requirement for exquisite temporal control. Attempts to reconcile the interpretation of Turing's ideas with an increasing understanding of the mechanisms driving zebrafish pigmentation suggests that one should reconsider Turing's model in terms of pigment cells rather than morphogens (Nakamasu et al., 2009, PNAS, 106: , 8429-8434; Yamaguchi et al., 2007, PNAS, 104: , 4790-4793). Here the dynamics of pigment cells is subject to response delays implicit in the cell cycle and apoptosis. Hence we explore simulations of fish skin patterning, focussing on the dynamical influence of gene expression delays in morphogen-based Turing models and response delays for cell-based Turing models. We find that reconciling the mechanisms driving the behaviour of Turing systems with observations of fish skin patterning remains a fundamental challenge. © The Authors 2013. Published by Oxford University Press on behalf of the Institute of Mathematics and its Applications. All rights reserved.

Sensitivity analysis of dynamic biological systems with time-delays.

PubMed

Wu, Wu Hsiung; Wang, Feng Sheng; Chang, Maw Shang

2010-10-15

Mathematical modeling has been applied to the study and analysis of complex biological systems for a long time. Some processes in biological systems, such as the gene expression and feedback control in signal transduction networks, involve a time delay. These systems are represented as delay differential equation (DDE) models. Numerical sensitivity analysis of a DDE model by the direct method requires the solutions of model and sensitivity equations with time-delays. The major effort is the computation of Jacobian matrix when computing the solution of sensitivity equations. The computation of partial derivatives of complex equations either by the analytic method or by symbolic manipulation is time consuming, inconvenient, and prone to introduce human errors. To address this problem, an automatic approach to obtain the derivatives of complex functions efficiently and accurately is necessary. We have proposed an efficient algorithm with an adaptive step size control to compute the solution and dynamic sensitivities of biological systems described by ordinal differential equations (ODEs). The adaptive direct-decoupled algorithm is extended to solve the solution and dynamic sensitivities of time-delay systems describing by DDEs. To save the human effort and avoid the human errors in the computation of partial derivatives, an automatic differentiation technique is embedded in the extended algorithm to evaluate the Jacobian matrix. The extended algorithm is implemented and applied to two realistic models with time-delays: the cardiovascular control system and the TNF-α signal transduction network. The results show that the extended algorithm is a good tool for dynamic sensitivity analysis on DDE models with less user intervention. By comparing with direct-coupled methods in theory, the extended algorithm is efficient, accurate, and easy to use for end users without programming background to do dynamic sensitivity analysis on complex biological systems with time-delays.

GEsture: an online hand-drawing tool for gene expression pattern search.

PubMed

Wang, Chunyan; Xu, Yiqing; Wang, Xuelin; Zhang, Li; Wei, Suyun; Ye, Qiaolin; Zhu, Youxiang; Yin, Hengfu; Nainwal, Manoj; Tanon-Reyes, Luis; Cheng, Feng; Yin, Tongming; Ye, Ning

2018-01-01

Gene expression profiling data provide useful information for the investigation of biological function and process. However, identifying a specific expression pattern from extensive time series gene expression data is not an easy task. Clustering, a popular method, is often used to classify similar expression genes, however, genes with a 'desirable' or 'user-defined' pattern cannot be efficiently detected by clustering methods. To address these limitations, we developed an online tool called GEsture. Users can draw, or graph a curve using a mouse instead of inputting abstract parameters of clustering methods. GEsture explores genes showing similar, opposite and time-delay expression patterns with a gene expression curve as input from time series datasets. We presented three examples that illustrate the capacity of GEsture in gene hunting while following users' requirements. GEsture also provides visualization tools (such as expression pattern figure, heat map and correlation network) to display the searching results. The result outputs may provide useful information for researchers to understand the targets, function and biological processes of the involved genes.

Coordinated Gene Regulation in the Initial Phase of Salt Stress Adaptation*

PubMed Central

Vanacloig-Pedros, Elena; Bets-Plasencia, Carolina; Pascual-Ahuir, Amparo; Proft, Markus

2015-01-01

Stress triggers complex transcriptional responses, which include both gene activation and repression. We used time-resolved reporter assays in living yeast cells to gain insights into the coordination of positive and negative control of gene expression upon salt stress. We found that the repression of “housekeeping” genes coincides with the transient activation of defense genes and that the timing of this expression pattern depends on the severity of the stress. Moreover, we identified mutants that caused an alteration in the kinetics of this transcriptional control. Loss of function of the vacuolar H+-ATPase (vma1) or a defect in the biosynthesis of the osmolyte glycerol (gpd1) caused a prolonged repression of housekeeping genes and a delay in gene activation at inducible loci. Both mutants have a defect in the relocation of RNA polymerase II complexes at stress defense genes. Accordingly salt-activated transcription is delayed and less efficient upon partially respiratory growth conditions in which glycerol production is significantly reduced. Furthermore, the loss of Hog1 MAP kinase function aggravates the loss of RNA polymerase II from housekeeping loci, which apparently do not accumulate at inducible genes. Additionally the Def1 RNA polymerase II degradation factor, but not a high pool of nuclear polymerase II complexes, is needed for efficient stress-induced gene activation. The data presented here indicate that the finely tuned transcriptional control upon salt stress is dependent on physiological functions of the cell, such as the intracellular ion balance, the protective accumulation of osmolyte molecules, and the RNA polymerase II turnover. PMID:25745106

Phenobarbital blockade of the preovulatory luteinizing hormone surge: association with phase-advanced circadian clock and altered suprachiasmatic nucleus Period1 gene expression

PubMed Central

Legan, Sandra J.; Donoghue, Kathleen M.; Franklin, Kathleen M.; Duncan, Marilyn J.

2009-01-01

The suprachiasmatic nucleus (SCN) controls the timing of the preovulatory luteinizing hormone (LH) surge in laboratory rodents. Barbiturate administration during a critical period on proestrus delays the surge and prolongs the estrous cycle 1 day. Because a nonphotic timing signal (zeitgeber) during the critical period that phase advances activity rhythms can also induce the latter effect, we hypothesized that barbiturates delay the LH surge by phase-advancing its circadian timing signal beyond the critical period. In experiment 1, locomotor rhythms and estrous cycles were monitored in hamsters for 2–3 wk preinjection and postinjection of vehicle or phenobarbital and after transfer to darkness at zeitgeber time (ZT) 6 on proestrus. Phenobarbital delayed estrous cycles in five of seven hamsters, which exhibited phase shifts that averaged twofold greater than those exhibited by vehicle controls or phenobarbital-injected hamsters with normal cycles. Experiment 2 used a similar protocol, but injections were at ZT 5, and blood samples for LH determination were collected from 1200 to 1800 on proestrus and the next day via jugular cannulae inserted the day before proestrus. Phenobarbital delayed the LH surge 1 day in all six hamsters, but it occurred at an earlier circadian time, supporting the above hypothesis. Experiment 3 investigated whether phenobarbital, like other nonphotic zeitgebers, suppresses SCN Period1 and Period2 transcription. Two hours postinjection, phenobarbital decreased SCN expression of only Period1 mRNA, as determined by in situ hybridization. These results suggest that phenobarbital advances the SCN pacemaker, governing activity rhythms and hormone release in part by decreasing its Period1 gene expression. PMID:19297538

Comparative transcriptome and proteome profiling of two Citrus sinensis cultivars during fruit development and ripening.

PubMed

Wang, Jian-Hui; Liu, Jian-Jun; Chen, Ke-Ling; Li, Hong-Wen; He, Jian; Guan, Bin; He, Li

2017-12-21

Transcriptome and proteome analyses on fruit pulp from the blood orange 'Zaohong' and the navel orange 'twenty-first century' were performed to study Citrus sinensis quality-related molecular changes during consecutive developmental periods, including young fruit, fruit-coloring onset and fruit delayed-harvest for two months, during which fruit remained on the trees. The time-course analysis for the fruit developmental periods indicated a complex, dynamic gene expression pattern, with the numbers of differentially expressed genes (DEGs) between the two cultivars being 119, 426 and 904 at the three continuous stages tested during fruit development and ripening. The continuous increase in total soluble solids over the course of fruit development was correlated with up-regulated sucrose phosphate synthase (SPS) transcription levels in both cultivars. Eleven differentially expressed genes between the two cultivars involved in the flavonoid pathway were significantly enriched at the onset of the fruit-coloring stage when anthocyanins were detected in blood orange alone. Among 5185 proteins, 65 up-regulated and 29 down-regulated proteins were co-expressed with their cognate mRNAs with significant transcription and protein expression levels when the fruits from the two cultivars were compared at the fruit delayed-harvest stage. Additionally, important genes participating in the γ-aminobutyric acid (GABA) shunt were activated in blood orange at two significant expression levels in the fruit delayed-harvest stage. Thus, organic acids in fruit continuously decreased during this stage. This research was the first to provide a more comprehensive understanding of the differentially expressed genes involved in anthocyanin, sucrose and citrate metabolism at the transcriptome and proteome levels in C. sinensis, especially during the fruit delayed-harvest stage.

LEAP: constructing gene co-expression networks for single-cell RNA-sequencing data using pseudotime ordering.

PubMed

Specht, Alicia T; Li, Jun

2017-03-01

To construct gene co-expression networks based on single-cell RNA-Sequencing data, we present an algorithm called LEAP, which utilizes the estimated pseudotime of the cells to find gene co-expression that involves time delay. R package LEAP available on CRAN. jun.li@nd.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Roles for the Histone Modifying and Exchange Complex NuA4 in Cell Cycle Progression in Drosophila melanogaster.

PubMed

Flegel, Kerry; Grushko, Olga; Bolin, Kelsey; Griggs, Ellen; Buttitta, Laura

2016-07-01

Robust and synchronous repression of E2F-dependent gene expression is critical to the proper timing of cell cycle exit when cells transition to a postmitotic state. Previously NuA4 was suggested to act as a barrier to proliferation in Drosophila by repressing E2F-dependent gene expression. Here we show that NuA4 activity is required for proper cell cycle exit and the repression of cell cycle genes during the transition to a postmitotic state in vivo However, the delay of cell cycle exit caused by compromising NuA4 is not due to additional proliferation or effects on E2F activity. Instead NuA4 inhibition results in slowed cell cycle progression through late S and G2 phases due to aberrant activation of an intrinsic p53-independent DNA damage response. A reduction in NuA4 function ultimately produces a paradoxical cell cycle gene expression program, where certain cell cycle genes become derepressed in cells that are delayed during the G2 phase of the final cell cycle. Bypassing the G2 delay when NuA4 is inhibited leads to abnormal mitoses and results in severe tissue defects. NuA4 physically and genetically interacts with components of the E2F complex termed D: rosophila, R: bf, E: 2F A: nd M: yb/ M: ulti-vulva class B: (DREAM/MMB), and modulates a DREAM/MMB-dependent ectopic neuron phenotype in the posterior wing margin. However, this effect is also likely due to the cell cycle delay, as simply reducing Cdk1 is sufficient to generate a similar phenotype. Our work reveals that the major requirement for NuA4 in the cell cycle in vivo is to suppress an endogenous DNA damage response, which is required to coordinate proper S and G2 cell cycle progression with differentiation and cell cycle gene expression. Copyright © 2016 by the Genetics Society of America.

Roles for the Histone Modifying and Exchange Complex NuA4 in Cell Cycle Progression in Drosophila melanogaster

PubMed Central

Flegel, Kerry; Grushko, Olga; Bolin, Kelsey; Griggs, Ellen; Buttitta, Laura

2016-01-01

Robust and synchronous repression of E2F-dependent gene expression is critical to the proper timing of cell cycle exit when cells transition to a postmitotic state. Previously NuA4 was suggested to act as a barrier to proliferation in Drosophila by repressing E2F-dependent gene expression. Here we show that NuA4 activity is required for proper cell cycle exit and the repression of cell cycle genes during the transition to a postmitotic state in vivo. However, the delay of cell cycle exit caused by compromising NuA4 is not due to additional proliferation or effects on E2F activity. Instead NuA4 inhibition results in slowed cell cycle progression through late S and G2 phases due to aberrant activation of an intrinsic p53-independent DNA damage response. A reduction in NuA4 function ultimately produces a paradoxical cell cycle gene expression program, where certain cell cycle genes become derepressed in cells that are delayed during the G2 phase of the final cell cycle. Bypassing the G2 delay when NuA4 is inhibited leads to abnormal mitoses and results in severe tissue defects. NuA4 physically and genetically interacts with components of the E2F complex termed Drosophila, Rbf, E2F and Myb/Multi-vulva class B (DREAM/MMB), and modulates a DREAM/MMB-dependent ectopic neuron phenotype in the posterior wing margin. However, this effect is also likely due to the cell cycle delay, as simply reducing Cdk1 is sufficient to generate a similar phenotype. Our work reveals that the major requirement for NuA4 in the cell cycle in vivo is to suppress an endogenous DNA damage response, which is required to coordinate proper S and G2 cell cycle progression with differentiation and cell cycle gene expression. PMID:27184390

Genetic studies in a patient with X-linked retinoschisis coexisting with developmental delay and sensorineural hearing loss.

PubMed

Sudha, Dhandayuthapani; Patric, Irene Rosita Pia; Ganapathy, Aparna; Agarwal, Smitha; Krishna, Shuba; Neriyanuri, Srividya; Sripriya, Sarangapani; Sen, Parveen; Chidambaram, Subbulakshmi; Arunachalam, Jayamuruga Pandian

2017-01-01

In this study, we present a juvenile retinoschisis patient with developmental delay, sensorineural hearing loss, and reduced axial tone. X-linked juvenile retinoschisis (XLRS) is a retinal dystrophy, most often not associated with systemic anomalies and also not showing any locus heterogeneity. Therefore it was of interest to understand the genetic basis of the condition in this patient. RS1 gene screening for XLRS was performed by Sanger sequencing. Whole genome SNP 6.0 array analysis was carried out to investigate gross chromosomal aberrations that could result in systemic phenotype. In addition, targeted next generation sequencing (NGS) was employed to determine any possible involvement of X-linked syndromic and non-syndromic mental retardation genes. This NGS panel consisted of 550 genes implicated in several other rare inherited diseases. RS1 gene screening revealed a pathogenic hemizygous splice site mutation (c.78+1G>T), inherited from the mother. SNP 6.0 array analysis did not indicate any significant chromosomal aberrations that could be disease-associated. Targeted resequencing did not identify any mutations in the X-linked mental retardation genes. However, variations in three other genes (NSD1, LARGE, and POLG) were detected, which were all inherited from the patient's unaffected father. Taken together, RS1 mutation was found to segregate with retinoschisis phenotype while none of the other identified variations were co-segregating with the systemic defects. Hereby, we infer that the multisystemic defects harbored by the patient are a rare coexistence of XLRS, developmental delay, sensorineural hearing loss, and reduced axial tone reported for the first time in the literature.

Stage-specific apoptosis, developmental delay, and embryonic lethality in mice homozygous for a targeted disruption in the murine Bloom's syndrome gene.

PubMed

Chester, N; Kuo, F; Kozak, C; O'Hara, C D; Leder, P

1998-11-01

Bloom's syndrome is a human autosomal genetic disorder characterized at the cellular level by genome instability and increased sister chomatid exchanges (SCEs). Clinical features of the disease include proportional dwarfism and a predisposition to develop a wide variety of malignancies. The human BLM gene has been cloned recently and encodes a DNA helicase. Mouse embryos homozygous for a targeted mutation in the murine Bloom's syndrome gene (Blm) are developmentally delayed and die by embryonic day 13.5. The fact that the interrupted gene is the homolog of the human BLM gene was confirmed by its homologous sequence, its chromosomal location, and by demonstrating high numbers of SCEs in cultured murine Blm-/- fibroblasts. The proportional dwarfism seen in the human is consistent with the small size and developmental delay (12-24 hr) seen during mid-gestation in murine Blm-/- embryos. Interestingly, the growth retardation in mutant embryos can be accounted for by a wave of increased apoptosis in the epiblast restricted to early post-implantation embryogenesis. Mutant embryos do not survive past day 13.5, and at this time exhibit severe anemia. Red blood cells and their precursors from Blm-/- embryos are heterogeneous in appearance and have increased numbers of macrocytes and micronuclei. Both the apoptotic wave and the appearance of micronuclei in red blood cells are likely cellular consequences of damaged DNA caused by effects on replicating or segregating chromosomes.

DELAY OF GERMINATION1 (DOG1) regulates both seed dormancy and flowering time through microRNA pathways

PubMed Central

Huo, Heqiang; Wei, Shouhui; Bradford, Kent J.

2016-01-01

Seed germination and flowering, two critical developmental transitions in plant life cycles, are coordinately regulated by genetic and environmental factors to match plant establishment and reproduction to seasonal cues. The DELAY OF GERMINATION1 (DOG1) gene is involved in regulating seed dormancy in response to temperature and has also been associated genetically with pleiotropic flowering phenotypes across diverse Arabidopsis thaliana accessions and locations. Here we show that DOG1 can regulate seed dormancy and flowering times in lettuce (Lactuca sativa, Ls) and Arabidopsis through an influence on levels of microRNAs (miRNAs) miR156 and miR172. In lettuce, suppression of LsDOG1 expression enabled seed germination at high temperature and promoted early flowering in association with reduced miR156 and increased miR172 levels. In Arabidopsis, higher miR156 levels resulting from overexpression of the MIR156 gene enhanced seed dormancy and delayed flowering. These phenotypic effects, as well as conversion of MIR156 transcripts to miR156, were compromised in DOG1 loss-of-function mutant plants, especially in seeds. Overexpression of MIR172 reduced seed dormancy and promoted early flowering in Arabidopsis, and the effect on flowering required functional DOG1. Transcript levels of several genes associated with miRNA processing were consistently lower in dry seeds of Arabidopsis and lettuce when DOG1 was mutated or its expression was reduced; in contrast, transcript levels of these genes were elevated in a DOG1 gain-of-function mutant. Our results reveal a previously unknown linkage between two critical developmental phase transitions in the plant life cycle through a DOG1–miR156–miR172 interaction. PMID:27035986

The 3111 Clock gene polymorphism is not associated with sleep and circadian rhythmicity in phenotypically characterized human subjects.

PubMed

Robilliard, Donna L; Archer, Simon N; Arendt, Josephine; Lockley, Steven W; Hack, Lisa M; English, Judie; Leger, Damien; Smits, Marcel G; Williams, Adrian; Skene, Debra J; Von Schantz, Malcolm

2002-12-01

Mutations in clock genes are associated with abnormal circadian parameters, including sleep. An association has been reported previously between a polymorphism (3111C), situated in the 3'-untranslated region (3'-UTR) of the circadian gene Clock and evening preference. In the present study, this polymorphism was assessed in: (1) 105 control subjects with defined diurnal preference, (2) 26 blind subjects with free-running circadian rhythms and characterized with regard to circadian period (tau) and (3) 16 delayed sleep phase syndrome patients. The control group was chosen from a larger population (n = 484) by Horne-Ostberg questionnaire analysis, from which three subgroups were selected (evening, intermediate and morning preference). Data from sleep diaries completed by 90% of these subjects showed a strong correlation between preferred and estimated timings of sleep and wake. The mean timings of activities for the evening group were at least 2 h later than the morning group. Genetic analysis showed that, in contrast with the previously published finding, there was no association between 3111C and eveningness. Neither was there an association between 3111C and tau, nor a significant difference in 3111C frequency between the normal and delayed sleep phase syndrome groups. To assess the effect of this polymorphism on messenger RNA (mRNA) translatability, luciferase reporter gene constructs containing the two Clock polymorphic variants in their 3'-UTR were transfected into COS-1 cells and luciferase activity measured. No significant difference was observed between the two variants. These results do not support Clock 3111C as a marker for diurnal preference, tau, or delayed sleep phase syndrome in humans.

Effects of early neonatal development and delayed feeding immediately post-hatch on the hepatic lipogenic program in broiler chicks.

PubMed

Richards, Mark P; Proszkowiec-Weglarz, Monika; Rosebrough, Robert W; McMurtry, John P; Angel, Roselina

2010-12-01

The embryo to neonate transition is a critical period of development that has significant impact on broiler production. During this time important genetic programs governing metabolism and growth are established. The goal of this work was to study the effects of early post-hatch (PH) development and the time of initiation of feeding on activation of the genetic program regulating hepatic lipogenesis. A comparison of liver total RNA samples at hatch and 7 days PH was performed using oligonucleotide-based (Affymetrix GeneChip®) chicken genome microarrays. During the first week PH there was significant up-regulation of key lipogenic genes including: ATP citrate lyase (ACL), malic enzyme (ME), fatty acid synthase (FAS), acetyl-CoA carboxylase alpha (ACCα), stearoyl-CoA desaturase-1 (SCD-1), sterol regulatory element binding protein-2 (SREBP-2) and thyroid hormone responsive spot 14α (Spot 14α) among others. These findings were confirmed using gene-specific RT-PCR assays. In a follow-up study, we investigated the effects of withholding feed for the first 48 h PH (delayed feeding, DF) on lipogenic gene expression through 8 days PH. Body weight gain was significantly depressed by DF. Plasma levels of the major metabolic hormones that regulate lipogenic gene expression (insulin, glucagon and T(3)) changed significantly during PH development, but were largely unaffected by DF. Plasma glucose was significantly lower in the DF group at 24h PH but recovered thereafter. In general, DF inhibited the up-regulation of lipogenic genes until feeding was initiated. Delayed up-regulation was also observed for the lipogenic transcription factor genes, SREBP-1, SREBP-2 and peroxisome proliferator-activated receptor gamma (PPARγ), but not for carbohydrate response element binding protein (ChREB) or liver X receptor (LXR). Our results offer additional insight into the transcriptional programming of hepatic lipogenesis in response to the transition from high fat (yolk) to high carbohydrate (feed) nutrition that occurs during early PH development. Published by Elsevier Inc.

Cytokinin delays dark-induced senescence in rice by maintaining the chlorophyll cycle and photosynthetic complexes.

PubMed

Talla, Sai Krishna; Panigrahy, Madhusmita; Kappara, Saivishnupriya; Nirosha, P; Neelamraju, Sarla; Ramanan, Rajeshwari

2016-03-01

The phytohormone cytokinin (CK) is known to delay senescence in plants. We studied the effect of a CK analog, 6-benzyl adenine (BA), on rice leaves to understand the possible mechanism by which CK delays senescence in a drought- and heat-tolerant rice cultivar Nagina22 (N22) using dark-induced senescence (DIS) as a surrogate for natural senescence of leaves. Leaves of N22-H-dgl162, a stay-green mutant of N22, and BA-treated N22 showed retention of chlorophyll (Chl) pigments, maintenance of the Chl a/b ratio, and delay in reduction of both photochemical efficiency and rate of oxygen evolution during DIS. HPLC analysis showed accumulation of 7-hydroxymethyl chlorophyll (HmChl) during DIS, and the kinetics of its accumulation correlated with progression of senescence. Transcriptome analysis revealed that several plastid-localized genes, specifically those associated with photosystem II (PSII), showed higher transcript levels in BA-treated N22 and the stay-green mutant leaves compared with naturally senescing N22 leaves. Real-time PCR analyses showed that genes coding for enzymes associated with Chl a/b interconversion and proteins associated with light-harvesting complexes maintained higher transcript levels up to 72h of DIS following BA treatment. The pigment-protein complexes analyzed by green gel remained intact in both N22-H-dgl162 and BA-treated N22 leaves even after 96h of DIS. Thus, CK delays senescence by accumulation of HmChl and up-regulating genes in the Chl cycle, thereby maintaining the Chl a/b ratio. Also, CK treatment retains higher transcript levels of PSII-related genes, resulting in the stability of photosynthetic pigment complexes and functional stay-greenness in rice. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Travelling waves in somitogenesis: Collective cellular properties emerge from time-delayed juxtacrine oscillation coupling.

PubMed

Tomka, Tomas; Iber, Dagmar; Boareto, Marcelo

2018-04-24

The sculpturing of the vertebrate body plan into segments begins with the sequential formation of somites in the presomitic mesoderm (PSM). The rhythmicity of this process is controlled by travelling waves of gene expression. These kinetic waves emerge from coupled cellular oscillators and sweep across the PSM. In zebrafish, the oscillations are driven by autorepression of her genes and are synchronized via Notch signalling. Mathematical modelling has played an important role in explaining how collective properties emerge from the molecular interactions. Increasingly more quantitative experimental data permits the validation of those mathematical models, yet leads to increasingly more complex model formulations that hamper an intuitive understanding of the underlying mechanisms. Here, we review previous efforts, and design a mechanistic model of the her1 oscillator, which represents the experimentally viable her7;hes6 double mutant. This genetically simplified system is ideally suited to conceptually recapitulate oscillatory entrainment and travelling wave formation, and to highlight open questions. It shows that three key parameters, the autorepression delay, the juxtacrine coupling delay, and the coupling strength, are sufficient to understand the emergence of the collective period, the collective amplitude, and the synchronization of neighbouring Her1 oscillators. Moreover, two spatiotemporal time delay gradients, in the autorepression and in the juxtacrine signalling, are required to explain the collective oscillatory dynamics and synchrony of PSM cells. The highlighted developmental principles likely apply more generally to other developmental processes, including neurogenesis and angiogenesis. Copyright © 2018. Published by Elsevier Ltd.

A functional variant of the serotonin transporter gene (SLC6A4) moderates impulsive choice in ADHD boys and siblings

PubMed Central

Sonuga-Barke, Edmund J. S.; Kumsta, Robert; Schlotz, Wolff; Lasky-Su, Jessica; Marco, Rafaela; Miranda, Ana; Mulas, Fernando; Oades, Robert D.; Banaschewski, Tobias; Mueller, Ueli; Andreou, Penny; Christiansen, Hanna; Gabriels, Isabel; Uebel, Henrik; Kuntsi, Jonna; Franke, Barbara; Buitelaar, Jan; Ebstein, Richard; Gill, Michael; Anney, Richard; Roeyers, Herbert; Rothenberger, Aribert; Sergeant, Joseph; Steinhausen, Hans Christoph; Asherson, Philip; Faraone, Stephen V.

2011-01-01

Background Impulsive drive for immediate reward (IDIR) and delay aversion are dissociable elements of the preference for immediate over delayed rewards seen in Attention Deficit/Hyperactivity Disorder (ADHD). We hypothesized that IDIR would be associated with dopamine regulating genes and delay aversion with serotonin regulating genes. Methods IDIR and delay aversion were measured in 459 male children and adolescents (328 ADHD and 131 unaffected siblings) using a laboratory choice task. The sample was genotyped for the 5HTT (SLC6A4) promoter 5-HTTLPR polymorphism and a DAT1 (SLC6A3) 40-base pair VNTR located in the 3`-untranslated region of the gene. Results There was no effect of DAT1 on IDIR. As predicted 5-HTTLPR s-allele carriers were more delay averse. This effect was driven by the s/l genotype in the ADHD group. These results were not altered by taking account of the rs25531 A/G SNP and were independent of age, IQ and ODD symptoms. Conclusions The results support the genetic distinctiveness of IDIR and delay aversion in ADHD and implicate serotonin function in delay aversion. Possible explanations of the heterosis effect in the ADHD cases are presented. PMID:21497794

Quantification of the effects of VRN1 and Ppd-D1 to predict spring wheat (Triticum aestivum) heading time across diverse environments

PubMed Central

Zheng, Bangyou; Biddulph, Ben; Li, Dora; Kuchel, Haydn; Chapman, Scott

2013-01-01

Heading time is a major determinant of the adaptation of wheat to different environments, and is critical in minimizing risks of frost, heat, and drought on reproductive development. Given that major developmental genes are known in wheat, a process-based model, APSIM, was modified to incorporate gene effects into estimation of heading time, while minimizing degradation in the predictive capability of the model. Model parameters describing environment responses were replaced with functions of the number of winter and photoperiod (PPD)-sensitive alleles at the three VRN1 loci and the Ppd-D1 locus, respectively. Two years of vernalization and PPD trials of 210 lines (spring wheats) at a single location were used to estimate the effects of the VRN1 and Ppd-D1 alleles, with validation against 190 trials (~4400 observations) across the Australian wheatbelt. Compared with spring genotypes, winter genotypes for Vrn-A1 (i.e. with two winter alleles) had a delay of 76.8 degree days (°Cd) in time to heading, which was double the effect of the Vrn-B1 or Vrn-D1 winter genotypes. Of the three VRN1 loci, winter alleles at Vrn-B1 had the strongest interaction with PPD, delaying heading time by 99.0 °Cd under long days. The gene-based model had root mean square error of 3.2 and 4.3 d for calibration and validation datasets, respectively. Virtual genotypes were created to examine heading time in comparison with frost and heat events and showed that new longer-season varieties could be heading later (with potential increased yield) when sown early in season. This gene-based model allows breeders to consider how to target gene combinations to current and future production environments using parameters determined from a small set of phenotyping treatments. PMID:23873997

Quantification of the effects of VRN1 and Ppd-D1 to predict spring wheat (Triticum aestivum) heading time across diverse environments.

PubMed

Zheng, Bangyou; Biddulph, Ben; Li, Dora; Kuchel, Haydn; Chapman, Scott

2013-09-01

Heading time is a major determinant of the adaptation of wheat to different environments, and is critical in minimizing risks of frost, heat, and drought on reproductive development. Given that major developmental genes are known in wheat, a process-based model, APSIM, was modified to incorporate gene effects into estimation of heading time, while minimizing degradation in the predictive capability of the model. Model parameters describing environment responses were replaced with functions of the number of winter and photoperiod (PPD)-sensitive alleles at the three VRN1 loci and the Ppd-D1 locus, respectively. Two years of vernalization and PPD trials of 210 lines (spring wheats) at a single location were used to estimate the effects of the VRN1 and Ppd-D1 alleles, with validation against 190 trials (~4400 observations) across the Australian wheatbelt. Compared with spring genotypes, winter genotypes for Vrn-A1 (i.e. with two winter alleles) had a delay of 76.8 degree days (°Cd) in time to heading, which was double the effect of the Vrn-B1 or Vrn-D1 winter genotypes. Of the three VRN1 loci, winter alleles at Vrn-B1 had the strongest interaction with PPD, delaying heading time by 99.0 °Cd under long days. The gene-based model had root mean square error of 3.2 and 4.3 d for calibration and validation datasets, respectively. Virtual genotypes were created to examine heading time in comparison with frost and heat events and showed that new longer-season varieties could be heading later (with potential increased yield) when sown early in season. This gene-based model allows breeders to consider how to target gene combinations to current and future production environments using parameters determined from a small set of phenotyping treatments.

Inference of time-delayed gene regulatory networks based on dynamic Bayesian network hybrid learning method

PubMed Central

Yu, Bin; Xu, Jia-Meng; Li, Shan; Chen, Cheng; Chen, Rui-Xin; Wang, Lei; Zhang, Yan; Wang, Ming-Hui

2017-01-01

Gene regulatory networks (GRNs) research reveals complex life phenomena from the perspective of gene interaction, which is an important research field in systems biology. Traditional Bayesian networks have a high computational complexity, and the network structure scoring model has a single feature. Information-based approaches cannot identify the direction of regulation. In order to make up for the shortcomings of the above methods, this paper presents a novel hybrid learning method (DBNCS) based on dynamic Bayesian network (DBN) to construct the multiple time-delayed GRNs for the first time, combining the comprehensive score (CS) with the DBN model. DBNCS algorithm first uses CMI2NI (conditional mutual inclusive information-based network inference) algorithm for network structure profiles learning, namely the construction of search space. Then the redundant regulations are removed by using the recursive optimization algorithm (RO), thereby reduce the false positive rate. Secondly, the network structure profiles are decomposed into a set of cliques without loss, which can significantly reduce the computational complexity. Finally, DBN model is used to identify the direction of gene regulation within the cliques and search for the optimal network structure. The performance of DBNCS algorithm is evaluated by the benchmark GRN datasets from DREAM challenge as well as the SOS DNA repair network in Escherichia coli, and compared with other state-of-the-art methods. The experimental results show the rationality of the algorithm design and the outstanding performance of the GRNs. PMID:29113310

Inference of time-delayed gene regulatory networks based on dynamic Bayesian network hybrid learning method.

PubMed

Yu, Bin; Xu, Jia-Meng; Li, Shan; Chen, Cheng; Chen, Rui-Xin; Wang, Lei; Zhang, Yan; Wang, Ming-Hui

2017-10-06

Gene regulatory networks (GRNs) research reveals complex life phenomena from the perspective of gene interaction, which is an important research field in systems biology. Traditional Bayesian networks have a high computational complexity, and the network structure scoring model has a single feature. Information-based approaches cannot identify the direction of regulation. In order to make up for the shortcomings of the above methods, this paper presents a novel hybrid learning method (DBNCS) based on dynamic Bayesian network (DBN) to construct the multiple time-delayed GRNs for the first time, combining the comprehensive score (CS) with the DBN model. DBNCS algorithm first uses CMI2NI (conditional mutual inclusive information-based network inference) algorithm for network structure profiles learning, namely the construction of search space. Then the redundant regulations are removed by using the recursive optimization algorithm (RO), thereby reduce the false positive rate. Secondly, the network structure profiles are decomposed into a set of cliques without loss, which can significantly reduce the computational complexity. Finally, DBN model is used to identify the direction of gene regulation within the cliques and search for the optimal network structure. The performance of DBNCS algorithm is evaluated by the benchmark GRN datasets from DREAM challenge as well as the SOS DNA repair network in Escherichia coli , and compared with other state-of-the-art methods. The experimental results show the rationality of the algorithm design and the outstanding performance of the GRNs.

Suppression of the vacuolar invertase gene delays senescent sweetening in chipping potatoes

USDA-ARS?s Scientific Manuscript database

Background: Potato chip processors require potato tubers that meet quality specifications for fried chip color, and color depends largely upon tuber sugar contents. At later times in storage, potatoes accumulate sucrose, glucose and fructose. This developmental process, senescent sweetening, manifes...

Pleiotropy in the wild: the dormancy gene DOG1 exerts cascading control on life cycles.

PubMed

Chiang, George C K; Barua, Deepak; Dittmar, Emily; Kramer, Elena M; de Casas, Rafael Rubio; Donohue, Kathleen

2013-03-01

In the wild, organismal life cycles occur within seasonal cycles, so shifts in the timing of developmental transitions can alter the seasonal environment experienced subsequently. Effects of genes that control the timing of prior developmental events can therefore be magnified in the wild because they determine seasonal conditions experienced by subsequent life stages, which can influence subsequent phenotypic expression. We examined such environmentally induced pleiotropy of developmental-timing genes in a field experiment with Arabidopsis thaliana. When studied in the field under natural seasonal variation, an A. thaliana seed-dormancy gene, Delay Of Germination 1 (DOG1), was found to influence not only germination, but also flowering time, overall life history, and fitness. Flowering time of the previous generation, in turn, imposed maternal effects that altered germination, the effects of DOG1 alleles, and the direction of natural selection on these alleles. Thus under natural conditions, germination genes act as flowering genes and potentially vice versa. These results illustrate how seasonal environmental variation can alter pleiotropic effects of developmental-timing genes, such that effects of genes that regulate prior life stages ramify to influence subsequent life stages. In this case, one gene acting at the seed stage impacted the entire life cycle. © 2012 The Author(s). Evolution© 2012 The Society for the Study of Evolution.

Does the transition into daylight saving time really cause partial sleep deprivation?

PubMed

Toth Quintilham, Manoel Carlos; Adamowicz, Taísa; Pereira, Erico Felden; Pedrazzoli, Mario; Louzada, Fernando Mazzilli

2014-01-01

To identify possible changes in the sleep patterns according to chronotype in undergraduate students during the daylight saving time (DST) transition. A total of 378 students answered the Morningness-Eveningness Questionnaire (MEQ) to determine their chronotype and kept a diary about sleep-wake schedules 1 week before and after the DST transition. Oral mucosal cell samples were collected for genetic analysis. After the DST transition, intermediate types (I-types) delayed bedtime and increased their time in bed and all groups delayed their wake-up time. All groups presented a shorter phase angle between sunset and the bedtime after the DST transition. On the other hand, only E-types showed a tendency to reduce the phase angle between sunrise and wake-up time, while I-types and M-types kept the same phase angles between sunrise and wake-up time after the DST transition. The polymorphisms in the human genes CLOCK and PER3 were not associated with individual differences in sleep patterns, nor were they associated with an adjustment to the DST transition. Under the new set of social times determined by DST, the adjustment was only partial. I-types delayed bedtime and all groups delayed their wake-up times after the beginning of DST. Consequently, the time in bed after the DST transition was not reduced; Morning (M-types) and Evening-types (E-types) kept the same time in bed and I-types showed an increase on it.

Histone deacetylases regulate multicellular development in the social amoeba Dictyostelium discoideum.

PubMed

Sawarkar, Ritwick; Visweswariah, Sandhya S; Nellen, Wolfgang; Nanjundiah, Vidyanand

2009-09-04

Epigenetic modifications of histones regulate gene expression and lead to the establishment and maintenance of cellular phenotypes during development. Histone acetylation depends on a balance between the activities of histone acetyltransferases and histone deacetylases (HDACs) and influences transcriptional regulation. In this study, we analyse the roles of HDACs during growth and development of one of the cellular slime moulds, the social amoeba Dictyostelium discoideum. The inhibition of HDAC activity by trichostatin A results in histone hyperacetylation and a delay in cell aggregation and differentiation. Cyclic AMP oscillations are normal in starved amoebae treated with trichostatin A but the expression of a subset of cAMP-regulated genes is delayed. Bioinformatic analysis indicates that there are four genes encoding putative HDACs in D. discoideum. Using biochemical, genetic and developmental approaches, we demonstrate that one of these four genes, hdaB, is dispensable for growth and development under laboratory conditions. A knockout of the hdaB gene results in a social context-dependent phenotype: hdaB(-) cells develop normally but sporulate less efficiently than the wild type in chimeras. We infer that HDAC activity is important for regulating the timing of gene expression during the development of D. discoideum and for defining aspects of the phenotype that mediate social behaviour in genetically heterogeneous groups.

Expression of the Nitrate Transporter Gene OsNRT1.1A/OsNPF6.3 Confers High Yield and Early Maturation in Rice.

PubMed

Wang, Wei; Hu, Bin; Yuan, Dingyang; Liu, Yongqiang; Che, Ronghui; Hu, Yingchun; Ou, Shujun; Liu, Yongxin; Zhang, Zhihua; Wang, Hongru; Li, Hua; Jiang, Zhimin; Zhang, Zhengli; Gao, Xiaokai; Qiu, Yahong; Meng, Xiangbing; Liu, Yongxin; Bai, Yang; Liang, Yan; Wang, Yiqin; Zhang, Lianhe; Li, Legong; Sodmergen; Jing, Haichun; Li, Jiayang; Chu, Chengcai

2018-03-01

Nitrogen (N) is a major driving force for crop yield improvement, but application of high levels of N delays flowering, prolonging maturation and thus increasing the risk of yield losses. Therefore, traits that enable utilization of high levels of N without delaying maturation will be highly desirable for crop breeding. Here, we show that OsNRT1.1A (OsNPF6.3), a member of the rice ( Oryza sativa ) nitrate transporter 1/peptide transporter family, is involved in regulating N utilization and flowering, providing a target to produce high yield and early maturation simultaneously. OsNRT.1A has functionally diverged from previously reported NRT1.1 genes in plants and functions in upregulating the expression of N utilization-related genes not only for nitrate but also for ammonium, as well as flowering-related genes. Relative to the wild type, osnrt1.1a mutants exhibited reduced N utilization and late flowering. By contrast, overexpression of OsNRT1.1A in rice greatly improved N utilization and grain yield, and maturation time was also significantly shortened. These effects were further confirmed in different rice backgrounds and also in Arabidopsis thaliana Our study paves a path for the use of a single gene to dramatically increase yield and shorten maturation time for crops, outcomes that promise to substantially increase world food security. © 2018 American Society of Plant Biologists. All rights reserved.

Expression of the Nitrate Transporter Gene OsNRT1.1A/OsNPF6.3 Confers High Yield and Early Maturation in Rice[OPEN

PubMed Central

Wang, Wei; Hu, Bin; Liu, Yongqiang; Che, Ronghui; Hu, Yingchun; Zhang, Zhihua; Wang, Hongru; Li, Hua; Jiang, Zhimin; Zhang, Zhengli; Gao, Xiaokai; Qiu, Yahong; Meng, Xiangbing; Liu, Yongxin; Bai, Yang; Liang, Yan; Wang, Yiqin; Zhang, Lianhe; Li, Legong; Sodmergen; Jing, Haichun

2018-01-01

Nitrogen (N) is a major driving force for crop yield improvement, but application of high levels of N delays flowering, prolonging maturation and thus increasing the risk of yield losses. Therefore, traits that enable utilization of high levels of N without delaying maturation will be highly desirable for crop breeding. Here, we show that OsNRT1.1A (OsNPF6.3), a member of the rice (Oryza sativa) nitrate transporter 1/peptide transporter family, is involved in regulating N utilization and flowering, providing a target to produce high yield and early maturation simultaneously. OsNRT.1A has functionally diverged from previously reported NRT1.1 genes in plants and functions in upregulating the expression of N utilization-related genes not only for nitrate but also for ammonium, as well as flowering-related genes. Relative to the wild type, osnrt1.1a mutants exhibited reduced N utilization and late flowering. By contrast, overexpression of OsNRT1.1A in rice greatly improved N utilization and grain yield, and maturation time was also significantly shortened. These effects were further confirmed in different rice backgrounds and also in Arabidopsis thaliana. Our study paves a path for the use of a single gene to dramatically increase yield and shorten maturation time for crops, outcomes that promise to substantially increase world food security. PMID:29475937

Measuring Information-Transfer Delays

PubMed Central

Wibral, Michael; Pampu, Nicolae; Priesemann, Viola; Siebenhühner, Felix; Seiwert, Hannes; Lindner, Michael; Lizier, Joseph T.; Vicente, Raul

2013-01-01

In complex networks such as gene networks, traffic systems or brain circuits it is important to understand how long it takes for the different parts of the network to effectively influence one another. In the brain, for example, axonal delays between brain areas can amount to several tens of milliseconds, adding an intrinsic component to any timing-based processing of information. Inferring neural interaction delays is thus needed to interpret the information transfer revealed by any analysis of directed interactions across brain structures. However, a robust estimation of interaction delays from neural activity faces several challenges if modeling assumptions on interaction mechanisms are wrong or cannot be made. Here, we propose a robust estimator for neuronal interaction delays rooted in an information-theoretic framework, which allows a model-free exploration of interactions. In particular, we extend transfer entropy to account for delayed source-target interactions, while crucially retaining the conditioning on the embedded target state at the immediately previous time step. We prove that this particular extension is indeed guaranteed to identify interaction delays between two coupled systems and is the only relevant option in keeping with Wiener’s principle of causality. We demonstrate the performance of our approach in detecting interaction delays on finite data by numerical simulations of stochastic and deterministic processes, as well as on local field potential recordings. We also show the ability of the extended transfer entropy to detect the presence of multiple delays, as well as feedback loops. While evaluated on neuroscience data, we expect the estimator to be useful in other fields dealing with network dynamics. PMID:23468850

Impacts of the phenylpyrazole insecticide fipronil on larval fish: time-series gene transcription responses in fathead minnow (Pimephales promelas) following short-term exposure.

PubMed

Beggel, Sebastian; Werner, Inge; Connon, Richard E; Geist, Juergen P

2012-06-01

The utilization of molecular endpoints in ecotoxicology can provide rapid and valuable information on immediate organismal responses to chemical stressors and is increasingly used for mechanistic interpretation of effects at higher levels of biological organization. This study contributes knowledge on the sublethal effects of a commonly used insecticide, the phenylpyrazole fipronil, on larval fathead minnow (Pimephales promelas), utilizing a quantitative transcriptomic approach. Immediately after 24h of exposure to fipronil concentrations of ≥31 μg.L(-1), highly significant changes in gene transcription were observed for aspartoacylase, metallothionein, glucocorticoid receptor, cytochrome P450 3A126 and vitellogenin. Different mechanisms of toxicity were apparent over the course of the experiment, with short-term responses indicating neurotoxic effects. After 6 days of recovery, endocrine effects were observed with vitellogenin being up-regulated 90-fold at 61 μg.L(-1) fipronil. Principal component analysis demonstrated a significant increase in gene transcription changes over time and during the recovery period. In conclusion, multiple mechanisms of action were observed in response to fipronil exposure, and unknown delayed effects would have been missed if transcriptomic responses had only been measured at a single time-point. These challenges can be overcome by the inclusion of multiple endpoints and delayed effects in experimental designs. Copyright © 2012 Elsevier B.V. All rights reserved.

CK1/Doubletime activity delays transcription activation in the circadian clock

PubMed Central

O'Neil, Jenna L; Merz, Gregory E; Dusad, Kritika; Crane, Brian R; Young, Michael W

2018-01-01

In the Drosophila circadian clock, Period (PER) and Timeless (TIM) proteins inhibit Clock-mediated transcription of per and tim genes until PER is degraded by Doubletime/CK1 (DBT)-mediated phosphorylation, establishing a negative feedback loop. Multiple regulatory delays within this feedback loop ensure ~24 hr periodicity. Of these delays, the mechanisms that regulate delayed PER degradation (and Clock reactivation) remain unclear. Here we show that phosphorylation of certain DBT target sites within a central region of PER affect PER inhibition of Clock and the stability of the PER/TIM complex. Our results indicate that phosphorylation of PER residue S589 stabilizes and activates PER inhibitory function in the presence of TIM, but promotes PER degradation in its absence. The role of DBT in regulating PER activity, stabilization and degradation ensures that these events are chronologically and biochemically linked, and contributes to the timing of an essential delay that influences the period of the circadian clock. PMID:29611807

Banana MaMADS Transcription Factors Are Necessary for Fruit Ripening and Molecular Tools to Promote Shelf-Life and Food Security1[OPEN

PubMed Central

Elitzur, Tomer; Yakir, Esther; Quansah, Lydia; Zhangjun, Fei; Vrebalov, Julia; Khayat, Eli; Giovannoni, James J.

2016-01-01

Genetic solutions to postharvest crop loss can reduce cost and energy inputs while increasing food security, especially for banana (Musa acuminata), which is a significant component of worldwide food commerce. We have functionally characterized two banana E class (SEPALLATA3 [SEP3]) MADS box genes, MaMADS1 and MaMADS2, homologous to the tomato (Solanum lycopersicum) RIN-MADS ripening gene. Transgenic banana plants repressing either gene (via antisense or RNA interference [RNAi]) were created and exhibited specific ripening delay and extended shelf-life phenotypes, including delayed color development and softening. The delay in fruit ripening is associated with a delay in climacteric respiration and reduced synthesis of the ripening hormone ethylene; in the most severe repressed lines, no ethylene was produced and ripening was most delayed. Unlike tomato rin mutants, banana fruits of all transgenic repression lines responded to exogenous ethylene by ripening normally, likely due to incomplete transgene repression and/or compensation by other MADS box genes. Our results show that, although MADS box ripening gene necessity is conserved across diverse taxa (monocots to dicots), unlike tomato, banana ripening requires at least two necessary members of the SEPALLATA MADS box gene group, and either can serve as a target for ripening control. The utility of such genes as tools for ripening control is especially relevant in important parthenocarpic crops such as the vegetatively propagated and widely consumed Cavendish banana, where breeding options for trait improvement are severely limited. PMID:26956665

Banana MaMADS Transcription Factors Are Necessary for Fruit Ripening and Molecular Tools to Promote Shelf-Life and Food Security.

PubMed

Elitzur, Tomer; Yakir, Esther; Quansah, Lydia; Zhangjun, Fei; Vrebalov, Julia; Khayat, Eli; Giovannoni, James J; Friedman, Haya

2016-05-01

Genetic solutions to postharvest crop loss can reduce cost and energy inputs while increasing food security, especially for banana (Musa acuminata), which is a significant component of worldwide food commerce. We have functionally characterized two banana E class (SEPALLATA3 [SEP3]) MADS box genes, MaMADS1 and MaMADS2, homologous to the tomato (Solanum lycopersicum) RIN-MADS ripening gene. Transgenic banana plants repressing either gene (via antisense or RNA interference [RNAi]) were created and exhibited specific ripening delay and extended shelf-life phenotypes, including delayed color development and softening. The delay in fruit ripening is associated with a delay in climacteric respiration and reduced synthesis of the ripening hormone ethylene; in the most severe repressed lines, no ethylene was produced and ripening was most delayed. Unlike tomato rin mutants, banana fruits of all transgenic repression lines responded to exogenous ethylene by ripening normally, likely due to incomplete transgene repression and/or compensation by other MADS box genes. Our results show that, although MADS box ripening gene necessity is conserved across diverse taxa (monocots to dicots), unlike tomato, banana ripening requires at least two necessary members of the SEPALLATA MADS box gene group, and either can serve as a target for ripening control. The utility of such genes as tools for ripening control is especially relevant in important parthenocarpic crops such as the vegetatively propagated and widely consumed Cavendish banana, where breeding options for trait improvement are severely limited. © 2016 American Society of Plant Biologists. All Rights Reserved.

A functional variant of the serotonin transporter gene (SLC6A4) moderates impulsive choice in attention-deficit/hyperactivity disorder boys and siblings.

PubMed

Sonuga-Barke, Edmund J S; Kumsta, Robert; Schlotz, Wolff; Lasky-Su, Jessica; Marco, Rafaela; Miranda, Ana; Mulas, Fernando; Oades, Robert D; Banaschewski, Tobias; Mueller, Ueli; Andreou, Penny; Christiansen, Hanna; Gabriels, Isabel; Uebel, Henrik; Kuntsi, Jonna; Franke, Barbara; Buitelaar, Jan; Ebstein, Richard; Gill, Michael; Anney, Richard; Roeyers, Herbert; Rothenberger, Aribert; Sergeant, Joseph; Steinhausen, Hans Christoph; Asherson, Philip; Faraone, Stephen V

2011-08-01

Impulsive drive for immediate reward (IDIR) and delay aversion are dissociable elements of the preference for immediate over delayed rewards seen in attention-deficit/hyperactivity disorder (ADHD). We hypothesized that IDIR would be associated with dopamine regulating genes and delay aversion would be associated with serotonin-regulating genes. Impulsive drive for immediate reward and delay aversion were measured in 459 male children and adolescents (328 ADHD and 131 unaffected siblings) with a laboratory choice task. The sample was genotyped for the 5HTT (SLC6A4) promoter serotonin-transporter-linked polymorphic region polymorphism and a DAT1 (SLC6A3) 40-base pair variable number tandem repeat located in the 3'-untranslated region of the gene. There was no effect of dopamine transporter (DAT)1 on IDIR. As predicted, serotonin-transporter-linked polymorphic region s-allele carriers were more delay averse. This effect was driven by the s/l genotype in the ADHD group. These results were not altered by taking account of the rs25531 A/G single nucleotide polymorphism and were independent of age, IQ, and oppositional defiant disorder symptoms. The results support the genetic distinctiveness of IDIR and delay aversion in ADHD and implicate serotonin function in delay aversion. Possible explanations of the heterosis effect in the ADHD cases are presented. Copyright © 2011 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Duplication of 17(p11.2p11.2) in a male child with autism and severe language delay.

PubMed

Nakamine, Alisa; Ouchanov, Leonid; Jiménez, Patricia; Manghi, Elina R; Esquivel, Marcela; Monge, Silvia; Fallas, Marietha; Burton, Barbara K; Szomju, Barbara; Elsea, Sarah H; Marshall, Christian R; Scherer, Stephen W; McInnes, L Alison

2008-03-01

Duplications of 17(p11.2p11.2) have been associated with various behavioral manifestations including attention deficits, obsessive-compulsive symptoms, autistic traits, and language delay. We are conducting a genetic study of autism and are screening all cases for submicroscopic chromosomal abnormalities, in addition to standard karyotyping, and fragile X testing. Using array-based comparative genomic hybridization analysis of data from the Affymetrix GeneChip(R) Human Mapping Array set, we detected a duplication of approximately 3.3 Mb on chromosome 17p11.2 in a male child with autism and severe expressive language delay. The duplication was confirmed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Gene expression analyses revealed increased expression of three candidate genes for the Smith-Magenis neurobehavioral phenotype, RAI1, DRG2, and RASD1, in transformed lymphocytes from Case 81A, suggesting gene dosage effects. Our results add to a growing body of evidence suggesting that duplications of 17(p11.2p11.2) result in language delay as well as autism and related phenotypes. As Smith-Magenis syndrome is also associated with language delay, a gene involved in acquisition of language may lie within this interval. Whether a parent of origin effect, gender of the case, the presence of allelic variation, or changes in expression of genes outside the breakpoints influence the resultant phenotype remains to be determined. (c) 2007 Wiley-Liss, Inc.

The WNT2 Gene Polymorphism Associated with Speech Delay Inherent to Autism

ERIC Educational Resources Information Center

Lin, Ping-I; Chien, Yi-Ling; Wu, Yu-Yu; Chen, Chia-Hsiang; Gau, Susan Shur-Fen; Huang, Yu-Shu; Liu, Shih-Kai; Tsai, Wen-Che; Chiu, Yen-Nan

2012-01-01

Previous evidence suggests that language function is modulated by genetic variants on chromosome 7q31-36. However, it is unclear whether this region harbors loci that contribute to speech delay in autism. We previously reported that the WNT2 gene located on 7q31 was associated with the risk of autism. Additionally, two other genes on 7q31-36,…

Transcriptome changes associated with delayed flower senescence on transgenic petunia by inducing expression of etr1-1, a mutant ethylene receptor.

PubMed

Wang, Hong; Stier, Genevieve; Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, 'the regulation of transcription' was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death.

Transcriptome Changes Associated with Delayed Flower Senescence on Transgenic Petunia by Inducing Expression of etr1-1, a Mutant Ethylene Receptor

PubMed Central

Lin, Jing; Liu, Gang; Zhang, Zhen; Chang, Youhong; Reid, Michael S.; Jiang, Cai-Zhong

2013-01-01

Flowers of ethylene-sensitive ornamental plants transformed with ethylene-insensitive 1-1(etr1-1), a mutant ethylene receptor first isolated from Arabidopsis, are known to have longer shelf lives. We have generated petunia plants in which the etr1-1 gene was over-expressed under the control of a chemically-inducible promoter, which would allow expression of etr1-1 to be initiated at the desired time and stage of development. Here, we showed that transgenic plants grew and developed normally without a chemical inducer. Semi-quantitative RT-PCR demonstrated that the abundance of transcripts of Arabidopsis etr1-1 gene was substantially induced in flowers with 30 μM dexamethasone (DEX). Consequently, t he life of the flowers was almost doubled and the peak of ethylene production was delayed. We compared gene expression changes of petals with DEX to those without DEX at 24 h and 48 h by microarray. Our results indicated that transcripts of many putative genes encoding transcription factors were down-regulated by etr1-1 induced expression at the early stage. In addition, putative genes involved in gibberellin biosynthesis, response to jasmonic acid/gibberellins stimulus, cell wall modification, ethylene biosynthesis, and cell death were down-regulated associating with etr1-1 induced expression. We investigated time-course gene expression profiles and found two profiles which displayed totally opposite expression patterns under these two treatments. In these profiles, ‘the regulation of transcription’ was predominant in GO categories. Taking all results together, we concluded those transcription factors down-regulated at early stage might exert a major role in regulating the senescence process which were consequently characterized by cell wall modification and cell death. PMID:23874385

Transcriptional profiling reveals regulated genes in the hippocampus during memory formation

NASA Technical Reports Server (NTRS)

Donahue, Christine P.; Jensen, Roderick V.; Ochiishi, Tomoyo; Eisenstein, Ingrid; Zhao, Mingrui; Shors, Tracey; Kosik, Kenneth S.

2002-01-01

Transcriptional profiling (TP) offers a powerful approach to identify genes activated during memory formation and, by inference, the molecular pathways involved. Trace eyeblink conditioning is well suited for the study of regional gene expression because it requires the hippocampus, whereas the highly parallel task, delay conditioning, does not. First, we determined when gene expression was most regulated during trace conditioning. Rats were exposed to 200 trials per day of paired and unpaired stimuli each day for 4 days. Changes in gene expression were most apparent 24 h after exposure to 200 trials. Therefore, we profiled gene expression in the hippocampus 24 h after 200 trials of trace eyeblink conditioning, on multiple arrays using additional animals. Of 1,186 genes on the filter array, seven genes met the statistical criteria and were also validated by real-time polymerase chain reaction. These genes were growth hormone (GH), c-kit receptor tyrosine kinase (c-kit), glutamate receptor, metabotropic 5 (mGluR5), nerve growth factor-beta (NGF-beta), Jun oncogene (c-Jun), transmembrane receptor Unc5H1 (UNC5H1), and transmembrane receptor Unc5H2 (UNC5H2). All these genes, except for GH, were downregulated in response to trace conditioning. GH was upregulated; therefore, we also validated the downregulation of the GH inhibitor, somatostatin (SST), even though it just failed to meet criteria on the arrays. By during situ hybridization, GH was expressed throughout the cell layers of the hippocampus in response to trace conditioning. None of the genes regulated in trace eyeblink conditioning were similarly affected by delay conditioning, a task that does not require the hippocampus. These findings demonstrate that transcriptional profiling can exhibit a repertoire of genes sensitive to the formation of hippocampal-dependent associative memories.

Influence of hatch time and access to feed on intramuscular adipose tissue deposition in broilers.

PubMed

Powell, D J; Velleman, S G; Cowieson, A J; Singh, M; Muir, W I

2016-06-01

The effect of hatch time and subsequent access to feed on intramuscular adipose tissue deposition was studied in the pectoralis major muscle of male Ross 308 broiler chickens. Based on their hatch time chicks were classified as early (EH), midterm (MH), or late (LH) hatchers, with an average incubation duration of 497.7 h for EH, 508.8 h for MH, and 514.5 h for LH birds. Chicks were provided access to feed either immediately at hatch, or 24 h after the conclusion of the hatch window. Expression of the adipogenic regulatory genes peroxisome proliferator-activated receptor gamma (PPARγ), and stearoyl-CoA desaturase (SCD), were measured at the time of hatch, and zero, one, 4, 7, 28, and 40 d. Intramuscular adipocyte cell width and visualization of adipose tissue deposition was observed at 28 and 40 d. Expression of PPARγ was increased in the pectoralis major of LH birds at the time of hatch, zero, and one d. The expression of PPARγ at one and 7 d, and SCD at 7 d were increased in all birds that received delayed access to feed. At 28 d, adipocyte cell width was increased in LH birds with delayed access to feed, compared to EH and MH birds with delayed access to feed and LH birds with immediate access to feed. At 40 d, adipocyte cell width was increased in all birds that received delayed access to feed. Also at 40 d, there was a trend (P = 0.078) for more extensive intramuscular adipose tissue deposition in LH than EH birds, and in birds with delayed access to feed (P = 0.075). These data indicate delayed access to feed increases intramuscular adipose tissue deposition in the pectoralis major muscle, and suggest that hatch time influences this regulation. © 2016 Poultry Science Association Inc.

Combining Selective Pressures to Enhance the Durability of Disease Resistance Genes.

PubMed

2016-01-01

The efficacy of disease resistance genes in plants decreases over time because of the selection of virulent pathogen genotypes. A key goal of crop protection programs is to increase the durability of the resistance conferred by these genes. The spatial and temporal deployment of plant disease resistance genes is considered to be a major factor determining their durability. In the literature, four principal strategies combining resistance genes over time and space have been considered to delay the evolution of virulent pathogen genotypes. We reviewed this literature with the aim of determining which deployment strategy results in the greatest durability of resistance genes. Although theoretical and empirical studies comparing deployment strategies of more than one resistance gene are very scarce, they suggest that the overall durability of disease resistance genes can be increased by combining their presence in the same plant (pyramiding). Retrospective analyses of field monitoring data also suggest that the pyramiding of disease resistance genes within a plant is the most durable strategy. By extension, we suggest that the combination of disease resistance genes with other practices for pathogen control (pesticides, farming practices) may be a relevant management strategy to slow down the evolution of virulent pathogen genotypes.

Mice Deficient in Surfactant Protein A (SP-A) and SP-D or in TLR2 Manifest Delayed Parturition and Decreased Expression of Inflammatory and Contractile Genes

PubMed Central

Montalbano, Alina P.; Hawgood, Samuel

2013-01-01

Previously we obtained compelling evidence that the fetus provides a critical signal for the initiation of term labor through developmental induction of surfactant protein (SP)-A expression by the fetal lung and secretion into amniotic fluid (AF). We proposed that interactions of AF macrophage (Mφ) Toll-like receptors (TLRs) with SP-A, at term, or bacterial components, at preterm, result in their activation and migration to the pregnant uterus. Herein the timing of labor in wild-type (WT) C57BL/6 mice was compared with mice homozygous null for TLR2, SP-A, SP-D, or doubly deficient in SP-A and SP-D. Interestingly, TLR2−/− females manifested a significant (P < 0.001) delay in timing of labor compared with WT as well as reduced expression of the myometrial contraction-associated protein (CAP) gene, connexin-43, and Mφ marker, F4/80, at 18.5 d postcoitum (dpc). Whereas in first pregnancies, SP-A−/−, SP-D−/−, and SP-A/D−/− females delivered at term (∼19.5 dpc), in second pregnancies, parturition was delayed by approximately 12 h in SP-A−/− (P = 0.07) and in SP-A/D−/− (P <0.001) females. Myometrium of SP-A/D−/− females expressed significantly lower levels of IL-1β, IL-6, and CAP genes, connexin-43, and oxytocin receptor at 18.5 dpc compared with WT. F4/80+ AF Mφs from TLR2−/− and SP-A/D−/− mice expressed significantly lower levels of both proinflammatory and antiinflammatory activation markers (e.g. IL-1β, IL-6, ARG1, YM1) compared with gestation-matched WT AF Mφs. These novel findings suggest that the pulmonary collectins acting via TLR2 serve a modulatory role in the timing of labor; their relative impact may be dependent on parity. PMID:23183169

An essential role for the RNA-binding protein Smaug during the Drosophila maternal-to-zygotic transition.

PubMed

Benoit, Beatrice; He, Chun Hua; Zhang, Fan; Votruba, Sarah M; Tadros, Wael; Westwood, J Timothy; Smibert, Craig A; Lipshitz, Howard D; Theurkauf, William E

2009-03-01

Genetic control of embryogenesis switches from the maternal to the zygotic genome during the maternal-to-zygotic transition (MZT), when maternal mRNAs are destroyed, high-level zygotic transcription is initiated, the replication checkpoint is activated and the cell cycle slows. The midblastula transition (MBT) is the first morphological event that requires zygotic gene expression. The Drosophila MBT is marked by blastoderm cellularization and follows 13 cleavage-stage divisions. The RNA-binding protein Smaug is required for cleavage-independent maternal transcript destruction during the Drosophila MZT. Here, we show that smaug mutants also disrupt syncytial blastoderm stage cell-cycle delays, DNA replication checkpoint activation, cellularization, and high-level zygotic expression of protein coding and micro RNA genes. We also show that Smaug protein levels increase through the cleavage divisions and peak when the checkpoint is activated and zygotic transcription initiates, and that transgenic expression of Smaug in an anterior-to-posterior gradient produces a concomitant gradient in the timing of maternal transcript destruction, cleavage cell cycle delays, zygotic gene transcription, cellularization and gastrulation. Smaug accumulation thus coordinates progression through the MZT.

Neuronal Susceptibility to GRIM in Drosophila melanogaster Measures the Rate of Genetic Changes that Scale to Lifespan

PubMed Central

Bedoukian, Matthew A.; Rodriguez, Sarah M.; Cohen, Matthew B.; Duncan Smith, Stuart V.; Park, Jennifer

2009-01-01

Gene expression in Drosophila melanogaster changes significantly throughout life and some of these changes can be delayed by lowering ambient temperature and also by dietary restriction. These two interventions are known to slow the rate of aging as well as the accumulation of damage. It is unknown, however, whether gene expression changes that occur during development and early adult life make an animal more vulnerable to death. Here we develop a method capable of measuring the rate of programmed genetic changes during young adult life in Drosophila melanogaster and show that these changes can be delayed or accelerated in a manner that is predictive of longevity. We show that temperature shifts and dietary restriction, which slow the rate of aging in Drosophila melanogaster, extend the window of neuronal susceptibility to GRIM over-expression in a way that scales to lifespan. We propose that this susceptibility can be used to test compounds and genetic manipulations that alter the onset of senescence by changing the programmed timing of gene expression that correlates and may be causal to aging. PMID:19428445

SPL13 regulates shoot branching and flowering time in Medicago sativa.

PubMed

Gao, Ruimin; Gruber, Margaret Y; Amyot, Lisa; Hannoufa, Abdelali

2018-01-01

Our results show SPL13 plays a crucial role in regulating vegetative and reproductive development in Medicago sativa L. (alfalfa), and that MYB112 is targeted and downregulated by SPL13 in alfalfa. We previously showed that transgenic Medicago sativa (alfalfa) plants overexpressing microRNA156 (miR156) show a bushy phenotype, reduced internodal length, delayed flowering time, and enhanced biomass yield. In alfalfa, transcripts of seven SQUAMOSA-PROMOTER BINDING PROTEIN-LIKE (SPL) transcription factors, including SPL13, are targeted for cleavage by miR156. Thus, association of each target SPL gene to a trait or set of traits is essential for developing molecular markers for alfalfa breeding. In this study, we investigated SPL13 function using SPL13 overexpression and silenced alfalfa plants. Severe growth retardation, distorted branches and up-curled leaves were observed in miR156-impervious 35S::SPL13m over-expression plants. In contrast, more lateral branches and delayed flowering time were observed in SPL13 silenced plants. SPL13 transcripts were predominantly present in the plant meristems, indicating that SPL13 is involved in regulating shoot branch development. Accordingly, the shoot branching-related CAROTENOID CLEAVAGE DIOXYGENASE 8 gene was found to be significantly downregulated in SPL13 RNAi silencing plants. A R2R3-MYB gene MYB112 was also identified as being directly silenced by SPL13 based on Next Generation Sequencing-mediated transcriptome analysis and chromatin immunoprecipitation assays, suggesting that MYB112 may be involved in regulating alfalfa vegetative growth.

Neurokinin B is critical for normal timing of sexual maturation but dispensable for adult reproductive function in female mice.

PubMed

True, Cadence; Nasrin Alam, Sayeda; Cox, Kimberly; Chan, Yee-Ming; Seminara, Stephanie B

2015-04-01

Humans carrying mutations in neurokinin B (NKB) or the NKB receptor fail to undergo puberty due to decreased secretion of GnRH. Despite this pubertal delay, many of these patients go on to achieve activation of their hypothalamic-pituitary-gonadal axis in adulthood, a phenomenon termed reversal, indicating that NKB signaling may play a more critical role for the timing of pubertal development than adult reproductive function. NKB receptor-deficient mice are hypogonadotropic but have no defects in the timing of sexual maturation. The current study has performed the first phenotypic evaluation of mice bearing mutations in Tac2, the gene encoding the NKB ligand, to determine whether they have impaired sexual development similar to their human counterparts. Male Tac2-/- mice showed no difference in the timing of sexual maturation or fertility compared with wild-type littermates and were fertile. In contrast, Tac2-/- females had profound delays in sexual maturation, with time to vaginal opening and first estrus occurring significantly later than controls, and initial abnormalities in estrous cycles. However, cycling recovered in adulthood and Tac2-/- females were fertile, although they produced fewer pups per litter. Thus, female Tac2-/- mice parallel humans harboring NKB pathway mutations, with delayed sexual maturation and activation of the reproductive cascade later in life. Moreover, direct comparison of NKB ligand and receptor-deficient females confirmed that only NKB ligand-deficient animals have delayed sexual maturation, suggesting that in the absence of the NKB receptor, NKB may regulate the timing of sexual maturation through other tachykinin receptors.

REVIEW ARTICLE: Oscillations and temporal signalling in cells

NASA Astrophysics Data System (ADS)

Tiana, G.; Krishna, S.; Pigolotti, S.; Jensen, M. H.; Sneppen, K.

2007-06-01

The development of new techniques to quantitatively measure gene expression in cells has shed light on a number of systems that display oscillations in protein concentration. Here we review the different mechanisms which can produce oscillations in gene expression or protein concentration using a framework of simple mathematical models. We focus on three eukaryotic genetic regulatory networks which show 'ultradian' oscillations, with a time period of the order of hours, and involve, respectively, proteins important for development (Hes1), apoptosis (p53) and immune response (NF-κB). We argue that underlying all three is a common design consisting of a negative feedback loop with time delay which is responsible for the oscillatory behaviour.

Effects of trimethoprim on life history parameters, oxidative stress, and the expression of cytochrome P450 genes in the copepod Tigriopus japonicus.

PubMed

Han, Jeonghoon; Lee, Min-Chul; Kim, Duck-Hyun; Lee, Young Hwan; Park, Jun Chul; Lee, Jae-Seong

2016-09-01

Trimethoprim (TMP) is an antibiotic that has been detected in various environments including marine habitats; however, the toxic effects of TMP are poorly understood in non-target marine organisms. In this study, the effects of TMP on mortality, development, reproduction, intracellular reactive oxygen species (ROS) levels, and transcription levels of antioxidant and xenobiotic detoxification-related enzyme genes were investigated in the copepod Tigriopus japonicus. The TMP half lethal dose at 48 h (LC50-48 h) in nauplius and TMP LC50-96 h in adult T. japonicus copepods was determined as 156 mg/L and 200 mg/L, respectively. In TMP-exposed T. japonicus, delayed developmental time and impaired reproduction were observed as harmful effects on the life history parameters. Increased ROS levels were also shown in response to TMP exposure at the highest concentration (100 mg/L TMP) and the expression of antioxidant- (e.g. GST-kappa, GST-sigma) and xenobiotic detoxification (e.g. CYPs)-related genes were upregulated in a time and/or dose-dependent manner in response to TMP. Particularly, significant upregulation of three CYP genes (Tj-CYP3024A2, Tj-CYP3024A3 and Tj-CYP3027C2) were examined, suggesting that these CYP genes are likely playing an important role in the TMP detoxification metabolism in T. japonicus. In summary, we found that TMP induced oxidative stress via the transcriptional regulation of antioxidant- and xenobiotic detoxification-related genes, leading to changes in life history parameters such as developmental delay and reproduction impairment. Three Tj-CYP genes (Tj-CYP3024A2, Tj-CYP3024A3 and Tj-CYP3027C2) could be useful as potential T. japonicus biomarkers in response to antibiotics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Acute and delayed neuroinflammatory response following experimental penetrating ballistic brain injury in the rat

PubMed Central

Williams, Anthony J; Wei, Hans H; Dave, Jitendra R; Tortella, Frank C

2007-01-01

Background Neuroinflammation following acute brain trauma is considered to play a prominent role in both the pathological and reconstructive response of the brain to injury. Here we characterize and contrast both an acute and delayed phase of inflammation following experimental penetrating ballistic brain injury (PBBI) in rats out to 7 days post-injury. Methods Quantitative real time PCR (QRT-PCR) was used to evaluate changes in inflammatory gene expression from the brain tissue of rats exposed to a unilateral frontal PBBI. Brain histopathology was assessed using hematoxylin and eosin (H&E), silver staining, and immunoreactivity for astrocytes (GFAP), microglia (OX-18) and the inflammatory proteins IL-1β and ICAM-1. Results Time course analysis of gene expression levels using QRT-PCR indicated a peak increase during the acute phase of the injury between 3–6 h for the cytokines TNF-α (8–11 fold), IL-1β (11–13 fold), and IL-6 (40–74 fold) as well as the cellular adhesion molecules VCAM (2–3 fold), ICAM-1 (7–15 fold), and E-selectin (11–13 fold). Consistent with the upregulation of pro-inflammatory genes, peripheral blood cell infiltration was a prominent post-injury event with peak levels of infiltrating neutrophils (24 h) and macrophages (72 h) observed throughout the core lesion. In regions of the forebrain immediately surrounding the lesion, strong immunoreactivity for activated astrocytes (GFAP) was observed as early as 6 h post-injury followed by prominent microglial reactivity (OX-18) at 72 h and resolution of both cell types in cortical brain regions by day 7. Delayed thalamic inflammation (remote from the primary lesion) was also observed as indicated by both microglial and astrocyte reactivity (72 h to 7 days) concomitant with the presence of fiber degeneration (silver staining). Conclusion In summary, PBBI induces both an acute and delayed neuroinflammatory response occurring in distinct brain regions, which may provide useful diagnostic information for the treatment of this type of brain injury. PMID:17605820

DELAY OF GERMINATION 1 mediates a conserved coat-dormancy mechanism for the temperature- and gibberellin-dependent control of seed germination.

PubMed

Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard

2014-08-26

Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the delay of germination 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination.

Parametric Sensitivity Analysis of Oscillatory Delay Systems with an Application to Gene Regulation.

PubMed

Ingalls, Brian; Mincheva, Maya; Roussel, Marc R

2017-07-01

A parametric sensitivity analysis for periodic solutions of delay-differential equations is developed. Because phase shifts cause the sensitivity coefficients of a periodic orbit to diverge, we focus on sensitivities of the extrema, from which amplitude sensitivities are computed, and of the period. Delay-differential equations are often used to model gene expression networks. In these models, the parametric sensitivities of a particular genotype define the local geometry of the evolutionary landscape. Thus, sensitivities can be used to investigate directions of gradual evolutionary change. An oscillatory protein synthesis model whose properties are modulated by RNA interference is used as an example. This model consists of a set of coupled delay-differential equations involving three delays. Sensitivity analyses are carried out at several operating points. Comments on the evolutionary implications of the results are offered.

General anesthesia alters time perception by phase shifting the circadian clock.

PubMed

Cheeseman, James F; Winnebeck, Eva C; Millar, Craig D; Kirkland, Lisa S; Sleigh, James; Goodwin, Mark; Pawley, Matt D M; Bloch, Guy; Lehmann, Konstantin; Menzel, Randolf; Warman, Guy R

2012-05-01

Following general anesthesia, people are often confused about the time of day and experience sleep disruption and fatigue. It has been hypothesized that these symptoms may be caused by general anesthesia affecting the circadian clock. The circadian clock is fundamental to our well-being because it regulates almost all aspects of our daily biochemistry, physiology, and behavior. Here, we investigated the effects of the most common general anesthetic, isoflurane, on time perception and the circadian clock using the honeybee (Apis mellifera) as a model. A 6-h daytime anesthetic systematically altered the time-compensated sun compass orientation of the bees, with a mean anticlockwise shift in vanishing bearing of 87° in the Southern Hemisphere and a clockwise shift in flight direction of 58° in the Northern Hemisphere. Using the same 6-h anesthetic treatment, time-trained bees showed a delay in the start of foraging of 3.3 h, and whole-hive locomotor-activity rhythms were delayed by an average of 4.3 h. We show that these effects are all attributable to a phase delay in the core molecular clockwork. mRNA oscillations of the central clock genes cryptochrome-m and period were delayed by 4.9 and 4.3 h, respectively. However, this effect is dependent on the time of day of administration, as is common for clock effects, and nighttime anesthesia did not shift the clock. Taken together, our results suggest that general anesthesia during the day causes a persistent and marked shift of the clock effectively inducing "jet lag" and causing impaired time perception. Managing this effect in humans is likely to help expedite postoperative recovery.

Overexpression of AtAP1M3 regulates flowering time and floral development in Arabidopsis and effects key flowering-related genes in poplar.

PubMed

Chen, Zhong; Ye, Meixia; Su, Xiaoxing; Liao, Weihua; Ma, Huandi; Gao, Kai; Lei, Bingqi; An, Xinmin

2015-08-01

APETALA1 plays a crucial role in the transition from vegetative to reproductive phase and in floral development. In this study, to determine the effect of AP1 expression on flowering time and floral organ development, transgenic Arabidopsis and poplar overexpressing of AtAP1M3 (Arabidopsis AP1 mutant by dominant negative mutation) were generated. Transgenic Arabidopsis with e35Spro::AtAP1M3 displayed phenotypes with delayed-flowering compared to wild-type and flowers with abnormal sepals, petals and stamens. In addition, transgenic Arabidopsis plants exhibited reduced growth vigor compared to the wild-type plants. Ectopic expression of AtAP1M3 in poplar resulted in up- or down-regulation of some endogenous key flowering-related genes, including floral meristems identity gene LFY, B-class floral organ identity genes AP3 and PI, flowering pathway integrator FT1 and flower repressors TFL1 and SVP. These results suggest that AtAP1M3 regulates flowering time and floral development in plants.

Trithorax Group Protein Oryza sativa Trithorax1 Controls Flowering Time in Rice via Interaction with Early heading date31[W][OPEN

PubMed Central

Choi, Sang Chul; Lee, Shinyoung; Kim, Sung-Ryul; Lee, Yang-Seok; Liu, Chunyan; Cao, Xiaofeng; An, Gynheung

2014-01-01

Trithorax group proteins are chromatin-remodeling factors that activate target gene expression by antagonistically functioning against the Polycomb group. In Arabidopsis (Arabidopsis thaliana), Arabidopsis Trithorax protein1 (ATX1) regulates flowering time and floral organ identity. Here, we observed that suppression of Oryza sativa Trithorax1 (OsTrx1), an ortholog of ATX1, delayed flowering time in rice (Oryza sativa). Because the delay occurred only under long-day conditions, we evaluated the flowering signal pathways that specifically function under long-day conditions. Among them, the OsMADS50 and Heading date1 pathways were not affected by the mutation. However, the Grain number, plant height, and heading date7 (Ghd7) pathway was altered in ostrx1. Transcript levels of OsGI, phytochrome genes, and Early heading date3 (Ehd3), which function upstream of Ghd7, were unchanged in the mutant. Because Trx group proteins form a complex with other proteins to modify the chromatin structure of target genes, we investigated whether OsTrx1 interacts with a previously identified protein that functions upstream of Ghd7. We demonstrated that the plant homeodomain motif of OsTrx1 binds to native histone H3 from the calf thymus and that OsTrx1 binds to Ehd3 through the region between the plant homeodomain and SET domains. Finally, we showed that the SET domain at the C-terminal end of OsTrx1 has histone H3 methyltransferase activity when incubated with oligonucleosomes. Our results suggest that OsTrx1 plays an important role in regulating flowering time in rice by modulating chromatin structure. PMID:24420930

Wetlab-2 - Quantitative PCR Tools for Spaceflight Studies of Gene Expression Aboard the International Space Station

NASA Technical Reports Server (NTRS)

Schonfeld, Julie E.

2015-01-01

Wetlab-2 is a research platform for conducting real-time quantitative gene expression analysis aboard the International Space Station. The system enables spaceflight genomic studies involving a wide variety of biospecimen types in the unique microgravity environment of space. Currently, gene expression analyses of space flown biospecimens must be conducted post flight after living cultures or frozen or chemically fixed samples are returned to Earth from the space station. Post-flight analysis is limited for several reasons. First, changes in gene expression can be transient, changing over a timescale of minutes. The delay between sampling on Earth can range from days to months, and RNA may degrade during this period of time, even in fixed or frozen samples. Second, living organisms that return to Earth may quickly re-adapt to terrestrial conditions. Third, forces exerted on samples during reentry and return to Earth may affect results. Lastly, follow up experiments designed in response to post-flight results must wait for a new flight opportunity to be tested.

Diet-Induced Obesity Affects Muscle Regeneration After Murine Blunt Muscle Trauma-A Broad Spectrum Analysis.

PubMed

Xu, Pengfei; Werner, Jens-Uwe; Milerski, Sebastian; Hamp, Carmen M; Kuzenko, Tatjana; Jähnert, Markus; Gottmann, Pascal; de Roy, Luisa; Warnecke, Daniela; Abaei, Alireza; Palmer, Annette; Huber-Lang, Markus; Dürselen, Lutz; Rasche, Volker; Schürmann, Annette; Wabitsch, Martin; Knippschild, Uwe

2018-01-01

Injury to skeletal muscle affects millions of people worldwide. The underlying regenerative process however, is a very complex mechanism, time-wise highly coordinated, and subdivided in an initial inflammatory, a regenerative and a remodeling phase. Muscle regeneration can be impaired by several factors, among them diet-induced obesity (DIO). In order to evaluate if obesity negatively affects healing processes after trauma, we utilized a blunt injury approach to damage the extensor iliotibialis anticus muscle on the left hind limb of obese and normal weight C57BL/6J without showing any significant differences in force input between normal weight and obese mice. Magnetic resonance imaging (MRI) of the injury and regeneration process revealed edema formation and hemorrhage exudate in muscle tissue of normal weight and obese mice. In addition, morphological analysis of physiological changes revealed tissue necrosis, immune cell infiltration, extracellular matrix (ECM) remodeling, and fibrosis formation in the damaged muscle tissue. Regeneration was delayed in muscles of obese mice, with a higher incidence of fibrosis formation due to hampered expression levels of genes involved in ECM organization. Furthermore, a detailed molecular fingerprint in different stages of muscle regeneration underlined a delay or even lack of a regenerative response to injury in obese mice. A time-lapse heatmap determined 81 differentially expressed genes (DEG) with at least three hits in our model at all-time points, suggesting key candidates with a high impact on muscle regeneration. Pathway analysis of the DEG revealed five pathways with a high confidence level: myeloid leukocyte migration, regulation of tumor necrosis factor production, CD4-positive, alpha-beta T cell differentiation, ECM organization, and toll-like receptor (TLR) signaling. Moreover, changes in complement-, Wnt-, and satellite cell-related genes were found to be impaired in obese animals after trauma. Furthermore, histological satellite cell evaluation showed lower satellite cell numbers in the obese model upon injury. Ankrd1, C3ar1, Ccl8, Mpeg1 , and Myog expression levels were also verified by qPCR. In summary, increased fibrosis formation, the reduction of Pax7 + satellite cells as well as specific changes in gene expression and signaling pathways could explain the delay of tissue regeneration in obese mice post trauma.

Examining Plasmodium falciparum and P. vivax clearance subsequent to antimalarial drug treatment in the Myanmar-China border area based on quantitative real-time polymerase chain reaction.

PubMed

Lo, Eugenia; Nguyen, Jennifer; Oo, Winny; Hemming-Schroeder, Elizabeth; Zhou, Guofa; Yang, Zhaoqing; Cui, Liwang; Yan, Guiyun

2016-04-16

Recent emergence of artemisinin-resistant P. falciparum has posed a serious hindrance to the elimination of malaria in the Greater Mekong Subregion. Parasite clearance time, a measure of change in peripheral parasitaemia in a sequence of samples taken after treatment, can be used to reflect the susceptibility of parasites or the efficiency of antimalarials. The association of genetic polymorphisms and artemisinin resistance has been documented. This study aims to examine clearance time of P. falciparum and P. vivax parasitemia as well as putative gene mutations associated with residual or recurred parasitemia in Myanmar. A total of 63 P. falciparum and 130 P. vivax samples collected from two internally-displaced populations and one surrounding village were examined for parasitemia changes. At least four samples were taken from each patient, at the first day of diagnosis up to 3 months following the initial treatment. The amount of parasite gene copy number was estimated using quantitative real-time PCR based on a species-specific region of the 18S rRNA gene. For samples that showed residual or recurred parasitemia after treatment, microsatellites were used to identify the 'post-treatment' parasite genotype and compared such with the 'pre-treatment' genotype. Mutations in genes pfcrt, pfmdr1, pfatp6, pfmrp1 and pfK13 that are potentially associated with ACT resistance were examined to identify if mutation is a factor for residual or persistent parasitemia. Over 30% of the P. falciprium infections showed delayed clearance of parasitemia after 2-3 days of treatment and 9.5% showed recurred parasitemia. Mutations in codon 876 of the pfmrp1 corroborated significance association with slow clearance time. However, no association was observed in the variation in pfmdr1 gene copy number as well as mutations of various codonsinpfatp6, pfcrt, and pfK13 with clearance time. For P. vivax, over 95% of the infections indicated cleared parasitemia at days 2-3 of treatment. Four samples were found to be re-infected with new parasite strains based on microsatellite genotypes after initial treatment. The appearance of P.falciparum infected samples showing delayed clearance or recurred parasitemia after treatment raises concerns on current treatment and ACT drug resistance.

Generalized binomial τ-leap method for biochemical kinetics incorporating both delay and intrinsic noise

NASA Astrophysics Data System (ADS)

Leier, André; Marquez-Lago, Tatiana T.; Burrage, Kevin

2008-05-01

The delay stochastic simulation algorithm (DSSA) by Barrio et al. [Plos Comput. Biol. 2, 117(E) (2006)] was developed to simulate delayed processes in cell biology in the presence of intrinsic noise, that is, when there are small-to-moderate numbers of certain key molecules present in a chemical reaction system. These delayed processes can faithfully represent complex interactions and mechanisms that imply a number of spatiotemporal processes often not explicitly modeled such as transcription and translation, basic in the modeling of cell signaling pathways. However, for systems with widely varying reaction rate constants or large numbers of molecules, the simulation time steps of both the stochastic simulation algorithm (SSA) and the DSSA can become very small causing considerable computational overheads. In order to overcome the limit of small step sizes, various τ-leap strategies have been suggested for improving computational performance of the SSA. In this paper, we present a binomial τ-DSSA method that extends the τ-leap idea to the delay setting and avoids drawing insufficient numbers of reactions, a common shortcoming of existing binomial τ-leap methods that becomes evident when dealing with complex chemical interactions. The resulting inaccuracies are most evident in the delayed case, even when considering reaction products as potential reactants within the same time step in which they are produced. Moreover, we extend the framework to account for multicellular systems with different degrees of intercellular communication. We apply these ideas to two important genetic regulatory models, namely, the hes1 gene, implicated as a molecular clock, and a Her1/Her 7 model for coupled oscillating cells.

Mutant Alleles of Photoperiod-1 in Wheat (Triticum aestivum L.) That Confer a Late Flowering Phenotype in Long Days

PubMed Central

Shaw, Lindsay M.; Turner, Adrian S.; Herry, Laurence; Griffiths, Simon; Laurie, David A.

2013-01-01

Flowering time in wheat and barley is known to be modified by mutations in the Photoperiod-1 (Ppd-1) gene. Semi-dominant Ppd-1a mutations conferring an early flowering phenotype are well documented in wheat but gene sequencing has also identified candidate loss of function mutations for Ppd-A1 and Ppd-D1. By analogy to the recessive ppd-H1 mutation in barley, loss of function mutations in wheat are predicted to delay flowering under long day conditions. To test this experimentally, introgression lines were developed in the spring wheat variety ‘Paragon’. Plants lacking a Ppd-B1 gene were identified from a gamma irradiated ‘Paragon’ population. These were crossed with the other introgression lines to generate plants with candidate loss of function mutations on one, two or three genomes. Lines lacking Ppd-B1 flowered 10 to 15 days later than controls under long days. Candidate loss of function Ppd-A1 alleles delayed flowering by 1 to 5 days while candidate loss of function Ppd-D1 alleles did not affect flowering time. Loss of Ppd-A1 gave an enhanced effect, and loss of Ppd-D1 became detectable in lines where Ppd-B1 was absent, indicating effects may be buffered by functional Ppd-1 alleles on other genomes. Expression analysis revealed that delayed flowering was associated with reduced expression of the TaFT1 gene and increased expression of TaCO1. A survey of the GEDIFLUX wheat collection grown in the UK and North Western Europe between the 1940s and 1980s and the A.E. Watkins global collection of landraces from the 1920s and 1930s showed that the identified candidate loss of function mutations for Ppd-D1 were common and widespread, while the identified candidate Ppd-A1 loss of function mutation was rare in countries around the Mediterranean and in the Far East but was common in North Western Europe. This may reflect a possible benefit of the latter in northern locations. PMID:24244507

Visual function in patients with cone-rod dystrophy (CRD) associated with mutations in the ABCA4(ABCR) gene.

PubMed

Birch, D G; Peters, A Y; Locke, K L; Spencer, R; Megarity, C F; Travis, G H

2001-12-01

Mutations in the ABCA4(ABCR) gene cause autosomal recessive Stargardt disease (STGD). ABCR mutations were identified in patients with cone-rod dystrophy (CRD) and retinitis pigmentosa (RP) by direct sequencing of all 50 exons in 40 patients. Of 10 patients with RP, one contained two ABCR mutations suggesting a compound heterozygote. This patient had a characteristic fundus appearance with attenuated vessels, pale disks and bone-spicule pigmentation. Rod electroretinograms (ERGs) were non-detectable, cone ERGs were greatly reduced in amplitude and delayed in implicit time, and visual fields were constricted to 10 degrees diameter. Eleven of 30 (37%) patients with CRD had mutations in ABCR. In general, these patients showed reduced but detectable rod ERG responses, reduced and delayed cone responses, and poor visual acuity. Rod photoresponses to high intensity flashes were of reduced maximum amplitude but showed normal values for the gain of phototransduction. Most CRD patients with mutations in ABCR showed delayed recovery of sensitivity (dark adaptation) following exposure to bright light. Pupils were also significantly smaller in these patients compared to controls at 30 min following light exposure, consistent with a persistent 'equivalent light' background due to the accumulation of a tentatively identified 'noisy' photoproduct. Copyright 2001 Academic Press.

2q24 deletion in a 9-month old girl with anal atresia, hearing impairment, and hypotonia.

PubMed

Zhao, Peiwei; Mao, Bing; Cai, Xiaonan; Jiang, Jun; Liu, Zhisheng; Lin, Jun; He, Xuelian

2018-06-01

Deletion of 2q24.2 is a rare cytogenetic aberration in patients, exhibiting heterogeneous clinical features, and common phenotypes included developmental delay, intellectual disability, hypotonia, and mild dysmorphic features. Hearing impairment and anal atresia are rarely described. Here we described a 9-month-old female patient with hypotonia in all four limbs, developmental delay, and intellectual disability. In addition, congenital anal atresia was diagnosed and treated after birth, and hearing impairment was found in right ear. Single nucleotide polymorphisms (SNP) array detected a 5.2 Mb deletion on 2q24.2q24.3, including 19 genes (ITGB6; TBR1; SLC4A10; KCNH7 SCN3A; SCN2A et al.). Among these genes, it is affirmative that TBR1 is a causative gene for intellectual disability; however, the pathogenic genes of other phenotypes remain unclear. We briefly review the knowledge of genes likely involved in these clinical features, including hearing impairment, anal atresia, and developmental delay. Copyright © 2018 Elsevier B.V. All rights reserved.

Androgen therapy for delayed male puberty.

PubMed

Ambler, Geoffrey R

2009-06-01

Delayed puberty in men is a commonly presenting problem to paediatricians and an understanding of the available evidence on cause, treatments and outcomes is important to guide practice. Understanding of the regulation of the onset of puberty is gradually unfolding, although the genetic factors that dictate the timing of puberty in individuals and families remain poorly elucidated. Mutations and polymorphisms in candidate genes are being actively studied and it is likely that there is significant overlap between traditional diagnostic categories. Also, environmental endocrine disruptors may interact with the genetic regulation of puberty. Delayed puberty may not always be a benign condition, with increased risks of failing to achieve target height, adverse psychological and educational consequences, delayed sexual and psychosocial integration into society and effects on skeletal proportions and bone mass reported. Appropriate evaluation and follow-up is needed to guide clinical practice, particularly to distinguish constitutional delay in growth and puberty from that associated with other medical disease or permanent disorders. In milder cases of delayed puberty, treatment is often not required; however, considerable evidence exists for the efficacy and safety of short courses of low-dose testosterone therapy for appropriately selected individuals. This treatment is associated with high levels of patient satisfaction. There is not yet sufficient evidence for the routine use of other therapies (e.g. growth hormone, aromatase inhibitors) for constitutional delay in growth and puberty and better characterization of cause may lead to more targeted individual therapy.

Identification of a novel mutation in the PTCH gene in a patient with Gorlin-Goltz syndrome with unusual ocular disorders.

PubMed

Romano, Mary; Iacovello, Daniela; Cascone, Nikhil C; Contestabile, Maria Teresa

2011-01-01

To document the clinical, functional, and in vivo microanatomic characteristics of a patient with Gorlin-Goltz syndrome with a novel nonsense mutation in PTCH (patched). Optical coherence tomography (OCT), fluorescein angiography, electrophysiologic testing, visual field, magnetic resonance imaging, and mutation screening of PTCH gene. Visual acuity was 20/20 in the right eye and 20/25 in the left. Fundus examination revealed myelinated nerve fibers in the left eye and bilateral epiretinal membranes with lamellar macular hole also documented with macular OCT. A reduction of the retinal nerve fiber layers in both eyes was found with fiber nervous OCT. Fluorescein angiography showed bilaterally foveal hyperfluorescence and the visual field revealed inferior hemianopia in the right eye. Pattern visual evoked potentials registered a reduction of amplitude in both eyes and latency was delayed in the left eye. Pattern electroretinogram showed a reduction in P50 and N95 peak time and a delay in P50 peak time in the left eye. Flash electroretinogram was reduced in rod response, maximal response, and oscillatory potentials in both eyes. Cone response was normal and 30-Hz flicker was slightly reduced in both eyes. Mutation screening identified a novel nonsense mutation in PTCH. A novel nonsense mutation in the PTCH gene was found. We report the occurrence of epiretinal membranes and the persistence of myelinated nerve fibers. Electrophysiologic and visual field alterations, supporting a neuroretinal dysfunction, were also documented.

A laboratory simulation of Arabidopsis seed dormancy cycling provides new insight into its regulation by clock genes and the dormancy-related genes DOG1, MFT, CIPK23 and PHYA.

PubMed

Footitt, Steven; Ölçer-Footitt, Hülya; Hambidge, Angela J; Finch-Savage, William E

2017-08-01

Environmental signals drive seed dormancy cycling in the soil to synchronize germination with the optimal time of year, a process essential for species' fitness and survival. Previous correlation of transcription profiles in exhumed seeds with annual environmental signals revealed the coordination of dormancy-regulating mechanisms with the soil environment. Here, we developed a rapid and robust laboratory dormancy cycling simulation. The utility of this simulation was tested in two ways: firstly, using mutants in known dormancy-related genes [DELAY OF GERMINATION 1 (DOG1), MOTHER OF FLOWERING TIME (MFT), CBL-INTERACTING PROTEIN KINASE 23 (CIPK23) and PHYTOCHROME A (PHYA)] and secondly, using further mutants, we test the hypothesis that components of the circadian clock are involved in coordination of the annual seed dormancy cycle. The rate of dormancy induction and relief differed in all lines tested. In the mutants, dog1-2 and mft2, dormancy induction was reduced but not absent. DOG1 is not absolutely required for dormancy. In cipk23 and phyA dormancy, induction was accelerated. Involvement of the clock in dormancy cycling was clear when mutants in the morning and evening loops of the clock were compared. Dormancy induction was faster when the morning loop was compromised and delayed when the evening loop was compromised. © 2017 The Authors Plant, Cell & Environment Published by John Wiley & Sons Ltd.

LateBiclustering: Efficient Heuristic Algorithm for Time-Lagged Bicluster Identification.

PubMed

Gonçalves, Joana P; Madeira, Sara C

2014-01-01

Identifying patterns in temporal data is key to uncover meaningful relationships in diverse domains, from stock trading to social interactions. Also of great interest are clinical and biological applications, namely monitoring patient response to treatment or characterizing activity at the molecular level. In biology, researchers seek to gain insight into gene functions and dynamics of biological processes, as well as potential perturbations of these leading to disease, through the study of patterns emerging from gene expression time series. Clustering can group genes exhibiting similar expression profiles, but focuses on global patterns denoting rather broad, unspecific responses. Biclustering reveals local patterns, which more naturally capture the intricate collaboration between biological players, particularly under a temporal setting. Despite the general biclustering formulation being NP-hard, considering specific properties of time series has led to efficient solutions for the discovery of temporally aligned patterns. Notably, the identification of biclusters with time-lagged patterns, suggestive of transcriptional cascades, remains a challenge due to the combinatorial explosion of delayed occurrences. Herein, we propose LateBiclustering, a sensible heuristic algorithm enabling a polynomial rather than exponential time solution for the problem. We show that it identifies meaningful time-lagged biclusters relevant to the response of Saccharomyces cerevisiae to heat stress.

DELAY OF GERMINATION 1 mediates a conserved coat-dormancy mechanism for the temperature- and gibberellin-dependent control of seed germination

PubMed Central

Graeber, Kai; Linkies, Ada; Steinbrecher, Tina; Mummenhoff, Klaus; Tarkowská, Danuše; Turečková, Veronika; Ignatz, Michael; Sperber, Katja; Voegele, Antje; de Jong, Hans; Urbanová, Terezie; Strnad, Miroslav; Leubner-Metzger, Gerhard

2014-01-01

Seed germination is an important life-cycle transition because it determines subsequent plant survival and reproductive success. To detect optimal spatiotemporal conditions for germination, seeds act as sophisticated environmental sensors integrating information such as ambient temperature. Here we show that the DELAY OF GERMINATION 1 (DOG1) gene, known for providing dormancy adaptation to distinct environments, determines the optimal temperature for seed germination. By reciprocal gene-swapping experiments between Brassicaceae species we show that the DOG1-mediated dormancy mechanism is conserved. Biomechanical analyses show that this mechanism regulates the material properties of the endosperm, a seed tissue layer acting as germination barrier to control coat dormancy. We found that DOG1 inhibits the expression of gibberellin (GA)-regulated genes encoding cell-wall remodeling proteins in a temperature-dependent manner. Furthermore we demonstrate that DOG1 causes temperature-dependent alterations in the seed GA metabolism. These alterations in hormone metabolism are brought about by the temperature-dependent differential expression of genes encoding key enzymes of the GA biosynthetic pathway. These effects of DOG1 lead to a temperature-dependent control of endosperm weakening and determine the optimal temperature for germination. The conserved DOG1-mediated coat-dormancy mechanism provides a highly adaptable temperature-sensing mechanism to control the timing of germination. PMID:25114251

Effect of cytokinins on delaying petunia flower senescence: a transcriptome study approach.

PubMed

Trivellini, Alice; Cocetta, Giacomo; Vernieri, Paolo; Mensuali-Sodi, Anna; Ferrante, Antonio

2015-01-01

Flower senescence is a fascinating natural process that represents the final developmental stage in the life of a flower. Plant hormones play an important role in regulating the timing of flower senescence. Ethylene is a trigger and usually accelerates the senescence rate, while cytokinins are known to delay it. The aim of this work was to study the effect of 6-benzylaminopurine (BA) on petal senescence by transcript profile comparison after 3 or 6 h using a cross-species method by hybridizing petunia samples to a 4 × 44 K Agilent tomato array. The relative content of ethylene, abscisic acid, anthocyanins, total carotenoids and total phenols that determine the physiological behaviours of the petal tissue were measured. BA treatment prolonged the flower life and increased the concentrations of phenols and anthocyanins, while total carotenoids did not increase and were lower than the control. The ethylene biosynthetic and perception gene expressions were studied immediately after treatment until 24 h and all genes were repressed, while ethylene production was strongly induced after 4 days. The microarray analyses highlighted that BA strongly affected gene regulation after 3 h, but only 14% of genes remained differentially expressed after 6 h. The most affected pathways and genes were those related to stress, such as heat shock proteins, abscisic acid (ABA) catabolism and its signalling pathway, lipid metabolism and antioxidant defence systems. A gene annotation enrichment analysis using DAVID showed that the most important gene clusters were involved in energy generation and conservation processes. In addition to the ethylene pathway, cytokinins seem to be strongly involved the regulation of the ABA response in flower tissues.

Transcriptional Analysis of Flowering Time in Switchgrass

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Transcriptional Analysis of Flowering Time in Switchgrass

DOE PAGES

Tornqvist, Carl-Erik; Vaillancourt, Brieanne; Kim, Jeongwoon; ...

2017-04-27

Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically earlymore » flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.Over the past two decades, switchgrass (Panicum virgatum) has emerged as a priority biofuel feedstock. The bulk of switchgrass biomass is in the vegetative portion of the plant; therefore, increasing the length of vegetative growth will lead to an increase in overall biomass yield. The goal of this study was to gain insight into the control of flowering time in switchgrass that would assist in development of cultivars with longer vegetative phases through delayed flowering. RNA sequencing was used to assess genome-wide expression profiles across a developmental series between switchgrass genotypes belonging to the two main ecotypes: upland, typically early flowering, and lowland, typically late flowering. Leaf blades and tissues enriched for the shoot apical meristem (SAM) were collected in a developmental series from emergence through anthesis for RNA extraction. RNA from samples that flanked the SAM transition stage was sequenced for expression analyses. The analyses revealed differential expression patterns between early- and late-flowering genotypes for known flowering time orthologs. Namely, genes shown to play roles in photoperiod response and the circadian clock in other species were identified as potential candidates for regulating flowering time in the switchgrass genotypes analyzed. Based on their expression patterns, many of the differentially expressed genes could also be classified as putative promoters or repressors of flowering. The candidate genes presented here may then be used to guide switchgrass improvement through marker-assisted breeding and/or transgenic or gene editing approaches.« less

Lactic acid delays the inflammatory response of human monocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Peter, Katrin, E-mail: katrin.peter@ukr.de; Rehli, Michael, E-mail: michael.rehli@ukr.de; RCI Regensburg Center for Interventional Immunology, University Hospital Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg

2015-02-13

Lactic acid (LA) accumulates under inflammatory conditions, e.g. in wounds or tumors, and influences local immune cell functions. We previously noted inhibitory effects of LA on glycolysis and TNF secretion of human LPS-stimulated monocytes. Here, we globally analyze the influence of LA on gene expression during monocyte activation. To separate LA-specific from lactate- or pH-effects, monocytes were treated for one or four hours with LPS in the presence of physiological concentrations of LA, sodium lactate (NaL) or acidic pH. Analyses of global gene expression profiles revealed striking effects of LA during the early stimulation phase. Up-regulation of most LPS-induced genesmore » was significantly delayed in the presence of LA, while this inhibitory effect was attenuated in acidified samples and not detected after incubation with NaL. LA targets included genes encoding for important monocyte effector proteins like cytokines (e.g. TNF and IL-23) or chemokines (e.g. CCL2 and CCL7). LA effects were validated for several targets by quantitative RT-PCR and/or ELISA. Further analysis of LPS-signaling pathways revealed that LA delayed the phosphorylation of protein kinase B (AKT) as well as the degradation of IκBα. Consistently, the LPS-induced nuclear accumulation of NFκB was also diminished in response to LA. These results indicate that the broad effect of LA on gene expression and function of human monocytes is at least partially caused by its interference with immediate signal transduction events after activation. This mechanism might contribute to monocyte suppression in the tumor environment. - Highlights: • Lactic acid broadly delays LPS-induced gene expression in human monocytes. • Expression of important monocyte effector molecules is affected by lactic acid. • Interference of lactic acid with TLR signaling causes the delayed gene expression. • The profound effect of lactic acid might contribute to immune suppression in tumors.« less

Increased proliferation of late-born retinal progenitor cells by gestational lead exposure delays rod and bipolar cell differentiation.

PubMed

Chaney, Shawnta Y; Mukherjee, Shradha; Giddabasappa, Anand; Rueda, Elda M; Hamilton, W Ryan; Johnson, Jerry E; Fox, Donald A

2016-01-01

Studies of neuronal development in the retina often examine the stages of proliferation, differentiation, and synaptic development, albeit independently. Our goal was to determine if a known neurotoxicant insult to a population of retinal progenitor cells (RPCs) would affect their eventual differentiation and synaptic development. To that end, we used our previously published human equivalent murine model of low-level gestational lead exposure (GLE). Children and animals with GLE exhibit increased scotopic electroretinogram a- and b-waves. Adult mice with GLE exhibit an increased number of late-born RPCs, a prolonged period of RPC proliferation, and an increased number of late-born rod photoreceptors and rod and cone bipolar cells (BCs), with no change in the number of late-born Müller glial cells or early-born neurons. The specific aims of this study were to determine whether increased and prolonged RPC proliferation alters the spatiotemporal differentiation and synaptic development of rods and BCs in early postnatal GLE retinas compared to control retinas. C57BL/6N mouse pups were exposed to lead acetate via drinking water throughout gestation and until postnatal day 10, which is equivalent to the human gestation period for retinal neurogenesis. RT-qPCR, immunohistochemical analysis, and western blots of well-characterized, cell-specific genes and proteins were performed at embryonic and early postnatal ages to assess rod and cone photoreceptor differentiation, rod and BC differentiation and synaptic development, and Müller glial cell differentiation. Real-time quantitative PCR (RT-qPCR) with the rod-specific transcription factors Nrl , Nr2e3 , and Crx and the rod-specific functional gene Rho , along with central retinal confocal studies with anti-recoverin and anti-rhodopsin antibodies, revealed a two-day delay in the differentiation of rod photoreceptors in GLE retinas. Rhodopsin immunoblots supported this conclusion. No changes in glutamine synthetase gene or protein expression, a marker for late-born Müller glial cells, were observed in the developing retinas. In the retinas from the GLE mice, anti-PKCα, - Chx10 (Vsx2) and -secretagogin antibodies revealed a two- to three-day delay in the differentiation of rod and cone BCs, whereas the expression of the proneural and BC genes Otx2 and Chx10 , respectively, increased. In addition, confocal studies of proteins associated with functional synapses (e.g., vesicular glutamate transporter 1 [VGluT1], plasma membrane calcium ATPase [PMCA], transient receptor potential channel M1 [TRPM1], and synaptic vesicle glycoprotein 2B [SV2B]) revealed a two-day delay in the formation of the outer and inner plexiform layers of the GLE retinas. Moreover, several markers revealed that the initiation of the differentiation and intensity of the labeling of early-born cells in the retinal ganglion cell and inner plexiform layers were not different in the control retinas. Our combined gene, confocal, and immunoblot findings revealed that the onset of rod and BC differentiation and their subsequent synaptic development is delayed by two to three days in GLE retinas. These results suggest that perturbations during the early proliferative stages of late-born RPCs fated to be rods and BCs ultimately alter the coordinated time-dependent progression of rod and BC differentiation and synaptic development. These GLE effects were selective for late-born neurons. Although the molecular mechanisms are unknown, alterations in soluble neurotrophic factors and/or their receptors are likely to play a role. Since neurodevelopmental delays and altered synaptic connectivity are associated with neuropsychiatric and behavioral disorders as well as cognitive deficits, future work is needed to determine if similar effects occur in the brains of GLE mice and whether children with GLE experience similar delays in retinal and brain neuronal differentiation and synaptic development.

Effects of delay and noise in a negative feedback regulatory motif

NASA Astrophysics Data System (ADS)

Palassini, Matteo; Dies, Marta

2009-03-01

The small copy number of the molecules involved in gene regulation can induce nontrivial stochastic phenomena such as noise-induced oscillations. An often neglected aspect of regulation dynamics are the delays involved in transcription and translation. Delays introduce analytical and computational complications because the dynamics is non-Markovian. We study the interplay of noise and delays in a negative feedback model of the p53 core regulatory network. Recent experiments have found pronounced oscillations in the concentrations of proteins p53 and Mdm2 in individual cells subjected to DNA damage. Similar oscillations occur in the Hes-1 and NK-kB systems, and in circadian rhythms. Several mechanisms have been proposed to explain this oscillatory behaviour, such as deterministic limit cycles, with and without delay, or noise-induced excursions in excitable models. We consider a generic delayed Master Equation incorporating the activation of Mdm2 by p53 and the Mdm2-promoted degradation of p53. In the deterministic limit and for large delays, the model shows a Hopf bifurcation. Via exact stochastic simulations, we find strong noise-induced oscillations well outside the limit-cycle region. We propose that this may be a generic mechanism for oscillations in gene regulatory systems.

Circadian polymorphisms in night owls, in bipolars, and in non-24-hour sleep cycles.

PubMed

Kripke, Daniel F; Klimecki, Walter T; Nievergelt, Caroline M; Rex, Katharine M; Murray, Sarah S; Shekhtman, Tatyana; Tranah, Gregory J; Loving, Richard T; Lee, Heon-Jeong; Rhee, Min Kyu; Shadan, Farhad F; Poceta, J Steven; Jamil, Shazia M; Kline, Lawrence E; Kelsoe, John R

2014-10-01

People called night owls habitually have late bedtimes and late times of arising, sometimes suffering a heritable circadian disturbance called delayed sleep phase syndrome (DSPS). Those with DSPS, those with more severe progressively-late non-24-hour sleep-wake cycles, and those with bipolar disorder may share genetic tendencies for slowed or delayed circadian cycles. We searched for polymorphisms associated with DSPS in a case-control study of DSPS research participants and a separate study of Sleep Center patients undergoing polysomnography. In 45 participants, we resequenced portions of 15 circadian genes to identify unknown polymorphisms that might be associated with DSPS, non-24-hour rhythms, or bipolar comorbidities. We then genotyped single nucleotide polymorphisms (SNPs) in both larger samples, using Illumina Golden Gate assays. Associations of SNPs with the DSPS phenotype and with the morningness-eveningness parametric phenotype were computed for both samples, then combined for meta-analyses. Delayed sleep and "eveningness" were inversely associated with loci in circadian genes NFIL3 (rs2482705) and RORC (rs3828057). A group of haplotypes overlapping BHLHE40 was associated with non-24-hour sleep-wake cycles, and less robustly, with delayed sleep and bipolar disorder (e.g., rs34883305, rs34870629, rs74439275, and rs3750275 were associated with n=37, p=4.58E-09, Bonferroni p=2.95E-06). Bright light and melatonin can palliate circadian disorders, and genetics may clarify the underlying circadian photoperiodic mechanisms. After further replication and identification of the causal polymorphisms, these findings may point to future treatments for DSPS, non-24-hour rhythms, and possibly bipolar disorder or depression.

Genetic architecture of learning and delayed recall: a twin study of episodic memory.

PubMed

Panizzon, Matthew S; Lyons, Michael J; Jacobson, Kristen C; Franz, Carol E; Grant, Michael D; Eisen, Seth A; Xian, Hong; Kremen, William S

2011-07-01

Although episodic memory is often conceptualized as consisting of multiple component processes, there is a lack of understanding as to whether these processes are influenced by the same or different genetic determinants. The aim of the present study was to utilize multivariate twin analyses to elucidate the degree to which learning and delayed recall, two critical measures of episodic memory performance, have common or different genetic and environmental influences. Participants from the Vietnam Era Twin Study of Aging (314 monozygotic twin pairs, 259 dizygotic twin pairs, and 47 unpaired twins) were assessed using the second edition of the California Verbal Learning Test. Mean age at the time of the evaluation was 55.4 years (SD = 2.5). Model fitting revealed the presence of a higher-order latent factor influencing learning, short- and long-delay free recall, with a heritability of .36. The best-fitting model also indicated specific genetic influences on learning, which accounted for 10% of the overall variance. Given that learning involves the acquisition and retrieval of information, whereas delayed recall involves only retrieval, we conclude that these specific effects are likely to reflect genes that are specific to acquisition processes. These results demonstrate that even in nonclinical populations, it is possible to differentiate component processes in episodic memory. These different genetic influences may have implications for gene association studies, as well as other genetic studies of cognitive aging and disorders of episodic memory such as Alzheimer's disease or mild cognitive impairment. PsycINFO Database Record (c) 2011 APA, all rights reserved.

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hsieh, Ru-Lan

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As{sup III}), arsenate (As{sup V}), monomethylarsonic acid (MMA{sup V}), and dimethylarsinic acid (DMA{sup V}) weremore » measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G + G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08–2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. - Highlights: • AS3MT genotypes were found to affect susceptibility to developmental delay. • AS3MT rs3740392 A/G and G/G genotype had a significantly low SMI (DMA/MMA) index. • AS3MT high-risk haplotype was significantly associated with developmental delay.« less

Estradiol-induced gene expression in largemouth bass (Micropterus salmoides)

USGS Publications Warehouse

Bowman, C.J.; Kroll, K.J.; Gross, T.G.; Denslow, N.D.

2002-01-01

Vitellogenin (Vtg) and estrogen receptor (ER) gene expression levels were measured in largemouth bass to evaluate the activation of the ER-mediated pathway by estradiol (E2). Single injections of E2 ranging from 0.0005 to 5 mg/kg up-regulated plasma Vtg in a dose-dependent manner. Vtg and ER mRNAs were measured using partial cDNA sequences corresponding to the C-terminal domain for Vtg and the ligand-binding domain of ER?? sequences. After acute E2-exposures (2 mg/kg), Vtg and ER mRNAs and plasma Vtg levels peaked after 2 days. The rate of ER mRNA accumulation peaked 36-42 h earlier than Vtg mRNA. The expression window for ER defines the primary response to E2 in largemouth bass and that for Vtg a delayed primary response. The specific effect of E2 on other estrogen-regulated genes was tested during these same time windows using differential display RT-PCR. Specific up-regulated genes that are expressed in the same time window as Vtg were ERp72 (a membrane-bound disulfide isomerase) and a gene with homology to an expressed gene identified in zebrafish. Genes that were expressed in a pattern that mimics the ER include the gene for zona radiata protein ZP2, and a gene with homology to an expressed gene found in winter flounder. One gene for fibrinogen ?? was down-regulated and an unidentified gene was transiently up-regulated after 12 h of exposure and returned to basal levels by 48 h. Taken together these studies indicate that the acute molecular response to E2 involves a complex network of responses over time. ?? 2002 Elsevier Science Ireland Ltd. All rights reserved.

Relation of polymorphism of arsenic metabolism genes to arsenic methylation capacity and developmental delay in preschool children in Taiwan.

PubMed

Hsieh, Ru-Lan; Su, Chien-Tien; Shiue, Horng-Sheng; Chen, Wei-Jen; Huang, Shiau-Rung; Lin, Ying-Chin; Lin, Ming-I; Mu, Shu-Chi; Chen, Ray-Jade; Hsueh, Yu-Mei

2017-04-15

Inefficient arsenic methylation capacity has been associated with developmental delay in children. The present study was designed to explore whether polymorphisms and haplotypes of arsenic methyltransferase (AS3MT), glutathione-S-transferase omegas (GSTOs), and purine nucleoside phosphorylase (PNP) affect arsenic methylation capacity and developmental delay. A case-control study was conducted from August 2010 to March 2014. All participants were recruited from the Shin Kong Wu Ho-Su Memorial Teaching Hospital. In total, 179 children with developmental delay and 88 children without delay were recruited. Urinary arsenic species, including arsenite (As III ), arsenate (As V ), monomethylarsonic acid (MMA V ), and dimethylarsinic acid (DMA V ) were measured using a high-performance liquid chromatography-linked hydride generator and atomic absorption spectrometry. The polymorphisms of AS3MT, GSTO, and PNP were performed using the Sequenom MassARRAY platform with iPLEX Gold chemistry. Polymorphisms of AS3MT genes were found to affect susceptibility to developmental delay in children, but GSTO and PNP polymorphisms were not. Participants with AS3MT rs3740392 A/G+G/G genotype, compared with AS3MT rs3740392 A/A genotype, had a significantly lower secondary methylation index. This may result in an increased OR for developmental delay. Participants with the AS3MT high-risk haplotype had a significantly higher OR than those with AS3MT low-risk haplotypes [OR and 95% CI, 1.59 (1.08-2.34)]. This is the first study to show a joint dose-response effect of this AS3MT high-risk haplotype and inefficient arsenic methylation capacity on developmental delay. Our data provide evidence that AS3MT genes are related to developmental delay and may partially influence arsenic methylation capacity. Copyright © 2017 Elsevier Inc. All rights reserved.

Individual Differences in Sleep Timing Relate to Melanopsin-Based Phototransduction in Healthy Adolescents and Young Adults.

PubMed

van der Meijden, Wisse P; Van Someren, Jamie L; Te Lindert, Bart H W; Bruijel, Jessica; van Oosterhout, Floor; Coppens, Joris E; Kalsbeek, Andries; Cajochen, Christian; Bourgin, Patrice; Van Someren, Eus J W

2016-06-01

Individual differences in sleep timing have been widely recognized and are of particular relevance in adolescents and young adults who often show mild to severely delayed sleep. The biological mechanisms underlying the between-subject variance remain to be determined. Recent human genetics studies showed an association between sleep timing and melanopsin gene variation, but support for functional effects on downstream pathways and behavior was not demonstrated before. We therefore investigated the association between the autonomic (i.e., pupil diameter) and behavioral (i.e., sleep timing) readouts of two different downstream brain areas, both affected by the same melanopsin-dependent retinal phototransduction: the olivary pretectal nucleus (OPN) and the suprachiasmatic nucleus (SCN). Our study population included 71 healthy individuals within an age range with known vulnerability to a delayed sleep phase (16.8-35.7 y, 37 males, 34 females). Pupillometry was performed to estimate functionality of the intrinsic melanopsin-signaling circuitry based on the OPN-mediated post-illumination pupil response (PIPR) to blue light. Sleep timing was quantified by estimating the SCN-mediated mid-sleep timing in three different ways in parallel: using a chronotype questionnaire, a sleep diary, and actigraphy. All three measures consistently showed that those individuals with a later mid-sleep timing had a more pronounced PIPR (0.03 < P < 0.05), indicating a stronger blue-light responsiveness of the intrinsic melanopsin-based phototransduction circuitry. Trait-like individual differences in the melanopsin phototransduction circuitry contribute to individual differences in sleep timing. Blue light-sensitive young individuals are more prone to delayed sleep. © 2016 Associated Professional Sleep Societies, LLC.

Upregulation of MAOA in the hippocampus results in delayed depressive-like behaviors in burn mice.

PubMed

Wang, Zhen; Chen, Lu; Rong, Xinzhou; Wang, Xuemin

2017-04-14

To observe depressive-like behavior and hippocampus monoamine oxidase A (MAOA) changes in burned mice. We tested depression and anxiety like behaviors of burn C57 mice with the sucrose preference test, forced swimming test (FST), open field test and elevated plus maze test and then detected the MAOA content and MAOA gene transcriptional levels in the hippocampus with western blot analysis and real-time quantitative PCR analysis. We then sought to reverse depressive-like behavior of burned mice with an MAOA inhibitor. (1) Mice showed depressive and anxiety like behaviors one week after they were burned; (2) The content of MAOA in the hippocampus of burned mice was significantly higher than that in control mice (P<0.05); (3) MAOA gene transcription in the hippocampus of burned mice was significantly increased (MAOA mRNA was increased, P<0.05); (4) treatment with a MAOA inhibitor (phenelzine) significantly increased the sucrose preference rate and decreased FST immobility time in burned mice, and also decreased elevated expression of MAOA in the hippocampus of burned mice. Burned mice showed "delayed" depressive-like behavior combined with a degree of anxiety; this phenomenon is likely associated with the increase in MAOA expression in the hippocampus. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

Phytotoxic effects of Sicyos deppei (Cucurbitaceae) in germinating tomato seeds.

PubMed

Lara-Núñez, Aurora; Sánchez-Nieto, Sobeida; Luisa Anaya, Ana; Cruz-Ortega, Rocio

2009-06-01

The phytotoxic effect of allelochemicals is referred to as allelochemical stress and it is considered a biotic stress. Sicyos deppei G. Don (Cucurbitaceae) is an allelopathic weed that causes phytotoxicity in Lycopersicon esculentum, delaying seed germination and severely inhibiting radicle growth. This paper reports in in vitro conditions, the effects of the aqueous leachate of S. deppei-throughout tomato germination times-on (1) the dynamics of starch and sugars metabolism, (2) activity and expression of the cell wall enzymes involved in endosperm weakening that allows the protrusion of the radicle, and (3) whether abscisic acid (ABA) is involved in this altered metabolic processes. Results showed that S. deppei leachate on tomato seed germination mainly caused: (1) delay in starch degradation as well as in sucrose hydrolysis; (2) lower activity of sucrose phosphate synthase, cell wall invertase, and alpha-amylase; being sucrose phosphate synthase (SPS) gene expression down-regulated, and the last two up regulated; (3) also, lower activity of endo beta-mannanase, beta-1,3 glucanase, alpha-galactosidase, and exo-polygalacturonase with altered gene expression; and (4) higher content of ABA during all times of germination. The phytotoxic effect of S. deppei aqueous leachate is because of the sum of many metabolic processes affected during tomato seed germination that finally is evidenced by a strong inhibition of radicle growth.

Timing of Tissue-specific Cell Division Requires a Differential Onset of Zygotic Transcription during Metazoan Embryogenesis*

PubMed Central

Wong, Ming-Kin; Guan, Daogang; Ng, Kaoru Hon Chun; Ho, Vincy Wing Sze; An, Xiaomeng; Li, Runsheng; Ren, Xiaoliang

2016-01-01

Metazoan development demands not only precise cell fate differentiation but also accurate timing of cell division to ensure proper development. How cell divisions are temporally coordinated during development is poorly understood. Caenorhabditis elegans embryogenesis provides an excellent opportunity to study this coordination due to its invariant development and widespread division asynchronies. One of the most pronounced asynchronies is a significant delay of cell division in two endoderm progenitor cells, Ea and Ep, hereafter referred to as E2, relative to its cousins that mainly develop into mesoderm organs and tissues. To unravel the genetic control over the endoderm-specific E2 division timing, a total of 822 essential and conserved genes were knocked down using RNAi followed by quantification of cell cycle lengths using in toto imaging of C. elegans embryogenesis and automated lineage. Intriguingly, knockdown of numerous genes encoding the components of general transcription pathway or its regulatory factors leads to a significant reduction in the E2 cell cycle length but an increase in cell cycle length of the remaining cells, indicating a differential requirement of transcription for division timing between the two. Analysis of lineage-specific RNA-seq data demonstrates an earlier onset of transcription in endoderm than in other germ layers, the timing of which coincides with the birth of E2, supporting the notion that the endoderm-specific delay in E2 division timing demands robust zygotic transcription. The reduction in E2 cell cycle length is frequently associated with cell migration defect and gastrulation failure. The results suggest that a tissue-specific transcriptional activation is required to coordinate fate differentiation, division timing, and cell migration to ensure proper development. PMID:27056332

A Novel Microdeletion in 1(p34.2p34.3), Involving the "SLC2A1" ("GLUT1") Gene, and Severe Delayed Development

ERIC Educational Resources Information Center

Vermeer, Sascha; Koolen, David A; Visser, Gepke; Brackel, Hein J. L.; van der Burgt, Ineke; de Leeuw, Nicole; Willemsen, Michel A. A. P.; Sistermans, Erik A.; Pfundt, Rolph; de Vries, Bert B. A.

2007-01-01

A "de novo" 4.1-megabase microdeletion of chromosome 1p34.2p34.3 has been identified by array-based comparative genomic hybridization in a young male with severely delayed development, microcephaly, pronounced hypotonia, and facial dysmorphism. The deleted region encompasses 48 genes, among them the glucose transporter 1 ("SLC2A1" or "GLUT1")…

Genetic variation in melatonin pathway enzymes in children with autism spectrum disorder and comorbid sleep onset delay.

PubMed

Veatch, Olivia J; Pendergast, Julie S; Allen, Melissa J; Leu, Roberta M; Johnson, Carl Hirschie; Elsea, Sarah H; Malow, Beth A

2015-01-01

Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with comorbid expression of sleep onset delay. We evaluated variation in two melatonin pathway genes, acetylserotonin O-methyltransferase (ASMT) and cytochrome P450 1A2 (CYP1A2). We observed higher frequencies than currently reported (p < 0.04) for variants evidenced to decrease ASMT expression and related to decreased CYP1A2 enzyme activity (p ≤ 0.0007). We detected a relationship between genotypes in ASMT and CYP1A2 (r(2) = 0.63). Our results indicate that expression of sleep onset delay relates to melatonin pathway genes.

Toxic responses of Sox2 gene in the regeneration of the earthworm Eisenia foetida exposed to Retnoic acid.

PubMed

Tao, Jing; Rong, Wei; Diao, Xiaoping; Zhou, Hailong

2018-01-01

Exogenous retinoic acid delays and disturbs the regeneration of Eisenia foetida. The stem cell pluripotency factor, Sox2, can play a crucial role in cell reprogramming and dedifferentiation. In this study, we compared the regeneration of Eisenia foetida in different segments after amputation and the effects of retinoic acid on the regeneration of different segments. The results showed that the regeneration speed of the head and tail was slightly faster than the middle part, and retinoic acid disrupted and delayed the regeneration of the earthworm. The qRT-PCR and Western blot analysis showed that the expression of the Sox2 gene and Sox2 protein was highest on the seventh day in different segments (p<0.05). After treatment with retinoic acid, the expression level of the Sox2 gene and Sox2 protein was significantly reduced (p<0.05). The results indicated that the regeneration of earthworms and the formation of blastema are related to the expression of the Sox2 gene and protein. Retinoic acid delays and interferes with the regeneration of the earthworm by affecting the expression levels of the Sox2 gene and protein. Copyright © 2017 Elsevier Inc. All rights reserved.

Regulation of Zn and Fe transporters by the GPC1 gene during early wheat monocarpic senescence.

PubMed

Pearce, Stephen; Tabbita, Facundo; Cantu, Dario; Buffalo, Vince; Avni, Raz; Vazquez-Gross, Hans; Zhao, Rongrong; Conley, Christopher J; Distelfeld, Assaf; Dubcovksy, Jorge

2014-12-19

During wheat senescence, leaf components are degraded in a coordinated manner, releasing amino acids and micronutrients which are subsequently transported to the developing grain. We have previously shown that the simultaneous downregulation of Grain Protein Content (GPC) transcription factors, GPC1 and GPC2, greatly delays senescence and disrupts nutrient remobilization, and therefore provide a valuable entry point to identify genes involved in micronutrient transport to the wheat grain. We generated loss-of-function mutations for GPC1 and GPC2 in tetraploid wheat and showed in field trials that gpc1 mutants exhibit significant delays in senescence and reductions in grain Zn and Fe content, but that mutations in GPC2 had no significant effect on these traits. An RNA-seq study of these mutants at different time points showed a larger proportion of senescence-regulated genes among the GPC1 (64%) than among the GPC2 (37%) regulated genes. Combined, the two GPC genes regulate a subset (21.2%) of the senescence-regulated genes, 76.1% of which are upregulated at 12 days after anthesis, before the appearance of any visible signs of senescence. Taken together, these results demonstrate that GPC1 is a key regulator of nutrient remobilization which acts predominantly during the early stages of senescence. Genes upregulated at this stage include transporters from the ZIP and YSL gene families, which facilitate Zn and Fe export from the cytoplasm to the phloem, and genes involved in the biosynthesis of chelators that facilitate the phloem-based transport of these nutrients to the grains. This study provides an overview of the transport mechanisms activated in the wheat flag leaf during monocarpic senescence. It also identifies promising targets to improve nutrient remobilization to the wheat grain, which can help mitigate Zn and Fe deficiencies that afflict many regions of the developing world.

Mechanical induction of transitions into mesenchymal and amoeboid states

NASA Astrophysics Data System (ADS)

Liphardt, Jan

One of the fundamental mysteries of biology lies in the ability of cells to convert from one phenotype to another in response to external control inputs. We have been studying the Epithelial-to-Mesenchymal Transition (EMT), which allows organized assemblies of epithelial cells to scatter into lone mesenchymal cells. EMT is critical for normal development and wound healing, and may be important for cancer metastasis. I'll present recent data on disorganizing mammary epithelial structures. We have used CRISPR to insert fluorescent tags directly into eight EMT-related genes (such as E-cadherin and Vimentin), which allows us to monitor the dynamics of the transition in real time, subject only to delays imposed by fluorophore folding/maturation times. With this information, we can begin to order events in time (temporal resolution 30 minutes), starting with external signal inputs and proceeding through a secession of intracellular changes of gene expression on the path to the mesenchymal state.

Sex- and brain region-specific patterns of gene expression associated with socially-mediated puberty in a eusocial mammal

PubMed Central

Monks, D. Ashley; Zovkic, Iva B.; Holmes, Melissa M.

2018-01-01

The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropin-releasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty. PMID:29474488

Assessing co-regulation of directly linked genes in biological networks using microarray time series analysis.

PubMed

Del Sorbo, Maria Rosaria; Balzano, Walter; Donato, Michele; Draghici, Sorin

2013-11-01

Differential expression of genes detected with the analysis of high throughput genomic experiments is a commonly used intermediate step for the identification of signaling pathways involved in the response to different biological conditions. The impact analysis was the first approach for the analysis of signaling pathways involved in a certain biological process that was able to take into account not only the magnitude of the expression change of the genes but also the topology of signaling pathways including the type of each interactions between the genes. In the impact analysis, signaling pathways are represented as weighted directed graphs with genes as nodes and the interactions between genes as edges. Edges weights are represented by a β factor, the regulatory efficiency, which is assumed to be equal to 1 in inductive interactions between genes and equal to -1 in repressive interactions. This study presents a similarity analysis between gene expression time series aimed to find correspondences with the regulatory efficiency, i.e. the β factor as found in a widely used pathway database. Here, we focused on correlations among genes directly connected in signaling pathways, assuming that the expression variations of upstream genes impact immediately downstream genes in a short time interval and without significant influences by the interactions with other genes. Time series were processed using three different similarity metrics. The first metric is based on the bit string matching; the second one is a specific application of the Dynamic Time Warping to detect similarities even in presence of stretching and delays; the third one is a quantitative comparative analysis resulting by an evaluation of frequency domain representation of time series: the similarity metric is the correlation between dominant spectral components. These three approaches are tested on real data and pathways, and a comparison is performed using Information Retrieval benchmark tools, indicating the frequency approach as the best similarity metric among the three, for its ability to detect the correlation based on the correspondence of the most significant frequency components. Copyright © 2013. Published by Elsevier Ireland Ltd.

Biological consequences of earlier snowmelt from desert dust deposition in alpine landscapes.

PubMed

Steltzer, Heidi; Landry, Chris; Painter, Thomas H; Anderson, Justin; Ayres, Edward

2009-07-14

Dust deposition to mountain snow cover, which has increased since the late 19(th) century, accelerates the rate of snowmelt by increasing the solar radiation absorbed by the snowpack. Snowmelt occurs earlier, but is decoupled from seasonal warming. Climate warming advances the timing of snowmelt and early season phenological events (e.g., the onset of greening and flowering); however, earlier snowmelt without warmer temperatures may have a different effect on phenology. Here, we report the results of a set of snowmelt manipulations in which radiation-absorbing fabric and the addition and removal of dust from the surface of the snowpack advanced or delayed snowmelt in the alpine tundra. These changes in the timing of snowmelt were superimposed on a system where the timing of snowmelt varies with topography and has been affected by increased dust loading. At the community level, phenology exhibited a threshold response to the timing of snowmelt. Greening and flowering were delayed before seasonal warming, after which there was a linear relationship between the date of snowmelt and the timing of phenological events. Consequently, the effects of earlier snowmelt on phenology differed in relation to topography, which resulted in increasing synchronicity in phenology across the alpine landscape with increasingly earlier snowmelt. The consequences of earlier snowmelt from increased dust deposition differ from climate warming and include delayed phenology, leading to synchronized growth and flowering across the landscape and the opportunity for altered species interactions, landscape-scale gene flow via pollination, and nutrient cycling.

Biophysical modelling of early and delayed radiation damage at chromosome level

NASA Astrophysics Data System (ADS)

Andreev, S.; Eidelman, Y.

Exposure by ionising radiation increases cancer risk in human population Cancer is thought to originate from an altered expression of certain number of specific genes It is now widely recognised that chromosome aberrations CA are involved in stable change in expression of genes by gain or loss of their functions Thus CA can contribute to initiation or progression of cancer Therefore understanding mechanisms of CA formation in the course of cancer development might be valuable tool for quantification and prognosis of different stages of radiation carcinogenesis Early CA are defined as aberrations induced in first post-irradiation mitotic cycle The present work describes the original biophysical technique for early CA modelling It includes the following simulation steps the ionising particle track structure the structural organisation of all chromosomes in G 0 G 1 cell nucleus spatial distribution of radiation induced DNA double-strand breaks dsb within chromosomes dsb rejoining and misrejoining modelling cell cycle taking into account mitotic delay which results in complex time dependence of aberrant cells in first mitosis The results on prediction of dose-response curves for simple and complex CA measured in cells undergoing first division cycle are presented in comparison with recent experimental data There is increasing evidence that CA are also observed in descendents of irradiated cells many generations after direct DNA damage These delayed CA or chromosome instability CI are thought to be a manifestation of genome

[3-Hydroxy-isobutyryl-CoA hydrolase deficiency in a child with Leigh-like syndrome and literature review].

PubMed

Zhu, Hongmin; Bao, Xinhua; Zhang, Yao

2015-08-01

To investigate the clinical features and genetic characteristics of patients with 3-hydroxy-isobutyryl-CoA hydrolase (HIBCH) gene mutations. The clinical data of a patient with novel HIBCH mutations were collected, the related literature was searched from China National Knowledge Infrastructure, Wanfang Data Knowledge Service Platform, National Center for Biotechnology Information and PubMed (up to December 2014) by using search terms" HIBCH", "3-hydroxy-isobutyryl-CoA hydrolase" or "beta-Hydroxyisobutyryl CoA Deacylase Deficiency". The clinical features, neuroimage and treatment of the patients with HIBCH gene mutations were studied. The patient was a girl who was born at term after an uneventful pregnancy to non-consanguineous healthy parents, she was hospitalized at 5 years and 5 months of age because of development delay for 5 years and 5 months and abnormal posture on the left of body for more than 10 days. The family history was unremarkable. Her psychomotor development was significantly delayed. Three times brain MRI between 2. 5 years and 5 years of age revealed bilateral symmetrical lesions in basal ganglia. At the age of 5 years and 5 months, she presented with acute encephalopathy and severe extrapyramidal symptoms preceded by fever. At that time, her brain MRI revealed aggravated lesions in bilateral basal ganglia, new lesions in the midbrain cerebral peduncle and pons, and cerebellar atrophy. The results of biochemical tests were normal. A novel compound heterozygous mutation of HIBCH gene, c. 1027C > G, p. H343D and c. 79-1G > T, splicing, were found in the parent. Further study showed that c. 1027 C > G mutation was inherited from her father and c. 79-1 G > T from her mother. Her symptoms were mitigated after "cocktail" therapy and symptomatic treatment. Repeated brain MRI revealed that the lesion in basal ganglia got better, the lesions in brain stem disappeared. Literature relevant to HIBCH published all around the world was reviewed, no Chinese cases with HIBCH gene mutations had been reported, 6 foreign cases with HIBCH gene mutations were reported. Among them, 5 patients were diagnosed as Leigh-like syndrome, with progressive neurodegenerative course, and symmetrical basal ganglia lesions on brain MRI. Another case was reported in 1982, with developmental delay and various physical malformations without data on his brain MRI. HIBCH gene mutational analysis showed that 4 cases had homozygous mutations, which were c. 950G > A (p. G317E) in two brothers, c. 219 _220insTTGAATAG (p. K73fsX86) and c. 1128_1129insT (p. K377X) respectively. Three of them died before 3 years old. Two cases had compound heterozygous mutations: c. 365A > G (p. Y122C) and IVS2-3C > G (p. R27fsX50); c. 517 + 1G > A and c. 410C > T (p. A137V). They were alive at the time of the report. Patients with HIBCH gene mutation mainly presented as Leigh-like syndrome both in clinical manifestation and in neuroimage. HIBCH gene mutational analysis should be performed on children with Leigh-like syndrome, if the mutations of known genes of Leigh syndrome were negative.

A genomic lifespan program that reorganises the young adult brain is targeted in schizophrenia.

PubMed

Skene, Nathan G; Roy, Marcia; Grant, Seth Gn

2017-09-12

The genetic mechanisms regulating the brain and behaviour across the lifespan are poorly understood. We found that lifespan transcriptome trajectories describe a calendar of gene regulatory events in the brain of humans and mice. Transcriptome trajectories defined a sequence of gene expression changes in neuronal, glial and endothelial cell-types, which enabled prediction of age from tissue samples. A major lifespan landmark was the peak change in trajectories occurring in humans at 26 years and in mice at 5 months of age. This species-conserved peak was delayed in females and marked a reorganization of expression of synaptic and schizophrenia-susceptibility genes. The lifespan calendar predicted the characteristic age of onset in young adults and sex differences in schizophrenia. We propose a genomic program generates a lifespan calendar of gene regulation that times age-dependent molecular organization of the brain and mutations that interrupt the program in young adults cause schizophrenia.

Lipid overloading during liver regeneration causes delayed hepatocyte DNA replication by increasing ER stress in mice with simple hepatic steatosis.

PubMed

Hamano, Mina; Ezaki, Hisao; Kiso, Shinichi; Furuta, Kunimaro; Egawa, Mayumi; Kizu, Takashi; Chatani, Norihiro; Kamada, Yoshihiro; Yoshida, Yuichi; Takehara, Tetsuo

2014-02-01

Impaired fatty liver regeneration has already been reported in many genetic modification models. However, in diet-induced simple hepatic steatosis, which showed similar phenotype with clinical pathology, whether liver regeneration is impaired or not remains unclear. In this study, we evaluated liver regeneration in mice with diet-induced simple hepatic steatosis, and focused on excess lipid accumulation occurring during liver regeneration. Mice were fed high fat diet (HFD) or control diet for 9-10 weeks. We analyzed intrahepatic lipid accumulation, DNA replication, and various signaling pathways including cell proliferation and ER stress during liver regeneration after partial hepatectomy. In addition, some of mice were pretreated with tauroursodeoxycholic acid (TUDCA), a chemical chaperone which alleviates ER stress, and then we estimated TUDCA effects on liver regeneration. The peak of hepatocyte BrdU incorporation, the expression of proliferation cell nuclear antigen (PCNA) protein, and the expressions of cell cycle-related genes were observed in delayed time in HFD mice. The expression of phosphorylated Erk1/2 was also delayed in HFD mice. The amounts of liver triglyceride were at least twofold higher in HFD mice at each time point. Intrahepatic palmitic acid was increased especially in HFD mice. ER stress induced during liver regeneration was significantly higher in HFD mice. In HFD mice, pretreatment with TUDCA reduced ER stress and resulted in improvement of delayed liver regeneration. In simple hepatic steatosis, lipid overloading occurring during liver regeneration might be caused ER stress and results in delayed hepatocyte DNA replication.

Extended local similarity analysis (eLSA) of microbial community and other time series data with replicates.

PubMed

Xia, Li C; Steele, Joshua A; Cram, Jacob A; Cardon, Zoe G; Simmons, Sheri L; Vallino, Joseph J; Fuhrman, Jed A; Sun, Fengzhu

2011-01-01

The increasing availability of time series microbial community data from metagenomics and other molecular biological studies has enabled the analysis of large-scale microbial co-occurrence and association networks. Among the many analytical techniques available, the Local Similarity Analysis (LSA) method is unique in that it captures local and potentially time-delayed co-occurrence and association patterns in time series data that cannot otherwise be identified by ordinary correlation analysis. However LSA, as originally developed, does not consider time series data with replicates, which hinders the full exploitation of available information. With replicates, it is possible to understand the variability of local similarity (LS) score and to obtain its confidence interval. We extended our LSA technique to time series data with replicates and termed it extended LSA, or eLSA. Simulations showed the capability of eLSA to capture subinterval and time-delayed associations. We implemented the eLSA technique into an easy-to-use analytic software package. The software pipeline integrates data normalization, statistical correlation calculation, statistical significance evaluation, and association network construction steps. We applied the eLSA technique to microbial community and gene expression datasets, where unique time-dependent associations were identified. The extended LSA analysis technique was demonstrated to reveal statistically significant local and potentially time-delayed association patterns in replicated time series data beyond that of ordinary correlation analysis. These statistically significant associations can provide insights to the real dynamics of biological systems. The newly designed eLSA software efficiently streamlines the analysis and is freely available from the eLSA homepage, which can be accessed at http://meta.usc.edu/softs/lsa.

Extended local similarity analysis (eLSA) of microbial community and other time series data with replicates

PubMed Central

2011-01-01

Background The increasing availability of time series microbial community data from metagenomics and other molecular biological studies has enabled the analysis of large-scale microbial co-occurrence and association networks. Among the many analytical techniques available, the Local Similarity Analysis (LSA) method is unique in that it captures local and potentially time-delayed co-occurrence and association patterns in time series data that cannot otherwise be identified by ordinary correlation analysis. However LSA, as originally developed, does not consider time series data with replicates, which hinders the full exploitation of available information. With replicates, it is possible to understand the variability of local similarity (LS) score and to obtain its confidence interval. Results We extended our LSA technique to time series data with replicates and termed it extended LSA, or eLSA. Simulations showed the capability of eLSA to capture subinterval and time-delayed associations. We implemented the eLSA technique into an easy-to-use analytic software package. The software pipeline integrates data normalization, statistical correlation calculation, statistical significance evaluation, and association network construction steps. We applied the eLSA technique to microbial community and gene expression datasets, where unique time-dependent associations were identified. Conclusions The extended LSA analysis technique was demonstrated to reveal statistically significant local and potentially time-delayed association patterns in replicated time series data beyond that of ordinary correlation analysis. These statistically significant associations can provide insights to the real dynamics of biological systems. The newly designed eLSA software efficiently streamlines the analysis and is freely available from the eLSA homepage, which can be accessed at http://meta.usc.edu/softs/lsa. PMID:22784572

A rare de novo interstitial duplication of 15q15.3q21.2 in a boy with severe short stature, hypogonadism, global developmental delay and intellectual disability.

PubMed

Yuan, Haiming; Meng, Zhe; Zhang, Lina; Luo, Xiangyang; Liu, Liping; Chen, Mengfan; Li, Xinwei; Zhao, Weiwei; Liang, Liyang

2016-01-01

Interstitial duplications distal to 15q13 are very rare. Here, we reported a 14-year-old boy with severe short stature, delayed bone age, hypogonadism, global developmental delay and intellectual disability. His had distinctive facial features including macrocephaly, broad forehead, deep-set and widely spaced eyes, broad nose bridge, shallow philtrum and thick lips. A de novo 6.4 Mb interstitial duplication of 15q15.3q21.2 was detected by chromosomal microarray analysis. We compared our patient's clinical phenotypes with those of several individuals with overlapping duplications and several candidate genes responsible for the phenotypes were identified as well. The results suggest a novel contiguous gene duplication syndrome characterized with shared features including short stature, hypogonadism, global developmental delay and other congenital anomalies.

Use of NAP gene to manipulate leaf senescence in plants

DOEpatents

Gan, Susheng; Guo, Yongfeng

2013-04-16

The present invention discloses transgenic plants having an altered level of NAP protein compared to that of a non-transgenic plant, where the transgenic plants display an altered leaf senescence phenotype relative to a non-transgenic plant, as well as mutant plants comprising an inactivated NAP gene, where mutant plants display a delayed leaf senescence phenotype compared to that of a non-mutant plant. The present invention also discloses methods for delaying leaf senescence in a plant, as well as methods of making a mutant plant having a decreased level of NAP protein compared to that of a non-mutant plant, where the mutant plant displays a delayed leaf senescence phenotype relative to a non-mutant plant. Methods for causing precocious leaf senescence or promoting leaf senescence in a plant are also disclosed. Also disclosed are methods of identifying a candidate plant suitable for breeding that displays a delayed leaf senescence and/or enhanced yield phenotype.

Contrasting roles for MyoD in organizing myogenic promoter structures during embryonic skeletal muscle development.

PubMed

Cho, Ok Hyun; Mallappa, Chandrashekara; Hernández-Hernández, J Manuel; Rivera-Pérez, Jaime A; Imbalzano, Anthony N

2015-01-01

Among the complexities of skeletal muscle differentiation is a temporal distinction in the onset of expression of different lineage-specific genes. The lineage-determining factor MyoD is bound to myogenic genes at the onset of differentiation whether gene activation is immediate or delayed. How temporal regulation of differentiation-specific genes is established remains unclear. Using embryonic tissue, we addressed the molecular differences in the organization of the myogenin and muscle creatine kinase (MCK) gene promoters by examining regulatory factor binding as a function of both time and spatial organization during somitogenesis. At the myogenin promoter, binding of the homeodomain factor Pbx1 coincided with H3 hyperacetylation and was followed by binding of co-activators that modulate chromatin structure. MyoD and myogenin binding occurred subsequently, demonstrating that Pbx1 facilitates chromatin remodeling and modification before myogenic regulatory factor binding. At the same time, the MCK promoter was bound by HDAC2 and MyoD, and activating histone marks were largely absent. The association of HDAC2 and MyoD was confirmed by co-immunoprecipitation, proximity ligation assay (PLA), and sequential ChIP. MyoD differentially promotes activated and repressed chromatin structures at myogenic genes early after the onset of skeletal muscle differentiation in the developing mouse embryo. © 2014 Wiley Periodicals, Inc.

Ecstacy-induced delayed rhabdomyolysis and neuroleptic malignant syndrome in a patient with a novel variant in the ryanodine receptor type 1 gene.

PubMed

Russell, T; Riazi, S; Kraeva, N; Steel, A C; Hawryluck, L A

2012-09-01

We present the case of a 20-year-old woman who developed rhabdomyolysis, disseminated intravascular coagulopathy and multi-organ failure induced by ecstasy. Following initial improvement, she developed delayed rhabdomyolysis then haloperidol-induced neuroleptic malignant syndrome, which was treated with a total of 50 mg.kg(-1) dantrolene. Subsequent genetic testing revealed a novel potentially pathogenic variant in the ryanodine receptor type 1 gene. However, caffeine-halothane contracture testing of the patient's mother who carried the same gene variant was negative for malignant hyperthermia. Anaesthesia © 2012 The Association of Anaesthetists of Great Britain and Ireland.

Local Stability of AIDS Epidemic Model Through Treatment and Vertical Transmission with Time Delay

NASA Astrophysics Data System (ADS)

Novi W, Cascarilla; Lestari, Dwi

2016-02-01

This study aims to explain stability of the spread of AIDS through treatment and vertical transmission model. Human with HIV need a time to positively suffer AIDS. The existence of a time, human with HIV until positively suffer AIDS can be delayed for a time so that the model acquired is the model with time delay. The model form is a nonlinear differential equation with time delay, SIPTA (susceptible-infected-pre AIDS-treatment-AIDS). Based on SIPTA model analysis results the disease free equilibrium point and the endemic equilibrium point. The disease free equilibrium point with and without time delay are local asymptotically stable if the basic reproduction number is less than one. The endemic equilibrium point will be local asymptotically stable if the time delay is less than the critical value of delay, unstable if the time delay is more than the critical value of delay, and bifurcation occurs if the time delay is equal to the critical value of delay.

The effects of the framing of time on delay discounting.

PubMed

DeHart, William Brady; Odum, Amy L

2015-01-01

We examined the effects of the framing of time on delay discounting. Delay discounting is the process by which delayed outcomes are devalued as a function of time. Time in a titrating delay discounting task is often framed in calendar units (e.g., as 1 week, 1 month, etc.). When time is framed as a specific date, delayed outcomes are discounted less compared to the calendar format. Other forms of framing time; however, have not been explored. All participants completed a titrating calendar unit delay-discounting task for money. Participants were also assigned to one of two delay discounting tasks: time as dates (e.g., June 1st, 2015) or time in units of days (e.g., 5000 days), using the same delay distribution as the calendar delay-discounting task. Time framed as dates resulted in less discounting compared to the calendar method, whereas time framed as days resulted in greater discounting compared to the calendar method. The hyperboloid model fit best compared to the hyperbola and exponential models. How time is framed may alter how participants attend to the delays as well as how the delayed outcome is valued. Altering how time is framed may serve to improve adherence to goals with delayed outcomes. © Society for the Experimental Analysis of Behavior.

Identification of three signaling molecules required for calcineurin-dependent monopolar growth induced by the DNA replication checkpoint in fission yeast.

PubMed

Kume, Kazunori; Hashimoto, Tomoyo; Suzuki, Masashi; Mizunuma, Masaki; Toda, Takashi; Hirata, Dai

2017-09-30

Cell polarity is coordinately regulated with the cell cycle. Growth polarity of the fission yeast Schizosaccharomyces pombe transits from monopolar to bipolar during G2 phase, termed NETO (new end take off). Upon perturbation of DNA replication, the checkpoint kinase Cds1/CHK2 induces NETO delay through activation of Ca 2+ /calmodulin-dependent protein phosphatase calcineurin (CN). CN in turn regulates its downstream targets including the microtubule (MT) plus-end tracking CLIP170 homologue Tip1 and the Casein kinase 1γ Cki3. However, whether and which Ca 2+ signaling molecules are involved in the NETO delay remains elusive. Here we show that 3 genes (trp1322, vcx1 and SPAC6c3.06c encoding TRP channel, antiporter and P-type ATPase, respectively) play vital roles in the NETO delay. Upon perturbation of DNA replication, these 3 genes are required for not only the NETO delay but also for the maintenance of cell viability. Trp1322 and Vcx1 act downstream of Cds1 and upstream of CN for the NETO delay, whereas SPAC6c3.06c acts downstream of CN. Consistently, Trp1322 and Vcx1, but not SPAC6c3.06c, are essential for activation of CN. Interestingly, we have found that elevated extracellular Ca 2+ per se induces a NETO delay, which depends on CN and its downstream target genes. These findings imply that Ca 2+ -CN signaling plays a central role in cell polarity control by checkpoint activation. Copyright © 2017 Elsevier Inc. All rights reserved.

Abnormal electroretinogram associated with developmental brain anomalies.

PubMed Central

Cibis, G W; Fitzgerald, K M

1995-01-01

PURPOSE: We have encountered abnormal ERGs associated with optic nerve hypoplasia, macular, optic nerve and chorioretinal colobomata and developmental brain anomalies. Brain anomalies include cortical dysgenesis, lissencephaly, porencephaly, cerebellar and corpus callosum hypoplasia. We describe six exemplar cases. METHODS: Scotopic and photopic ERGs adherent to international standards were performed as well as photopic ERGs to long-duration stimuli. CT or MRI studies were also done. The ERGs were compared to age-matched normal control subjects. RESULTS: ERG changes include reduced amplitude b-waves to blue and red stimuli under scotopic testing conditions. Implicit times were often delayed. The photopic responses also showed reduced amplitude a- and b-waves with implicit time delays. The long-duration photopic ERG done in one case shows attenuation of both ON- and OFF-responses. CONCLUSIONS: Common underlying developmental genetic or environmental unifying casualties are speculated to be at fault in causing these cases of associated retinal and brain abnormalities. No single etiology is expected. Multiple potential causes acting early in embryogenesis effecting neuronal induction, migration and differentiation are theorized. These occur at a time when brain and retinal cells are sufficiently undifferentiated to be similarly effected. We call these cases examples of Brain Retina Neuroembryodysgenesis (BRNED). Homeobox and PAX genes with global neuronal developmental influences are gene candidates to unify the observed disruption of brain and retinal cell development. The ERG can provide a valuable clinical addition in understanding and ultimately classifying these disorders. Images FIGURE 1 FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 7 FIGURE 8 PMID:8719676

Transcription and translation of the sigG gene is tuned for proper execution of the switch from early to late gene expression in the developing Bacillus subtilis spore

PubMed Central

Mearls, Elizabeth B.; Jackter, Jacquelin; Colquhoun, Jennifer M.; Matthews, Allison J.; Fenton, Colleen

2018-01-01

A cascade of alternative sigma factors directs developmental gene expression during spore formation by the bacterium Bacillus subtilis. As the spore develops, a tightly regulated switch occurs in which the early-acting sigma factor σF is replaced by the late-acting sigma factor σG. The gene encoding σG (sigG) is transcribed by σF and by σG itself in an autoregulatory loop; yet σG activity is not detected until σF-dependent gene expression is complete. This separation in σF and σG activities has been suggested to be due at least in part to a poorly understood intercellular checkpoint pathway that delays sigG expression by σF. Here we report the results of a careful examination of sigG expression during sporulation. Unexpectedly, our findings argue against the existence of a regulatory mechanism to delay sigG transcription by σF and instead support a model in which sigG is transcribed by σF with normal timing, but at levels that are very low. This low-level expression of sigG is the consequence of several intrinsic features of the sigG regulatory and coding sequence—promoter spacing, secondary structure potential of the mRNA, and start codon identity—that dampen its transcription and translation. Especially notable is the presence of a conserved hairpin in the 5’ leader sequence of the sigG mRNA that occludes the ribosome-binding site, reducing translation by up to 4-fold. Finally, we demonstrate that misexpression of sigG from regulatory and coding sequences lacking these features triggers premature σG activity in the forespore during sporulation, as well as inappropriate σG activity during vegetative growth. Altogether, these data indicate that transcription and translation of the sigG gene is tuned to prevent vegetative expression of σG and to ensure the precise timing of the switch from σF to σG in the developing spore. PMID:29702640

Serotonin Transporter Promoter Region (5-HTTLPR) Polymorphism Is Not Associated With Paroxetine-Induced Ejaculation Delay in Dutch Men With Lifelong Premature Ejaculation

PubMed Central

Janssen, Paddy K.C.; Zwinderman, Aeilko H.; Olivier, Berend

2014-01-01

Purpose To investigate the association between the 5-HT-transporter-gene-linked promoter region (5-HTTLPR) polymorphism and 20-mg paroxetine-induced ejaculation delay in men with lifelong premature ejaculation (LPE). Materials and Methods This was a prospective study of 10 weeks of paroxetine treatment in 54 men with LPE. Intravaginal ejaculation latency time (IELT) was measured by stopwatch. Controls consisted of 92 Caucasian men. All men with LPE were genotyped for the 5-HTTLPR polymorphism. Allele frequencies and genotypes of short (S) and long (L) variants of the polymorphism were compared between patients and controls. Associations between the LL, SL, and SS genotypes and fold increase of mean IELT were investigated. Results Of the 54 patients, 43 (79.6%) responded to 20-mg paroxetine treatment with an ejaculation delay, whereas 11 patients (20.4%) did not respond; 44%, 18%, and 18% of the patients showed a fold increase in mean IELT of 2-10, 10-20, and more than 20, respectively. Of the 54 men, 14 (25.9%) had the LL genotype, 29 (53.7%) had the SL genotype, and 11 (20.4%) had the SS genotype. In the 92 controls, the LL, SL, and SS genotypes were present in 27 (29.3%), 41 (44.6%), and 24 (26.1%), respectively. No statistically significant differences were found in 5-HTTLPR allelic variations or in 5-HTTLPR gene variations. In all men treated with 20 mg paroxetine, analysis of variance of the natural logarithm of fold increase in the IELT showed no statistically significant difference according to genotype (p=0.83). Conclusions The 5-HTTLPR polymorphism is not associated with daily 20-mg paroxetine treatment-induced ejaculation delay in men with LPE. PMID:24578810

Predicted RNA Binding Proteins Pes4 and Mip6 Regulate mRNA Levels, Translation, and Localization during Sporulation in Budding Yeast.

PubMed

Jin, Liang; Zhang, Kai; Sternglanz, Rolf; Neiman, Aaron M

2017-05-01

In response to starvation, diploid cells of Saccharomyces cerevisiae undergo meiosis and form haploid spores, a process collectively referred to as sporulation. The differentiation into spores requires extensive changes in gene expression. The transcriptional activator Ndt80 is a central regulator of this process, which controls many genes essential for sporulation. Ndt80 induces ∼300 genes coordinately during meiotic prophase, but different mRNAs within the NDT80 regulon are translated at different times during sporulation. The protein kinase Ime2 and RNA binding protein Rim4 are general regulators of meiotic translational delay, but how differential timing of individual transcripts is achieved was not known. This report describes the characterization of two related NDT80 -induced genes, PES4 and MIP6 , encoding predicted RNA binding proteins. These genes are necessary to regulate the steady-state expression, translational timing, and localization of a set of mRNAs that are transcribed by NDT80 but not translated until the end of meiosis II. Mutations in the predicted RNA binding domains within PES4 alter the stability of target mRNAs. PES4 and MIP6 affect only a small portion of the NDT80 regulon, indicating that they act as modulators of the general Ime2/Rim4 pathway for specific transcripts. Copyright © 2017 American Society for Microbiology.

Dynamics of scroll waves with time-delay propagation in excitable media

NASA Astrophysics Data System (ADS)

Chen, Jiang-Xing; Xiao, Jie; Qiao, Li-Yan; Xu, Jiang-Rong

2018-06-01

Information transmission delay can be widely observed in various systems. Here, we study the dynamics of scroll waves with time-delay propagation among slices in excitable media. Weak time delay induces scroll waves to meander. Through increasing the time delay, we find a series of dynamical transitions. Firstly, the straight filament of a scroll wave becomes twisted. Then, the scroll wave breaks and forms interesting patterns. With long time delay, loosed scroll waves are maintained while their period are greatly decreased. Also, cylinder waves appears. The influences of diffusively coupling strength on the time-delay-induced scroll waves are studied. It is found that the critical time delay characterizing those transitions decreases as the coupling strength is increased. A phase diagram in the diffusive coupling-time delay plane is presented.

49 CFR 236.563 - Delay time.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Delay time. 236.563 Section 236.563 Transportation... Cab Signal Systems Rules and Instructions; Locomotives § 236.563 Delay time. Delay time of automatic... requirements of § 236.24 shall take into consideration the delay time. ...

49 CFR 236.563 - Delay time.

Code of Federal Regulations, 2014 CFR

2014-10-01

... 49 Transportation 4 2014-10-01 2014-10-01 false Delay time. 236.563 Section 236.563 Transportation... Cab Signal Systems Rules and Instructions; Locomotives § 236.563 Delay time. Delay time of automatic... requirements of § 236.24 shall take into consideration the delay time. ...

A Drought-Inducible Transcription Factor Delays Reproductive Timing in Rice.

PubMed

Zhang, Chunyu; Liu, Jun; Zhao, Tao; Gomez, Adam; Li, Cong; Yu, Chunsheng; Li, Hongyu; Lin, Jianzhong; Yang, Yuanzhu; Liu, Bin; Lin, Chentao

2016-05-01

The molecular mechanisms underlying photoperiod or temperature control of flowering time have been recently elucidated, but how plants regulate flowering time in response to other external factors, such as water availability, remains poorly understood. Using a large-scale Hybrid Transcription Factor approach, we identified a bZIP transcriptional factor, O. sativa ABA responsive element binding factor 1 (OsABF1), which acts as a suppressor of floral transition in a photoperiod-independent manner. Simultaneous knockdown of both OsABF1 and its closest homologous gene, OsbZIP40, in rice (Oryza sativa) by RNA interference results in a significantly earlier flowering phenotype. Molecular and genetic analyses demonstrate that a drought regime enhances expression of the OsABF1 gene, which indirectly suppresses expression of the Early heading date 1 (Ehd1) gene that encodes a key activator of rice flowering. Furthermore, we identified a drought-inducible gene named OsWRKY104 that is under the direct regulation of OsABF1 Overexpression of OsWRKY104 can suppress Ehd1 expression and confers a later flowering phenotype in rice. Together, these findings reveal a novel pathway by which rice modulates heading date in response to the change of ambient water availability. © 2016 American Society of Plant Biologists. All Rights Reserved.

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Selenium delays tomato fruit ripening by inhibiting ethylene biosynthesis and enhancing the antioxidant defense system.

PubMed

Zhu, Zhu; Chen, Yanli; Shi, Guoqing; Zhang, Xueji

2017-03-15

The antioxidant activity of selenium (Se) detoxifies reactive oxygen species (ROS) in plants and animals. In the present study, we elucidated the mechanism underlying Se induced fruit development and ripening. Our study showed that foliar pretreatment with 1mgL -1 sodium selenate effectively delayed fruit ripening and maintained fruit quality. Gene expression studies revealed that the repression of ethylene biosynthetic genes 1-aminocyclopropane-1-carboxylic acid (ACC) synthase and ACC oxidase decreased ethylene production and respiration rate. Moreover, Se treatment probably boosted the antioxidant defense system to reduce ROS generation and membrane damage. The enhanced antioxidative effect was attributed to higher glutathione content and increased activity of enzymes such as glutathione peroxidase and glutathione reductase. The upregulation of respiratory burst oxidase homologue genes in tomato fruit may also contribute to the enhanced antioxidative effect. Selenium treatment represents a promising strategy for delaying ripening and extending the shelf life of tomato fruit. Copyright © 2016 Elsevier Ltd. All rights reserved.

Wigner time delay in photodetachment of Tm-and in photoionization of Yb: A comparative study

NASA Astrophysics Data System (ADS)

Saha, Soumyajit; Jose, Jobin; Deshmukh, Pranawa; Dolmatov, Valeriy; Kheifets, Anatoli; Manson, Steven

2017-04-01

Preliminary studies of Wigner time delay in photodetachment spectra of negative ions have been reported. Photodetachment time delay for some dipole channels of Tm- and of Cl- were calculated using relativistic random phase approximation (RRPA). Comparisons between photodetachment time delay of Cl- and photoionization time delay of Ar were made. We investigate the photodetachment time delay for all three relativistically split nd -> ɛ f channels of Tm- and for nd -> ɛ f channels of Yb (isoelectronic to Tm-) using RRPA. We study the effect of the shape resonance, brought about by the centrifugal barrier potential, on photodetachment time delay. A negative ion is a good laboratory for studying the effects of shape resonances on time delay since the phase is unaffected by the Coulomb component. Wigner time delay in photodetachment of Tm- and in photoionization of Yb: A comparative study.

Hybrid modeling in biochemical systems theory by means of functional petri nets.

PubMed

Wu, Jialiang; Voit, Eberhard

2009-02-01

Many biological systems are genuinely hybrids consisting of interacting discrete and continuous components and processes that often operate at different time scales. It is therefore desirable to create modeling frameworks capable of combining differently structured processes and permitting their analysis over multiple time horizons. During the past 40 years, Biochemical Systems Theory (BST) has been a very successful approach to elucidating metabolic, gene regulatory, and signaling systems. However, its foundation in ordinary differential equations has precluded BST from directly addressing problems containing switches, delays, and stochastic effects. In this study, we extend BST to hybrid modeling within the framework of Hybrid Functional Petri Nets (HFPN). First, we show how the canonical GMA and S-system models in BST can be directly implemented in a standard Petri Net framework. In a second step we demonstrate how to account for different types of time delays as well as for discrete, stochastic, and switching effects. Using representative test cases, we validate the hybrid modeling approach through comparative analyses and simulations with other approaches and highlight the feasibility, quality, and efficiency of the hybrid method.

Effects of partial time delays on phase synchronization in Watts-Strogatz small-world neuronal networks.

PubMed

Sun, Xiaojuan; Perc, Matjaž; Kurths, Jürgen

2017-05-01

In this paper, we study effects of partial time delays on phase synchronization in Watts-Strogatz small-world neuronal networks. Our focus is on the impact of two parameters, namely the time delay τ and the probability of partial time delay p delay , whereby the latter determines the probability with which a connection between two neurons is delayed. Our research reveals that partial time delays significantly affect phase synchronization in this system. In particular, partial time delays can either enhance or decrease phase synchronization and induce synchronization transitions with changes in the mean firing rate of neurons, as well as induce switching between synchronized neurons with period-1 firing to synchronized neurons with period-2 firing. Moreover, in comparison to a neuronal network where all connections are delayed, we show that small partial time delay probabilities have especially different influences on phase synchronization of neuronal networks.

Delay-range-dependent chaos synchronization approach under varying time-lags and delayed nonlinear coupling.

PubMed

Zaheer, Muhammad Hamad; Rehan, Muhammad; Mustafa, Ghulam; Ashraf, Muhammad

2014-11-01

This paper proposes a novel state feedback delay-range-dependent control approach for chaos synchronization in coupled nonlinear time-delay systems. The coupling between two systems is esteemed to be nonlinear subject to time-lags. Time-varying nature of both the intrinsic and the coupling delays is incorporated to broad scope of the present study for a better-quality synchronization controller synthesis. Lyapunov-Krasovskii (LK) functional is employed to derive delay-range-dependent conditions that can be solved by means of the conventional linear matrix inequality (LMI)-tools. The resultant control approach for chaos synchronization of the master-slave time-delay systems considers non-zero lower bound of the intrinsic as well as the coupling time-delays. Further, the delay-dependent synchronization condition has been established as a special case of the proposed LK functional treatment. Furthermore, a delay-range-dependent condition, independent of the delay-rate, has been provided to address the situation when upper bound of the delay-derivative is unknown. A robust state feedback control methodology is formulated for synchronization of the time-delay chaotic networks against the L2 norm bounded perturbations by minimizing the L2 gain from the disturbance to the synchronization error. Numerical simulation results are provided for the time-delay chaotic networks to show effectiveness of the proposed delay-range-dependent chaos synchronization methodologies. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

A novel polyketide biosynthesis gene cluster is involved in fruiting body morphogenesis in the filamentous fungi Sordaria macrospora and Neurospora crassa.

PubMed

Nowrousian, Minou

2009-04-01

During fungal fruiting body development, hyphae aggregate to form multicellular structures that protect and disperse the sexual spores. Analysis of microarray data revealed a gene cluster strongly upregulated during fruiting body development in the ascomycete Sordaria macrospora. Real time PCR analysis showed that the genes from the orthologous cluster in Neurospora crassa are also upregulated during development. The cluster encodes putative polyketide biosynthesis enzymes, including a reducing polyketide synthase. Analysis of knockout strains of a predicted dehydrogenase gene from the cluster showed that mutants in N. crassa and S. macrospora are delayed in fruiting body formation. In addition to the upregulated cluster, the N. crassa genome comprises another cluster containing a polyketide synthase gene, and five additional reducing polyketide synthase (rpks) genes that are not part of clusters. To study the role of these genes in sexual development, expression of the predicted rpks genes in S. macrospora (five genes) and N. crassa (six genes) was analyzed; all but one are upregulated during sexual development. Analysis of knockout strains for the N. crassa rpks genes showed that one of them is essential for fruiting body formation. These data indicate that polyketides produced by RPKSs are involved in sexual development in filamentous ascomycetes.

Downhole delay assembly for blasting with series delay

DOEpatents

Ricketts, Thomas E.

1982-01-01

A downhole delay assembly is provided which can be placed into a blasthole for initiation of explosive in the blasthole. The downhole delay assembly includes at least two detonating time delay devices in series in order to effect a time delay of longer than about 200 milliseconds in a round of explosions. The downhole delay assembly provides a protective housing to prevent detonation of explosive in the blasthole in response to the detonation of the first detonating time delay device. There is further provided a connection between the first and second time delay devices. The connection is responsive to the detonation of the first detonating time delay device and initiates the second detonating time delay device. A plurality of such downhole delay assemblies are placed downhole in unfragmented formation and are initiated simultaneously for providing a round of explosive expansions. The explosive expansions can be used to form an in situ oil shale retort containing a fragmented permeable mass of formation particles.

Parenting Predictors of Delay Inhibition in Socioeconomically Disadvantaged Preschoolers

PubMed Central

Merz, Emily C.; Landry, Susan H.; Zucker, Tricia A.; Barnes, Marcia A.; Assel, Michael; Taylor, Heather B.; Lonigan, Christopher J.; Phillips, Beth M.; Clancy-Menchetti, Jeanine; Eisenberg, Nancy; Spinrad, Tracy L.; Valiente, Carlos; de Villiers, Jill; Consortium, the School Readiness Research

2016-01-01

This study examined longitudinal associations between specific parenting factors and delay inhibition in socioeconomically disadvantaged preschoolers. At Time 1, parents and 2- to 4-year-old children (mean age = 3.21 years; N = 247) participated in a videotaped parent-child free play session, and children completed delay inhibition tasks (gift delay-wrap, gift delay-bow, and snack delay tasks). Three months later, at Time 2, children completed the same set of tasks. Parental responsiveness was coded from the parent-child free play sessions, and parental directive language was coded from transcripts of a subset of 127 of these sessions. Structural equation modeling was used, and covariates included age, gender, language skills, parental education, and Time 1 delay inhibition. Results indicated that in separate models, Time 1 parental directive language was significantly negatively associated with Time 2 delay inhibition, and Time 1 parental responsiveness was significantly positively associated with Time 2 delay inhibition. When these parenting factors were entered simultaneously, Time 1 parental directive language significantly predicted Time 2 delay inhibition whereas Time 1 parental responsiveness was no longer significant. Findings suggest that parental language that modulates the amount of autonomy allotted the child may be an important predictor of early delay inhibition skills. PMID:27833461

Comparison of transcript profiles in different life stages of the nematode Globodera pallida under different host potato genotypes.

PubMed

Palomares-Rius, Juan E; Hedley, Pete E; Cock, Peter J A; Morris, Jenny A; Jones, John T; Vovlas, Nikos; Blok, Vivian

2012-12-01

The potato cyst nematodes (PCNs) Globodera pallida and Globodera rostochiensis are important parasites of potato. PCNs undergo complex biotrophic interactions with their hosts that involve gene expression changes in both the nematode and the host plant. The aim of this study was to determine key genes that are differentially expressed in Globodera pallida life cycle stages and during the initiation of the feeding site in susceptible and partially resistant potato genotypes. For this purpose, two microarray experiments were designed: (i) a comparison of eggs, infective second-stage juveniles (J2s) and sedentary parasitic-stage J2s (SJ2); (ii) a comparison of SJ2s at 8 days after inoculation (DAI) in the susceptible cultivar (Desirée) and two partially resistant lines. The results showed differential expression of G. pallida genes during the stages studied, including previously characterized effectors. In addition, a large number of genes changed their expression between SJ2s in the susceptible cultivar and those infecting partially resistant lines; the number of genes with modified expression was lower when the two partially resistant lines were compared. Moreover, a histopathological study was performed at several time points (7, 14 and 30 DAI) and showed the similarities between both partially resistant lines with a delay and degeneration in the formation of the syncytia in comparison with the susceptible cultivar. Females at 30 DAI in partially resistant lines showed a delay in their development in comparison with those in the susceptible cultivar. © 2012 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

Muscle segment homeobox genes direct embryonic diapause by limiting inflammation in the uterus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cha, Jeeyeon; Burnum-Johnson, Kristin E.; Bartos, Amanda

Embryonic diapause (delayed implantation) is a reproductive strategy widespread in the animal kingdom. Under this condition, embryos at the blastocyst stage become dormant simultaneously with uterine quiescence until environmental or physiological conditions are favorable for the survival of the mother and newborn. Under favorable conditions, activation of the blastocyst and uterus ensues with implantation and progression of pregnancy. Although endocrine factors are known to participate in this process, the underlying molecular mechanism coordinating this phenomenon is not clearly understood. We recently found that uterine muscle segment homeobox (Msx) transcription factors are critical for the initiation and maintenance of delayed implantationmore » in mice. To better understand why Msx genes are critical for delayed implantation, we compared uterine proteomics profiles between littermate floxed (Msx1/Msx2f/f) mice and mice with uterine deletion of Msx genes (Msx1/Msx2d/d) under delayed conditions. In Msx1/Msx2d/d uteri, pathways including protein translation, ubiquitin-proteasome system, inflammation, chaperone-mediated protein folding, and endoplasmic reticulum (ER) stress were enriched, and computational modeling showed intersection of these pathways on inflammatory responses. Indeed, increases in the ubiquitin-proteasome system and inflammation conformed to proteotoxic and ER stress in Msx1/Msx2d/d uteri under delayed conditions. Interestingly, treatment with a proteasome inhibitor bortezomib further exacerbated ER stress in Msx1/Msx2d/d uteri with aggravated inflammatory response, deteriorating rate of blastocyst recovery and failure to sustain delayed implantation. This study highlights a previously unrecognized role for Msx in preventing proteotoxic stress and inflammatory responses to coordinate embryo dormancy and uterine quiescence during embryonic diapause.« less

A role for Lin-28 in growth and metamorphosis in Drosophila melanogaster.

PubMed

González-Itier, Sergio; Contreras, Esteban G; Larraín, Juan; Glavic, Álvaro; Faunes, Fernando

2018-06-13

Insect metamorphosis has been a classic model to understand the role of hormones in growth and timing of developmental transitions. In addition to hormones, transitions in some species are regulated by genetic programs, such as the heterochronic gene network discovered in C. elegans. However, the functional link between hormones and heterochronic genes is not clear. The heterochronic gene lin-28 is involved in the maintenance of stem cells, growth and developmental timing in vertebrates. In this work, we used gain-of-function and loss-of-function experiments to study the role of Lin-28 in larval growth and the timing of metamorphosis of Drosophila melanogaster. During the late third instar stage, Lin-28 is mainly expressed in neurons of the central nervous system and in the intestine. Loss-of-function lin-28 mutant larvae are smaller and the larval-to-pupal transition is accelerated. This faster transition correlates with increased levels of ecdysone direct target genes such as Broad-Complex (BR-C) and Ecdysone Receptor (EcR). Overexpression of Lin-28 does not affect the timing of pupariation but most animals are not able to eclose, suggesting defects in metamorphosis. Overexpression of human Lin-28 results in delayed pupariation and the death of animals during metamorphosis. Altogether, these results suggest that Lin-28 is involved in the control of growth during larval development and in the timing and progression of metamorphosis. Copyright © 2017. Published by Elsevier B.V.

Variability of the caprine whey protein genes and their association with milk yield, composition and renneting properties in the Sarda breed. 1. The LALBA gene.

PubMed

Dettori, Maria Luisa; Pazzola, Michele; Paschino, Pietro; Pira, Maria Giovanna; Vacca, Giuseppe Massimo

2015-11-01

The 5' flanking region and 3' UTR of the caprine LALBA gene were analysed by SSCP and sequencing. A total of nine SNPs were detected: three in the promoter region, two were synonymous coding SNPs at exon-1, and four SNPs were in exon-4, within the 3'UTR. The nucleotide changes located in the promoter region (c.-358T>C, c.-163G>A, c.-121T>G) were genotyped by SSCP in 263 Sarda goats to evaluate their possible effect on milk yield, composition and renneting properties. We observed an effect of the three SNPs on milk yield and lactose content. Genotypes TT and CT at c.-358T>C (P A (P C and c.-121T>G were part of transcription factors binding sites, potentially involved in modulating the LALBA gene expression. The LALBA genotype affected renneting properties (P < 0.001), as heterozygotes c.-358CT and c.-163GA were characterised by delayed rennet coagulation time and curd firming time and the lowest value of curd firmness. The present investigation increases the panel of SNPs and adds new information about the effects of the caprine LALBA gene polymorphism.

Promising role of ANGPTL4 gene in diabetic wound healing.

PubMed

Arya, Awadhesh K; Tripathi, Kamlakar; Das, Parimal

2014-03-01

Diabetes mellitus (DM) is one of the severe metabolic disorders of carbohydrate metabolism worldwide. Developing countries are at higher risk of DM, and there is significant evidence that it is epidemic in many economically developing and newly industrialized countries. Among all other complications associated with DM, delayed wound healing is a major concern in diabetic patients. Wound healing is a natural healing process that starts immediately after injury. This involves interaction of a complex cascade of cellular events that generates resurfacing, reconstitution, and restoration of the tensile strength of injured skin. There are multiple factors responsible for delayed wound healing among which the contribution of DM has been well documented. The wound healing process is also delayed by the metabolic, vascular, neurological, and inflammatory alterations, which are well known in both type 1 and type 2 diabetes. Keratinocytes are crucial for wound re-epithelialization, and defects in directed migration of keratinocytes due to DM are associated with the delayed wound healing process. Many factors responsible for re-epithelialization have been identified, characterized, and well described; however, the genes responsible for the healing process have only partially been illustrated. This article will therefore focus on the efficacy of ANGPTL4 (angiopoietin-like 4) gene, which plays a novel role in keratinocyte migration during wound healing.

Time-delayed feedback control of diffusion in random walkers.

PubMed

Ando, Hiroyasu; Takehara, Kohta; Kobayashi, Miki U

2017-07-01

Time delay in general leads to instability in some systems, while specific feedback with delay can control fluctuated motion in nonlinear deterministic systems to a stable state. In this paper, we consider a stochastic process, i.e., a random walk, and observe its diffusion phenomenon with time-delayed feedback. As a result, the diffusion coefficient decreases with increasing delay time. We analytically illustrate this suppression of diffusion by using stochastic delay differential equations and justify the feasibility of this suppression by applying time-delayed feedback to a molecular dynamics model.

Effect of thyroid hormone concentration on the transcriptional response underlying induced metamorphosis in the Mexican axolotl (Ambystoma)

PubMed Central

Page, Robert B; Voss, Stephen R; Samuels, Amy K; Smith, Jeramiah J; Putta, Srikrishna; Beachy, Christopher K

2008-01-01

Background Thyroid hormones (TH) induce gene expression programs that orchestrate amphibian metamorphosis. In contrast to anurans, many salamanders do not undergo metamorphosis in nature. However, they can be induced to undergo metamorphosis via exposure to thyroxine (T4). We induced metamorphosis in juvenile Mexican axolotls (Ambystoma mexicanum) using 5 and 50 nM T4, collected epidermal tissue from the head at four time points (Days 0, 2, 12, 28), and used microarray analysis to quantify mRNA abundances. Results Individuals reared in the higher T4 concentration initiated morphological and transcriptional changes earlier and completed metamorphosis by Day 28. In contrast, initiation of metamorphosis was delayed in the lower T4 concentration and none of the individuals completed metamorphosis by Day 28. We identified 402 genes that were statistically differentially expressed by ≥ two-fold between T4 treatments at one or more non-Day 0 sampling times. To complement this analysis, we used linear and quadratic regression to identify 542 and 709 genes that were differentially expressed by ≥ two-fold in the 5 and 50 nM T4 treatments, respectively. Conclusion We found that T4 concentration affected the timing of gene expression and the shape of temporal gene expression profiles. However, essentially all of the identified genes were similarly affected by 5 and 50 nM T4. We discuss genes and biological processes that appear to be common to salamander and anuran metamorphosis, and also highlight clear transcriptional differences. Our results show that gene expression in axolotls is diverse and precise, and that axolotls provide new insights about amphibian metamorphosis. PMID:18267027

Effect of thyroid hormone concentration on the transcriptional response underlying induced metamorphosis in the Mexican axolotl (Ambystoma).

PubMed

Page, Robert B; Voss, Stephen R; Samuels, Amy K; Smith, Jeramiah J; Putta, Srikrishna; Beachy, Christopher K

2008-02-11

Thyroid hormones (TH) induce gene expression programs that orchestrate amphibian metamorphosis. In contrast to anurans, many salamanders do not undergo metamorphosis in nature. However, they can be induced to undergo metamorphosis via exposure to thyroxine (T4). We induced metamorphosis in juvenile Mexican axolotls (Ambystoma mexicanum) using 5 and 50 nM T4, collected epidermal tissue from the head at four time points (Days 0, 2, 12, 28), and used microarray analysis to quantify mRNA abundances. Individuals reared in the higher T4 concentration initiated morphological and transcriptional changes earlier and completed metamorphosis by Day 28. In contrast, initiation of metamorphosis was delayed in the lower T4 concentration and none of the individuals completed metamorphosis by Day 28. We identified 402 genes that were statistically differentially expressed by > or = two-fold between T4 treatments at one or more non-Day 0 sampling times. To complement this analysis, we used linear and quadratic regression to identify 542 and 709 genes that were differentially expressed by > or = two-fold in the 5 and 50 nM T4 treatments, respectively. We found that T4 concentration affected the timing of gene expression and the shape of temporal gene expression profiles. However, essentially all of the identified genes were similarly affected by 5 and 50 nM T4. We discuss genes and biological processes that appear to be common to salamander and anuran metamorphosis, and also highlight clear transcriptional differences. Our results show that gene expression in axolotls is diverse and precise, and that axolotls provide new insights about amphibian metamorphosis.

Inhibition of androgen receptor by decoy molecules delays progression to castration-recurrent prostate cancer.

PubMed

Myung, Jae-Kyung; Wang, Gang; Chiu, Helen H L; Wang, Jun; Mawji, Nasrin R; Sadar, Marianne D

2017-01-01

Androgen receptor (AR) is a member of the steroid receptor family and a therapeutic target for all stages of prostate cancer. AR is activated by ligand binding within its C-terminus ligand-binding domain (LBD). Here we show that overexpression of the AR NTD to generate decoy molecules inhibited both the growth and progression of prostate cancer in castrated hosts. Specifically, it was shown that lentivirus delivery of decoys delayed hormonal progression in castrated hosts as indicated by increased doubling time of tumor volume, prolonged time to achieve pre-castrate levels of serum prostate-specific antigen (PSA) and PSA nadir. These clinical parameters are indicative of delayed hormonal progression and improved therapeutic response and prognosis. Decoys reduced the expression of androgen-regulated genes that correlated with reduced in situ interaction of the AR with androgen response elements. Decoys did not reduce levels of AR protein or prevent nuclear localization of the AR. Nor did decoys interact directly with the AR. Thus decoys did not inhibit AR transactivation by a dominant negative mechanism. This work provides evidence that the AR NTD plays an important role in the hormonal progression of prostate cancer and supports the development of AR antagonists that target the AR NTD.

Inhibition of androgen receptor by decoy molecules delays progression to castration-recurrent prostate cancer

PubMed Central

Myung, Jae-Kyung; Wang, Gang; Chiu, Helen H. L.; Wang, Jun; Mawji, Nasrin R.; Sadar, Marianne D.

2017-01-01

Androgen receptor (AR) is a member of the steroid receptor family and a therapeutic target for all stages of prostate cancer. AR is activated by ligand binding within its C-terminus ligand-binding domain (LBD). Here we show that overexpression of the AR NTD to generate decoy molecules inhibited both the growth and progression of prostate cancer in castrated hosts. Specifically, it was shown that lentivirus delivery of decoys delayed hormonal progression in castrated hosts as indicated by increased doubling time of tumor volume, prolonged time to achieve pre-castrate levels of serum prostate-specific antigen (PSA) and PSA nadir. These clinical parameters are indicative of delayed hormonal progression and improved therapeutic response and prognosis. Decoys reduced the expression of androgen-regulated genes that correlated with reduced in situ interaction of the AR with androgen response elements. Decoys did not reduce levels of AR protein or prevent nuclear localization of the AR. Nor did decoys interact directly with the AR. Thus decoys did not inhibit AR transactivation by a dominant negative mechanism. This work provides evidence that the AR NTD plays an important role in the hormonal progression of prostate cancer and supports the development of AR antagonists that target the AR NTD. PMID:28306720

CONSTANS-like 9 (COL9) delays the flowering time in Oryza sativa by repressing the Ehd1 pathway.

PubMed

Liu, Hao; Gu, Fengwei; Dong, Shuangyu; Liu, Wei; Wang, Hui; Chen, Zhiqiang; Wang, Jiafeng

2016-10-14

Flowering or heading is one of most important agronomic traits in rice. It has been characterized that CONSTANS (CO) and CONSTANS-like (COL) proteins are critical flowering regulators in response to photoperiodic stress in plants. We have previously identified that the COL family member OsCOL9 can positively enhance the rice blast resistance. In the present study, we aimed to explore the functional role of OsCOL9 in modulating the photoperiodic flowering. Our data showed that overexpression of OsCOL9 delayed the flowering time under both short-day (SD) and long-day (LD) conditions, leading to suppressed expressions of EHd1, RFT and Hd3a at the mRNA Level. OsCOL9 expression exhibited two types of circadian patterns under different daylight conditions, and it could delay the heading date by suppressing the Ehd1 photoperiodic flowering pathway. In contrast, the expressions of previously reported flowering regulators were not significantly changed in OsCOL9 transgenic plants, indicating that OsCOL9 functioned independently of other flowering pathways. In addition, OsCOL9 served as a potential yield gene, and its deficiency reduced the grain number of main panicle in plants. Furthermore, yeast two-hybrid assay indicated that OsCOL9 physically interacted with Receptor for Activated C-kinase 1 (OsRACK1). Rhythmic pattern analysis suggested that OsRACK1 responded to the change of daylight, which was regulated by the circadian clock. Taken together, our results revealed that OsCOL9 could delay the flowering time in rice by repressing the Ehd1 pathway. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1.

PubMed

Hoppe, U C; Marbán, E; Johns, D C

2001-04-24

The long QT syndrome (LQTS) is a heritable disorder that predisposes to sudden cardiac death. LQTS is caused by mutations in ion channel genes including HERG and KCNE1, but the precise mechanisms remain unclear. To clarify this situation we injected adenoviral vectors expressing wild-type or LQT mutants of HERG and KCNE1 into guinea pig myocardium. End points at 48-72 h included electrophysiology in isolated myocytes and electrocardiography in vivo. HERG increased the rapid component, I(Kr), of the delayed rectifier current, thereby accelerating repolarization, increasing refractoriness, and diminishing beat-to-beat action potential variability. Conversely, HERG-G628S suppressed I(Kr) without significantly delaying repolarization. Nevertheless, HERG-G628S abbreviated refractoriness and increased beat-to-beat variability, leading to early afterdepolarizations (EADs). KCNE1 increased the slow component of the delayed rectifier, I(Ks), without clear phenotypic sequelae. In contrast, KCNE1-D76N suppressed I(Ks) and markedly slowed repolarization, leading to frequent EADs and electrocardiographic QT prolongation. Thus, the two genes predispose to sudden death by distinct mechanisms: the KCNE1 mutant flagrantly undermines cardiac repolarization, and HERG-G628S subtly facilitates the genesis and propagation of premature beats. Our ability to produce electrocardiographic long QT in vivo with a clinical KCNE1 mutation demonstrates the utility of somatic gene transfer in creating genotype-specific disease models.

Key changes in denervated muscles and their impact on regeneration and reinnervation

PubMed Central

Wu, Peng; Chawla, Aditya; Spinner, Robert J.; Yu, Cong; Yaszemski, Michael J.; Windebank, Anthony J.; Wang, Huan

2014-01-01

The neuromuscular junction becomes progressively less receptive to regenerating axons if nerve repair is delayed for a long period of time. It is difficult to ascertain the denervated muscle's residual receptivity by time alone. Other sensitive markers that closely correlate with the extent of denervation should be found. After a denervated muscle develops a fibrillation potential, muscle fiber conduction velocity, muscle fiber diameter, muscle wet weight, and maximal isometric force all decrease; remodeling increases neuromuscular junction fragmentation and plantar area, and expression of myogenesis-related genes is initially up-regulated and then down-regulated. All these changes correlate with both the time course and degree of denervation. The nature and time course of these denervation changes in muscle are reviewed from the literature to explore their roles in assessing both the degree of detrimental changes and the potential success of a nerve repair. Fibrillation potential amplitude, muscle fiber conduction velocity, muscle fiber diameter, mRNA expression levels of myogenic regulatory factors and nicotinic acetylcholine receptor could all reflect the severity and length of denervation and the receptiveness of denervated muscle to regenerating axons, which could possibly offer an important clue for surgical choices and predict the outcomes of delayed nerve repair. PMID:25422641

Mutations in HIVEP2 are associated with developmental delay, intellectual disability, and dysmorphic features.

PubMed

Steinfeld, Hallie; Cho, Megan T; Retterer, Kyle; Person, Rick; Schaefer, G Bradley; Danylchuk, Noelle; Malik, Saleem; Wechsler, Stephanie Burns; Wheeler, Patricia G; van Gassen, Koen L I; Terhal, P A; Verhoeven, Virginie J M; van Slegtenhorst, Marjon A; Monaghan, Kristin G; Henderson, Lindsay B; Chung, Wendy K

2016-07-01

Human immunodeficiency virus type I enhancer binding protein 2 (HIVEP2) has been previously associated with intellectual disability and developmental delay in three patients. Here, we describe six patients with developmental delay, intellectual disability, and dysmorphic features with de novo likely gene-damaging variants in HIVEP2 identified by whole-exome sequencing (WES). HIVEP2 encodes a large transcription factor that regulates various neurodevelopmental pathways. Our findings provide further evidence that pathogenic variants in HIVEP2 lead to intellectual disabilities and developmental delay.

Effects of partial time delays on phase synchronization in Watts-Strogatz small-world neuronal networks

NASA Astrophysics Data System (ADS)

Sun, Xiaojuan; Perc, Matjaž; Kurths, Jürgen

2017-05-01

In this paper, we study effects of partial time delays on phase synchronization in Watts-Strogatz small-world neuronal networks. Our focus is on the impact of two parameters, namely the time delay τ and the probability of partial time delay pdelay, whereby the latter determines the probability with which a connection between two neurons is delayed. Our research reveals that partial time delays significantly affect phase synchronization in this system. In particular, partial time delays can either enhance or decrease phase synchronization and induce synchronization transitions with changes in the mean firing rate of neurons, as well as induce switching between synchronized neurons with period-1 firing to synchronized neurons with period-2 firing. Moreover, in comparison to a neuronal network where all connections are delayed, we show that small partial time delay probabilities have especially different influences on phase synchronization of neuronal networks.

Effect of time delay on surgical performance during telesurgical manipulation.

PubMed

Fabrizio, M D; Lee, B R; Chan, D Y; Stoianovici, D; Jarrett, T W; Yang, C; Kavoussi, L R

2000-03-01

Telementoring allows a less experienced surgeon to benefit from an expert surgical consultation, reducing cost, travel, and the learning curve associated with new procedures. However, there are several technical limitations that affect practical applications. One potentially serious problem is the time delay that occurs any time data are transferred across long distances. To date, the effect of time delay on surgical performance has not been studied. A two-phase trial was designed to examine the effect of time delay on surgical performance. In the first phase, a series of tasks was performed, and the numbers of robotic movements required for completion was counted. Programmed incremental time delays were made in audiovisual acquisition and robotic controls. The number of errors made while performing each task at various time delay intervals was noted. In the second phase, a remote surgeon in Baltimore performed the tasks 9000 miles away in Singapore. The number of errors made was recorded. As the time delay increased, the number of operator errors increased. The accuracy needed to perform remote robotic procedures was diminished as the time delay increased. A learning curve did exist for each task, but as the time delay interval increased, it took longer to complete the task. Time delay does affect surgical performance. There is an acceptable delay of <700 msec in which surgeons can compensate for this phenomenon. Clinical studies will be needed to evaluate the true impact of time delay.

Finite time synchronization of memristor-based Cohen-Grossberg neural networks with mixed delays.

PubMed

Chen, Chuan; Li, Lixiang; Peng, Haipeng; Yang, Yixian

2017-01-01

Finite time synchronization, which means synchronization can be achieved in a settling time, is desirable in some practical applications. However, most of the published results on finite time synchronization don't include delays or only include discrete delays. In view of the fact that distributed delays inevitably exist in neural networks, this paper aims to investigate the finite time synchronization of memristor-based Cohen-Grossberg neural networks (MCGNNs) with both discrete delay and distributed delay (mixed delays). By means of a simple feedback controller and novel finite time synchronization analysis methods, several new criteria are derived to ensure the finite time synchronization of MCGNNs with mixed delays. The obtained criteria are very concise and easy to verify. Numerical simulations are presented to demonstrate the effectiveness of our theoretical results.

Hsp70 protects from stroke in atrial fibrillation patients by preventing thrombosis without increased bleeding risk.

PubMed

Allende, Mikel; Molina, Eva; Guruceaga, Elisabet; Tamayo, Ibai; González-Porras, José Ramón; Gonzalez-López, Tomás José; Toledo, Estefanía; Rabal, Obdulia; Ugarte, Ana; Roldán, Vanesa; Rivera, José; Oyarzabal, Julen; Montes, Ramón; Hermida, José

2016-06-01

Atrial fibrillation (AF) is a major risk factor for cardio-embolic stroke. Anticoagulant drugs are effective in preventing AF-related stroke. However, the high frequency of anticoagulant-associated major bleeding is a major concern. This study sought to identify new targets to develop safer antithrombotic therapies. Here, microarray analysis in peripheral blood cells in eight patients with AF and stroke and eight AF subjects without stroke brought to light a stroke-related gene expression pattern. HSPA1B, which encodes for heat-shock protein 70 kDa (Hsp70), was the most differentially expressed gene. This gene was down-regulated in stroke subjects, a finding confirmed further in an independent AF cohort of 200 individuals. Hsp70 knock-out mice subjected to different thrombotic challenges developed thrombosis significantly earlier than their wild-type (WT) counterparts. Remarkably, the tail bleeding time was unchanged. Accordingly, both TRC051384 and tubastatin A, i.e. two Hsp70 inducers via different pathways, delayed thrombus formation in WT mice, the tail bleeding time still being unaltered. Most interestingly, Hsp70 inducers did not increase the bleeding risk even when aspirin was concomitantly administered. Hsp70 induction was associated with an increased vascular thrombomodulin expression and higher circulating levels of activated protein C upon thrombotic stimulus. Hsp70 induction is a novel approach to delay thrombus formation with minimal bleeding risk, and is especially promising for treating AF patients and in other situations where there is also a major bleeding hazard. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2016. For permissions please email: journals.permissions@oup.com.

Heterochronic opsin expression due to early light deprivation results in drastically shifted visual sensitivity in a cichlid fish: Possible role of thyroid hormone signaling.

PubMed

Karagic, Nidal; Härer, Andreas; Meyer, Axel; Torres-Dowdall, Julián

2018-06-14

During early ontogeny, visual opsin gene expression in cichlids is influenced by prevailing light regimen. Red light, for example, leads to an early switch from the expression of short-wavelength sensitive to long-wavelength sensitive opsins. Here, we address the influence of light deprivation on opsin expression. Individuals reared in constant darkness during the first 14 days post-hatching (dph) showed a general developmental delay compared with fish reared under a 12:12 hr light-dark cycle (control group). Several characters including pigmentation patterns and eye development, appeared later in dark-reared individuals. Quantitative real-time PCR and fluorescent in situ hybridization at six time points during the 14 days period revealed that fish from the control group expressed opsin genes from 5 dph on and maintained a short-wavelength sensitive phenotype (sws1, rh2b, and rh2a). Onset of opsin expression in dark-reared Midas cichlids was delayed by 4 days and visual sensitivity rapidly progressed toward a long-wavelength sensitive phenotype (sws2b, rh2a, and lws). Shifts in visual sensitivities toward longer wavelengths are mediated by thyroid hormone (TH) in many vertebrates. Compared to control fish, dark-reared individuals showed elevated dio3 expression levels - a validated proxy for TH concentration - suggesting higher circulating TH levels. Despite decelerated overall development, ontogeny of opsin gene expression was accelerated, resulting in retinae with long-wavelength shifted predicted sensitivities compared to light-reared individuals. Indirect evidence suggests that this was due to altered TH metabolism. © 2018 Wiley Periodicals, Inc.

Hericium erinaceus extracts alter behavioral rhythm in mice.

PubMed

Furuta, Shoko; Kuwahara, Rika; Hiraki, Eri; Ohnuki, Koichiro; Yasuo, Shinobu; Shimizu, Kuniyoshi

2016-01-01

Hericium erinaceus (HE), an edible mushroom, has been used as a herbal medicine in several Asian countries since ancient times. HE has potential as a medicine for the treatment and prevention of dementia, a disorder closely linked with circadian rhythm. This study investigated the effects of the intake of HE extracts on behavioral rhythm, photosensitivity of the circadian clock, and clock gene mRNA expression in the suprachiasmatic nucleus (SCN), a central clock, in mice. Although the HE ethanol extract only affected the offset time of activity, the HE water extract advanced the sleep-wake cycle without affecting the free-running period, photosensitivity, or the clock gene mRNA expression in SCN. In addition, both extracts decreased wakefulness around end of active phase. The findings of the present study suggest that HE may serve as a functional food in the prevention and treatment of Alzheimer's disease and delayed sleep phase syndrome.

Time-delayed chameleon: Analysis, synchronization and FPGA implementation

NASA Astrophysics Data System (ADS)

Rajagopal, Karthikeyan; Jafari, Sajad; Laarem, Guessas

2017-12-01

In this paper we report a time-delayed chameleon-like chaotic system which can belong to different families of chaotic attractors depending on the choices of parameters. Such a characteristic of self-excited and hidden chaotic flows in a simple 3D system with time delay has not been reported earlier. Dynamic analysis of the proposed time-delayed systems are analysed in time-delay space and parameter space. A novel adaptive modified functional projective lag synchronization algorithm is derived for synchronizing identical time-delayed chameleon systems with uncertain parameters. The proposed time-delayed systems and the synchronization algorithm with controllers and parameter estimates are then implemented in FPGA using hardware-software co-simulation and the results are presented.

The time delay in strong gravitational lensing with Gauss-Bonnet correction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Man, Jingyun; Cheng, Hongbo, E-mail: jingyunman@mail.ecust.edu.cn, E-mail: hbcheng@ecust.edu.cn

2014-11-01

The time delay between two relativistic images in the strong gravitational lensing governed by Gauss-Bonnet gravity is studied. We make a complete analytical derivation of the expression of time delay in presence of Gauss-Bonnet coupling. With respect to Schwarzschild, the time delay decreases as a consequence of the shrinking of the photon sphere. As the coupling increases, the second term in the time delay expansion becomes more relevant. Thus time delay in strong limit encodes some new information about geometry in five-dimensional spacetime with Gauss-Bonnet correction.

Genomic responses in rat cerebral cortex after traumatic brain injury

PubMed Central

von Gertten, Christina; Morales, Amilcar Flores; Holmin, Staffan; Mathiesen, Tiit; Nordqvist, Ann-Christin Sandberg

2005-01-01

Background Traumatic brain injury (TBI) initiates a complex sequence of destructive and neuroprotective cellular responses. The initial mechanical injury is followed by an extended time period of secondary brain damage. Due to the complicated pathological picture a better understanding of the molecular events occurring during this secondary phase of injury is needed. This study was aimed at analysing gene expression patterns following cerebral cortical contusion in rat using high throughput microarray technology with the goal of identifying genes involved in an early and in a more delayed phase of trauma, as genomic responses behind secondary mechanisms likely are time-dependent. Results Among the upregulated genes 1 day post injury, were transcription factors and genes involved in metabolism, e.g. STAT-3, C/EBP-δ and cytochrome p450. At 4 days post injury we observed increased gene expression of inflammatory factors, proteases and their inhibitors, like cathepsins, α-2-macroglobulin and C1q. Notably, genes with biological function clustered to immune response were significantly upregulated 4 days after injury, which was not found following 1 day. Osteopontin and one of its receptors, CD-44, were both upregulated showing a local mRNA- and immunoreactivity pattern in and around the injury site. Fewer genes had decreased expression both 1 and 4 days post injury and included genes implicated in transport, metabolism, signalling, and extra cellular matrix formation, e.g. vitronectin, neuroserpin and angiotensinogen. Conclusion The different patterns of gene expression, with little overlap in genes, 1 and 4 days post injury showed time dependence in genomic responses to trauma. An early induction of factors involved in transcription could lead to the later inflammatory response with strongly upregulated CD-44 and osteopontin expression. An increased knowledge of genes regulating the pathological mechanisms in trauma will help to find future treatment targets. Since trauma is a risk factor for development of neurodegenerative disease, this knowledge may also reduce late negative effects. PMID:16318630

Collection media and delayed freezing effects on microbial composition of human stool.

PubMed

Flores, Roberto; Shi, Jianxin; Yu, Guoqin; Ma, Bing; Ravel, Jacques; Goedert, James J; Sinha, Rashmi

2015-01-01

Different bacteria in stool have markedly varied growth and survival when stored at ambient temperature. It is paramount to develop optimal biostabilization of stool samples during collection and assess long-term storage for clinical specimens and epidemiological microbiome studies. We evaluated the effect of collection media and delayed freezing up to 7 days on microbial composition. Ten participants collected triplicate stool samples each into no media as well as RNAlater® with and without kanamycin or ciprofloxacin. For each set of conditions, triplicate samples were frozen on dry ice immediately (time = 0) or frozen at -80 °C after 3-days and 7-days incubation at 25 °C. Microbiota metrics were estimated from Illumina MiSeq sequences of 16S rRNA gene fragments (V3-V4 region). Intraclass correlation coefficients (ICC) across triplicates, collection media, and incubation time were estimated for taxonomy and alpha and beta diversity metrics. RNAlater® alone yielded the highest ICCs for diversity metrics at time = 0 [ICC median 0.935 (range 0.89-0.97)], but ICCs varied greatly (range 0.44-1.0) for taxa with relative abundances <1%. The 3- and 7-day freezing delays were generally associated with stable beta diversity for all three media conditions. Freezing delay caused increased variance for Shannon index (median ICC 0.77) and especially for observed species abundance (median ICC 0.47). Variance in observed species abundance and in phylogenetic distance whole tree was similarly increased with a 7-day delay. Antibiotics did not mitigate variance. No media had inferior ICCs at time 0 and differed markedly from any media in microbiome composition (e.g., P =0.01 for relative abundance of Bacteroidetes). Bacterial community composition was stable for 7 days at room temperature in RNAlater® alone. RNAlater® provides some stability for beta diversity analyses, but analyses of rare taxa will be inaccurate if specimens are not frozen immediately. RNAlater® could be used as collection media with minimal change in the microbiota composition.

Improving diagnosis and broadening the phenotypes in early-onset seizure and severe developmental delay disorders through gene panel analysis.

PubMed

Trump, Natalie; McTague, Amy; Brittain, Helen; Papandreou, Apostolos; Meyer, Esther; Ngoh, Adeline; Palmer, Rodger; Morrogh, Deborah; Boustred, Christopher; Hurst, Jane A; Jenkins, Lucy; Kurian, Manju A; Scott, Richard H

2016-05-01

We sought to investigate the diagnostic yield and mutation spectrum in previously reported genes for early-onset epilepsy and disorders of severe developmental delay. In 400 patients with these disorders with no known underlying aetiology and no major structural brain anomaly, we analysed 46 genes using a combination of targeted sequencing on an Illumina MiSeq platform and targeted, exon-level microarray copy number analysis. We identified causative mutations in 71/400 patients (18%). The diagnostic rate was highest among those with seizure onset within the first two months of life (39%), although overall it was similar in those with and without seizures. The most frequently mutated gene was SCN2A (11 patients, 3%). Other recurrently mutated genes included CDKL5, KCNQ2, SCN8A (six patients each), FOXG1, MECP2, SCN1A, STXBP1 (five patients each), KCNT1, PCDH19, TCF4 (three patients each) and ATP1A3, PRRT2 and SLC9A6 (two patients each). Mutations in EHMT1, GABRB3, LGI1, MBD5, PIGA, UBE3A and ZEB2 were each found in single patients. We found mutations in a number of genes in patients where either the electroclinical features or dysmorphic phenotypes were atypical for the identified gene. In only 11 cases (15%) had the clinician sufficient certainty to specify the mutated gene as the likely cause before testing. Our data demonstrate the considerable utility of a gene panel approach in the diagnosis of patients with early-onset epilepsy and severe developmental delay disorders., They provide further insights into the phenotypic spectrum and genotype-phenotype correlations for a number of the causative genes and emphasise the value of exon-level copy number testing in their analysis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Leukoencephalopathy with thalamus and brainstem involvement and high lactate caused by novel mutations in the EARS2 gene in two siblings.

PubMed

Şahin, Sevim; Cansu, Ali; Kalay, Ersan; Dinçer, Tuba; Kul, Sibel; Çakır, İsmet Miraç; Kamaşak, Tülay; Budak, Gülden Yorgancıoğlu

2016-06-15

Leukoencephalopathy with thalamus and brainstem involvement, and high lactate (LTBL) is a recently identified disease related to mutations in the EARS2 gene encoding glutamyl-tRNA synthetase. We report clinical and radiological findings for two siblings with new pathogenic mutations in the EARS2 gene. Both patients showed symptoms of mild-type disease, but there were clinical differences between the two siblings. While the older brother had hypotonia and delayed developmental milestones, the younger brother had seizures and spasticity in the lower extremities. Brain magnetic resonance imaging (MRI) findings were quite similar for the two siblings. MRI findings were specific to LTBL. MRI lesions of the older sibling had regressed over time. Clinical and radiological improvement, as in the previously reported patients with LTBL, may be an important clue for diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

Uptake, Results, and Outcomes of Germline Multiple-Gene Sequencing After Diagnosis of Breast Cancer.

PubMed

Kurian, Allison W; Ward, Kevin C; Hamilton, Ann S; Deapen, Dennis M; Abrahamse, Paul; Bondarenko, Irina; Li, Yun; Hawley, Sarah T; Morrow, Monica; Jagsi, Reshma; Katz, Steven J

2018-05-10

Low-cost sequencing of multiple genes is increasingly available for cancer risk assessment. Little is known about uptake or outcomes of multiple-gene sequencing after breast cancer diagnosis in community practice. To examine the effect of multiple-gene sequencing on the experience and treatment outcomes for patients with breast cancer. For this population-based retrospective cohort study, patients with breast cancer diagnosed from January 2013 to December 2015 and accrued from SEER registries across Georgia and in Los Angeles, California, were surveyed (n = 5080, response rate = 70%). Responses were merged with SEER data and results of clinical genetic tests, either BRCA1 and BRCA2 (BRCA1/2) sequencing only or including additional other genes (multiple-gene sequencing), provided by 4 laboratories. Type of testing (multiple-gene sequencing vs BRCA1/2-only sequencing), test results (negative, variant of unknown significance, or pathogenic variant), patient experiences with testing (timing of testing, who discussed results), and treatment (strength of patient consideration of, and surgeon recommendation for, prophylactic mastectomy), and prophylactic mastectomy receipt. We defined a patient subgroup with higher pretest risk of carrying a pathogenic variant according to practice guidelines. Among 5026 patients (mean [SD] age, 59.9 [10.7]), 1316 (26.2%) were linked to genetic results from any laboratory. Multiple-gene sequencing increasingly replaced BRCA1/2-only testing over time: in 2013, the rate of multiple-gene sequencing was 25.6% and BRCA1/2-only testing, 74.4%;in 2015 the rate of multiple-gene sequencing was 66.5% and BRCA1/2-only testing, 33.5%. Multiple-gene sequencing was more often ordered by genetic counselors (multiple-gene sequencing, 25.5% and BRCA1/2-only testing, 15.3%) and delayed until after surgery (multiple-gene sequencing, 32.5% and BRCA1/2-only testing, 19.9%). Multiple-gene sequencing substantially increased rate of detection of any pathogenic variant (multiple-gene sequencing: higher-risk patients, 12%; average-risk patients, 4.2% and BRCA1/2-only testing: higher-risk patients, 7.8%; average-risk patients, 2.2%) and variants of uncertain significance, especially in minorities (multiple-gene sequencing: white patients, 23.7%; black patients, 44.5%; and Asian patients, 50.9% and BRCA1/2-only testing: white patients, 2.2%; black patients, 5.6%; and Asian patients, 0%). Multiple-gene sequencing was not associated with an increase in the rate of prophylactic mastectomy use, which was highest with pathogenic variants in BRCA1/2 (BRCA1/2, 79.0%; other pathogenic variant, 37.6%; variant of uncertain significance, 30.2%; negative, 35.3%). Multiple-gene sequencing rapidly replaced BRCA1/2-only testing for patients with breast cancer in the community and enabled 2-fold higher detection of clinically relevant pathogenic variants without an associated increase in prophylactic mastectomy. However, important targets for improvement in the clinical utility of multiple-gene sequencing include postsurgical delay and racial/ethnic disparity in variants of uncertain significance.

Expression Profiling of Castanea Genes during Resistant and Susceptible Interactions with the Oomycete Pathogen Phytophthora cinnamomi Reveal Possible Mechanisms of Immunity

PubMed Central

Santos, Carmen; Duarte, Sofia; Tedesco, Sara; Fevereiro, Pedro; Costa, Rita L.

2017-01-01

The most dangerous pathogen affecting the production of chestnuts is Phytophthora cinnamomi a hemibiotrophic that causes root rot, also known as ink disease. Little information has been acquired in chestnut on the molecular defense strategies against this pathogen. The expression of eight candidate genes potentially involved in the defense to P. cinnamomi was quantified by digital PCR in Castanea genotypes showing different susceptibility to the pathogen. Seven of the eight candidate genes displayed differentially expressed levels depending on genotype and time-point after inoculation. Cast_Gnk2-like revealed to be the most expressed gene across all experiments and the one that best discriminates between susceptible and resistant genotypes. Our data suggest that the pre-formed defenses are crucial for the resistance of C. crenata to P. cinnamomi. A lower and delayed expression of the eight studied genes was found in the susceptible Castanea sativa, which may be related with the establishment and spread of the disease in this species. A working model integrating the obtained results is presented. PMID:28443110

Histone Deacetylase Inhibitors Prolong Cardiac Repolarization through Transcriptional Mechanisms.

PubMed

Spence, Stan; Deurinck, Mark; Ju, Haisong; Traebert, Martin; McLean, LeeAnne; Marlowe, Jennifer; Emotte, Corinne; Tritto, Elaine; Tseng, Min; Shultz, Michael; Friedrichs, Gregory S

2016-09-01

Histone deacetylase (HDAC) inhibitors are an emerging class of anticancer agents that modify gene expression by altering the acetylation status of lysine residues of histone proteins, thereby inducing transcription, cell cycle arrest, differentiation, and cell death or apoptosis of cancer cells. In the clinical setting, treatment with HDAC inhibitors has been associated with delayed cardiac repolarization and in rare instances a lethal ventricular tachyarrhythmia known as torsades de pointes. The mechanism(s) of HDAC inhibitor-induced effects on cardiac repolarization is unknown. We demonstrate that administration of structurally diverse HDAC inhibitors to dogs causes delayed but persistent increases in the heart rate corrected QT interval (QTc), an in vivo measure of cardiac repolarization, at timepoints far removed from the Tmax for parent drug and metabolites. Transcriptional profiling of ventricular myocardium from dogs treated with various HDAC inhibitors demonstrated effects on genes involved in protein trafficking, scaffolding and insertion of various ion channels into the cell membrane as well as genes for specific ion channel subunits involved in cardiac repolarization. Extensive in vitro ion channel profiling of various structural classes of HDAC inhibitors (and their major metabolites) by binding and acute patch clamp assays failed to show any consistent correlations with direct ion channel blockade. Drug-induced rescue of an intracellular trafficking-deficient mutant potassium ion channel, hERG (G601S), and decreased maturation (glycosylation) of wild-type hERG expressed by CHO cells in vitro correlated with prolongation of QTc intervals observed in vivo The results suggest that HDAC inhibitor-induced prolongation of cardiac repolarization may be mediated in part by transcriptional changes of genes required for ion channel trafficking and localization to the sarcolemma. These data have broad implications for the development of these drug classes and suggest that the optimal time to assess potentially transcriptionally mediated physiologic effects will be delayed relative to an epigenetic drug's Tmax/Cmax. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Cold exposure inhibits hypothalamic Kiss-1 gene expression, serum leptin concentration, and delays reproductive development in male Brandt's vole ( Lasiopodomys brandtii)

NASA Astrophysics Data System (ADS)

Zhang, Qiang; Lin, Yi; Zhang, Xue-Ying; Wang, De-Hua

2015-06-01

Cold commonly affects growth and reproductive development in small mammals. Here, we test the hypothesis that low ambient temperature will affect growth and puberty onset, associated with altered hypothalamic Kiss-1 gene expression and serum leptin concentration in wild rodents. Male Brandt's voles ( Lasiopodomys brandtii) were exposed to cold (4 ± 1 °C) and warm (23 ± 1 °C) conditions from the birth and sacrificed on different developmental stages (day 26, day 40, day 60, and day 90, respectively). Brandt's voles increased the thermogenic capacity of brown adipose tissue, mobilized body fat, decreased serum leptin levels, and delayed the reproductive development especially on day 40 in the cold condition. They increased food intake to compensate for the high energy demands in the cold. The hypothalamic Kiss-1 gene expression on day 26 was decreased, associated with lower wet testis mass and testis testosterone concentration on day 40, in the cold-exposed voles compared to that in the warm. Serum leptin was positively correlated with body fat, testis mass, and testosterone concentration. These data suggested that cold exposure inhibited hypothalamic Kiss-1 gene expression during the early stage of development, decreased serum leptin concentration, and delayed reproductive development in male Brandt's voles.

Effect of Time Delay on Recognition Memory for Pictures: The Modulatory Role of Emotion

PubMed Central

Wang, Bo

2014-01-01

This study investigated the modulatory role of emotion in the effect of time delay on recognition memory for pictures. Participants viewed neutral, positive and negative pictures, and took a recognition memory test 5 minutes, 24 hours, or 1 week after learning. The findings are: 1) For neutral, positive and negative pictures, overall recognition accuracy in the 5-min delay did not significantly differ from that in the 24-h delay. For neutral and positive pictures, overall recognition accuracy in the 1-week delay was lower than in the 24-h delay; for negative pictures, overall recognition in the 24-h and 1-week delay did not significantly differ. Therefore negative emotion modulates the effect of time delay on recognition memory, maintaining retention of overall recognition accuracy only within a certain frame of time. 2) For the three types of pictures, recollection and familiarity in the 5-min delay did not significantly differ from that in the 24-h and the 1-week delay. Thus emotion does not appear to modulate the effect of time delay on recollection and familiarity. However, recollection in the 24-h delay was higher than in the 1-week delay, whereas familiarity in the 24-h delay was lower than in the 1-week delay. PMID:24971457

A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

PubMed

Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

2016-12-15

PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

Angular dependence of EWS time delay for photoionization of @Xe

NASA Astrophysics Data System (ADS)

Mandal, Ankur; Deshmukh, Pranawa; Kheifets, Anatoli; Dolmatov, Valeriy; Manson, Steven

2017-04-01

Interference between photoionization channels leads to angular dependence in photoionization time delay. Angular dependence is found to be a common effect for two-photon absorption experiments very recently. The effect of confinement on the time delay where each partial wave contributions to the ionization are studied. In this work we report angular dependence and confinement effects on Eisenbud-Wigner-Smith (EWS) time delay in atomic photoionization. Using and we computed the EWS time delay for free and confined Xe atom for photoionization from inner 4d3/2 and 4d5/2 and outer 5p1/2 and 5p3/2 subshells at various angles. The calculated EWS time delay is few tens to few hundreds of attoseconds (10-18 second). The photoionization time delay for @Xe follows that in the free Xe atom on which the confinement oscillations are built. The present work reveals the effect of confinement on the photoionization time delay at different angles between photoelectron ejection and the photon polarization.

Crash testing difference-smoothing algorithm on a large sample of simulated light curves from TDC1

NASA Astrophysics Data System (ADS)

Rathna Kumar, S.

2017-09-01

In this work, we propose refinements to the difference-smoothing algorithm for the measurement of time delay from the light curves of the images of a gravitationally lensed quasar. The refinements mainly consist of a more pragmatic approach to choose the smoothing time-scale free parameter, generation of more realistic synthetic light curves for the estimation of time delay uncertainty and using a plot of normalized χ2 computed over a wide range of trial time delay values to assess the reliability of a measured time delay and also for identifying instances of catastrophic failure. We rigorously tested the difference-smoothing algorithm on a large sample of more than thousand pairs of simulated light curves having known true time delays between them from the two most difficult 'rungs' - rung3 and rung4 - of the first edition of Strong Lens Time Delay Challenge (TDC1) and found an inherent tendency of the algorithm to measure the magnitude of time delay to be higher than the true value of time delay. However, we find that this systematic bias is eliminated by applying a correction to each measured time delay according to the magnitude and sign of the systematic error inferred by applying the time delay estimator on synthetic light curves simulating the measured time delay. Following these refinements, the TDC performance metrics for the difference-smoothing algorithm are found to be competitive with those of the best performing submissions of TDC1 for both the tested 'rungs'. The MATLAB codes used in this work and the detailed results are made publicly available.

Time to Adjuvant Chemotherapy for Breast Cancer in National Comprehensive Cancer Network Institutions

PubMed Central

2013-01-01

Background High-quality care must be not only appropriate but also timely. We assessed time to initiation of adjuvant chemotherapy for breast cancer as well as factors associated with delay to help identify targets for future efforts to reduce unnecessary delays. Methods Using data from the National Comprehensive Cancer Network (NCCN) Outcomes Database, we assessed the time from pathological diagnosis to initiation of chemotherapy (TTC) among 6622 women with stage I to stage III breast cancer diagnosed from 2003 through 2009 and treated with adjuvant chemotherapy in nine NCCN centers. Multivariable models were constructed to examine factors associated with TTC. All statistical tests were two-sided. Results Mean TTC was 12.0 weeks overall and increased over the study period. A number of factors were associated with a longer TTC. The largest effects were associated with therapeutic factors, including immediate postmastectomy reconstruction (2.7 weeks; P < .001), re-excision (2.1 weeks; P < .001), and use of the 21-gene reverse-transcription polymerase chain reaction assay (2.2 weeks; P < .001). In comparison with white women, a longer TTC was observed among black (1.5 weeks; P < .001) and Hispanic (0.8 weeks; P < .001) women. For black women, the observed disparity was greater among women who transferred their care to the NCCN center after diagnosis (P interaction = .008) and among women with Medicare vs commercial insurance (P interaction < .001). Conclusions Most observed variation in TTC was related to use of appropriate therapeutic interventions. This suggests the importance of targeted efforts to minimize potentially preventable causes of delay, including inefficient transfers in care or prolonged appointment wait times. PMID:23264681

Transient anhedonia phenotype and altered circadian timing of behaviour during night-time dim light exposure in Per3-/- mice, but not wildtype mice.

PubMed

Martynhak, Bruno Jacson; Hogben, Alexandra L; Zanos, Panos; Georgiou, Polymnia; Andreatini, Roberto; Kitchen, Ian; Archer, Simon N; von Schantz, Malcolm; Bailey, Alexis; van der Veen, Daan R

2017-01-10

Industrialisation greatly increased human night-time exposure to artificial light, which in animal models is a known cause of depressive phenotypes. Whilst many of these phenotypes are 'direct' effects of light on affect, an 'indirect' pathway via altered sleep-wake timing has been suggested. We have previously shown that the Period3 gene, which forms part of the biological clock, is associated with altered sleep-wake patterns in response to light. Here, we show that both wild-type and Per3 -/- mice showed elevated levels of circulating corticosterone and increased hippocampal Bdnf expression after 3 weeks of exposure to dim light at night, but only mice deficient for the PERIOD3 protein (Per3 -/- ) exhibited a transient anhedonia-like phenotype, observed as reduced sucrose preference, in weeks 2-3 of dim light at night, whereas WT mice did not. Per3 -/- mice also exhibited a significantly smaller delay in behavioural timing than WT mice during weeks 1, 2 and 4 of dim light at night exposure. When treated with imipramine, neither Per3 -/- nor WT mice exhibited an anhedonia-like phenotype, and neither genotypes exhibited a delay in behavioural timing in responses to dLAN. While the association between both Per3 -/- phenotypes remains unclear, both are alleviated by imipramine treatment during dim night-time light.

Analysis of nodule senescence in pea (Pisum sativum L.) using laser microdissection, real-time PCR, and ACC immunolocalization.

PubMed

Serova, Tatiana A; Tikhonovich, Igor A; Tsyganov, Viktor E

2017-05-01

A delay in the senescence of symbiotic nodules could prolong active nitrogen fixation, resulting in improved crop yield and a reduced need for chemical fertilizers. The molecular genetic mechanisms underlying nodule senescence have not been extensively studied with a view to breeding varieties with delayed nodule senescence. In such studies, plant mutants with the phenotype of premature degradation of symbiotic structures are useful models to elucidate the genetic basis of nodule senescence. Using a dataset from transcriptome analysis of Medicago truncatula Gaertn. nodules and previous studies on pea (Pisum sativum L.) nodules, we developed a set of molecular markers based on genes that are known to be activated during nodule senescence. These genes encode cysteine proteases, a thiol protease, a bZIP transcription factor, enzymes involved in the biosynthesis of ethylene (ACS2 for ACC synthase and ACO1 for ACC oxidase) and ABA (AO3 for aldehyde oxidase), and an enzyme involved in catabolism of gibberellins (GA 2-oxidase). We analyzed the transcript levels of these genes in the nodules of two pea wild-types (cv. Sparkle and line Sprint-2) and two mutant lines, one showing premature nodule senescence (E135F (sym13)) and one showing no morphological signs of symbiotic structure degradation (Sprint-2Fix - (sym31)). Real-time PCR analyses revealed that all of the selected genes showed increased transcript levels during nodule aging in all phenotypes. Remarkably, at 4 weeks after inoculation (WAI), the transcript levels of all analyzed genes were significantly higher in the early senescent nodules of the mutant line E135F (sym13) and in nodules of the mutant Sprint-2Fix - (sym31) than in the active nitrogen-fixing nodules of wild-types. In contrast, the transcript levels of the same genes of both wild-types were significantly increased only at 6 WAI. We evaluated the expression of selected markers in the different histological nodule zones of pea cv. Sparkle and its mutant line E135F (sym13) by laser capture microdissection analysis. Finally, we analyzed ACC by immunolocalization in the nodules of both wild-type pea and their mutants. Together, the results indicate that nodule senescence is a general plant response to nodule ineffectiveness. Copyright © 2017 Elsevier GmbH. All rights reserved.

Comparison of delay enhancement mechanisms for SBS-based slow light systems.

PubMed

Schneider, Thomas; Henker, Ronny; Lauterbach, Kai-Uwe; Junker, Markus

2007-07-23

We compare two simple mechanisms for the enhancement of the time delay in slow light systems. Both are based on the superposition of the Brillouin gain with additional loss. As we will show in theory and experiment if two losses are placed at the wings of a SBS gain, contrary to other methods, the loss power increases the time delay. This leads to higher delay times at lower optical powers and to an increase of the zero gain delay of more than 50%. With this method we achieved a time delay of more than 120ns for pulses with a temporal width of 30ns. To the best of our knowledge, this is the highest time delay in just one fiber spool. Beside the enhancement of the time delay the method could have the potential to decrease the pulse distortions for high bit rate signals.

IL-1 or TNF receptor gene deletion delays onset of encephalopathy and attenuates brain edema in experimental acute liver failure.

PubMed

Bémeur, Chantal; Qu, Hong; Desjardins, Paul; Butterworth, Roger F

2010-01-01

Previous reports suggested that brain-derived proinflammatory cytokines are involved in the pathogenesis of hepatic encephalopathy (HE) and brain edema in acute liver failure (ALF). To further address this issue, expression of interleukin-1beta (IL-1beta), tumor necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma) mRNAs were measured in the brains of mice with acute liver failure resulting from exposure to azoxymethane. In addition, time to severe encephalopathy (coma) was assessed in mice lacking genes coding for interferon-gamma, the tumor necrosis factor receptor-1 or the interleukin-1 type 1 receptor. Interleukin-1beta, tumor necrosis factor-alpha and interferon-gamma expression were quantified using RT-PCR. Significant increases in interleukin-1beta and tumor necrosis factor-alpha mRNA were observed in the frontal cortex of azoxymethane-treated wild-type mice at coma stages of encephalopathy. Interferon-gamma, however, could not be detected in the brains of these animals. Onset of severe encephalopathy (coma) and brain edema in ALF mice were significantly delayed in interleukin-1 type 1 receptor or tumor necrosis factor receptor-1 knockout mice. Deletion of the interferon-gamma gene, on the other hand, had no significative effect on the neurological status or brain water content of acute liver failure mice. These results demonstrate that toxic liver injury resulting from exposure to azoxymethane is associated with selective induction of proinflammatory cytokines in the brain and that deletion of tumor necrosis factor receptor-1 or interlukin-1 type 1 receptor delays the onset of coma and brain edema in this model of acute liver failure. These findings further support a role for selective brain-derived cytokines in the pathogenesis of the cerebral complications in acute liver failure and suggest that anti-inflammatory strategies could be beneficial in their prevention. Copyright 2009 Elsevier Ltd. All rights reserved.

Impact of Partial Time Delay on Temporal Dynamics of Watts-Strogatz Small-World Neuronal Networks

NASA Astrophysics Data System (ADS)

Yan, Hao; Sun, Xiaojuan

2017-06-01

In this paper, we mainly discuss effects of partial time delay on temporal dynamics of Watts-Strogatz (WS) small-world neuronal networks by controlling two parameters. One is the time delay τ and the other is the probability of partial time delay pdelay. Temporal dynamics of WS small-world neuronal networks are discussed with the aid of temporal coherence and mean firing rate. With the obtained simulation results, it is revealed that for small time delay τ, the probability pdelay could weaken temporal coherence and increase mean firing rate of neuronal networks, which indicates that it could improve neuronal firings of the neuronal networks while destroying firing regularity. For large time delay τ, temporal coherence and mean firing rate do not have great changes with respect to pdelay. Time delay τ always has great influence on both temporal coherence and mean firing rate no matter what is the value of pdelay. Moreover, with the analysis of spike trains and histograms of interspike intervals of neurons inside neuronal networks, it is found that the effects of partial time delays on temporal coherence and mean firing rate could be the result of locking between the period of neuronal firing activities and the value of time delay τ. In brief, partial time delay could have great influence on temporal dynamics of the neuronal networks.

Piloted simulator study of allowable time delay in pitch flight control system of a transport airplane with negative static stability

NASA Technical Reports Server (NTRS)

Grantham, William D.; Smith, Paul M.; Person, Lee H., Jr.; Meyer, Robert T.; Tingas, Stephen A.

1987-01-01

A piloted simulation study was conducted to determine the permissible time delay in the flight control system of a 10-percent statically unstable transport airplane during cruise flight conditions. The math model used for the simulation was a derivative Lockheed L-1011 wide-body jet transport. Data were collected and analyzed from a total of 137 cruising flights in both calm- and turbulent-air conditions. Results of this piloted simulation study verify previous findings that show present military specifications for allowable control-system time delay may be too stringent when applied to transport-size airplanes. Also, the degree of handling-qualities degradation due to time delay is shown to be strongly dependent on the source of the time delay in an advanced flight control system. Maximum allowable time delay for each source of time delay in the control system, in addition to a less stringent overall maximum level of time delay, should be considered for large aircraft. Preliminary results also suggest that adverse effects of control-system time delay may be at least partially offset by variations in control gearing. It is recommended that the data base include different airplane baselines, control systems, and piloting tasks with many pilots participating, so that a reasonable set of limits for control-system time delay can be established to replace the military specification limits currently being used.

Individual Differences in Sleep Timing Relate to Melanopsin-Based Phototransduction in Healthy Adolescents and Young Adults

PubMed Central

van der Meijden, Wisse P.; Van Someren, Jamie L.; te Lindert, Bart H.W.; Bruijel, Jessica; van Oosterhout, Floor; Coppens, Joris E.; Kalsbeek, Andries; Cajochen, Christian; Bourgin, Patrice; Van Someren, Eus J.W.

2016-01-01

Study Objectives: Individual differences in sleep timing have been widely recognized and are of particular relevance in adolescents and young adults who often show mild to severely delayed sleep. The biological mechanisms underlying the between-subject variance remain to be determined. Recent human genetics studies showed an association between sleep timing and melanopsin gene variation, but support for functional effects on downstream pathways and behavior was not demonstrated before. We therefore investigated the association between the autonomic (i.e., pupil diameter) and behavioral (i.e., sleep timing) readouts of two different downstream brain areas, both affected by the same melanopsin-dependent retinal phototransduction: the olivary pretectal nucleus (OPN) and the suprachiasmatic nucleus (SCN). Methods: Our study population included 71 healthy individuals within an age range with known vulnerability to a delayed sleep phase (16.8–35.7 y, 37 males, 34 females). Pupillometry was performed to estimate functionality of the intrinsic melanopsin-signaling circuitry based on the OPN-mediated post-illumination pupil response (PIPR) to blue light. Sleep timing was quantified by estimating the SCN-mediated mid-sleep timing in three different ways in parallel: using a chronotype questionnaire, a sleep diary, and actigraphy. Results: All three measures consistently showed that those individuals with a later mid-sleep timing had a more pronounced PIPR (0.03 < P < 0.05), indicating a stronger blue-light responsiveness of the intrinsic melanopsin-based phototransduction circuitry. Conclusions: Trait-like individual differences in the melanopsin phototransduction circuitry contribute to individual differences in sleep timing. Blue light-sensitive young individuals are more prone to delayed sleep. Citation: van der Meijden WP, Van Someren JL; te Lindert BH, Bruijel J, van Oosterhout F, Coppens JE, Kalsbeek A, Cajochen C, Bourgin P, Van Someren EJ. Individual differences in sleep timing relate to melanopsin-based phototransduction in healthy adolescents and young adults. SLEEP 2016;39(6):1305–1310. PMID:27091519

Dual-species transcriptional profiling during systemic candidiasis reveals organ-specific host-pathogen interactions.

PubMed

Hebecker, Betty; Vlaic, Sebastian; Conrad, Theresia; Bauer, Michael; Brunke, Sascha; Kapitan, Mario; Linde, Jörg; Hube, Bernhard; Jacobsen, Ilse D

2016-11-03

Candida albicans is a common cause of life-threatening fungal bloodstream infections. In the murine model of systemic candidiasis, the kidney is the primary target organ while the fungal load declines over time in liver and spleen. To better understand these organ-specific differences in host-pathogen interaction, we performed gene expression profiling of murine kidney, liver and spleen and determined the fungal transcriptome in liver and kidney. We observed a delayed transcriptional immune response accompanied by late induction of fungal stress response genes in the kidneys. In contrast, early upregulation of the proinflammatory response in the liver was associated with a fungal transcriptome resembling response to phagocytosis, suggesting that phagocytes contribute significantly to fungal control in the liver. Notably, C. albicans hypha-associated genes were upregulated in the absence of visible filamentation in the liver, indicating an uncoupling of gene expression and morphology and a morphology-independent effect by hypha-associated genes in this organ. Consistently, integration of host and pathogen transcriptional data in an inter-species gene regulatory network indicated connections of C. albicans cell wall remodelling and metabolism to the organ-specific immune responses.

Dual-species transcriptional profiling during systemic candidiasis reveals organ-specific host-pathogen interactions

PubMed Central

Hebecker, Betty; Vlaic, Sebastian; Conrad, Theresia; Bauer, Michael; Brunke, Sascha; Kapitan, Mario; Linde, Jörg; Hube, Bernhard; Jacobsen, Ilse D.

2016-01-01

Candida albicans is a common cause of life-threatening fungal bloodstream infections. In the murine model of systemic candidiasis, the kidney is the primary target organ while the fungal load declines over time in liver and spleen. To better understand these organ-specific differences in host-pathogen interaction, we performed gene expression profiling of murine kidney, liver and spleen and determined the fungal transcriptome in liver and kidney. We observed a delayed transcriptional immune response accompanied by late induction of fungal stress response genes in the kidneys. In contrast, early upregulation of the proinflammatory response in the liver was associated with a fungal transcriptome resembling response to phagocytosis, suggesting that phagocytes contribute significantly to fungal control in the liver. Notably, C. albicans hypha-associated genes were upregulated in the absence of visible filamentation in the liver, indicating an uncoupling of gene expression and morphology and a morphology-independent effect by hypha-associated genes in this organ. Consistently, integration of host and pathogen transcriptional data in an inter-species gene regulatory network indicated connections of C. albicans cell wall remodelling and metabolism to the organ-specific immune responses. PMID:27808111

76 FR 68734 - Taking and Importing Marine Mammals: Taking Marine Mammals Incidental to Navy Training Exercises...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-11-07

... marine mammal is likely to travel during the time associated with the TDFD's time delay, and that... Navy provided the approximate distance that an animal would typically travel within a given time-delay... Speed and Length of Time-Delay Potential distance Species group Swim speed Time-delay traveled Delphinid...

Ketogenic diet delays the phase of circadian rhythms and does not affect AMP-activated protein kinase (AMPK) in mouse liver.

PubMed

Genzer, Yoni; Dadon, Maayan; Burg, Chen; Chapnik, Nava; Froy, Oren

2015-12-05

Ketogenic diet (KD) is used for weight loss or to treat epilepsy. KD leads to liver AMP-activated protein kinase (AMPK) activation, which would be expected to inhibit gluconeogenesis. However, KD leads to increased hepatic glucose output. As AMPK and its active phosphorylated form (pAMPK) show circadian oscillation, this discrepancy could stem from wrong-time-of-day sampling. The effect of KD was tested on mouse clock gene expression, AMPK, mTOR, SIRT1 and locomotor activity for 2 months and compared to low-fat diet (LFD). KD led to 1.5-fold increased levels of blood glucose and insulin. Brain pAMPK/AMPK ratio was 40% higher under KD, whereas that in liver was not affected. KD led to 40% and 20% down-regulation of the ratio of pP70S6K/P70S6K, the downstream target of mTOR, in the brain and liver, respectively. SIRT1 levels were 40% higher in the brain, but 40% lower in the liver of KD-fed mice. Clock genes showed delayed rhythms under KD. In the brain of KD-fed mice, amplitudes of clock genes were down-regulated, whereas 6-fold up-regulation was found in the liver. The metabolic state under KD indicates reduced satiety in the brain and reduced anabolism alongside increased gluconeogenesis in the liver. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Manipulation of a Senescence-Associated Gene Improves Fleshy Fruit Yield1[OPEN

PubMed Central

Gramegna, Giovanna; Trench, Bruna A.; Alves, Frederico R.R.; Silva, Eder M.; Silva, Geraldo F.F.; Thirumalaikumar, Venkatesh P.; Lupi, Alessandra C.D.; Demarco, Diego; Nogueira, Fabio T.S.; Freschi, Luciano

2017-01-01

Senescence is the process that marks the end of a leaf’s lifespan. As it progresses, the massive macromolecular catabolism dismantles the chloroplasts and, consequently, decreases the photosynthetic capacity of these organs. Thus, senescence manipulation is a strategy to improve plant yield by extending the leaf’s photosynthetically active window of time. However, it remains to be addressed if this approach can improve fleshy fruit production and nutritional quality. One way to delay senescence initiation is by regulating key transcription factors (TFs) involved in triggering this process, such as the NAC TF ORESARA1 (ORE1). Here, three senescence-related NAC TFs from tomato (Solanum lycopersicum) were identified, namely SlORE1S02, SlORE1S03, and SlORE1S06. All three genes were shown to be responsive to senescence-inducing stimuli and posttranscriptionally regulated by the microRNA miR164. Moreover, the encoded proteins interacted physically with the chloroplast maintenance-related TF SlGLKs. This characterization led to the selection of a putative tomato ORE1 as target gene for RNA interference knockdown. Transgenic lines showed delayed senescence and enhanced carbon assimilation that, ultimately, increased the number of fruits and their total soluble solid content. Additionally, the fruit nutraceutical composition was enhanced. In conclusion, these data provide robust evidence that the manipulation of leaf senescence is an effective strategy for yield improvement in fleshy fruit-bearing species. PMID:28710129

A t(5;16) translocation is the likely driver of a syndrome with ambiguous genitalia, facial dysmorphism, intellectual disability, and speech delay.

PubMed

Ozantürk, Ayşegül; Davis, Erica E; Sabo, Aniko; Weiss, Marjan M; Muzny, Donna; Dugan-Perez, Shannon; Sistermans, Erik A; Gibbs, Richard A; Özgül, Köksal R; Yalnızoglu, Dilek; Serdaroglu, Esra; Dursun, Ali; Katsanis, Nicholas

2016-03-01

Genetic studies grounded on monogenic paradigms have accelerated both gene discovery and molecular diagnosis. At the same time, complex genomic rearrangements are also appreciated as potent drivers of disease pathology. Here, we report two male siblings with a dysmorphic face, ambiguous genitalia, intellectual disability, and speech delay. Through quad-based whole-exome sequencing and concomitant molecular cytogenetic testing, we identified two copy-number variants (CNVs) in both affected individuals likely arising from a balanced translocation: a 13.5-Mb duplication on Chromosome 16 (16q23.1 → 16qter) and a 7.7-Mb deletion on Chromosome 5 (5p15.31 → 5pter), as well as a hemizygous missense variant in CXorf36 (also known as DIA1R). The 5p terminal deletion has been associated previously with speech delay, whereas craniofacial dysmorphia and genital/urinary anomalies have been reported in patients with a terminal duplication of 16q. However, dosage changes in either genomic region alone could not account for the overall clinical presentation in our family; functional testing of CXorf36 in zebrafish did not induce defects in neurogenesis or the craniofacial skeleton. Notably, literature and database analysis revealed a similar dosage disruption in two siblings with extensive phenotypic overlap with our patients. Taken together, our data suggest that dosage perturbation of genes within the two chromosomal regions likely drives the syndromic manifestations of our patients and highlight how multiple genetic lesions can contribute to complex clinical pathologies.

Ectopic expression of Capsicum-specific cell wall protein Capsicum annuum senescence-delaying 1 (CaSD1) delays senescence and induces trichome formation in Nicotiana benthamiana.

PubMed

Seo, Eunyoung; Yeom, Seon-In; Jo, Sunghwan; Jeong, Heejin; Kang, Byoung-Cheorl; Choi, Doil

2012-04-01

Secreted proteins are known to have multiple roles in plant development, metabolism, and stress response. In a previous study to understand the roles of secreted proteins, Capsicum annuum secreted proteins (CaS) were isolated by yeast secretion trap. Among the secreted proteins, we further characterized Capsicum annuum senescence-delaying 1 (CaSD1), a gene encoding a novel secreted protein that is present only in the genus Capsicum. The deduced CaSD1 contains multiple repeats of the amino acid sequence KPPIHNHKPTDYDRS. Interestingly, the number of repeats varied among cultivars and species in the Capsicum genus. CaSD1 is constitutively expressed in roots, and Agrobacterium-mediated transient overexpression of CaSD1 in Nicotiana benthamiana leaves resulted in delayed senescence with a dramatically increased number of trichomes and enlarged epidermal cells. Furthermore, senescence- and cell division-related genes were differentially regulated by CaSD1-overexpressing plants. These observations imply that the pepper-specific cell wall protein CaSD1 plays roles in plant growth and development by regulating cell division and differentiation.

Probability of Loss of Assured Safety in Systems with Multiple Time-Dependent Failure Modes: Incorporation of Delayed Link Failure in the Presence of Aleatory Uncertainty.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Helton, Jon C.; Brooks, Dusty Marie; Sallaberry, Cedric Jean-Marie.

Probability of loss of assured safety (PLOAS) is modeled for weak link (WL)/strong link (SL) systems in which one or more WLs or SLs could potentially degrade into a precursor condition to link failure that will be followed by an actual failure after some amount of elapsed time. The following topics are considered: (i) Definition of precursor occurrence time cumulative distribution functions (CDFs) for individual WLs and SLs, (ii) Formal representation of PLOAS with constant delay times, (iii) Approximation and illustration of PLOAS with constant delay times, (iv) Formal representation of PLOAS with aleatory uncertainty in delay times, (v) Approximationmore » and illustration of PLOAS with aleatory uncertainty in delay times, (vi) Formal representation of PLOAS with delay times defined by functions of link properties at occurrence times for failure precursors, (vii) Approximation and illustration of PLOAS with delay times defined by functions of link properties at occurrence times for failure precursors, and (viii) Procedures for the verification of PLOAS calculations for the three indicated definitions of delayed link failure.« less

Time delay can facilitate coherence in self-driven interacting-particle systems

NASA Astrophysics Data System (ADS)

Sun, Yongzheng; Lin, Wei; Erban, Radek

2014-12-01

Directional switching in a self-propelled particle model with delayed interactions is investigated. It is shown that the average switching time is an increasing function of time delay. The presented results are applied to studying collective animal behavior. It is argued that self-propelled particle models with time delays can explain the state-dependent diffusion coefficient measured in experiments with locust groups. The theory is further generalized to heterogeneous groups where each individual can respond to its environment with a different time delay.

Delay banking for air traffic management

NASA Technical Reports Server (NTRS)

Green, Steven M. (Inventor)

2007-01-01

A method and associated system for time delay banking for aircraft arrival time, aircraft departure time and/or en route flight position. The delay credit value for a given flight may decrease with passage of time and may be transferred to or traded with other flights having the same or a different user (airline owner or operator). The delay credit value for a given aircraft flight depends upon an initial delay credit value, which is determined by a central system and depends upon one or more other flight characteristics. Optionally, the delay credit value decreases with passage of time. Optionally, a transaction cost is assessed against a delay credit value that is used on behalf of another flight with the same user or is traded with a different user.

General relation between the group delay and dwell time in multicomponent electron systems

NASA Astrophysics Data System (ADS)

Zhai, Feng; Lu, Junqiang

2016-10-01

For multicomponent electron scattering states, we derive a general relation between the Wigner group delay and the Bohmian dwell time. It is found that the definition of group delay should account for the phase of the spinor wave functions of propagating modes. The difference between the group delay and dwell time comes from both the interference delay and the decaying modes. For barrier tunneling of helical electrons on a surface of topological insulators, our calculations including the trigonal-warping term show that the decaying modes can contribute greatly to the group delay. The derived relation between the group delay and the dwell time is helpful to unify the two definitions of tunneling time in a quite general situation.

CAN LARGE TIME DELAYS OBSERVED IN LIGHT CURVES OF CORONAL LOOPS BE EXPLAINED IN IMPULSIVE HEATING?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lionello, Roberto; Linker, Jon A.; Mikić, Zoran

The light curves of solar coronal loops often peak first in channels associated with higher temperatures and then in those associated with lower temperatures. The delay times between the different narrowband EUV channels have been measured for many individual loops and recently for every pixel of an active region observation. The time delays between channels for an active region exhibit a wide range of values. The maximum time delay in each channel pair can be quite large, i.e., >5000 s. These large time delays make-up 3%–26% (depending on the channel pair) of the pixels where a trustworthy, positive time delaymore » is measured. It has been suggested that these time delays can be explained by simple impulsive heating, i.e., a short burst of energy that heats the plasma to a high temperature, after which the plasma is allowed to cool through radiation and conduction back to its original state. In this paper, we investigate whether the largest observed time delays can be explained by this hypothesis by simulating a series of coronal loops with different heating rates, loop lengths, abundances, and geometries to determine the range of expected time delays between a set of four EUV channels. We find that impulsive heating cannot address the largest time delays observed in two of the channel pairs and that the majority of the large time delays can only be explained by long, expanding loops with photospheric abundances. Additional observations may rule out these simulations as an explanation for the long time delays. We suggest that either the time delays found in this manner may not be representative of real loop evolution, or that the impulsive heating and cooling scenario may be too simple to explain the observations, and other potential heating scenarios must be explored.« less

Cognitive person variables in the delay of gratification of older children at risk.

PubMed

Rodriguez, M L; Mischel, W; Shoda, Y

1989-08-01

The components of self-regulation were analyzed, extending the self-imposed delay of gratification paradigm to older children with social adjustment problems. Delay behavior was related to a network of conceptually relevant cognitive person variables, consisting of attention deployment strategies during delay, knowledge of delay rules, and intelligence. A positive relationship was demonstrated between concurrent indexes of intelligence, attention deployment, and actual delay time. Moreover, attention deployment, measured as an individual differences variable during the delay process, had a direct, positive effect on delay behavior. Specifically, as the duration of delay and the frustration of the situation increased, children who spent a higher proportion of the time distracting themselves from the tempting elements of the delay situation were able to delay longer. The effect of attention deployment on delay behavior was significant even when age, intelligence, and delay rule knowledge were controlled. Likewise, delay rule knowledge significantly predicted delay time, even when age, attention deployment, and intelligence were controlled.

Refinement of the 12q14 microdeletion syndrome: primordial dwarfism and developmental delay with or without osteopoikilosis

PubMed Central

Mari, Francesca; Hermanns, Pia; Giovannucci-Uzielli, Maria L; Galluzzi, Fiorella; Scott, Daryl; Lee, Brendan; Renieri, Alessandra; Unger, Sheila; Zabel, Bernhard; Superti-Furga, Andrea

2009-01-01

In their studies on the molecular basis of osteopoikilosis, Menten et al have identified three individuals with microdeletions on chromosome 12q14.4, which removed several genes including LEMD3, the osteopoikilosis gene. In addition to osteopoikilosis, affected individuals had growth retardation and developmental delay. We now report a smaller 12q14.4 microdeletion in a boy with severe pre and postnatal growth failure, and mild developmental delay; the patient was small at birth and presented with poor feeding and failure to thrive during the first 2 years of life, similar to the phenotype of primordial dwarfism or severe Silver-Russell syndrome (SRS). The 12q14 deletion did not include LEMD3, and no signs of osteopoikilosis were observed on skeletal radiographs. Among the deleted genes, HMGA2 is of particular interest in relationship to the aberrant somatic growth in our patient, as HMGA2 variants have been linked to stature variations in the general population and loss of function of Hmga2 in the mouse results in the pygmy phenotype that combines pre and postnatal growth failure, with resistance to the adipogenic effect of overfeeding. Sequencing of the remaining HMGA2 allele in our patient showed a normal sequence, suggesting that HMGA2 haploinsufficiency may be sufficient to produce the aberrant growth phenotype. We conclude that the 12q14.4 microdeletion syndrome can occur with or without deletion of LEMD3 gene; in LEMD3-intact cases, the phenotype includes primordial short stature and failure to thrive with moderate developmental delay, but osteopoikilosis is absent. Such cases will likely be diagnosed as Silver-Russell-like or as primordial dwarfism. PMID:19277063

Development and Characterization of a High Throughput Screen to investigate the delayed Effects of Radiations Commonly Encountered in Space

NASA Astrophysics Data System (ADS)

Morgan, W. F.

Astronauts based on the space station or on long-term space missions will be exposed to high Z radiations in the cosmic environment In order to evaluate the potentially deleterious effects of exposure to radiations commonly encountered in space we have developed and characterized a high throughput assay to detect mutation deletion events and or hyperrecombination in the progeny of exposed cells This assay is based on a plasmid vector containing a green fluorescence protein reporter construct We have shown that after stable transfection of the vector into human or hamster cells this construct can identify mutations specifically base changes and deletions as well as recombination events e g gene conversion or homologous recombination occurring as a result of exposure to ionizing radiation Our focus has been on those events occurring in the progeny of an irradiated cell that are potentially associated with radiation induced genomic instability rather than the more conventional assays that evaluate the direct immediate effects of radiation exposure Considerable time has been spent automating analysis of surviving colonies as a function of time after irradiation in order to determine when delayed instability is induced and the consequences of this delayed instability The assay is now automated permitting the evaluation of potentially rare events associated with low dose low dose rate radiations commonly encountered in space

Firing patterns transition and desynchronization induced by time delay in neural networks

NASA Astrophysics Data System (ADS)

Huang, Shoufang; Zhang, Jiqian; Wang, Maosheng; Hu, Chin-Kun

2018-06-01

We used the Hindmarsh-Rose (HR) model (Hindmarsh and Rose, 1984) to study the effect of time delay on the transition of firing behaviors and desynchronization in neural networks. As time delay is increased, neural networks exhibit diversity of firing behaviors, including regular spiking or bursting and firing patterns transitions (FPTs). Meanwhile, the desynchronization of firing and unstable bursting with decreasing amplitude in neural system, are also increasingly enhanced with the increase of time delay. Furthermore, we also studied the effect of coupling strength and network randomness on these phenomena. Our results imply that time delays can induce transition and desynchronization of firing behaviors in neural networks. These findings provide new insight into the role of time delay in the firing activities of neural networks, and can help to better understand the firing phenomena in complex systems of neural networks. A possible mechanism in brain that can cause the increase of time delay is discussed.

Investigation of apoptosis-related gene expression levels in preimplantation biopsies as predictors of delayed kidney graft function.

PubMed

Goncalves-Primo, Amador; Mourão, Tuíla B; Andrade-Oliveira, Vinícius; Campos, Erika F; Medina-Pestana, José O; Tedesco-Silva, Hélio; Gerbase-DeLima, Maria

2014-06-27

The purpose of this study was to investigate the expression of the gene coding for the antiapoptotic molecule Bcl-2, the proapoptotic molecule Bax, and the apoptosis executor enzyme caspase-3 in preimplantation renal biopsies (PIB) as markers for delayed graft function. In this prospective single-center study, gene expression levels were evaluated using real-time TaqMan polymerase chain reaction in PIB of kidneys from 72 deceased donors (DDs) and 18 living donors (LDs). CASP3 and BAX expression levels were higher, whereas those of BCL2 were lower, in DD than in LD PIB. In biopsies from DD, BCL2 levels were lower in cases with DGF, whereas no differences were observed concerning CASP3 and BAX. The BAX/BCL2 gene expression ratio greater than 2.29 associated with DGF with an odds ratio of 2.00. A multiple regression analysis including data of TLR4 expression in the first day posttransplant PB from a previous study of our group conducted in the same patients revealed a very strong association of the combination of BAX/BCL2 greater than 2.3 in PIB and TLR4 of 0.95 uRE or lesser in PB with the occurrence of DGF, with OR of 120 and positive and negative predictive values of 91% and 92%, respectively. The power to predict DGF of the combination of high BAX/BCL2 expression in PIB and low TLR4 expression in the first day posttransplant peripheral blood observed in the present study is extremely high, in comparison to any other marker or combinations of markers so far published in the literature.

Mutations in Plasmodium falciparum K13 propeller gene from Bangladesh (2009-2013).

PubMed

Mohon, Abu Naser; Alam, Mohammad Shafiul; Bayih, Abebe Genetu; Folefoc, Asongna; Shahinas, Dea; Haque, Rashidul; Pillai, Dylan R

2014-11-18

Bangladesh is a malaria hypo-endemic country sharing borders with India and Myanmar. Artemisinin combination therapy (ACT) remains successful in Bangladesh. An increase of artemisinin-resistant malaria parasites on the Thai-Cambodia and Thai-Myanmar borders is worrisome. K13 propeller gene (PF3D7_1343700 or PF13_0238) mutations have been linked to both in vitro artemisinin resistance and in vivo slow parasite clearance rates. This group undertook to evaluate if mutations seen in Cambodia have emerged in Bangladesh where ACT use is now standard for a decade. Samples were obtained from Plasmodium falciparum-infected malaria patients from Upazila health complexes (UHC) between 2009 and 2013 in seven endemic districts of Bangladesh. These districts included Khagrachari (Matiranga UHC), Rangamati (Rajasthali UHC), Cox's Bazar (Ramu and Ukhia UHC), Bandarban (Lama UHC), Mymensingh (Haluaghat UHC), Netrokona (Durgapur and Kalmakanda UHC), and Moulvibazar (Sreemangal and Kamalganj UHC). Out of 296 microscopically positive P. falciparum samples, 271 (91.6%) were confirmed as mono-infections by both real-time PCR and nested PCR. The K13 propeller gene from 253 (93.4%) samples was sequenced bi-directionally. One non-synonymous mutation (A578S) was found in Bangladeshi clinical isolates. The A578S mutation was confirmed and lies adjacent to the C580Y mutation, the major mutation causing delayed parasite clearance in Cambodia. Based on computational modeling A578S should have a significant effect on tertiary structure of the protein. The data suggest that P. falciparum in Bangladesh remains free of the C580Y mutation linked to delayed parasite clearance. However, the mutation A578S is present and based on structural analysis could affect K13 gene function. Further in vivo clinical studies are required to validate the effect of this mutation.

Clinical and mutational spectrum in Korean patients with Rubinstein-Taybi syndrome: the spectrum of brain MRI abnormalities.

PubMed

Lee, Jin Sook; Byun, Christine K; Kim, Hunmin; Lim, Byung Chan; Hwang, Hee; Choi, Ji Eun; Hwang, Yong Seung; Seong, Moon-Woo; Park, Sung Sup; Kim, Ki Joong; Chae, Jong-Hee

2015-04-01

Rubinstein-Taybi syndrome (RSTS) is one of the neurodevelopmental disorders caused by mutations of epigenetic genes. The CREBBP gene is the most common causative gene, encoding the CREB-binding protein with histone acetyltransferase (HAT) activity, an epigenetic modulator. To date, there have been few reports on the structural abnormalities of the brain in RSTS patients. In addition, there are no reports on the analysis of CREBBP mutations in Korean RSTS patients. We performed mutational analyses on 16 unrelated patients with RSTS, with diagnosis based on the typical clinical features. Their medical records and brain MRI images were reviewed retrospectively. Ten of 16 patients (62.5%) had mutations in the CREBBP gene. The mutations included five frameshift mutations (31.2%), two nonsense mutations (12.5%), and three multiexon deletions (18.8%). There were no remarkable significant differences in the clinical features between those with and without a CREBBP mutation, although brain MRI abnormalities were more frequently observed in those with a CREBBP mutation. Seven of 10 patients in whom brain imaging was performed had structural abnormalities, including Chiari malformation type 1, thinning of the corpus callosum, and delayed myelination. There were no differences in delayed development or cognitive impairment between those with and without abnormal brain images, while epilepsy was involved in two patients who had abnormalities on brain MRI images. We investigated the spectrum of CREBBP mutations in Korean patients with RSTS for the first time. Eight novel mutations extended the genetic spectrum of CREBBP mutations in RSTS patients. This is also the first study showing the prevalence and spectrum of abnormalities on brain MRI in RSTS patients. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

PubMed

Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

2018-02-09

WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

Setting the Tempo in Development: An Investigation of the Zebrafish Somite Clock Mechanism

PubMed Central

Giudicelli, François; Özbudak, Ertuğrul M; Wright, Gavin J; Lewis, Julian

2007-01-01

The somites of the vertebrate embryo are clocked out sequentially from the presomitic mesoderm (PSM) at the tail end of the embryo. Formation of each somite corresponds to one cycle of oscillation of the somite segmentation clock—a system of genes whose expression switches on and off periodically in the cells of the PSM. We have previously proposed a simple mathematical model explaining how the oscillations, in zebrafish at least, may be generated by a delayed negative feedback loop in which the products of two Notch target genes, her1 and her7, directly inhibit their own transcription, as well as that of the gene for the Notch ligand DeltaC; Notch signalling via DeltaC keeps the oscillations of neighbouring cells in synchrony. Here we subject the model to quantitative tests. We show how to read temporal information from the spatial pattern of stripes of gene expression in the anterior PSM and in this way obtain values for the biosynthetic delays and molecular lifetimes on which the model critically depends. Using transgenic lines of zebrafish expressing her1 or her7 under heat-shock control, we confirm the regulatory relationships postulated by the model. From the timing of somite segmentation disturbances following a pulse of her7 misexpression, we deduce that although her7 continues to oscillate in the anterior half of the PSM, it governs the future somite segmentation behaviour of the cells only while they are in the posterior half. In general, the findings strongly support the mathematical model of how the somite clock works, but they do not exclude the possibility that other oscillator mechanisms may operate upstream from the her7/her1 oscillator or in parallel with it. PMID:17535112

Delay time in a single barrier for a movable quantum shutter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez, Alberto

2010-05-15

The transient solution and delay time for a {delta} potential scatterer with a movable quantum shutter is calculated by solving analytically the time-dependent Schroedinger equation. The delay time is analyzed as a function of the distance between the shutter and the potential barrier and also as a function of the distance between the potential barrier and the detector. In both cases, it is found that the delay time exhibits a dynamical behavior and that it tends to a saturation value {Delta}t{sub sat} in the limit of very short distances, which represents the maximum delay produced by the potential barrier nearmore » the interaction region. The phase time {tau}{sub {theta},} on the other hand, is not an appropriate time scale for measuring the time delay near the interaction region, except if the shutter is moved far away from the potential. The role played by the antibound state of the system on the behavior of the delay time is also discussed.« less

LiDAR-IMU Time Delay Calibration Based on Iterative Closest Point and Iterated Sigma Point Kalman Filter.

PubMed

Liu, Wanli

2017-03-08

The time delay calibration between Light Detection and Ranging (LiDAR) and Inertial Measurement Units (IMUs) is an essential prerequisite for its applications. However, the correspondences between LiDAR and IMU measurements are usually unknown, and thus cannot be computed directly for the time delay calibration. In order to solve the problem of LiDAR-IMU time delay calibration, this paper presents a fusion method based on iterative closest point (ICP) and iterated sigma point Kalman filter (ISPKF), which combines the advantages of ICP and ISPKF. The ICP algorithm can precisely determine the unknown transformation between LiDAR-IMU; and the ISPKF algorithm can optimally estimate the time delay calibration parameters. First of all, the coordinate transformation from the LiDAR frame to the IMU frame is realized. Second, the measurement model and time delay error model of LiDAR and IMU are established. Third, the methodology of the ICP and ISPKF procedure is presented for LiDAR-IMU time delay calibration. Experimental results are presented that validate the proposed method and demonstrate the time delay error can be accurately calibrated.

Moist exposed burn ointment promotes cutaneous excisional wound healing in rats involving VEGF and bFGF.

PubMed

Tang, Qian-Li; Han, Shan-Shan; Feng, Jing; Di, Jia-Qi; Qin, Wen-Xi; Fu, Jun; Jiang, Qiu-Yan

2014-04-01

Cutaneous delayed wounds are a challenging clinical problem, and vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) exhibit key roles in wound healing. Moist exposed burn ointment (MEBO), a Chinese burn ointment with a USA patented formulation, has been reported to promote chronic ischemic and neurogenic ulcer healing in patients; however, the underlying mechanisms remain unclear. In the present study, MEBO significantly promoted the formation of granulation tissue in cutaneous excisional wounds, shortened the time of wound healing, and increased neovascularization and the number of fibroblasts. Furthermore, as well as enhancing the protein expression, MEBO application also increased the gene expression of VEGF and bFGF. The results indicate that MEBO promotes cutaneous excisional wound healing by at least partially enhancing VEGF and bFGF production, implicating the potential uses of MEBO for delayed cutaneous wound healing.

Arabidopsis florigen FT binds to diurnally oscillating phospholipids that accelerate flowering.

PubMed

Nakamura, Yuki; Andrés, Fernando; Kanehara, Kazue; Liu, Yu-chi; Dörmann, Peter; Coupland, George

2014-04-04

Arabidopsis FT protein is a component of florigen, which transmits photoperiodic flowering signals from leaf companion cells to the shoot apex. Here, we show that FT specifically binds phosphatidylcholine (PC) in vitro. A transgenic approach to increase PC levels in vivo in the shoot meristem accelerates flowering whereas reduced PC levels delay flowering, demonstrating that PC levels are correlated with flowering time. The early flowering is related to FT activity, because expression of FT-effector genes is increased in these plants. Simultaneous increase of FT and PC in the shoot apical meristem further stimulates flowering, whereas a loss of FT function leads to an attenuation of the effect of increased PC. Specific molecular species of PC oscillate diurnally, and night-dominant species are not the preferred ligands of FT. Elevating night-dominant species during the day delays flowering. We suggest that FT binds to diurnally changing molecular species of PC to promote flowering.

On Time Delay Margin Estimation for Adaptive Control and Optimal Control Modification

NASA Technical Reports Server (NTRS)

Nguyen, Nhan T.

2011-01-01

This paper presents methods for estimating time delay margin for adaptive control of input delay systems with almost linear structured uncertainty. The bounded linear stability analysis method seeks to represent an adaptive law by a locally bounded linear approximation within a small time window. The time delay margin of this input delay system represents a local stability measure and is computed analytically by three methods: Pade approximation, Lyapunov-Krasovskii method, and the matrix measure method. These methods are applied to the standard model-reference adaptive control, s-modification adaptive law, and optimal control modification adaptive law. The windowing analysis results in non-unique estimates of the time delay margin since it is dependent on the length of a time window and parameters which vary from one time window to the next. The optimal control modification adaptive law overcomes this limitation in that, as the adaptive gain tends to infinity and if the matched uncertainty is linear, then the closed-loop input delay system tends to a LTI system. A lower bound of the time delay margin of this system can then be estimated uniquely without the need for the windowing analysis. Simulation results demonstrates the feasibility of the bounded linear stability method for time delay margin estimation.

Effects of paroxetine on intravaginal ejaculatory latency time in Egyptian patients with lifelong premature ejaculation as a function of serotonin transporter polymorphism.

PubMed

Salem, A M; Kamel, I I; Rashed, L A; GamalEl Din, S F

2017-01-01

Premature ejaculation (PE) is a common ejaculatory complaint. The estimated rates among Turkish men reached 20%, although the severest type of PE (lifelong PE) usually does not exceed 2.3%. This could be seen in line with two survey studies involving five nations. They revealed that 2.5% of men had an intravaginal ejaculation latency time of <1 min and 6% of <2 min. Rapid ejaculation may be treated pharmacologically with a variety of different medications that act either centrally or locally to delay ejaculation and subsequent orgasm. Antidepressants, particularly members of the selective serotonin reuptake inhibitor class, retard ejaculation significantly. Recently, it was postulated that men with lifelong PE might result from a combination of polymorphisms of the serotonergic transporter and receptors, and other neurotransmitters and/or receptors. Our findings augment the significant effect of paroxetine in delaying ejaculation in the responders (P<0.001). Meanwhile, the findings do not suggest a positive association between such response and serotonin transporter gene promoter polymorphism.

Genotype-phenotype characterization in 13 individuals with chromosome Xp11.22 duplications.

PubMed

Grams, Sarah E; Argiropoulos, Bob; Lines, Matthew; Chakraborty, Pranesh; Mcgowan-Jordan, Jean; Geraghty, Michael T; Tsang, Marilyn; Eswara, Marthand; Tezcan, Kamer; Adams, Kelly L; Linck, Leesa; Himes, Patricia; Kostiner, Dana; Zand, Dina J; Stalker, Heather; Driscoll, Daniel J; Huang, Taosheng; Rosenfeld, Jill A; Li, Xu; Chen, Emily

2016-04-01

We report 13 new individuals with duplications in Xp11.22-p11.23. The index family has one male and two female members in three generations with mild-severe intellectual disability (ID), speech delay, dysmorphic features, early puberty, constipation, and/or hand and foot abnormalities. Affected individuals were found to have two small duplications in Xp11.22 at nucleotide position (hg19) 50,112,063-50,456,458 bp (distal) and 53,160,114-53,713,154 bp (proximal). Collectively, these two regions include 14 RefSeq genes, prompting collection of a larger cohort of patients, in an attempt to delineate critical genes associated with the observed phenotype. In total, we have collected data on nine individuals with duplications overlapping the distal duplication region containing SHROOM4 and DGKK and eight individuals overlapping the proximal region including HUWE1. Duplications of HUWE1 have been previously associated with non-syndromic ID. Our data, with previously published reports, suggest that duplications involving SHROOM4 and DGKK may represent a new syndromic X-linked ID critical region associated with mild to severe ID, speech delay +/- dysarthria, attention deficit disorder, precocious puberty, constipation, and motor delay. We frequently observed foot abnormalities, 5th finger clinodactyly, tapering fingers, constipation, and exercise intolerance in patients with duplications of these two genes. Regarding duplications including the proximal region, our observations agree with previous studies, which have found associations with intellectual disability. In addition, expressive language delay, failure to thrive, motor delay, and 5th finger clinodactyly were also frequently observed in patients with the proximal duplication. © 2015 Wiley Periodicals, Inc.

Leveraging delay discounting for health: Can time delays influence food choice?

PubMed

Appelhans, Bradley M; French, Simone A; Olinger, Tamara; Bogucki, Michael; Janssen, Imke; Avery-Mamer, Elizabeth F; Powell, Lisa M

2018-07-01

Delay discounting, the tendency to choose smaller immediate rewards over larger delayed rewards, is theorized to promote consumption of immediately rewarding but unhealthy foods at the expense of long-term weight maintenance and nutritional health. An untested implication of delay discounting models of decision-making is that selectively delaying access to less healthy foods may promote selection of healthier (immediately available) alternatives, even if they may be less desirable. The current study tested this hypothesis by measuring healthy versus regular vending machine snack purchasing before and during the implementation of a 25-s time delay on the delivery of regular snacks. Purchasing was also examined under a $0.25 discount on healthy snacks, a $0.25 tax on regular snacks, and the combination of both pricing interventions with the 25-s time delay. Across 32,019 vending sales from three separate vending locations, the 25-s time delay increased healthy snack purchasing from 40.1% to 42.5%, which was comparable to the impact of a $0.25 discount (43.0%). Combining the delay and the discount had a roughly additive effect (46.0%). However, the strongest effects were seen under the $0.25 tax on regular snacks (53.7%) and the combination of the delay and the tax (50.2%). Intervention effects varied substantially between vending locations. Importantly, time delays did not harm overall vending sales or revenue, which is relevant to the real-world feasibility of this intervention. More investigation is needed to better understand how the impact of time delays on food choice varies across populations, evaluate the effects of time delays on beverage vending choices, and extend this approach to food choices in contexts other than vending machines. ClinicalTrials.gov, NCT02359916. Copyright © 2018 Elsevier Ltd. All rights reserved.

Effect of time delay on flying qualities: An update

NASA Technical Reports Server (NTRS)

Smith, R. E.; Sarrafian, S. K.

1986-01-01

Flying qualities problems of modern, full-authority electronic flight control systems are most often related to the introduction of additional time delay in aircraft response to a pilot input. These delays can have a significant effect on the flying qualities of the aircraft. Time delay effects are reexamined in light of recent flight test experience with aircraft incorporating new technology. Data from the X-29A forward-swept-wing demonstrator, a related preliminary in-flight experiment, and other flight observations are presented. These data suggest that the present MIL-F-8785C allowable-control system time delay specifications are inadequate or, at least, incomplete. Allowable time delay appears to be a function of the shape of the aircraft response following the initial delay. The cockpit feel system is discussed as a dynamic element in the flight control system. Data presented indicate that the time delay associated with a significant low-frequency feel system does not result in the predicted degradation in aircraft flying qualities. The impact of the feel system is discussed from two viewpoints: as a filter in the control system which can alter the initial response shape and, therefore, the allowable time delay, and as a unique dynamic element whose delay contribution can potentially be discounted by special pilot loop closures.

Describing-function analysis of a ripple regulator with slew-rate limits and time delays

NASA Technical Reports Server (NTRS)

Wester, Gene W.

1990-01-01

The effects of time delays and slew-rate limits on the steady-state operating points and performance of a free-running ripple regulator are evaluated using describing-function analysis. The describing function of an ideal comparator (no time delays or slew rate limits) has no phase shift and is independent of frequency. It is found that turn-on delay and turn-off delay have different effects on gain and phase and cannot be combined. Comparator hysteresis affects both gain and phase; likewise, time delays generally affect both gain and phase. It is found that the effective time delay around the feedback loop is one half the sum of turn-on and turn-off delays, regardless of whether the delays are caused by storage time or slew rate limits. Expressions are formulated for the switching frequency, switch duty ratio, dc output, and output ripple. For the case of no hysteresis, a simple, graphical solution for the switching frequency is possible, and the resulting switching frequency is independent of first-order variations of input or load.

Overexpression of AtLOV1 in Switchgrass alters plant architecture, lignin content, and flowering time.

PubMed

Xu, Bin; Sathitsuksanoh, Noppadon; Tang, Yuhong; Udvardi, Michael K; Zhang, Ji-Yi; Shen, Zhengxing; Balota, Maria; Harich, Kim; Zhang, Percival Y-H; Zhao, Bingyu

2012-01-01

Switchgrass (Panicum virgatum L.) is a prime candidate crop for biofuel feedstock production in the United States. As it is a self-incompatible polyploid perennial species, breeding elite and stable switchgrass cultivars with traditional breeding methods is very challenging. Translational genomics may contribute significantly to the genetic improvement of switchgrass, especially for the incorporation of elite traits that are absent in natural switchgrass populations. In this study, we constitutively expressed an Arabidopsis NAC transcriptional factor gene, LONG VEGETATIVE PHASE ONE (AtLOV1), in switchgrass. Overexpression of AtLOV1 in switchgrass caused the plants to have a smaller leaf angle by changing the morphology and organization of epidermal cells in the leaf collar region. Also, overexpression of AtLOV1 altered the lignin content and the monolignol composition of cell walls, and caused delayed flowering time. Global gene-expression analysis of the transgenic plants revealed an array of responding genes with predicted functions in plant development, cell wall biosynthesis, and flowering. To our knowledge, this is the first report of a single ectopically expressed transcription factor altering the leaf angle, cell wall composition, and flowering time of switchgrass, therefore demonstrating the potential advantage of translational genomics for the genetic improvement of this crop.

Cardiac Delayed Rectifier Potassium Channels in Health and Disease.

PubMed

Chen, Lei; Sampson, Kevin J; Kass, Robert S

2016-06-01

Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this article, we will review their molecular identities and biophysical properties. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. Copyright © 2016 Elsevier Inc. All rights reserved.

Cardiac Delayed Rectifier Potassium Channels in Health and Disease

PubMed Central

Chen, Lei; Sampson, Kevin J.; Kass, Robert S.

2016-01-01

Cardiac delayed rectifier potassium channels conduct outward potassium currents during the plateau phase of action potentials and play pivotal roles in cardiac repolarization. These include IKs, IKr and the atrial specific IKur channels. In this chapter, we will review the molecular identities and biophysical properties of these channels. Mutations in the genes encoding delayed rectifiers lead to loss- or gain-of-function phenotypes, disrupt normal cardiac repolarization and result in various cardiac rhythm disorders, including congenital Long QT Syndrome, Short QT Syndrome and familial atrial fibrillation. We will also discuss the possibility and prospect of using delayed rectifier channels as therapeutic targets to manage cardiac arrhythmia. PMID:27261823

Market-based control strategy for long-span structures considering the multi-time delay issue

NASA Astrophysics Data System (ADS)

Li, Hongnan; Song, Jianzhu; Li, Gang

2017-01-01

To solve the different time delays that exist in the control device installed on spatial structures, in this study, discrete analysis using a 2 N precise algorithm was selected to solve the multi-time-delay issue for long-span structures based on the market-based control (MBC) method. The concept of interval mixed energy was introduced from computational structural mechanics and optimal control research areas, and it translates the design of the MBC multi-time-delay controller into a solution for the segment matrix. This approach transforms the serial algorithm in time to parallel computing in space, greatly improving the solving efficiency and numerical stability. The designed controller is able to consider the issue of time delay with a linear controlling force combination and is especially effective for large time-delay conditions. A numerical example of a long-span structure was selected to demonstrate the effectiveness of the presented controller, and the time delay was found to have a significant impact on the results.

Delay time and Hartman effect in strain engineered graphene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Xi, E-mail: xchen@shu.edu.cn; Deng, Zhi-Yong; Ban, Yue, E-mail: yban@shu.edu.cn

2014-05-07

Tunneling times, including group delay and dwell time, are studied for massless Dirac electrons transmitting through a one-dimensional barrier in strain-engineered graphene. The Hartman effect, the independence of group delay on barrier length, is induced by the strain effect, and associated with the transmission gap and the evanescent mode. The influence of barrier height/length and strain modulus/direction on the group delay is also discussed, which provides the flexibility to control the group delay with applications in graphene-based devices. The relationship between group delay and dwell time is finally derived to clarify the nature of the Hartman effect.

Octyl Methoxycinnamate Modulates Gene Expression and Prevents Cyclobutane Pyrimidine Dimer Formation but not Oxidative DNA Damage in UV-Exposed Human Cell Lines

PubMed Central

Duale, Nur; Olsen, Ann-Karin; Christensen, Terje; Butt, Shamas T.; Brunborg, Gunnar

2010-01-01

Octyl methoxycinnamate (OMC) is one of the most widely used sunscreen ingredients. To analyze biological effects of OMC, an in vitro approach was used implying ultraviolet (UV) exposure of two human cell lines, a primary skin fibroblast (GM00498) and a breast cancer (MCF-7) cell lines. End points include cell viability assessment, assay of cyclobutane pyrimidine dimers (CPDs) and oxidated DNA lesions using alkaline elution and lesion-specific enzymes, and gene expression analysis of a panel of 17 DNA damage–responsive genes. We observed that OMC provided protection against CPDs, and the degree of protection correlated with the OMC-mediated reduction in UV dose. No such protection was found with respect to oxidative DNA lesions. Upon UV exposure in the presence of OMC, the gene expression studies showed significant differential changes in some of the genes studied and the expression of p53 protein was also changed. For some genes, the change in expression seemed to be delayed in time by OMC. The experimental approach applied in this study, using a panel of 17 genes in an in vitro cellular system together with genotoxicity assays, may be useful in the initial screening of active ingredients in sunscreens. PMID:20071424

Reconstructions of parameters of radiophysical chaotic generator with delayed feedback from short time series

NASA Astrophysics Data System (ADS)

Ishbulatov, Yu. M.; Karavaev, A. S.; Kiselev, A. R.; Semyachkina-Glushkovskaya, O. V.; Postnov, D. E.; Bezruchko, B. P.

2018-04-01

A method for the reconstruction of time-delayed feedback system is investigated, which is based on the detection of synchronous response of a slave time-delay system with respect to the driving from the master system under study. The structure of the driven system is similar to the structure of the studied time-delay system, but the feedback circuit is broken in the driven system. The method efficiency is tested using short and noisy data gained from an electronic chaotic oscillator with time-delayed feedback.

First cardiac manifestation of hypotonia-cystinuria syndrome.

PubMed

Kılıç, Mustafa; Ceylan, Ahmet Cevdet; Örün, Utku Arman; Kılıç, Esra

2018-04-07

Hypotonia-cystinuria syndrome is a very rare autosomal recessive contiguous gene deletion syndrome of PREPL and SLC3A1 at 2p21 with neuromuscular and neuroendocrinologic presentation. We report a two-year-six-month-old affected female infant and her five-month-old affected brother with a novel homozygous deletion in SLC3A1 and PREPL gene. Both of siblings had mild facial dysmorphism, hypotonia, feeding problems, failure to thrive, developmental delay. She also had dilated cardiomyopathy which differ from other reported patients. Therefore cardiomyopathy may also be considered one of the features of hypotonia-cystinuria syndrome. With this case report, we present cardiac manifestation of hypotonia-cystinuria syndrome for the first time. Because of two siblings had hyperechogenic bowel in prenatal sonography, it might be a prenatal marker for HCS.

Clots Are Potent Triggers of Inflammatory Cell Gene Expression: Indications for Timely Fibrinolysis.

PubMed

Campbell, Robert A; Vieira-de-Abreu, Adriana; Rowley, Jesse W; Franks, Zechariah G; Manne, Bhanu Kanth; Rondina, Matthew T; Kraiss, Larry W; Majersik, Jennifer J; Zimmerman, Guy A; Weyrich, Andrew S

2017-10-01

Blood vessel wall damage often results in the formation of a fibrin clot that traps inflammatory cells, including monocytes. The effect of clot formation and subsequent lysis on the expression of monocyte-derived genes involved in the development and progression of ischemic stroke and other vascular diseases, however, is unknown. Determine whether clot formation and lysis regulates the expression of human monocyte-derived genes that modulate vascular diseases. We performed next-generation RNA sequencing on monocytes extracted from whole blood clots and using a purified plasma clot system. Numerous mRNAs were differentially expressed by monocytes embedded in clots compared with unclotted controls, and IL-8 (interleukin 8) and MCP-1 (monocyte chemoattractant protein-1) were among the upregulated transcripts in both models. Clotted plasma also increased expression of IL-8 and MCP-1, which far exceeded responses observed in lipopolysaccharide-stimulated monocytes. Upregulation of IL-8 and MCP-1 occurred in a thrombin-independent but fibrin-dependent manner. Fibrinolysis initiated shortly after plasma clot formation (ie, 1-2 hours) reduced the synthesis of IL-8 and MCP-1, whereas delayed fibrinolysis was far less effective. Consistent with these in vitro models, monocytes embedded in unresolved thrombi from patients undergoing thrombectomy stained positively for IL-8 and MCP-1. These findings demonstrate that clots are potent inducers of monocyte gene expression and that timely fibrinolysis attenuates inflammatory responses, specifically IL-8 and MCP-1. Dampening of inflammatory gene expression by timely clot lysis may contribute to the clinically proven efficacy of fibrinolytic drug treatment within hours of stroke onset. © 2017 American Heart Association, Inc.

Differential roles of breakfast and supper in rats of a daily three-meal schedule upon circadian regulation and physiology.

PubMed

Wu, Tao; Sun, Lu; ZhuGe, Fen; Guo, Xichao; Zhao, Zhining; Tang, Ruiqi; Chen, Qinping; Chen, Lin; Kato, Hisanori; Fu, Zhengwei

2011-12-01

The timing of meals has been suggested to play an important role in circadian regulation and metabolic health. Three meals a day is a well-established human feeding habit, which in today's lifestyle may or may not be followed. The aim of this study was to test whether the absence of breakfast or supper significantly affects the circadian system and physiological function. The authors developed a rat model for their daily three meals study, whereby animals were divided into three groups (three meals, TM; no first meal, NF; no last meal, NL) all fed with the same amount of food every day. Rats in the NF group displayed significantly decreased levels of plasma triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), low-density lipoprotein cholesterol (LDL-C), and glucose in the activity phase, accompanied by delayed circadian phases of hepatic peripheral clock and downstream metabolic genes. Rats in the NL group showed lower concentration of plasma TC, HDL-C, and glucose in the rest phase, plus reduced adipose tissue accumulation and body weight gain. Real-time polymerase chain reaction (PCR) analysis indicated an attenuated rhythm in the food-entraining pathway, including down-regulated expression of the clock genes Per2, Bmal1, and Rev-erbα, which may further contribute to the delayed and decreased expression of FAS in lipogenesis in this group. Our findings are consistent with the conclusion that the daily first meal determines the circadian phasing of peripheral clocks, such as in the liver, whereas the daily last meal tightly couples to lipid metabolism and adipose tissue accumulation, which suggests differential physiological effects and function of the respective meal timings.

Effects of Different PER Translational Kinetics on the Dynamics of a Core Circadian Clock Model

PubMed Central

Nieto, Paula S.; Revelli, Jorge A.; Garbarino-Pico, Eduardo; Condat, Carlos A.; Guido, Mario E.; Tamarit, Francisco A.

2015-01-01

Living beings display self-sustained daily rhythms in multiple biological processes, which persist in the absence of external cues since they are generated by endogenous circadian clocks. The period (per) gene is a central player within the core molecular mechanism for keeping circadian time in most animals. Recently, the modulation PER translation has been reported, both in mammals and flies, suggesting that translational regulation of clock components is important for the proper clock gene expression and molecular clock performance. Because translational regulation ultimately implies changes in the kinetics of translation and, therefore, in the circadian clock dynamics, we sought to study how and to what extent the molecular clock dynamics is affected by the kinetics of PER translation. With this objective, we used a minimal mathematical model of the molecular circadian clock to qualitatively characterize the dynamical changes derived from kinetically different PER translational mechanisms. We found that the emergence of self-sustained oscillations with characteristic period, amplitude, and phase lag (time delays) between per mRNA and protein expression depends on the kinetic parameters related to PER translation. Interestingly, under certain conditions, a PER translation mechanism with saturable kinetics introduces longer time delays than a mechanism ruled by a first-order kinetics. In addition, the kinetic laws of PER translation significantly changed the sensitivity of our model to parameters related to the synthesis and degradation of per mRNA and PER degradation. Lastly, we found a set of parameters, with realistic values, for which our model reproduces some experimental results reported recently for Drosophila melanogaster and we present some predictions derived from our analysis. PMID:25607544

Effects of different per translational kinetics on the dynamics of a core circadian clock model.

PubMed

Nieto, Paula S; Revelli, Jorge A; Garbarino-Pico, Eduardo; Condat, Carlos A; Guido, Mario E; Tamarit, Francisco A

2015-01-01

Living beings display self-sustained daily rhythms in multiple biological processes, which persist in the absence of external cues since they are generated by endogenous circadian clocks. The period (per) gene is a central player within the core molecular mechanism for keeping circadian time in most animals. Recently, the modulation PER translation has been reported, both in mammals and flies, suggesting that translational regulation of clock components is important for the proper clock gene expression and molecular clock performance. Because translational regulation ultimately implies changes in the kinetics of translation and, therefore, in the circadian clock dynamics, we sought to study how and to what extent the molecular clock dynamics is affected by the kinetics of PER translation. With this objective, we used a minimal mathematical model of the molecular circadian clock to qualitatively characterize the dynamical changes derived from kinetically different PER translational mechanisms. We found that the emergence of self-sustained oscillations with characteristic period, amplitude, and phase lag (time delays) between per mRNA and protein expression depends on the kinetic parameters related to PER translation. Interestingly, under certain conditions, a PER translation mechanism with saturable kinetics introduces longer time delays than a mechanism ruled by a first-order kinetics. In addition, the kinetic laws of PER translation significantly changed the sensitivity of our model to parameters related to the synthesis and degradation of per mRNA and PER degradation. Lastly, we found a set of parameters, with realistic values, for which our model reproduces some experimental results reported recently for Drosophila melanogaster and we present some predictions derived from our analysis.

Reconstruction of ensembles of coupled time-delay systems from time series.

PubMed

Sysoev, I V; Prokhorov, M D; Ponomarenko, V I; Bezruchko, B P

2014-06-01

We propose a method to recover from time series the parameters of coupled time-delay systems and the architecture of couplings between them. The method is based on a reconstruction of model delay-differential equations and estimation of statistical significance of couplings. It can be applied to networks composed of nonidentical nodes with an arbitrary number of unidirectional and bidirectional couplings. We test our method on chaotic and periodic time series produced by model equations of ensembles of diffusively coupled time-delay systems in the presence of noise, and apply it to experimental time series obtained from electronic oscillators with delayed feedback coupled by resistors.

Ectopic expression of UGT84A2 delayed flowering by indole-3-butyric acid-mediated transcriptional repression of ARF6 and ARF8 genes in Arabidopsis.

PubMed

Zhang, Gui-Zhi; Jin, Shang-Hui; Li, Pan; Jiang, Xiao-Yi; Li, Yan-Jie; Hou, Bing-Kai

2017-12-01

Ectopic expression of auxin glycosyltransferase UGT84A2 in Arabidopsis can delay flowering through increased indole-3-butyric acid and suppressed transcription of ARF6, ARF8 and flowering-related genes FT, SOC1, AP1 and LFY. Auxins are critical regulators for plant growth and developmental processes. Auxin homeostasis is thus an important issue for plant biology. Here, we identified an indole-3-butyric acid (IBA)-specific glycosyltransferase, UGT84A2, and characterized its role in Arabidopsis flowering development. UGT84A2 could catalyze the glycosylation of IBA, but not indole-3-acetic acid (IAA). UGT84A2 transcription expression was clearly induced by IBA. When ectopically expressing in Arabidopsis, UGT84A2 caused obvious delay in flowering. Correspondingly, the increase of IBA level, the down-regulation of AUXIN RESPONSE FACTOR 6 (ARF6) and ARF8, and the down-regulation of flowering-related genes such as FLOWERING LOCUS T (FT), SUPPRESSOR OF OVEREXPRESSION OF CO1(SOC1), APETALA1 (AP1), and LEAFY(LFY) were observed in transgenic plants. When exogenously applying IBA to wild-type plants, the late flowering phenotype, the down-regulation of ARF6, ARF8 and flowering-related genes recurred. We examined the arf6arf8 double mutants and found that the expression of flowering-related genes was also substantially decreased in these mutants. Together, our results suggest that glycosyltransferase UGT84A2 may be involved in flowering regulation through indole-3-butyric acid-mediated transcriptional repression of ARF6, ARF8 and downstream flowering pathway genes.

Molecular characterization of a novel X-linked syndrome involving developmental delay and deafness.

PubMed

Hildebrand, Michael S; de Silva, Michelle G; Tan, Tiong Yang; Rose, Elizabeth; Nishimura, Carla; Tolmachova, Tanya; Hulett, Joanne M; White, Susan M; Silver, Jeremy; Bahlo, Melanie; Smith, Richard J H; Dahl, Hans-Henrik M

2007-11-01

X-linked syndromes associated with developmental delay and sensorineural hearing loss (SNHL) have been characterized at the molecular level, including Mohr-Tranebjaerg syndrome and Norrie disease. In this study we report on a novel X-linked recessive, congenital syndrome in a family with developmental delay and SNHL that maps to a locus associated with mental retardation (MR) for which no causative gene has been identified. The X-linked recessive inheritance and congenital nature of the syndrome was confirmed by detailed clinical investigation and the family history. Linkage mapping of the X-chromosome was conducted to ascertain the disease locus and candidate genes were screened by direct sequencing and STRP analysis. The recessive syndrome was mapped to Xp11.3-q21.32 and a deletion was identified in a regulatory region upstream of the POU3F4 gene in affected family members. Since mutations in POU3F4 cause deafness at the DFN3 locus, the deletion is the likely cause of the SNHL in this family. The choroideremia (CHM) gene was also screened and a novel missense change was identified. The alteration changes the serine residue at position 89 in the Rab escort 1 protein (REP-1) to a cysteine (S89C). Prenylation of Rab proteins was investigated in patients and the location of REP-1 expression in the brain determined. However, subsequent analysis revealed that this change in CHM was polymorphic having no effect on REP-1 function. Although the causative gene at the MR locus in this family has not been identified, there are a number of genes involved in syndromic and nonsyndromic forms of MR that are potential candidates. Copyright 2007 Wiley-Liss, Inc.

Stability of Nonlinear Systems with Unknown Time-varying Feedback Delay

NASA Astrophysics Data System (ADS)

Chunodkar, Apurva A.; Akella, Maruthi R.

2013-12-01

This paper considers the problem of stabilizing a class of nonlinear systems with unknown bounded delayed feedback wherein the time-varying delay is 1) piecewise constant 2) continuous with a bounded rate. We also consider application of these results to the stabilization of rigid-body attitude dynamics. In the first case, the time-delay in feedback is modeled specifically as a switch among an arbitrarily large set of unknown constant values with a known strict upper bound. The feedback is a linear function of the delayed states. In the case of linear systems with switched delay feedback, a new sufficiency condition for average dwell time result is presented using a complete type Lyapunov-Krasovskii (L-K) functional approach. Further, the corresponding switched system with nonlinear perturbations is proven to be exponentially stable inside a well characterized region of attraction for an appropriately chosen average dwell time. In the second case, the concept of the complete type L-K functional is extended to a class of nonlinear time-delay systems with unknown time-varying time-delay. This extension ensures stability robustness to time-delay in the control design for all values of time-delay less than the known upper bound. Model-transformation is used in order to partition the nonlinear system into a nominal linear part that is exponentially stable with a bounded perturbation. We obtain sufficient conditions which ensure exponential stability inside a region of attraction estimate. A constructive method to evaluate the sufficient conditions is presented together with comparison with the corresponding constant and piecewise constant delay. Numerical simulations are performed to illustrate the theoretical results of this paper.

Effect of metrology time delay on overlay APC

NASA Astrophysics Data System (ADS)

Carlson, Alan; DiBiase, Debra

2002-07-01

The run-to-run control strategy of lithography APC is primarily composed of a feedback loop as shown in the diagram below. It is known that the insertion of a time delay in a feedback loop can cause degradation in control performance and could even cause a stable system to become unstable, if the time delay becomes sufficiently large. Many proponents of integrated metrology methods have cited the damage caused by metrology time delays as the primary justification for moving from a stand-alone to integrated metrology. While there is little dispute over the qualitative form of this argument, there has been very light published about the quantitative effects under real fab conditions - precisely how much control is lost due to these time delays. Another issue regarding time delays is that the length of these delays is not typically fixed - they vary from lot to lot and in some cases this variance can be large - from one hour on the short side to over 32 hours on the long side. Concern has been expressed that the variability in metrology time delays can cause undesirable dynamics in feedback loops that make it difficult to optimize feedback filters and gains and at worst could drive a system unstable. By using data from numerous fabs, spanning many sizes and styles of operation, we have conducted a quantitative study of the time delay effect on overlay run- to-run control. Our analysis resulted in the following conclusions: (1) There is a significant and material relationship between metrology time delay and overlay control under a variety of real world production conditions. (2) The run-to-run controller can be configured to minimize sensitivity to time delay variations. (3) The value of moving to integrated metrology can be quantified.

A Recurrent De Novo Variant in NACC1 Causes a Syndrome Characterized by Infantile Epilepsy, Cataracts, and Profound Developmental Delay.

PubMed

Schoch, Kelly; Meng, Linyan; Szelinger, Szabolcs; Bearden, David R; Stray-Pedersen, Asbjorg; Busk, Oyvind L; Stong, Nicholas; Liston, Eriskay; Cohn, Ronald D; Scaglia, Fernando; Rosenfeld, Jill A; Tarpinian, Jennifer; Skraban, Cara M; Deardorff, Matthew A; Friedman, Jeremy N; Akdemir, Zeynep Coban; Walley, Nicole; Mikati, Mohamad A; Kranz, Peter G; Jasien, Joan; McConkie-Rosell, Allyn; McDonald, Marie; Wechsler, Stephanie Burns; Freemark, Michael; Kansagra, Sujay; Freedman, Sharon; Bali, Deeksha; Millan, Francisca; Bale, Sherri; Nelson, Stanley F; Lee, Hane; Dorrani, Naghmeh; Goldstein, David B; Xiao, Rui; Yang, Yaping; Posey, Jennifer E; Martinez-Agosto, Julian A; Lupski, James R; Wangler, Michael F; Shashi, Vandana

2017-02-02

Whole-exome sequencing (WES) has increasingly enabled new pathogenic gene variant identification for undiagnosed neurodevelopmental disorders and provided insights into both gene function and disease biology. Here, we describe seven children with a neurodevelopmental disorder characterized by microcephaly, profound developmental delays and/or intellectual disability, cataracts, severe epilepsy including infantile spasms, irritability, failure to thrive, and stereotypic hand movements. Brain imaging in these individuals reveals delay in myelination and cerebral atrophy. We observe an identical recurrent de novo heterozygous c.892C>T (p.Arg298Trp) variant in the nucleus accumbens associated 1 (NACC1) gene in seven affected individuals. One of the seven individuals is mosaic for this variant. NACC1 encodes a transcriptional repressor implicated in gene expression and has not previously been associated with germline disorders. The probability of finding the same missense NACC1 variant by chance in 7 out of 17,228 individuals who underwent WES for diagnoses of neurodevelopmental phenotypes is extremely small and achieves genome-wide significance (p = 1.25 × 10 -14 ). Selective constraint against missense variants in NACC1 makes this excess of an identical missense variant in all seven individuals more remarkable. Our findings are consistent with a germline recurrent mutational hotspot associated with an allele-specific neurodevelopmental phenotype in NACC1. Copyright © 2017 American Society of Human Genetics. All rights reserved.

Advances in ultrasound-targeted microbubble-mediated gene therapy for liver fibrosis.

PubMed

Huang, Cuiyuan; Zhang, Hong; Bai, Ruidan

2017-07-01

Hepatic fibrosis develops as a wound-healing scar in response to acute and chronic liver inflammation and can lead to cirrhosis in patients with chronic hepatitis B and C. The condition arises due to increased synthesis and reduced degradation of extracellular matrix (ECM) and is a common pathological sequela of chronic liver disease. Excessive deposition of ECM in the liver causes liver dysfunction, ascites, and eventually upper gastrointestinal bleeding as well as a series of complications. However, fibrosis can be reversed before developing into cirrhosis and has thus been the subject of extensive researches particularly at the gene level. Currently, therapeutic genes are imported into the damaged liver to delay or prevent the development of liver fibrosis by regulating the expression of exogenous genes. One technique of gene delivery uses ultrasound targeting of microbubbles combined with therapeutic genes where the time and intensity of the ultrasound can control the release process. Ultrasound irradiation of microbubbles in the vicinity of cells changes the permeability of the cell membrane by its cavitation effect and enhances gene transfection. In this paper, recent progress in the field is reviewed with emphasis on the following aspects: the types of ultrasound microbubbles, the construction of an ultrasound-mediated gene delivery system, the mechanism of ultrasound microbubble-mediated gene transfer and the application of ultrasound microbubbles in the treatment of liver fibrosis.

Digital time delay

DOEpatents

Martin, A.D.

1986-05-09

Method and apparatus are provided for generating an output pulse following a trigger pulse at a time delay interval preset with a resolution which is high relative to a low resolution available from supplied clock pulses. A first lumped constant delay provides a first output signal at predetermined interpolation intervals corresponding to the desired high resolution time interval. Latching circuits latch the high resolution data to form a first synchronizing data set. A selected time interval has been preset to internal counters and corrected for circuit propagation delay times having the same order of magnitude as the desired high resolution. Internal system clock pulses count down the counters to generate an internal pulse delayed by an internal which is functionally related to the preset time interval. A second LCD corrects the internal signal with the high resolution time delay. A second internal pulse is then applied to a third LCD to generate a second set of synchronizing data which is complementary with the first set of synchronizing data for presentation to logic circuits. The logic circuits further delay the internal output signal with the internal pulses. The final delayed output signal thereafter enables the output pulse generator to produce the desired output pulse at the preset time delay interval following input of the trigger pulse.

12q14 microdeletion associated with HMGA2 gene disruption and growth restriction.

PubMed

Alyaqoub, Fadel; Pyatt, Robert E; Bailes, Andrea; Brock, Amanda; Deeg, Carol; McKinney, Aimee; Astbury, Caroline; Reshmi, Shalini; Shane, Kate P; Thrush, Devon Lamb; Sommer, Annemarie; Gastier-Foster, Julie M

2012-11-01

The 12q14 microdeletion syndrome is a rare condition that has previously been characterized by pre- and postnatal growth restriction, proportionate short stature, failure to thrive, developmental delay, and osteopoikilosis. Previously reported microdeletions within this region have ranged in size from 1.83 to 10.12 Mb with a proposed 2.61 Mb smallest region of overlap containing the LEMD3, HMGA2, and GRIP1 genes. Here, we report on the identification of a 12q14 microdeletion in a female child presenting with proportionate short stature, failure to thrive, and speech delay. The genomic loss (minimum size 4.17 Mb, maximum size 4.21 Mb) contained 25 RefSeq genes including IRAK3, GRIP1, and the 3' portion of the HMGA2 gene. This is the first partial deletion of HMGA2 associated with the 12q14 microdeletion syndrome. This case further clarifies the association of LEMD3 deletions with the 12q14 microdeletion syndrome and provides additional support for the role of the HMGA2 gene in human growth. Copyright © 2012 Wiley Periodicals, Inc.

Expression of interferon-induced antiviral genes is delayed in a STAT1 knockout mouse model of Crimean-Congo hemorrhagic fever.

PubMed

Bowick, Gavin C; Airo, Adriana M; Bente, Dennis A

2012-06-19

Crimean Congo hemorrhagic fever (CCHF) is a tick-borne hemorrhagic zoonosis associated with high mortality. Pathogenesis studies and the development of vaccines and antivirals against CCHF have been severely hampered by the lack of suitable animal model. We recently developed and characterized a mature mouse model for CCHF using mice carrying STAT1 knockout (KO). Given the importance of interferons in controlling viral infections, we investigated the expression of interferon pathway-associated genes in KO and wild-type (WT) mice challenged with CCHF virus. We expected that the absence of the STAT1 protein would result in minimal expression of IFN-related genes. Surprisingly, the KO mice showed high levels of IFN-stimulated gene expression, beginning on day 2 post-infection, while in WT mice challenged with virus the same genes were expressed at similar levels on day 1. We conclude that CCHF virus induces similar type I IFN responses in STAT1 KO and WT mice, but the delayed response in the KO mice permits rapid viral dissemination and fatal illness.

The C4 Model Grass Setaria Is a Short Day Plant with Secondary Long Day Genetic Regulation

PubMed Central

Doust, Andrew N.; Mauro-Herrera, Margarita; Hodge, John G.; Stromski, Jessica

2017-01-01

The effect of photoperiod (day:night ratio) on flowering time was investigated in the wild species, Setaria viridis, and in a set of recombinant inbred lines (RILs) derived from a cross between foxtail millet (S. italica) and its wild ancestor green foxtail (S. viridis). Photoperiods totaled 24 h, with three trials of 8:16, 12:12 and 16:8 light:dark hour regimes for the RIL population, and these plus 10:14 and 14:10 for the experiments with S. viridis alone. The response of S. viridis to light intensity as well as photoperiod was assessed by duplicating photoperiods at two light intensities (300 and 600 μmol.m-2.s-1). In general, day lengths longer than 12 h delayed flowering time, although flowering time was also delayed in shorter day-lengths relative to the 12 h trial, even when daily flux in high intensity conditions exceeded that of the low intensity 12 h trial. Cluster analysis showed that the effect of photoperiod on flowering time differed between sets of RILs, with some being almost photoperiod insensitive and others being delayed with respect to the population as a whole in either short (8 or 12 h light) or long (16 h light) photoperiods. QTL results reveal a similar picture, with several major QTL colocalizing between the 8 and 12 h light trials, but with a partially different set of QTL identified in the 16 h trial. Major candidate genes for these QTL include several members of the PEBP protein family that includes Flowering Locus T (FT) homologs such as OsHd3a, OsRFT1, and ZCN8/12. Thus, Setaria is a short day plant (flowering quickest in short day conditions) whose flowering is delayed by long day lengths in a manner consistent with the responses of most other members of the grass family. However, the QTL results suggest that flowering time under long day conditions uses additional genetic pathways to those used under short day conditions. PMID:28729868

The C4 Model Grass Setaria Is a Short Day Plant with Secondary Long Day Genetic Regulation.

PubMed

Doust, Andrew N; Mauro-Herrera, Margarita; Hodge, John G; Stromski, Jessica

2017-01-01

The effect of photoperiod (day:night ratio) on flowering time was investigated in the wild species, Setaria viridis , and in a set of recombinant inbred lines (RILs) derived from a cross between foxtail millet ( S. italica ) and its wild ancestor green foxtail ( S. viridis ). Photoperiods totaled 24 h, with three trials of 8:16, 12:12 and 16:8 light:dark hour regimes for the RIL population, and these plus 10:14 and 14:10 for the experiments with S. viridis alone. The response of S. viridis to light intensity as well as photoperiod was assessed by duplicating photoperiods at two light intensities (300 and 600 μmol.m -2 .s -1 ). In general, day lengths longer than 12 h delayed flowering time, although flowering time was also delayed in shorter day-lengths relative to the 12 h trial, even when daily flux in high intensity conditions exceeded that of the low intensity 12 h trial. Cluster analysis showed that the effect of photoperiod on flowering time differed between sets of RILs, with some being almost photoperiod insensitive and others being delayed with respect to the population as a whole in either short (8 or 12 h light) or long (16 h light) photoperiods. QTL results reveal a similar picture, with several major QTL colocalizing between the 8 and 12 h light trials, but with a partially different set of QTL identified in the 16 h trial. Major candidate genes for these QTL include several members of the PEBP protein family that includes Flowering Locus T (FT) homologs such as OsHd3a, OsRFT1, and ZCN8/12. Thus, Setaria is a short day plant (flowering quickest in short day conditions) whose flowering is delayed by long day lengths in a manner consistent with the responses of most other members of the grass family. However, the QTL results suggest that flowering time under long day conditions uses additional genetic pathways to those used under short day conditions.

Delayed Adrenarche may be an Additional Feature of Immunoglobulin Super Family Member 1 Deficiency Syndrome.

PubMed

Van Hulle, Severine; Craen, Margarita; Callewaert, Bert; Joustra, Sjoerd; Oostdijk, Wilma; Losekoot, Monique; Wit, Jan Maarten; Turgeon, Marc Olivier; Bernard, Daniel J; De Schepper, Jean

2016-03-05

Immunoglobulin super family member 1 (IGSF1) deficiency syndrome is characterized by central hypothyroidism, delayed surge in testosterone during puberty, macro-orchidism, and in some cases, hypoprolactinemia and/or transient growth hormone (GH) deficiency. Our patient was a 19-year-old male adolescent who had been treated since the age of 9 years with GH and thyroxine for an idiopathic combined GH, thyroid-stimulating hormone (TSH), and prolactin (PRL) deficiency. His GH deficiency proved to be transient, but deficiencies of TSH and PRL persisted, and he had developed macro-orchidism since the end of puberty. Brain magnetic resonance imaging and PROP1 and POU1F1 sequencing were normal. A disharmonious puberty (delayed genital and pubic hair development, bone maturation, and pubertal growth spurt, despite normal testicular growth) was observed as well as a delayed adrenarche, as reflected by very low dehydroepiandrosterone sulfate and delayed pubarche. Direct sequencing of the IGSF1 gene revealed a novel hemizygous mutation, c.3127T>C, p.Cys1043Arg. Pathogenicity of the mutation was demonstrated in vitro. Male children with an idiopathic combined GH, PRL, and TSH deficiency, showing persistent central hypothyroidism but transient GH deficiency upon retesting at adult height, should be screened for mutations in the IGSF1 gene, especially when macro-orchidism and/or hypoprolactinemia are present. We suspect that delayed adrenarche, as a consequence of PRL deficiency, might be part of the clinical phenotype of patients with IGSF1 deficiency.

Delayed Adrenarche may be an Additional Feature of Immunoglobulin Super Family Member 1 Deficiency Syndrome

PubMed Central

Hulle, Severine Van; Craen, Margarita; Callewaert, Bert; Joustra, Sjoerd; Oostdijk, Wilma; Losekoot, Monique; Wit, Jan Maarten; Turgeon, Marc Olivier; Bernard, Daniel J.; Schepper, Jean De

2016-01-01

Immunoglobulin super family member 1 (IGSF1) deficiency syndrome is characterized by central hypothyroidism, delayed surge in testosterone during puberty, macro-orchidism, and in some cases, hypoprolactinemia and/or transient growth hormone (GH) deficiency. Our patient was a 19-year-old male adolescent who had been treated since the age of 9 years with GH and thyroxine for an idiopathic combined GH, thyroid-stimulating hormone (TSH), and prolactin (PRL) deficiency. His GH deficiency proved to be transient, but deficiencies of TSH and PRL persisted, and he had developed macro-orchidism since the end of puberty. Brain magnetic resonance imaging and PROP1 and POU1F1 sequencing were normal. A disharmonious puberty (delayed genital and pubic hair development, bone maturation, and pubertal growth spurt, despite normal testicular growth) was observed as well as a delayed adrenarche, as reflected by very low dehydroepiandrosterone sulfate and delayed pubarche. Direct sequencing of the IGSF1 gene revealed a novel hemizygous mutation, c.3127T>C, p.Cys1043Arg. Pathogenicity of the mutation was demonstrated in vitro. Male children with an idiopathic combined GH, PRL, and TSH deficiency, showing persistent central hypothyroidism but transient GH deficiency upon retesting at adult height, should be screened for mutations in the IGSF1 gene, especially when macro-orchidism and/or hypoprolactinemia are present. We suspect that delayed adrenarche, as a consequence of PRL deficiency, might be part of the clinical phenotype of patients with IGSF1 deficiency. PMID:26757742

Traversal of electromagnetic pulses through dispersive media with negative refractive index

NASA Astrophysics Data System (ADS)

Nanda, L.; Ramakrishna, S. A.

2017-05-01

We investigate the traversal of electromagnetic pulses through dispersive media with negative refractive index in such a way that no resonant effects come into play. It has been verified that for evanescent waves, the definitions of the group delay and the reshaping delay times get interchanged in comparison to the propagating waves. We show that for a negative refractive index medium (NRM) with ɛ(ω)=μ(ω), the reshaping delay time identically vanishes for propagating waves. The total delay time in NRM is otherwise contributed by both the group and the reshaping delay times, whereas for the case of broadband pulses in NRM the total delay time is always subluminal.

The role of the Arabidopsis FUSCA3 transcription factor during inhibition of seed germination at high temperature.

PubMed

Chiu, Rex S; Nahal, Hardeep; Provart, Nicholas J; Gazzarrini, Sonia

2012-01-27

Imbibed seeds integrate environmental and endogenous signals to break dormancy and initiate growth under optimal conditions. Seed maturation plays an important role in determining the survival of germinating seeds, for example one of the roles of dormancy is to stagger germination to prevent mass growth under suboptimal conditions. The B3-domain transcription factor FUSCA3 (FUS3) is a master regulator of seed development and an important node in hormonal interaction networks in Arabidopsis thaliana. Its function has been mainly characterized during embryonic development, where FUS3 is highly expressed to promote seed maturation and dormancy by regulating ABA/GA levels. In this study, we present evidence for a role of FUS3 in delaying seed germination at supraoptimal temperatures that would be lethal for the developing seedlings. During seed imbibition at supraoptimal temperature, the FUS3 promoter is reactivated and induces de novo synthesis of FUS3 mRNA, followed by FUS3 protein accumulation. Genetic analysis shows that FUS3 contributes to the delay of seed germination at high temperature. Unlike WT, seeds overexpressing FUS3 (ML1:FUS3-GFP) during imbibition are hypersensitive to high temperature and do not germinate, however, they can fully germinate after recovery at control temperature reaching 90% seedling survival. ML1:FUS3-GFP hypersensitivity to high temperature can be partly recovered in the presence of fluridone, an inhibitor of ABA biosynthesis, suggesting this hypersensitivity is due in part to higher ABA level in this mutant. Transcriptomic analysis shows that WT seeds imbibed at supraoptimal temperature activate seed-specific genes and ABA biosynthetic and signaling genes, while inhibiting genes that promote germination and growth, such as GA biosynthetic and signaling genes. In this study, we have uncovered a novel function for the master regulator of seed maturation, FUS3, in delaying germination at supraoptimal temperature. Physiologically, this is important since delaying germination has a protective role at high temperature. Transcriptomic analysis of seeds imbibed at supraoptimal temperature reveal that a complex program is in place, which involves not only the regulation of heat and dehydration response genes to adjust cellular functions, but also the activation of seed-specific programs and the inhibition of germination-promoting programs to delay germination. © 2011 Chiu et al; licensee BioMed Central Ltd.

The role of the Arabidopsis FUSCA3 transcription factor during inhibition of seed germination at high temperature

PubMed Central

2012-01-01

Background Imbibed seeds integrate environmental and endogenous signals to break dormancy and initiate growth under optimal conditions. Seed maturation plays an important role in determining the survival of germinating seeds, for example one of the roles of dormancy is to stagger germination to prevent mass growth under suboptimal conditions. The B3-domain transcription factor FUSCA3 (FUS3) is a master regulator of seed development and an important node in hormonal interaction networks in Arabidopsis thaliana. Its function has been mainly characterized during embryonic development, where FUS3 is highly expressed to promote seed maturation and dormancy by regulating ABA/GA levels. Results In this study, we present evidence for a role of FUS3 in delaying seed germination at supraoptimal temperatures that would be lethal for the developing seedlings. During seed imbibition at supraoptimal temperature, the FUS3 promoter is reactivated and induces de novo synthesis of FUS3 mRNA, followed by FUS3 protein accumulation. Genetic analysis shows that FUS3 contributes to the delay of seed germination at high temperature. Unlike WT, seeds overexpressing FUS3 (ML1:FUS3-GFP) during imbibition are hypersensitive to high temperature and do not germinate, however, they can fully germinate after recovery at control temperature reaching 90% seedling survival. ML1:FUS3-GFP hypersensitivity to high temperature can be partly recovered in the presence of fluridone, an inhibitor of ABA biosynthesis, suggesting this hypersensitivity is due in part to higher ABA level in this mutant. Transcriptomic analysis shows that WT seeds imbibed at supraoptimal temperature activate seed-specific genes and ABA biosynthetic and signaling genes, while inhibiting genes that promote germination and growth, such as GA biosynthetic and signaling genes. Conclusion In this study, we have uncovered a novel function for the master regulator of seed maturation, FUS3, in delaying germination at supraoptimal temperature. Physiologically, this is important since delaying germination has a protective role at high temperature. Transcriptomic analysis of seeds imbibed at supraoptimal temperature reveal that a complex program is in place, which involves not only the regulation of heat and dehydration response genes to adjust cellular functions, but also the activation of seed-specific programs and the inhibition of germination-promoting programs to delay germination. PMID:22279962

Simulation analysis of the effect of initial delay on flight delay diffusion

NASA Astrophysics Data System (ADS)

Que, Zufu; Yao, Hongguang; Yue, Wei

2018-01-01

The initial delay of the flight is an important factor affecting the spread of flight delays, so clarifying their relationship conduces to control flight delays in the aeronautical network. Through establishing a model of the chain aviation network and making simulation analysis of the effects of initial delay on the delay longitudinal diffusion, it’s found that the number of delayed airports in the air network, the total delay time and the average delay time of the delayed airport are generally positively correlated with the initial delay. This indicates that the occurrence of the initial delay should be avoided or reduced as much as possible to improve the punctuality of the flight.

Oxalate exposure provokes HSP 70 response in LLC-PK1 cells, a line of renal epithelial cells: protective role of HSP 70 against oxalate toxicity.

PubMed

Koul, Sweaty; Huang, Meiyi; Bhat, Sidarth; Maroni, Paul; Meacham, Randall B; Koul, Hari K

2008-02-01

We investigated the effects of oxalate on immediate early genes (IEGs) and stress protein HSP 70, commonly induced genes in response to a variety of stresses. LLC-PK1 cells were exposed to oxalate. Gene transcription and translation were monitored by Northern and Western blot analysis. RNA and DNA synthesis were assessed by [(3)H]-uridine and [(3)H]-thymidine incorporation, respectively. Oxalate exposure selectively increased the levels of mRNA encoding IEGs c-myc and c-jun as well as stress protein HSP 70. While expression of c-myc and c-jun was rapid (within 15 min to 2 h) and transient, HSP 70 expression was delayed (approximately 8 h) and stable. Furthermore, oxalate exposure resulted in delayed induction of generalized transcription by 18 h and reinitiation of the DNA synthesis by 24 h of oxalate exposure. Moreover, we show that prior induction of HSP 70 by mild hypertonic exposure protected the cells from oxalate toxicity. To the best of our knowledge this is the first study to demonstrate rapid IEG response and delayed heat-shock response to oxalate toxicity and protective role of HSP 70 against oxalate toxicity to renal epithelial cells. Oxalate, a metabolic end product, induces IEGs c-myc and c-jun and a delayed HSP 70 expression; While IEG expression may regulate additional genetic responses to oxalate, increased HSP 70 expression would serve an early protective role during oxalate stress.

Long Term Follow up of the Delayed Effects of Acute Radiation Exposure in Primates

DTIC Science & Technology

2017-10-01

66 of 94 We will then use shRNAs and/or CRISPR constructs targeting the gene of interest to knock down its expression in stem cells prior to...DLBCLs Mutational profiling identifies 150 driver genes Gene expression identifies sub- groups including cell of origin Unbiased CRISPR screen...Exome sequencing in 1,001 DLBCL patients comprehensively identifies 150 driver genes d Unbiased CRISPR screen in DLBCL cell lines identifies essential

Gene Expression Profiling of Monkeypox Virus-Infected Cells Reveals Novel Interfaces for Host-Virus Interactions

DTIC Science & Technology

2010-07-28

expression is plotted on Y -axis after normalization to mock-treated samples. Results plotted to compare calculated fold change in expression of each gene ...RESEARCH Open Access Gene expression profiling of monkeypox virus-infected cells reveals novel interfaces for host-virus interactions Abdulnaser...suppress antiviral cell defenses, exploit host cell machinery, and delay infection-induced cell death. However, a comprehensive study of all host genes

A New Strain of Drosophila That Inhibits the Development of Symptoms in Imagoes Infected with Sigma Virus

PubMed Central

Herforth, R. S.

1978-01-01

A strain of Drosophila melanogaster bearing the mutant gene ebony has been found to slow the development of symptoms (carbon dioxide sensitivity) in adult flies inoculated with sigma virus, a member of the rhabdovirus group. This inhibition is made evident by comparing mean incubation times of the virus in ebony and wild-type (Oregon) flies. The increase in mean incubation time in ebony flies has ranged from about 3 to 8 days, depending on the virus strain, amount of virus injected, and the age of the flies at the time of inoculation. This delay in development of symptoms appears to be due to a dominant autosomal gene, although further work is needed to confirm this. When accumulation of infectious virus after inoculation is compared in ebony and Oregon flies, there seems to be no inhibition of multiplication in ebony at the level of the entire fly. The relationship of this work to current theories on the mechanism of symptom production by sigma virus is discussed. PMID:17248809

De novo variants in KLF7 are a potential novel cause of developmental delay/intellectual disability, neuromuscular and psychiatric symptoms.

PubMed

Powis, Z; Petrik, I; Cohen, J S; Escolar, D; Burton, J; van Ravenswaaij-Arts, C M A; Sival, D A; Stegmann, A P A; Kleefstra, T; Pfundt, R; Chikarmane, R; Begtrup, A; Huether, R; Tang, S; Shinde, D N

2018-05-01

Due to small numbers of reported patients with pathogenic variants in single genes, the phenotypic spectrum associated with genes causing neurodevelopmental disorders such as intellectual disability (ID) and autism spectrum disorder is expanding. Among these genes is KLF7 (Krüppel-like factor 7), which is located at 2q33.3 and has been implicated in several developmental processes. KLF7 has been proposed to be a candidate gene for the phenotype of autism features seen in patients with a 2q33.3q34 deletion. Herein, we report 4 unrelated individuals with de novo KLF7 missense variants who share similar clinical features of developmental delay/ID, hypotonia, feeding/swallowing issues, psychiatric features and neuromuscular symptoms, and add to the knowledge about the phenotypic spectrum associated with KLF7 haploinsufficiency. © 2017 The Authors. Clinical Genetics published by John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Overexpression of a novel MADS-box gene SlFYFL delays senescence, fruit ripening and abscission in tomato

PubMed Central

Xie, Qiaoli; Hu, Zongli; Zhu, Zhiguo; Dong, Tingting; Zhao, Zhiping; Cui, Baolu; Chen, Guoping

2014-01-01

MADS-domain proteins are important transcription factors involved in many biological processes of plants. In our study, a tomato MADS-box gene, SlFYFL, was isolated. SlFYFL is expressed in all tissues of tomato and significantly higher in mature leave, fruit of different stages, AZ (abscission zone) and sepal. Delayed leaf senescence and fruit ripening, increased storability and longer sepals were observed in 35S:FYFL tomato. The accumulation of carotenoid was reduced, and ethylene content, ethylene biosynthetic and responsive genes were down-regulated in 35S:FYFL fruits. Abscission zone (AZ) did not form normally and abscission zone development related genes were declined in AZs of 35S:FYFL plants. Yeast two-hybrid assay revealed that SlFYFL protein could interact with SlMADS-RIN, SlMADS1 and SlJOINTLESS, respectively. These results suggest that overexpression of SlFYFL regulate fruit ripening and development of AZ via interactions with the ripening and abscission zone-related MADS box proteins. PMID:24621662

A common haplotype lowers PU.1 expression in myeloid cells and delays onset of Alzheimer's disease.

PubMed

Huang, Kuan-Lin; Marcora, Edoardo; Pimenova, Anna A; Di Narzo, Antonio F; Kapoor, Manav; Jin, Sheng Chih; Harari, Oscar; Bertelsen, Sarah; Fairfax, Benjamin P; Czajkowski, Jake; Chouraki, Vincent; Grenier-Boley, Benjamin; Bellenguez, Céline; Deming, Yuetiva; McKenzie, Andrew; Raj, Towfique; Renton, Alan E; Budde, John; Smith, Albert; Fitzpatrick, Annette; Bis, Joshua C; DeStefano, Anita; Adams, Hieab H H; Ikram, M Arfan; van der Lee, Sven; Del-Aguila, Jorge L; Fernandez, Maria Victoria; Ibañez, Laura; Sims, Rebecca; Escott-Price, Valentina; Mayeux, Richard; Haines, Jonathan L; Farrer, Lindsay A; Pericak-Vance, Margaret A; Lambert, Jean Charles; van Duijn, Cornelia; Launer, Lenore; Seshadri, Sudha; Williams, Julie; Amouyel, Philippe; Schellenberg, Gerard D; Zhang, Bin; Borecki, Ingrid; Kauwe, John S K; Cruchaga, Carlos; Hao, Ke; Goate, Alison M

2017-08-01

A genome-wide survival analysis of 14,406 Alzheimer's disease (AD) cases and 25,849 controls identified eight previously reported AD risk loci and 14 novel loci associated with age at onset. Linkage disequilibrium score regression of 220 cell types implicated the regulation of myeloid gene expression in AD risk. The minor allele of rs1057233 (G), within the previously reported CELF1 AD risk locus, showed association with delayed AD onset and lower expression of SPI1 in monocytes and macrophages. SPI1 encodes PU.1, a transcription factor critical for myeloid cell development and function. AD heritability was enriched within the PU.1 cistrome, implicating a myeloid PU.1 target gene network in AD. Finally, experimentally altered PU.1 levels affected the expression of mouse orthologs of many AD risk genes and the phagocytic activity of mouse microglial cells. Our results suggest that lower SPI1 expression reduces AD risk by regulating myeloid gene expression and cell function.

Estimation of coupling between time-delay systems from time series

NASA Astrophysics Data System (ADS)

Prokhorov, M. D.; Ponomarenko, V. I.

2005-07-01

We propose a method for estimation of coupling between the systems governed by scalar time-delay differential equations of the Mackey-Glass type from the observed time series data. The method allows one to detect the presence of certain types of linear coupling between two time-delay systems, to define the type, strength, and direction of coupling, and to recover the model equations of coupled time-delay systems from chaotic time series corrupted by noise. We verify our method using both numerical and experimental data.

LiDAR-IMU Time Delay Calibration Based on Iterative Closest Point and Iterated Sigma Point Kalman Filter

PubMed Central

Liu, Wanli

2017-01-01

The time delay calibration between Light Detection and Ranging (LiDAR) and Inertial Measurement Units (IMUs) is an essential prerequisite for its applications. However, the correspondences between LiDAR and IMU measurements are usually unknown, and thus cannot be computed directly for the time delay calibration. In order to solve the problem of LiDAR-IMU time delay calibration, this paper presents a fusion method based on iterative closest point (ICP) and iterated sigma point Kalman filter (ISPKF), which combines the advantages of ICP and ISPKF. The ICP algorithm can precisely determine the unknown transformation between LiDAR-IMU; and the ISPKF algorithm can optimally estimate the time delay calibration parameters. First of all, the coordinate transformation from the LiDAR frame to the IMU frame is realized. Second, the measurement model and time delay error model of LiDAR and IMU are established. Third, the methodology of the ICP and ISPKF procedure is presented for LiDAR-IMU time delay calibration. Experimental results are presented that validate the proposed method and demonstrate the time delay error can be accurately calibrated. PMID:28282897

UGT1A1 gene polymorphism: Impact on toxicity and efficacy of irinotecan-based regimens in metastatic colorectal cancer

PubMed Central

Schulz, Christoph; Heinemann, Volker; Schalhorn, Andreas; Moosmann, Nikolas; Zwingers, Thomas; Boeck, Stefan; Giessen, Clemens; Stemmler, Hans-Joachim

2009-01-01

AIM: To investigate the correlation between uridine diphosphate glucuronosyl transferase 1A1 (UGT1A1) gene polymorphisms and irinotecan-associated side effects and parameters of drug efficacy in patients with metastatic colorectal cancer (mCRC) receiving a low-dose weekly irinotecan chemotherapeutic regimen. METHODS: Genotypes were retrospectively evaluated by gene scan analysis on the ABI 310 sequencer of the TATAA box in the promoter region of the UGT1A1 gene in blood samples from 105 patients who had received 1st line irinotecan-based chemotherapy for mCRC. RESULTS: The distribution of the genotypes was as follows: wild type genotype (WT) (6/6) 39.0%, heterozygous genotype (6/7) 49.5%, and homozygous genotype (7/7) 9.5%. The overall response rate (OR) was similar between patients carrying the (6/7, 7/7) or the WT genotype (6/6) (44.3% vs 43.2%, P = 0.75). Neither time to progression [(TTP) 8.1 vs 8.2 mo, P = 0.97] nor overall survival [(OS) 21.2 vs 18.9 mo, P = 0.73] differed significantly in patients who carried the (6/6) when compared to the (6/7, 7/7) genotype. No significant differences in toxicity were observed: Grade 3 and 4 delayed diarrhoea [(6/7, 7/7) vs (6/6); 13.0% vs 6.2%, P = 0.08], treatment delays [(6/7, 7/7) vs (6/6); 25.1% vs 19.3%, P =0.24] or dose reductions [(6/7, 7/7) vs (6/6); 21.5% vs 27.2%, P = 0.07]. CONCLUSION: This analysis demonstrates the non-significant influence of the UGT1A1 gene polymorphism on efficacy and rate of irinotecan-associated toxicity in mCRC patients receiving low-dose irinotecan based chemotherapy. PMID:19859999

[Time perception in depressed and manic patients].

PubMed

Zhao, Qi-yuan; Ji, Yi-fu; Wang, Kai; Zhang, Lei; Liu, Ping; Jiang, Yu-bao

2010-02-02

To investigate the time perception in affective disorders by using neuropsychological tests and to try to elucidate its neurobiochemical mechanism. Using a time reproduction task, a comparative study was conducted for 28 depressive patients, 22 manic patients, and 26 age and education level matched healthy persons as healthy controls. Both depressive patients and manic patients are abnormal (P < 0.001), depressive patients over-reproduced the time interval than healthy controls (600 ms/delay 1 s: 1.6 +/- 0.6, P < 0.001; 600 ms/delay 5 s: 1.7 +/- 0.6, P < 0.001; 3 s/delay 1 s: 3.9 +/- 0.9, P < 0.001; 3 s/delay 5 s: 3.9 +/- 0.7, P < 0.001; 5 s/delay 1 s: 5.9 +/- 1.3, P < 0.001; 5 s/delay 5 s: 6.1 +/- 1.3, P < 0.001), yet manic patients under-reproduced the time interval (600 ms/delay 1 s: 0.7 +/- 0.2, P < 0.01; 600 ms/delay 5 s: 0.6 +/- 0.3, P < 0.001; 3 s/delay 1 s: 1.7 +/- 0.5, P < 0.001; 3 s/delay 5 s: 1.8 +/- 0.6, P < 0.001; 5 s/delay 1 s: 2.9 +/- 0.7, P < 0.001; 5 s/delay 5 s: 3.0 +/- 0.8, P < 0.001). The results of time reproduction task in patients were not related to age, education, duration of illness, number of admission (P > 0.05), but had some relation to severity of illness.And the results were positively correlated with the score of HAMD in depressive patients (six times: r = 0.44, 0.46, 0.73, 0.61, 0.55, 0.50, P < 0.05), but negatively with the score of BRMS in manic patients (six times: r = -0.57, -0.54, -0.71, -0.69, -0.80, -0.71, P < 0.05). Emotion will affect one's time perception. And the neurotransmitter in brain may participate in the processes of time perception.

Bounded Linear Stability Analysis - A Time Delay Margin Estimation Approach for Adaptive Control

NASA Technical Reports Server (NTRS)

Nguyen, Nhan T.; Ishihara, Abraham K.; Krishnakumar, Kalmanje Srinlvas; Bakhtiari-Nejad, Maryam

2009-01-01

This paper presents a method for estimating time delay margin for model-reference adaptive control of systems with almost linear structured uncertainty. The bounded linear stability analysis method seeks to represent the conventional model-reference adaptive law by a locally bounded linear approximation within a small time window using the comparison lemma. The locally bounded linear approximation of the combined adaptive system is cast in a form of an input-time-delay differential equation over a small time window. The time delay margin of this system represents a local stability measure and is computed analytically by a matrix measure method, which provides a simple analytical technique for estimating an upper bound of time delay margin. Based on simulation results for a scalar model-reference adaptive control system, both the bounded linear stability method and the matrix measure method are seen to provide a reasonably accurate and yet not too conservative time delay margin estimation.

An out-of-lab trial: a case example for the effect of intensive exercise on rhythms of human clock gene expression

PubMed Central

2013-01-01

Background Although out-of-lab investigation of the human circadian clock at the clock gene expression level remains difficult, a recent method using hair follicle cells might be useful. While exercise may function as an entrainment cue for circadian rhythms, it remains unclear whether exercise affects human circadian clock gene expression. Methods Efforts to observe apparent effects of exercise on clock gene expression require that several specific conditions be met: intense exercise should be habitually performed at a relatively uncommon time of day over an extended period; and any relative phase shift thereby observed should be validated by comparison of exercise and no-exercise periods. Wake-up and meal times should be kept almost constant over the experimental period. The present study was conducted using a professional fighter who met these strict criteria as subject. Facial hair samples were collected at 4-h intervals around the clock to ascertain rhythms of clock gene expression. Results During a period in which nighttime training (from 20:00 to 22:00) was habitually performed, circadian clock gene expression was phase-delayed by 2 to 4 h compared with that during a no-exercise period. Maximum level and circadian amplitude of clock gene expression were not affected by the nighttime training. Conclusion Our trial observations illustrate the possibility that heavy physical exercise might strongly affect the circadian phase of clock gene expression. Exercise might be therefore effective for the clinical care of circadian disorders. The results also suggest that athletes may require careful scheduling of heavy physical exercise to maintain normal circadian phase and ensure optimal athletic performance. PMID:24004634

Gene expression profiling in human skeletal muscle during recovery from eccentric exercise

PubMed Central

Mohoney, D. J.; Safdar, A.; Parise, G.; Melov, S.; Fu, Minghua; MacNeil, L.; Kaczor, J.; Payne, E. T.; Tarnopolsky, M. A.

2009-01-01

We used cDNA microarrays to screen for differentially expressed genes during recovery from exercise-induced muscle damage in humans. Male subjects (n = 4) performed 300 maximal eccentric contractions, and skeletal muscle biopsy samples were analyzed at 3 h and 48 h after exercise. In total, 113 genes increased 3 h postexercise, and 34 decreased. At 48 h postexercise, 59 genes increased and 29 decreased. On the basis of these data, we chose 19 gene changes and conducted secondary analyses using real-time RT-PCR from muscle biopsy samples taken from 11 additional subjects who performed an identical bout of exercise. Real-time RT-PCR analyses confirmed that exercise-induced muscle damage led to a rapid (3 h) increase in sterol response element binding protein 2 (SREBP-2), followed by a delayed (48 h) increase in the SREBP-2 gene targets Acyl CoA:cholesterol acyltransferase (ACAT)-2 and insulin-induced gene 1 (insig-1). The expression of the IL-1 receptor, a known regulator of SREBP-2, was also elevated after exercise. Taken together, these expression changes suggest a transcriptional program for increasing cholesterol and lipid synthesis and/or modification. Additionally, damaging exercise induced the expression of protein kinase H11, capping protein Z alpha (capZα), and modulatory calcineurin-interacting protein 1 (MCIP1), as well as cardiac ankryin repeat protein 1 (CARP1), DNAJB2, c-myc, and junD, each of which are likely involved in skeletal muscle growth, remodeling, and stress management. In summary, using DNA microarrays and RT-PCR, we have identified novel genes that respond to skeletal muscle damage, which, given the known biological functions, are likely involved in recovery from and/or adaptation to damaging exercise. PMID:18321953

Broadband true time delay for microwave signal processing, using slow light based on stimulated Brillouin scattering in optical fibers.

PubMed

Chin, Sanghoon; Thévenaz, Luc; Sancho, Juan; Sales, Salvador; Capmany, José; Berger, Perrine; Bourderionnet, Jérôme; Dolfi, Daniel

2010-10-11

We experimentally demonstrate a novel technique to process broadband microwave signals, using all-optically tunable true time delay in optical fibers. The configuration to achieve true time delay basically consists of two main stages: photonic RF phase shifter and slow light, based on stimulated Brillouin scattering in fibers. Dispersion properties of fibers are controlled, separately at optical carrier frequency and in the vicinity of microwave signal bandwidth. This way time delay induced within the signal bandwidth can be manipulated to correctly act as true time delay with a proper phase compensation introduced to the optical carrier. We completely analyzed the generated true time delay as a promising solution to feed phased array antenna for radar systems and to develop dynamically reconfigurable microwave photonic filters.

Block of HERG human K(+) channel and IKr of guinea pig cardiomyocytes by chlorpromazine.

PubMed

Lee, So-Young; Choi, Se-Young; Youm, Jae Boum; Ho, Won-Kyung; Earm, Yung E; Lee, Chin O; Jo, Su-Hyun

2004-05-01

Chlorpromazine, a commonly used antipsychotic drug, has been known to induce QT prolongation and torsades de pointes, which can cause sudden death. We studied the effects of chlorpromazine on the human ether-a-go-go-related gene (HERG) channel expressed in Xenopus oocytes and on delayed rectifier K current of guinea pig ventricular myocytes. Application of chlorpromazine showed a dose-dependent decrease in the amplitudes of steady-state currents and tail currents of HERG. The decrease became more pronounced at increasingly positive potential, suggesting that the blockade of HERG by chlorpromazine is voltage dependent. IC50 for chlorpromazine block of HERG current was progressively decreased according to depolarization: IC50 values at -30, 0, and +30 mV were 10.5, 8.8, and 4.9 microM, respectively. The block of HERG current during the voltage step increased with time starting from a level 89% of the control current. In guinea pig ventricular myocytes, bath application of 2 and 5 microM chlorpromazine at 36 degree C blocked rapidly activating delayed rectifier K current (IKr) by 31 and 83%, respectively. How-ever, the same concentrations of chlorpromazine failed to significantly block slowly activating delayed rectifier K current (IKs). Our findings suggest that the arrhythmogenic side effect of chlorpromazine is caused by blockade of HERG and rapid component of delayed rectifier K current rather than by blockade of the slow component.

Glucocorticoid-mediated Period2 induction delays the phase of circadian rhythm

PubMed Central

Cheon, Solmi; Park, Noheon; Cho, Sehyung; Kim, Kyungjin

2013-01-01

Glucocorticoid (GC) signaling synchronizes the circadian rhythm of individual peripheral cells and induces the expression of circadian genes, including Period1 (Per1) and Period2 (Per2). However, no GC response element (GRE) has been reported in the Per2 promoter region. Here we report the molecular mechanisms of Per2 induction by GC signaling and its relevance to the regulation of circadian timing. We found that GC prominently induced Per2 expression and delayed the circadian phase. The overlapping GRE and E-box (GE2) region in the proximal Per2 promoter was responsible for GC-mediated Per2 induction. The GRE in the Per2 promoter was unique in that brain and muscle ARNT-like protein-1 (BMAL1) was essential for GC-induced Per2 expression, whereas other GRE-containing promoters, such as Per1 and mouse mammary tumor virus, responded to dexamethasone in the absence of BMAL1. This specialized regulatory mechanism was mediated by BMAL1-dependent binding of the GC receptor to GRE in Per2 promoter. When Per2 induction was abrogated by the mutation of the GRE or E-box, the circadian oscillation phase failed to be delayed compared with that of the wild-type. Therefore, the current study demonstrates that the rapid Per2 induction mediated by GC is crucial for delaying the circadian rhythm. PMID:23620290

FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset.

PubMed

Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman

2016-07-02

Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

Two msh/msx-related genes, Djmsh1 and Djmsh2, contribute to the early blastema growth during planarian head regeneration.

PubMed

Mannini, Linda; Deri, Paolo; Gremigni, Vittorio; Rossi, Leonardo; Salvetti, Alessandra; Batistoni, Renata

2008-01-01

Regeneration in planarians is an intriguing phenomenon, based on the presence of pluripotent stem cells, known as neoblasts. Following amputation, these cells activate mitotic divisions, migrate distally and undergo differentiation, giving rise to the regeneration blastema. We have identified two msh/msx-related genes, Djmsh1 and Djmsh2, which are expressed in distinct cell populations of the planarian Dugesia japonica and activated, with different patterns, during head regeneration. We demonstrate that RNA interference of Djmsh1 or Djmsh2 generates a delay in the growth of cephalic blastema, interfering with the dynamics of mitoses during its initial formation. Our data also reveal that the activity of the two planarian msh genes is required to regulate Djbmp expression during head regeneration. This study identifies, for the first time, a functional association between muscle segment homeobox (MSH) homeoproteins and BMP signaling during stem cell-based regeneration of the planarian head and provides a functional analysis of how msh genes may regulate in vivo the regenerative response of planarian stem cells.

The tempo of human childhood: a maternal foot on the accelerator, a paternal foot on the brake.

PubMed

Kotler, Jennifer; Haig, David

2018-03-01

Relative to the life history of other great apes, that of humans is characterized by early weaning and short interbirth intervals (IBIs). We propose that in modern humans, birth until adrenarche, or the rise in adrenal androgens, developmentally corresponds to the period from birth until weaning in great apes and ancestral hominins. According to this hypothesis, humans achieved short IBIs by subdividing ancestral infancy into a nurseling phase, during which offspring fed at the breast, and a weanling phase, during which offspring fed specially prepared foods. Imprinted genes influence the timing of human weaning and adrenarche, with paternally expressed genes promoting delays in childhood maturation and maternally expressed genes promoting accelerated maturation. These observations suggest that the tempo of human development has been shaped by consequences for the fitness of kin, with faster development increasing maternal fitness at a cost to child fitness. The effects of imprinted genes suggest that the duration of the juvenile period (adrenarche until puberty) has also been shaped by evolutionary conflicts within the family. © 2018 The Authors Evolutionary Anthropology Published by Wiley Periodicals, Inc.

The tempo of human childhood: a maternal foot on the accelerator, a paternal foot on the brake

PubMed Central

Haig, David

2018-01-01

Abstract Relative to the life history of other great apes, that of humans is characterized by early weaning and short interbirth intervals (IBIs). We propose that in modern humans, birth until adrenarche, or the rise in adrenal androgens, developmentally corresponds to the period from birth until weaning in great apes and ancestral hominins. According to this hypothesis, humans achieved short IBIs by subdividing ancestral infancy into a nurseling phase, during which offspring fed at the breast, and a weanling phase, during which offspring fed specially prepared foods. Imprinted genes influence the timing of human weaning and adrenarche, with paternally expressed genes promoting delays in childhood maturation and maternally expressed genes promoting accelerated maturation. These observations suggest that the tempo of human development has been shaped by consequences for the fitness of kin, with faster development increasing maternal fitness at a cost to child fitness. The effects of imprinted genes suggest that the duration of the juvenile period (adrenarche until puberty) has also been shaped by evolutionary conflicts within the family. PMID:29575348

Leukemia inhibitory factor influences the timing of programmed synapses withdrawal from neonatal muscles.

PubMed

Kwon, Y W; Abbondanzo, S J; Stewart, C L; Gurney, M E

1995-09-01

We show that leukemia inhibitory factor (LIF) plays a physiological role in the programmed withdrawal of synapses from neonatal muscles. First, LIF mRNA is present in embryonic skeletal muscle and is developmentally regulated. We detect high levels of LIF mRNA at embryonic day 17 (E17) in mouse hind leg muscles. The content of LIF mRNA falls 10-fold between E17 and birth and then remains low in the neonate and adult. The decrease in LIF mRNA in skeletal muscle coincides with the end of secondary myogenesis and the completion of the adult number of myofibers. Second, treatment of the mouse tensor fascia latae (TFL), a superficial muscle of the hind leg, with LIF from birth (100 ng/day), transiently delays the withdrawal of excess inputs from polyneuronally innervated myofibers by approximately 3 days. The midpoint of the process is shifted from 7.5 +/- 10.2 +/- 0.6 days of age. LIF treatment delays synapse withdrawal by altering its timing without an appreciable effect on its rate. Third, in mice homozygous for a disruption of the LIF gene, the midpoint in the reduction of multiply innervated TFL myofibers occurs 1 day earlier, at 6.5 +/- 0.5 days of age. Muscle fiber number is unchanged in LIF null mice. Treatment with LIF does not alter the rate of neonatal growth, the number of muscle fibers in the TFL, or the reappearance of inputs that have been eliminated. Instead, LIF appears to delay maturation of the motor unit by transiently delaying the onset of synapse withdrawal. We hypothesize that this is a necessary component of a selective process that will operate simultaneously and equally on multiple, competing motor units.

A novel X-linked disorder with developmental delay and autistic features.

PubMed

Kaya, Namik; Colak, Dilek; Albakheet, Albandary; Al-Owain, Mohammad; Abu-Dheim, Nada; Al-Younes, Banan; Al-Zahrani, Jawaher; Mukaddes, Nahit M; Dervent, Aysin; Al-Dosari, Naji; Al-Odaib, Ali; Kayaalp, Inci V; Al-Sayed, Moeenaladin; Al-Hassnan, Zuhair; Nester, Michael J; Al-Dosari, Mohammad; Al-Dhalaan, Hesham; Chedrawi, Aziza; Gunoz, Hulya; Karakas, Bedri; Sakati, Nadia; Alkuraya, Fowzan S; Gascon, Generaso G; Ozand, Pinar T

2012-04-01

Genomic duplications that lead to autism and other human diseases are interesting pathological lesions since the underlying mechanism almost certainly involves dosage sensitive genes. We aim to understand a novel genomic disorder with profound phenotypic consequences, most notably global developmental delay, autism, psychosis, and anorexia nervosa. We evaluated the affected individuals, all maternally related, using childhood autism rating scale (CARS) and Vineland Adaptive scales, magnetic resonance imaging (MRI) and magnetic resonance spectroscopy (MRS) brain, electroencephalography (EEG), electromyography (EMG), muscle biopsy, high-resolution molecular karyotype arrays, Giemsa banding (G-banding) and fluorescent in situ hybridization (FISH) experiments, mitochondrial DNA (mtDNA) sequencing, X-chromosome inactivation study, global gene expression analysis on Epstein-Barr virus (EBV)-transformed lymphoblasts, and quantitative reverse-transcription polymerase chain reaction (qRT-PCR). We have identified a novel Xq12-q13.3 duplication in an extended family. Clinically normal mothers were completely skewed in favor of the normal chromosome X. Global transcriptional profiling of affected individuals and controls revealed significant alterations of genes and pathways in a pattern consistent with previous microarray studies of autism spectrum disorder patients. Moreover, expression analysis revealed copy number-dependent increased messenger RNA (mRNA) levels in affected patients compared to control individuals. A subset of differentially expressed genes was validated using qRT-PCR. Xq12-q13.3 duplication is a novel global developmental delay and autism-predisposing chromosomal aberration; pathogenesis of which may be mediated by increased dosage of genes contained in the duplication, including NLGN3, OPHN1, AR, EFNB1, TAF1, GJB1, and MED12. Copyright © 2011 American Neurological Association.

Finite-Time Stabilization and Adaptive Control of Memristor-Based Delayed Neural Networks.

PubMed

Wang, Leimin; Shen, Yi; Zhang, Guodong

Finite-time stability problem has been a hot topic in control and system engineering. This paper deals with the finite-time stabilization issue of memristor-based delayed neural networks (MDNNs) via two control approaches. First, in order to realize the stabilization of MDNNs in finite time, a delayed state feedback controller is proposed. Then, a novel adaptive strategy is applied to the delayed controller, and finite-time stabilization of MDNNs can also be achieved by using the adaptive control law. Some easily verified algebraic criteria are derived to ensure the stabilization of MDNNs in finite time, and the estimation of the settling time functional is given. Moreover, several finite-time stability results as our special cases for both memristor-based neural networks (MNNs) without delays and neural networks are given. Finally, three examples are provided for the illustration of the theoretical results.Finite-time stability problem has been a hot topic in control and system engineering. This paper deals with the finite-time stabilization issue of memristor-based delayed neural networks (MDNNs) via two control approaches. First, in order to realize the stabilization of MDNNs in finite time, a delayed state feedback controller is proposed. Then, a novel adaptive strategy is applied to the delayed controller, and finite-time stabilization of MDNNs can also be achieved by using the adaptive control law. Some easily verified algebraic criteria are derived to ensure the stabilization of MDNNs in finite time, and the estimation of the settling time functional is given. Moreover, several finite-time stability results as our special cases for both memristor-based neural networks (MNNs) without delays and neural networks are given. Finally, three examples are provided for the illustration of the theoretical results.

Short Vegetative Phase-Like MADS-Box Genes Inhibit Floral Meristem Identity in Barley1[W][OA

PubMed Central

Trevaskis, Ben; Tadege, Million; Hemming, Megan N.; Peacock, W. James; Dennis, Elizabeth S.; Sheldon, Candice

2007-01-01

Analysis of the functions of Short Vegetative Phase (SVP)-like MADS-box genes in barley (Hordeum vulgare) indicated a role in determining meristem identity. Three SVP-like genes are expressed in vegetative tissues of barley: Barley MADS1 (BM1), BM10, and Vegetative to Reproductive Transition gene 2. These genes are induced by cold but are repressed during floral development. Ectopic expression of BM1 inhibited spike development and caused floral reversion in barley, with florets at the base of the spike replaced by tillers. Head emergence was delayed in plants that ectopically express BM1, primarily by delayed development after the floral transition, but expression levels of the barley VRN1 gene (HvVRN1) were not affected. Ectopic expression of BM10 inhibited spike development and caused partial floral reversion, where florets at the base of the spike were replaced by inflorescence-like structures, but did not affect heading date. Floral reversion occurred more frequently when BM1 and BM10 ectopic expression lines were grown in short-day conditions. BM1 and BM10 also inhibited floral development and caused floral reversion when expressed in Arabidopsis (Arabidopsis thaliana). We conclude that SVP-like genes function to suppress floral meristem identity in winter cereals. PMID:17114273

The effect of visual-motion time delays on pilot performance in a pursuit tracking task

NASA Technical Reports Server (NTRS)

Miller, G. K., Jr.; Riley, D. R.

1976-01-01

A study has been made to determine the effect of visual-motion time delays on pilot performance of a simulated pursuit tracking task. Three interrelated major effects have been identified: task difficulty, motion cues, and time delays. As task difficulty, as determined by airplane handling qualities or target frequency, increases, the amount of acceptable time delay decreases. However, when relatively complete motion cues are included in the simulation, the pilot can maintain his performance for considerably longer time delays. In addition, the number of degrees of freedom of motion employed is a significant factor.

Robust stability bounds for multi-delay networked control systems

NASA Astrophysics Data System (ADS)

Seitz, Timothy; Yedavalli, Rama K.; Behbahani, Alireza

2018-04-01

In this paper, the robust stability of a perturbed linear continuous-time system is examined when controlled using a sampled-data networked control system (NCS) framework. Three new robust stability bounds on the time-invariant perturbations to the original continuous-time plant matrix are presented guaranteeing stability for the corresponding discrete closed-loop augmented delay-free system (ADFS) with multiple time-varying sensor and actuator delays. The bounds are differentiated from previous work by accounting for the sampled-data nature of the NCS and for separate communication delays for each sensor and actuator, not a single delay. Therefore, this paper expands the knowledge base in multiple inputs multiple outputs (MIMO) sampled-data time delay systems. Bounds are presented for unstructured, semi-structured, and structured perturbations.

Discrete-time BAM neural networks with variable delays

NASA Astrophysics Data System (ADS)

Liu, Xin-Ge; Tang, Mei-Lan; Martin, Ralph; Liu, Xin-Bi

2007-07-01

This Letter deals with the global exponential stability of discrete-time bidirectional associative memory (BAM) neural networks with variable delays. Using a Lyapunov functional, and linear matrix inequality techniques (LMI), we derive a new delay-dependent exponential stability criterion for BAM neural networks with variable delays. As this criterion has no extra constraints on the variable delay functions, it can be applied to quite general BAM neural networks with a broad range of time delay functions. It is also easy to use in practice. An example is provided to illustrate the theoretical development.

Local Bifurcations and Optimal Theory in a Delayed Predator-Prey Model with Threshold Prey Harvesting

NASA Astrophysics Data System (ADS)

Tankam, Israel; Tchinda Mouofo, Plaire; Mendy, Abdoulaye; Lam, Mountaga; Tewa, Jean Jules; Bowong, Samuel

2015-06-01

We investigate the effects of time delay and piecewise-linear threshold policy harvesting for a delayed predator-prey model. It is the first time that Holling response function of type III and the present threshold policy harvesting are associated with time delay. The trajectories of our delayed system are bounded; the stability of each equilibrium is analyzed with and without delay; there are local bifurcations as saddle-node bifurcation and Hopf bifurcation; optimal harvesting is also investigated. Numerical simulations are provided in order to illustrate each result.

A Strain-Sonde Technique for the Measurement of Mechanical Time-Delay Fuze Function Times and Performance

DTIC Science & Technology

1983-09-01

AD IV) MEMORANDUM REPORT ARBRL-MR-03309 N(Supersedes IMR No. 760) A STRAIN -SONDE TECHNIQUE FOR THE MEASUREMENT OF MECHANICAL TIME- DELAY FUZE...and BkuWel) S. TYPE OF REPORT & PERIOD COVERED A STRAIN -SONDE TECHNIQUE FOR THE MEASUREMENT OF Final MECHANICAL TIME-DELAY FUZE FUNCTION TIMES AND S...nmber) M577 Mechanical Time-Delay Fuze F"/FM Telemeter Interlock Pin Release Semiconductor Strain Gage Rotor Signal Condition Amplifier Firing Pin In

Robust optimization for nonlinear time-delay dynamical system of dha regulon with cost sensitivity constraint in batch culture

NASA Astrophysics Data System (ADS)

Yuan, Jinlong; Zhang, Xu; Liu, Chongyang; Chang, Liang; Xie, Jun; Feng, Enmin; Yin, Hongchao; Xiu, Zhilong

2016-09-01

Time-delay dynamical systems, which depend on both the current state of the system and the state at delayed times, have been an active area of research in many real-world applications. In this paper, we consider a nonlinear time-delay dynamical system of dha-regulonwith unknown time-delays in batch culture of glycerol bioconversion to 1,3-propanediol induced by Klebsiella pneumonia. Some important properties and strong positive invariance are discussed. Because of the difficulty in accurately measuring the concentrations of intracellular substances and the absence of equilibrium points for the time-delay system, a quantitative biological robustness for the concentrations of intracellular substances is defined by penalizing a weighted sum of the expectation and variance of the relative deviation between system outputs before and after the time-delays are perturbed. Our goal is to determine optimal values of the time-delays. To this end, we formulate an optimization problem in which the time delays are decision variables and the cost function is to minimize the biological robustness. This optimization problem is subject to the time-delay system, parameter constraints, continuous state inequality constraints for ensuring that the concentrations of extracellular and intracellular substances lie within specified limits, a quality constraint to reflect operational requirements and a cost sensitivity constraint for ensuring that an acceptable level of the system performance is achieved. It is approximated as a sequence of nonlinear programming sub-problems through the application of constraint transcription and local smoothing approximation techniques. Due to the highly complex nature of this optimization problem, the computational cost is high. Thus, a parallel algorithm is proposed to solve these nonlinear programming sub-problems based on the filled function method. Finally, it is observed that the obtained optimal estimates for the time-delays are highly satisfactory via numerical simulations.

Time delay and noise explaining the behaviour of the cell growth in fermentation process

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ayuobi, Tawfiqullah; Rosli, Norhayati; Bahar, Arifah

2015-02-03

This paper proposes to investigate the interplay between time delay and external noise in explaining the behaviour of the microbial growth in batch fermentation process. Time delay and noise are modelled jointly via stochastic delay differential equations (SDDEs). The typical behaviour of cell concentration in batch fermentation process under this model is investigated. Milstein scheme is applied for solving this model numerically. Simulation results illustrate the effects of time delay and external noise in explaining the lag and stationary phases, respectively for the cell growth of fermentation process.

Time delay and noise explaining the behaviour of the cell growth in fermentation process

NASA Astrophysics Data System (ADS)

Ayuobi, Tawfiqullah; Rosli, Norhayati; Bahar, Arifah; Salleh, Madihah Md

2015-02-01

This paper proposes to investigate the interplay between time delay and external noise in explaining the behaviour of the microbial growth in batch fermentation process. Time delay and noise are modelled jointly via stochastic delay differential equations (SDDEs). The typical behaviour of cell concentration in batch fermentation process under this model is investigated. Milstein scheme is applied for solving this model numerically. Simulation results illustrate the effects of time delay and external noise in explaining the lag and stationary phases, respectively for the cell growth of fermentation process.

Transient anhedonia phenotype and altered circadian timing of behaviour during night-time dim light exposure in Per3−/− mice, but not wildtype mice

PubMed Central

Martynhak, Bruno Jacson; Hogben, Alexandra L.; Zanos, Panos; Georgiou, Polymnia; Andreatini, Roberto; Kitchen, Ian; Archer, Simon N.; von Schantz, Malcolm; Bailey, Alexis; van der Veen, Daan R.

2017-01-01

Industrialisation greatly increased human night-time exposure to artificial light, which in animal models is a known cause of depressive phenotypes. Whilst many of these phenotypes are ‘direct’ effects of light on affect, an ‘indirect’ pathway via altered sleep-wake timing has been suggested. We have previously shown that the Period3 gene, which forms part of the biological clock, is associated with altered sleep-wake patterns in response to light. Here, we show that both wild-type and Per3−/− mice showed elevated levels of circulating corticosterone and increased hippocampal Bdnf expression after 3 weeks of exposure to dim light at night, but only mice deficient for the PERIOD3 protein (Per3−/−) exhibited a transient anhedonia-like phenotype, observed as reduced sucrose preference, in weeks 2–3 of dim light at night, whereas WT mice did not. Per3−/− mice also exhibited a significantly smaller delay in behavioural timing than WT mice during weeks 1, 2 and 4 of dim light at night exposure. When treated with imipramine, neither Per3−/− nor WT mice exhibited an anhedonia-like phenotype, and neither genotypes exhibited a delay in behavioural timing in responses to dLAN. While the association between both Per3−/− phenotypes remains unclear, both are alleviated by imipramine treatment during dim night-time light. PMID:28071711

The Effects of Financial Education on Impulsive Decision Making

PubMed Central

DeHart, William B.; Friedel, Jonathan E.; Lown, Jean M.; Odum, Amy L.

2016-01-01

Delay discounting, as a behavioral measure of impulsive choice, is strongly related to substance abuse and other risky behaviors. Therefore, effective techniques that alter delay discounting are of great interest. We explored the ability of a semester long financial education course to change delay discounting. Participants were recruited from a financial education course (n = 237) and an abnormal psychology course (n = 80). Both groups completed a delay-discounting task for $100 during the first two weeks (Time 1) of the semester as well as during the last two weeks (Time 2) of the semester. Participants also completed a personality inventory and financial risk tolerance scale both times and a delay-discounting task for $1,000 during Time 2. Delay discounting decreased in the financial education group at the end of the semester whereas there was no change in delay discounting in the abnormal psychology group. Financial education may be an effective method for reducing delay discounting. PMID:27442237

The Effects of Financial Education on Impulsive Decision Making.

PubMed

DeHart, William B; Friedel, Jonathan E; Lown, Jean M; Odum, Amy L

2016-01-01

Delay discounting, as a behavioral measure of impulsive choice, is strongly related to substance abuse and other risky behaviors. Therefore, effective techniques that alter delay discounting are of great interest. We explored the ability of a semester long financial education course to change delay discounting. Participants were recruited from a financial education course (n = 237) and an abnormal psychology course (n = 80). Both groups completed a delay-discounting task for $100 during the first two weeks (Time 1) of the semester as well as during the last two weeks (Time 2) of the semester. Participants also completed a personality inventory and financial risk tolerance scale both times and a delay-discounting task for $1,000 during Time 2. Delay discounting decreased in the financial education group at the end of the semester whereas there was no change in delay discounting in the abnormal psychology group. Financial education may be an effective method for reducing delay discounting.

FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis

PubMed Central

Deng, Weiwei; Ying, Hua; Helliwell, Chris A.; Taylor, Jennifer M.; Peacock, W. James; Dennis, Elizabeth S.

2011-01-01

FLOWERING LOCUS C (FLC) has a key role in the timing of the initiation of flowering in Arabidopsis. FLC binds and represses two genes that promote flowering, FT and SOC1. We show that FLC binds to many other genes, indicating that it has regulatory roles other than the repression of flowering. We identified 505 FLC binding sites, mostly located in the promoter regions of genes and containing at least one CArG box, the motif known to be associated with MADS-box proteins such as FLC. We examined 40 of the target genes, and 20 showed increased transcript levels in an flc mutant compared with the wild type. Five genes showed decreased expression in the mutant, indicating that FLC binding can result in either transcriptional repression or activation. The genes we identified as FLC targets are involved in developmental pathways throughout the life history of the plant, many of which are associated with reproductive development. FLC is also involved in vegetative development, as evidenced by its binding to SPL15, delaying the progression from juvenile to adult phase. Some of the FLC target genes are also bound by two other MADS-box proteins, AP1 and SEP3, suggesting that MADS-box genes may operate in a network of control at different stages of the life cycle, many ultimately contributing to the development of the reproductive phase of the plant. PMID:21464308

FLOWERING LOCUS C (FLC) regulates development pathways throughout the life cycle of Arabidopsis.

PubMed

Deng, Weiwei; Ying, Hua; Helliwell, Chris A; Taylor, Jennifer M; Peacock, W James; Dennis, Elizabeth S

2011-04-19

FLOWERING LOCUS C (FLC) has a key role in the timing of the initiation of flowering in Arabidopsis. FLC binds and represses two genes that promote flowering, FT and SOC1. We show that FLC binds to many other genes, indicating that it has regulatory roles other than the repression of flowering. We identified 505 FLC binding sites, mostly located in the promoter regions of genes and containing at least one CArG box, the motif known to be associated with MADS-box proteins such as FLC. We examined 40 of the target genes, and 20 showed increased transcript levels in an flc mutant compared with the wild type. Five genes showed decreased expression in the mutant, indicating that FLC binding can result in either transcriptional repression or activation. The genes we identified as FLC targets are involved in developmental pathways throughout the life history of the plant, many of which are associated with reproductive development. FLC is also involved in vegetative development, as evidenced by its binding to SPL15, delaying the progression from juvenile to adult phase. Some of the FLC target genes are also bound by two other MADS-box proteins, AP1 and SEP3, suggesting that MADS-box genes may operate in a network of control at different stages of the life cycle, many ultimately contributing to the development of the reproductive phase of the plant.

Identification of Potentially Neuroprotective Genes Upregulated by Neurotrophin Treatment of CA3 Neurons in the Injured Brain

PubMed Central

Malik, Saafan Z.; Motamedi, Shahab; Royo, Nicolas C.; LeBold, David

2011-01-01

Abstract Specific neurotrophic factors mediate histological and/or functional improvement in animal models of traumatic brain injury (TBI). In previous work, several lines of evidence indicated that the mammalian neurotrophin NT-4/5 is neuroprotective for hippocampal CA3 pyramidal neurons after experimental TBI. We hypothesized that NT-4/5 neuroprotection is mediated by changes in the expression of specific sets of genes, and that NT-4/5-regulated genes are potential therapeutic targets for blocking delayed neuronal death after TBI. In this study, we performed transcription profiling analysis of CA3 neurons to identify genes regulated by lateral fluid percussion injury, or by treatment with the trkB ligands NT-4/5 or brain-derived neurotrophic factor (BDNF). The results indicate extensive overlap between genes upregulated by neurotrophins and genes upregulated by injury, suggesting that the mechanism behind neurotrophin neuroprotection may mimic the brain's endogenous protective response. A subset of genes selected for further study in vitro exhibited neuroprotection against glutamate excitotoxicity. The neuroprotective genes identified in this study were upregulated at 30 h post-injury, and are thus expected to act during a clinically useful time frame of hours to days after injury. Modulation of these factors and pathways by genetic manipulation or small molecules may confer hippocampal neuroprotection in vivo in preclinical models of TBI. PMID:21083427

Delay-induced stochastic bifurcations in a bistable system under white noise

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Zhongkui, E-mail: sunzk@nwpu.edu.cn; Fu, Jin; Xu, Wei

2015-08-15

In this paper, the effects of noise and time delay on stochastic bifurcations are investigated theoretically and numerically in a time-delayed Duffing-Van der Pol oscillator subjected to white noise. Due to the time delay, the random response is not Markovian. Thereby, approximate methods have been adopted to obtain the Fokker-Planck-Kolmogorov equation and the stationary probability density function for amplitude of the response. Based on the knowledge that stochastic bifurcation is characterized by the qualitative properties of the steady-state probability distribution, it is found that time delay and feedback intensity as well as noise intensity will induce the appearance of stochasticmore » P-bifurcation. Besides, results demonstrated that the effects of the strength of the delayed displacement feedback on stochastic bifurcation are accompanied by the sensitive dependence on time delay. Furthermore, the results from numerical simulations best confirm the effectiveness of the theoretical analyses.« less

The rates and time-delay distribution of multiply imaged supernovae behind lensing clusters

NASA Astrophysics Data System (ADS)

Li, Xue; Hjorth, Jens; Richard, Johan

2012-11-01

Time delays of gravitationally lensed sources can be used to constrain the mass model of a deflector and determine cosmological parameters. We here present an analysis of the time-delay distribution of multiply imaged sources behind 17 strong lensing galaxy clusters with well-calibrated mass models. We find that for time delays less than 1000 days, at z = 3.0, their logarithmic probability distribution functions are well represented by P(log Δt) = 5.3 × 10-4Δttilde beta/M2502tilde beta, with tilde beta = 0.77, where M250 is the projected cluster mass inside 250 kpc (in 1014M⊙), and tilde beta is the power-law slope of the distribution. The resultant probability distribution function enables us to estimate the time-delay distribution in a lensing cluster of known mass. For a cluster with M250 = 2 × 1014M⊙, the fraction of time delays less than 1000 days is approximately 3%. Taking Abell 1689 as an example, its dark halo and brightest galaxies, with central velocity dispersions σ>=500kms-1, mainly produce large time delays, while galaxy-scale mass clumps are responsible for generating smaller time delays. We estimate the probability of observing multiple images of a supernova in the known images of Abell 1689. A two-component model of estimating the supernova rate is applied in this work. For a magnitude threshold of mAB = 26.5, the yearly rate of Type Ia (core-collapse) supernovae with time delays less than 1000 days is 0.004±0.002 (0.029±0.001). If the magnitude threshold is lowered to mAB ~ 27.0, the rate of core-collapse supernovae suitable for time delay observation is 0.044±0.015 per year.

Elapsed Time Between the First Symptoms of Breast Cancer and Medical Help-Seeking Behavior and the Affecting Factors.

PubMed

Gözüm, Sebahat; Tuzcu, Ayla

Many studies have determined that the time between women's realization of first symptoms and seeking help from a healthcare professional is more than 1 month. The situation is defined as delay in medical help-seeking behavior (MHSB). The purpose of this study was to determine the time elapsed between the first symptoms of breast cancer and MHSB, as well as the factors contributing to the delay. In this descriptive study, the data were collected from 132 patients who received a diagnosis of breast cancer and are receiving treatment in the Oncology Clinic of Akdeniz University Hospital. The questionnaire used in the study was structured in 3 parts: sociodemographic characteristics, breast cancer history/screening behaviors, and psychological factors affecting MHSB. The elapsed time between patients' first symptoms and MHSB was classified into "normal" when it was less than 1 month, "delay" when it was between 1 and 3 months, "long-term delay" when it was more than 3 months, and "very serious delay" when it was more than 6 months. A total of 59.8% were classified as normal, 16.7% as delayed, 5.3% as a long-term delay, and 18.2% as a very serious delay after first symptoms. The delay in MHSB time was affected 18.55 times by "not caring/minding," 10.73 times by "fear," 7.13 times by "having more important problems," and 4.23 times by "realization of first symptoms" by themselves. Psychological factors were the most important determinants in delay. The MHSB time was less if those first realizing the symptoms were healthcare professionals. Healthcare professionals should direct women to screenings and train them to interpret symptoms correctly.

Effects of computing time delay on real-time control systems

NASA Technical Reports Server (NTRS)

Shin, Kang G.; Cui, Xianzhong

1988-01-01

The reliability of a real-time digital control system depends not only on the reliability of the hardware and software used, but also on the speed in executing control algorithms. The latter is due to the negative effects of computing time delay on control system performance. For a given sampling interval, the effects of computing time delay are classified into the delay problem and the loss problem. Analysis of these two problems is presented as a means of evaluating real-time control systems. As an example, both the self-tuning predicted (STP) control and Proportional-Integral-Derivative (PID) control are applied to the problem of tracking robot trajectories, and their respective effects of computing time delay on control performance are comparatively evaluated. For this example, the STP (PID) controller is shown to outperform the PID (STP) controller in coping with the delay (loss) problem.

The influences of delay time on the stability of a market model with stochastic volatility

NASA Astrophysics Data System (ADS)

Li, Jiang-Cheng; Mei, Dong-Cheng

2013-02-01

The effects of the delay time on the stability of a market model are investigated, by using a modified Heston model with a cubic nonlinearity and cross-correlated noise sources. These results indicate that: (i) There is an optimal delay time τo which maximally enhances the stability of the stock price under strong demand elasticity of stock price, and maximally reduces the stability of the stock price under weak demand elasticity of stock price; (ii) The cross correlation coefficient of noises and the delay time play an opposite role on the stability for the case of the delay time <τo and the same role for the case of the delay time >τo. Moreover, the probability density function of the escape time of stock price returns, the probability density function of the returns and the correlation function of the returns are compared with other literatures.

DETERMINATE and LATE FLOWERING are two TERMINAL FLOWER1/CENTRORADIALIS homologs that control two distinct phases of flowering initiation and development in pea.

PubMed

Foucher, Fabrice; Morin, Julie; Courtiade, Juliette; Cadioux, Sandrine; Ellis, Noel; Banfield, Mark J; Rameau, Catherine

2003-11-01

Genes in the TERMINAL FLOWER1 (TFL1)/CENTRORADIALIS family are important key regulatory genes involved in the control of flowering time and floral architecture in several different plant species. To understand the functions of TFL1 homologs in pea, we isolated three TFL1 homologs, which we have designated PsTFL1a, PsTFL1b, and PsTFL1c. By genetic mapping and sequencing of mutant alleles, we demonstrate that PsTFL1a corresponds to the DETERMINATE (DET) gene and PsTFL1c corresponds to the LATE FLOWERING (LF) gene. DET acts to maintain the indeterminacy of the apical meristem during flowering, and consistent with this role, DET expression is limited to the shoot apex after floral initiation. LF delays the induction of flowering by lengthening the vegetative phase, and allelic variation at the LF locus is an important component of natural variation for flowering time in pea. The most severe class of alleles flowers early and carries either a deletion of the entire PsTFL1c gene or an amino acid substitution. Other natural and induced alleles for LF, with an intermediate flowering time phenotype, present no changes in the PsTFL1c amino acid sequence but affect LF transcript level in the shoot apex: low LF transcript levels are correlated with early flowering, and high LF transcript levels are correlated with late flowering. Thus, different TFL1 homologs control two distinct aspects of plant development in pea, whereas a single gene, TFL1, performs both functions in Arabidopsis. These results show that different species have evolved different strategies to control key developmental transitions and also that the genetic basis for natural variation in flowering time may differ among plant species.

Ectopic Expression of Capsicum-Specific Cell Wall Protein Capsicum annuum Senescence-Delaying 1 (CaSD1) Delays Senescence and Induces Trichome Formation in Nicotiana benthamiana

PubMed Central

Seo, Eunyoung; Yeom, Seon-In; Jo, SungHwan; Jeong, Heejin; Kang, Byoung-Cheorl; Choi, Doil

2012-01-01

Secreted proteins are known to have multiple roles in plant development, metabolism, and stress response. In a previous study to understand the roles of secreted proteins, Capsicum annuum secreted proteins (CaS) were isolated by yeast secretion trap. Among the secreted proteins, we further characterized Capsicum annuum senescence-delaying 1 (CaSD1), a gene encoding a novel secreted protein that is present only in the genus Capsicum. The deduced CaSD1 contains multiple repeats of the amino acid sequence KPPIHNHKPTDYDRS. Interestingly, the number of repeats varied among cultivars and species in the Capsicum genus. CaSD1 is constitutively expressed in roots, and Agrobacterium-mediated transient overexpression of CaSD1 in Nicotiana benthamiana leaves resulted in delayed senescence with a dramatically increased number of trichomes and enlarged epidermal cells. Furthermore, senescence- and cell division-related genes were differentially regulated by CaSD1-overexpressing plants. These observations imply that the pepper-specific cell wall protein CaSD1 plays roles in plant growth and development by regulating cell division and differentiation. PMID:22441673

Digital signaling decouples activation probability and population heterogeneity.

PubMed

Kellogg, Ryan A; Tian, Chengzhe; Lipniacki, Tomasz; Quake, Stephen R; Tay, Savaş

2015-10-21

Digital signaling enhances robustness of cellular decisions in noisy environments, but it is unclear how digital systems transmit temporal information about a stimulus. To understand how temporal input information is encoded and decoded by the NF-κB system, we studied transcription factor dynamics and gene regulation under dose- and duration-modulated inflammatory inputs. Mathematical modeling predicted and microfluidic single-cell experiments confirmed that integral of the stimulus (or area, concentration × duration) controls the fraction of cells that activate NF-κB in the population. However, stimulus temporal profile determined NF-κB dynamics, cell-to-cell variability, and gene expression phenotype. A sustained, weak stimulation lead to heterogeneous activation and delayed timing that is transmitted to gene expression. In contrast, a transient, strong stimulus with the same area caused rapid and uniform dynamics. These results show that digital NF-κB signaling enables multidimensional control of cellular phenotype via input profile, allowing parallel and independent control of single-cell activation probability and population heterogeneity.

Timescales and bottlenecks in miRNA-dependent gene regulation.

PubMed

Hausser, Jean; Syed, Afzal Pasha; Selevsek, Nathalie; van Nimwegen, Erik; Jaskiewicz, Lukasz; Aebersold, Ruedi; Zavolan, Mihaela

2013-12-03

MiRNAs are post-transcriptional regulators that contribute to the establishment and maintenance of gene expression patterns. Although their biogenesis and decay appear to be under complex control, the implications of miRNA expression dynamics for the processes that they regulate are not well understood. We derived a mathematical model of miRNA-mediated gene regulation, inferred its parameters from experimental data sets, and found that the model describes well time-dependent changes in mRNA, protein and ribosome density levels measured upon miRNA transfection and induction. The inferred parameters indicate that the timescale of miRNA-dependent regulation is slower than initially thought. Delays in miRNA loading into Argonaute proteins and the slow decay of proteins relative to mRNAs can explain the typically small changes in protein levels observed upon miRNA transfection. For miRNAs to regulate protein expression on the timescale of a day, as miRNAs involved in cell-cycle regulation do, accelerated miRNA turnover is necessary.

Contribution of sleep to the repair of neuronal DNA double-strand breaks: evidence from flies and mice.

PubMed

Bellesi, Michele; Bushey, Daniel; Chini, Mattia; Tononi, Giulio; Cirelli, Chiara

2016-11-10

Exploration of a novel environment leads to neuronal DNA double-strand breaks (DSBs). These DSBs are generated by type 2 topoisomerase to relieve topological constrains that limit transcription of plasticity-related immediate early genes. If not promptly repaired, however, DSBs may lead to cell death. Since the induction of plasticity-related genes is higher in wake than in sleep, we asked whether it is specifically wake associated with synaptic plasticity that leads to DSBs, and whether sleep provides any selective advantage over wake in their repair. In flies and mice, we find that enriched wake, more than simply time spent awake, induces DSBs, and their repair in mice is delayed or prevented by subsequent wake. In both species the repair of irradiation-induced neuronal DSBs is also quicker during sleep, and mouse genes mediating the response to DNA damage are upregulated in sleep. Thus, sleep facilitates the repair of neuronal DSBs.

Time delay and long-range connection induced synchronization transitions in Newman-Watts small-world neuronal networks.

PubMed

Qian, Yu

2014-01-01

The synchronization transitions in Newman-Watts small-world neuronal networks (SWNNs) induced by time delay τ and long-range connection (LRC) probability P have been investigated by synchronization parameter and space-time plots. Four distinct parameter regions, that is, asynchronous region, transition region, synchronous region, and oscillatory region have been discovered at certain LRC probability P = 1.0 as time delay is increased. Interestingly, desynchronization is observed in oscillatory region. More importantly, we consider the spatiotemporal patterns obtained in delayed Newman-Watts SWNNs are the competition results between long-range drivings (LRDs) and neighboring interactions. In addition, for moderate time delay, the synchronization of neuronal network can be enhanced remarkably by increasing LRC probability. Furthermore, lag synchronization has been found between weak synchronization and complete synchronization as LRC probability P is a little less than 1.0. Finally, the two necessary conditions, moderate time delay and large numbers of LRCs, are exposed explicitly for synchronization in delayed Newman-Watts SWNNs.

Time Delay and Long-Range Connection Induced Synchronization Transitions in Newman-Watts Small-World Neuronal Networks

PubMed Central

Qian, Yu

2014-01-01

The synchronization transitions in Newman-Watts small-world neuronal networks (SWNNs) induced by time delay and long-range connection (LRC) probability have been investigated by synchronization parameter and space-time plots. Four distinct parameter regions, that is, asynchronous region, transition region, synchronous region, and oscillatory region have been discovered at certain LRC probability as time delay is increased. Interestingly, desynchronization is observed in oscillatory region. More importantly, we consider the spatiotemporal patterns obtained in delayed Newman-Watts SWNNs are the competition results between long-range drivings (LRDs) and neighboring interactions. In addition, for moderate time delay, the synchronization of neuronal network can be enhanced remarkably by increasing LRC probability. Furthermore, lag synchronization has been found between weak synchronization and complete synchronization as LRC probability is a little less than 1.0. Finally, the two necessary conditions, moderate time delay and large numbers of LRCs, are exposed explicitly for synchronization in delayed Newman-Watts SWNNs. PMID:24810595

[Analysis of characteristics and influence factors of diagnostic delay of endometriosis].

PubMed

Han, X T; Guo, H Y; Kong, D L; Han, J S; Zhang, L F

2018-02-25

Objective: To access the influence factors of diagnostic delay of endometriosis. Methods: We designed a questionnaire of diagnostic delay of endometriosis. From February 2014 to February 2016, 400 patients who had dysmenorrhea and diagnosed with endometriosis by surgery in Peking University Third Hospital were surveyed retrospectively. Time and risk factors of diagnostic delay were analyzed. Results: The diagnostic delay of 400 patients was 13.0 years (0.2-43.0 years), 78.5%(314/400) patients thought pain was a normal phenomenon and didn't see the doctor. Patients who suffered dysmenorrhea at menarche experienced longer diagnostic delay than those who had dysmenorrhea after menarche (18.0 vs 4.5 years; Z= 191.800, P< 0.01) . Patients who suffered aggravating dysmenorrhea experienced shorter delay time than those who suffered stable or relieving dysmenorrhea (11.0 vs 12.5 vs 18.0 years; Z= 8.270, P< 0.05) , with the difference statistically significant, single factor analysis shows. Severe dysmenorrhea, deep infiltration endometriosis (DIE) , family history of dysmenorrhea or endometriosis, previous surgical history of endometriosis, high stage, with infertility, adenomyoma or other symptoms, could help to shorten diagnostic delay with no significant difference ( P> 0.05) . By multiple logistic regression analysis, the results shown that whether have dysmenorrhea at menarche and clinical diagnosis time were the independent factors affecting delayed diagnosis ( P< 0.01) . Conclusions: Diagnostic delay of endometriosis is common and the mean delay time is 13.0 years mainly due to the unawareness of dysmenorrhea. Dysmenorrhea at menarche, clinical diagnosis time and dysmenorrhea intensity are the factors affecting time of diagnostic delay.

LMI designmethod for networked-based PID control

NASA Astrophysics Data System (ADS)

Souza, Fernando de Oliveira; Mozelli, Leonardo Amaral; de Oliveira, Maurício Carvalho; Palhares, Reinaldo Martinez

2016-10-01

In this paper, we propose a methodology for the design of networked PID controllers for second-order delayed processes using linear matrix inequalities. The proposed procedure takes into account time-varying delay on the plant, time-varying delays induced by the network and packed dropouts. The design is carried on entirely using a continuous-time model of the closed-loop system where time-varying delays are used to represent sampling and holding occurring in a discrete-time digital PID controller.

When stress predicts a shrinking gene pool, trading early reproduction for longevity can increase fitness, even with lower fecundity.

PubMed

Ratcliff, William C; Hawthorne, Peter; Travisano, Michael; Denison, R Ford

2009-06-25

Stresses like dietary restriction or various toxins increase lifespan in taxa as diverse as yeast, Caenorhabditis elegans, Drosophila and rats, by triggering physiological responses that also tend to delay reproduction. Food odors can reverse the effects of dietary restriction, showing that key mechanisms respond to information, not just resources. Such environmental cues can predict population trends, not just individual prospects for survival and reproduction. When population size is increasing, each offspring produced earlier makes a larger proportional contribution to the gene pool, but the reverse is true when population size is declining. We show mathematically that natural selection can favor facultative delay in reproduction when environmental cues predict a decrease in total population size, even if lifetime fecundity decreases with delay. We also show that increased reproduction from waiting for better conditions does not increase fitness (proportional representation) when the whole population benefits similarly. We conclude that the beneficial effects of stress on longevity (hormesis) in diverse taxa are a side-effect of delaying reproduction in response to environmental cues that population size is likely to decrease. The reversal by food odors of the effects of dietary restriction can be explained as a response to information that population size is less likely to decrease, reducing the chance that delaying reproduction will increase fitness.

Association of KIBRA rs17070145 polymorphism with episodic memory in the early stages of a human neurodevelopmental disorder.

PubMed

Vyas, Nora S; Ahn, Kwangmi; Stahl, Daniel R; Caviston, Paul; Simic, Mima; Netherwood, Siobhan; Puri, Basant K; Lee, Yohan; Aitchison, Katherine J

2014-12-15

A common T/C polymorphism within the ninth intron of the KIBRA gene (rs17070145) is thought to influence memory in humans. Since cognitive impairment, including memory, is a core feature of schizophrenia, we attempted to investigate this association in an independent sample of adolescent patients with early-onset schizophrenia (EOS; onset before age 18) probands and their healthy siblings. In a sample of 25 pairs of EOS proband-healthy full sibling, we sought to investigate the association of KIBRA with memory performance. Episodic memory was measured using immediate and delayed recall measures of the California Verbal Learning Test. EOS underperformed at immediate and delayed recall compared with siblings. In a combined analysis (TT vs. TC/CC) assuming a C dominant model of inheritance, we found a main effect of genotype where individuals with TT genotype outperformed non-TT-carriers at immediate and delayed recall. A genotype by group interaction showed that EOS with TT genotype did not show a memory advantage over siblings with TT or non-TT-carriers at immediate or delayed recall. Siblings with TT genotype showed enhanced immediate recall (not delayed recall) compared with non-TT-carriers. This study demonstrates an association between the KIBRA gene and episodic memory (immediate free recall) and suggests a differential effect of this genetic variant in EOS and healthy siblings. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Delayed expression of SAGs correlates with longevity in CMS wheat plants compared to its fertile plants.

PubMed

Semwal, Vimal Kumar; Singh, Bhupinder; Khanna-Chopra, Renu

2014-04-01

Reproductive sinks regulate monocarpic senescence in crop plants. Monocarpic senescence was studied in wheat fertile (cv. HW 2041) and its isonuclear cytoplasmic male sterile (CMS) line. CMS plants exhibited slower rate of senescence accompanied by longer green leaf area duration and slower deceleration in chlorophyll, protein content, PN and rubisco content coupled with lower protease activities than fertile (F) plants. CMS plants also exhibited lower ROS levels and less membrane damage than F plants. CMS plants maintained better antioxidant defense, less oxidative damage in chloroplast and higher transcript levels of both rbcL and rbcS genes during senescence than F plants. F plants exhibited early induction and higher expression of SAGs like serine and cysteine proteases, glutamine synthetases GS1 and GS2, WRKY53 transcription factor and decline in transcript levels of CAT1 and CAT2 genes than CMS plants. Hence, using genetically fertile and its CMS line of wheat it is confirmed that delayed senescence in the absence of reproductive sinks is linked with slower protein oxidation, rubisco degradation and delayed activation of SAGs. Better antioxidant defense in chloroplasts at later stages of senescence was able to mitigate the deleterious effects of ROS in CMS plants. We propose that delayed increase in ROS in cytoplasmic male sterile wheat plants resulted in delayed activation of WRKY53, SAGs and the associated biochemical changes than fertile plants.

Accurate time delay technology in simulated test for high precision laser range finder

NASA Astrophysics Data System (ADS)

Chen, Zhibin; Xiao, Wenjian; Wang, Weiming; Xue, Mingxi

2015-10-01

With the continuous development of technology, the ranging accuracy of pulsed laser range finder (LRF) is higher and higher, so the maintenance demand of LRF is also rising. According to the dominant ideology of "time analog spatial distance" in simulated test for pulsed range finder, the key of distance simulation precision lies in the adjustable time delay. By analyzing and comparing the advantages and disadvantages of fiber and circuit delay, a method was proposed to improve the accuracy of the circuit delay without increasing the count frequency of the circuit. A high precision controllable delay circuit was designed by combining the internal delay circuit and external delay circuit which could compensate the delay error in real time. And then the circuit delay accuracy could be increased. The accuracy of the novel circuit delay methods proposed in this paper was actually measured by a high sampling rate oscilloscope actual measurement. The measurement result shows that the accuracy of the distance simulated by the circuit delay is increased from +/- 0.75m up to +/- 0.15m. The accuracy of the simulated distance is greatly improved in simulated test for high precision pulsed range finder.

Delayed Administration of Bone Marrow Mesenchymal Stem Cell Conditioned Medium Significantly Improves Outcome After Retinal Ischemia in Rats

PubMed Central

Dreixler, John C.; Poston, Jacqueline N.; Balyasnikova, Irina; Shaikh, Afzhal R.; Tupper, Kelsey Y.; Conway, Sineadh; Boddapati, Venkat; Marcet, Marcus M.; Lesniak, Maciej S.; Roth, Steven

2014-01-01

Purpose. Delayed treatment after ischemia is often unsatisfactory. We hypothesized that injection of bone marrow stem cell (BMSC) conditioned medium after ischemia could rescue ischemic retina, and in this study we characterized the functional and histological outcomes and mechanisms of this neuroprotection. Methods. Retinal ischemia was produced in adult Wistar rats by increasing intraocular pressure for 55 minutes. Conditioned medium (CM) from rat BMSCs or unconditioned medium (uCM) was injected into the vitreous 24 hours after the end of ischemia. Recovery was assessed 7 days after ischemia using electroretinography, at which time we euthanized the animals and then prepared 4-μm-thick paraffin-embedded retinal sections. TUNEL and Western blot were used to identify apoptotic cells and apoptosis-related gene expression 24 hours after injections; that is, 48 hours after ischemia. Protein content in CM versus uCM was studied using tandem mass spectrometry, and bioinformatics methods were used to model protein interactions. Results. Intravitreal injection of CM 24 hours after ischemia significantly improved retinal function and attenuated cell loss in the retinal ganglion cell layer. CM attenuated postischemic apoptosis and apoptosis-related gene expression. By spectral counting, 19 proteins that met stringent identification criteria were increased in the CM compared to uCM; the majority were extracellular matrix proteins that mapped into an interactional network together with other proteins involved in cell growth and adhesion. Conclusions. By restoring retinal function, attenuating apoptosis, and preventing retinal cell loss after ischemia, CM is a robust means of delayed postischemic intervention. We identified some potential candidate proteins for this effect. PMID:24699381

Kalman filters for fractional discrete-time stochastic systems along with time-delay in the observation signal

NASA Astrophysics Data System (ADS)

Torabi, H.; Pariz, N.; Karimpour, A.

2016-02-01

This paper investigates fractional Kalman filters when time-delay is entered in the observation signal in the discrete-time stochastic fractional order state-space representation. After investigating the common fractional Kalman filter, we try to derive a fractional Kalman filter for time-delay fractional systems. A detailed derivation is given. Fractional Kalman filters will be used to estimate recursively the states of fractional order state-space systems based on minimizing the cost function when there is a constant time delay (d) in the observation signal. The problem will be solved by converting the filtering problem to a usual d-step prediction problem for delay-free fractional systems.

Time Delay of CGM Sensors

PubMed Central

Schmelzeisen-Redeker, Günther; Schoemaker, Michael; Kirchsteiger, Harald; Freckmann, Guido; Heinemann, Lutz; del Re, Luigi

2015-01-01

Background: Continuous glucose monitoring (CGM) is a powerful tool to support the optimization of glucose control of patients with diabetes. However, CGM systems measure glucose in interstitial fluid but not in blood. Rapid changes in one compartment are not accompanied by similar changes in the other, but follow with some delay. Such time delays hamper detection of, for example, hypoglycemic events. Our aim is to discuss the causes and extent of time delays and approaches to compensate for these. Methods: CGM data were obtained in a clinical study with 37 patients with a prototype glucose sensor. The study was divided into 5 phases over 2 years. In all, 8 patients participated in 2 phases separated by 8 months. A total number of 108 CGM data sets including raw signals were used for data analysis and were processed by statistical methods to obtain estimates of the time delay. Results: Overall mean (SD) time delay of the raw signals with respect to blood glucose was 9.5 (3.7) min, median was 9 min (interquartile range 4 min). Analysis of time delays observed in the same patients separated by 8 months suggests a patient dependent delay. No significant correlation was observed between delay and anamnestic or anthropometric data. The use of a prediction algorithm reduced the delay by 4 minutes on average. Conclusions: Prediction algorithms should be used to provide real-time CGM readings more consistent with simultaneous measurements by SMBG. Patient specificity may play an important role in improving prediction quality. PMID:26243773

A comparison of control modes for time-delayed remote manipulation

NASA Technical Reports Server (NTRS)

Starr, G. P.

1982-01-01

Transmission time delay in the communication channel of a manual control system is investigated. A time delay can exist in remote manipulation systems, caused by long communication distances or bandwidth limitations. Ferrell 1 conducted the first research in time-delayed manipulation using a two degree-of-freedom manipulator. His subjects, working at time delays of 1.0, 2.1, and 3.2 s, could accomplish tasks even requiring great accuracy. The subjects spontaneously adopted a pattern of moving cautiously, then waiting to see the results of their actions. In experiments with a six degree-of-freedom master-slave manipulator system and time delays of 1.0 to 6 s, Black 2 saw that subjects tried to use the move-and-wait strategy; but there were often difficulties. The subjects seemed to have a problem in holding the master arm stationary while waiting for feedback. Any undesired drifting of the master arm introduced a discrepancy between the positions of the master and slave. This discrepancy was not perceived because of the time delay. The subject would then begin his next move with an inherent error. The difficulty of effectively using the move-and-wait strategy with a master-slave manipulator suggested that rate control might be a more effective control mode with time delay.

TIMEDELN: A programme for the detection and parametrization of overlapping resonances using the time-delay method

NASA Astrophysics Data System (ADS)

Little, Duncan A.; Tennyson, Jonathan; Plummer, Martin; Noble, Clifford J.; Sunderland, Andrew G.

2017-06-01

TIMEDELN implements the time-delay method of determining resonance parameters from the characteristic Lorentzian form displayed by the largest eigenvalues of the time-delay matrix. TIMEDELN constructs the time-delay matrix from input K-matrices and analyses its eigenvalues. This new version implements multi-resonance fitting and may be run serially or as a high performance parallel code with three levels of parallelism. TIMEDELN takes K-matrices from a scattering calculation, either read from a file or calculated on a dynamically adjusted grid, and calculates the time-delay matrix. This is then diagonalized, with the largest eigenvalue representing the longest time-delay experienced by the scattering particle. A resonance shows up as a characteristic Lorentzian form in the time-delay: the programme searches the time-delay eigenvalues for maxima and traces resonances when they pass through different eigenvalues, separating overlapping resonances. It also performs the fitting of the calculated data to the Lorentzian form and outputs resonance positions and widths. Any remaining overlapping resonances can be fitted jointly. The branching ratios of decay into the open channels can also be found. The programme may be run serially or in parallel with three levels of parallelism. The parallel code modules are abstracted from the main physics code and can be used independently.

14 CFR 417.221 - Time delay analysis.

Code of Federal Regulations, 2010 CFR

2010-01-01

... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a) General. A flight safety analysis must include a time delay analysis that establishes the mean elapsed time between the violation of a flight termination rule and the time when the flight safety system is...

14 CFR 417.221 - Time delay analysis.

Code of Federal Regulations, 2011 CFR

2011-01-01

... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a) General. A flight safety analysis must include a time delay analysis that establishes the mean elapsed time between the violation of a flight termination rule and the time when the flight safety system is...

Lineage-specific rediploidization is a mechanism to explain time-lags between genome duplication and evolutionary diversification.

PubMed

Robertson, Fiona M; Gundappa, Manu Kumar; Grammes, Fabian; Hvidsten, Torgeir R; Redmond, Anthony K; Lien, Sigbjørn; Martin, Samuel A M; Holland, Peter W H; Sandve, Simen R; Macqueen, Daniel J

2017-06-14

The functional divergence of duplicate genes (ohnologues) retained from whole genome duplication (WGD) is thought to promote evolutionary diversification. However, species radiation and phenotypic diversification are often temporally separated from WGD. Salmonid fish, whose ancestor underwent WGD by autotetraploidization ~95 million years ago, fit such a 'time-lag' model of post-WGD radiation, which occurred alongside a major delay in the rediploidization process. Here we propose a model, 'lineage-specific ohnologue resolution' (LORe), to address the consequences of delayed rediploidization. Under LORe, speciation precedes rediploidization, allowing independent ohnologue divergence in sister lineages sharing an ancestral WGD event. Using cross-species sequence capture, phylogenomics and genome-wide analyses of ohnologue expression divergence, we demonstrate the major impact of LORe on salmonid evolution. One-quarter of each salmonid genome, harbouring at least 4550 ohnologues, has evolved under LORe, with rediploidization and functional divergence occurring on multiple independent occasions >50 million years post-WGD. We demonstrate the existence and regulatory divergence of many LORe ohnologues with functions in lineage-specific physiological adaptations that potentially facilitated salmonid species radiation. We show that LORe ohnologues are enriched for different functions than 'older' ohnologues that began diverging in the salmonid ancestor. LORe has unappreciated significance as a nested component of post-WGD divergence that impacts the functional properties of genes, whilst providing ohnologues available solely for lineage-specific adaptation. Under LORe, which is predicted following many WGD events, the functional outcomes of WGD need not appear 'explosively', but can arise gradually over tens of millions of years, promoting lineage-specific diversification regimes under prevailing ecological pressures.

49 CFR 236.831 - Time, delay.

Code of Federal Regulations, 2010 CFR

2010-10-01

... 49 Transportation 4 2010-10-01 2010-10-01 false Time, delay. 236.831 Section 236.831 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION... Time, delay. As applied to an automatic train stop or train control system, the time which elapses...

Lesions Responsible for Delayed Oral Transit Time in Post-stroke Dysphagia.

PubMed

Moon, Hyun Im; Yoon, Seo Yeon; Yi, Tae Im; Jeong, Yoon Jeong; Cho, Tae Hwan

2018-06-01

Some stroke patients show oral phase dysphagia, characterized by a markedly prolonged oral transit time that hinders oral feeding. The aim of this study was to clarify the clinical characteristics and lesions responsible for delayed swallowing. We reviewed 90 patients with stroke. The oral processing time plus the postfaucial aggregation time required to swallow semisolid food was assessed. The patients were divided into two groups according to oral transit time, and we analyzed the differences in characteristics such as demographic factors, lesion factors, and cognitive function. Logistic regression analyses were performed to examine the predictors of delayed oral transit time. Lesion location and volume were measured on brain magnetic resonance images. We generated statistic maps of lesions related to delayed oral phase in swallowing using voxel-based lesion symptom mapping (VLSM). The group of patients who showed delayed oral transit time had significantly low cognitive function. Also, in a regression model, delayed oral phase was predicted with low K-MMSE (Korean version of the Mini Mental Status Exam). Using VLSM, we found the lesion location to be associated with delayed oral phase after adjusting for K-MMSE score. Although these results did not reach statistical significance, they showed the lesion pattern with predominant distribution in the left frontal lobe. Delayed oral phase in post-stroke patients was not negligible clinically. Patients' cognitive impairments affect the oral transit time. When adjusting it, we found a trend that the lesion responsible for delayed oral phase was located in the left frontal lobe, though the association did not reach significance. The delay might be related to praxis function.

A single-molecule view of gene regulation in cancer

NASA Astrophysics Data System (ADS)

Larson, Daniel

2013-03-01

Single-cell analysis has revealed that transcription is dynamic and stochastic, but tools are lacking that can determine the mechanism operating at a single gene. Here we utilize single-molecule observations of RNA in fixed and living cells to develop a single-cell model of steroid-receptor mediated gene activation. Steroid receptors coordinate a diverse range of responses in higher eukaryotes and are involved in a wide range of human diseases, including cancer. Steroid receptor response elements are present throughout the human genome and modulate chromatin remodeling and transcription in both a local and long-range fashion. As such, steroid receptor-mediated transcription is a paradigm of genetic control in the metazoan nucleus. Moreover, the ligand-dependent nature of these transcription factors makes them appealing targets for therapeutic intervention, necessitating a quantitative understanding of how receptors control output from target genes. We determine that steroids drive mRNA synthesis by frequency modulation of transcription. This digital behavior in single cells gives rise to the well-known analog dose response across the population. To test this model, we developed a light-activation technology to turn on a single gene and follow dynamic synthesis of RNA from the activated locus. The response delay is a measure of time required for chromatin remodeling at a single gene.

Early indicators of exposure to biological threat agents using host gene profiles in peripheral blood mononuclear cells

PubMed Central

Das, Rina; Hammamieh, Rasha; Neill, Roger; Ludwig, George V; Eker, Steven; Lincoln, Patrick; Ramamoorthy, Preveen; Dhokalia, Apsara; Mani, Sachin; Mendis, Chanaka; Cummings, Christiano; Kearney, Brian; Royaee, Atabak; Huang, Xiao-Zhe; Paranavitana, Chrysanthi; Smith, Leonard; Peel, Sheila; Kanesa-Thasan, Niranjan; Hoover, David; Lindler, Luther E; Yang, David; Henchal, Erik; Jett, Marti

2008-01-01

Background Effective prophylaxis and treatment for infections caused by biological threat agents (BTA) rely upon early diagnosis and rapid initiation of therapy. Most methods for identifying pathogens in body fluids and tissues require that the pathogen proliferate to detectable and dangerous levels, thereby delaying diagnosis and treatment, especially during the prelatent stages when symptoms for most BTA are indistinguishable flu-like signs. Methods To detect exposures to the various pathogens more rapidly, especially during these early stages, we evaluated a suite of host responses to biological threat agents using global gene expression profiling on complementary DNA arrays. Results We found that certain gene expression patterns were unique to each pathogen and that other gene changes occurred in response to multiple agents, perhaps relating to the eventual course of illness. Nonhuman primates were exposed to some pathogens and the in vitro and in vivo findings were compared. We found major gene expression changes at the earliest times tested post exposure to aerosolized B. anthracis spores and 30 min post exposure to a bacterial toxin. Conclusion Host gene expression patterns have the potential to serve as diagnostic markers or predict the course of impending illness and may lead to new stage-appropriate therapeutic strategies to ameliorate the devastating effects of exposure to biothreat agents. PMID:18667072

Functional Inactivation of Putative Photosynthetic Electron Acceptor Ferredoxin C2 (FdC2) Induces Delayed Heading Date and Decreased Photosynthetic Rate in Rice

PubMed Central

Ruan, Banpu; Kang, Shujing; He, Lei; Zhang, Sen; Dong, Guojun; Hu, Jiang; Zeng, Dali; Zhang, Guangheng; Gao, Zhenyu; Ren, Deyong; Hu, Xingming; Chen, Guang; Guo, Longbiao; Qian, Qian; Zhu, Li

2015-01-01

Ferredoxin (Fd) protein as unique electron acceptor, involved in a variety of fundamental metabolic and signaling processes, which is indispensable for plant growth. The molecular mechanisms of Fd such as regulation of electron partitioning, impact of photosynthetic rate and involvement in the carbon fixing remain elusive in rice. Here we reported a heading date delay and yellowish leaf 1 (hdy1) mutant derived from Japonica rice cultivar “Nipponbare” subjected to EMS treatment. In the paddy field, the hdy1 mutant appeared at a significantly late heading date and had yellow-green leaves during the whole growth stage. Further investigation indicated that the abnormal phenotype of hdy1 was connected with depressed pigment content and photosynthetic rate. Genetic analysis results showed that the hdy1 mutant phenotype was caused by a single recessive nuclear gene mutation. Map-based cloning revealed that OsHDY1 is located on chromosome 3 and encodes an ortholog of the AtFdC2 gene. Complementation and overexpression, transgenic plants exhibited the mutant phenotype including head date, leaf color and the transcription levels of the FdC2 were completely rescued by transformation with OsHDY1. Real-time PCR revealed that the expression product of OsHDY1 was detected in almost all of the organs except root, whereas highest expression levels were observed in seeding new leaves. The lower expression levels of HDY1 and content of iron were detected in hdy1 than WT’s. The FdC2::GFP was detected in the chloroplasts of rice. Real-time PCR results showed that the expression of many photosynthetic electron transfer related genes in hdy1 were higher than WT. Our results suggest that OsFdC2 plays an important role in photosynthetic rate and development of heading date by regulating electron transfer and chlorophyll content in rice. PMID:26598971

The effect of visual-motion time-delays on pilot performance in a simulated pursuit tracking task

NASA Technical Reports Server (NTRS)

Miller, G. K., Jr.; Riley, D. R.

1977-01-01

An experimental study was made to determine the effect on pilot performance of time delays in the visual and motion feedback loops of a simulated pursuit tracking task. Three major interrelated factors were identified: task difficulty either in the form of airplane handling qualities or target frequency, the amount and type of motion cues, and time delay itself. In general, the greater the task difficulty, the smaller the time delay that could exist without degrading pilot performance. Conversely, the greater the motion fidelity, the greater the time delay that could be tolerated. The effect of motion was, however, pilot dependent.

Optimal estimation of parameters and states in stochastic time-varying systems with time delay

NASA Astrophysics Data System (ADS)

Torkamani, Shahab; Butcher, Eric A.

2013-08-01

In this study estimation of parameters and states in stochastic linear and nonlinear delay differential systems with time-varying coefficients and constant delay is explored. The approach consists of first employing a continuous time approximation to approximate the stochastic delay differential equation with a set of stochastic ordinary differential equations. Then the problem of parameter estimation in the resulting stochastic differential system is represented as an optimal filtering problem using a state augmentation technique. By adapting the extended Kalman-Bucy filter to the resulting system, the unknown parameters of the time-delayed system are estimated from noise-corrupted, possibly incomplete measurements of the states.

Opto-VLSI-based photonic true-time delay architecture for broadband adaptive nulling in phased array antennas.

PubMed

Juswardy, Budi; Xiao, Feng; Alameh, Kamal

2009-03-16

This paper proposes a novel Opto-VLSI-based tunable true-time delay generation unit for adaptively steering the nulls of microwave phased array antennas. Arbitrary single or multiple true-time delays can simultaneously be synthesized for each antenna element by slicing an RF-modulated broadband optical source and routing specific sliced wavebands through an Opto-VLSI processor to a high-dispersion fiber. Experimental results are presented, which demonstrate the principle of the true-time delay unit through the generation of 5 arbitrary true-time delays of up to 2.5 ns each. (c) 2009 Optical Society of America

Mutational analysis of GALT gene in Greek patients with galactosaemia: identification of two novel mutations and clinical evaluation.

PubMed

Schulpis, Kleopatra H; Thodi, Georgia; Iakovou, Konstantinos; Chatzidaki, Maria; Dotsikas, Yannis; Molou, Elina; Triantafylli, Olga; Loukas, Yannis L

2017-10-01

Classical galactosaemia is an inborn error of metabolism due to the deficiency of the enzyme galactose-1-phosphate uridylyltransferase (GALT). The aim of the study was to identify the underlying mutations in Greek patients with GALT deficiency and evaluate their psychomotor and speech development. Patients with GALT deficiency (n = 17) were picked up through neonatal screening. Mutational analysis was conducted via Sanger sequencing, while in silico analysis was used in the cases of novel missense mutations. Psychomotor speech development tests were utilized for the clinical evaluation of the patients. Eleven different mutations in the GALT gene were detected in the patient cohort, including two novel ones. The most frequent mutation was p.Q188R (c.563 A > G). As for the novel mutations, p.M298I (c.894 G > A) was identified in four out of 32 independent alleles, while p.P115S (c.343 C > T) was identified once. Psychomotor evaluation revealed that most of the patients were found in the borderline area (Peabody test), while only two had speech delay problems. The WISK test revealed three patients at borderline limits and two were at lower than normal limits. The mutational spectrum of the GALT gene in Greek patients is presented for the first time. The mutation p.Q188R is the most frequent among Greek patients. Two novel mutations were identified and their potential pathogenicity was estimated. Regarding the phenotypic characteristics, psychomotor disturbances and speech delay were mainly observed among GALT-deficient patients.

Fine Time Course Expression Analysis Identifies Cascades of Activation and Repression and Maps a Putative Regulator of Mammalian Sex Determination

PubMed Central

Looger, Loren L.; Ohler, Uwe; Capel, Blanche

2013-01-01

In vertebrates, primary sex determination refers to the decision within a bipotential organ precursor to differentiate as a testis or ovary. Bifurcation of organ fate begins between embryonic day (E) 11.0–E12.0 in mice and likely involves a dynamic transcription network that is poorly understood. To elucidate the first steps of sexual fate specification, we profiled the XX and XY gonad transcriptomes at fine granularity during this period and resolved cascades of gene activation and repression. C57BL/6J (B6) XY gonads showed a consistent ∼5-hour delay in the activation of most male pathway genes and repression of female pathway genes relative to 129S1/SvImJ, which likely explains the sensitivity of the B6 strain to male-to-female sex reversal. Using this fine time course data, we predicted novel regulatory genes underlying expression QTLs (eQTLs) mapped in a previous study. To test predictions, we developed an in vitro gonad primary cell assay and optimized a lentivirus-based shRNA delivery method to silence candidate genes and quantify effects on putative targets. We provide strong evidence that Lmo4 (Lim-domain only 4) is a novel regulator of sex determination upstream of SF1 (Nr5a1), Sox9, Fgf9, and Col9a3. This approach can be readily applied to identify regulatory interactions in other systems. PMID:23874228

Solar oscillation time delay measurement assisted celestial navigation method

NASA Astrophysics Data System (ADS)

Ning, Xiaolin; Gui, Mingzhen; Zhang, Jie; Fang, Jiancheng; Liu, Gang

2017-05-01

Solar oscillation, which causes the sunlight intensity and spectrum frequency change, has been studied in great detail, both observationally and theoretically. In this paper, owing to the existence of solar oscillation, the time delay between the sunlight coming from the Sun directly and the sunlight reflected by the other celestial body such as the satellite of planet or asteroid can be obtained with two optical power meters. Because the solar oscillation time delay is determined by the relative positions of the spacecraft, reflective celestial body and the Sun, it can be adopted as the navigation measurement to estimate the spacecraft's position. The navigation accuracy of single solar oscillation time delay navigation system depends on the time delay measurement accuracy, and is influenced by the distance between spacecraft and reflective celestial body. In this paper, we combine it with the star angle measurement and propose a solar oscillation time delay measurement assisted celestial navigation method for deep space exploration. Since the measurement model of time delay is an implicit function, the Implicit Unscented Kalman Filter (IUKF) is applied. Simulations demonstrate the effectiveness and superiority of this method.

System for sensing droplet formation time delay in a flow cytometer

DOEpatents

Van den Engh, Ger; Esposito, Richard J.

1997-01-01

A droplet flow cytometer system which includes a system to optimize the droplet formation time delay based on conditions actually experienced includes an automatic droplet sampler which rapidly moves a plurality of containers stepwise through the droplet stream while simultaneously adjusting the droplet time delay. Through the system sampling of an actual substance to be processed can be used to minimize the effect of the substances variations or the determination of which time delay is optimal. Analysis such as cell counting and the like may be conducted manually or automatically and input to a time delay adjustment which may then act with analysis equipment to revise the time delay estimate actually applied during processing. The automatic sampler can be controlled through a microprocessor and appropriate programming to bracket an initial droplet formation time delay estimate. When maximization counts through volume, weight, or other types of analysis exists in the containers, the increment may then be reduced for a more accurate ultimate setting. This may be accomplished while actually processing the sample without interruption.

Transcriptional regulation of crystallin, redox, and apoptotic genes by C-Phycocyanin in the selenite-induced cataractogenic rat model

PubMed Central

Kumari, Rasiah Pratheepa; Ramkumar, Srinivasagan; Thankappan, Bency; Natarajaseenivasan, Kalimuthusamy; Balaji, Sadhasivam

2015-01-01

Purpose This study was designed to examine the constrictive potential of C-Phycocyanin (C-PC) in regulating changes imposed on gene expression in the selenite-induced cataract model. Methods Wistar rat pups were divided into three groups of eight each. On P10, Group I received an intraperitoneal injection of normal saline. Groups II and III received a subcutaneous injection of sodium selenite (19 μmol/kg bodyweight); Group III also received an intraperitoneal injection of C-PC (200 mg/kg bodyweight) on P9–14. Total RNA was isolated on P16, and the relative abundance of mRNA of the crystallin structural genes, redox components, and apoptotic cascade were ascertained with real-time PCR with reference to the internal control β-actin. Results Real-time PCR analysis showed the crystallin genes (αA-, βB1-, γD-) and redox cycle components (Cat, SOD-1, Gpx) were downregulated, the apoptotic components were upregulated, and antiapoptotic Bcl-2 was downregulated in Group II. Treatment with 200 mg/kg bodyweight C-PC (Group III) transcriptionally regulated the instability of the expression of these genes, thus ensuring C-PC is a prospective anticataractogenic agent that probably delays the onset and progression of cataractogenesis induced by sodium selenite. Conclusions C-PC treatment possibly prevented cataractogenesis triggered by sodium selenite, by regulating the lens crystallin, redox genes, and apoptotic cascade mRNA expression and thus maintains lens transparency. C-PC may be developed as a potential antioxidant compound applied in the future to prevent and treat age-related cataract. PMID:25593511

A comparative study of ripening among berries of the grape cluster reveals an altered transcriptional programme and enhanced ripening rate in delayed berries

PubMed Central

Gouthu, Satyanarayana; O’Neil, Shawn T.; Di, Yanming; Ansarolia, Mitra; Megraw, Molly; Deluc, Laurent G.

2014-01-01

Transcriptional studies in relation to fruit ripening generally aim to identify the transcriptional states associated with physiological ripening stages and the transcriptional changes between stages within the ripening programme. In non-climacteric fruits such as grape, all ripening-related genes involved in this programme have not been identified, mainly due to the lack of mutants for comparative transcriptomic studies. A feature in grape cluster ripening (Vitis vinifera cv. Pinot noir), where all berries do not initiate the ripening at the same time, was exploited to study their shifted ripening programmes in parallel. Berries that showed marked ripening state differences in a véraison-stage cluster (ripening onset) ultimately reached similar ripeness states toward maturity, indicating the flexibility of the ripening programme. The expression variance between these véraison-stage berry classes, where 11% of the genes were found to be differentially expressed, was reduced significantly toward maturity, resulting in the synchronization of their transcriptional states. Defined quantitative expression changes (transcriptional distances) not only existed between the véraison transitional stages, but also between the véraison to maturity stages, regardless of the berry class. It was observed that lagging berries complete their transcriptional programme in a shorter time through altered gene expressions and ripening-related hormone dynamics, and enhance the rate of physiological ripening progression. Finally, the reduction in expression variance of genes can identify new genes directly associated with ripening and also assess the relevance of gene activity to the phase of the ripening programme. PMID:25135520

Leigh syndrome associated with a novel mutation in the COX15 gene.

PubMed

Miryounesi, Mohammad; Fardaei, Majid; Tabei, Seyed Mohammadbagher; Ghafouri-Fard, Soudeh

2016-06-01

Leigh syndrome (LS) is a subacute necrotizing encephalomyelopathy with a diverse range of symptoms, such as psychomotor delay or regression, weakness, hypotonia, truncal ataxia, intention tremor as well as lactic acidosis in the blood, cerebrospinal fluid or urine. Both nuclear gene defects and mutations of the mitochondrial genome have been detected in these patients. Here we report a 7-year-old girl with hypotonia, tremor, developmental delay and psychomotor regression. However, serum lactate level as well as brain magnetic resonance imaging were normal. Mutational analysis has revealed a novel mutation in exon 4 of COX15 gene (c.415C>G) which results in p.Leu139Val. Previous studies have demonstrated that COX15 mutations are associated with typical LS as well as fatal infantile hypertrophic cardiomyopathy. Consequently, clinical manifestations of COX15 mutations may be significantly different in patients. Such information is of practical importance in genetic counseling.

Features of CRISPR-Cas Regulation Key to Highly Efficient and Temporally-Specific crRNA Production.

PubMed

Rodic, Andjela; Blagojevic, Bojana; Djordjevic, Magdalena; Severinov, Konstantin; Djordjevic, Marko

2017-01-01

Bacterial immune systems, such as CRISPR-Cas or restriction-modification (R-M) systems, affect bacterial pathogenicity and antibiotic resistance by modulating horizontal gene flow. A model system for CRISPR-Cas regulation, the Type I-E system from Escherichia coli , is silent under standard laboratory conditions and experimentally observing the dynamics of CRISPR-Cas activation is challenging. Two characteristic features of CRISPR-Cas regulation in E. coli are cooperative transcription repression of cas gene and CRISPR array promoters, and fast non-specific degradation of full length CRISPR transcripts (pre-crRNA). In this work, we use computational modeling to understand how these features affect the system expression dynamics. Signaling which leads to CRISPR-Cas activation is currently unknown, so to bypass this step, we here propose a conceptual setup for cas expression activation, where cas genes are put under transcription control typical for a restriction-modification (R-M) system and then introduced into a cell. Known transcription regulation of an R-M system is used as a proxy for currently unknown CRISPR-Cas transcription control, as both systems are characterized by high cooperativity, which is likely related to similar dynamical constraints of their function. We find that the two characteristic CRISPR-Cas control features are responsible for its temporally-specific dynamical response, so that the system makes a steep (switch-like) transition from OFF to ON state with a time-delay controlled by pre-crRNA degradation rate. We furthermore find that cooperative transcription regulation qualitatively leads to a cross-over to a regime where, at higher pre-crRNA processing rates, crRNA generation approaches the limit of an infinitely abrupt system induction. We propose that these dynamical properties are associated with rapid expression of CRISPR-Cas components and efficient protection of bacterial cells against foreign DNA. In terms of synthetic applications, the setup proposed here should allow highly efficient expression of small RNAs in a narrow time interval, with a specified time-delay with respect to the signal onset.

Tunable delay time and Hartman effect in graphene magnetic barriers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ban, Yue; Wang, Lin-Jun; Chen, Xi, E-mail: xchen@shu.edu.cn

2015-04-28

Tunable group delay and Hartman effect have been investigated for massless Dirac electrons in graphene magnetic barriers. In the presence of magnetic field, dwell time is found to be equal to net group delay plus the group delay contributing from the lateral shifts. The group delay times are discussed in both cases of normal and oblique incidence, to clarify the nature of Hartman effect. In addition, the group delay in transmission can be modulated from subluminality to superluminality by adjusting the magnetic field, which may also lead to potential applications in graphene-based microelectronics.

Ultraviolet stress delays chromosome replication in light/dark synchronized cells of the marine cyanobacterium Prochlorococcus marinus PCC9511

PubMed Central

2010-01-01

Background The marine cyanobacterium Prochlorococcus is very abundant in warm, nutrient-poor oceanic areas. The upper mixed layer of oceans is populated by high light-adapted Prochlorococcus ecotypes, which despite their tiny genome (~1.7 Mb) seem to have developed efficient strategies to cope with stressful levels of photosynthetically active and ultraviolet (UV) radiation. At a molecular level, little is known yet about how such minimalist microorganisms manage to sustain high growth rates and avoid potentially detrimental, UV-induced mutations to their DNA. To address this question, we studied the cell cycle dynamics of P. marinus PCC9511 cells grown under high fluxes of visible light in the presence or absence of UV radiation. Near natural light-dark cycles of both light sources were obtained using a custom-designed illumination system (cyclostat). Expression patterns of key DNA synthesis and repair, cell division, and clock genes were analyzed in order to decipher molecular mechanisms of adaptation to UV radiation. Results The cell cycle of P. marinus PCC9511 was strongly synchronized by the day-night cycle. The most conspicuous response of cells to UV radiation was a delay in chromosome replication, with a peak of DNA synthesis shifted about 2 h into the dark period. This delay was seemingly linked to a strong downregulation of genes governing DNA replication (dnaA) and cell division (ftsZ, sepF), whereas most genes involved in DNA repair (such as recA, phrA, uvrA, ruvC, umuC) were already activated under high visible light and their expression levels were only slightly affected by additional UV exposure. Conclusions Prochlorococcus cells modified the timing of the S phase in response to UV exposure, therefore reducing the risk that mutations would occur during this particularly sensitive stage of the cell cycle. We identified several possible explanations for the observed timeshift. Among these, the sharp decrease in transcript levels of the dnaA gene, encoding the DNA replication initiator protein, is sufficient by itself to explain this response, since DNA synthesis starts only when the cellular concentration of DnaA reaches a critical threshold. However, the observed response likely results from a more complex combination of UV-altered biological processes. PMID:20670397

Causes of delay in door-to-balloon time in south-east Asian patients undergoing primary percutaneous coronary intervention.

PubMed

Sim, Wen Jun; Ang, An Shing; Tan, Mae Chyi; Xiang, Wen Wei; Foo, David; Loh, Kwok Kong; Jafary, Fahim Haider; Watson, Timothy James; Ong, Paul Jau Lueng; Ho, Hee Hwa

2017-01-01

To evaluate causes and impact of delay in the door-to-balloon (D2B) time for patients undergoing primary percutaneous coronary intervention (PPCI). From January 2009 to December 2012, 1268 patients (86% male, mean age of 58 ± 12 years) presented to our hospital for ST-elevation myocardial infarction (STEMI) and underwent PPCI. They were divided into two groups: Non-delay defined as D2B time ≤ 90 mins and delay group defined as D2B time > 90 mins. Data were collected retrospectively on baseline clinical characteristics, mode of presentation, angiographic findings, therapeutic modality and inhospital outcome. 202 patients had delay in D2B time. There were more female patients in the delay group. They were older and tend to self-present to hospital. They were less likely to be smokers and have a higher prevalence of prior MI. The incidence of posterior MI was higher in the delay group. They also had a higher incidence of triple vessel disease. The 3 most common reasons for D2B delay was delay in the emergency department (39%), atypical clinical presentation (37.6%) and unstable medical condition requiring stabilisation/computed tomographic imaging (26.7%). The inhospital mortality was numerically higher in the delay group (7.4% versus 4.8%, p = 0.12). Delay in D2B occurred in 16% of our patients undergoing PPCI. Several key factors for delay were identified and warrant further intervention.

Ir gene controlled carrier effects in the induction and elicitation of hapten-specific delayed-type hypersensitivity responses.

PubMed

Weinberger, J Z; Benacerraf, B; Dorf, M E

1979-11-01

The genetic requirements of carrier recognition were examined in the priming and elicitation of hapten specific, T-cell mediated, delayed-type hypersensitivity (DTH) responses. It was shown that nitrophenyl acetyl-poly-(L-glu56-L-lys35-L-phe9) (NP-GLO) could prime for NP responses only in strains of mice which are Ir gene responders to GLO. In contrast to this requirement, NO-GLO could elicit an NP-specific response in NP-bovine gamma globulin primed mice, even in GLO nonresponder strains. Furthermore, the nonimmunogenic molecule, NP-GL, could elicit an NP-specific DTH response in animals primed with NP on an immunogenic carrier.

Delay-correlation landscape reveals characteristic time delays of brain rhythms and heart interactions

PubMed Central

Lin, Aijing; Liu, Kang K. L.; Bartsch, Ronny P.; Ivanov, Plamen Ch.

2016-01-01

Within the framework of ‘Network Physiology’, we ask a fundamental question of how modulations in cardiac dynamics emerge from networked brain–heart interactions. We propose a generalized time-delay approach to identify and quantify dynamical interactions between physiologically relevant brain rhythms and the heart rate. We perform empirical analysis of synchronized continuous EEG and ECG recordings from 34 healthy subjects during night-time sleep. For each pair of brain rhythm and heart interaction, we construct a delay-correlation landscape (DCL) that characterizes how individual brain rhythms are coupled to the heart rate, and how modulations in brain and cardiac dynamics are coordinated in time. We uncover characteristic time delays and an ensemble of specific profiles for the probability distribution of time delays that underly brain–heart interactions. These profiles are consistently observed in all subjects, indicating a universal pattern. Tracking the evolution of DCL across different sleep stages, we find that the ensemble of time-delay profiles changes from one physiologic state to another, indicating a strong association with physiologic state and function. The reported observations provide new insights on neurophysiological regulation of cardiac dynamics, with potential for broad clinical applications. The presented approach allows one to simultaneously capture key elements of dynamic interactions, including characteristic time delays and their time evolution, and can be applied to a range of coupled dynamical systems. PMID:27044991

Delay-correlation landscape reveals characteristic time delays of brain rhythms and heart interactions

NASA Astrophysics Data System (ADS)

Lin, Aijing; Liu, Kang K. L.; Bartsch, Ronny P.; Ivanov, Plamen Ch.

2016-05-01

Within the framework of `Network Physiology', we ask a fundamental question of how modulations in cardiac dynamics emerge from networked brain-heart interactions. We propose a generalized time-delay approach to identify and quantify dynamical interactions between physiologically relevant brain rhythms and the heart rate. We perform empirical analysis of synchronized continuous EEG and ECG recordings from 34 healthy subjects during night-time sleep. For each pair of brain rhythm and heart interaction, we construct a delay-correlation landscape (DCL) that characterizes how individual brain rhythms are coupled to the heart rate, and how modulations in brain and cardiac dynamics are coordinated in time. We uncover characteristic time delays and an ensemble of specific profiles for the probability distribution of time delays that underly brain-heart interactions. These profiles are consistently observed in all subjects, indicating a universal pattern. Tracking the evolution of DCL across different sleep stages, we find that the ensemble of time-delay profiles changes from one physiologic state to another, indicating a strong association with physiologic state and function. The reported observations provide new insights on neurophysiological regulation of cardiac dynamics, with potential for broad clinical applications. The presented approach allows one to simultaneously capture key elements of dynamic interactions, including characteristic time delays and their time evolution, and can be applied to a range of coupled dynamical systems.

Control of amplitude chimeras by time delay in oscillator networks

NASA Astrophysics Data System (ADS)

Gjurchinovski, Aleksandar; Schöll, Eckehard; Zakharova, Anna

2017-04-01

We investigate the influence of time-delayed coupling in a ring network of nonlocally coupled Stuart-Landau oscillators upon chimera states, i.e., space-time patterns with coexisting partially coherent and partially incoherent domains. We focus on amplitude chimeras, which exhibit incoherent behavior with respect to the amplitude rather than the phase and are transient patterns, and we show that their lifetime can be significantly enhanced by coupling delay. To characterize their transition to phase-lag synchronization (coherent traveling waves) and other coherent structures, we generalize the Kuramoto order parameter. Contrasting the results for instantaneous coupling with those for constant coupling delay, for time-varying delay, and for distributed-delay coupling, we demonstrate that the lifetime of amplitude chimera states and related partially incoherent states can be controlled, i.e., deliberately reduced or increased, depending upon the type of coupling delay.

Time domain passivity controller for 4-channel time-delay bilateral teleoperation.

PubMed

Rebelo, Joao; Schiele, Andre

2015-01-01

This paper presents an extension of the time-domain passivity control approach to a four-channel bilateral controller under the effects of time delays. Time-domain passivity control has been used successfully to stabilize teleoperation systems with position-force and position-position controllers; however, the performance with such control architectures is sub-optimal both with and without time delays. This work extends the network representation of the time-domain passivity controller to the four-channel architecture, which provides perfect transparency to the user without time delay. The proposed architecture is based on modelling the controllers as dependent voltage sources and using only series passivity controllers. The obtained results are shown on a one degree-of-freedom setup and illustrate the stabilization behaviour of the proposed controller when time delay is present in the communication channel.

Typical teleoperator time delay profiles, phase 2. [remotely controlled manipulator arms

NASA Technical Reports Server (NTRS)

Wetherington, R. D.; Walsh, J. R.

1974-01-01

The results of the second phase of a study on time delays in communications systems applicable to the teleoperator program are presented. Estimates of the maximum time delays that will be encountered and presents time delay profiles are given for (1) ground control to teleoperator in low earth orbit, (2) ground control to teleoperator in geosynchronous orbit, and (3) low earth orbit control to teleoperator in low earth orbit.

VARIABLE TIME DELAY MEANS

DOEpatents

Clemensen, R.E.

1959-11-01

An electrically variable time delay line is described which may be readily controlled simuitaneously with variable impedance matching means coupied thereto such that reflections are prevented. Broadly, the delay line includes a signal winding about a magnetic core whose permeability is electrically variable. Inasmuch as the inductance of the line varies directly with the permeability, the time delay and characteristic impedance of the line both vary as the square root of the permeability. Consequently, impedance matching means may be varied similariy and simultaneously w:th the electrically variable permeability to match the line impedance over the entire range of time delay whereby reflections are prevented.

Simulator study of the effect of visual-motion time delays on pilot tracking performance with an audio side task

NASA Technical Reports Server (NTRS)

Riley, D. R.; Miller, G. K., Jr.

1978-01-01

The effect of time delay was determined in the visual and motion cues in a flight simulator on pilot performance in tracking a target aircraft that was oscillating sinusoidally in altitude only. An audio side task was used to assure the subject was fully occupied at all times. The results indicate that, within the test grid employed, about the same acceptable time delay (250 msec) was obtained for a single aircraft (fighter type) by each of two subjects for both fixed-base and motion-base conditions. Acceptable time delay is defined as the largest amount of delay that can be inserted simultaneously into the visual and motion cues before performance degradation occurs. A statistical analysis of the data was made to establish this value of time delay. Audio side task provided quantitative data that documented the subject's work level.

Wigner time delay and spin-orbit activated confinement resonances

NASA Astrophysics Data System (ADS)

Keating, D. A.; Deshmukh, P. C.; Manson, S. T.

2017-09-01

A study of the photoionization of spin-orbit split subshells of high-Z atoms confined in C60 has been performed using the relativistic-random-phase approximation. Specifically, Hg@C60 5p, Rn@C60 6p and Ra@C60 5d were investigated and the near-threshold confinement resonances in the j = l - 1/2 channels were found to engender structures in the j = l + 1/2 cross sections via correlation in the form of interchannel coupling. These structures are termed spin-orbit induced confinement resonances and they are found to profoundly influence the Wigner time delay spectrum resulting in time delays of tens or hundreds of attoseconds along with dramatic swings in time delay over small energy intervals. Pronounced relativistic effects in time delay are also found. These structures, including their manifestation in time delay spectra, are expected to be general phenomena in the photoionization of spin-orbit doublets in confined high-Z atoms.

Synchronization in a chaotic neural network with time delay depending on the spatial distance between neurons

NASA Astrophysics Data System (ADS)

Tang, Guoning; Xu, Kesheng; Jiang, Luoluo

2011-10-01

The synchronization is investigated in a two-dimensional Hindmarsh-Rose neuronal network by introducing a global coupling scheme with time delay, where the length of time delay is proportional to the spatial distance between neurons. We find that the time delay always disturbs synchronization of the neuronal network. When both the coupling strength and length of time delay per unit distance (i.e., enlargement factor) are large enough, the time delay induces the abnormal membrane potential oscillations in neurons. Specifically, the abnormal membrane potential oscillations for the symmetrically placed neurons form an antiphase, so that the large coupling strength and enlargement factor lead to the desynchronization of the neuronal network. The complete and intermittently complete synchronization of the neuronal network are observed for the right choice of parameters. The physical mechanism underlying these phenomena is analyzed.

Dissipativity and stability analysis of fractional-order complex-valued neural networks with time delay.

PubMed

Velmurugan, G; Rakkiyappan, R; Vembarasan, V; Cao, Jinde; Alsaedi, Ahmed

2017-02-01

As we know, the notion of dissipativity is an important dynamical property of neural networks. Thus, the analysis of dissipativity of neural networks with time delay is becoming more and more important in the research field. In this paper, the authors establish a class of fractional-order complex-valued neural networks (FCVNNs) with time delay, and intensively study the problem of dissipativity, as well as global asymptotic stability of the considered FCVNNs with time delay. Based on the fractional Halanay inequality and suitable Lyapunov functions, some new sufficient conditions are obtained that guarantee the dissipativity of FCVNNs with time delay. Moreover, some sufficient conditions are derived in order to ensure the global asymptotic stability of the addressed FCVNNs with time delay. Finally, two numerical simulations are posed to ensure that the attention of our main results are valuable. Copyright © 2016 Elsevier Ltd. All rights reserved.

Six post-implantation lethal knockouts of genes for lipophilic MAPK pathway proteins are expressed in preimplantation mouse embryos and trophoblast stem cells.

PubMed

Xie, Yufen; Wang, Yingchun; Sun, Tong; Wang, Fangfei; Trostinskaia, Anna; Puscheck, Elizabeth; Rappolee, Daniel A

2005-05-01

Mitogen-activated protein kinase (MAPK) signaling pathways play an important role in controlling embryonic proliferation and differentiation. It has been demonstrated that sequential lipophilic signal transduction mediators that participate in the MAPK pathway are null post-implantation lethal. It is not clear why the lethality of these null mutants arises after implantation and not before. One hypothesis is that the gene product of these post-implantation lethal null mutants are not present before implantation in normal embryos and do not have function until after implantation. To test this hypothesis, we selected a set of lipophilic genes mediating MAPK signal transduction pathways whose null mutants result in early peri-implantation or placental lethality. These included FRS2alpha, GAB1, GRB2, SOS1, Raf-B, and Raf1. Products of these selected genes were detected and their locations and functions indicated by indirect immunocytochemistry and Western blotting for proteins and RT-polymerase chain reaction (PCR) for mRNA transcription. We report here that all six signal mediators are detected at the protein level in preimplantation mouse embryo, placental trophoblasts, and in cultured trophoblast stem cells (TSC). Proteins are all detected in E3.5 embryos at a time when the first known mitogenic intercellular communication has been documented. mRNA transcripts of two post-implantation null mutant genes are expressed in mouse preimplantation embryos and unfertilized eggs. These mRNA transcripts were detected as maternal mRNA in unfertilized eggs that could delay the lethality of null mutants. All of the proteins were detected in the cytoplasm or in the cell membrane. This study of spatial and temporal expression revealed that all of these six null mutants post-implantation genes in MAPK pathway are expressed and, where tested, phosphorylated/activated proteins are detected in the blastocyst. Studies on RNA expression using RT-PCR suggest that maternal RNA could play an important role in delaying the presence of the lethal phenotype of null mutations. Copyright (c) 2005 Wiley-Liss, Inc.

[Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

PubMed

Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

2016-10-02

Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic diagnosis rate of the patients with unexplained ID or DD. Combined use of these technologies can serve as a useful examinational method in assisting differential diagnosis of children with unexplained ID or DD.

Exonic deletions of AUTS2 in Chinese patients with developmental delay and intellectual disability.

PubMed

Fan, Yanjie; Qiu, Wenjuan; Wang, Lili; Gu, Xuefan; Yu, Yongguo

2016-02-01

Genomic rearrangements involving dosage change of genes have been implicated in a range of developmental disorders. Increasing evidences suggest copy number variations (CNVs) of autism susceptibility candidate gene 2 (AUTS2) are associated with a syndromic form of developmental delay and intellectual disability. However, the genetic and clinical profiles involving AUTS2 variations have not been fully characterized in Asian patients yet, and the outcome of treatments has not been reported. Here we report de novo exonic deletions of AUTS2 detected by chromosomal microarray analysis (CMA) in three Chinese children referred to the clinic for developmental delay, including two deletions involving only exon 6 (98.4 and 262 kb, respectively) and one deletion involving the C-terminal of AUTS2 (2147 kb). The phenotypic presentations of these three patients were described and compared with previous cases in literature. In addition, we presented the outcome of hormonal treatment for short stature in one patient. © 2015 Wiley Periodicals, Inc.

Genetic variation of transgenerational plasticity of offspring germination in response to salinity stress and the seed transcriptome of Medicago truncatula.

PubMed

Vu, Wendy T; Chang, Peter L; Moriuchi, Ken S; Friesen, Maren L

2015-04-01

Transgenerational plasticity provides phenotypic variation that contributes to adaptation. For plants, the timing of seed germination is critical for offspring survival in stressful environments, as germination timing can alter the environmental conditions a seedling experiences. Stored seed transcripts are important determinants of seed germination, but have not previously been linked with transgenerational plasticity of germination behavior. In this study we used RNAseq and growth chamber experiments of the model legume M. trucantula to test whether parental exposure to salinity stress influences the expression of stored seed transcripts and early offspring traits and test for genetic variation. We detected genotype-dependent parental environmental effects (transgenerational plasticity) on the expression levels of stored seed transcripts, seed size, and germination behavior of four M. truncatula genotypes. More than 50% of the transcripts detected in the mature, ungerminated seed transcriptome were annotated as regulating seed germination, some of which are involved in abiotic stress response and post-embryonic development. Some genotypes showed increased seed size in response to parental exposure to salinity stress, but no parental environmental influence on germination timing. In contrast, other genotypes showed no seed size differences across contrasting parental conditions but displayed transgenerational plasticity for germimation timing, with significantly delayed germination in saline conditions when parental plants were exposed to salinity. In genotypes that show significant transgenerational plastic germination response, we found significant coexpression networks derived from salt responsive transcripts involved in post-transcriptional regulation of the germination pathway. Consistent with the delayed germination response to saline conditions in these genotypes, we found genes associated with dormancy and up-regulation of abscisic acid (ABA). Our results demonstrate genetic variation in transgenerational plasticity within M. truncatula and show that parental exposure to salinity stress influences the expression of stored seed transcripts, seed weight, and germination behavior. Furthermore, we show that the parental environment influences gene expression to modulate biological pathways that are likely responsible for offspring germination responses to salinity stress.

Determining delayed admission to intensive care unit for mechanically ventilated patients in the emergency department.

PubMed

Hung, Shih-Chiang; Kung, Chia-Te; Hung, Chih-Wei; Liu, Ber-Ming; Liu, Jien-Wei; Chew, Ghee; Chuang, Hung-Yi; Lee, Wen-Huei; Lee, Tzu-Chi

2014-08-23

The adverse effects of delayed admission to the intensive care unit (ICU) have been recognized in previous studies. However, the definitions of delayed admission varies across studies. This study proposed a model to define "delayed admission", and explored the effect of ICU-waiting time on patients' outcome. This retrospective cohort study included non-traumatic adult patients on mechanical ventilation in the emergency department (ED), from July 2009 to June 2010. The primary outcomes measures were 21-ventilator-day mortality and prolonged hospital stays (over 30 days). Models of Cox regression and logistic regression were used for multivariate analysis. The non-delayed ICU-waiting was defined as a period in which the time effect on mortality was not statistically significant in a Cox regression model. To identify a suitable cut-off point between "delayed" and "non-delayed", subsets from the overall data were made based on ICU-waiting time and the hazard ratio of ICU-waiting hour in each subset was iteratively calculated. The cut-off time was then used to evaluate the impact of delayed ICU admission on mortality and prolonged length of hospital stay. The final analysis included 1,242 patients. The time effect on mortality emerged after 4 hours, thus we deduced ICU-waiting time in ED > 4 hours as delayed. By logistic regression analysis, delayed ICU admission affected the outcomes of 21 ventilator-days mortality and prolonged hospital stay, with odds ratio of 1.41 (95% confidence interval, 1.05 to 1.89) and 1.56 (95% confidence interval, 1.07 to 2.27) respectively. For patients on mechanical ventilation at the ED, delayed ICU admission is associated with higher probability of mortality and additional resource expenditure. A benchmark waiting time of no more than 4 hours for ICU admission is recommended.

Microlensing makes lensed quasar time delays significantly time variable

NASA Astrophysics Data System (ADS)

Tie, S. S.; Kochanek, C. S.

2018-01-01

The time delays of gravitationally lensed quasars are generally believed to be unique numbers whose measurement is limited only by the quality of the light curves and the models for the contaminating contribution of gravitational microlensing to the light curves. This belief is incorrect - gravitational microlensing also produces changes in the actual time delays on the ∼day(s) light-crossing time-scale of the emission region. This is due to a combination of the inclination of the disc relative to the line of sight and the differential magnification of the temperature fluctuations producing the variability. We demonstrate this both mathematically and with direct calculations using microlensing magnification patterns. Measuring these delay fluctuations can provide a physical scale for microlensing observations, removing the need for priors on either the microlens masses or the component velocities. That time delays in lensed quasars are themselves time variable likely explains why repeated delay measurements of individual lensed quasars appear to vary by more than their estimated uncertainties. This effect is also a new important systematic problem for attempts to use time delays in lensed quasars for cosmology or to detect substructures (satellites) in lens galaxies.

Genome-wide analysis and characterization of Aux/IAA family genes related to fruit ripening in papaya (Carica papaya L.).

PubMed

Liu, Kaidong; Yuan, Changchun; Feng, Shaoxian; Zhong, Shuting; Li, Haili; Zhong, Jundi; Shen, Chenjia; Liu, Jinxiang

2017-05-05

Auxin/indole-3-acetic acid (Aux/IAA) family genes encode short-lived nuclear proteins that mediate the responses of auxin-related genes and are involved in several plant developmental and growth processes. However, how Aux/IAA genes function in the fruit development and ripening of papaya (Carica papaya L.) is largely unknown. In this study, a comprehensive identification and a distinctive expression analysis of 18 C. papaya Aux/IAA (CpIAA) genes were performed using newly updated papaya reference genome data. The Aux/IAA gene family in papaya is slightly smaller than that in Arabidopsis, but all of the phylogenetic subfamilies are represented. Most of the CpIAA genes are responsive to various phytohormones and expressed in a tissues-specific manner. To understand the putative biological functions of the CpIAA genes involved in fruit development and ripening, quantitative real-time PCR was used to test the expression profiling of CpIAA genes at different stages. Furthermore, an IAA treatment significantly delayed the ripening process in papaya fruit at the early stages. The expression changes of CpIAA genes in ACC and 1-MCP treatments suggested a crosstalk between auxin and ethylene during the fruit ripening process of papaya. Our study provided comprehensive information on the Aux/IAA family in papaya, including gene structures, phylogenetic relationships and expression profiles. The involvement of CpIAA gene expression changes in fruit development and ripening gives us an opportunity to understand the roles of auxin signaling in the maturation of papaya reproductive organs.

Lxr-driven enterocyte lipid droplet formation delays transport of ingested lipids.

PubMed

Cruz-Garcia, Lourdes; Schlegel, Amnon

2014-09-01

Liver X receptors (Lxrs) are master regulators of cholesterol catabolism, driving the elimination of cholesterol from the periphery to the lumen of the intestine. Development of pharmacological agents to activate Lxrs has been hindered by synthetic Lxr agonists' induction of hepatic lipogenesis and hypertriglyceridemia. Elucidating the function of Lxrs in regulating enterocyte lipid handling might identify novel aspects of lipid metabolism that are pharmacologically amenable. We took a genetic approach centered on the single Lxr gene nr1h3 in zebrafish to study the role of Lxr in enterocyte lipid metabolism. Loss of nr1h3 function causes anticipated gene regulatory changes and cholesterol intolerance, collectively reflecting high evolutionary conservation of zebrafish Lxra function. Intestinal nr1h3 activation delays transport of absorbed neutral lipids, with accumulation of neutral lipids in enterocyte cytoplasmic droplets. This delay in transport of ingested neutral lipids protects animals from hypercholesterolemia and hepatic steatosis induced by a high-fat diet. On a gene regulatory level, Lxra induces expression of acsl3a, which encodes acyl-CoA synthetase long-chain family member 3a, a lipid droplet-anchored protein that directs fatty acyl chains into lipids. Forced overexpression of acls3a in enterocytes delays, in part, the appearance of neutral lipids in the vasculature of zebrafish larvae. Activation of Lxr in the intestine cell-autonomously regulates the rate of delivery of absorbed lipids by inducting a temporary lipid intestinal droplet storage depot. Copyright © 2014 by the American Society for Biochemistry and Molecular Biology, Inc.

Suppressed inflammatory gene expression during human hypertrophic scar compared to normotrophic scar formation.

PubMed

van den Broek, Lenie J; van der Veer, Willem M; de Jong, Etty H; Gibbs, Susan; Niessen, Frank B

2015-08-01

Hypertrophic scar formation is a result of adverse cutaneous wound healing. The pathogenesis of hypertrophic scar formation is still poorly understood. A problem next to the lack of suitable animal models is that often normal skin is compared to hypertrophic scar (HTscar) and not to normotrophic scar (NTscar) tissue. Another drawback is that often only one time period after wounding is studied, while scar formation is a dynamic process over a period of several months. In this study, we compared the expression of genes involved in inflammation, angiogenesis and extracellular matrix (ECM) formation and also macrophage infiltration in biopsies obtained before and up to 52 weeks after standard surgery in five patients who developed HTscar and six patients who developed NTscar. It was found that HTscar formation coincided with a prolonged decreased expression of inflammatory genes (TNFα, IL-1α, IL-1RN, CCL2, CCL3, CXCL2, CXCR2, C3 and IL-10) and an extended increased expression of ECM-related genes (PLAU, Col3A1, TGFβ3). This coincided with a delayed but prolonged infiltration of macrophages (type 2) in HTscar tissue compared to NTscar tissue. These findings were supported by immunohistochemical localization of proteins coding for select genes named above. Our study emphasizes that human cutaneous wound healing is a dynamic process that is needed to be studied over a period of time rather than a single point of time. Taken together, our results suggest innate immune stimulatory therapies may be a better option for improving scar quality than the currently used anti-inflammatory scar therapies. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Proteomics and transcriptomics of broccoli subjected to exogenously supplied and transgenic senescence-induced cytokinin for amelioration of postharvest yellowing.

PubMed

Liu, Mao-Sen; Li, Hui-Chun; Lai, Ying-Mi; Lo, Hsiao-Feng; Chen, Long-Fang O

2013-11-20

Previously, we investigated transgenic broccoli harboring senescence-associated-gene (SAG) promoter-triggered isopentenyltransferase (ipt), which encodes the key enzyme for cytokinin (CK) synthesis and mimics the action of exogenous supplied CK in delaying postharvest senescence of broccoli. Here, we used proteomics and transcriptomics to compare the mechanisms of ipt-transgenic and N(6)-benzylaminopurine (BA) CK treatment of broccoli during postharvest storage. The 2 treatments conferred common and distinct mechanisms. BA treatment decreased the quantity of proteins involved in energy and carbohydrate metabolism and amino acid metabolism, and ipt-transgenic treatment increased that of stress-related proteins and molecular chaperones and slightly affected levels of carbohydrate metabolism proteins. Both treatments regulated genes involved in CK signaling, sugar transport, energy and carbohydrate metabolism, amino acid metabolism and lipid metabolism, although ipt-transgenic treatment to a lesser extent. BA treatment induced genes encoding molecular chaperones, whereas ipt-transgenic treatment induced stress-related genes for cellular protection during storage. Both BA and ipt-transgenic treatments acted antagonistically on ethylene functions. We propose a long-term acclimation of metabolism and protection systems with ipt-transgenic treatment of broccoli and short-term modulation of metabolism and establishment of a protection system with both BA and ipt-transgenic treatments in delaying senescence of broccoli florets. Transgenic broccoli harboring senescence-associated-gene (SAG) promoter-triggered isopentenyltransferase (ipt), which encodes the key enzyme for cytokinin (CK) synthesis and N(6)-benzylaminopurine (BA) CK treated broccoli both showed retardation of postharvest senescence during storage. The mechanisms underlying the two treatments were compared. The combination of proteomic and transcriptomic evidences revealed that the 2 treatments conferred common and distinct mechanisms in delaying senescence of broccoli florets. We propose a long-term acclimation of metabolism and protection systems with ipt-transgenic treatment of broccoli and short-term modulation of metabolism and establishment of a protection system with both BA and ipt-transgenic treatments in delaying senescence of broccoli florets. This article is part of a Special Issue entitled: Translational Plant Proteomics. Copyright © 2013 Elsevier B.V. All rights reserved.

Long-time behavior for suspension bridge equations with time delay

NASA Astrophysics Data System (ADS)

Park, Sun-Hye

2018-04-01

In this paper, we consider suspension bridge equations with time delay of the form u_{tt}(x,t) + Δ ^2 u (x,t) + k u^+ (x,t) + a_0 u_t (x,t) + a_1 u_t (x, t- τ ) + f(u(x,t)) = g(x). Many researchers have studied well-posedness, decay rates of energy, and existence of attractors for suspension bridge equations without delay effects. But, as far as we know, there is no work about suspension equations with time delay. In addition, there are not many studies on attractors for other delayed systems. Thus we first provide well-posedness for suspension equations with time delay. And then show the existence of global attractors and the finite dimensionality of the attractors by establishing energy functionals which are related to the norm of the phase space to our problem.

Robust outer synchronization between two nonlinear complex networks with parametric disturbances and mixed time-varying delays

NASA Astrophysics Data System (ADS)

Zhang, Chuan; Wang, Xingyuan; Luo, Chao; Li, Junqiu; Wang, Chunpeng

2018-03-01

In this paper, we focus on the robust outer synchronization problem between two nonlinear complex networks with parametric disturbances and mixed time-varying delays. Firstly, a general complex network model is proposed. Besides the nonlinear couplings, the network model in this paper can possess parametric disturbances, internal time-varying delay, discrete time-varying delay and distributed time-varying delay. Then, according to the robust control strategy, linear matrix inequality and Lyapunov stability theory, several outer synchronization protocols are strictly derived. Simple linear matrix controllers are designed to driver the response network synchronize to the drive network. Additionally, our results can be applied on the complex networks without parametric disturbances. Finally, by utilizing the delayed Lorenz chaotic system as the dynamics of all nodes, simulation examples are given to demonstrate the effectiveness of our theoretical results.

Fixed-base simulator study of the effect of time delays in visual cues on pilot tracking performance

NASA Technical Reports Server (NTRS)

Queijo, M. J.; Riley, D. R.

1975-01-01

Factors were examined which determine the amount of time delay acceptable in the visual feedback loop in flight simulators. Acceptable time delays are defined as delays which significantly affect neither the results nor the manner in which the subject 'flies' the simulator. The subject tracked a target aircraft as it oscillated sinusoidally in a vertical plane only. The pursuing aircraft was permitted five degrees of freedom. Time delays of from 0.047 to 0.297 second were inserted in the visual feedback loop. A side task was employed to maintain the workload constant and to insure that the pilot was fully occupied during the experiment. Tracking results were obtained for 17 aircraft configurations having different longitudinal short-period characteristics. Results show a positive correlation between improved handling qualities and a longer acceptable time delay.

A comprehensive review of prehospital and in-hospital delay times in acute stroke care.

PubMed

Evenson, K R; Foraker, R E; Morris, D L; Rosamond, W D

2009-06-01

The purpose of this study was to systematically review and summarize prehospital and in-hospital stroke evaluation and treatment delay times. We identified 123 unique peer-reviewed studies published from 1981 to 2007 of prehospital and in-hospital delay time for evaluation and treatment of patients with stroke, transient ischemic attack, or stroke-like symptoms. Based on studies of 65 different population groups, the weighted Poisson regression indicated a 6.0% annual decline (P<0.001) in hours/year for prehospital delay, defined from symptom onset to emergency department arrival. For in-hospital delay, the weighted Poisson regression models indicated no meaningful changes in delay time from emergency department arrival to emergency department evaluation (3.1%, P=0.49 based on 12 population groups). There was a 10.2% annual decline in hours/year from emergency department arrival to neurology evaluation or notification (P=0.23 based on 16 population groups) and a 10.7% annual decline in hours/year for delay time from emergency department arrival to initiation of computed tomography (P=0.11 based on 23 population groups). Only one study reported on times from arrival to computed tomography scan interpretation, two studies on arrival to drug administration, and no studies on arrival to transfer to an in-patient setting, precluding generalizations. Prehospital delay continues to contribute the largest proportion of delay time. The next decade provides opportunities to establish more effective community-based interventions worldwide. It will be crucial to have effective stroke surveillance systems in place to better understand and improve both prehospital and in-hospital delays for acute stroke care.

Copy number variants analysis in a cohort of isolated and syndromic developmental delay/intellectual disability reveals novel genomic disorders, position effects and candidate disease genes.

PubMed

Di Gregorio, E; Riberi, E; Belligni, E F; Biamino, E; Spielmann, M; Ala, U; Calcia, A; Bagnasco, I; Carli, D; Gai, G; Giordano, M; Guala, A; Keller, R; Mandrile, G; Arduino, C; Maffè, A; Naretto, V G; Sirchia, F; Sorasio, L; Ungari, S; Zonta, A; Zacchetti, G; Talarico, F; Pappi, P; Cavalieri, S; Giorgio, E; Mancini, C; Ferrero, M; Brussino, A; Savin, E; Gandione, M; Pelle, A; Giachino, D F; De Marchi, M; Restagno, G; Provero, P; Cirillo Silengo, M; Grosso, E; Buxbaum, J D; Pasini, B; De Rubeis, S; Brusco, A; Ferrero, G B

2017-10-01

Array-comparative genomic hybridization (array-CGH) is a widely used technique to detect copy number variants (CNVs) associated with developmental delay/intellectual disability (DD/ID). Identification of genomic disorders in DD/ID. We performed a comprehensive array-CGH investigation of 1,015 consecutive cases with DD/ID and combined literature mining, genetic evidence, evolutionary constraint scores, and functional information in order to assess the pathogenicity of the CNVs. We identified non-benign CNVs in 29% of patients. Amongst the pathogenic variants (11%), detected with a yield consistent with the literature, we found rare genomic disorders and CNVs spanning known disease genes. We further identified and discussed 51 cases with likely pathogenic CNVs spanning novel candidate genes, including genes encoding synaptic components and/or proteins involved in corticogenesis. Additionally, we identified two deletions spanning potential Topological Associated Domain (TAD) boundaries probably affecting the regulatory landscape. We show how phenotypic and genetic analyses of array-CGH data allow unraveling complex cases, identifying rare disease genes, and revealing unexpected position effects. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Resveratrol regulates gene transcription via activation of stimulus-responsive transcription factors.

PubMed

Thiel, Gerald; Rössler, Oliver G

2017-03-01

Resveratrol (trans-3,4',5-trihydroxystilbene), a polyphenolic phytoalexin of grapes and other fruits and plants, is a common constituent of our diet and of dietary supplements. Many health-promoting benefits have been connected with resveratrol in the treatment of cardiovascular diseases, cancer, diabetes, inflammation, neurodegeneration, and diseases connected with aging. To explain the pleiotropic effects of resveratrol, the molecular targets of this compound have to be identified on the cellular level. Resveratrol induces intracellular signal transduction pathways which ultimately lead to changes in the gene expression pattern of the cells. Here, we review the effect of resveratrol on the activation of the stimulus-responsive transcription factors CREB, AP-1, Egr-1, Elk-1, and Nrf2. Following activation, these transcription factors induce transcription of delayed response genes. The gene products of these delayed response genes are ultimately responsible for the changes in the biochemistry and physiology of resveratrol-treated cells. The activation of stimulus-responsive transcription factors may explain many of the intracellular activities of resveratrol. However, results obtained in vitro may not easily be transferred to in vivo systems. Copyright © 2016 Elsevier Ltd. All rights reserved.

UVB Radiation Delays Tribolium castaneum Metamorphosis by Influencing Ecdysteroid Metabolism.

PubMed

Sang, Wen; Yu, Lin; He, Li; Ma, Wei-Hua; Zhu, Zhi-Hui; Zhu, Fen; Wang, Xiao-Ping; Lei, Chao-Liang

2016-01-01

Ultraviolet B (UVB) radiation is an important environmental factor. It is generally known that UVB exhibits high genotoxicity due to causing DNA damage, potentially leading to skin carcinogenesis and aging in mammals. However, little is known about the effects of UVB on the development and metamorphosis of insects, which are the most abundant terrestrial animals. In the present study, we performed dose-response analyses of the effects UVB irradiation on Tribolium castaneum metamorphosis, assessed the function of the T. castaneum prothoracicotropic hormone gene (Trcptth), and analyzed ecdysteroid pathway gene expression profile and ecdysterone titers post-UVB irradiation. The results showed that UVB not only caused death of T. castaneum larvae, but also delayed larval-pupal metamorphosis and reduced the size and emergence rate of pupae. In addition, we verified the function of Trcptth, which is responsible for regulating metamorphosis. It was also found that the expression profiles of Trcptth as well as ecdysteroidogenesis and response genes were influenced by UVB radiation. Therefore, a disturbance pulse of ecdysteroid may be involved in delaying development under exposure to irradiation. To our knowledge, this is the first report indicating that UVB can influence the metamorphosis of insects. This study will contribute to a better understanding of the impact of UVB on signaling mechanisms in insect metamorphosis.

The heterochronic gene Lin28 regulates amphibian metamorphosis through disturbance of thyroid hormone function.

PubMed

Faunes, Fernando; Gundermann, Daniel G; Muñoz, Rosana; Bruno, Renzo; Larraín, Juan

2017-05-15

Metamorphosis is a classic example of developmental transition, which involves important morphological and physiological changes that prepare the organism for the adult life. It has been very well established that amphibian metamorphosis is mainly controlled by Thyroid Hormone (TH). Here, we show that the heterochronic gene Lin28 is downregulated during Xenopus laevis metamorphosis. Lin28 overexpression before activation of TH signaling delays metamorphosis and inhibits the expression of TH target genes. The delay in metamorphosis is rescued by incubation with exogenous TH, indicating that Lin28 works upstream or parallel to TH. High-throughput analyses performed before any delay on metamorphosis or change in TH signaling showed that overexpression of Lin28 reduces transcript levels of several hormones secreted by the pituitary, including the Thyroid-Stimulating Hormone (TSH), and regulates the expression of proteins involved in TH transport, metabolism and signaling, showing that Lin28 disrupts TH function at different levels. Our data demonstrates that the role of Lin28 in controlling developmental transitions is evolutionary conserved and establishes a functional interaction between Lin28 and thyroid hormone function introducing a new regulatory step in perinatal development with implications for our understanding of endocrine disorders. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Mutations in the human SC4MOL gene encoding a methyl sterol oxidase cause psoriasiform dermatitis, microcephaly, and developmental delay

PubMed Central

He, Miao; Kratz, Lisa E.; Michel, Joshua J.; Vallejo, Abbe N.; Ferris, Laura; Kelley, Richard I.; Hoover, Jacqueline J.; Jukic, Drazen; Gibson, K. Michael; Wolfe, Lynne A.; Ramachandran, Dhanya; Zwick, Michael E.; Vockley, Jerry

2011-01-01

Defects in cholesterol synthesis result in a wide variety of symptoms, from neonatal lethality to the relatively mild dysmorphic features and developmental delay found in individuals with Smith-Lemli-Opitz syndrome. We report here the identification of mutations in sterol-C4-methyl oxidase–like gene (SC4MOL) as the cause of an autosomal recessive syndrome in a human patient with psoriasiform dermatitis, arthralgias, congenital cataracts, microcephaly, and developmental delay. This gene encodes a sterol-C4-methyl oxidase (SMO), which catalyzes demethylation of C4-methylsterols in the cholesterol synthesis pathway. C4-Methylsterols are meiosis-activating sterols (MASs). They exist at high concentrations in the testis and ovary and play roles in meiosis activation. In this study, we found that an accumulation of MASs in the patient led to cell overproliferation in both skin and blood. SMO deficiency also substantially altered immunocyte phenotype and in vitro function. MASs serve as ligands for liver X receptors α and β (LXRα and LXRβ), which are important in regulating not only lipid transport in the epidermis, but also innate and adaptive immunity. Deficiency of SMO represents a biochemical defect in the cholesterol synthesis pathway, the clinical spectrum of which remains to be defined. PMID:21285510

Effects of time delay and pitch control sensitivity in the flared landing

NASA Technical Reports Server (NTRS)

Berthe, C. J.; Chalk, C. R.; Wingarten, N. C.; Grantham, W.

1986-01-01

Between December 1985 and January 1986, a flared landing program was conducted, using the USAF Total In-Flight simulator airplane, to examine time delay effects in a formal manner. Results show that as pitch sensitivity is increased, tolerance to time delay decreases. With the proper selection of pitch sensitivity, Level I performance was maintained with time delays ranging from 150 milliseconds to greater than 300 milliseconds. With higher sensitivity, configurations with Level I performance at 150 milliseconds degraded to level 2 at 200 milliseconds. When metrics of time delay and pitch sensitivity effects are applied to enhance previously developed predictive criteria, the result is an improved prediction technique which accounts for significant closed loop items.

Exact synchronization bound for coupled time-delay systems.

PubMed

Senthilkumar, D V; Pesquera, Luis; Banerjee, Santo; Ortín, Silvia; Kurths, J

2013-04-01

We obtain an exact bound for synchronization in coupled time-delay systems using the generalized Halanay inequality for the general case of time-dependent delay, coupling, and coefficients. Furthermore, we show that the same analysis is applicable to both uni- and bidirectionally coupled time-delay systems with an appropriate evolution equation for their synchronization manifold, which can also be defined for different types of synchronization. The exact synchronization bound assures an exponential stabilization of the synchronization manifold which is crucial for applications. The analytical synchronization bound is independent of the nature of the modulation and can be applied to any time-delay system satisfying a Lipschitz condition. The analytical results are corroborated numerically using the Ikeda system.

Time delay induced different synchronization patterns in repulsively coupled chaotic oscillators

NASA Astrophysics Data System (ADS)

Yao, Chenggui; Yi, Ming; Shuai, Jianwei

2013-09-01

Time delayed coupling plays a crucial role in determining the system's dynamics. We here report that the time delay induces transition from the asynchronous state to the complete synchronization (CS) state in the repulsively coupled chaotic oscillators. In particular, by changing the coupling strength or time delay, various types of synchronous patterns, including CS, antiphase CS, antiphase synchronization (ANS), and phase synchronization, can be generated. In the transition regions between different synchronous patterns, bistable synchronous oscillators can be observed. Furthermore, we show that the time-delay-induced phase flip bifurcation is of key importance for the emergence of CS. All these findings may light on our understanding of neuronal synchronization and information processing in the brain.

Stability analysis of fractional-order Hopfield neural networks with time delays.

PubMed

Wang, Hu; Yu, Yongguang; Wen, Guoguang

2014-07-01

This paper investigates the stability for fractional-order Hopfield neural networks with time delays. Firstly, the fractional-order Hopfield neural networks with hub structure and time delays are studied. Some sufficient conditions for stability of the systems are obtained. Next, two fractional-order Hopfield neural networks with different ring structures and time delays are developed. By studying the developed neural networks, the corresponding sufficient conditions for stability of the systems are also derived. It is shown that the stability conditions are independent of time delays. Finally, numerical simulations are given to illustrate the effectiveness of the theoretical results obtained in this paper. Copyright © 2014 Elsevier Ltd. All rights reserved.

Influence of coal particles on ignition delay times of methane-air mixture

NASA Astrophysics Data System (ADS)

Fedorov, A. V.; Tropin, D. A.

2018-03-01

The results of numerical investigation of the ignition of a stoichiometric methane-air mixture in the presence of carbon particles with diameters of 20-52 μm in the temperature range 950-1150 K and pressures of 1.5-2.0 MPa are presented. The calculated data of the ignition delay times of coal particles in the coal particles/air mixture and of the ignition delay times of methane and coal particles in the methane/coal particles /air mixture are compared with the experimental ones. A satisfactory agreement of the data on the coal particles ignition delay times and methane ignition delay times in all the mixtures considered is shown.

Genetic factors responsible for long bone fractures non-union.

PubMed

Szczęsny, Grzegorz; Olszewski, Waldemar L; Zagozda, Małgorzata; Rutkowska, Joanna; Czapnik, Zanetta; Swoboda-Kopeć, Ewa; Górecki, Andrzej

2011-02-01

Approximately 10-15% of all fractures of long bones heal with delay, prolonged immobilization and repetitive operative interventions. Despite intense investigations, the pathomechanism of impaired healing of skeletal tissue remains unclear. An important role in the pathomechanism of mal-union of close fractures plays subclinically proceeding infections. The question arises whether colonization and proliferation of bacteria in the fracture gap could be related to the mutation of genes for factors regulating local antimicrobial response, such as pathogen recognizing receptors (PRR), cytokines and chemokines. We carried out studies in patients with delayed long bone fractures estimating the frequency of mutation of genes crucial for pathogen recognition (TLR2, TLR4 and CD14), and elimination (CRP, IL-6, IL-1ra), as well as wound healing (TGF-β). The molecular milieu regulating healing process (IGF-1, COLL1a, TGF-β, BMP-2, and PDGF) was validated by Western blot analysis of the gap tissue. Microbiological investigations showed the presence of viable bacterial strains in 34 out of 108 gaps in patients with non-healing fractures (31.5%) and in 20 out of 122 patients with uneventful healing (16.4%) (P < 0.05). The occurrence of mutated TLR4 1/W but not 2/W gene was significantly higher (P < 0.05) in the non-healing infected than sterile group. In the non-healing infected group 1/W mutated gene frequency was also higher than in healing infected. In the TGF-β codon 10 a significantly higher frequency of mutated homozygote T and heterozygote C/T in the non-healing infected versus non-healing sterile subgroup was observed (P < 0.05). Similar difference was observed in the non-healing infected versus healing infected subgroup (P < 0.05). The CRP (G1059C), IL1ra (genotype 2/2), IL-6 (G176C), CD14 (G-159T), TLR2 (G2259A) and TLR4/2 (Thr399Ile) polymorphisms did not play evident role in the delay of fracture healing. Individuals bearing the mutant TLR 4 gene 1/W (Asp299Gly) and TGF-β gene codon 10 mutant T and T/C allele may predispose to impaired pathogen recognition and elimination, leading to prolonged pathogen existence in the fracture gaps and healing delays.

Stochastic parameter estimation in nonlinear time-delayed vibratory systems with distributed delay

NASA Astrophysics Data System (ADS)

Torkamani, Shahab; Butcher, Eric A.

2013-07-01

The stochastic estimation of parameters and states in linear and nonlinear time-delayed vibratory systems with distributed delay is explored. The approach consists of first employing a continuous time approximation to approximate the delayed integro-differential system with a large set of ordinary differential equations having stochastic excitations. Then the problem of state and parameter estimation in the resulting stochastic ordinary differential system is represented as an optimal filtering problem using a state augmentation technique. By adapting the extended Kalman-Bucy filter to the augmented filtering problem, the unknown parameters of the time-delayed system are estimated from noise-corrupted, possibly incomplete measurements of the states. Similarly, the upper bound of the distributed delay can also be estimated by the proposed technique. As an illustrative example to a practical problem in vibrations, the parameter, delay upper bound, and state estimation from noise-corrupted measurements in a distributed force model widely used for modeling machine tool vibrations in the turning operation is investigated.

Optical resonators for true-time-delay beam steering

NASA Astrophysics Data System (ADS)

Gesell, Leslie H.; Evanko, Stephen M.

1996-06-01

Conventional true time delay beamforming and steering devices rely on switching between various lengths of delay line. Therefore only discrete delays are possible. Proposed is a new photonics concept for true time delay beamforming which provides a finely controlled continuum of delays with switching speeds on the order of 10's of nanoseconds or faster. The architecture uses an array of waveguide cavities with different resonate frequencies to channelize the signal. Each spectral component of the signal is phase shifted by an amount proportional to the frequency of that component and the desired time delay. These phase shifted spectral components are then summed to obtain the delayed signal. This paper provides an overview of the results of a Phase I SBIR contract where this concept has been refined and analyzed. The parameters for an operational system are determined and indication of the feasibility of this approach is given. Among the issues addressed are the requirements of the resonators and the methods necessary to implement fiber optic Bragg gratings as these resonators.

Variation of heat shock protein gene expression in the brain of cold-induced pulmonary hypertensive chickens.

PubMed

Hassanpour, H; Khosravi Alekoohi, Z; Madreseh, S; Bahadoran, S; Nasiri, L

2016-10-01

Quantitative real-time PCR was carried out to evaluate gene expression of heat shock proteins (HSP) (HSP27, HSP56, HSP60, HSP70, HSP90 and ubiquitin) in the brain (hindbrain, midbrain, forebrain) of chickens with cold-induced pulmonary hypertension. The ratio of the right ventricle to the total ventricle (index of pulmonary hypertension in chickens) was increased in the cold-induced pulmonary hypertensive chickens at 42 d of age compared with control. The HSP genes were expressed in the three parts of the brain in the two experimental groups. In the hindbrain of cold-induced pulmonary hypertensive chickens, the relative gene expression of HSP27, HSP60, HSP70 and HSP90 was decreased while gene expression of HSP56 and ubiquitin was increased compared with controls. In the midbrain of cold induced-pulmonary hypertensive chickens, the expression of HSP56, HSP60, HSP70 and ubiquitin genes was increased compared with controls while HSP27 and HSP90 were decreased. In the forebrain of cold induced-pulmonary hypertensive chickens, the expression of HSP56, HSP60, HSP70 and ubiquitin genes was increased while the expression of the HSP27 gene was decreased compared with controls. It is concluded that overexpression of HSPs in the forebrain and midbrain probably delays the pathological process of cold stress whereas diminished expression of HSP genes in the hindbrain may affect the normal function of brain centres in this area to exacerbate pulmonary hypertension.

Stability analysis for discrete-time stochastic memristive neural networks with both leakage and probabilistic delays.

PubMed

Liu, Hongjian; Wang, Zidong; Shen, Bo; Huang, Tingwen; Alsaadi, Fuad E

2018-06-01

This paper is concerned with the globally exponential stability problem for a class of discrete-time stochastic memristive neural networks (DSMNNs) with both leakage delays as well as probabilistic time-varying delays. For the probabilistic delays, a sequence of Bernoulli distributed random variables is utilized to determine within which intervals the time-varying delays fall at certain time instant. The sector-bounded activation function is considered in the addressed DSMNN. By taking into account the state-dependent characteristics of the network parameters and choosing an appropriate Lyapunov-Krasovskii functional, some sufficient conditions are established under which the underlying DSMNN is globally exponentially stable in the mean square. The derived conditions are made dependent on both the leakage and the probabilistic delays, and are therefore less conservative than the traditional delay-independent criteria. A simulation example is given to show the effectiveness of the proposed stability criterion. Copyright © 2018 Elsevier Ltd. All rights reserved.

[Clinical and genetic analysis for two children with congenital disturbance of glycosylation with PMM2 gene mutations].

PubMed

Ren, Changhong; Fang, Fang; Huang, Yu; Cheng, Hua; Dai, Lifang

2015-12-01

To analyze the clinical and PMM2 gene mutation features of congenital disturbance of glycosylation caused by PMM2 gene mutation (PMM2-CDG, previously known as CDG 1a). The clinical data of two Chinese patients who were clinically diagnosed as PMM2-CDG at neurology department of Beijing Children's Hospital in 2012 were retrospectively collected. The gene mutations were identified by Sanger sequencing. Both patients were female, aged 1 year and 1 month and 8 months respectively. The main clinical features of the two cases were developmental delay after birth, chronic diarrhea and metabolic acidosis, associated with elevated serum transaminases, and decreased antithrombin III activity. Physical examination showed esotropia, inverted nipples, and abnormal subcutaneous fat pads. The cranial MRI showed cerebellar atrophy. Both cases were treated with occupational therapy, physical therapy and speech therapy. The development was gradually improved but also delayed as compared with normal peers during follow-up for more than 3 years. Genetic analysis showed that patient 1 was compound heterozygous for c. 422G>A(p.Arg141His), which was reported for known pathogenic mutation, and c. 669C>A(p.Asp223Glu), was a new mutation. The patient 2 showed compound heterozygous mutation for c. 634A>G (p.Met212Val)and c. 713G>C(p.Arg238Pro), which were both new mutations. PMM2-CDG is a rare metabolic disease, and the diagnosis should be considered in a child with developmental delay, elevated serum transaminases, decreased antithrombin III activity, inverted nipples, abnormal subcutaneous fat pads, esotropia, and cerebellar atrophy on MRI. It can be confirmed by PMM2 gene analysis.

14 CFR 417.221 - Time delay analysis.

Code of Federal Regulations, 2012 CFR

2012-01-01

... occurs; (2) A flight safety official's decision and reaction time, including variation in human response... 14 Aeronautics and Space 4 2012-01-01 2012-01-01 false Time delay analysis. 417.221 Section 417... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a...

14 CFR 417.221 - Time delay analysis.

Code of Federal Regulations, 2014 CFR

2014-01-01

... occurs; (2) A flight safety official's decision and reaction time, including variation in human response... 14 Aeronautics and Space 4 2014-01-01 2014-01-01 false Time delay analysis. 417.221 Section 417... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a...

14 CFR 417.221 - Time delay analysis.

Code of Federal Regulations, 2013 CFR

2013-01-01

... occurs; (2) A flight safety official's decision and reaction time, including variation in human response... 14 Aeronautics and Space 4 2013-01-01 2013-01-01 false Time delay analysis. 417.221 Section 417... OF TRANSPORTATION LICENSING LAUNCH SAFETY Flight Safety Analysis § 417.221 Time delay analysis. (a...

Symmetry, Hopf bifurcation, and the emergence of cluster solutions in time delayed neural networks.

PubMed

Wang, Zhen; Campbell, Sue Ann

2017-11-01

We consider the networks of N identical oscillators with time delayed, global circulant coupling, modeled by a system of delay differential equations with Z N symmetry. We first study the existence of Hopf bifurcations induced by the coupling time delay and then use symmetric Hopf bifurcation theory to determine how these bifurcations lead to different patterns of symmetric cluster oscillations. We apply our results to a case study: a network of FitzHugh-Nagumo neurons with diffusive coupling. For this model, we derive the asymptotic stability, global asymptotic stability, absolute instability, and stability switches of the equilibrium point in the plane of coupling time delay (τ) and excitability parameter (a). We investigate the patterns of cluster oscillations induced by the time delay and determine the direction and stability of the bifurcating periodic orbits by employing the multiple timescales method and normal form theory. We find that in the region where stability switching occurs, the dynamics of the system can be switched from the equilibrium point to any symmetric cluster oscillation, and back to equilibrium point as the time delay is increased.

75 FR 41920 - Agency Information Collection; Activity Under OMB Review; Airline Service Quality Performance...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-19

... and analyze air traffic delays. Wheels-up and wheels-down times are used in conjunction with departure and arrival times to show the extent of ground delays. Actual elapsed flight time, wheels-down minus wheels- up time, is compared to scheduled elapsed flight time to identify airborne delays. The reporting...

High resolution digital delay timer

DOEpatents

Martin, Albert D.

1988-01-01

Method and apparatus are provided for generating an output pulse following a trigger pulse at a time delay interval preset with a resolution which is high relative to a low resolution available from supplied clock pulses. A first lumped constant delay (20) provides a first output signal (24) at predetermined interpolation intervals corresponding to the desired high resolution time interval. Latching circuits (26, 28) latch the high resolution data (24) to form a first synchronizing data set (60). A selected time interval has been preset to internal counters (142, 146, 154) and corrected for circuit propagation delay times having the same order of magnitude as the desired high resolution. Internal system clock pulses (32, 34) count down the counters to generate an internal pulse delayed by an interval which is functionally related to the preset time interval. A second LCD (184) corrects the internal signal with the high resolution time delay. A second internal pulse is then applied to a third LCD (74) to generate a second set of synchronizing data (76) which is complementary with the first set of synchronizing data (60) for presentation to logic circuits (64). The logic circuits (64) further delay the internal output signal (72) to obtain a proper phase relationship of an output signal (80) with the internal pulses (32, 34). The final delayed output signal (80) thereafter enables the output pulse generator (82) to produce the desired output pulse (84) at the preset time delay interval following input of the trigger pulse (10, 12).

Analyzing Double Delays at Newark Liberty International Airport

NASA Technical Reports Server (NTRS)

Evans, Antony D.; Lee, Paul

2016-01-01

When weather or congestion impacts the National Airspace System, multiple different Traffic Management Initiatives can be implemented, sometimes with unintended consequences. One particular inefficiency that is commonly identified is in the interaction between Ground Delay Programs (GDPs) and time based metering of internal departures, or TMA scheduling. Internal departures under TMA scheduling can take large GDP delays, followed by large TMA scheduling delays, because they cannot be easily fitted into the overhead stream. In this paper we examine the causes of these double delays through an analysis of arrival operations at Newark Liberty International Airport (EWR) from June to August 2010. Depending on how the double delay is defined between 0.3 percent and 0.8 percent of arrivals at EWR experienced double delays in this period. However, this represents between 21 percent and 62 percent of all internal departures in GDP and TMA scheduling. A deep dive into the data reveals that two causes of high internal departure scheduling delays are upstream flights making up time between their estimated departure clearance times (EDCTs) and entry into time based metering, which undermines the sequencing and spacing underlying the flight EDCTs, and high demand on TMA, when TMA airborne metering delays are high. Data mining methods (currently) including logistic regression, support vector machines and K-nearest neighbors are used to predict the occurrence of double delays and high internal departure scheduling delays with accuracies up to 0.68. So far, key indicators of double delay and high internal departure scheduling delay are TMA virtual runway queue size, and the degree to which estimated runway demand based on TMA estimated times of arrival has changed relative to the estimated runway demand based on EDCTs. However, more analysis is needed to confirm this.

Determination of Relevant Neuron–Neuron Connections for Neural Prosthetics Using Time-Delayed Mutual Information: Tutorial and Preliminary Results

PubMed Central

Taghva, Alexander; Song, Dong; Hampson, Robert E.; Deadwyler, Sam A.; Berger, Theodore W.

2013-01-01

BACKGROUND Identification of functional dependence among neurons is a necessary component in both the rational design of neural prostheses as well as in the characterization of network physiology. The objective of this article is to provide a tutorial for neurosurgeons regarding information theory, specifically time-delayed mutual information, and to compare time-delayed mutual information, an information theoretic quantity based on statistical dependence, with cross-correlation, a commonly used metric for this task in a preliminary analysis of rat hippocampal neurons. METHODS Spike trains were recorded from rats performing delayed nonmatch-to-sample task using an array of electrodes surgically implanted into the hippocampus of each hemisphere of the brain. In addition, spike train simulations of positively correlated neurons, negatively correlated neurons, and neurons correlated by nonlinear functions were generated. These were evaluated by time-delayed mutual information (MI) and cross-correlation. RESULTS Application of time-delayed MI to experimental data indicated the optimal bin size for information capture in the CA3-CA1 system was 40 ms, which may provide some insight into the spatiotemporal nature of encoding in the rat hippocampus. On simulated data, time-delayed MI showed peak values at appropriate time lags in positively correlated, negatively correlated, and complexly correlated data. Cross-correlation showed peak and troughs with positively correlated and negatively correlated data, but failed to capture some higher order correlations. CONCLUSIONS Comparison of time-delayed MI to cross-correlation in identification of functionally dependent neurons indicates that the methods are not equivalent. Time-delayed MI appeared to capture some interactions between CA3-CA1 neurons at physiologically plausible time delays missed by cross-correlation. It should be considered as a method for identification of functional dependence between neurons and may be useful in the development of neural prosthetics. PMID:22120279

Determination of relevant neuron-neuron connections for neural prosthetics using time-delayed mutual information: tutorial and preliminary results.

PubMed

Taghva, Alexander; Song, Dong; Hampson, Robert E; Deadwyler, Sam A; Berger, Theodore W

2012-12-01

Identification of functional dependence among neurons is a necessary component in both the rational design of neural prostheses as well as in the characterization of network physiology. The objective of this article is to provide a tutorial for neurosurgeons regarding information theory, specifically time-delayed mutual information, and to compare time-delayed mutual information, an information theoretic quantity based on statistical dependence, with cross-correlation, a commonly used metric for this task in a preliminary analysis of rat hippocampal neurons. Spike trains were recorded from rats performing delayed nonmatch-to-sample task using an array of electrodes surgically implanted into the hippocampus of each hemisphere of the brain. In addition, spike train simulations of positively correlated neurons, negatively correlated neurons, and neurons correlated by nonlinear functions were generated. These were evaluated by time-delayed mutual information (MI) and cross-correlation. Application of time-delayed MI to experimental data indicated the optimal bin size for information capture in the CA3-CA1 system was 40 ms, which may provide some insight into the spatiotemporal nature of encoding in the rat hippocampus. On simulated data, time-delayed MI showed peak values at appropriate time lags in positively correlated, negatively correlated, and complexly correlated data. Cross-correlation showed peak and troughs with positively correlated and negatively correlated data, but failed to capture some higher order correlations. Comparison of time-delayed MI to cross-correlation in identification of functionally dependent neurons indicates that the methods are not equivalent. Time-delayed MI appeared to capture some interactions between CA3-CA1 neurons at physiologically plausible time delays missed by cross-correlation. It should be considered as a method for identification of functional dependence between neurons and may be useful in the development of neural prosthetics. Copyright © 2012 Elsevier Inc. All rights reserved.

Reduced order modelling in searches for continuous gravitational waves - I. Barycentring time delays

NASA Astrophysics Data System (ADS)

Pitkin, M.; Doolan, S.; McMenamin, L.; Wette, K.

2018-06-01

The frequencies and phases of emission from extra-solar sources measured by Earth-bound observers are modulated by the motions of the observer with respect to the source, and through relativistic effects. These modulations depend critically on the source's sky-location. Precise knowledge of the modulations are required to coherently track the source's phase over long observations, for example, in pulsar timing, or searches for continuous gravitational waves. The modulations can be modelled as sky-location and time-dependent time delays that convert arrival times at the observer to the inertial frame of the source, which can often be the Solar system barycentre. We study the use of reduced order modelling for speeding up the calculation of this time delay for any sky-location. We find that the time delay model can be decomposed into just four basis vectors, and with these the delay for any sky-location can be reconstructed to sub-nanosecond accuracy. When compared to standard routines for time delay calculation in gravitational wave searches, using the reduced basis can lead to speed-ups of 30 times. We have also studied components of time delays for sources in binary systems. Assuming eccentricities <0.25, we can reconstruct the delays to within 100 s of nanoseconds, with best case speed-ups of a factor of 10, or factors of two when interpolating the basis for different orbital periods or time stamps. In long-duration phase-coherent searches for sources with sky-position uncertainties, or binary parameter uncertainties, these speed-ups could allow enhancements in their scopes without large additional computational burdens.

Principles of cell-free genetic circuit assembly.

PubMed

Noireaux, Vincent; Bar-Ziv, Roy; Libchaber, Albert

2003-10-28

Cell-free genetic circuit elements were constructed in a transcription-translation extract. We engineered transcriptional activation and repression cascades, in which the protein product of each stage is the input required to drive or block the following stage. Although we can find regions of linear response for single stages, cascading to subsequent stages requires working in nonlinear regimes. Substantial time delays and dramatic decreases in output production are incurred with each additional stage because of a bottleneck at the translation machinery. Faster turnover of RNA message can relieve competition between genes and stabilize output against variations in input and parameters.

Suppression of the vacuolar invertase gene delays senescent sweetening in chipping potatoes.

PubMed

Wiberley-Bradford, Amy E; Bethke, Paul C

2018-01-01

Potato chip processors require potato tubers that meet quality specifications for fried chip color, and color depends largely upon tuber sugar contents. At later times in storage, potatoes accumulate sucrose, glucose, and fructose. This developmental process, senescent sweetening, manifests as a blush of color near the center of the fried chip, becomes more severe with time, and limits the storage period. Vacuolar invertase (VInv) converts sucrose to glucose and fructose and is hypothesized to play a role in senescent sweetening. To test this hypothesis, senescent sweetening was quantified in multiple lines of potato with reduced VInv expression. Chip darkening from senescent sweetening was delayed by about 4 weeks for tubers with reduced VInv expression. A strong positive correlation between frequency of dark chips and tuber hexose content was observed. Tubers with reduced VInv expression had lower hexose to sucrose ratios than controls. VInv activity contributes to reducing sugar accumulation during senescent sweetening. Sucrose breakdown during frying may contribute to chip darkening. Suppressing VInv expression increases the storage period of the chipping potato crop, which is an important consideration, as potatoes with reduced VInv expression are entering commercial production in the USA. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Longitudinal Outcomes of Start Time Delay on Sleep, Behavior, and Achievement in High School

PubMed Central

Thacher, Pamela V.; Onyper, Serge V.

2016-01-01

Study Objectives: To establish whether sleep, health, mood, behavior, and academics improved after a 45-minute delay in high school start time, and whether changes persisted longitudinally. Methods: We collected data from school records and student self-report across a number of domains at baseline (May 2012) and at two follow-up time points (November 2012 and May 2013), at a public high school in upstate New York. Students enrolled during academic years (AY) 2011–2012 and 2012–2013 completed the Pittsburgh Sleep Quality Index; the DASS-21; the “Owl-Lark” Scale; the Daytime Sleepiness Index; and a brief self-report of health. Reports from school records regarding attendance, tardiness, disciplinary violations, and academic performance were collected for AY 2010–2011 through 2013–2014. Results: Students delayed but did not extend their sleep period; we found lasting improvements in tardiness and disciplinary violations after the start-time delay, but no changes to other variables. At the first follow-up, students reported 20 minutes longer sleep, driven by later rise times and stable bed times. At the second follow-up, students maintained later rise times but delayed bedtimes, returning total sleep to baseline levels. A delay in rise time, paralleling the delay in the start time that occurred, resulted in less tardiness and decreased disciplinary incidents, but larger improvements to sleep patterns may be necessary to affect health, attendance, sleepiness, and academic performance. Conclusions: Later start times improved tardiness and disciplinary issues at this school district. A delay in start time may be a necessary but not sufficient means to increase sleep time and may depend on preexisting individual differences. Commentary: A commentary on this article appears in this issue on page 267. Citation: Thacher PV, Onyper SV. Longitudinal outcomes of start time delay on sleep, behavior, and achievement in high school. SLEEP 2016;39(2):271–281. PMID:26446106

Stability and Bifurcation Analysis in a Maglev System with Multiple Delays

NASA Astrophysics Data System (ADS)

Zhang, Lingling; Huang, Jianhua; Huang, Lihong; Zhang, Zhizhou

This paper considers the time-delayed feedback control for Maglev system with two discrete time delays. We determine constraints on the feedback time delays which ensure the stability of the Maglev system. An algorithm is developed for drawing a two-parametric bifurcation diagram with respect to two delays τ1 and τ2. Direction and stability of periodic solutions are also determined using the normal form method and center manifold theory by Hassard. The complex dynamical behavior of the Maglev system near the domain of stability is confirmed by exhaustive numerical simulation.

PRECISION TIME-DELAY CIRCUIT

DOEpatents

Creveling, R.

1959-03-17

A tine-delay circuit which produces a delay time in d. The circuit a capacitor, an te back resistance, connected serially with the anode of the diode going to ground. At the start of the time delay a negative stepfunction is applied to the series circuit and initiates a half-cycle transient oscillatory voltage terminated by a transient oscillatory voltage of substantially higher frequency. The output of the delay circuit is taken at the junction of the inductor and diode where a sudden voltage rise appears after the initiation of the higher frequency transient oscillations.

Academic delay of gratification, self-efficacy, and time management among academically unprepared college students.

PubMed

Bembenutty, Héfer

2009-04-01

This study examined the associations between academic delay of gratification, self-efficacy beliefs, and time management among academically unprepared college students participating in a summer-immersion program. This study also examined whether the relation of self-efficacy with time management is mediated by academic delay of gratification. Analysis indicated that self-efficacy was directly associated with time management, as delay of gratification served to mediate this effect partially. Self-efficacy emerged as the strongest positive predictor of academic achievement.

Time delay in atomic photoionization with circularly polarized light

NASA Astrophysics Data System (ADS)

Ivanov, I. A.; Kheifets, A. S.

2013-03-01

We study time delay in atomic photoionization by circularly polarized light. By considering the Li atom in an excited 2p state, we demonstrate a strong time-delay asymmetry between the photoemission of the target electrons that are co- and counter-rotating with the electromagnetic field in the polarization plane. In addition, we observe the time-delay sensitivity to the polar angle of the photoelectron emission in the polarization plane. This modulation depends on the shape and duration of the electromagnetic pulse.

Generating chaos for discrete time-delayed systems via impulsive control.

PubMed

Guan, Zhi-Hong; Liu, Na

2010-03-01

Generating chaos for a class of discrete time-delayed systems via impulsive control is investigated in this paper. With the augmented matrix method, the time-delay impulsive systems can be transformed into a new class of linear discrete impulsive systems. Based on the largest Lyapunov exponent and the boundedness of the systems, some theoretical results about the chaotification for the discrete impulsive systems with time delay are derived and an example is given to visualize the satisfactory control performance.

Insensitivity of synchronization to network structure in chaotic pendulum systems with time-delay coupling.

PubMed

Yao, Chenggui; Zhan, Meng; Shuai, Jianwei; Ma, Jun; Kurths, Jürgen

2017-12-01

It has been generally believed that both time delay and network structure could play a crucial role in determining collective dynamical behaviors in complex systems. In this work, we study the influence of coupling strength, time delay, and network topology on synchronization behavior in delay-coupled networks of chaotic pendulums. Interestingly, we find that the threshold value of the coupling strength for complete synchronization in such networks strongly depends on the time delay in the coupling, but appears to be insensitive to the network structure. This lack of sensitivity was numerically tested in several typical regular networks, such as different locally and globally coupled ones as well as in several complex networks, such as small-world and scale-free networks. Furthermore, we find that the emergence of a synchronous periodic state induced by time delay is of key importance for the complete synchronization.

Determining collective barrier operation skew in a parallel computer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Faraj, Daniel A.

2015-11-24

Determining collective barrier operation skew in a parallel computer that includes a number of compute nodes organized into an operational group includes: for each of the nodes until each node has been selected as a delayed node: selecting one of the nodes as a delayed node; entering, by each node other than the delayed node, a collective barrier operation; entering, after a delay by the delayed node, the collective barrier operation; receiving an exit signal from a root of the collective barrier operation; and measuring, for the delayed node, a barrier completion time. The barrier operation skew is calculated by:more » identifying, from the compute nodes' barrier completion times, a maximum barrier completion time and a minimum barrier completion time and calculating the barrier operation skew as the difference of the maximum and the minimum barrier completion time.« less

Effects of time delays on stability and Hopf bifurcation in a fractional ring-structured network with arbitrary neurons

NASA Astrophysics Data System (ADS)

Huang, Chengdai; Cao, Jinde; Xiao, Min; Alsaedi, Ahmed; Hayat, Tasawar

2018-04-01

This paper is comprehensively concerned with the dynamics of a class of high-dimension fractional ring-structured neural networks with multiple time delays. Based on the associated characteristic equation, the sum of time delays is regarded as the bifurcation parameter, and some explicit conditions for describing delay-dependent stability and emergence of Hopf bifurcation of such networks are derived. It reveals that the stability and bifurcation heavily relies on the sum of time delays for the proposed networks, and the stability performance of such networks can be markedly improved by selecting carefully the sum of time delays. Moreover, it is further displayed that both the order and the number of neurons can extremely influence the stability and bifurcation of such networks. The obtained criteria enormously generalize and improve the existing work. Finally, numerical examples are presented to verify the efficiency of the theoretical results.

Determining collective barrier operation skew in a parallel computer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Faraj, Daniel A.

Determining collective barrier operation skew in a parallel computer that includes a number of compute nodes organized into an operational group includes: for each of the nodes until each node has been selected as a delayed node: selecting one of the nodes as a delayed node; entering, by each node other than the delayed node, a collective barrier operation; entering, after a delay by the delayed node, the collective barrier operation; receiving an exit signal from a root of the collective barrier operation; and measuring, for the delayed node, a barrier completion time. The barrier operation skew is calculated by:more » identifying, from the compute nodes' barrier completion times, a maximum barrier completion time and a minimum barrier completion time and calculating the barrier operation skew as the difference of the maximum and the minimum barrier completion time.« less

Delay-dependent coupling for a multi-agent LTI consensus system with inter-agent delays

NASA Astrophysics Data System (ADS)

Qiao, Wei; Sipahi, Rifat

2014-01-01

Delay-dependent coupling (DDC) is considered in this paper in a broadly studied linear time-invariant multi-agent consensus system in which agents communicate with each other under homogeneous delays, while attempting to reach consensus. The coupling among the agents is designed here as an explicit parameter of this delay, allowing couplings to autonomously adapt based on the delay value, and in order to guarantee stability and a certain degree of robustness in the network despite the destabilizing effect of delay. Design procedures, analysis of convergence speed of consensus, comprehensive numerical studies for the case of time-varying delay, and limitations are presented.

Delay correlation analysis and representation for vital complaint VHDL models

DOEpatents

Rich, Marvin J.; Misra, Ashutosh

2004-11-09

A method and system unbind a rise/fall tuple of a VHDL generic variable and create rise time and fall time generics of each generic variable that are independent of each other. Then, according to a predetermined correlation policy, the method and system collect delay values in a VHDL standard delay file, sort the delay values, remove duplicate delay values, group the delay values into correlation sets, and output an analysis file. The correlation policy may include collecting all generic variables in a VHDL standard delay file, selecting each generic variable, and performing reductions on the set of delay values associated with each selected generic variable.

Pneumatic shutoff and time-delay valve operates at controlled rate

NASA Technical Reports Server (NTRS)

Horning, J. L.; Tomlinson, L. E.

1966-01-01

Shutoff and time delay valve, which incorporates a metering spool that moves at constant velocity under pneumatic pressure and spring compression, increases fluid-flow area at a uniform rate. Diaphragm areas, control cavity volume, and bleed-orifice size may be varied to give any desired combination of time delay and spool travel time.

The phantom robot - Predictive displays for teleoperation with time delay

NASA Technical Reports Server (NTRS)

Bejczy, Antal K.; Kim, Won S.; Venema, Steven C.

1990-01-01

An enhanced teleoperation technique for time-delayed bilateral teleoperator control is discussed. The control technique selected for time delay is based on the use of a high-fidelity graphics phantom robot that is being controlled in real time (without time delay) against the static task image. Thus, the motion of the phantom robot image on the monitor predicts the motion of the real robot. The real robot's motion will follow the phantom robot's motion on the monitor with the communication time delay implied in the task. Real-time high-fidelity graphics simulation of a PUMA arm is generated and overlaid on the actual camera view of the arm. A simple camera calibration technique is used for calibrated graphics overlay. A preliminary experiment is performed with the predictive display by using a very simple tapping task. The results with this simple task indicate that predictive display enhances the human operator's telemanipulation task performance significantly during free motion when there is a long time delay. It appears, however, that either two-view or stereoscopic predictive displays are necessary for general three-dimensional tasks.

Detection and characterization of Budd-Chiari syndrome with inferior vena cava obstruction: Comparison of fixed and flexible delayed scan time of computed tomography venography.

PubMed

Zhou, Peng-Li; Wu, Gang; Han, Xin-Wei; Bi, Yong-Hua; Zhang, Wen-Guang; Wu, Zheng-Yang

2017-06-01

To compare the results of computed tomography venography (CTV) with a fixed and a flexible delayed scan time for Budd-Chiari syndrome (BCS) with inferior vena cava (IVC) obstruction. A total of 209 consecutive BCS patients with IVC obstruction underwent either a CTV with a fixed delayed scan time of 180s (n=87) or a flexible delayed scan time for good image quality according to IVC blood flow in color Doppler ultrasonography (n=122). The IVC blood flow velocity was measured using a color Doppler ultrasound prior to CT scan. Image quality was classified as either good, moderate, or poor. Image quality, surrounding structures and the morphology of the IVC obstruction were compared between the two groups using a χ 2 -test or paired or unpaired t-tests as appropriate. Inter-observer agreement was assessed using Kappa statistics. There was no significant difference in IVC blood flow velocity between the two groups. Overall image quality, surrounding structures and IVC obstruction morphology delineation on the flexible delayed scan time of CTV images were rated better relative to those obtained by fixed delayed scan time of CTV images (p<0.001). Evaluation of CTV data sets was significantly facilitated with flexible delayed scan time of CTV. There were no significant differences in Kappa statistics between Group A and Group B. The flexible delayed scan time of CTV was associated with better detection and more reliable characterization of BCS with IVC obstruction compared to a fixed delayed scan time. Copyright © 2017 Elsevier B.V. All rights reserved.

Impact of geographic distance on appraisal delay for active TB treatment seeking in Uganda: a network analysis of the Kawempe Community Health Cohort Study.

PubMed

Fluegge, Kyle; Malone, LaShaunda L; Nsereko, Mary; Okware, Brenda; Wejse, Christian; Kisingo, Hussein; Mupere, Ezekiel; Boom, W Henry; Stein, Catherine M

2018-06-26

Appraisal delay is the time a patient takes to consider a symptom as not only noticeable, but a sign of illness. The study's objective was to determine the association between appraisal delay in seeking tuberculosis (TB) treatment and geographic distance measured by network travel (driving and pedestrian) time (in minutes) and distance (Euclidean and self-reported) (in kilometers) and to identify other risk factors from selected covariates and how they modify the core association between delay and distance. This was part of a longitudinal cohort study known as the Kawempe Community Health Study based in Kampala, Uganda. The study enrolled households from April 2002 to July 2012. Multivariable interval regression with multiplicative heteroscedasticity was used to assess the impact of time and distance on delay. The delay interval outcome was defined using a comprehensive set of 28 possible self-reported symptoms. The main independent variables were network travel time (in minutes) and Euclidean distance (in kilometers). Other covariates were organized according to the Andersen utilization conceptual framework. A total of 838 patients with both distance and delay data were included in the network analysis. Bivariate analyses did not reveal a significant association of any distance metric with the delay outcome. However, adjusting for patient characteristics and cavitary disease status, the multivariable model indicated that each minute of driving time to the clinic significantly (p = 0.02) and positively predicted 0.25 days' delay. At the median distance value of 47 min, this represented an additional delay of about 12 (95% CI: [3, 21]) days to the mean of 40 days (95% CI: [25, 56]). Increasing Euclidean distance significantly predicted (p = 0.02) reduced variance in the delay outcome, thereby increasing precision of the mean delay estimate. At the median Euclidean distance of 2.8 km, the variance in the delay was reduced by more than 25%. Of the four geographic distance measures, network travel driving time was a better and more robust predictor of mean delay in this setting. Including network travel driving time with other risk factors may be important in identifying populations especially vulnerable to delay.

Operating room efficiency improvement after implementation of a postoperative team assessment.

PubMed

Porta, Christopher R; Foster, Andrew; Causey, Marlin W; Cordier, Patricia; Ozbirn, Roger; Bolt, Stephen; Allison, Dennis; Rush, Robert

2013-03-01

Operating room time is highly resource intensive, and delays can be a source of lost revenue and surgeon frustration. Methods to decrease these delays are important not only for patient care, but to maximize operating room resource utilization. The purpose of this study was to determine the root cause of operating room delays in a standardized manner to help improve overall operating room efficiency. We performed a single-center prospective observational study analyzing operating room utilization and efficiency after implementing an executive-driven standardized postoperative team debriefing system from January 2010 to December 2010. A total of 11,342 procedures were performed over the 1-y study period (elective 86%, urgent 11%, and emergent 3%), with 1.3 million min of operating room time, 865,864 min of surgeon operative time (62.5%), and 162,958 min of anesthesia time (11.8%). Overall, the average operating room delay was 18 min and varied greatly based on the surgical specialty. The longest delays were due to need for radiology (40 min); other significant delays were due to supply issues (22.7 min), surgeon issues (18 min), nursing issues (14 min), and room turnover (14 min). Over the 1-y period, there was a decrease in mean delay duration, averaging a decrease in delay of 0.147 min/mo with an overall 9% decrease in the mean delay times. With regard to overall operating room utilization, there was a 39% decrease in overall un-utilized available OR time that was due to delays, improving efficiency by 2334 min (212 min/mo). During this study interval no sentinel events occurred in the operating room. A standardized postoperative debrief tracking system is highly beneficial in identifying and reducing overall operative delays and improving operating room utilization. Published by Elsevier Inc.

Time-delayed directional beam phased array antenna

DOEpatents

Fund, Douglas Eugene; Cable, John William; Cecil, Tony Myron

2004-10-19

An antenna comprising a phased array of quadrifilar helix or other multifilar antenna elements and a time-delaying feed network adapted to feed the elements. The feed network can employ a plurality of coaxial cables that physically bridge a microstrip feed circuitry to feed power signals to the elements. The cables provide an incremental time delay which is related to their physical lengths, such that replacing cables having a first set of lengths with cables having a second set of lengths functions to change the time delay and shift or steer the antenna's main beam. Alternatively, the coaxial cables may be replaced with a programmable signal processor unit adapted to introduce the time delay using signal processing techniques applied to the power signals.

Genomic evidence reveals a radiation of placental mammals uninterrupted by the KPg boundary

PubMed Central

Liu, Liang; Zhang, Jin; Rheindt, Frank E.; Lei, Fumin; Qu, Yanhua; Wang, Yu; Zhang, Yu; Sullivan, Corwin; Nie, Wenhui; Wang, Jinhuan; Yang, Fengtang; Chen, Jinping; Edwards, Scott V.; Meng, Jin; Wu, Shaoyuan

2017-01-01

The timing of the diversification of placental mammals relative to the Cretaceous–Paleogene (KPg) boundary mass extinction remains highly controversial. In particular, there have been seemingly irreconcilable differences in the dating of the early placental radiation not only between fossil-based and molecular datasets but also among molecular datasets. To help resolve this discrepancy, we performed genome-scale analyses using 4,388 loci from 90 taxa, including representatives of all extant placental orders and transcriptome data from flying lemurs (Dermoptera) and pangolins (Pholidota). Depending on the gene partitioning scheme, molecular clock model, and genic deviation from molecular clock assumptions, extensive sensitivity analyses recovered widely varying diversification scenarios for placental mammals from a given gene set, ranging from a deep Cretaceous origin and diversification to a scenario spanning the KPg boundary, suggesting that the use of suboptimal molecular clock markers and methodologies is a major cause of controversies regarding placental diversification timing. We demonstrate that reconciliation between molecular and paleontological estimates of placental divergence times can be achieved using the appropriate clock model and gene partitioning scheme while accounting for the degree to which individual genes violate molecular clock assumptions. A birth-death-shift analysis suggests that placental mammals underwent a continuous radiation across the KPg boundary without apparent interruption by the mass extinction, paralleling a genus-level radiation of multituberculates and ecomorphological diversification of both multituberculates and therians. These findings suggest that the KPg catastrophe evidently played a limited role in placental diversification, which, instead, was likely a delayed response to the slightly earlier radiation of angiosperms. PMID:28808022

Genomic evidence reveals a radiation of placental mammals uninterrupted by the KPg boundary.

PubMed

Liu, Liang; Zhang, Jin; Rheindt, Frank E; Lei, Fumin; Qu, Yanhua; Wang, Yu; Zhang, Yu; Sullivan, Corwin; Nie, Wenhui; Wang, Jinhuan; Yang, Fengtang; Chen, Jinping; Edwards, Scott V; Meng, Jin; Wu, Shaoyuan

2017-08-29

The timing of the diversification of placental mammals relative to the Cretaceous-Paleogene (KPg) boundary mass extinction remains highly controversial. In particular, there have been seemingly irreconcilable differences in the dating of the early placental radiation not only between fossil-based and molecular datasets but also among molecular datasets. To help resolve this discrepancy, we performed genome-scale analyses using 4,388 loci from 90 taxa, including representatives of all extant placental orders and transcriptome data from flying lemurs (Dermoptera) and pangolins (Pholidota). Depending on the gene partitioning scheme, molecular clock model, and genic deviation from molecular clock assumptions, extensive sensitivity analyses recovered widely varying diversification scenarios for placental mammals from a given gene set, ranging from a deep Cretaceous origin and diversification to a scenario spanning the KPg boundary, suggesting that the use of suboptimal molecular clock markers and methodologies is a major cause of controversies regarding placental diversification timing. We demonstrate that reconciliation between molecular and paleontological estimates of placental divergence times can be achieved using the appropriate clock model and gene partitioning scheme while accounting for the degree to which individual genes violate molecular clock assumptions. A birth-death-shift analysis suggests that placental mammals underwent a continuous radiation across the KPg boundary without apparent interruption by the mass extinction, paralleling a genus-level radiation of multituberculates and ecomorphological diversification of both multituberculates and therians. These findings suggest that the KPg catastrophe evidently played a limited role in placental diversification, which, instead, was likely a delayed response to the slightly earlier radiation of angiosperms.

Links between ammonia oxidizer species composition, functional diversity and nitrification kinetics in grassland soils.

PubMed

Webster, Gordon; Embley, T Martin; Freitag, Thomas E; Smith, Zena; Prosser, James I

2005-05-01

Molecular approaches have revealed considerable diversity and uncultured novelty in natural prokaryotic populations, but not direct links between the new genotypes detected and ecosystem processes. Here we describe the influence of the structure of communities of ammonia-oxidizing bacteria on nitrogen cycling in microcosms containing natural and managed grasslands and amended with artificial sheep urine, a major factor determining local ammonia concentrations in these environments. Nitrification kinetics were assessed by analysis of changes in urea, ammonia, nitrite and nitrate concentrations and ammonia oxidizer communities were characterized by analysis of 16S rRNA genes amplified from extracted DNA using ammonia oxidizer-specific primers. In natural soils, ammonia oxidizer community structure determined the delay preceding nitrification, which depended on the relative abundance of two Nitrosospira clusters, termed 3a and 3b. In batch cultures, pure culture and enrichment culture representatives of Nitrosospira 3a were sensitive to high ammonia concentration, while Nitrosospira cluster 3b representatives and Nitrosomonas europaea were tolerant. Delays in nitrification occurred in natural soils dominated by Nitrosospira cluster 3a and resulted from the time required for growth of low concentrations of Nitrosospira cluster 3b. In microcosms dominated by Nitrosospira cluster 3b and Nitrosomonas, no substantial delays were observed. In managed soils, no delays in nitrification were detected, regardless of initial ammonia oxidizer community structure, most probably resulting from higher ammonia oxidizer cell concentrations. The data therefore demonstrate a direct link between bacterial community structure, physiological diversity and ecosystem function.

Methane oxidation behind reflected shock waves: Ignition delay times measured by pressure and flame band emission

NASA Technical Reports Server (NTRS)

Brabbs, T. A.; Robertson, T. F.

1986-01-01

Ignition delay data were recorded for three methane-oxygen-argon mixtures (phi = 0.5, 1.0, 2.0) for the temperature range 1500 to 1920 K. Quiet pressure trances enabled us to obtain delay times for the start of the experimental pressure rise. These times were in good agreement with those obtained from the flame band emission at 3700 A. The data correlated well with the oxygen and methane dependence of Lifshitz, but showed a much stronger temperature dependence (phi = 0.5 delta E = 51.9, phi = 1.0 delta = 58.8, phi = 2.0 delta E = 58.7 Kcal). The effect of probe location on the delay time measurement was studied. It appears that the probe located 83 mm from the reflecting surface measured delay times which may not be related to the initial temperature and pressure. It was estimated that for a probe located 7 mm from the reflecting surface, the measured delay time would be about 10 microseconds too short, and it was suggested that delay times less than 100 microsecond should not be used. The ignition period was defined as the time interval between start of the experimental pressure rise and 50 percent of the ignition pressure. This time interval was measured for three gas mixtures and found to be similar (40 to 60 micro sec) for phi = 1.0 and 0.5 but much longer (100 to 120) microsecond for phi = 2.0. It was suggested that the ignition period would be very useful to the kinetic modeler in judging the agreement between experimental and calculated delay times.

Nfix Regulates Temporal Progression of Muscle Regeneration through Modulation of Myostatin Expression.

PubMed

Rossi, Giuliana; Antonini, Stefania; Bonfanti, Chiara; Monteverde, Stefania; Vezzali, Chiara; Tajbakhsh, Shahragim; Cossu, Giulio; Messina, Graziella

2016-03-08

Nfix belongs to a family of four highly conserved proteins that act as transcriptional activators and/or repressors of cellular and viral genes. We previously showed a pivotal role for Nfix in regulating the transcriptional switch from embryonic to fetal myogenesis. Here, we show that Nfix directly represses the Myostatin promoter, thus controlling the proper timing of satellite cell differentiation and muscle regeneration. Nfix-null mice display delayed regeneration after injury, and this deficit is reversed upon in vivo Myostatin silencing. Conditional deletion of Nfix in satellite cells results in a similar delay in regeneration, confirming the functional requirement for Nfix in satellite cells. Moreover, mice lacking Nfix show reduced myofiber cross sectional area and a predominant slow twitching phenotype. These data define a role for Nfix in postnatal skeletal muscle and unveil a mechanism for Myostatin regulation, thus providing insights into the modulation of its complex signaling pathway. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Expression patterns of wnt8 orthologs in two sand dollar species with different developmental modes.

PubMed

Nakata, Hidewo; Minokawa, Takuya

2009-03-01

Two wnt8 orthologs, Smwnt8 and Pjwnt8, were isolated from an indirect developing sand dollar, Scaphechinus mirabilis, and a direct developing sand dollar, Peronella japonica, respectively. The expression patterns of two genes during early development were examined by whole mount in situ hybridization. The expression of Smwnt8 was initiated in the micromeres at the late 16-cell stage and expanded at the 64-cell stage to the whole vegetal hemisphere, including the presumptive endomesodermal regions. The timing of the initiation of Pjwnt8 transcription in the presumptive endomesoderm region was delayed by 2-3 cell cycles compared to that of Smwnt8. The delay, or molecular heterochrony, of Pjwnt8 transcription strongly suggests the existence of a substantial evolutionary change in the early endomesodermal specification of P. japonica. In addition to the endomesodermal expression during early embryogenesis, bilateral expressions were observed commonly in the ectoderm of two sand dollar species during larval stages.

Longitudinal Outcomes of Start Time Delay on Sleep, Behavior, and Achievement in High School.

PubMed

Thacher, Pamela V; Onyper, Serge V

2016-02-01

To establish whether sleep, health, mood, behavior, and academics improved after a 45-minute delay in high school start time, and whether changes persisted longitudinally. We collected data from school records and student self-report across a number of domains at baseline (May 2012) and at two follow-up time points (November 2012 and May 2013), at a public high school in upstate New York. Students enrolled during academic years (AY) 2011-2012 and 2012-2013 completed the Pittsburgh Sleep Quality Index; the DASS-21; the "Owl-Lark" Scale; the Daytime Sleepiness Index; and a brief self-report of health. Reports from school records regarding attendance, tardiness, disciplinary violations, and academic performance were collected for AY 2010-2011 through 2013-2014. Students delayed but did not extend their sleep period; we found lasting improvements in tardiness and disciplinary violations after the start-time delay, but no changes to other variables. At the first follow-up, students reported 20 minutes longer sleep, driven by later rise times and stable bed times. At the second follow-up, students maintained later rise times but delayed bedtimes, returning total sleep to baseline levels. A delay in rise time, paralleling the delay in the start time that occurred, resulted in less tardiness and decreased disciplinary incidents, but larger improvements to sleep patterns may be necessary to affect health, attendance, sleepiness, and academic performance. Later start times improved tardiness and disciplinary issues at this school district. A delay in start time may be a necessary but not sufficient means to increase sleep time and may depend on preexisting individual differences. A commentary on this article appears in this issue on page 267. © 2016 Associated Professional Sleep Societies, LLC.

Design of surface acoustic wave filters for the multiplex transmission system of multilevel inverter circuits

NASA Astrophysics Data System (ADS)

Kubo, Keita; Kanai, Nanae; Kobayashi, Fumiya; Goka, Shigeyoshi; Wada, Keiji; Kakio, Shoji

2017-07-01

We designed surface acoustic wave (SAW) filters for a multiplex transmission system of multilevel inverter circuits, and applied them to a single-phase three-level inverter. To reduce the transmission delay time of the SAW filters, a four-channel SAW filter array was fabricated and its characteristics were measured. The delay time of the SAW filters was <350 ns, and the delay time difference was reduced to ≤184 ns, less than half that previously reported. The SAW filters withstood up to 990 V, which is sufficient for the inverters used in most domestic appliances. A single-phase three-level inverter with the fabricated SAW filters worked with a total delay time shorter than our target delay time of 2.5 µs. The delay time difference of the proposed system was 0.26 µs, which is sufficient for preventing the inverter circuit from short-circuiting. The SAW filters controlled a multilevel inverter system with simple signal wiring and high dielectric withstanding voltages.

Sirh7/Ldoc1 knockout mice exhibit placental P4 overproduction and delayed parturition

PubMed Central

Naruse, Mie; Ono, Ryuichi; Irie, Masahito; Nakamura, Kenji; Furuse, Tamio; Hino, Toshiaki; Oda, Kanako; Kashimura, Misho; Yamada, Ikuko; Wakana, Shigeharu; Yokoyama, Minesuke; Ishino, Fumitoshi; Kaneko-Ishino, Tomoko

2014-01-01

Sirh7/Ldoc1 [sushi-ichi retrotransposon homolog 7/leucine zipper, downregulated in cancer 1, also called mammalian retrotransposon-derived 7 (Mart7)] is one of the newly acquired genes from LTR retrotransposons in eutherian mammals. Interestingly, Sirh7/Ldoc1 knockout (KO) mice exhibited abnormal placental cell differentiation/maturation, leading to an overproduction of placental progesterone (P4) and placental lactogen 1 (PL1) from trophoblast giant cells (TGCs). The placenta is an organ that is essential for mammalian viviparity and plays a major endocrinological role during pregnancy in addition to providing nutrients and oxygen to the fetus. P4 is an essential hormone in the preparation and maintenance of pregnancy and the determination of the timing of parturition in mammals; however, the biological significance of placental P4 in rodents is not properly recognized. Here, we demonstrate that mouse placentas do produce P4 in mid-gestation, coincident with a temporal reduction in ovarian P4, suggesting that it plays a role in the protection of the conceptuses specifically in this period. Pregnant Sirh7/Ldoc1 knockout females also displayed delayed parturition associated with a low pup weaning rate. All these results suggest that Sirh7/Ldoc1 has undergone positive selection during eutherian evolution as a eutherian-specific acquired gene because it impacts reproductive fitness via the regulation of placental endocrine function. PMID:25468940

Lack of genetic interaction between Tbx20 and Tbx3 in early mouse heart development.

PubMed

Gavrilov, Svetlana; Harvey, Richard P; Papaioannou, Virginia E

2013-01-01

Members of the T-box family of transcription factors are important regulators orchestrating the complex regionalization of the developing mammalian heart. Individual mutations in Tbx20 and Tbx3 cause distinct congenital heart abnormalities in the mouse: Tbx20 mutations result in failure of heart looping, developmental arrest and lack of chamber differentiation, while hearts of Tbx3 mutants progress further, loop normally but show atrioventricular convergence and outflow tract defects. The two genes have overlapping areas of expression in the atrioventricular canal and outflow tract of the heart but their potential genetic interaction has not been previously investigated. In this study we produced compound mutants to investigate potential genetic interactions at the earliest stages of heart development. We find that Tbx20; Tbx3 double heterozygous mice are viable and fertile with no apparent abnormalities, while double homozygous mutants are embryonic lethal by midgestation. Double homozygous mutant embryos display abnormal cardiac morphogenesis, lack of heart looping, expression patterns of cardiac genes and time of death that are indistinguishable from Tbx20 homozygous mutants. Prior to death, the double homozygotes show an overall developmental delay similar to Tbx3 homozygous mutants. Thus the effects of Tbx20 are epistatic to Tbx3 in the heart but Tbx3 is epistatic to Tbx20 with respect to developmental delay.

Reaction time, inhibition, working memory and ‘delay aversion’ performance: genetic influences and their interpretation

PubMed Central

KUNTSI, JONNA; ROGERS, HANNAH; SWINARD, GREER; BÖRGER, NORBERT; van der MEERE, JAAP; RIJSDIJK, FRUHLING; ASHERSON, PHILIP

2013-01-01

Background For candidate endophenotypes to be useful for psychiatric genetic research, they first of all need to show significant genetic influences. To address the relative lack of previous data, we set to investigate the extent of genetic and environmental influences on performance in a set of theoretically driven cognitive-experimental tasks in a large twin sample. We further aimed to illustrate how test–retest reliability of the measures affects the estimates. Method Four-hundred 7- to 9-year-old twin pairs were assessed individually on tasks measuring reaction time, inhibition, working memory and ‘delay aversion’ performance. Test–retest reliability data on some of the key measures were available from a previous study. Results Several key measures of reaction time, inhibition and working-memory performance indicated a moderate degree of genetic influence. Combining data across theoretically related tasks increased the heritability estimates, as illustrated by the heritability estimates of 60% for mean reaction time and 50% for reaction-time variability. Psychometric properties (reliability or ceiling effects) had a substantial influence on the estimates for some measures. Conclusions The data support the usefulness of several of the variables for endophenotype studies that aim to link genes to cognitive and motivational processes. Importantly, the data also illustrate specific conditions under which the true extent of genetic influences may be underestimated and hence the usefulness for genetic mapping studies compromised, and suggest ways to address this. PMID:16882357

Two R7 RGS proteins shape retinal bipolar cell signaling

PubMed Central

Mojumder, Deb Kumar; Qian, Yan; Wensel, Theodore G.

2009-01-01

RGS7, RGS11, and their binding partner Gβ5 are localized to the dendritic tips of retinal ON bipolar cells (ON-BPC), where mGluR6 responds to glutamate released from photoreceptor terminals by activation of the RGS7/RGS11 substrate, Gαo. To determine their functions in retinal signaling, we investigated cell-specific expression patterns of RGS7 and RGS11 by immunostaining, and measured light responses by electroretinography (ERG) in mice with targeted disruptions of the genes encoding them. RGS7 staining is present in dendritic tips of all rod ON-BPC, but missing in those for subsets of cone ON-BPC, whereas the converse was true for RGS11 staining. Genetic disruption of either RGS7 or RGS11 produced delays in the ON-BPC-derived electroretinogram b-wave, but no changes in the photoreceptor-derived a-wave. Homozygous RGS7 mutant mice had delays in rod-driven b-waves, whereas, RGS11 mutant mice had delays in rod-driven, and especially in cone-driven b-waves. The b-wave delays were further enhanced in mice homozygous for both RGS7 and RGS11 gene disruptions. Thus, RGS7 and RGS11 act in parallel to regulate the kinetics of ON bipolar cell responses, with differential impacts on the rod and cone pathways. PMID:19535587

IDENTIFYING ANOMALIES IN GRAVITATIONAL LENS TIME DELAYS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Congdon, Arthur B.; Keeton, Charles R.; Nordgren, C. Erik, E-mail: acongdon@jpl.nasa.go, E-mail: keeton@physics.rutgers.ed, E-mail: nordgren@sas.upenn.ed

2010-02-01

We examine the ability of gravitational lens time delays to reveal complex structure in lens potentials. In a previous paper, we predicted how the time delay between the bright pair of images in a 'fold' lens scales with the image separation, for smooth lens potentials. Here we show that the proportionality constant increases with the quadrupole moment of the lens potential, and depends only weakly on the position of the source along the caustic. We use Monte Carlo simulations to determine the range of time delays that can be produced by realistic smooth lens models consisting of isothermal ellipsoid galaxiesmore » with tidal shear. We can then identify outliers as 'time delay anomalies'. We find evidence for anomalies in close image pairs in the cusp lenses RX J1131 - 1231 and B1422+231. The anomalies in RX J1131 - 1231 provide strong evidence for substructure in the lens potential, while at this point the apparent anomalies in B1422+231 mainly indicate that the time delay measurements need to be improved. We also find evidence for time delay anomalies in larger-separation image pairs in the fold lenses, B1608+656 and WFI 2033 - 4723, and the cusp lens RX J0911+0551. We suggest that these anomalies are caused by some combination of substructure and a complex lens environment. Finally, to assist future monitoring campaigns we use our smooth models with shear to predict the time delays for all known four-image lenses.« less

Identifying Anomalies in Gravitational Lens Time Delays

NASA Astrophysics Data System (ADS)

Congdon, Arthur B.; Keeton, Charles R.; Nordgren, C. Erik

2010-02-01

We examine the ability of gravitational lens time delays to reveal complex structure in lens potentials. In a previous paper, we predicted how the time delay between the bright pair of images in a "fold" lens scales with the image separation, for smooth lens potentials. Here we show that the proportionality constant increases with the quadrupole moment of the lens potential, and depends only weakly on the position of the source along the caustic. We use Monte Carlo simulations to determine the range of time delays that can be produced by realistic smooth lens models consisting of isothermal ellipsoid galaxies with tidal shear. We can then identify outliers as "time delay anomalies." We find evidence for anomalies in close image pairs in the cusp lenses RX J1131 - 1231 and B1422+231. The anomalies in RX J1131 - 1231 provide strong evidence for substructure in the lens potential, while at this point the apparent anomalies in B1422+231 mainly indicate that the time delay measurements need to be improved. We also find evidence for time delay anomalies in larger-separation image pairs in the fold lenses, B1608+656 and WFI 2033 - 4723, and the cusp lens RX J0911+0551. We suggest that these anomalies are caused by some combination of substructure and a complex lens environment. Finally, to assist future monitoring campaigns we use our smooth models with shear to predict the time delays for all known four-image lenses.

COSMOGRAIL XVII: Time Delays for the Quadruply Imaged Quasar PG 1115+080

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonvin, V.; et al.

We present time-delay estimates for the quadruply imaged quasar PG 1115+080. Our resuls are based on almost daily observations for seven months at the ESO MPIA 2.2m telescope at La Silla Observatory, reaching a signal-to-noise ratio of about 1000 per quasar image. In addition, we re-analyse existing light curves from the literature that we complete with an additional three seasons of monitoring with the Mercator telescope at La Palma Observatory. When exploring the possible source of bias we consider the so-called microlensing time delay, a potential source of systematic error so far never directly accounted for in previous time-delay publications.more » In fifteen years of data on PG 1115+080, we find no strong evidence of microlensing time delay. Therefore not accounting for this effect, our time-delay estimates on the individual data sets are in good agreement with each other and with the literature. Combining the data sets, we obtain the most precise time-delay estimates to date on PG 1115+080, with Dt(AB) = 8.3+1.5-1.6 days (18.7% precision), Dt(AC) = 9.9+1.1-1.1 days (11.1%) and Dt(BC) = 18.8+1.6-1.6 days (8.5%). Turning these time delays into cosmological constraints is done in a companion paper that makes use of ground-based Adaptive Optics (AO) with the Keck telescope.« less

Nuclear reactor with internal thimble-type delayed neutron detection system

DOEpatents

Gross, Kenny C.; Poloncsik, John; Lambert, John D. B.

1990-01-01

This invention teaches improved apparatus for the method of detecting a breach in cladded fuel used in a nuclear reactor. The detector apparatus is located in the primary heat exchanger which conveys part of the reactor coolant past at least three separate delayed-neutron detectors mounted in this heat exchanger. The detectors are spaced apart such that the coolant flow time from the core to each detector is different, and these differences are known. The delayed-neutron activity at the detectors is a function of the delay time after the reaction in the fuel until the coolant carrying the delayed-neutron emitter passes the respective detector. This time delay is broken down into separate components including an isotopic holdup time required for the emitter to move through the fuel from the reaction to the coolant at the breach, and two transit times required for the emitter now in the coolant to flow from the breach to the detector loop and then via the loop to the detector. At least two of these time components are determined during calibrated operation of the reactor. Thereafter during normal reactor operation, repeated comparisons are made by the method of regression approximation of the third time component for the best-fit line correlating measured delayed-neutron activity against activity that is approximated according to specific equations. The equations use these time-delay components and known parameter values of the fuel and of the part and emitting daughter isotopes.

Time and decision making: differential contribution of the posterior insular cortex and the striatum during a delay discounting task.

PubMed

Wittmann, Marc; Leland, David S; Paulus, Martin P

2007-06-01

Delay discounting refers to the fact that an immediate reward is valued more than the same reward if it occurs some time in the future. To examine the neural substrates underlying this process, we studied 13 healthy volunteers who repeatedly had to decide between an immediate and parametrically varied delayed hypothetical reward using a delay discounting task during event-related functional magnetic resonance imaging. Subject's preference judgments resulted in different discounting slopes for shorter (<1 year) and for longer (> or =1 year) delays. Neural activation associated with the shorter delays relative to the longer delays was associated with increased activation in the head of the left caudate nucleus and putamen. When individuals selected the delayed relative to the immediate reward, a strong activation was found in bilateral posterior insular cortex. Several brain areas including the left caudate nucleus showed a correlation between the behaviorally determined discounting and brain activation for the contrast of intervals with delays <1 and > or =1 year. These results suggest that (1) the posterior insula, which is a critical component of the decision-making neural network, is involved in delaying gratification and (2) the degree of neural activation in the striatum, which plays a fundamental role in reward prediction and in time estimation, may code for the time delay.

Trehalose metabolism genes of Aphelenchoides besseyi (Nematoda: Aphelenchoididae) in hypertonic osmotic pressure survival

PubMed Central

Chen, Qiaoli; Li, Danlei; Zhang, Ruizhi; Ling, Yaming

2017-01-01

ABSTRACT Some organisms can survive extreme desiccation caused by hypertonic osmotic pressure by entering a state of suspended animation known as osmobiosis. The free-living mycophagous nematode Aphelenchoides besseyi can be induced to enter osmobiosis by soaking in osmolytes. It is assumed that sugars (in particular trehalose) are instrumental for survival under environmental stress. In A. besseyi, two putative trehalose-6-phosphate synthase genes (TPS) encoding enzymes catalyzing trehalose synthesis, and a putative trehalase gene (TRE) encoding enzymes that catalyze hydrolysis of trehalose were identified and then characterized based on their transcriptome. RT-qPCR analyses showed that each of these genes is expressed as mRNA when A. besseyi is entering in, during and recovering from osmobiosis, but only for certain periods. The changes of TRE activity were consistent with the transcript level changes of the TRE gene, and the trehalose level declined at certain periods when the nematodes were in, as well as recovering from, osmobiosis; this suggested that the hydrolysis of threhalose is essential. The feeding method of RNA interference (RNAi) was used to temporarily knock down the expression of each of the TPS and TRE genes. No obviously different phenotype was observed from any of the genes silenced individually or simultaneously, but the survival under hypertonic osmotic pressure reduced significantly and the recovery was delayed. These results indicated that trehalose metabolism genes should play a role in osmobiosis regulation and function within a restricted time frame. PMID:28396490

Zooming in on children's behavior during delay of gratification: Disentangling impulsigenic and volitional processes underlying self-regulation.

PubMed

Neuenschwander, Regula; Blair, Clancy

2017-02-01

When delaying gratification, both motivational and regulatory processes are likely to be at play; however, the relative contributions of motivational and regulatory influences on delay behavior are unclear. By examining behavioral responses during a delay task, this study sought to examine the motivational (anticipatory behavior) and regulatory mechanisms (executive function and self-control strategies) underlying children's self-regulation. The participants, 65 5- to 9-year-old children (M age =7.19years, SD=0.89), were video-recorded during a delay procedure and later coded for anticipatory behaviors (e.g., gazing intensely at the tablet) and self-control strategies. Children also completed two executive function (EF) tasks. We found that anticipatory behavior was curvilinearly related to delay time. Children showing either very low or very high levels of anticipatory behavior were not able to wait the entire time. Furthermore, our results indicated that anticipatory behavior interacted with EF to predict delay time. Specifically, anticipatory behavior was negatively related to delay time only if EF abilities were low. Finally, self-control strategies also interacted with EF to predict children's ability to delay. Spontaneous engagement in self-control strategies such as fidgeting and engagement in alternative activities were beneficial for children with low EF but were unrelated to delay time for children with high EF. Results indicate the value of examining motivational and regulatory influences on delay behavior. Lapses in self-regulation may be due to the combination of powerful impulsigenic (i.e., anticipatory behavior) and weak volitional processes (i.e., EF, self-control strategies). Copyright © 2016. Published by Elsevier Inc.

Finite-time resilient decentralized control for interconnected impulsive switched systems with neutral delay.

PubMed

Ren, Hangli; Zong, Guangdeng; Hou, Linlin; Yang, Yi

2017-03-01

This paper is concerned with the problem of finite-time control for a class of interconnected impulsive switched systems with neutral delay in which the time-varying delay appears in both the state and the state derivative. The concepts of finite-time boundedness and finite-time stability are respectively extended to interconnected impulsive switched systems with neutral delay for the first time. By applying the average dwell time method, sufficient conditions are first derived to cope with the problem of finite-time boundedness and finite-time stability for interconnected impulsive switched systems with neutral delay. In addition, the purpose of finite-time resilient decentralized control is to construct a resilient decentralized state-feedback controller such that the closed-loop system is finite-time bounded and finite-time stable. All the conditions are formulated in terms of linear matrix inequalities to ensure finite-time boundedness and finite-time stability of the given system. Finally, an example is presented to illustrate the effectiveness of the proposed approach. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Method and apparatus for measuring the intensity and phase of an ultrashort light pulse

DOEpatents

Kane, Daniel J.; Trebino, Rick P.

1998-01-01

The pulse shape I(t) and phase evolution x(t) of ultrashort light pulses are obtained using an instantaneously responding nonlinear optical medium to form a signal pulse. A light pulse, such a laser pulse, is split into a gate pulse and a probe pulse, where the gate pulse is delayed relative to the probe pulse. The gate pulse and the probe pulse are combined within an instantaneously responding optical medium to form a signal pulse functionally related to a temporal slice of the gate pulse corresponding to the time delay of the probe pulse. The signal pulse is then input to a wavelength-selective device to output pulse field information comprising intensity vs. frequency for a first value of the time delay. The time delay is varied over a range of values effective to yield an intensity plot of signal intensity vs. wavelength and delay. In one embodiment, the beams are overlapped at an angle so that a selected range of delay times is within the intersection to produce a simultaneous output over the time delays of interest.

Radar wideband digital beamforming based on time delay and phase compensation

NASA Astrophysics Data System (ADS)

Fu, Wei; Jiang, Defu

2018-07-01

In conventional phased array radars, analogue time delay devices and phase shifters have been used for wideband beamforming. These methods suffer from insertion losses, gain mismatches and delay variations, and they occupy a large chip area. To solve these problems, a compact architecture of digital array antennas based on subarrays was considered. In this study, the receiving beam patterns of wideband linear frequency modulation (LFM) signals were constructed by applying analogue stretch processing via mixing with delayed reference signals at the subarray level. Subsequently, narrowband digital time delaying and phase compensation of the tone signals were implemented with reduced arithmetic complexity. Due to the differences in amplitudes, phases and time delays between channels, severe performance degradation of the beam patterns occurred without corrections. To achieve good beamforming performance, array calibration was performed in each channel to adjust the amplitude, frequency and phase of the tone signal. Using a field-programmable gate array, wideband LFM signals and finite impulse response filters with continuously adjustable time delays were implemented in a polyphase structure. Simulations and experiments verified the feasibility and effectiveness of the proposed digital beamformer.

77 FR 33718 - Taking and Importing Marine Mammals: Taking Marine Mammals Incidental to Navy Training Exercises...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-07

...). Here, the Navy identifies the distance that a marine mammal is likely to travel during the time... typically travel within a given time-delay period (Table 1). Based on acoustic propagation modeling... Speed and Length of Time-Delay Potential Species group Swim speed Time-delay (min) distance traveled (yd...

An active balance board system with real-time control of stiffness and time-delay to assess mechanisms of postural stability.

PubMed

Cruise, Denise R; Chagdes, James R; Liddy, Joshua J; Rietdyk, Shirley; Haddad, Jeffrey M; Zelaznik, Howard N; Raman, Arvind

2017-07-26

Increased time-delay in the neuromuscular system caused by neurological disorders, concussions, or advancing age is an important factor contributing to balance loss (Chagdes et al., 2013, 2016a,b). We present the design and fabrication of an active balance board system that allows for a systematic study of stiffness and time-delay induced instabilities in standing posture. Although current commercial balance boards allow for variable stiffness, they do not allow for manipulation of time-delay. Having two controllable parameters can more accurately determine the cause of balance deficiencies, and allows us to induce instabilities even in healthy populations. An inverted pendulum model of human posture on such an active balance board predicts that reduced board rotational stiffness destabilizes upright posture through board tipping, and limit cycle oscillations about the upright position emerge as feedback time-delay is increased. We validate these two mechanisms of instability on the designed balance board, showing that rotational stiffness and board time-delay induced the predicted postural instabilities in healthy, young adults. Although current commercial balance boards utilize control of rotational stiffness, real-time control of both stiffness and time-delay on an active balance board is a novel and innovative manipulation to reveal balance deficiencies and potentially improve individualized balance training by targeting multiple dimensions contributing to standing balance. Copyright © 2017 Elsevier Ltd. All rights reserved.

Maturation delay for the predators can enhance stable coexistence for a class of prey-predator models.

PubMed

Banerjee, Malay; Takeuchi, Yasuhiro

2017-01-07

Maturation time delay for the predators is introduced in prey-predator models to implicitly model the stage-structure of predators. Most of the prey-predator models with maturation delay are known to exhibit destabilization of coexistence steady-state. Discrete time delay induced destabilization is a common finding, however, this is due to the introduction of time delay with lack of ecological justification. The main objective of the present work is to show the stabilizing role of maturation delay for a class of delayed prey-predator model. To be specific, we consider prey-predator models with strong and weak Allee effects in prey growth and Michaelis-Menten type functional response. We provide ecological justification for the introduction of maturation delay parameter in predator's growth equation. We obtain the conditions for stable and oscillatory coexistence of prey and their specialist predator in case of strong as well as weak Allee effect for non-delayed and delayed models. Apart from the analytical results for the models under consideration, we perform extensive numerical simulations to construct the relevant bifurcation diagrams. Our analytical and supportive numerical findings reveal that delay is not always a destabilizing factor rather the stable coexistence in the presence of time delay depends upon the formulation of the delayed model. The biological implications of the current investigation are provided in the conclusion section. We also explain the validity of obtained results for other types of prey-predator models with a specialist predator. Copyright © 2016 Elsevier Ltd. All rights reserved.

The product of the Saccharomyces cerevisiae cell cycle gene DBF2 has homology with protein kinases and is periodically expressed in the cell cycle.

PubMed Central

Johnston, L H; Eberly, S L; Chapman, J W; Araki, H; Sugino, A

1990-01-01

Several Saccharomyces cerevisiae dbf mutants defective in DNA synthesis have been described previously. In this paper, one of them, dbf2, is characterized in detail. The DBF2 gene has been cloned and mapped, and its nucleotide sequence has been determined. This process has identified an open reading frame capable of encoding a protein of molecular weight 64,883 (561 amino acids). The deduced amino acid sequence contains all 11 conserved domains found in various protein kinases. DBF2 was periodically expressed in the cell cycle at a time that clearly differed from the time of expression of either the histone H2A or DNA polymerase I gene. Its first function was completed very near to initiation of DNA synthesis. However, DNA synthesis in the mutant was only delayed at 37 degrees C, and the cells blocked in nuclear division. Consistent with this finding, the execution point occurred about 1 h after DNA synthesis, and the nuclear morphology of the mutant at the restrictive temperature was that of cells blocked in late nuclear division. DBF2 is therefore likely to encode a protein kinase that may function in initiation of DNA synthesis and also in late nuclear division. Images PMID:2181271

Oscillatory dynamics of an intravenous glucose tolerance test model with delay interval

NASA Astrophysics Data System (ADS)

Shi, Xiangyun; Kuang, Yang; Makroglou, Athena; Mokshagundam, Sriprakash; Li, Jiaxu

2017-11-01

Type 2 diabetes mellitus (T2DM) has become prevalent pandemic disease in view of the modern life style. Both diabetic population and health expenses grow rapidly according to American Diabetes Association. Detecting the potential onset of T2DM is an essential focal point in the research of diabetes mellitus. The intravenous glucose tolerance test (IVGTT) is an effective protocol to determine the insulin sensitivity, glucose effectiveness, and pancreatic β-cell functionality, through the analysis and parameter estimation of a proper differential equation model. Delay differential equations have been used to study the complex physiological phenomena including the glucose and insulin regulations. In this paper, we propose a novel approach to model the time delay in IVGTT modeling. This novel approach uses two parameters to simulate not only both discrete time delay and distributed time delay in the past interval, but also the time delay distributed in a past sub-interval. Normally, larger time delay, either a discrete or a distributed delay, will destabilize the system. However, we find that time delay over a sub-interval might not. We present analytically some basic model properties, which are desirable biologically and mathematically. We show that this relatively simple model provides good fit to fluctuating patient data sets and reveals some intriguing dynamics. Moreover, our numerical simulation results indicate that our model may remove the defect in well known Minimal Model, which often overestimates the glucose effectiveness index.

Modeling of synchronization behavior of bursting neurons at nonlinearly coupled dynamical networks.

PubMed

Çakir, Yüksel

2016-01-01

Synchronization behaviors of bursting neurons coupled through electrical and dynamic chemical synapses are investigated. The Izhikevich model is used with random and small world network of bursting neurons. Various currents which consist of diffusive electrical and time-delayed dynamic chemical synapses are used in the simulations to investigate the influences of synaptic currents and couplings on synchronization behavior of bursting neurons. The effects of parameters, such as time delay, inhibitory synaptic strengths, and decay time on synchronization behavior are investigated. It is observed that in random networks with no delay, bursting synchrony is established with the electrical synapse alone, single spiking synchrony is observed with hybrid coupling. In small world network with no delay, periodic bursting behavior with multiple spikes is observed when only chemical and only electrical synapse exist. Single-spike and multiple-spike bursting are established with hybrid couplings. A decrease in the synchronization measure is observed with zero time delay, as the decay time is increased in random network. For synaptic delays which are above active phase period, synchronization measure increases with an increase in synaptic strength and time delay in small world network. However, in random network, it increases with only an increase in synaptic strength.

Bacteriophage-associated gene transfer in pneumococcus: transduction or pseudotransduction?

PubMed Central

Porter, R D; Shoemaker, N B; Rampe, G; Guild, W R

1979-01-01

Lysates of pneumococcal phage PG24 transferred genes from one host to another in a process with many of the properties of generalized transduction, in that the host genes were packaged in DNase-resistant particles that closely resembled infectious phage in physical properties, adsorbed to the recipient cells like phage, and were inhibited by antisera to the phage and by trypsin. However, phage processes did not complete the transfer of host DNA as they did phage DNA. Instead, gene transfer required development of competence and entry of the host DNA by the endonuclease-dependent pathway used for transforming and transfecting DNA. This process often occurred on the assay plate hours after adsorption of the particles to the cells, and the transfer was DNase sensitive if challenged at this time. Phenotypic expression was therefore also delayed. The product of entry was like that in transformation, a single strand of DNA that integrates by formation of a hex-sensitive donor-recipient heteroduplex. Whether this gene transfer process is unique to this system or is only the first one described is not clear. The term "pseudotransduction" may be useful in calling attention to its unexpected features. The DNA of PG24 phage has anomalous physical properties reflecting unusual bases. Images PMID:33154

Functional conservation and diversification of the soybean maturity gene E1 and its homologs in legumes.

PubMed

Zhang, Xingzheng; Zhai, Hong; Wang, Yaying; Tian, Xiaojie; Zhang, Yupeng; Wu, Hongyan; Lü, Shixiang; Yang, Guang; Li, Yuqiu; Wang, Lu; Hu, Bo; Bu, Qingyun; Xia, Zhengjun

2016-07-13

Gene regulatory networks involved in flowering time and photoperiodic responses in legumes remain unknown. Although the major maturity gene E1 has been successfully deciphered in soybean, knowledge on the functional conservation of this gene is limited to a certain extent to E1 homologs in legumes. The ectopic expression of Phvul.009G204600 (PvE1L), an E1 homolog from common bean, delayed the onset of flowering in soybean. By contrast, the ectopic expression of Medtr2g058520 (MtE1L) from Medicago truncatula did not affect the flowering of soybean. Characterization of the late-flowering mte1l mutant indicated that MtE1L promoted flowering in Medicago truncatula. Moreover, all transgenic E1, PvE1L and MtE1L soybean lines exhibited phenotypic changes in terms of plant height. Transgenic E1 or PvE1L plants were taller than the wild-type, whereas transgenic MtE1L plants produced dwarf phenotype with few nodes and short internode. Thus, functional conservation and diversification of E1 family genes from legumes in the regulation of flowering and plant growth may be associated with lineage specification and genomic duplication.

Effect of chilling and cryopreservation on expression of Pax genes in zebrafish (Danio rerio) embryos and blastomeres.

PubMed

Lin, C; Spikings, E; Zhang, T; Rawson, D M

2009-08-01

Cryopreservation is now common practice in the fields of aquaculture, conservation and biomedicine. However, there is a lack of information on the effect of chilling and cryopreservation at the molecular level. In the present study, we used real-time RT-PCR analysis to determine the effect of chilling and cryopreservation on expression of Pax2a, Pax2b, Pax5 and Pax8 which constitute one subgroup of the Pax gene family. As intact embryos of zebrafish have not yet been successfully cryopreserved, we have used two alternatives: chilling of intact embryos and cryopreservation of isolated blastomeres. Cryopreservation was found to affect the normal pattern of gene expression in zebrafish embryonic blastomeres. The trends, profile changes, in expression of Pax2a and Pax5 occurred to a lesser extent in frozen-thawed blastomeres than in fresh blastomeres whilst the opposite was true for Pax8. The trends in expression of Pax2b were delayed in frozen-thawed blastomeres compared to fresh blastomeres. Cryopreservation can therefore disrupt normal gene expression patterns in zebrafish embryonic blastomeres which could have a detrimental effect on embryo development.

Biomolecular engineering of intracellular switches in eukaryotes

PubMed Central

Pastuszka, M.K.; Mackay, J.A.

2010-01-01

Tools to selectively and reversibly control gene expression are useful to study and model cellular functions. When optimized, these cellular switches can turn a protein's function “on” and “off” based on cues designated by the researcher. These cues include small molecules, drugs, hormones, and even temperature variations. Here we review three distinct areas in gene expression that are commonly targeted when designing cellular switches. Transcriptional switches target gene expression at the level of mRNA polymerization, with examples including the tetracycline gene induction system as well as nuclear receptors. Translational switches target the process of turning the mRNA signal into protein, with examples including riboswitches and RNA interference. Post-translational switches control how proteins interact with one another to attenuate or relay signals. Examples of post-translational modification include dimerization and intein splicing. In general, the delay times between switch and effect decreases from transcription to translation to post-translation; furthermore, the fastest switches may offer the most elegant opportunities to influence and study cell behavior. We discuss the pros and cons of these strategies, which directly influence their usefulness to study and implement drug targeting at the tissue and cellular level. PMID:21209849

Yorkie Facilitates Organ Growth and Metamorphosis in Bombyx.

PubMed

Liu, Shumin; Zhang, Panli; Song, Hong-Sheng; Qi, Hai-Sheng; Wei, Zhao-Jun; Zhang, Guozheng; Zhan, Shuai; Liu, Zhihong; Li, Sheng

2016-01-01

The Hippo pathway, which was identified from genetic screens in the fruit fly, Drosophila melanogaster, has a major size-control function in animals. All key components of the Hippo pathway, including the transcriptional coactivator Yorkie that is the most critical substrate and downstream effector of the Hippo kinase cassette, are found in the silkworm, Bombyx mori. As revealed by microarray and quantitative real-time PCR, expression of Hippo pathway genes is particularly enriched in several mitotic tissues, including the ovary, testis, and wing disc. Developmental profiles of Hippo pathway genes are generally similar (with the exception of Yorkie) within each organ, but vary greatly in different tissues showing nearly opposing expression patterns in the wing disc and the posterior silk gland (PSG) on day 2 of the prepupal stage. Importantly, the reduction of Yorkie expression by RNAi downregulated Yorkie target genes in the ovary, decreased egg number, and delayed larval-pupal-adult metamorphosis. In contrast, baculovirus-mediated Yorkie(CA) overexpression upregulated Yorkie target genes in the PSG, increased PSG size, and accelerated larval-pupal metamorphosis. Together the results show that Yorkie potentially facilitates organ growth and metamorphosis, and suggest that the evolutionarily conserved Hippo pathway is critical for size control, particularly for PSG growth, in the silkworm.

Effects of delayed polymerization time and bracket manipulation on orthodontic resin modified glass ionomer adhesive

NASA Astrophysics Data System (ADS)

Gilbert, Danielle Wiggins

This study examined the effect of varying delayed polymerization times in combination with bracket manipulation on shear bond strength (SBS), degree of conversion (DC), and adhesive remnant index (ARI) score when using a resin modified glass ionomer (RMGI) adhesive. Specimens were divided into three groups of clinically relevant delay times (0.5, 2, and 4-min) to simulate the delay that frequently occurs between bracket placement and manipulation and subsequent light curing. Based on an analysis of variance (alpha=.05), the SBS was not significantly different between the three groups. While one of the goals of this study was to be the first study to quantify DC of RMGI using Raman microspectroscopy, several challenges, including weak peak signal with and without fluorescence, were encountered and as a result, DC could not be determined. A significant difference (p<0.05) in ARI score was detected between the 0.5-min and 4.0-min delay groups with more adhesive remaining on the bracket with increasing delay time. A Spearman correlation between SBS and ARI indicated no positive association between SBS and ARI measures across delay times. The results of this study suggest that clinically relevant delay times of 0.5, 2, and 4-min do not negatively impact the SBS of a RMGI adhesive. However, with increasing delay time, the results suggest that more adhesive might remain on the bracket during debonding. With more adhesive remaining on the bracket, this could be beneficial in that less adhesive needs to be removed from enamel by grinding at the time of bracket removal when orthodontic treatment is completed.

Delayed stabilization of dendritic spines in fragile X mice.

PubMed

Cruz-Martín, Alberto; Crespo, Michelle; Portera-Cailliau, Carlos

2010-06-09

Fragile X syndrome (FXS) causes mental impairment and autism through transcriptional silencing of the Fmr1 gene, resulting in the loss of the RNA-binding protein fragile X mental retardation protein (FMRP). Cortical pyramidal neurons in affected individuals and Fmr1 knock-out (KO) mice have an increased density of dendritic spines. The mutant mice also show defects in synaptic and experience-dependent circuit plasticity, which are known to be mediated in part by dendritic spine dynamics. We used in vivo time-lapse imaging with two-photon microscopy through cranial windows in male and female neonatal mice to test the hypothesis that dynamics of dendritic protrusions are altered in KO mice during early postnatal development. We find that layer 2/3 neurons from wild-type mice exhibit a rapid decrease in dendritic spine dynamics during the first 2 postnatal weeks, as immature filopodia are replaced by mushroom spines. In contrast, KO mice show a developmental delay in the downregulation of spine turnover and in the transition from immature to mature spine subtypes. Blockade of metabotropic glutamate receptor (mGluR) signaling, which reverses some adult phenotypes of KO mice, accentuated this immature protrusion phenotype in KO mice. Thus, absence of FMRP delays spine stabilization and dysregulated mGluR signaling in FXS may partially normalize this early synaptic defect.

Molecular and geographic evolutionary support for the essential role of GIGANTEAa in soybean domestication of flowering time.

PubMed

Wang, Yan; Gu, Yongzhe; Gao, Huihui; Qiu, Lijuan; Chang, Ruzhen; Chen, Shouyi; He, Chaoying

2016-04-12

Flowering time is a domestication trait of Glycine max and varies in soybeans, yet, a gene for flowering time variation has not been associated with soybean domestication. GIGANTEA (GI) is a major gene involved in the control of flowering time in Arabidopsis, although three GI homologs complicate this model in the soybean genome. In the present work, we revealed that the geographic evolution of the GIGANTEAa (GIa) haplotypes in G. max (GmGIa) and Glycine soja (GsGIa). Three GIa haplotypes (H1, H2, and H3) were found among cultivated soybeans and their wild relatives, yet an additional 44 diverse haplotypes were observed in wild soybeans. H1 had a premature stop codon in the 10(th) exon, whereas the other haplotypes encoded full-length GIa protein isoforms. In both wild-type and cultivated soybeans, H2 was present in the Southern region of China, and H3 was restricted to areas near the Northeast region of China. H1 was genetically derived from H2, and it was dominant and widely distributed among cultivated soybeans, whereas in wild populations, the ortholog of this domesticated haplotype H1 was only found in Yellow River basin with a low frequency. Moreover, this mutated GIa haplotype significantly correlated with early flowering. We further determined that the differences in gene expression of the three GmGIa haplotypes were not correlated to flowering time variations in cultivated soybeans. However, only the truncated GmGIa H1 could partially rescue gi-2 Arabidopsis from delayed flowering in transgenic plants, whereas both GmGIa H2 and H3 haplotypes could significantly repress flowering in transgenic Arabidopsis with a wild-type background. Thus, GmGIa haplotype diversification may have contributed to flowering time adaptation that facilitated the radiation of domesticated soybeans. In light of the evolution of the GIa gene, soybean domestication history for an early flowering phenotype is discussed.

Using a new discretization approach to design a delayed LQG controller

NASA Astrophysics Data System (ADS)

Haraguchi, M.; Hu, H. Y.

2008-07-01

In general, discrete-time controls have become more and more preferable in engineering because of their easy implementation and simple computations. However, the available discretization approaches for the systems having time delays increase the system dimensions and have a high computational cost. This paper presents an effective discretization approach for the continuous-time systems with an input delay. The approach enables one to transform the input-delay system into a delay-free system, but retain the system dimensions unchanged in the state transformation. To demonstrate an application of the approach, this paper presents the design of an LQ regulator for continuous-time systems with an input delay and gives a state observer with a Kalman filter for estimating the full-state vector from some measurements of the system as well. The case studies in the paper well support the efficacy and efficiency of the proposed approach applied to the vibration control of a three-story structure model with the actuator delay taken into account.

Pre-school children with and without developmental delay: behaviour problems and parenting stress over time.

PubMed

Baker, B L; McIntyre, L L; Blacher, J; Crnic, K; Edelbrock, C; Low, C

2003-01-01

Children with intellectual disability are at heightened risk for behaviour problems and diagnosed mental disorder. The present authors studied the early manifestation and continuity of problem behaviours in 205 pre-school children with and without developmental delays. Behaviour problems were quite stable over the year from age 36-48 months. Children with developmental delays were rated higher on behaviour problems than their non-delayed peers, and were three times as likely to score in the clinical range. Mothers and fathers showed high agreement in their rating of child problems, especially in the delayed group. Parenting stress was also higher in the delayed group, but was related to the extent of behaviour problems rather than to the child's developmental delay. Over time, a transactional model fit the relationship between parenting stress and behaviour problems: high parenting stress contributed to a worsening in child behaviour problems over time, and high child behaviour problems contributed to a worsening in parenting stress. Findings for mothers and fathers were quite similar.

49 CFR 236.563 - Delay time.

Code of Federal Regulations, 2011 CFR

2011-10-01

... OF SIGNAL AND TRAIN CONTROL SYSTEMS, DEVICES, AND APPLIANCES Automatic Train Stop, Train Control and Cab Signal Systems Rules and Instructions; Locomotives § 236.563 Delay time. Delay time of automatic train stop or train control system shall not exceed 8 seconds and the spacing of signals to meet the...

Relativistic effects in photoionization: Wigner time delay for the noble gases and IIB atoms

NASA Astrophysics Data System (ADS)

Banerjee, Sourav; Deshmukh, Pranawa; Dolmatov, Valeriy; Kheifets, Anatoli; Manson, Steven

2017-04-01

Time delay in atomic photoionization has been observed in several experiments, and various theoretical and experimental approaches are developing rapidly to obtain a better understanding of this phenomena. Theoretical methods that account for many body correlations include the relativistic random phase approximation (RRPA) and its non-relativistic analogue, RPAE. Calculations using RRPA are performed and the impact of relativistic interactions on Wigner time delay are explored via comparison of this result with RPAE results. In addition, results on Wigner time delay for Zn Cd and Hg are presented.

Delay decomposition at a single server queue with constant service time and multiple inputs. [Waiting time on computer network

NASA Technical Reports Server (NTRS)

Ziegler, C.; Schilling, D. L.

1977-01-01

Two networks consisting of single server queues, each with a constant service time, are considered. The external inputs to each network are assumed to follow some general probability distribution. Several interesting equivalencies that exist between the two networks considered are derived. This leads to the introduction of an important concept in delay decomposition. It is shown that the waiting time experienced by a customer can be decomposed into two basic components called self delay and interference delay.

Finite-time robust stabilization of uncertain delayed neural networks with discontinuous activations via delayed feedback control.

PubMed

Wang, Leimin; Shen, Yi; Sheng, Yin

2016-04-01

This paper is concerned with the finite-time robust stabilization of delayed neural networks (DNNs) in the presence of discontinuous activations and parameter uncertainties. By using the nonsmooth analysis and control theory, a delayed controller is designed to realize the finite-time robust stabilization of DNNs with discontinuous activations and parameter uncertainties, and the upper bound of the settling time functional for stabilization is estimated. Finally, two examples are provided to demonstrate the effectiveness of the theoretical results. Copyright © 2016 Elsevier Ltd. All rights reserved.

Flight Departure Delay and Rerouting Under Uncertainty in En Route Convective Weather

NASA Technical Reports Server (NTRS)

Mukherjee, Avijit; Grabbe, Shon; Sridhar, Banavar

2011-01-01

Delays caused by uncertainty in weather forecasts can be reduced by improving traffic flow management decisions. This paper presents a methodology for traffic flow management under uncertainty in convective weather forecasts. An algorithm for assigning departure delays and reroutes to aircraft is presented. Departure delay and route assignment are executed at multiple stages, during which, updated weather forecasts and flight schedules are used. At each stage, weather forecasts up to a certain look-ahead time are treated as deterministic and flight scheduling is done to mitigate the impact of weather on four-dimensional flight trajectories. Uncertainty in weather forecasts during departure scheduling results in tactical airborne holding of flights. The amount of airborne holding depends on the accuracy of forecasts as well as the look-ahead time included in the departure scheduling. The weather forecast look-ahead time is varied systematically within the experiments performed in this paper to analyze its effect on flight delays. Based on the results, longer look-ahead times cause higher departure delays and additional flying time due to reroutes. However, the amount of airborne holding necessary to prevent weather incursions reduces when the forecast look-ahead times are higher. For the chosen day of traffic and weather, setting the look-ahead time to 90 minutes yields the lowest total delay cost.

Passivity of memristive BAM neural networks with leakage and additive time-varying delays

NASA Astrophysics Data System (ADS)

Wang, Weiping; Wang, Meiqi; Luo, Xiong; Li, Lixiang; Zhao, Wenbing; Liu, Linlin; Ping, Yuan

2018-02-01

This paper investigates the passivity of memristive bidirectional associate memory neural networks (MBAMNNs) with leakage and additive time-varying delays. Based on some useful inequalities and appropriate Lyapunov-Krasovskii functionals (LKFs), several delay-dependent conditions for passivity performance are obtained in linear matrix inequalities (LMIs). Moreover, the leakage delays as well as additive delays are considered separately. Finally, numerical simulations are provided to demonstrate the feasibility of the theoretical results.

Sex Difference in Daily Rhythms of Clock Gene Expression in the Aged Human Cerebral Cortex

PubMed Central

Lim, Andrew S.P.; Myers, Amanda J.; Yu, Lei; Buchman, Aron S.; Duffy, Jeanne F.; De Jager, Philip L.; Bennett, David A.

2013-01-01

Background Studies using self-report and physiological markers of circadian rhythmicity have demonstrated sex differences in a number of circadian attributes including morningness-eveningness, entrained phase, and intrinsic period. However, these sex differences have not been examined at the level of the molecular clock, and not in human cerebral cortex. We tested the hypothesis that there are detectable daily rhythms of clock gene expression in human cerebral cortex, and that there are significant sex differences in the timing of these rhythms. Methods We quantified the expression levels of three clock genes – PER2, PER3, and ARNTL1 in samples of dorsolateral prefrontal cortex from 490 deceased individuals in two cohort studies of older individuals, the Religious Orders Study and the Rush Memory and Aging Project, using mRNA microarray data. We parameterized clock gene expression at death as a function of time of death using cosine curves, and examined for sex differences in the phase of these curves. Findings Significant daily variation was seen in the expression of PER2 (p=0.004), PER3 (p=0.003) and ARNTL1 (p=0.0005). PER2/3 expression peaked at 10:38 [95%CI 9:20–11:56] and 10:44 [95%CI 9:29–11:59] respectively, and ARNTL1 expression peaked in antiphase to this at 21:23 [95%CI 20:16–22:30]. The timing of the expression of all three genes was significantly earlier in women than in men (PER2 6.8 hours p=0.002; PER3 5.5 hours p=0.001; ARNTL1 4.7 hours p=0.007). Interpretation Daily rhythms of clock gene expression are present in human cerebral cortex and can be inferred from postmortem samples. Moreover, these rhythms are relatively delayed in men compared to women. PMID:23606611

Time signal distribution in communication networks based on synchronous digital hierarchy

NASA Technical Reports Server (NTRS)

Imaoka, Atsushi; Kihara, Masami

1993-01-01

A new method that uses round-trip paths to accurately measure transmission delay for time synchronization is proposed. The performance of the method in Synchronous Digital Hierarchy networks is discussed. The feature of this method is that it separately measures the initial round trip path delay and the variations in round-trip path delay. The delay generated in SDH equipment is determined by measuring the initial round-trip path delay. In an experiment with actual SDH equipment, the error of initial delay measurement was suppressed to 30ns.

Two unrelated children with overlapping 6q25.3 deletions, motor speech disorders, and language delays.

PubMed

Peter, Beate; Lancaster, Hope; Vose, Caitlin; Fares, Amna; Schrauwen, Isabelle; Huentelman, Matthew

2017-10-01

Interstitial and terminal 6q25 deletions are associated with developmental delays, hypotonia, eye pathologies, craniofacial dysmorphologies, and structural brain anomalies. In most cases, speech and language deficits are not described in detail. We report on a case (Patient 1, age 7 years) with a de novo 6q25.3-qter deletion, 11.1 Mb long and encompassing 108 genes, and a case (Patient 2, age 5 years) with an inherited interstitial 6q25.3 deletion, located within Patient 1's deletion region and 403 kb long, the smallest 6q25 deletion reported to date. Both children have hypotonia, motor speech disorders, and expressive language delays. Patient 1's speech was characterized by childhood apraxia of speech (CAS) and dysarthria. Other findings include developmental delay, ataxic cerebral palsy, optic nerve dysplagia, and atypical brain morphologies regarding the corpus callosum and gyration patterns, a clinical profile that closely matches a previously reported case with a nearly identical deletion. Patient 2 had speech characterized by CAS and typical nonverbal processing abilities. His father, a carrier, had typical speech and language but showed difficulties with complex motor speech and hand motor tasks, similar to other adults with residual signs of CAS. The small deletion in this family contains the IGF2R-AIRN-SLC22A2-SLC22A3 gene cluster, which is associated with imprinting and maternal-specific expression of Igf2R, Slc22a2, and Slc22a3 in mice, whereas imprinting in humans is a polymorphic trait. The shared phenotypes in the two patients might be associated with the deletion of the gene cluster. © 2017 Wiley Periodicals, Inc.

Microdeletion/microduplication of proximal 15q11.2 between BP1 and BP2: a susceptibility region for neurological dysfunction including developmental and language delay.

PubMed

Burnside, Rachel D; Pasion, Romela; Mikhail, Fady M; Carroll, Andrew J; Robin, Nathaniel H; Youngs, Erin L; Gadi, Inder K; Keitges, Elizabeth; Jaswaney, Vikram L; Papenhausen, Peter R; Potluri, Venkateswara R; Risheg, Hiba; Rush, Brooke; Smith, Janice L; Schwartz, Stuart; Tepperberg, James H; Butler, Merlin G

2011-10-01

The proximal long arm of chromosome 15 has segmental duplications located at breakpoints BP1-BP5 that mediate the generation of NAHR-related microdeletions and microduplications. The classical Prader-Willi/Angelman syndrome deletion is flanked by either of the proximal BP1 or BP2 breakpoints and the distal BP3 breakpoint. The larger Type I deletions are flanked by BP1 and BP3 in both Prader-Willi and Angelman syndrome subjects. Those with this deletion are reported to have a more severe phenotype than individuals with either Type II deletions (BP2-BP3) or uniparental disomy 15. The BP1-BP2 region spans approximately 500 kb and contains four evolutionarily conserved genes that are not imprinted. Reports of mutations or disturbed expression of these genes appear to impact behavioral and neurological function in affected individuals. Recently, reports of deletions and duplications flanked by BP1 and BP2 suggest an association with speech and motor delays, behavioral problems, seizures, and autism. We present a large cohort of subjects with copy number alteration of BP1 to BP2 with common phenotypic features. These include autism, developmental delay, motor and language delays, and behavioral problems, which were present in both cytogenetic groups. Parental studies demonstrated phenotypically normal carriers in several instances, and mildly affected carriers in others, complicating phenotypic association and/or causality. Possible explanations for these results include reduced penetrance, altered gene dosage on a particular genetic background, or a susceptibility region as reported for other areas of the genome implicated in autism and behavior disturbances.

KinD is a checkpoint protein linking spore formation to extracellular-matrix production in Bacillus subtilis biofilms.

PubMed

Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto

2010-05-18

Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed.

KinD Is a Checkpoint Protein Linking Spore Formation to Extracellular-Matrix Production in Bacillus subtilis Biofilms

PubMed Central

Aguilar, Claudio; Vlamakis, Hera; Guzman, Alejandra; Losick, Richard; Kolter, Roberto

2010-01-01

ABSTRACT Bacillus subtilis cells form multicellular biofilm communities in which spatiotemporal regulation of gene expression occurs, leading to differentiation of multiple coexisting cell types. These cell types include matrix-producing and sporulating cells. Extracellular matrix production and sporulation are linked in that a mutant unable to produce matrix is delayed for sporulation. Here, we show that the delay in sporulation is not due to a growth advantage of the matrix-deficient mutant under these conditions. Instead, we show that the link between matrix production and sporulation is through the Spo0A signaling pathway. Both processes are regulated by the phosphorylated form of the master transcriptional regulator Spo0A. When cells have low levels of phosphorylated Spo0A (Spo0A~P), matrix genes are expressed; however, at higher levels of Spo0A~P, sporulation commences. We have found that Spo0A~P levels are maintained at low levels in the matrix-deficient mutant, thereby delaying expression of sporulation-specific genes. This is due to the activity of one of the components of the Spo0A phosphotransfer network, KinD. A deletion of kinD suppresses the sporulation defect of matrix mutants, while its overproduction delays sporulation. Our data indicate that KinD displays a dual role as a phosphatase or a kinase and that its activity is linked to the presence of extracellular matrix in the biofilms. We propose a novel role for KinD in biofilms as a checkpoint protein that regulates the onset of sporulation by inhibiting the activity of Spo0A until matrix, or a component therein, is sensed. PMID:20689749

Proteomic analysis of tree peony (Paeonia ostii 'Feng Dan') seed germination affected by low temperature.

PubMed

Ren, Xiu-Xia; Xue, Jing-Qi; Wang, Shun-Li; Xue, Yu-Qian; Zhang, Ping; Jiang, Hai-Dong; Zhang, Xiu-Xin

Seed germination is a critical process that is influenced by various factors. In the present study, the effect of low temperature (4 °C) on tree peony seed germination was investigated. Compared to seeds maintained at 25 °C, germination was inhibited when seeds were kept at 4 °C. Furthermore, low-temperature exposure of seeds resulted in a delay in water uptake, starch degradation, and soluble sugar consumption and a subsequent increase in soluble protein levels. Two-dimensional gel electrophoresis (2-DE) proteomic analysis identified 100 protein spots. Comparative analysis indicated that low-temperature exposure apparently mainly affected glycolysis and the tricarboxylic acid (TCA) cycle, while also significantly affecting proteometabolism-related factors. Moreover, low-temperature exposure led to the induction of abscisic acid, whereas the gibberellin pathway was not affected. Further comparison of the two temperature conditions showed that low-temperature exposure delays carbohydrate metabolism, adenosine triphosphate (ATP) production, respiration, and proteolysis and increases defense response factors. To further examine the obtained proteomic findings, four genes were evaluated by quantitative polymerase chain reaction (qPCR). The obtained transcriptional results for the GAPC gene coincided with the translational results, thus further suggesting that the delay in glycolysis may play a key role in low-temperature-induced inhibition of seed germination. However, the other three genes examined, which included FPP synthase, PCNT115, and endochitinase, showed non-correlative transcriptional and translational profiles. Our results suggest that the exposure of tree peony seeds to low temperature results in a delay in the degradation of starch and other metabolites, which in turn affects glycolysis and some other processes, thereby ultimately inhibiting seed germination. Copyright © 2017. Published by Elsevier GmbH.

Differences in the rate of oestrogen-induced apoptosis in breast cancer by oestradiol and the triphenylethylene bisphenol

PubMed Central

Obiorah, I E; Jordan, V C

2014-01-01

Background and Purpose Triphenylethylene (TPE)-like compounds were the first agents to be used in the treatment of metastatic breast cancer in postmenopausal women. Although structurally related to the anti-oestrogen, 4-hydroxytamoxifen, TPEs possess oestrogenic properties in fully oestrogenized breast cancer cells but do not induce apoptosis with short-term treatment in long-term oestrogen-deprived breast cancer cells. This study determined the differential effects of bisphenol, a TPE, on growth and apoptosis based on the modulation of the shape of the ligand–oestrogen receptor complex. Experimental Approach Apoptotic flow cytometric studies were used to evaluate apoptosis over time. Proliferation of the breast cancer cells was assessed using DNA quantification and cell cycle analysis. Real-time PCR was performed to quantify mRNA levels of apoptotic genes. Regulation of cell cycle and apoptotic genes was determined using PCR-based arrays. Key Results Bisphenol induced an up-regulation of cell cycle genes similar to those induced by 17β oestradiol (E2). Unlike the changes induced by E2 that occur after 24 h, the apoptosis evoked by bisphenol occurred after 4 days, with quantifiable apoptotic changes noted at 6 days. A prolonged up-regulation of endoplasmic reticulum stress and inflammatory stress response genes was observed with subsequent activation of apoptosis-related genes in the second week of treatment with bisphenol. Conclusions and Implications The bisphenol: ERα complex induces delayed biological effects on the growth and apoptosis of breast cancer cells. Both the shape of the complex and the duration of treatment control the initiation of apoptosis. PMID:24819221

Understanding the Delay in Onset of Pagets Disease of Bone

DTIC Science & Technology

2015-09-01

gacaacccaggacaggaccgagccacctgcaaggaagagaaggcaggcagttcgggtctc D N P G Q D R A T C K E E K A G S S G L MVP gene D N P G Q D R A T C K E...E K A G S S G L MVV gene agcaaaccatgcctctcagcaattggatcaactgaaggcggtgcacctcgcatccgcggt S K P C L S A I G S T E G G A P R...I R G MVP gene S K P C L S A I G S T E G G A P R I R G MVV gene

Early development and molecular plasticity in the Mediterranean sea urchin Paracentrotus lividus exposed to CO2-driven acidification.

PubMed

Martin, Sophie; Richier, Sophie; Pedrotti, Maria-Luiza; Dupont, Sam; Castejon, Charlotte; Gerakis, Yannis; Kerros, Marie-Emmanuelle; Oberhänsli, François; Teyssié, Jean-Louis; Jeffree, Ross; Gattuso, Jean-Pierre

2011-04-15

Ocean acidification is predicted to have significant effects on benthic calcifying invertebrates, in particular on their early developmental stages. Echinoderm larvae could be particularly vulnerable to decreased pH, with major consequences for adult populations. The objective of this study was to understand how ocean acidification would affect the initial life stages of the sea urchin Paracentrotus lividus, a common species that is widely distributed in the Mediterranean Sea and the NE Atlantic. The effects of decreased pH (elevated P(CO(2))) were investigated through physiological and molecular analyses on both embryonic and larval stages. Eggs and larvae were reared in Mediterranean seawater at six pH levels, i.e. pH(T) 8.1, 7.9, 7.7, 7.5, 7.25 and 7.0. Fertilization success, survival, growth and calcification rates were monitored over a 3 day period. The expression of genes coding for key proteins involved in development and biomineralization was also monitored. Paracentrotus lividus appears to be extremely resistant to low pH, with no effect on fertilization success or larval survival. Larval growth was slowed when exposed to low pH but with no direct impact on relative larval morphology or calcification down to pH(T) 7.25. Consequently, at a given time, larvae exposed to low pH were present at a normal but delayed larval stage. More surprisingly, candidate genes involved in development and biomineralization were upregulated by factors of up to 26 at low pH. Our results revealed plasticity at the gene expression level that allows a normal, but delayed, development under low pH conditions.

Calpains are downstream effectors of bax-dependent excitotoxic apoptosis.

PubMed

D'Orsi, Beatrice; Bonner, Helena; Tuffy, Liam P; Düssmann, Heiko; Woods, Ina; Courtney, Michael J; Ward, Manus W; Prehn, Jochen H M

2012-02-01

Excitotoxicity resulting from excessive Ca(2+) influx through glutamate receptors contributes to neuronal injury after stroke, trauma, and seizures. Increased cytosolic Ca(2+) levels activate a family of calcium-dependent proteases with papain-like activity, the calpains. Here we investigated the role of calpain activation during NMDA-induced excitotoxic injury in embryonic (E16-E18) murine cortical neurons that (1) underwent excitotoxic necrosis, characterized by immediate deregulation of Ca(2+) homeostasis, a persistent depolarization of mitochondrial membrane potential (Δψ(m)), and insensitivity to bax-gene deletion, (2) underwent excitotoxic apoptosis, characterized by recovery of NMDA-induced cytosolic Ca(2+) increases, sensitivity to bax gene deletion, and delayed Δψ(m) depolarization and Ca(2+) deregulation, or (3) that were tolerant to excitotoxic injury. Interestingly, treatment with the calpain inhibitor calpeptin, overexpression of the endogenous calpain inhibitor calpastatin, or gene silencing of calpain protected neurons against excitotoxic apoptosis but did not influence excitotoxic necrosis. Calpeptin failed to exert a protective effect in bax-deficient neurons but protected bid-deficient neurons similarly to wild-type cells. To identify when calpains became activated during excitotoxic apoptosis, we monitored calpain activation dynamics by time-lapse fluorescence microscopy using a calpain-sensitive Förster resonance energy transfer probe. We observed a delayed calpain activation that occurred downstream of mitochondrial engagement and directly preceded neuronal death. In contrast, we could not detect significant calpain activity during excitotoxic necrosis or in neurons that were tolerant to excitotoxic injury. Oxygen/glucose deprivation-induced injury in organotypic hippocampal slice cultures confirmed that calpains were specifically activated during bax-dependent apoptosis and in this setting function as downstream cell-death executioners.

Effects of Light-Emitting Diode Therapy on Muscle Hypertrophy, Gene Expression, Performance, Damage, and Delayed-Onset Muscle Soreness: Case-control Study with a Pair of Identical Twins.

PubMed

Ferraresi, Cleber; Bertucci, Danilo; Schiavinato, Josiane; Reiff, Rodrigo; Araújo, Amélia; Panepucci, Rodrigo; Matheucci, Euclides; Cunha, Anderson Ferreira; Arakelian, Vivian Maria; Hamblin, Michael R; Parizotto, Nivaldo; Bagnato, Vanderlei

2016-10-01

The aim of this study was to verify how a pair of monozygotic twins would respond to light-emitting diode therapy (LEDT) or placebo combined with a strength-training program during 12 weeks. This case-control study enrolled a pair of male monozygotic twins, allocated randomly to LEDT or placebo therapies. Light-emitting diode therapy or placebo was applied from a flexible light-emitting diode array (λ = 850 nm, total energy = 75 J, t = 15 seconds) to both quadriceps femoris muscles of each twin immediately after each strength training session (3 times/wk for 12 weeks) consisting of leg press and leg extension exercises with load of 80% and 50% of the 1-repetition maximum test, respectively. Muscle biopsies, magnetic resonance imaging, maximal load, and fatigue resistance tests were conducted before and after the training program to assess gene expression, muscle hypertrophy and performance, respectively. Creatine kinase levels in blood and visual analog scale assessed muscle damage and delayed-onset muscle soreness, respectively, during the training program. Compared with placebo, LEDT increased the maximal load in exercise and reduced fatigue, creatine kinase, and visual analog scale. Gene expression analyses showed decreases in markers of inflammation (interleukin 1β) and muscle atrophy (myostatin) with LEDT. Protein synthesis (mammalian target of rapamycin) and oxidative stress defense (SOD2 [mitochondrial superoxide dismutase]) were up-regulated with LEDT, together with increases in thigh muscle hypertrophy. Light-emitting diode therapy can be useful to reduce muscle damage, pain, and atrophy, as well as to increase muscle mass, recovery, and athletic performance in rehabilitation programs and sports medicine.

Protein PSMD8 may mediate microgravity-induced cell cycle arrest

NASA Astrophysics Data System (ADS)

Hang, Xiaoming; Sun, Yeqing; Xu, Dan; Wu, Di; Chen, Xiaoning

Microgravity environment of space can induce a serial of changes in cells, such as morphology alterations, cytoskeleton disorder and cell cycle disturbance. Our previous study of simulated-microgravity on zebrafish (Danio rerio) embryos demonstrated 26s proteasome non-ATPase regulatory subunit 8 (PSMD8) might be a microgravity sensitive gene. However, functional study on PSMD8 is very limited and it has not been cloned in zebrafish till now. In this study, we tried to clone PSMD8 gene in zebrafish, quantify its protein expression level in zebrafish embryos after simulated microgravity and identify its possible function in cell cycle regulation. A rotary cell culture system (RCCS) designed by national aeronautics and apace administration (NASA) of America was used to simulate microgravity. The full-length of psmd8 gene in zebrafish was cloned. Preliminary analysis on its sequence and phylogenetic tree construction were carried out subsequently. Quantitative analysis by western blot showed that PSMD8 protein expression levels were significantly increased 1.18 and 1.22 times after 24-48hpf and 24-72hpf simulated microgravity, respectively. Moreover, a significant delay on zebrafish embryo development was found in simulated-microgravity exposed group. Inhibition of PSMD8 protein in zebrafish embryonic cell lines ZF4 could block cell cycle in G1 phase, which indicated that PSMD8 may play a role in cell cycle regulation. Interestingly, simulated-microgravity could also block ZF4 cell in G1 phase. Whether it is PSMD8 mediated cell cycle regulation result in the zebrafish embryo development delay after simulated microgravity exposure still needs further study. Key Words: PSMD8; Simulated-microgravity; Cell cycle; ZF4 cell line

Genetics of carbon catabolite repression in Saccharomycess cerevisiae: genes involved in the derepression process.

PubMed

Zimmermann, F K; Kaufmann, I; Rasenberger, H; Haubetamann, P

1977-02-28

A recessive mutant cat1-1, wild type CAT1, was isolated in Saccharomyces cerevisiae. It did not grow on glycerol nor ferment maltose even with fully constitutive, glucose resistant maltase synthesis. It prevented derepression of isocitrate lyase, fructose-1,6-diphosphatase and maltase in a constitutive but glucose sensitive maltase mutant. Derepression of malate dehydrogenase was retarded and slowed down. Sucrose fermentation and invertase synthesis was not affected. Respiration was normal. From this mutant, two reverse mutants were isolated. One was recessive, acted as a suppressor of cat1-1 and was called cat2-1, wild type CAT2; the other was dominant and allelic to CAT1 and designated CAT1-2d and cat2-1 caused an earlier derepression of enzymes studied but did not affect the repressed nor the fully derepressed enzyme levels. CAT1-2d and cat2-1 did not show any additive effects. It is proposed that carbon catabolite repression acts in two ways. The direct way represses synthesis of sensitive enzymes, during growth on repressing carbon sources whereas the other way regulates the derepression process. After alleviation of carbon catabolite repression, gene CAT1 becomes active and prevents the activity of CAT2 which functions as a repressor of sensitive enzyme synthesis. The CAT2 gene product has to be eliminated before derepression can actually occur. The time required for this causes a delay in derepression after the depletion of a repressible carbon source. cat1-1 cannot block CAT2 activity and therefore, derepression is blocked. cat2-1 is inactive and derepression can start after carbon catabolite repression has ceased. CAT1-2d permanently active as a repressor of CAT2 and eliminates the delay in derepression.

Staying green postharvest: how three mutations in the Arabidopsis chlorophyll b reductase gene NYC1 delay degreening by distinct mechanisms.

PubMed

Jibran, Rubina; Sullivan, Kerry L; Crowhurst, Ross; Erridge, Zoe A; Chagné, David; McLachlan, Andrew R G; Brummell, David A; Dijkwel, Paul P; Hunter, Donald A

2015-11-01

Stresses such as energy deprivation, wounding and water-supply disruption often contribute to rapid deterioration of harvested tissues. To uncover the genetic regulation behind such stresses, a simple assessment system was used to detect senescence mutants in conjunction with two rapid mapping techniques to identify the causal mutations. To demonstrate the power of this approach, immature inflorescences of Arabidopsis plants that contained ethyl methanesulfonate-induced lesions were detached and screened for altered timing of dark-induced senescence. Numerous mutant lines displaying accelerated or delayed timing of senescence relative to wild type were discovered. The underlying mutations in three of these were identified using High Resolution Melting analysis to map to a chromosomal arm followed by a whole-genome sequencing-based mapping method, termed 'Needle in the K-Stack', to identify the causal lesions. All three mutations were single base pair changes and occurred in the same gene, NON-YELLOW COLORING1 (NYC1), a chlorophyll b reductase of the short-chain dehydrogenase/reductase (SDR) superfamily. This was consistent with the mutants preferentially retaining chlorophyll b, although substantial amounts of chlorophyll b were still lost. The single base pair mutations disrupted NYC1 function by three distinct mechanisms, one by producing a termination codon, the second by interfering with correct intron splicing and the third by replacing a highly conserved proline with a non-equivalent serine residue. This non-synonymous amino acid change, which occurred in the NADPH binding domain of NYC1, is the first example of such a mutation in an SDR protein inhibiting a physiological response in plants. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Androgen deprivation results in time-dependent hypoxia in LNCaP prostate tumours: informed scheduling of the bioreductive drug AQ4N improves treatment response.

PubMed

Ming, Louise; Byrne, Niall M; Camac, Sarah Nicole; Mitchell, Christopher A; Ward, Claire; Waugh, David J; McKeown, Stephanie R; Worthington, Jenny

2013-03-15

Androgen withdrawal induces hypoxia in androgen-sensitive tissue; this is important as in the tumour microenvironment, hypoxia is known to drive malignant progression. Our study examined the time-dependent effect of androgen deprivation therapy (ADT) on tumour oxygenation and investigated the role of ADT-induced hypoxia on malignant progression in prostate tumours. LNCaP xenografted tumours were treated with anti-androgens and tumour oxygenation measured. Dorsal skin fold (DSF) chambers were used to image tumour vasculature in vivo. Quantitative PCR (QPCR) identified differential gene expression following treatment with bicalutamide. Bicalutamide-treated and vehicle-only-treated tumours were re-established in vitro, and invasion and sensitivity to docetaxel were measured. Tumour growth delay was calculated following treatment with bicalutamide combined with the bioreductive drug AQ4N. Tumour oxygenation measurements showed a precipitate decrease following initiation of ADT. A clinically relevant dose of bicalutamide (2 mg/kg/day) decreased tumour oxygenation by 45% within 24 hr, reaching a nadir of 0.09% oxygen (0.67 ± 0.06 mmHg) by Day 7; this persisted until Day 14 when it increased up to Day 28. Using DSF chambers, LNCaP tumours treated with bicalutamide showed loss of small vessels at Days 7 and 14 with revascularisation occurring by Day 21. QPCR showed changes in gene expression consistent with the vascular changes and malignant progression. Cells from bicalutamide-treated tumours were more malignant than vehicle-treated controls. Combining bicalutamide with AQ4N (50 mg/kg, single dose) caused greater tumour growth delay than bicalutamide alone. Our study shows that bicalutamide-induced hypoxia selects for cells that show malignant progression; targeting hypoxic cells may provide greater clinical benefit. Copyright © 2012 UICC.

Solar flux forecasting using mutual information with an optimal delay

NASA Technical Reports Server (NTRS)

Ashrafi, S.; Conway, D.; Rokni, M.; Sperling, R.; Roszman, L.; Cooley, J.

1993-01-01

Solar flux F(sub 10.7) directly affects the atmospheric density, thereby changing the lifetime and prediction of satellite orbits. For this reason, accurate forecasting of F(sub 10.7) is crucial for orbit determination of spacecraft. Our attempts to model and forecast F(sub 10.7) uncovered highly entangled dynamics. We concluded that the general lack of predictability in solar activity arises from its nonlinear nature. Nonlinear dynamics allow us to predict F(sub 10.7) more accurately than is possible using stochastic methods for time scales shorter than a characteristic horizon, and with about the same accuracy as using stochastic techniques when the forecasted data exceed this horizon. The forecast horizon is a function of two dynamical invariants: the attractor dimension and the Lyapunov exponent. In recent years, estimation of the attractor dimension reconstructed from a time series has become an important tool in data analysis. In calculating the invariants of the system, the first necessary step is the reconstruction of the attractor for the system from the time-delayed values of the time series. The choice of the time delay is critical for this reconstruction. For an infinite amount of noise-free data, the time delay can, in principle, be chosen almost arbitrarily. However, the quality of the phase portraits produced using the time-delay technique is determined by the value chosen for the delay time. Fraser and Swinney have shown that a good choice for this time delay is the one suggested by Shaw, which uses the first local minimum of the mutual information rather than the autocorrelation function to determine the time delay. This paper presents a refinement of this criterion and applies the refined technique to solar flux data to produce a forecast of the solar activity.

Silencing of DNase Colicin E8 Gene Expression by a Complex Nucleoprotein Assembly Ensures Timely Colicin Induction.

PubMed

Kamenšek, Simona; Browning, Douglas F; Podlesek, Zdravko; Busby, Stephen J W; Žgur-Bertok, Darja; Butala, Matej

2015-06-01

Colicins are plasmid-encoded narrow spectrum antibiotics that are synthesized by strains of Escherichia coli and govern intraspecies competition. In a previous report, we demonstrated that the global transcriptional factor IscR, co dependently with the master regulator of the DNA damage response, LexA, delays induction of the pore forming colicin genes after SOS induction. Here we show that IscR is not involved in the regulation of nuclease colicins, but that the AsnC protein is. We report that AsnC, in concert with LexA, is the key controller of the temporal induction of the DNA degrading colicin E8 gene (cea8), after DNA damage. We demonstrate that a large AsnC nucleosome-like structure, in conjunction with two LexA molecules, prevent cea8 transcription initiation and that AsnC binding activity is directly modulated by L asparagine. We show that L-asparagine is an environmental factor that has a marked impact on cea8 promoter regulation. Our results show that AsnC also modulates the expression of several other DNase and RNase colicin genes but does not substantially affect pore-forming colicin K gene expression. We propose that selection pressure has "chosen" highly conserved regulators to control colicin expression in E. coli strains, enabling similar colicin gene silencing among bacteria upon exchange of colicinogenic plasmids.

A Genome-Wide Analysis of the LBD (LATERAL ORGAN BOUNDARIES Domain) Gene Family in Malus domestica with a Functional Characterization of MdLBD11

PubMed Central

Su, Ling; Liu, Xin; Hao, Yujin

2013-01-01

The plant-specific LBD (LATERAL ORGAN BOUNDARIES domain) genes belong to a major family of transcription factor that encode a zinc finger-like domain. It has been shown that LBD genes play crucial roles in the growth and development of Arabidopsis and other plant species. However, no detailed information concerning this family is available for apple. In the present study, we analyzed the apple (Malus domestica) genome and identified 58 LBD genes. This gene family was tested for its phylogenetic relationships with homologous genes in the Arabidopsis genome, as well as its location in the genome, structure and expression. We also transformed one MdLBD gene into Arabidopsis to evaluate its function. Like Arabidopsis, apple LBD genes also have a conserved CX2CX6CX3C zinc finger-like domain in the N terminus and can be divided into two classes. The expression profile indicated that apple LBD genes exhibited a variety of expression patterns, suggesting that they have diverse functions. At the same time, the expression analysis implied that members of this apple gene family were responsive to hormones and stress and that they may participate in hormone-mediated plant organogenesis, which was demonstrated with the overexpression of the apple LBD gene MdLBD11, resulting in an abnormal phenotype. This phenotype included upward curling leaves, delayed flowering, downward-pointing flowers, siliques and other abnormal traits. Based on these data, we concluded that the MdLBD genes may play an important role in apple growth and development as in Arabidopsis and other species. PMID:23468909

BDE-47 causes developmental retardation with down-regulated expression profiles of ecdysteroid signaling pathway-involved nuclear receptor (NR) genes in the copepod Tigriopus japonicus.

PubMed

Hwang, Dae-Sik; Han, Jeonghoon; Won, Eun-Ji; Kim, Duck-Hyun; Jeong, Chang-Bum; Hwang, Un-Ki; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

2016-08-01

2,2',4,4'-Tetrabromodiphenyl ether (BDE-47) is a persistent organic pollutant (POP) in marine environments. Despite its adverse effects (e.g. developmental retardation) in ecdysozoa, the effects of BDE-47 on transcription of ecdysteroid signaling pathway-involved-nuclear receptor (NR) genes and metamorphosis-related genes have not been examined in copepods. To examine the deleterious effect of BDE-47 on copepod molting and metamorphosis, BDE-47 was exposed to the harpacticoid copepod Tigriopus japonicus, followed by monitoring developmental retardation and transcriptional alteration of NR genes. The developmental rate was significantly inhibited (P<0.05) in response to BDE-47 and the agricultural insecticide gamma-hexachlorocyclohexane. Conversely, the ecdysteroid agonist ponasterone A (PoA) led to decreased molting and metamorphosis time (P<0.05) from the nauplius stage to the adult stage. In particular, expression profiles of all NR genes were the highest at naupliar stages 5-6 except for SVP, FTZ-F1, and HR96 genes. Nuclear receptor USP, HR96, and FTZ-F1 genes also showed significant sex differences (P<0.05) in gene expression levels over different developmental stages, indicating that these genes may be involved in vitellogenesis. NR gene expression patterns showed significant decreases (P<0.05) in response to BDE-47 exposure, implying that molting and metamorphosis retardation is likely associated with NR gene expression. In summary, BDE-47 leads to molting and metamorphosis retardation and suppresses transcription of NR genes. This information will be helpful in understanding the molting and metamorphosis delay mechanism in response to BDE-47 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.

A genome-wide analysis of the LBD (LATERAL ORGAN BOUNDARIES domain) gene family in Malus domestica with a functional characterization of MdLBD11.

PubMed

Wang, Xiaofei; Zhang, Shizhong; Su, Ling; Liu, Xin; Hao, Yujin

2013-01-01

The plant-specific LBD (LATERAL ORGAN BOUNDARIES domain) genes belong to a major family of transcription factor that encode a zinc finger-like domain. It has been shown that LBD genes play crucial roles in the growth and development of Arabidopsis and other plant species. However, no detailed information concerning this family is available for apple. In the present study, we analyzed the apple (Malus domestica) genome and identified 58 LBD genes. This gene family was tested for its phylogenetic relationships with homologous genes in the Arabidopsis genome, as well as its location in the genome, structure and expression. We also transformed one MdLBD gene into Arabidopsis to evaluate its function. Like Arabidopsis, apple LBD genes also have a conserved CX2CX6CX3C zinc finger-like domain in the N terminus and can be divided into two classes. The expression profile indicated that apple LBD genes exhibited a variety of expression patterns, suggesting that they have diverse functions. At the same time, the expression analysis implied that members of this apple gene family were responsive to hormones and stress and that they may participate in hormone-mediated plant organogenesis, which was demonstrated with the overexpression of the apple LBD gene MdLBD11, resulting in an abnormal phenotype. This phenotype included upward curling leaves, delayed flowering, downward-pointing flowers, siliques and other abnormal traits. Based on these data, we concluded that the MdLBD genes may play an important role in apple growth and development as in Arabidopsis and other species.

Trithorax dependent changes in chromatin landscape at enhancer and promoter regions drive female puberty.

PubMed

Toro, Carlos A; Wright, Hollis; Aylwin, Carlos F; Ojeda, Sergio R; Lomniczi, Alejandro

2018-01-04

Polycomb group (PcG) proteins control the timing of puberty by repressing the Kiss1 gene in hypothalamic arcuate nucleus (ARC) neurons. Here we identify two members of the Trithorax group (TrxG) of modifiers, mixed-lineage leukemia 1 (MLL1), and 3 (MLL3), as central components of an activating epigenetic machinery that dynamically counteracts PcG repression. Preceding puberty, MLL1 changes the chromatin configuration at the promoters of Kiss1 and Tac3, two genes required for puberty to occur, from repressive to permissive. Concomitantly, MLL3 institutes a chromatin structure that changes the functional status of a Kiss1 enhancer from poised to active. RNAi-mediated, ARC-specific Mll1 knockdown reduced Kiss1 and Tac3 expression, whereas CRISPR-Cas9-directed epigenome silencing of the Kiss1 enhancer selectively reduced Kiss1 activity. Both interventions delay puberty and disrupt reproductive cyclicity. Our results demonstrate that an epigenetic switch from transcriptional repression to activation is crucial to the regulatory mechanism controlling the timing of mammalian puberty.

Design of hybrid optical delay line for automotive radar test system

NASA Astrophysics Data System (ADS)

Son, Byung-Hee; Kim, Kwang-Jin; Li, Ye; Park, Chang-In; Choi, Young-Wan

2015-03-01

In this paper, hybrid optical delay line (HODL) which is demanded on automotive radar test system (RTS) is proposed and demonstrated. HODL is composed with coaxial cable in short delay time (< 32 nsec) and optical fiber in long delay time (>= 32 nsec) which are considering the volume, loss and frequency characteristics. Also, the optical transceiver that has the bandwidth of 1 GHz is designed for frequency modulated continuous wave (FMCW). Experimental results show that the S21 is +/- 0.5 dB in the optical transceiver and +/- 1.7 dB in the whole system at 3.7 GHz ~ 4.7 GHz. The resolution of delay time is 1 ns and the delay flatness is +/- 0.23 ns.

The impact of physicochemical property interactions of iso -octane/ethanol blends on ignition timescales

DOE PAGES

Barraza-Botet, Cesar L.; Luecke, Jon; Zigler, Bradley T.; ...

2018-03-20

This work presents new measurements of liquid fuel ignition delay times of iso-octane and ethanol fuel blends obtained from an ignition quality tester at the National Renewable Energy Laboratory (NREL IQT), which are compared to previous ignition delay data from the University of Michigan rapid compression facility (UM RCF), at the same experimental conditions. Pressure-time histories were used to determine liquid fuel ignition delays at global stoichiometric non-premixed conditions for iso-octane, ethanol and iso-octane/ethanol blends of 25, 50, 75% by volume in mixtures of 10% oxygen diluted in nitrogen. Temperatures ranging from 880 to 970 K were studied at amore » pressure of 10 atm. By comparing total ignition delay times from the NREL IQT with chemical ignition delay times from the UM RCF, the contributions of physical phenomena were quantified as representative time scales for spray injection, breakup and evaporation processes, and for gas-phase turbulent mixing. Regression analyses were developed for ignition time scales as function of blend level and charge temperature. Non-dimensional analyses were also carried out to determine the relative effects of physical time scales with respect to chemical ignition delay times.« less

The impact of physicochemical property interactions of iso -octane/ethanol blends on ignition timescales

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barraza-Botet, Cesar L.; Luecke, Jon; Zigler, Bradley T.

This work presents new measurements of liquid fuel ignition delay times of iso-octane and ethanol fuel blends obtained from an ignition quality tester at the National Renewable Energy Laboratory (NREL IQT), which are compared to previous ignition delay data from the University of Michigan rapid compression facility (UM RCF), at the same experimental conditions. Pressure-time histories were used to determine liquid fuel ignition delays at global stoichiometric non-premixed conditions for iso-octane, ethanol and iso-octane/ethanol blends of 25, 50, 75% by volume in mixtures of 10% oxygen diluted in nitrogen. Temperatures ranging from 880 to 970 K were studied at amore » pressure of 10 atm. By comparing total ignition delay times from the NREL IQT with chemical ignition delay times from the UM RCF, the contributions of physical phenomena were quantified as representative time scales for spray injection, breakup and evaporation processes, and for gas-phase turbulent mixing. Regression analyses were developed for ignition time scales as function of blend level and charge temperature. Non-dimensional analyses were also carried out to determine the relative effects of physical time scales with respect to chemical ignition delay times.« less

A New Method to Test the Einstein’s Weak Equivalence Principle

NASA Astrophysics Data System (ADS)

Yu, Hai; Xi, Shao-Qiang; Wang, Fa-Yin

2018-06-01

The Einstein’s weak equivalence principle (WEP) is one of the foundational assumptions of general relativity and some other gravity theories. In the theory of parametrized post-Newtonian (PPN), the difference between the PPN parameters γ of different particles or the same type of particle with different energies, Δγ, represents the violation of WEP. Current constraints on Δγ are derived from the observed time delay between correlated particles of astronomical sources. However, the observed time delay is contaminated by other effects, such as the time delays due to different particle emission times, the potential Lorentz invariance violation, and none-zero photon rest mass. Therefore, current constraints are only upper limits. Here, we propose a new method to test WEP based on the fact that the gravitational time delay is direction-dependent while others are not. This is the first method that can naturally correct other time-delay effects. Using the time-delay measurements of BASTE gamma-ray burst sample and the gravitational potential of local super galaxy cluster Laniakea, we find that the constraint on Δγ of different energy photons can be as low as 10‑14. In the future, if more gravitational wave events and fast radio bursts with much more precise time-delay measurements are observed, this method can give a reliable and tight constraint on WEP.

Non-Gaussian noise-weakened stability in a foraging colony system with time delay

NASA Astrophysics Data System (ADS)

Dong, Xiaohui; Zeng, Chunhua; Yang, Fengzao; Guan, Lin; Xie, Qingshuang; Duan, Weilong

2018-02-01

In this paper, the dynamical properties in a foraging colony system with time delay and non-Gaussian noise were investigated. Using delay Fokker-Planck approach, the stationary probability distribution (SPD), the associated relaxation time (ART) and normalization correlation function (NCF) are obtained, respectively. The results show that: (i) the time delay and non-Gaussian noise can induce transition from a single peak to double peaks in the SPD, i.e., a type of bistability occurring in a foraging colony system where time delay and non-Gaussian noise not only cause transitions between stable states, but also construct the states themselves. Numerical simulations are presented and are in good agreement with the approximate theoretical results; (ii) there exists a maximum in the ART as a function of the noise intensity, this maximum for ART is identified as the characteristic of the non-Gaussian noise-weakened stability of the foraging colonies in the steady state; (iii) the ART as a function of the noise correlation time exhibits a maximum and a minimum, where the minimum for ART is identified as the signature of the non-Gaussian noise-enhanced stability of the foraging colonies; and (iv) the time delay can enhance the stability of the foraging colonies in the steady state, while the departure from Gaussian noise can weaken it, namely, the time delay and departure from Gaussian noise play opposite roles in ART or NCF.

Molecular basis and function of voltage-gated K+ channels in pulmonary arterial smooth muscle cells.

PubMed

Yuan, X J; Wang, J; Juhaszova, M; Golovina, V A; Rubin, L J

1998-04-01

K(+)-channel activity-mediated alteration of the membrane potential and cytoplasmic free Ca2+ concentration ([Ca2+]cyt) is a pivotal mechanism in controlling pulmonary vasomotor tone. By using combined approaches of patch clamp, imaging fluorescent microscopy, and molecular biology, we examined the electrophysiological properties of K+ channels and the role of different K+ currents in regulating [Ca2+]cyt and explored the molecular identification of voltage-gated K+ (KV)- and Ca(2+)-activated K+ (KCa)-channel genes expressed in pulmonary arterial smooth muscle cells (PASMC). Two kinetically distinct KV currents [IK(V)], a rapidly inactivating (A-type) and a noninactivating delayed rectifier, as well as a slowly activated KCa current [IK(Ca)] were identified. IK(V) was reversibly inhibited by 4-aminopyridine (5 mM), whereas IK(Ca) was significantly inhibited by charybdotoxin (10-20 nM). K+ channels are composed of pore-forming alpha-subunits and auxiliary beta-subunits. Five KV-channel alpha-subunit genes from the Shaker subfamily (KV1.1, KV1.2, KV1.4, KV1.5, and KV1.6), a KV-channel alpha-subunit gene from the Shab subfamily (KV2.1), a KV-channel modulatory alpha-subunit (KV9.3), and a KCa-channel alpha-subunit gene (rSlo), as well as three KV-channel beta-subunit genes (KV beta 1.1, KV beta 2, and KV beta 3) are expressed in PASMC. The data suggest that 1) native K+ channels in PASMC are encoded by multiple genes; 2) the delayed rectifier IK(V) may be generated by the KV1.1, KV1.2, KV1.5, KV1.6, KV2.1, and/or KV2.1/KV9.3 channels; 3) the A-type IK(V) may be generated by the KV1.4 channel and/or the delayed rectifier KV channels (KV1 subfamily) associated with beta-subunits; and 4) the IK(Ca) may be generated by the rSlo gene product. The function of the KV channels plays an important role in the regulation of membrane potential and [Ca2+]cyt in PASMC.

Cited2 Gene Controls Pluripotency and Cardiomyocyte Differentiation of Murine Embryonic Stem Cells through Oct4 Gene*

PubMed Central

Li, Qiang; Ramírez-Bergeron, Diana L.; Dunwoodie, Sally L.; Yang, Yu-Chung

2012-01-01

Cited2 (CBP/p300-interacting transactivator with glutamic acid (E)/aspartic acid (D)-rich tail 2) is a transcriptional modulator critical for the development of multiple organs. Although many Cited2-mediated phenotypes and molecular events have been well characterized using in vivo genetic murine models, Cited2-directed cell fate decision in embryonic stem cells (ESCs) remains elusive. In this study, we examined the role of Cited2 in the maintenance of stemness and pluripotency of murine ESCs by a gene-targeting approach. Cited2 knock-out (Cited2Δ/−, KO) ESCs display defective differentiation. Loss of Cited2 in differentiating ESCs results in delayed silencing of the genes involved in the maintenance of pluripotency and self-renewal of stem cells (Oct4, Klf4, Sox2, and c-Myc) and the disturbance in cardiomyocyte, hematopoietic, and neuronal differentiation. In addition, Cited2 KO ESCs experience a delayed induction of cardiomyocyte differentiation-associated proteins, NFAT3 (along with the reduced expression of NFAT3 target genes, Nkx2.5 and β-MHC), N-cadherin, and smooth muscle actin. CITED2 is recruited to the Oct4 promoter to regulate its expression during early ESC differentiation. This is the first demonstration that Cited2 controls ESC pluripotency and differentiation via direct regulation of Oct4 gene expression. PMID:22761414

The effect of pyramiding Phytophthora infestans resistance genes RPi-mcd1 and RPi-ber in potato

PubMed Central

Tan, M. Y. Adillah; Hutten, Ronald C. B.; Visser, Richard G. F.

2010-01-01

Despite efforts to control late blight in potatoes by introducing Rpi-genes from wild species into cultivated potato, there are still concerns regarding the durability and level of resistance. Pyramiding Rpi-genes can be a solution to increase both durability and level of resistance. In this study, two resistance genes, RPi-mcd1 and RPi-ber, introgressed from the wild tuber-bearing potato species Solanum microdontum and S. berthaultii were combined in a diploid S. tuberosum population. Individual genotypes from this population were classified after four groups, carrying no Rpi-gene, with only RPi-mcd1, with only RPi-ber, and a group with the pyramided RPi-mcd1 and RPi-ber by means of tightly linked molecular markers. The levels of resistance between the groups were compared in a field experiment in 2007. The group with RPi-mcd1 showed a significant delay to reach 50% infection of the leaf area of 3 days. The group with RPi-ber showed a delay of 3 weeks. The resistance level in the pyramid group suggested an additive effect of RPi-mcd1 with RPi-ber. This suggests that potato breeding can benefit from combining individual Rpi-genes, irrespective of the weak effect of RPi-mcd1 or the strong effect of RPi-ber. PMID:20204320

Radiation dependence of inverter propagation delay from timing sampler measurements

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Blaes, B. R.; Lin, Y.-S.

1989-01-01

A timing sampler consisting of 14 four-stage inverter-pair chains with different load capacitances was fabricated in 1.6-micron n-well CMOS and irradiated with cobalt-60 at 10 rad(Si)/s. For this CMOS process the measured results indicate that the rising delay increases by about 2.2 ns/Mrad(Si) and the falling delay increase is very small, i.e., less than 300 ps/Mrad(Si). The amount of radiation-induced delay depends on the size of the load capacitance. The maximum value observed for this effect was 5.65 ns/pF-Mrad(Si). Using a sensitivity analysis, the sensitivity of the rising delay to radiation can be explained by a simple timing model and the radiation sensitivity of dc MOSFET parameters. This same approach could not explain the insensitivity of the falling delay to radiation. This may be due to a failure of the timing model and/or trapping effects.

"ATP1A3" Mutations in Infants: A New Rapid-Onset Dystonia-Parkinsonism Phenotype Characterized by Motor Delay and Ataxia

ERIC Educational Resources Information Center

Brashear, Allison; Mink, Jonathan W.; Hill, Deborah F.; Boggs, Niki; McCall, W. Vaughn; Stacy, Mark A.; Snively, Beverly; Light, Laney S.; Sweadner, Kathleen J.; Ozelius, Laurie J.; Morrison, Leslie

2012-01-01

We report new clinical features of delayed motor development, hypotonia, and ataxia in two young children with mutations (R756H and D923N) in the "ATP1A3" gene. In adults, mutations in "ATP1A3" cause rapid-onset dystonia-Parkinsonism (RDP, DYT12) with abrupt onset of fixed dystonia. The parents and children were examined and videotaped, and…

Micromachined silicon acoustic delay line with improved structural stability and acoustic directivity for real-time photoacoustic tomography

NASA Astrophysics Data System (ADS)

Cho, Young; Kumar, Akhil; Xu, Song; Zou, Jun

2017-03-01

Recent studies have shown that micromachined silicon acoustic delay lines can provide a promising solution to achieve real-time photoacoustic tomography without the need for complex transducer arrays and data acquisition electronics. However, as its length increases to provide longer delay time, the delay line becomes more vulnerable to structural instability due to reduced mechanical stiffness. In addition, the small cross-section area of the delay line results in a large acoustic acceptance angle and therefore poor directivity. To address these two issues, this paper reports the design, fabrication, and testing of a new silicon acoustic delay line enhanced with 3D printed polymer micro linker structures. First, mechanical deformation of the silicon acoustic delay line (with and without linker structures) under gravity was simulated by using finite element method. Second, the acoustic crosstalk and acoustic attenuation caused by the polymer micro linker structures were evaluated with both numerical simulation and ultrasound transmission testing. The result shows that the use of the polymer micro linker structures significantly improves the structural stability of the silicon acoustic delay lines without creating additional acoustic attenuation and crosstalk. In addition, a new tapered design for the input terminal of the delay line was also investigate to improve its acoustic directivity by reducing the acoustic acceptance angle. These two improvements are expected to provide an effective solution to eliminate current limitations on the achievable acoustic delay time and out-of-plane imaging resolution of micromachined silicon acoustic delay line arrays.

Observer design for compensation of network-induced delays in integrated communication and control systems

NASA Technical Reports Server (NTRS)

Luck, R.; Ray, A.

1988-01-01

A method for compensating the effects of network-induced delays in integrated communication and control systems (ICCS) is proposed, and a finite-dimensional time-invariant ICCS model is developed. The problem of analyzing systems with time-varying and stochastic delays is circumvented by the application of a deterministic observer. For the case of controller-to-actuator delays, the observed design must rely on an extended model which represents the delays as additional states.

Linear stability and nonlinear analyses of traffic waves for the general nonlinear car-following model with multi-time delays

NASA Astrophysics Data System (ADS)

Sun, Dihua; Chen, Dong; Zhao, Min; Liu, Weining; Zheng, Linjiang

2018-07-01

In this paper, the general nonlinear car-following model with multi-time delays is investigated in order to describe the reactions of vehicle to driving behavior. Platoon stability and string stability criteria are obtained for the general nonlinear car-following model. Burgers equation and Korteweg de Vries (KdV) equation and their solitary wave solutions are derived adopting the reductive perturbation method. We investigate the properties of typical optimal velocity model using both analytic and numerical methods, which estimates the impact of delays about the evolution of traffic congestion. The numerical results show that time delays in sensing relative movement is more sensitive to the stability of traffic flow than time delays in sensing host motion.

De novo missense mutations in the NAA10 gene cause severe non-syndromic developmental delay in males and females

PubMed Central

Popp, Bernt; Støve, Svein I; Endele, Sabine; Myklebust, Line M; Hoyer, Juliane; Sticht, Heinrich; Azzarello-Burri, Silvia; Rauch, Anita; Arnesen, Thomas; Reis, André

2015-01-01

Recent studies revealed the power of whole-exome sequencing to identify mutations in sporadic cases with non-syndromic intellectual disability. We now identified de novo missense variants in NAA10 in two unrelated individuals, a boy and a girl, with severe global developmental delay but without any major dysmorphism by trio whole-exome sequencing. Both de novo variants were predicted to be deleterious, and we excluded other variants in this gene. This X-linked gene encodes N-alpha-acetyltransferase 10, the catalytic subunit of the NatA complex involved in multiple cellular processes. A single hypomorphic missense variant p.(Ser37Pro) was previously associated with Ogden syndrome in eight affected males from two different families. This rare disorder is characterized by a highly recognizable phenotype, global developmental delay and results in death during infancy. In an attempt to explain the discrepant phenotype, we used in vitro N-terminal acetylation assays which suggested that the severity of the phenotype correlates with the remaining catalytic activity. The variant in the Ogden syndrome patients exhibited a lower activity than the one seen in the boy with intellectual disability, while the variant in the girl was the most severe exhibiting only residual activity in the acetylation assays used. We propose that N-terminal acetyltransferase deficiency is clinically heterogeneous with the overall catalytic activity determining the phenotypic severity. PMID:25099252

Systematic Analysis of γ-Aminobutyric Acid (GABA) Metabolism and Function in the Social Amoeba Dictyostelium discoideum*

PubMed Central

Wu, Yuantai; Janetopoulos, Chris

2013-01-01

While GABA has been suggested to regulate spore encapsulation in the social amoeba Dictyostelium discoideum, the metabolic profile and other potential functions of GABA during development remain unclear. In this study, we investigated the homeostasis of GABA metabolism by disrupting genes related to GABA metabolism and signaling. Extracellular levels of GABA are tightly regulated during early development, and GABA is generated by the glutamate decarboxylase, GadB, during growth and in early development. However, overexpression of the prespore-specific homologue, GadA, in the presence of GadB reduces production of extracellular GABA. Perturbation of extracellular GABA levels delays the process of aggregation. Cytosolic GABA is degraded by the GABA transaminase, GabT, in the mitochondria. Disruption of a putative vesicular GABA transporter (vGAT) homologue DdvGAT reduces secreted GABA. We identified the GABAB receptor-like family member GrlB as the major GABA receptor during early development, and either disruption or overexpression of GrlB delays aggregation. This delay is likely the result of an abolished pre-starvation response and late expression of several “early” developmental genes. Distinct genes are employed for GABA generation during sporulation. During sporulation, GadA alone is required for generating GABA and DdvGAT is likely responsible for GABA secretion. GrlE but not GrlB is the GABA receptor during late development. PMID:23548898

A Rare de novo Interstitial Duplication at 4p15.2 in a Boy with Severe Congenital Heart Defects, Limb Anomalies, Hypogonadism, and Global Developmental Delay.

PubMed

Liang, Liyang; Xie, Yingjun; Shen, Yiping; Yin, Qibin; Yuan, Haiming

2016-01-01

Proximal 4p deletion syndrome is a relatively rare genetic condition characterized by dysmorphic facial features, limb anomalies, minor congenital heart defects, hypogonadism, cafe-au-lait spots, developmental delay, tall and thin habitus, and intellectual disability. At present, over 20 cases of this syndrome have been published. However, duplication of the same region in proximal 4p has never been reported. Here, we describe a 2-year-5-month-old boy with severe congenital heart defects, limb anomalies, hypogonadism, distinctive facial features, pre- and postnatal developmental delay, and mild cognitive impairments. A de novo 4.5-Mb interstitial duplication at 4p15.2p15.1 was detected by chromosomal microarray analysis. Next-generation sequencing was employed and confirmed the duplication, but revealed no additional pathogenic variants. Several candidate genes in this interval responsible for the complex clinical phenotype were identified, such as RBPJ, STIM2, CCKAR, and LGI2. The results suggest a novel contiguous gene duplication syndrome. © 2016 S. Karger AG, Basel.

Characterization of a complex chromosomal rearrangement using chromosome, FISH, and microarray assays in a girl with multiple congenital abnormalities and developmental delay.

PubMed

Hemmat, Morteza; Yang, Xiaojing; Chan, Patricia; McGough, Robert A; Ross, Leslie; Mahon, Loretta W; Anguiano, Arturo L; Boris, Wang T; Elnaggar, Mohamed M; Wang, Jia-Chi J; Strom, Charles M; Boyar, Fatih Z

2014-01-01

Complex chromosomal rearrangements (CCRs) are balanced or unbalanced structural rearrangements involving three or more cytogenetic breakpoints on two or more chromosomal pairs. The phenotypic anomalies in such cases are attributed to gene disruption, superimposed cryptic imbalances in the genome, and/or position effects. We report a 14-year-old girl who presented with multiple congenital anomalies and developmental delay. Chromosome and FISH analysis indicated a highly complex chromosomal rearrangement involving three chromosomes (3, 7 and 12), seven breakpoints as a result of one inversion, two insertions, and two translocations forming three derivative chromosomes. Additionally, chromosomal microarray study (CMA) revealed two submicroscopic deletions at 3p12.3 (467 kb) and 12q13.12 (442 kb). We postulate that microdeletion within the ROBO1 gene at 3p12.3 may have played a role in the patient's developmental delay, since it has potential activity-dependent role in neurons. Additionally, factors other than genomic deletions such as loss of function or position effects may also contribute to the abnormal phenotype in our patient.

Using Constant Time Delay to Teach Braille Word Recognition

ERIC Educational Resources Information Center

Hooper, Jonathan; Ivy, Sarah; Hatton, Deborah

2014-01-01

Introduction: Constant time delay has been identified as an evidence-based practice to teach print sight words and picture recognition (Browder, Ahlbrim-Delzell, Spooner, Mims, & Baker, 2009). For the study presented here, we tested the effectiveness of constant time delay to teach new braille words. Methods: A single-subject multiple baseline…

Impact of time delays on oscillatory dynamics of interlinked positive and negative feedback loops

NASA Astrophysics Data System (ADS)

Huang, Bo; Tian, Xinyu; Liu, Feng; Wang, Wei

2016-11-01

Interlinking a positive feedback loop (PFL) with a negative feedback loop (NFL) constitutes a typical motif in genetic networks, performing various functions in cell signaling. How time delay in feedback regulation affects the dynamics of such systems still remains unclear. Here, we investigate three systems of interlinked PFL and NFL with time delays: a synthetic genetic oscillator, a three-node circuit, and a simplified single-node model. The stability of steady states and the routes to oscillation in the single-node model are analyzed in detail. The amplitude and period of oscillations vary with a pointwise periodicity over a range of time delay. Larger-amplitude oscillations can be induced when the PFL has an appropriately long delay, in comparison with the PFL with no delay or short delay; this conclusion holds true for all the three systems. We unravel the underlying mechanism for the above effects via analytical derivation under a limiting condition. We also develop a stochastic algorithm for simulating a single reaction with two delays and show that robust oscillations can be maintained by the PFL with a properly long delay in the single-node system. This work presents an effective method for constructing robust large-amplitude oscillators and interprets why similar circuit architectures are engaged in timekeeping systems such as circadian clocks.

Impact of Collection and Storage of Lung Tumor Tissue on Whole Genome Expression Profiling

PubMed Central

Freidin, Maxim B.; Bhudia, Neesa; Lim, Eric; Nicholson, Andrew G.; Cookson, William O.; Moffatt, Miriam F.

2012-01-01

Gene expression profiling could assist in revealing biomarkers of lung cancer prognosis and progression. The handling of biological samples may strongly influence global gene expression, a fact that has not been addressed in many studies. We sought to investigate the changes in gene expression that may occur as a result of sample processing time and conditions. Using Illumina Human WG-6 arrays, we quantified gene expression in lung carcinoma samples from six patients obtained at chest opening before and immediately after lung resection with storage in RNAlater [T1a(CO) and T1b(LR)], after receipt of the sample for histopathology, placed in RNAlater [T2a(HP)]; snap frozen [T2b(HP.SF)]; or snap frozen and stored for 1 week [T2c(HP.SFA)], as well as formalin-fixed, paraffin-embedded (FFPE) block samples. Sampling immediately after resection closely represented the tissue obtained in situ, with only 1% of genes differing more than twofold [T1a(CO) versus T1b(LR)]. Delaying tissue harvest for an average of 30 minutes from the operating theater had a significant impact on gene expression, with approximately 25% of genes differing between T1a(CO) and T2a(HP). Many genes previously identified as lung cancer biomarkers were altered during this period. Examination of FFPE specimens showed minimal correlation with fresh samples. This study shows that tissue collection immediately after lung resection with conservation in RNAlater is an optimal strategy for gene expression profiling. PMID:22240448

Neurokinin B receptor antagonism decreases luteinising hormone pulse frequency and amplitude and delays puberty onset in the female rat.

PubMed

Li, S Y; Li, X F; Hu, M H; Shao, B; Poston, L; Lightman, S L; O'Byrne, K T

2014-08-01

The neural mechanisms controlling puberty onset remain enigmatic. Humans with loss of function mutations in TAC3 or TACR3, the genes encoding neurokinin B (NKB) or its receptor, neurokinin-3 receptor (NK3R), respectively, present with severe congenital gonadotrophin deficiency and pubertal failure. Animal studies have shown ambiguous actions of NKB-NK3R signalling with respect to controlling puberty onset. The present study aimed to determine the role of endogenous NKB-NK3R signalling in the control of pulsatile luteinising hormone (LH) secretion and the timing of puberty onset, and also whether precocious pubertal onset as a result of an obesogenic diet is similarly regulated by this neuropeptide system. Prepubertal female rats, chronically implanted with i.c.v. cannulae, were administered SB222200, a NK3R antagonist, or artificial cerebrospinal fluid via an osmotic mini-pump for 14 days. SB222200 significantly delayed the onset of vaginal opening and first oestrus (as markers of puberty) compared to controls in both normal and high-fat diet fed animals. Additionally, serial blood sampling, via chronic indwelling cardiac catheters, revealed that the increase in LH pulse frequency was delayed and that the LH pulse amplitude was reduced in response to NK3R antagonism, regardless of dietary status. These data suggest that endogenous NKB-NK3R signalling plays a role in controlling the timing of puberty and the associated acceleration of gonadotrophin-releasing hormone pulse generator frequency in the female rat. © 2014 British Society for Neuroendocrinology.