Measurement of time-dependent C P asymmetries in B 0 → K S 0 η γ decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakano, H.; Ishikawa, A.; Sumisawa, K.

Here, we report a measurement of time-dependent CP violation parameters in B 0→K 0 Sηγ decays. The study is based on a data sample, containing 772 × 10 6B¯B pairs, that was collected at the Υ(4S) resonance with the Belle detector at the KEKB asymmetric-energy e +e – collider. We obtain the CP violation parameters of S = –1.32 ± 0.77(stat) ± 0.36(syst) and A = –0.48 ± 0.41(stat) ± 0.07(syst) for the invariant mass of the K 0 Sη system up to 2.1 GeV/c 2.

Measurement of time-dependent C P asymmetries in B 0 → K S 0 η γ decays

DOE PAGES

Nakano, H.; Ishikawa, A.; Sumisawa, K.; ...

2018-05-18

Here, we report a measurement of time-dependent CP violation parameters in B 0→K 0 Sηγ decays. The study is based on a data sample, containing 772 × 10 6B¯B pairs, that was collected at the Υ(4S) resonance with the Belle detector at the KEKB asymmetric-energy e +e – collider. We obtain the CP violation parameters of S = –1.32 ± 0.77(stat) ± 0.36(syst) and A = –0.48 ± 0.41(stat) ± 0.07(syst) for the invariant mass of the K 0 Sη system up to 2.1 GeV/c 2.

Comparison of four different fuller's earth formulations in skin decontamination.

PubMed

Roul, Annick; Le, Cong-Anh-Khanh; Gustin, Marie-Paule; Clavaud, Emmanuel; Verrier, Bernard; Pirot, Fabrice; Falson, Françoise

2017-12-01

Industrial accidents, wars and terrorist threats are potential sources of skin contamination by highly toxic chemical warfare agents and manufacturing compounds. We have compared the time-dependent adsorption capacity and decontamination efficiency of fuller's earth (FE) for four different formulations for the molecular tracer, 4-cyanophenol (4-CP), in vitro and ex vivo using water decontamination as standard. The adsorption capacity of FE was assessed in vitro for 4-CP aqueous solutions whereas decontamination efficiency was investigated ex vivo by tracking porcine skin 4-CP content using attenuated total reflectance Fourier transform infrared spectroscopy. Decontamination was performed on short time, exposed porcine skin to 4-CP by application of FE: (1) as free powder; (2) loaded on adhesive tape; (3) on powdered glove; or (4) in suspension. Removal rate of 4-CP from aqueous solutions correlates with the amount of FE and its contact time. Decontamination efficiency estimated by the percentage of 4-CP recovery from contaminated porcine skin, achieved 54% with water, ranged between ~60 and 70% with dry FE and reached ~90% with FE suspension. Successful decontamination of the FE suspension, enabling a dramatic reduction of skin contamination after a brief exposure scenario, appears to be rapid, reliable and should be formulated in a new device ready to use for self-application. Copyright © 2017 John Wiley & Sons, Ltd.

Cytotoxic, Anti-Proliferative and Apoptosis Activity of l-Amino Acid Oxidase from Malaysian Cryptelytrops purpureomaculatus (CP-LAAO) Venom on Human Colon Cancer Cells.

PubMed

Zainal Abidin, Syafiq Asnawi; Rajadurai, Pathmanathan; Hoque Chowdhury, Md Ezharul; Othman, Iekhsan; Naidu, Rakesh

2018-06-08

The aim of this study is to investigate the potential anti-cancer activity of l-amino acid oxidase (CP-LAAO) purified from the venom of Cryptelytrops purpureomaculatus on SW480 and SW620 human colon cancer cells. Mass spectrometry guided purification was able to identify and purify CP-LAAO. Amino acid variations identified from the partial protein sequence of CP-LAAO may suggest novel variants of these proteins. The activity of the purified CP-LAAO was confirmed with o-phenyldiamine (OPD)-based spectrophotometric assay. CP-LAAO demonstrated time- and dose-dependent cytotoxic activity and the EC 50 value was determined at 13 µg/mL for both SW480 and SW620 cells. Significant increase of caspase-3 activity, reduction of Bcl-2 levels, as well as morphological changes consistent with apoptosis were demonstrated by CP-LAAO. Overall, these data provide evidence on the potential anti-cancer activity of CP-LAAO from the venom of Malaysian C. purpureomaculatus for therapeutic intervention of human colon cancer.

Penguin and rare decays in BaBar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akar, Simon

2015-04-29

We present recent results from the BABAR Collaboration on radiative decays. These include searches for new physics via measurements of several observables such as the time- dependent CP asymmetry in B 0 → K 0 Sπ – π +γ exclusive decays, as well as direct CP asymmetries and branching fractions in B → X sγ and B → X sℓ +ℓ – inclusive decays.

Antimutagenic effects of garlic extract on chromosomal aberrations.

PubMed

Shukla, Yogeshwer; Taneja, Pankaj

2002-02-08

Garlic (Allium sativum) has been used since ancient times, as a spice and also for its medicinal properties. In present set of investigations antimutagenic effect of garlic extract (GE) has been evaluated using 'in vivo chromosomal aberration assay' in Swiss albino mice. Cyclophosphamide (CP), a well-known mutagen, was given at a single dose of 25 mg/kg b.w. intraperitoneally. Pretreatment with 1, 2.5 and 5% of freshly prepared GE was given through oral intubation for 5 days prior to CP administration. Animals from all the groups were sacrificed at sampling times of 24 and 48 h and their bone marrow tissue was analyzed for chromosomal damage. The animals of the positive control group (CP alone) shows a significant increase in chromosomal aberrations both at 24 and 48 h sampling time. GE, alone did not significantly induced aberrations at either sampling time, confirming its non-mutagenicity. However in the GE pre-treated and CP post-treated groups, a dose dependent decrease in cytogenetic damage was recorded. A significant suppression in the chromosomal aberrations was recorded following pretreatment with 2.5 and 5% GE administration. The anticytotoxic effects of GE were also evident, as observed by significant increase in mitotic index, when compared to positive control group. Reduction in CP induced clastogenicity by GE was evident at 24 h and to a much greater extent at 48 h of cell cycle. Thus results of the present investigations revealed that GE has chemopreventive potential against CP induced chromosomal mutations in Swiss albino mice.

Measurement of D0-D0 mixing parameters in D0 --> Ks pi+ pi- decays.

PubMed

Zhang, L M; Zhang, Z P; Adachi, I; Aihara, H; Aulchenko, V; Aushev, T; Bakich, A M; Balagura, V; Barberio, E; Bay, A; Belous, K; Bitenc, U; Bondar, A; Bozek, A; Bracko, M; Brodzicka, J; Browder, T E; Chang, P; Chao, Y; Chen, A; Chen, K-F; Chen, W T; Cheon, B G; Chiang, C-C; Cho, I-S; Choi, Y; Choi, Y K; Dalseno, J; Danilov, M; Dash, M; Drutskoy, A; Eidelman, S; Epifanov, D; Fratina, S; Gabyshev, N; Gokhroo, G; Golob, B; Ha, H; Haba, J; Hara, T; Hastings, N C; Hayasaka, K; Hayashii, H; Hazumi, M; Heffernan, D; Hokuue, T; Hoshi, Y; Hou, W-S; Hsiung, Y B; Hyun, H J; Iijima, T; Ikado, K; Inami, K; Ishikawa, A; Ishino, H; Itoh, R; Iwasaki, M; Iwasaki, Y; Joshi, N J; Kah, D H; Kaji, H; Kajiwara, S; Kang, J H; Kawai, H; Kawasaki, T; Kichimi, H; Kim, H J; Kim, H O; Kim, S K; Kim, Y J; Kinoshita, K; Korpar, S; Krizan, P; Krokovny, P; Kumar, R; Kuo, C C; Kuzmin, A; Kwon, Y-J; Lee, J S; Lee, M J; Lee, S E; Lesiak, T; Li, J; Limosani, A; Lin, S-W; Liu, Y; Liventsev, D; Matsumoto, T; Matyja, A; McOnie, S; Medvedeva, T; Mitaroff, W; Miyake, H; Miyata, H; Miyazaki, Y; Mizuk, R; Nagasaka, Y; Nakamura, I; Nakano, E; Nakao, M; Natkaniec, Z; Nishida, S; Nitoh, O; Ogawa, S; Ohshima, T; Okuno, S; Olsen, S L; Onuki, Y; Ostrowicz, W; Ozaki, H; Pakhlov, P; Pakhlova, G; Park, C W; Park, H; Peak, L S; Pestotnik, R; Piilonen, L E; Poluektov, A; Sahoo, H; Sakai, Y; Schneider, O; Schümann, J; Schwanda, C; Schwartz, A J; Seidl, R; Senyo, K; Sevior, M E; Shapkin, M; Shibuya, H; Shinomiya, S; Shiu, J-G; Shwartz, B; Singh, J B; Sokolov, A; Somov, A; Soni, N; Stanic, S; Staric, M; Stoeck, H; Sumisawa, K; Sumiyoshi, T; Suzuki, S; Tajima, O; Takasaki, F; Tamai, K; Tamura, N; Tanaka, M; Taylor, G N; Teramoto, Y; Tian, X C; Tikhomirov, I; Tsuboyama, T; Uehara, S; Ueno, K; Uglov, T; Unno, Y; Uno, S; Urquijo, P; Usov, Y; Varner, G; Vervink, K; Villa, S; Vinokurova, A; Wang, C H; Wang, M-Z; Wang, P; Watanabe, Y; Won, E; Yabsley, B D; Yamaguchi, A; Yamashita, Y; Yamauchi, M; Yuan, C Z; Zhang, C C; Zhilich, V; Zupanc, A

2007-09-28

We report a measurement of D0-D(0) mixing parameters in D(0) --> K(s)(0) pi(+) pi(-) decays using a time-dependent Dalitz-plot analysis. We first assume CP conservation and subsequently allow for CP violation. The results are based on 540 fb(-1) of data accumulated with the Belle detector at the KEKB e(+)e(-) collider. Assuming negligible CP violation, we measure the mixing parameters x = (0.80 +/- 0.29(-0.07-0.14)(+0.09+0.10))% and y = (0.33+/-0.24(-0.12-0.08)(+0.08+0.06))%, where the errors are statistical, experimental systematic, and systematic due to the Dalitz decay model, respectively. Allowing for CP violation, we obtain the CP-violating parameters |q / p| = 0.86(-0.29-0.03)(+0.30+0.06) +/- 0.08 and arg(q/p) = (-14(-18-3-4)(+16+5+2)) degrees .

Photofragmentation of Gas-Phase Lanthanide Cyclopentadienyl Complexes: Experimental and Time-Dependent Excited-State Molecular Dynamics

PubMed Central

2015-01-01

Unimolecular gas-phase laser-photodissociation reaction mechanisms of open-shell lanthanide cyclopentadienyl complexes, Ln(Cp)3 and Ln(TMCp)3, are analyzed from experimental and computational perspectives. The most probable pathways for the photoreactions are inferred from photoionization time-of-flight mass spectrometry (PI-TOF-MS), which provides the sequence of reaction intermediates and the distribution of final products. Time-dependent excited-state molecular dynamics (TDESMD) calculations provide insight into the electronic mechanisms for the individual steps of the laser-driven photoreactions for Ln(Cp)3. Computational analysis correctly predicts several key reaction products as well as the observed branching between two reaction pathways: (1) ligand ejection and (2) ligand cracking. Simulations support our previous assertion that both reaction pathways are initiated via a ligand-to-metal charge-transfer (LMCT) process. For the more complex chemistry of the tetramethylcyclopentadienyl complexes Ln(TMCp)3, TMESMD is less tractable, but computational geometry optimization reveals the structures of intermediates deduced from PI-TOF-MS, including several classic “tuck-in” structures and products of Cp ring expansion. The results have important implications for metal–organic catalysis and laser-assisted metal–organic chemical vapor deposition (LCVD) of insulators with high dielectric constants. PMID:24910492

Bayesian inference supports a location and neighbour-dependent model of DNA methylation propagation at the MGMT gene promoter in lung tumours.

PubMed

Bonello, Nicolas; Sampson, James; Burn, John; Wilson, Ian J; McGrown, Gail; Margison, Geoff P; Thorncroft, Mary; Crossbie, Philip; Povey, Andrew C; Santibanez-Koref, Mauro; Walters, Kevin

2013-11-07

We exploit model-based Bayesian inference methodologies to analyse lung tumour-derived methylation data from a CpG island in the O6-methylguanine-DNA methyltransferase (MGMT) promoter. Interest is in modelling the changes in methylation patterns in a CpG island in the first exon of the promoter during lung tumour development. We propose four competils of methylation state propagation based on two mechanisms. The first is the location-dependence mechanism in which the probability of a gain or loss of methylation at a CpG within the promoter depends upon its location in the CpG sequence. The second mechanism is that of neighbour-dependence in which gain or loss of methylation at a CpG depends upon the methylation status of the immediately preceding CpG. Our data comprises the methylation status at 12 CpGs near the 5' end of the CpG island in two lung tumour samples for both alleles of a nearby polymorphism. We use approximate Bayesian computation, a computationally intensive rejection-sampling algorithm to infer model parameters and compare models without the need to evaluate the likelihood function. We compare the four proposed models using two criteria: the approximate Bayes factors and the distribution of the Euclidean distance between the summary statistics of the observed and simulated datasets. Our model-based analysis demonstrates compelling evidence for both location and neighbour dependence in the process of aberrant DNA methylation of this MGMT promoter CpG island in lung tumours. We find equivocal evidence to support the hypothesis that the methylation patterns of the two alleles evolve independently. © 2013 Published by Elsevier Ltd. All rights reserved.

Antitumor Activities of Rauwolfia vomitoria Extract and Potentiation of Carboplatin Effects Against Ovarian Cancer.

PubMed

Yu, Jun; Ma, Yan; Drisko, Jeanne; Chen, Qi

2013-12-01

Tumor resistance to platinum-based drugs has been an obstacle to the treatment of ovarian cancer. Extract of the plant Rauwolfia vomitoria has long been used by cancer patients. However, there have not been systematic studies of its anticancer activity. In an effort to enhance the effectiveness of platinum-based drugs, we investigated the anticancer effect of a Rauwolfia vomitoria extract (Rau), both alone and in combination with carboplatin (Cp). In vitro cytotoxicity and colony formation were evaluated in several ovarian cancer cell lines. In vivo effects were evaluated in an intraperitoneal ovarian cancer mouse model. The combination of Rau and Cp was assessed using Chou-Talalay's constant ratio design and median effect analysis based on the isobologram principle to determine the combination index values. Rau decreased cell growth in all 3 tested ovarian cancer cell lines dose dependently and completely inhibited formation of colonies in soft agar. Apoptosis was induced in a time- and dose-dependent manner and was the predominant form of Rau-induced cell death. Synergy of Rau with Cp was detected, with combination index values <1 and dose reduction index values for Cp ranging from 1.7- to 7-fold. Tumor growth in mice was significantly suppressed by 36% or 66% with Rau treatment alone at a low (20 mg/kg) or a high dose (50 mg/kg), respectively, an effect comparable to that of Cp alone. The volume of ascitic fluid and the number of nonblood cells in ascites were also significantly decreased. Combining Rau with Cp remarkably enhanced the effect of Cp and reduced tumor burden by 87% to 90% and ascites volume by 89% to 97%. Rau has potent antitumor activity and in combination significantly enhances the effect of Cp against ovarian cancer.

The Antimalarial Artemisinin Synergizes with Antibiotics To Protect against Lethal Live Escherichia coli Challenge by Decreasing Proinflammatory Cytokine Release

PubMed Central

Wang, Jun; Zhou, Hong; Zheng, Jiang; Cheng, Juan; Liu, Wei; Ding, Guofu; Wang, Liangxi; Luo, Ping; Lu, Yongling; Cao, Hongwei; Yu, Shuangjiang; Li, Bin; Zhang, Lezhi

2006-01-01

In the present study artemisinin (ART) was found to have potent anti-inflammatory effects in animal models of sepsis induced by CpG-containing oligodeoxy-nucleotides (CpG ODN), lipopolysaccharide (LPS), heat-killed Escherichia coli 35218 or live E. coli. Furthermore, we found that ART protected mice from a lethal challenge by CpG ODN, LPS, or heat-killed E. coli in a dose-dependent manner and that the protection was related to a reduction in serum tumor necrosis factor alpha (TNF-α). More significantly, the administration of ART together with ampicillin or unasyn (a complex of ampicillin and sulbactam) decreased mortality from 100 to 66.7% or 33.3%, respectively, in mice subjected to a lethal live E. coli challenge. Together with the observation that ART alone does not inhibit bacterial growth, this result suggests that ART protection is achieved as a result of its anti-inflammatory activity rather than an antimicrobial effect. In RAW264.7 cells, pretreatment with ART potently inhibited TNF-α and interleukin-6 release induced by CpG ODN, LPS, or heat-killed E. coli in a dose- and time-dependent manner. Experiments utilizing affinity sensor technology revealed no direct binding of ART with CpG ODN or LPS. Flow cytometry further showed that ART did not alter binding of CpG ODN to cell surfaces or the internalization of CpG ODN. In addition, upregulated levels of TLR9 and TLR4 mRNA were not attenuated by ART treatment. ART treatment did, however, block the NF-κB activation induced by CpG ODN, LPS, or heat-killed E. coli. These findings provide compelling evidence that ART may be an important potential drug for sepsis treatment. PMID:16801421

Caspase-1 Dependent IL-1β Secretion Is Critical for Host Defense in a Mouse Model of Chlamydia pneumoniae Lung Infection

PubMed Central

Shimada, Kenichi; Crother, Timothy R.; Karlin, Justin; Chen, Shuang; Chiba, Norika; Ramanujan, V. Krishnan; Vergnes, Laurent; Ojcius, David M.; Arditi, Moshe

2011-01-01

Chlamydia pneumoniae (CP) is an important human pathogen that causes atypical pneumonia and is associated with various chronic inflammatory disorders. Caspase-1 is a key component of the ‘inflammasome’, and is required to cleave pro-IL-1β to bioactive IL-1β. Here we demonstrate for the first time a critical requirement for IL-1β in response to CP infection. Caspase-1−/− mice exhibit delayed cytokine production, defective clearance of pulmonary bacteria and higher mortality in response to CP infection. Alveolar macrophages harbored increased bacterial numbers due to reduced iNOS levels in Caspase-1−/− mice. Pharmacological blockade of the IL-1 receptor in CP infected wild-type mice phenocopies Caspase-1-deficient mice, and administration of recombinant IL-1β rescues CP infected Caspase-1−/− mice from mortality, indicating that IL-1β secretion is crucial for host immune defense against CP lung infection. In vitro investigation reveals that CP-induced IL-1β secretion by macrophages requires TLR2/MyD88 and NLRP3/ASC/Caspase-1 signaling. Entry into the cell by CP and new protein synthesis by CP are required for inflammasome activation. Neither ROS nor cathepsin was required for CP infection induced inflammasome activation. Interestingly, Caspase-1 activation during CP infection occurs with mitochondrial dysfunction indicating a possible mechanism involving the mitochondria for CP-induced inflammasome activation. PMID:21731762

Measurement of branching fraction and time-dependent CP asymmetry parameters in B{sup 0}{yields}D*{sup +}D*{sup -}K{sub S}{sup 0} decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dalseno, J.; Moloney, G. R.; Sevior, M. E.

2007-10-01

We present a measurement of the branching fraction and time-dependent CP violation parameters for B{sup 0}{yields}D*{sup +}D*{sup -}K{sub S}{sup 0} decays. These results are obtained from a 414 fb{sup -1} data sample that contains 449x10{sup 6} BB pairs collected at the {upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric-energy e{sup +}e{sup -} collider. We obtain the branching fraction, B(B{sup 0}{yields}D*{sup +}D*{sup -}K{sub S}{sup 0})=[3.4{+-}0.4(stat){+-}0.7(syst)]x10{sup -3}, which is in agreement with the current world average. We also obtain an upper limit on the product branching fraction for a possible two-body decay, B(B{sup 0}{yields}D{sub s1}{sup +}(2536)D*{sup -})B(D{sub s1}{sup +}(2536){yields}D*{sup +}K{submore » S}{sup 0})<7.1x10{sup -4} (90% CL). In the traditional 2-parameter time-dependent CP analysis, we measure the CP violation parameters, A{sub CP}=-0.01{sub -0.28}{sup +0.28}(stat){+-}0.09(syst), Dsin2{phi}{sub 1}=0.06{sub -0.44}{sup +0.45}(stat){+-}0.06(syst). No evidence for either mixing-induced or direct CP violation is found. In a 3-parameter fit sensitive to cos2{phi}{sub 1} performed in the half-Dalitz spaces, s{sup -}{<=}s{sup +} and s{sup -}>s{sup +}, where s{sup {+-}}{identical_to}m{sup 2}(D*{sup {+-}}K{sub S}{sup 0}), we extract the CP violation parameters, J{sub c}/J{sub 0}=0.60{sub -0.28}{sup +0.25}(stat){+-}0.08(syst), 2J{sub s1}/J{sub 0}sin2{phi}{sub 1}=-0.17{sub -0.42}{sup +0.42}(stat){+-}0.09(syst), 2J{sub s2}/J{sub 0}cos2{phi}{sub 1}=-0.23{sub -0.41}{sup +0.43}(stat){+-}0.13(syst). A large value of J{sub c}/J{sub 0} would indicate a significant resonant contribution from a broad unknown D{sub s}**{sup +} state. Although the sign of the factor, 2J{sub s2}/J{sub 0}, can be deduced from theory, no conclusion can be drawn regarding the sign of cos2{phi}{sub 1} given the errors.« less

The Heteroaryldihydropyrimidine Bay 38-7690 Induces Hepatitis B Virus Core Protein Aggregates Associated with Promyelocytic Leukemia Nuclear Bodies in Infected Cells.

PubMed

Huber, Andrew D; Wolf, Jennifer J; Liu, Dandan; Gres, Anna T; Tang, Jing; Boschert, Kelsey N; Puray-Chavez, Maritza N; Pineda, Dallas L; Laughlin, Thomas G; Coonrod, Emily M; Yang, Qiongying; Ji, Juan; Kirby, Karen A; Wang, Zhengqiang; Sarafianos, Stefan G

2018-04-25

Heteroaryldihydropyrimidines (HAPs) are compounds that inhibit hepatitis B virus (HBV) replication by modulating viral capsid assembly. While their biophysical effects on capsid assembly in vitro have been previously studied, the effect of HAP treatment on capsid protein (Cp) in individual HBV-infected cells remains unknown. We report here that the HAP Bay 38-7690 promotes aggregation of recombinant Cp in vitro and causes a time- and dose-dependent decrease of Cp in infected cells, consistent with previously studied HAPs. Interestingly, immunofluorescence analysis showed Cp aggregating in nuclear foci of Bay 38-7690-treated infected cells in a time- and dose-dependent manner. We found these foci to be associated with promyelocytic leukemia (PML) nuclear bodies (NBs), which are structures that affect many cellular functions, including DNA damage response, transcription, apoptosis, and antiviral responses. Cp aggregation is not an artifact of the cell system used, as it is observed in HBV-expressing HepAD38 cells, in HepG2 cells transfected with an HBV-expressing plasmid, and in HepG2-NTCP cells infected with HBV. Use of a Cp overexpression vector without HBV sequences shows that aggregation is independent of viral replication, and use of an HBV-expressing plasmid harboring a HAP resistance mutation in Cp abrogated the aggregation, demonstrating that the effect is due to direct compound-Cp interactions. These studies provide novel insight into the effects of HAP-based treatment at a single-cell level. IMPORTANCE Despite the availability of effective vaccines and treatments, HBV remains a significant global health concern, with more than 240 million individuals chronically infected. Current treatments are highly effective at controlling viral replication and disease progression but rarely cure infections. Therefore, much emphasis is being placed on finding therapeutics with new drug targets, such as viral gene expression, covalently closed circular DNA formation and stability, capsid formation, and host immune modulators, with the ultimate goal of an HBV cure. Understanding the mechanisms by which novel antiviral agents act will be imperative for the development of curative HBV therapies. Copyright © 2018 Huber et al.

Synthesis, structural characterization and conversion of dinuclear iron-sulfur clusters containing the disulfide ligand: [Cp*Fe(μ-η2:η2-bdt)(cis-μ-η1:η1-S2)FeCp*], [Cp*Fe(μ-S(C6H4S2))(cis-μ-η1:η1-S2)FeCp*], and [{Cp*Fe(bdt)}2(trans-μ-η1:η1-S2)].

PubMed

Ji, Xiaoxiao; Tong, Peng; Yang, Dawei; Wang, Baomin; Zhao, Jinfeng; Li, Yang; Qu, Jingping

2017-03-21

The treatment of [Cp*Fe(μ-η 2 :η 4 -bdt)FeCp*] (1, Cp* = η 5 -C 5 Me 5 , bdt = benzene-1,2-dithiolate) with 1/4 equiv. of elemental sulfur (S 8 ) gave a dinuclear iron-sulfur cluster [Cp*Fe(μ-η 2 :η 2 -bdt)(cis-μ-η 1 :η 1 -S 2 )FeCp*] (2), which contains a cis-1,2-disulfide ligand. When complex 2 further interacted with 1/8 equiv. of S 8 , another sulfur atom inserted into an Fe-S bond to give a rare product [Cp*Fe(μ-S(C 6 H 4 S 2 ))(cis-μ-η 1 :η 1 -S 2 )FeCp*] (3). Unexpectedly, a trans-1,2 disulfide-bridged diiron complex [{Cp*Fe(bdt)} 2 (trans-μ-η 1 :η 1 -S 2 )] (4) was isolated from the reaction of complex 1 with 1/2 equiv. of S 8 , which represents a structural isomer of [2Fe-2S] ferredoxin-type clusters. In addition, cis-1,2-disulfide-bridged complex 3 can slowly convert into trans-1,2-disulfide-bridged complex 4 and the complex [Cp*Fe(μ-η 2 :η 2 -S 2 )(cis-μ-η 1 :η 1 -S 2 )FeCp*] (5) by self-assembly reaction at ambient temperature, which is evidenced by time-dependent 1 H NMR spectroscopy.

Surface modification of PLGA nanoparticles by carbopol to enhance mucoadhesion and cell internalization.

PubMed

Surassmo, Suvimol; Saengkrit, Nattika; Ruktanonchai, Uracha Rungsardthong; Suktham, Kunat; Woramongkolchai, Noppawan; Wutikhun, Tuksadon; Puttipipatkhachorn, Satit

2015-06-01

Mucoadhesive poly (lactic-co-glycolic acid) (PLGA) nanoparticles having a modified shell-matrix derived from polyvinyl alcohol (PVA) and Carbopol (CP), a biodegradable polymer coating, to improve the adhesion and cell transfection properties were developed. The optimum formulations utilized a CP concentration in the range of 0.05-0.2%w/v, and were formed using modified emulsion-solvent evaporation technique. The resulting CP-PLGA nanoparticles were characterized in terms of their physical and chemical properties. The absorbed CP on the PLGA shell-matrix was found to affect the particle size and surface charge, with 0.05% CP giving rise to smooth spherical particles (0.05CP-PLGA) with the smallest size (285.90 nm), and strong negative surface charge (-25.70 mV). The introduction of CP results in an enhancement of the mucoadhesion between CP-PLGA nanoparticles and mucin particles. In vitro cell internalization studies highlighted the potential of 0.05CP-PLGA nanoparticles for transfection into SiHa cells, with uptake being time dependent. Additionally, cytotoxicity studies of CP-PLGA nanoparticles against SiHa cancer cells indicated that low concentrations of the nanoparticles were non-toxic to cells (cell viability >80%). From the various formulations studied, 0.05CP-PLGA nanoparticles proved to be the optimum model carrier having the required mucoadhesive profile and could be an alternative therapeutic efficacy carrier for targeted mucosal drug delivery systems with biodegradable polymer. Copyright © 2015 Elsevier B.V. All rights reserved.

The Evaluation of CP-001 (a Standardized Herbal Mixture of Houttuynia cordata, Rehmannia glutinosa, Betula platyphylla, and Rubus coreanus) for Cytochrome P450-Related Herb-Drug Interactions

PubMed Central

Yoo, Hye Hyun; Kim, Sun-A; Kim, In Sook; Ko, Seong-Gyu

2013-01-01

In the present study, the effect of CP-001, a standardized herbal mixture of Houttuynia cordata, Rehmannia glutinosa, Betula platyphylla, and Rubus coreanus, on cytochrome P450 (CYP) enzyme-mediated drug metabolism was investigated in vitro to evaluate the potential for herb-drug interactions. CP-001 was tested at concentrations of 1, 3, 10, 30, and 100 μg/mL. A CYP-specific substrate mixture was incubated with CP-001 in human liver microsomes, and the metabolites generated by each CYP-specific metabolic reaction were measured by liquid chromatography-tandem mass spectrometry. CP-001 seemed to slightly inhibit some CYP isozymes, but the IC50 values for all CYP isozymes were greater than 100 μg/mL. Furthermore, CP-001 did not exhibit time-dependent CYP inhibitory activities, indicating that it does not act as a mechanism-based inactivator of CYP enzymes. In conclusion, the effects of CP-001 on CYP isozyme activities were negligible at the concentrations tested. Therefore, the likelihood of herbal mixture-drug interaction is considered minimal. PMID:23935684

Measurement of CP Violation in B^{0}→D^{+}D^{-} Decays.

PubMed

Aaij, R; Adeva, B; Adinolfi, M; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Andreassi, G; Andreotti, M; Andrews, J E; Appleby, R B; Archilli, F; d'Argent, P; Arnau Romeu, J; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Babuschkin, I; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Baker, S; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Baszczyk, M; Batozskaya, V; Batsukh, B; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Bel, L J; Bellee, V; Belloli, N; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bertolin, A; Betti, F; Bettler, M-O; van Beuzekom, M; Bezshyiko, Ia; Bifani, S; Billoir, P; Bird, T; Birnkraut, A; Bitadze, A; Bizzeti, A; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Boettcher, T; Bondar, A; Bondar, N; Bonivento, W; Borgheresi, A; Borghi, S; Borisyak, M; Borsato, M; Bossu, F; Boubdir, M; Bowcock, T J V; Bowen, E; Bozzi, C; Braun, S; Britsch, M; Britton, T; Brodzicka, J; Buchanan, E; Burr, C; Bursche, A; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Campora Perez, D H; Capriotti, L; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carniti, P; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cavallero, G; Cenci, R; Charles, M; Charpentier, Ph; Chatzikonstantinidis, G; Chefdeville, M; Chen, S; Cheung, S-F; Chobanova, V; Chrzaszcz, M; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Cogoni, V; Cojocariu, L; Collazuol, G; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombs, G; Coquereau, S; Corti, G; Corvo, M; Costa Sobral, C M; Couturier, B; Cowan, G A; Craik, D C; Crocombe, A; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Da Cunha Marinho, F; Dall'Occo, E; Dalseno, J; David, P N Y; Davis, A; De Aguiar Francisco, O; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Serio, M; De Simone, P; Dean, C-T; Decamp, D; Deckenhoff, M; Del Buono, L; Demmer, M; Derkach, D; Deschamps, O; Dettori, F; Dey, B; Di Canto, A; Dijkstra, H; Dordei, F; Dorigo, M; Dosil Suárez, A; Dovbnya, A; Dreimanis, K; Dufour, L; Dujany, G; Dungs, K; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Déléage, N; Easo, S; Ebert, M; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; Elsasser, Ch; Ely, S; Esen, S; Evans, H M; Evans, T; Falabella, A; Farley, N; Farry, S; Fay, R; Fazzini, D; Ferguson, D; Fernandez Albor, V; Fernandez Prieto, A; Ferrari, F; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fini, R A; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fleuret, F; Fohl, K; Fontana, M; Fontanelli, F; Forshaw, D C; Forty, R; Franco Lima, V; Frank, M; Frei, C; Fu, J; Furfaro, E; Färber, C; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; Garcia Martin, L M; García Pardiñas, J; Garra Tico, J; Garrido, L; Garsed, P J; Gascon, D; Gaspar, C; Gavardi, L; Gazzoni, G; Gerick, D; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianì, S; Gibson, V; Girard, O G; Giubega, L; Gizdov, K; Gligorov, V V; Golubkov, D; Golutvin, A; Gomes, A; Gorelov, I V; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graverini, E; Graziani, G; Grecu, A; Griffith, P; Grillo, L; Gruberg Cazon, B R; Grünberg, O; Gushchin, E; Guz, Yu; Gys, T; Göbel, C; Hadavizadeh, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hatch, M; He, J; Head, T; Heister, A; Hennessy, K; Henrard, P; Henry, L; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hombach, C; Hopchev, H; Hulsbergen, W; Humair, T; Hushchyn, M; Hussain, N; Hutchcroft, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jawahery, A; Jiang, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kandybei, S; Kanso, W; Karacson, M; Kariuki, J M; Karodia, S; Kecke, M; Kelsey, M; Kenyon, I R; Kenzie, M; Ketel, T; Khairullin, E; Khanji, B; Khurewathanakul, C; Kirn, T; Klaver, S; Klimaszewski, K; Koliiev, S; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Kosmyntseva, A; Kozachuk, A; Kozeiha, M; Kravchuk, L; Kreplin, K; Kreps, M; Krokovny, P; Kruse, F; Krzemien, W; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kuonen, A K; Kurek, K; Kvaratskheliya, T; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Leflat, A; Lefrançois, J; Lefèvre, R; Lemaitre, F; Lemos Cid, E; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Likhomanenko, T; Lindner, R; Linn, C; Lionetto, F; Liu, B; Liu, X; Loh, D; Longstaff, I; Lopes, J H; Lucchesi, D; Lucio Martinez, M; Luo, H; Lupato, A; Luppi, E; Lupton, O; Lusiani, A; Lyu, X; Machefert, F; Maciuc, F; Maev, O; Maguire, K; Malde, S; Malinin, A; Maltsev, T; Manca, G; Mancinelli, G; Manning, P; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marino, P; Marks, J; Martellotti, G; Martin, M; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massacrier, L M; Massafferri, A; Matev, R; Mathad, A; Mathe, Z; Matteuzzi, C; Mauri, A; Maurin, B; Mazurov, A; McCann, M; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Melnychuk, D; Merk, M; Merli, A; Michielin, E; Milanes, D A; Minard, M-N; Mitzel, D S; Mogini, A; Molina Rodriguez, J; Monroy, I A; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Moron, J; Morris, A B; Mountain, R; Muheim, F; Mulder, M; Mussini, M; Müller, D; Müller, J; Müller, K; Müller, V; Naik, P; Nakada, T; Nandakumar, R; Nandi, A; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nieswand, S; Niet, R; Nikitin, N; Nikodem, T; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Ogilvy, S; Oldeman, R; Onderwater, C J G; Otalora Goicochea, J M; Otto, A; Owen, P; Oyanguren, A; Pais, P R; Palano, A; Palombo, F; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Pappalardo, L L; Parker, W; Parkes, C; Passaleva, G; Pastore, A; Patel, G D; Patel, M; Patrignani, C; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perret, P; Pescatore, L; Petridis, K; Petrolini, A; Petrov, A; Petruzzo, M; Picatoste Olloqui, E; Pietrzyk, B; Pikies, M; Pinci, D; Pistone, A; Piucci, A; Playfer, S; Plo Casasus, M; Poikela, T; Polci, F; Poluektov, A; Polyakov, I; Polycarpo, E; Pomery, G J; Popov, A; Popov, D; Popovici, B; Poslavskii, S; Potterat, C; Price, E; Price, J D; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Quagliani, R; Rachwal, B; Rademacker, J H; Rama, M; Ramos Pernas, M; Rangel, M S; Raniuk, I; Raven, G; Redi, F; Reichert, S; Dos Reis, A C; Remon Alepuz, C; Renaudin, V; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Lopez, J A; Rodriguez Perez, P; Rogozhnikov, A; Roiser, S; Rollings, A; Romanovskiy, V; Romero Vidal, A; Ronayne, J W; Rotondo, M; Rudolph, M S; Ruf, T; Ruiz Valls, P; Saborido Silva, J J; Sadykhov, E; Sagidova, N; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santimaria, M; Santovetti, E; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrina, D; Schael, S; Schellenberg, M; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmelzer, T; Schmidt, B; Schneider, O; Schopper, A; Schubert, K; Schubiger, M; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Semennikov, A; Sergi, A; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Siddi, B G; Silva Coutinho, R; Silva de Oliveira, L; Simi, G; Simone, S; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, E; Smith, I T; Smith, J; Smith, M; Snoek, H; Sokoloff, M D; Soler, F J P; Souza De Paula, B; Spaan, B; Spradlin, P; Sridharan, S; Stagni, F; Stahl, M; Stahl, S; Stefko, P; Stefkova, S; Steinkamp, O; Stemmle, S; Stenyakin, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Straticiuc, M; Straumann, U; Sun, L; Sutcliffe, W; Swientek, K; Syropoulos, V; Szczekowski, M; Szumlak, T; T'Jampens, S; Tayduganov, A; Tekampe, T; Teklishyn, M; Tellarini, G; Teubert, F; Thomas, E; van Tilburg, J; Tilley, M J; Tisserand, V; Tobin, M; Tolk, S; Tomassetti, L; Tonelli, D; Topp-Joergensen, S; Toriello, F; Tournefier, E; Tourneur, S; Trabelsi, K; Traill, M; Tran, M T; Tresch, M; Trisovic, A; Tsaregorodtsev, A; Tsopelas, P; Tully, A; Tuning, N; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vacca, C; Vagnoni, V; Valassi, A; Valat, S; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; van Veghel, M; Velthuis, J J; Veltri, M; Veneziano, G; Venkateswaran, A; Vernet, M; Vesterinen, M; Viaud, B; Vieira, D; Vieites Diaz, M; Vilasis-Cardona, X; Volkov, V; Vollhardt, A; Voneki, B; Vorobyev, A; Vorobyev, V; Voß, C; de Vries, J A; Vázquez Sierra, C; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wang, J; Ward, D R; Wark, H M; Watson, N K; Websdale, D; Weiden, A; Whitehead, M; Wicht, J; Wilkinson, G; Wilkinson, M; Williams, M; Williams, M P; Williams, M; Williams, T; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wraight, K; Wright, S; Wyllie, K; Xie, Y; Xing, Z; Xu, Z; Yang, Z; Yin, H; Yu, J; Yuan, X; Yushchenko, O; Zarebski, K A; Zavertyaev, M; Zhang, L; Zhang, Y; Zhang, Y; Zhelezov, A; Zheng, Y; Zhokhov, A; Zhu, X; Zhukov, V; Zucchelli, S

2016-12-23

The CP violation observables S and C in the decay channel B^{0}→D^{+}D^{-} are determined from a sample of proton-proton collisions at center-of-mass energies of 7 and 8 TeV, collected by the LHCb experiment and corresponding to an integrated luminosity of 3  fb^{-1}. The observable S describes CP violation in the interference between mixing and the decay amplitude, and C parametrizes direct CP violation in the decay. The following values are obtained from a flavor-tagged, decay-time-dependent analysis: S=-0.54_{-0.16}^{+0.17}(stat)±0.05(syst), C=0.26_{-0.17}^{+0.18}(stat)±0.02(syst). These values provide evidence for CP violation at a significance level of 4.0 standard deviations. The phase shift due to higher-order standard model corrections is constrained to a small value of Δϕ=-0.16_{-0.21}^{+0.19}  rad.

Pediatric cleft palate patients show a 3- to 5-fold increase in cumulative radiation exposure from dental radiology compared with an age- and gender-matched population: a retrospective cohort study.

PubMed

Jacobs, Reinhilde; Pauwels, Ruben; Scarfe, William C; De Cock, Carl; Dula, Karl; Willems, Guy; Verdonck, An; Politis, Constantinus

2018-05-01

The objective of the study was to compare estimates of pediatric cumulative exposure and lifetime attributable risk (LAR) of radiation-induced cancer from dental radiology between cleft palate (CP) subjects and age- and gender-matched controls (non-CP), with and without orthodontic treatment. The radiation exposure frequency of CP subjects and non-CP controls with and without orthodontic treatment was compared for two-dimensional radiography (intra-oral, panoramic and cephalometric radiography), computed tomography (CT), and cone-beam CT (CBCT) using cumulative radiation dose as an estimate. From this dose estimate, the age- and gender-dependent risk for radiation-induced stochastic effects was calculated for each patient group. CP patients received more radiographic examinations than non-CP controls, with the exception of intra-oral radiographs. The cumulative dose to CP patients was considerably higher (1963 μSv at the age of 20 years) than non-CP patients with (597 μSv) and without (383 μSv) orthodontic treatment, primarily due to the higher frequency of CT scanning. Accordingly, CP patients had a three to five times higher LAR than non-CP patients. This study suggests a significantly higher lifetime radiation exposure to CP patients than non-CP controls from dental radiographic procedures. Diagnostic benefits from the use of CT and CBCT in children must be justified and appropriate dose optimization strategies implemented. The present study indicates the need for proper justification and optimization of pediatric exposures in dentistry, with a special focus on high-risk groups.

MeCP2 regulates ethanol sensitivity and intake.

PubMed

Repunte-Canonigo, Vez; Chen, Jihuan; Lefebvre, Celine; Kawamura, Tomoya; Kreifeldt, Max; Basson, Oan; Roberts, Amanda J; Sanna, Pietro Paolo

2014-09-01

We have investigated the expression of chromatin-regulating genes in the prefrontal cortex and in the shell subdivision of the nucleus accumbens during protracted withdrawal in mice with increased ethanol drinking after chronic intermittent ethanol (CIE) vapor exposure and in mice with a history of non-dependent drinking. We observed that the methyl-CpG binding protein 2 (MeCP2) was one of the few chromatin-regulating genes to be differentially regulated by a history of dependence. As MeCP2 has the potential of acting as a broad gene regulator, we investigated sensitivity to ethanol and ethanol drinking in MeCP2(308/) (Y) mice, which harbor a truncated MeCP2 allele but have a milder phenotype than MeCP2 null mice. We observed that MeCP2(308/) (Y) mice were more sensitive to ethanol's stimulatory and sedative effects than wild-type (WT) mice, drank less ethanol in a limited access 2 bottle choice paradigm and did not show increased drinking after induction of dependence with exposure to CIE vapors. Alcohol metabolism did not differ in MeCP2(308/) (Y) and WT mice. Additionally, MeCP2(308/) (Y) mice did not differ from WT mice in ethanol preference in a 24-hour paradigm nor in their intake of graded solutions of saccharin or quinine, suggesting that the MeCP2(308/) (Y) mutation did not alter taste function. Lastly, using the Gene Set Enrichment Analysis algorithm, we found a significant overlap in the genes regulated by alcohol and by MeCP2. Together, these results suggest that MeCP2 contributes to the regulation of ethanol sensitivity and drinking. © 2013 The Authors, Addiction Biology © 2013 Society for the Study of Addiction.

ESTIMATE OF CP VIOLATION FOR THE LBNE PROJECT AND δCP

NASA Astrophysics Data System (ADS)

Kisslinger, Leonard S.

2012-08-01

Measurements of CP violation (CPV) and the basic δCP parameter are the goals of the LBNE Project, which is being planned. Using the expected energy and baseline parameters for the LBNE Project, CPV and the dependence of CPV on δCP are estimated, to help in the planning of this project.

Association of time-dependent changes in mu opioid receptor mRNA, but not BDNF, TrkB, or MeCP2 mRNA and protein expression in the rat nucleus accumbens with incubation of heroin craving.

PubMed

Theberge, Florence R M; Pickens, Charles L; Goldart, Evan; Fanous, Sanya; Hope, Bruce T; Liu, Qing-Rong; Shaham, Yavin

2012-12-01

Responding to heroin cues progressively increases after cessation of heroin self-administration (incubation of heroin craving). We investigated whether this incubation is associated with time-dependent changes in brain-derived neurotrophic factor (BDNF) and methyl-CpG binding protein 2 (MeCP2) signaling and mu opioid receptor (MOR) expression in nucleus accumbens (NAc), dorsal striatum (DS), and medial prefrontal cortex (mPFC). We also investigated the effect of the preferential MOR antagonist naloxone on cue-induced heroin seeking during abstinence. We trained rats to self-administer heroin or saline for 9-10 days and then dissected the NAc, DS, and mPFC at different abstinence days and measured mRNA and protein levels of BDNF, TrkB, and MeCP2, as well as MOR mRNA (Oprm1). In other groups, we assessed cue-induced heroin seeking in extinction tests after 1, 11, and 30 abstinence days, and naloxone's (0-1.0 mg/kg) effect on extinction responding after 1 and 15 days. Cue-induced heroin seeking progressively increased or incubated during abstinence. This incubation was not associated with changes in BDNF, TrkB, or MeCP2 mRNA or protein levels in NAc, DS, or mPFC; additionally, no molecular changes were observed after extinction tests on day 11. In NAc, but not DS or mPFC, MOR mRNA decreased on abstinence day 1 and returned to basal levels over time. Naloxone significantly decreased cue-induced heroin seeking after 15 abstinence days but not 1 day. Results suggest a role of MOR in incubation of heroin craving. As previous studies implicated NAc BDNF in incubation of cocaine craving, our data suggest that different mechanisms contribute to incubation of heroin versus cocaine craving.

Association of time-dependent changes in mu opioid receptor mRNA, but not BDNF, TrkB, or MeCP2 mRNA and protein expression in the rat nucleus accumbens with incubation of heroin craving

PubMed Central

Theberge, Florence R. M.; Pickens, Charles L.; Goldart, Evan; Fanous, Sanya; Hope, Bruce T.; Liu, Qing-Rong

2013-01-01

Rationale and objectives Responding to heroin cues progressively increases after cessation of heroin self-administration (incubation of heroin craving). We investigated whether this incubation is associated with time-dependent changes in brain-derived neurotrophic factor (BDNF) and methyl-CpG binding protein 2 (MeCP2) signaling and mu opioid receptor (MOR) expression in nucleus accumbens (NAc), dorsal striatum (DS), and medial pre-frontal cortex (mPFC). We also investigated the effect of the preferential MOR antagonist naloxone on cue-induced heroin seeking during abstinence. Methods We trained rats to self-administer heroin or saline for 9–10 days and then dissected the NAc, DS, and mPFC at different abstinence days and measured mRNA and protein levels of BDNF, TrkB, and MeCP2, as well as MOR mRNA (Oprm1). In other groups, we assessed cue-induced heroin seeking in extinction tests after 1, 11, and 30 abstinence days, and naloxone’s (0–1.0 mg/kg) effect on extinction responding after 1 and 15 days. Results Cue-induced heroin seeking progressively increased or incubated during abstinence. This incubation was not associated with changes in BDNF, TrkB, or MeCP2 mRNA or protein levels in NAc, DS, or mPFC; additionally, no molecular changes were observed after extinction tests on day 11. In NAc, but not DS or mPFC, MOR mRNA decreased on abstinence day 1 and returned to basal levels over time. Naloxone significantly decreased cue-induced heroin seeking after 15 abstinence days but not 1 day. Conclusions Results suggest a role of MOR in incubation of heroin craving. As previous studies implicated NAc BDNF in incubation of cocaine craving, our data suggest that different mechanisms contribute to incubation of heroin versus cocaine craving. PMID:22790874

Measurement of CP-Violating Asymmetries in B0 to (rho pi)0 Using a Time-Dependent Dalitz Plot Analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, J.

We present the preliminary measurement of CP-violating asymmetries in B{sup 0} {yields} ({rho}{pi}){sup 0} {yields} {pi}{sup +}{pi}{sup -}{pi}{sup 0} decays using a time-dependent Dalitz plot analysis. The results are obtained from a data sample of 213 million {Upsilon}(4S) {yields} B{bar B} decays, collected by the BABAR detector at the PEP-II asymmetric-energy B Factory at SLAC. This analysis extends the narrow-rho quasi-two-body approximation used in the previous analysis, by taking into account the interference between the rho resonances of the three charges. We measure 16 coefficients of the bilinear form factor terms occurring in the time-dependent decay rate of the B{supmore » 0} meson with the use of a maximum-likelihood fit. We derive the physically relevant quantities from these coefficients. We measure the direct CP-violation parameters A{sub {rho}{pi}} = -0.088 {+-} 0.049 {+-} 0.013 and C = 0.34 {+-} 0.11 {+-} 0.05, where the first errors are statistical and the second systematic. For the mixing-induced CP-violation parameter we find S = -0.10 {+-} 0.14 {+-} 0.04, and for the dilution and strong phase shift parameters respectively, we obtain {Delta}C = 0.15 {+-} 0.11 {+-} 0.03 and {Delta}S = 0.22 {+-} 0.15 {+-} 0.03. For the angle alpha of the Unitarity Triangle we measure (113{sub -17}{sup +27} {+-} 6){sup o}, while only a weak constraint is achieved at the significance level of more than two standard deviations. Finally, for the relative strong phase {delta}{sub {+-}} between the B{sup 0} {yields} {rho}{sup -}{pi}{sup +} and B{sup 0} {yields} {rho}{sup +}{pi}{sup -} transitions we find (-67{sub -31}{sup +28} {+-} 7) deg, with a similarly weak constraint at two standard deviations and beyond.« less

Antitumor Activities of Rauwolfia vomitoria Extract and Potentiation of Carboplatin Effects Against Ovarian Cancer☆

PubMed Central

Yu, Jun; Ma, Yan; Drisko, Jeanne; Chen, Qi

2013-01-01

Background Tumor resistance to platinum-based drugs has been an obstacle to the treatment of ovarian cancer. Extract of the plant Rauwolfia vomitoria has long been used by cancer patients. However, there have not been systematic studies of its anticancer activity. Objective In an effort to enhance the effectiveness of platinum-based drugs, we investigated the anticancer effect of a Rauwolfia vomitoria extract (Rau), both alone and in combination with carboplatin (Cp). Methods In vitro cytotoxicity and colony formation were evaluated in several ovarian cancer cell lines. In vivo effects were evaluated in an intraperitoneal ovarian cancer mouse model. The combination of Rau and Cp was assessed using Chou-Talalay’s constant ratio design and median effect analysis based on the isobologram principle to determine the combination index values. Results Rau decreased cell growth in all 3 tested ovarian cancer cell lines dose dependently and completely inhibited formation of colonies in soft agar. Apoptosis was induced in a time- and dose-dependent manner and was the predominant form of Rau-induced cell death. Synergy of Rau with Cp was detected, with combination index values <1 and dose reduction index values for Cp ranging from 1.7- to 7-fold. Tumor growth in mice was significantly suppressed by 36% or 66% with Rau treatment alone at a low (20 mg/kg) or a high dose (50 mg/kg), respectively, an effect comparable to that of Cp alone. The volume of ascitic fluid and the number of nonblood cells in ascites were also significantly decreased. Combining Rau with Cp remarkably enhanced the effect of Cp and reduced tumor burden by 87% to 90% and ascites volume by 89% to 97%. Conclusions Rau has potent antitumor activity and in combination significantly enhances the effect of Cp against ovarian cancer. PMID:24465036

M-phase kinases induce phospho-dependent ubiquitination of somatic Wee1 by SCFβ-TrCP

PubMed Central

Watanabe, Nobumoto; Arai, Harumi; Nishihara, Yoshifumi; Taniguchi, Makoto; Watanabe, Naoko; Hunter, Tony; Osada, Hiroyuki

2004-01-01

Wee1, the Cdc2 inhibitory kinase, needs to be down-regulated at the onset of mitosis to ensure rapid activation of Cdc2. Previously, we have shown that human somatic Wee1 (Wee1A) is down-regulated both by protein phosphorylation and degradation, but the underlying mechanisms had not been elucidated. In the present study, we have identified the β-transducin repeat-containing protein 1/2 (β-TrCP1/2) F-box protein-containing SKP1/Cul1/F-box protein (SCF) complex (SCFβ-TrCP1/2) as an E3 ubiquitin ligase for Wee1A ubiquitination. Although Wee1A lacks a consensus DS(p)GXXS(p) phospho-dependent binding motif for β-TrCP, recognition of Wee1A by β-TrCP depended on phosphorylation, and two serine residues in Wee1A, S53 and S123, were found to be the most important phosphorylation sites for β-TrCP recognition. We have found also that the major M-phase kinases polo-like kinase 1 (Plk1) and Cdc2 are responsible for the phosphorylation of S53 and S123, respectively, and that in each case phosphorylation generates an unconventional phospho-degron (signal for degradation) that can be recognized by β-TrCP. Phosphorylation of Wee1A by these kinases cooperatively stimulated the recognition and ubiquitination of Wee1A by SCFβ-TrCP1/2 in vitro. Mutation of these residues or depletion of β-TrCP by small-interfering RNA treatment increased the stability of Wee1A in HeLa cells. Moreover, our analysis indicates that β-TrCP-dependent degradation of Wee1A is important for the normal onset of M-phase in vivo. These results also establish the existence of a feedback loop between Cdc2 and Wee1A in somatic cells that depends on ubiquitination and protein degradation and ensures the rapid activation of Cdc2 when cells are ready to divide. PMID:15070733

How additional visual feedback of the movements between center of pressure and vertically projected center of gravity can be used by hemiparetic patients.

PubMed

Rougier, Patrice R; Boudrahem, Samir

2012-01-01

In healthy adults, the beneficial effect of providing additional visual feedback (VFB) with a delay of either the center of pressure (CP) or the difference between CP movements and center of gravity (CP-CGv) movements was previously demonstrated and explained by their capacity to decrease their CP-CGv movements. The present study seeks to demonstrate whether similar trends could be observed in hemiparetic patients. Posturographic measurements were recorded in 56 hemiparetic patients in 3 VFB conditions: (1) CP in real time (VFBCP0), (2) CP with a 600-ms delay (VFBCP600), and (3) CP-CGv with a 600-ms delay (VFBCP-CG600). A condition without VFB (eyes open [EO]) was also included. The individual capacity to lower CP-CGv movements as compared to the reference VFBCP0 condition was assessed using dependency coefficients (ie, average surface covered by the CP-CGv displacements in an experimental condition relative to the VFBCP0 condition) in the VFBCP600, VFBCP-CG600, and EO conditions. Reduced CP-CGv movements were only obtained for half of the patients for the conditions with delay or without VFB. Significant linear correlations revealed that the most successful patients are characterized by reduced CP-CGv movements in these conditions and in the EO condition. In contrast, a poor correlation was found with the patients' clinical scores. Based on the behavioral profile of a patient able to use these VFB techniques effectively, this study emphasizes the complementary nature of the various conditions proposed by the VFB technique and provides insights for establishing rehabilitation protocols based on this VFB technique.

Loss of activity-induced phosphorylation of MeCP2 enhances synaptogenesis, LTP and spatial memory.

PubMed

Li, Hongda; Zhong, Xiaofen; Chau, Kevin Fongching; Williams, Emily Cunningham; Chang, Qiang

2011-07-17

DNA methylation-dependent epigenetic mechanisms underlie the development and function of the mammalian brain. MeCP2 is highly expressed in neurons and functions as a molecular linker between DNA methylation, chromatin remodeling and transcription regulation. Previous in vitro studies have shown that neuronal activity-induced phosphorylation (NAIP) of methyl CpG-binding protein 2 (MeCP2) precedes its release from the Bdnf promoter and the ensuing Bdnf transcription. However, the in vivo function of this phosphorylation event remains elusive. We generated knock-in mice that lack NAIP of MeCP2 and found that they performed better in hippocampus-dependent memory tests, presented enhanced long-term potentiation at two synapses in the hippocampus and showed increased excitatory synaptogenesis. At the molecular level, the phospho-mutant MeCP2 protein bound more tightly to several MeCP2 target gene promoters and altered the expression of these genes. Our results suggest that NAIP of MeCP2 is required for modulating dynamic functions of the adult mouse brain.

Loss of Activity-Induced Phosphorylation of MeCP2 Enhances Synaptogenesis, LTP, and Spatial Memory

PubMed Central

Li, Hongda; Zhong, Xiaofen; Chau, Kevin Fongching; Williams, Emily Cunningham; Chang, Qiang

2012-01-01

DNA methylation-dependent epigenetic mechanisms underlie the development and function of the mammalian brain. MeCP2 expresses highly in neurons, and functions as a molecular linker between DNA methylation, chromatin remodeling and transcription regulation. Previous in vitro studies showed neuronal activity-induced phosphorylation (NAIP) of MeCP2 precedes its release from the Bdnf promoter and the ensuing Bdnf transcription. However, the in vivo function of this phosphorylation event remains elusive. We generated knockin mice that lack NAIP of MeCP2, and show here the Mecp2 phospho-mutant mice perform better in hippocampus-dependent memory tests, present enhanced LTP at two synapses in the hippocampus, and show increased excitatory synaptogenesis. At the molecular level, the phospho-mutant MeCP2 protein binds more tightly to several MeCP2 target gene promoters and alters the expression of these genes. Our results supply the first genetic evidence that NAIP of MeCP2 is required in modulating dynamic functions of the adult mouse brain. PMID:21765426

Thermograpic study of upper extremities in patients with cerebral palsy

NASA Astrophysics Data System (ADS)

Lampe, R.; Kawelke, S.; Mitternacht, J.; Turova, V.; Blumenstein, T.; Alves-Pinto, A.

2015-03-01

Trophic disorders like reduced skin blood circulation are well-known epiphenomenon of cerebral palsy (CP). They can influence quality of life and can lead to skin damages and, as a consequence, to decubitus. Therefore, it is important to analyse temperature regulation in patients with CP. Thermal imaging camera FLIR BCAM SD was used to study the dependency of skin blood circulation in upper extremities of patients with CP on hand dominance, hand force and hand volume. The hand force was evaluated using a conventional dynamometer. The hand volume was measured with a volumeter. A cold stress test for hands was applied in 22 patients with CP and 6 healthy subjects. The warming up process after the test was recorded with the thermal camera. It was confirmed that the hands of patients warm up slower comparing to healthy persons. The patients' working hands warm up faster than non-working ones. A slight correlation was established between the hand grip force of the working hands and their warm up time. No correlation was found between the warming up time and the volume of the hand. The results confirm our assumption that there is a connection of peripheral blood circulation to upper limb motor functions.

Experience-dependent emergence of beta and gamma band oscillations in the primary visual cortex during the critical period

PubMed Central

Chen, Guang; Rasch, Malte J.; Wang, Ran; Zhang, Xiao-hui

2015-01-01

Neural oscillatory activities have been shown to play important roles in neural information processing and the shaping of circuit connections during development. However, it remains unknown whether and how specific neural oscillations emerge during a postnatal critical period (CP), in which neuronal connections are most substantially modified by neural activity and experience. By recording local field potentials (LFPs) and single unit activity in developing primary visual cortex (V1) of head-fixed awake mice, we here demonstrate an emergence of characteristic oscillatory activities during the CP. From the pre-CP to CP, the peak frequency of spontaneous fast oscillatory activities shifts from the beta band (15–35 Hz) to the gamma band (40–70 Hz), accompanied by a decrease of cross-frequency coupling (CFC) and broadband spike-field coherence (SFC). Moreover, visual stimulation induced a large increase of beta-band activity but a reduction of gamma-band activity specifically from the CP onwards. Dark rearing of animals from the birth delayed this emergence of oscillatory activities during the CP, suggesting its dependence on early visual experience. These findings suggest that the characteristic neuronal oscillatory activities emerged specifically during the CP may represent as neural activity trait markers for the experience-dependent maturation of developing visual cortical circuits. PMID:26648548

Temperature dependence of standard model CP violation.

PubMed

Brauner, Tomáš; Taanila, Olli; Tranberg, Anders; Vuorinen, Aleksi

2012-01-27

We analyze the temperature dependence of CP violation effects in the standard model by determining the effective action of its bosonic fields, obtained after integrating out the fermions from the theory and performing a covariant gradient expansion. We find nonvanishing CP violating terms starting at the sixth order of the expansion, albeit only in the C-odd-P-even sector, with coefficients that depend on quark masses, Cabibbo-Kobayashi-Maskawa matrix elements, temperature and the magnitude of the Higgs field. The CP violating effects are observed to decrease rapidly with temperature, which has important implications for the generation of a matter-antimatter asymmetry in the early Universe. Our results suggest that the cold electroweak baryogenesis scenario may be viable within the standard model, provided the electroweak transition temperature is at most of order 1 GeV.

Design and Synthesis of a Biocompatible 1D Coordination Polymer as Anti-Breast Cancer Drug Carrier, 5-Fu: In Vitro and in Vivo Studies.

PubMed

Rezaei, Mahsa; Abbasi, Alireza; Dinarvand, Rassoul; Jeddi-Tehrani, Mahmood; Janczak, Jan

2018-05-17

Designable coordination polymers with suitable chemical diversities and biocompatible structures have been proposed as a promising class of vehicles for drug delivery systems. Here, we hydrothermally synthesized a novel one-dimensional (1D) coordination polymer, [Zn(H 2 O) 6 K 2 (H 2 BTC) 2 (H 2 O) 4 ](H 2 BTC) 2 ·2H 2 O, where H 3 BTC = benzene-1,3,5-tricarboxylic acid (trimesic acid), cp.1. As the hydrogen bonds stabilized 1D chains in three dimensions, the cp.1 could be a good candidate for delivering small-molecule chemotherapeutics such as 5-fluorouracil (5-Fu). The synthesized cp.1 showed a remarkable 5-Fu loading of 66% with encapsulation efficiency of 98% and almost complete release process. The 5-Fu-loaded cp.1 displayed a time-dependent cytotoxicity effect against breast cancer cell lines MCF-7 and 4T1. The cellular uptake of cp.1 particles was investigated via confocal laser scanning microscopy using fluorescein isothiocyanate and LysoTracker Red staining. Furthermore, the in vivo antitumor impact of 5-Fu-loaded cp.1 was studied on 4T1 breast cancer BALB/c mice model. The intratumor treatment of 5-Fu-loaded cp.1 demonstrated beneficial antitumor efficacy by postponing tumor growth. These results suggest that the 5-Fu-loaded cp.1 microparticles with a great locoregional delivery can be efficient anticancer drug carriers for further clinical treatments.

Carboplatin–paclitaxel-induced leukopenia and neuropathy predict progression-free survival in recurrent ovarian cancer

PubMed Central

Lee, C K; Gurney, H; Brown, C; Sorio, R; Donadello, N; Tulunay, G; Meier, W; Bacon, M; Maenpaa, J; Petru, E; Reed, N; Gebski, V; Pujade-Lauraine, E; Lord, S; Simes, R J; Friedlander, M

2011-01-01

Background: We assess the prognostic value of chemotherapy-induced leukopenia and sensory neuropathy in the CALYPSO trial patients treated with carboplatin–paclitaxel (CP) or carboplatin–liposomal doxorubicin (CPLD). Methods: We performed a landmark analysis at first month after randomisation to correlate leukopenia (nadir white blood cell <4.0 × 109 per litre or severe infection) during cycle 1 of chemotherapy with progression-free survival (PFS). Using time-dependent proportional-hazards models, we also investigated the association between neuropathy and PFS. Results: Of 608 patients with nadir blood and did not receive growth factors, 72% (CP=70%, CPLD=73%) had leukopenia. Leukopenia was prognostic for PFS in those receiving CP (adjusted hazard ratio (aHR) 0.66, P=0.01). Carboplatin–liposomal doxorubicin was more effective than CP in patients without leukopenia (aHR 0.51, P=0.001), but not those experiencing leukopenia (aHR 0.93, P=0.54; interaction P=0.008). Of 949 patients, 32% (CP=62%, CPLD=28%) reported neuropathy during landmark. Neuropathy was prognostic for PFS in the CP group only (aHR 0.77, P=0.02). Carboplatin–liposomal doxorubicin appeared to be more effective than CP among patients without neuropathy (aHR 0.70, P<0.0001), but not those with neuropathy (aHR 0.96, P=0.81; interaction P=0.15). Conclusion: First-cycle leukopenia and neuropathy were prognostic for patients treated with CP. Efficacy of CP treatment was similar to CPLD in patients who developed leukopenia. These findings support further research to understand the mechanisms of treatment-related toxicity. PMID:21750553

Structure Features and Anti-Gastric Ulcer Effects of Inulin-Type Fructan CP-A from the Roots of Codonopsis pilosula (Franch.) Nannf.

PubMed

Li, Jiankuan; Wang, Tao; Zhu, Zhichuan; Yang, Fengrong; Cao, Lingya; Gao, Jianping

2017-12-18

Radix Codonopsis has been used in traditional Chinese medicine for strengthening the immune system, improving poor gastrointestinal function, treating gastric ulcers and chronic gastritis and so on. In the present study, an inulin-type fructan CP-A was obtained from the roots of Codonopsis pilosula (Franch.) Nannf. and its structure was confirmed by MS and NMR as (2 → 1) linked-β-d-fructofuranose. The protective effects of CP-A against ethanol-induced acute gastric ulcer in rats were intensively investigated. A Lacy assay demonstrated that CP-A-treated group (50 mg/kg) showed the gastric damage level 1, which was similar to the positive control group, while the model group exhibited the gastric damage level 3. The Guth assay demonstrated that the mucosa ulcer index for CP-A groups at the doses of 50 mg/kg and 25 mg/kg significantly decreased compared with that in the model group ( p < 0.05). Meanwhile, CP-A significantly increased the activities of SOD and GSH-Px, and decreased the contents of MDA and NO, and the activity of MPO in gastric tissue in a dose-dependent manner ( p < 0.05). The present research reported for the first time that inulin-type fructan CP-A were likely the potential component in Radix Codonopsis for treatment of acute gastric ulcers.

Measurements of Time-Dependent CP-Asymmetry Parameters in B Meson Decays to η' K 0 and of Branching Fractions of SU(3) Related Modes with BaBar Experiment at SLAC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biassoni, Pietro

2009-01-01

In this thesis work we have measured the following upper limits at 90% of confidence level, for B meson decays (in units of 10 -6), using a statistics of 465.0 x 10 6 Bmore » $$\\bar{B}$$ pairs: β(B 0 → ηK 0) < 1.6 β(B 0 → ηη) < 1.4 β(B 0 → η'η') < 2.1 β(B 0 → ηΦ) < 0.52 β(B 0 → ηω) < 1.6 β(B 0 → η'Φ) < 1.2 β(B 0 → η'ω) < 1.7 We have no observation of any decay mode, statistical significance for our measurements is in the range 1.3-3.5 standard deviation. We have a 3.5σ evidence for B → ηω and a 3.1 σ evidence for B → η'ω. The absence of observation of the B 0 → ηK 0 open an issue related to the large difference compared to the charged mode B + → ηK + branching fraction, which is measured to be 3.7 ± 0.4 ± 0.1 [118]. Our results represent substantial improvements of the previous ones [109, 110, 111] and are consistent with theoretical predictions. All these results were presented at Flavor Physics and CP Violation (FPCP) 2008 Conference, that took place in Taipei, Taiwan. They will be soon included into a paper to be submitted to Physical Review D. For time-dependent analysis, we have reconstructed 1820 ± 48 flavor-tagged B 0 → η'K 0 events, using the final BABAR statistic of 467.4 x 10 6 B$$\\bar{B}$$ pairs. We use these events to measure the time-dependent asymmetry parameters S and C. We find S = 0.59 ± 0.08 ± 0.02, and C = -0.06 ± 0.06 ± 0.02. A non-zero value of C would represent a directly CP non-conserving component in B 0 → η'K 0, while S would be equal to sin2β measured in B 0 → J/ΨK s 0 [108], a mixing-decay interference effect, provided the decay is dominated by amplitudes of a single weak phase. The new measured value of S can be considered in agreement with the expectations of the 'Standard Model', inside the experimental and theoretical uncertainties. Inconsistency of our result for S with CP conservation (S = 0) has a significance of 7.1 standard deviations (statistical and systematics included). Our result for the direct-CP violation parameter C is 0.9 standard deviations from zero (statistical and systematics included). Our results are in agreement with the previous ones [18]. Despite the statistics is only 20% larger than the one used in previous measurement, we improved of 20% the error on S and of 14% the error on C. This error is the smaller ever achieved, by both BABAR and Belle, in Time-Dependent CP Violation Parameters measurement is a b → s transition.« less

Observation of CP violation in neutral B meson going to positive kaon-antipion and neutral B meson going to pion-antipion decays with the BABAR detector

NASA Astrophysics Data System (ADS)

Li, Xuanzhong

This dissertation describes the measurement of asymmetries in neutral B meson decays to two-body final states of charged pions and kaons. The results are obtained from a data sample of 383 million Upsilon(4 S) → BB¯ decays collected between 1999 and 2006 with the BABAR detector at the PEP-II asymmetric-energy B factory located at the Stanford Linear Accelerator Center, California. The maximum likelihood fit that incorporates kinematical, event-shape, and particle identification information is used to measure the CP asymmetries in B0 → pi +pi- and K+/- pi∓ decays. The direct CP-violating asymmetry between decays to K-pi + is AKpi = -0.107 +/- 0.018+0.007-0.004 . The time-dependent CP-violating parameters in B0 → pi+pi- decays are Spipi = -0.60 +/- 0.11 +/- 0.03, Cpipi = -0.21 +/- 0.09 +/- 0.02. For all the measurements above, the first error is statistical and the second is systematic.

Measurements of CP Asymmetries in the Decay B --> {phi}K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aubert, B

The authors present a preliminary measurement of the time-dependent CP asymmetry for the neutral B-meson decay B{sup 0} --> {phi}K{sup 0}. They use a sample of approximately 227 million B-meson pairs recorded at the {Upsilon}(4S) resonance with the BABAR detector at the PEP-II B-meson Factory at SLAC. They reconstruct the CP eigenstates {phi}K{sub s}{sup 0} and {phi}K{sub L}{sup 0} where {phi} --> K{sup +}K{sup -}, K{sub s}{sup 0} --> {pi}{sup +}{pi}{sup -}, and K{sub L}{sup 0} is observed via its hadronic interactions. The other B meson in the event is tagged as either a B{sup 0} or {bar B}{sup 0}more » from its decay products. The values of the CP-violation parameters deived from the combined {phi}K{sup 0} dataset are S{sub {phi}K} = +0.50 {+-} 0.25(stat.){sub -0.04}{sup +0.07}(syst.) and C{sub {phi}K} = 0.00 {+-} 0.23(stat.) {+-}0.05(syst.). In addition, the authors measure the CP-violating charge asymmetry A{sub CP}(B{sup +} --> {phi}K{sup +}) = 0.054 {+-} 0.056(stat.) {+-} 0.012(syst.). All results are preliminary.« less

Simulations of cold electroweak baryogenesis: dependence on the source of CP-violation

NASA Astrophysics Data System (ADS)

Mou, Zong-Gang; Saffin, Paul M.; Tranberg, Anders

2018-05-01

We compute the baryon asymmetry created in a tachyonic electroweak symmetry breaking transition, focusing on the dependence on the source of effective CP-violation. Earlier simulations of Cold Electroweak Baryogenesis have almost exclusively considered a very specific CP-violating term explicitly biasing Chern-Simons number. We compare four different dimension six, scalar-gauge CP-violating terms, involving both the Higgs field and another dynamical scalar coupled to SU(2) or U(1) gauge fields. We find that for sensible values of parameters, all implementations can generate a baryon asymmetry consistent with observations, showing that baryogenesis is a generic outcome of a fast tachyonic electroweak transition.

Capping protein regulatory cycle driven by CARMIL and V-1 may promote actin network assembly at protruding edges

PubMed Central

Fujiwara, Ikuko; Remmert, Kirsten; Piszczek, Grzegorz; Hammer, John A.

2014-01-01

Although capping protein (CP) terminates actin filament elongation, it promotes Arp2/3-dependent actin network assembly and accelerates actin-based motility both in vitro and in vivo. In vitro, capping protein Arp2/3 myosin I linker (CARMIL) antagonizes CP by reducing its affinity for the barbed end and by uncapping CP-capped filaments, whereas the protein V-1/myotrophin sequesters CP in an inactive complex. Previous work showed that CARMIL can readily retrieve CP from the CP:V-1 complex, thereby converting inactive CP into a version with moderate affinity for the barbed end. Here we further clarify the mechanism of this exchange reaction, and we demonstrate that the CP:CARMIL complex created by complex exchange slows the rate of barbed-end elongation by rapidly associating with, and dissociating from, the barbed end. Importantly, the cellular concentrations of V-1 and CP determined here argue that most CP is sequestered by V-1 at steady state in vivo. Finally, we show that CARMIL is recruited to the plasma membrane and only at cell edges undergoing active protrusion. Assuming that CARMIL is active only at this location, our data argue that a large pool of freely diffusing, inactive CP (CP:V-1) feeds, via CARMIL-driven complex exchange, the formation of weak-capping complexes (CP:CARMIL) at the plasma membrane of protruding edges. In vivo, therefore, CARMIL should promote Arp2/3-dependent actin network assembly at the leading edge by promoting barbed-end capping there. PMID:24778263

The 'Critical Power' Concept: Applications to Sports Performance with a Focus on Intermittent High-Intensity Exercise.

PubMed

Jones, Andrew M; Vanhatalo, Anni

2017-03-01

The curvilinear relationship between power output and the time for which it can be sustained is a fundamental and well-known feature of high-intensity exercise performance. This relationship 'levels off' at a 'critical power' (CP) that separates power outputs that can be sustained with stable values of, for example, muscle phosphocreatine, blood lactate, and pulmonary oxygen uptake ([Formula: see text]), from power outputs where these variables change continuously with time until their respective minimum and maximum values are reached and exercise intolerance occurs. The amount of work that can be done during exercise above CP (the so-called W') is constant but may be utilized at different rates depending on the proximity of the exercise power output to CP. Traditionally, this two-parameter CP model has been employed to provide insights into physiological responses, fatigue mechanisms, and performance capacity during continuous constant power output exercise in discrete exercise intensity domains. However, many team sports (e.g., basketball, football, hockey, rugby) involve frequent changes in exercise intensity and, even in endurance sports (e.g., cycling, running), intensity may vary considerably with environmental/course conditions and pacing strategy. In recent years, the appeal of the CP concept has been broadened through its application to intermittent high-intensity exercise. With the assumptions that W' is utilized during work intervals above CP and reconstituted during recovery intervals below CP, it can be shown that performance during intermittent exercise is related to four factors: the intensity and duration of the work intervals and the intensity and duration of the recovery intervals. However, while the utilization of W' may be assumed to be linear, studies indicate that the reconstitution of W' may be curvilinear with kinetics that are highly variable between individuals. This has led to the development of a new CP model for intermittent exercise in which the balance of W' remaining ([Formula: see text]) may be calculated with greater accuracy. Field trials of athletes performing stochastic exercise indicate that this [Formula: see text] model can accurately predict the time at which W' tends to zero and exhaustion is imminent. The [Formula: see text] model potentially has important applications in the real-time monitoring of athlete fatigue progression in endurance and team sports, which may inform tactics and influence pacing strategy.

Human calprotectin affects the redox speciation of iron.

PubMed

Nakashige, Toshiki G; Nolan, Elizabeth M

2017-08-16

We report that the metal-sequestering human host-defense protein calprotectin (CP, S100A8/S100A9 oligomer) affects the redox speciation of iron (Fe) in bacterial growth media and buffered aqueous solution. Under aerobic conditions and in the absence of an exogenous reducing agent, CP-Ser (S100A8(C42S)/S100A9(C3S) oligomer) depletes Fe from three different bacterial growth media preparations over a 48 h timeframe (T = 30 °C). The presence of the reducing agent β-mercaptoethanol accelerates this process and allows CP-Ser to deplete Fe over a ≈1 h timeframe. Fe-depletion assays performed with metal-binding-site variants of CP-Ser show that the hexahistidine (His 6 ) site, which coordinates Fe(ii) with high affinity, is required for Fe depletion. An analysis of Fe redox speciation in buffer containing Fe(iii) citrate performed under aerobic conditions demonstrates that CP-Ser causes a time-dependent increase in the [Fe(ii)]/[Fe(iii)] ratio. Taken together, these results indicate that the hexahistidine site of CP stabilizes Fe(ii) and thereby shifts the redox equilibrium of Fe to the reduced ferrous state under aerobic conditions. We also report that the presence of bacterial metabolites affects the Fe-depleting activity of CP-Ser. Supplementation of bacterial growth media with an Fe(iii)-scavenging siderophore (enterobactin, staphyloferrin B, or desferrioxamine B) attenuates the Fe-depleting activity of CP-Ser. This result indicates that formation of Fe(iii)-siderophore complexes blocks CP-mediated reduction of Fe(iii) and hence the ability of CP to coordinate Fe(ii). In contrast, the presence of pyocyanin (PYO), a redox-cycling phenazine produced by Pseudomonas aeruginosa that reduces Fe(iii) to Fe(ii), accelerates Fe depletion by CP-Ser under aerobic conditions. These findings indicate that the presence of microbial metabolites that contribute to metal homeostasis at the host/pathogen interface can affect the metal-sequestering function of CP.

50 CFR 680.44 - Cost recovery.

Code of Federal Regulations, 2014 CFR

2014-10-01

... value determined for at-sea Catcher/Processors (CP), depending on their activity. Ex-vessel value...-vessel value—(i) General. Catcher/processors must use the corresponding CP standard price(s) for the purposes of calculating fee liability. (ii) CP standard prices. As part of the summary described in...

50 CFR 680.44 - Cost recovery.

Code of Federal Regulations, 2010 CFR

2010-10-01

... value determined for at-sea Catcher/Processors (CP), depending on their activity. Ex-vessel value...-vessel value—(i) General. Catcher/processors must use the corresponding CP standard price(s) for the purposes of calculating fee liability. (ii) CP standard prices. As part of the summary described in...

50 CFR 680.44 - Cost recovery.

Code of Federal Regulations, 2012 CFR

2012-10-01

... value determined for at-sea Catcher/Processors (CP), depending on their activity. Ex-vessel value...-vessel value—(i) General. Catcher/processors must use the corresponding CP standard price(s) for the purposes of calculating fee liability. (ii) CP standard prices. As part of the summary described in...

50 CFR 680.44 - Cost recovery.

Code of Federal Regulations, 2011 CFR

2011-10-01

... value determined for at-sea Catcher/Processors (CP), depending on their activity. Ex-vessel value...-vessel value—(i) General. Catcher/processors must use the corresponding CP standard price(s) for the purposes of calculating fee liability. (ii) CP standard prices. As part of the summary described in...

50 CFR 680.44 - Cost recovery.

Code of Federal Regulations, 2013 CFR

2013-10-01

... value determined for at-sea Catcher/Processors (CP), depending on their activity. Ex-vessel value...-vessel value—(i) General. Catcher/processors must use the corresponding CP standard price(s) for the purposes of calculating fee liability. (ii) CP standard prices. As part of the summary described in...

The epidemiology of cerebral palsy: incidence, impairments and risk factors.

PubMed

Odding, Else; Roebroeck, Marij E; Stam, Hendrik J

2006-02-28

Describing the epidemiology of cerebral palsy (CP), its impairments and risk factors. Literature review 1965-2004. Search terms: Cerebral palsy, incidence, prevalence, impairments, risk factors. In the last 40 years the prevalence of CP has risen to well above 2.0 per 1000 life births. In this time span the proportion of low-birthweight infants rose, the proportion of diplegia decreased, while the proportion of hemiplegia increased. CP is more prevalent in more deprived socio-economic populations. The majority of people with CP have the spastic syndrome of which the diplegic group is the smallest. Dependent on the subgroup of CP, 25-80% have additional impairments. A large proportion has some kind of cognitive impairment; the prevalence varies with the type of CP and especially increases when epilepsy is present. Epilepsy is present in 20-40%; it is most common among the hemi- and tetraplegics. Sensibility of the hands is impaired in about half. Chronic pain is reported by more than a quarter of the adults. Up to 80% have at least some impairment of speech. Low visual acuity is reported in almost three-quarters of all children. Half of all children have gastrointestinal and feeding problems. Stunted growth occurs in a quarter, while under- or overweight problems are present in half of the children. Almost 70% of people with spastic CP have abnormal brain CT findings; abnormal cranial ultrasounds is most strongly associated with hemiplegia, normal cranial ultrasounds with diplegia. The most important risk factors for CP are low birthweight, intrauterine infections and multiple gestation.

Synthesis of Carboxylate Cp*Zr(IV) Species: Toward the Formation of Novel Metallocavitands.

PubMed

Daigle, Maxime; Bi, Wenhua; Légaré, Marc-André; Morin, Jean-François; Fontaine, Frédéric-Georges

2015-06-01

With the intent of generating metallocavitands isostructural to species [(CpZr)3(μ(3)-O)(μ(2)-OH)3(κO,O,μ(2)-O2C(R))3](+), the reaction of Cp*2ZrCl2 and Cp*ZrCl3 with phenylcarboxylic acids was carried out. Depending on the reaction conditions, five new complexes were obtained, which consisted of Cp*2ZrCl(κ(2)-OOCPh) (1), (Cp*ZrCl(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2 (2), [(Cp*Zr(κ(2)-OOCPh))2(μ-κ(2)-OOCPh)2(μ(2)-OH)2]·Et2O (3·Et2O), [[Cp*ZrCl2](μ-Cl)(μ-OH)(μ-O2CC6H5)[Cp*Zr

An adequate level of training for technically competent colonoscopic polypectomy.

PubMed

Boo, Sun-Jin; Jung, Ji Hoon; Park, Jae Ho; Na, Soo-Young; Kim, Seon Ok; Park, Sang Hyoung; Yang, Dong-Hoon; Kim, Kyung-Jo; Ye, Byong Duk; Myung, Seung-Jae; Yang, Suk-Kyun; Kim, Jin-Ho; Byeon, Jeong-Sik

2015-07-01

The purpose of this study is to investigate the learning curve for colonoscopic polypectomy (CP) by trainee endoscopists. The amount of training required to achieve technical competence for CP is uncertain. The CP times and en bloc resection rates of three experienced colonoscopists were obtained from 240 procedures. These data were compared to those of three gastroenterology trainees who performed 750 CP procedures. A trainee procedure was deemed to be a success if en bloc resection was obtained and the CP time was within twice the median CP time of the experienced colonoscopists. Trainees were deemed to be technically competent when they achieved a CP success rate of greater than or equal to 80%. The median CP times and en bloc resection rates for the experienced colonoscopists and trainees were 79 s (range, 20-301 s) and 99.6% (239/240), and 118 s (range, 36-1051 s) and 95.6% (717/750), respectively. The trainee success rate of CP was 72% (540/750). The success rate of the procedure was associated with increased trainee experience (p = 0.003) and reached 80% after 250 procedures. The CP time significantly decreased (p < 0.001) and en bloc resection rate significantly increased (p = 0.011) as trainee experience accumulated. The level of experience was an independent predictor for successful CP. The achievement of technical competence with CP was associated with an accumulation of approximately 250 procedures. These findings suggest that dedicated education and training programs for CP are warranted.

Protective effects of total saponins from stem and leaf of Panax ginseng against cyclophosphamide-induced genotoxicity and apoptosis in mouse bone marrow cells and peripheral lymphocyte cells.

PubMed

Zhang, Qiu Hua; Wu, Chun Fu; Duan, Lian; Yang, Jing Yu

2008-01-01

Cyclophosphamide (CP), commonly used anti-cancer, induces oxidative stress and is cytotoxic to normal cells. It is very important to choice the protective agent combined CP to reduce the side effects in cancer treatment. Ginsenosides are biological active constituents of Panax ginseng C.A. Meyer that acts as the tonic agent for the cancer patients to reduce the side effects in the clinic application. Because CP is a pro-oxidant agent and induces oxidative stress by the generation of free radicals to decrease the activities of anti-oxidant enzymes, the protective effects of the total saponins from stem and leaf of P. ginseng C.A. Meyer (TSPG) act as an anti-oxidant agent against the decreased anti-oxidant enzymes, the genotoxicity and apoptosis induced by CP was carried out. The alkaline single cell gel electrophoresis was employed to detect DNA damage; flow cytometry assay and AO/EB staining assay were employed to measure cell apoptosis; the enzymatic anti-oxidants (T-SOD, CAT and GPx) and non-enzymatic anti-oxidant (GSH) were measured by the various colorimetric methods. CP induced the significant DNA damage in mouse peripheral lymphocytes in time- and dose-dependent manners, inhibited the activities of T-SOD, GPx and CAT, and decreased the contents of GSH in mouse blood, triggered bone marrow cell apoptosis at 6 and 12h. TSPG significantly reduced CP-induced DNA damages in bone marrow cells and peripheral lymphocyte cells, antagonized CP-induced reduction of T-SOD, GPx, CAT activities and the GSH contents, decreased the bone marrow cell apoptosis induced by CP. TSPG, significantly reduced the genotoxicity of CP in bone marrow cells and peripheral lymphocyte cells, and decreased the apoptotic cell number induced by CP in bone marrow cells. The effects of TSPG on T-SOD, GPx, CAT activities and GSH contents might partially contribute to its protective effects on CP-induced cell toxicities.

Structure, mechanical properties, and grindability of dental Ti-Zr alloys.

PubMed

Ho, Wen-Fu; Chen, Wei-Kai; Wu, Shih-Ching; Hsu, Hsueh-Chuan

2008-10-01

Structure, mechanical properties and grindability of a series of binary Ti-Zr alloys with zirconium contents ranging from 10 to 40 wt% have been investigated. Commercially pure titanium (c.p. Ti) was used as a control. Experimental results indicated that the diffraction peaks of all the Ti-Zr alloys matched those for alpha Ti. No beta-phase peaks were found. The hardness of the Ti-Zr alloys increased as the Zr contents increased, and ranged from 266 HV (Ti-10Zr) to 350 HV (Ti-40Zr). As the concentration of zirconium in the alloys increased, the strength, elastic recovery angles and hardness increased. Moreover, the elastically recoverable angle of Ti-40Zr was higher than of c.p. Ti by as much as 550%. The grindability of each metal was found to be largely dependent on the grinding conditions. The Ti-40Zr alloy had a higher grinding rate and grinding ratio than c.p. Ti at low speed. The grinding rate of the Ti-40Zr alloy at 500 m/min was about 1.8 times larger than that of c.p. Ti, and the grinding ratio was about 1.6 times larger than that of c.p. Ti. Our research suggested that the Ti-40Zr alloy has better mechanical properties, excellent elastic recovery capability and improved grindability at low grinding speed. The Ti-40Zr alloy has a great potential for use as a dental machining alloy.

Cyclin-dependent kinase (CDK) phosphorylation destabilizes somatic Wee1 via multiple pathways

PubMed Central

Watanabe, Nobumoto; Arai, Harumi; Iwasaki, Jun-ichi; Shiina, Masaaki; Ogata, Kazuhiro; Hunter, Tony; Osada, Hiroyuki

2005-01-01

At the onset of M phase, the activity of somatic Wee1 (Wee1A), the inhibitory kinase for cyclin-dependent kinase (CDK), is down-regulated primarily through proteasome-dependent degradation after ubiquitination by the E3 ubiquitin ligase SCFβ-TrCP. The F-box protein β-TrCP (β-transducin repeat-containing protein), the substrate recognition component of the ubiquitin ligase, binds to its substrates through a conserved binding motif (phosphodegron) containing two phosphoserines, DpSGXXpS. Although Wee1A lacks this motif, phosphorylation of serines 53 and 123 (S53 and S123) of Wee1A by polo-like kinase 1 (Plk1) and CDK, respectively, are required for binding to β-TrCP. The sequence surrounding phosphorylated S53 (DpSAFQE) is similar to the conserved β-TrCP-binding motif; however, the role of S123 phosphorylation (EEGFGSSpSPVK) in β-TrCP binding was not elucidated. In the present study, we show that phosphorylation of S123 (pS123) by CDK promoted the binding of Wee1A to β-TrCP through three independent mechanisms. The pS123 not only directly interacted with basic residues in the WD40 repeat domain of β-TrCP but also primed phosphorylation by two independent protein kinases, Plk1 and CK2 (formerly casein kinase 2), to create two phosphodegrons on Wee1A. In the case of Plk1, S123 phosphorylation created a polo box domain-binding motif (SpSP) on Wee1A to accelerate phosphorylation of S53 by Plk1. CK2 could phosphorylate S121, but only if S123 was phosphorylated first, thereby generating the second β-TrCP-binding site (EEGFGpS121). Using a specific inhibitor of CK2, we showed that the phosphorylation-dependent degradation of Wee1A is important for the proper onset of mitosis. PMID:16085715

A POT1 mutation implicates defective telomere end fill-in and telomere truncations in Coats plus

PubMed Central

Takai, Hiroyuki; Jenkinson, Emma; Kabir, Shaheen; Babul-Hirji, Riyana; Najm-Tehrani, Nasrin; Chitayat, David A.; Crow, Yanick J.; de Lange, Titia

2016-01-01

Coats plus (CP) can be caused by mutations in the CTC1 component of CST, which promotes polymerase α (polα)/primase-dependent fill-in throughout the genome and at telomeres. The cellular pathology relating to CP has not been established. We identified a homozygous POT1 S322L substitution (POT1CP) in two siblings with CP. POT1CP induced a proliferative arrest that could be bypassed by telomerase. POT1CP was expressed at normal levels, bound TPP1 and telomeres, and blocked ATR signaling. POT1CP was defective in regulating telomerase, leading to telomere elongation rather than the telomere shortening observed in other telomeropathies. POT1CP was also defective in the maintenance of the telomeric C strand, causing extended 3′ overhangs and stochastic telomere truncations that could be healed by telomerase. Consistent with shortening of the telomeric C strand, metaphase chromosomes showed loss of telomeres synthesized by leading strand DNA synthesis. We propose that CP is caused by a defect in POT1/CST-dependent telomere fill-in. We further propose that deficiency in the fill-in step generates truncated telomeres that halt proliferation in cells lacking telomerase, whereas, in tissues expressing telomerase (e.g., bone marrow), the truncations are healed. The proposed etiology can explain why CP presents with features distinct from those associated with telomerase defects (e.g., dyskeratosis congenita). PMID:27013236

Time dependent pre-treatment EPID dosimetry for standard and FFF VMAT.

PubMed

Podesta, Mark; Nijsten, Sebastiaan M J J G; Persoon, Lucas C G G; Scheib, Stefan G; Baltes, Christof; Verhaegen, Frank

2014-08-21

Methods to calibrate Megavoltage electronic portal imaging devices (EPIDs) for dosimetry have been previously documented for dynamic treatments such as intensity modulated radiotherapy (IMRT) using flattened beams and typically using integrated fields. While these methods verify the accumulated field shape and dose, the dose rate and differential fields remain unverified. The aim of this work is to provide an accurate calibration model for time dependent pre-treatment dose verification using amorphous silicon (a-Si) EPIDs in volumetric modulated arc therapy (VMAT) for both flattened and flattening filter free (FFF) beams. A general calibration model was created using a Varian TrueBeam accelerator, equipped with an aS1000 EPID, for each photon spectrum 6 MV, 10 MV, 6 MV-FFF, 10 MV-FFF. As planned VMAT treatments use control points (CPs) for optimization, measured images are separated into corresponding time intervals for direct comparison with predictions. The accuracy of the calibration model was determined for a range of treatment conditions. Measured and predicted CP dose images were compared using a time dependent gamma evaluation using criteria (3%, 3 mm, 0.5 sec). Time dependent pre-treatment dose verification is possible without an additional measurement device or phantom, using the on-board EPID. Sufficient data is present in trajectory log files and EPID frame headers to reliably synchronize and resample portal images. For the VMAT plans tested, significantly more deviation is observed when analysed in a time dependent manner for FFF and non-FFF plans than when analysed using only the integrated field. We show EPID-based pre-treatment dose verification can be performed on a CP basis for VMAT plans. This model can measure pre-treatment doses for both flattened and unflattened beams in a time dependent manner which highlights deviations that are missed in integrated field verifications.

CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

PubMed

He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

2016-01-01

The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

PubMed

Najar, Hossain M; Dutz, Jan P

2008-09-01

Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

Proteasome Activation is Mediated via a Functional Switch of the Rpt6 C-terminal Tail Following Chaperone-dependent Assembly

PubMed Central

Sokolova, Vladyslava; Li, Frances; Polovin, George; Park, Soyeon

2015-01-01

In the proteasome, the proteolytic 20S core particle (CP) associates with the 19S regulatory particle (RP) to degrade polyubiquitinated proteins. Six ATPases (Rpt1-Rpt6) of the RP form a hexameric Rpt ring and interact with the heptameric α ring (α1–α7) of the CP via the Rpt C-terminal tails individually binding to the α subunits. Importantly, the Rpt6 tail has been suggested to be crucial for RP assembly. Here, we show that the interaction of the CP and Rpt6 tail promotes a CP-Rpt3 tail interaction, and that they jointly mediate proteasome activation via opening the CP gate for substrate entry. The Rpt6 tail forms a novel relationship with the Nas6 chaperone, which binds to Rpt3 and regulates the CP-Rpt3 tail interaction, critically influencing cell growth and turnover of polyubiquitinated proteins. CP-Rpt6 tail binding promotes the release of Nas6 from the proteasome. Based on disulfide crosslinking that detects cognate α3-Rpt6 tail and α2-Rpt3 tail interactions in the proteasome, decreased α3-Rpt6 tail interaction facilitates robust α2-Rpt3 tail interaction that is also strongly ATP-dependent. Together, our data support the reported role of Rpt6 during proteasome assembly, and suggest that its function switches from anchoring for RP assembly into promoting Rpt3-dependent activation of the mature proteasome. PMID:26449534

CpG-B Oligodeoxynucleotides Inhibit TLR-Dependent and -Independent Induction of Type I IFN in Dendritic Cells

PubMed Central

Liu, Yi C.; Gray, Reginald C.; Hardy, Gareth A. D.; Kuchtey, John; Abbott, Derek W.; Emancipator, Steven N.; Harding, Clifford V.

2010-01-01

CpG oligodeoxynucleotides (ODNs) signal through TLR9 to induce type I IFN (IFN-αβ) in dendritic cells (DCs). CpG-A ODNs are more efficacious than CpG-B ODNs for induction of IFN-αβ. Because IFN-αβ may contribute to autoimmunity, it is important to identify mechanisms to inhibit induction of IFN-αβ. In our studies, CpG-B ODN inhibited induction of IFN-αβ by CpG-A ODN, whereas induction of TNF-α and IL-12p40 by CpG-A ODN was not affected. CpG-B inhibition of IFN-αβ was observed in FLT3 ligand-induced murine DCs, purified murine myeloid DCs, plasmacytoid DCs, and human PBMCs. CpG-B ODN inhibited induction of IFN-αβ by agonists of multiple receptors, including MyD88-dependent TLRs (CpG-AODN signaling via TLR9, or R837 or Sendai virus signaling via TLR7) and MyD88-independent receptors (polyinosinic:polycytidylic acid signaling via TLR3 or ds break-DNA signaling via a cytosolic pathway). CpG-B ODN did not inhibit the IFN-αβ positive feedback loop second-wave IFN-αβ, because IFN-αβ–induced expression of IFN-αβ was unaffected, and CpG-B inhibition of IFN-αβ was manifested in IFN-αβR−/− DCs, which lack the positive feedback mechanism. Rather, CpG-B ODN inhibited early TLR-induced first wave IFN-α4 and IFN-β. Chromatin immunoprecipitation revealed that association of IFN regulatory factor 1 with the IFN-α4 and IFN-β promoters was induced by CpG-A ODN but not CpG-B ODN. Moreover, CpG-A–induced association of IFN regulatory factor 1 with these promoters was inhibited by CpG-B ODN. Our studies demonstrate a novel mechanism of transcriptional regulation of first-wave IFN-αβ that selectively inhibits induction of IFN-αβ downstream of multiple receptors and may provide targets for future therapeutic inhibition of IFN-αβ expression in vivo. PMID:20181884

Ramped-Amplitude Cross Polarization in Magic-Angle-Spinning NMR

NASA Astrophysics Data System (ADS)

Metz, G.; Wu, X. L.; Smith, S. O.

The Hartmann-Hahn matching profile in CP-MAS NMR shows a strong mismatch dependence if the MAS frequency is on the order of the dipolar couplings in the sample. Under these conditions, the profile breaks down into a series of narrow matching bands separated by the spinning speed, and it becomes difficult to establish and maintain an efficient matching condition. Variable-amplitude CP (VACP), as introduced previously (Peersen et al., J. Magn. Reson. A104, 334, 1993), has been proven to be effective for restoring flat profiles at high spinning speeds. Here, a refined implementation of VACP using a ramped-amplitude cross-polarization sequence (RAMP-CP) is described. The order of the amplitude modulation is shown to be of importance for the cross-polarization process. The new pulse sequence with a linear amplitude ramp is not only easier to set up but also improves the performance of the variable-amplitude experiment in that it produces flat profiles over a wider range of matching conditions even with short total contact times. An increase in signal intensity is obtained compared to both con ventional CP and the originally proposed VACP sequence.

Automatic evaluation of hypernasality based on a cleft palate speech database.

PubMed

He, Ling; Zhang, Jing; Liu, Qi; Yin, Heng; Lech, Margaret; Huang, Yunzhi

2015-05-01

The hypernasality is one of the most typical characteristics of cleft palate (CP) speech. The evaluation outcome of hypernasality grading decides the necessity of follow-up surgery. Currently, the evaluation of CP speech is carried out by experienced speech therapists. However, the result strongly depends on their clinical experience and subjective judgment. This work aims to propose an automatic evaluation system for hypernasality grading in CP speech. The database tested in this work is collected by the Hospital of Stomatology, Sichuan University, which has the largest number of CP patients in China. Based on the production process of hypernasality, source sound pulse and vocal tract filter features are presented. These features include pitch, the first and second energy amplified frequency bands, cepstrum based features, MFCC, short-time energy in the sub-bands features. These features combined with KNN classier are applied to automatically classify four grades of hypernasality: normal, mild, moderate and severe. The experiment results show that the proposed system achieves a good performance. The classification rates for four hypernasality grades reach up to 80.4%. The sensitivity of proposed features to the gender is also discussed.

Measurement of the CP Violation Parameter A_{Γ} in D^{0}→K^{+}K^{-} and D^{0}→π^{+}π^{-} Decays.

PubMed

Aaij, R; Adeva, B; Adinolfi, M; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Andreassi, G; Andreotti, M; Andrews, J E; Appleby, R B; Archilli, F; d'Argent, P; Arnau Romeu, J; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Babuschkin, I; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Baker, S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Baryshnikov, F; Baszczyk, M; Batozskaya, V; Batsukh, B; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Beiter, A; Bel, L J; Bellee, V; Belloli, N; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Beranek, S; Berezhnoy, A; Bernet, R; Bertolin, A; Betancourt, C; Betti, F; Bettler, M-O; van Beuzekom, M; Bezshyiko, Ia; Bifani, S; Billoir, P; Bird, T; Birnkraut, A; Bitadze, A; Bizzeti, A; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Boettcher, T; Bondar, A; Bondar, N; Bonivento, W; Bordyuzhin, I; Borgheresi, A; Borghi, S; Borisyak, M; Borsato, M; Bossu, F; Boubdir, M; Bowcock, T J V; Bowen, E; Bozzi, C; Braun, S; Britsch, M; Britton, T; Brodzicka, J; Buchanan, E; Burr, C; Bursche, A; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D H; Capriotti, L; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carniti, P; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cavallero, G; Cenci, R; Chamont, D; Charles, M; Charpentier, Ph; Chatzikonstantinidis, G; Chefdeville, M; Chen, S; Cheung, S-F; Chobanova, V; Chrzaszcz, M; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Cogoni, V; Cojocariu, L; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombs, G; Coquereau, S; Corti, G; Corvo, M; Costa Sobral, C M; Couturier, B; Cowan, G A; Craik, D C; Crocombe, A; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Da Cunha Marinho, F; Dall'Occo, E; Dalseno, J; David, P N Y; Davis, A; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Serio, M; De Simone, P; Dean, C T; Decamp, D; Deckenhoff, M; Del Buono, L; Demmer, M; Dendek, A; Derkach, D; Deschamps, O; Dettori, F; Dey, B; Di Canto, A; Dijkstra, H; Dordei, F; Dorigo, M; Dosil Suárez, A; Dovbnya, A; Dreimanis, K; Dufour, L; Dujany, G; Dungs, K; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Déléage, N; Easo, S; Ebert, M; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; Ely, S; Esen, S; Evans, H M; Evans, T; Falabella, A; Farley, N; Farry, S; Fay, R; Fazzini, D; Ferguson, D; Fernandez Prieto, A; Ferrari, F; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fini, R A; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fleuret, F; Fohl, K; Fontana, M; Fontanelli, F; Forshaw, D C; Forty, R; Franco Lima, V; Frank, M; Frei, C; Fu, J; Funk, W; Furfaro, E; Färber, C; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; Garcia Martin, L M; García Pardiñas, J; Garra Tico, J; Garrido, L; Garsed, P J; Gascon, D; Gaspar, C; Gavardi, L; Gazzoni, G; Gerick, D; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianì, S; Gibson, V; Girard, O G; Giubega, L; Gizdov, K; Gligorov, V V; Golubkov, D; Golutvin, A; Gomes, A; Gorelov, I V; Gotti, C; Govorkova, E; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graverini, E; Graziani, G; Grecu, A; Greim, R; Griffith, P; Grillo, L; Gruberg Cazon, B R; Grünberg, O; Gushchin, E; Guz, Yu; Gys, T; Göbel, C; Hadavizadeh, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hamilton, B; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hatch, M; He, J; Head, T; Heister, A; Hennessy, K; Henrard, P; Henry, L; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hombach, C; Hopchev, H; Hulsbergen, W; Humair, T; Hushchyn, M; Hutchcroft, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jawahery, A; Jiang, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kandybei, S; Karacson, M; Kariuki, J M; Karodia, S; Kecke, M; Kelsey, M; Kenzie, M; Ketel, T; Khairullin, E; Khanji, B; Khurewathanakul, C; Kirn, T; Klaver, S; Klimaszewski, K; Klimkovich, T; Koliiev, S; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Kosmyntseva, A; Kozachuk, A; Kozeiha, M; Kravchuk, L; Kreplin, K; Kreps, M; Krokovny, P; Kruse, F; Krzemien, W; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kuonen, A K; Kurek, K; Kvaratskheliya, T; Lacarrere, D; Lafferty, G; Lai, A; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Leflat, A; Lefrançois, J; Lefèvre, R; Lemaitre, F; Lemos Cid, E; Leroy, O; Lesiak, T; Leverington, B; Li, T; Li, Y; Likhomanenko, T; Lindner, R; Linn, C; Lionetto, F; Liu, X; Loh, D; Longstaff, I; Lopes, J H; Lucchesi, D; Lucio Martinez, M; Luo, H; Lupato, A; Luppi, E; Lupton, O; Lusiani, A; Lyu, X; Machefert, F; Maciuc, F; Maev, O; Maguire, K; Malde, S; Malinin, A; Maltsev, T; Manca, G; Mancinelli, G; Manning, P; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marinangeli, M; Marino, P; Marks, J; Martellotti, G; Martin, M; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massacrier, L M; Massafferri, A; Matev, R; Mathad, A; Mathe, Z; Matteuzzi, C; Mauri, A; Maurice, E; Maurin, B; Mazurov, A; McCann, M; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Melnychuk, D; Merk, M; Merli, A; Michielin, E; Milanes, D A; Minard, M-N; Mitzel, D S; Mogini, A; Molina Rodriguez, J; Monroy, I A; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Morgunova, O; Moron, J; Morris, A B; Mountain, R; Muheim, F; Mulder, M; Mussini, M; Müller, D; Müller, J; Müller, K; Müller, V; Naik, P; Nakada, T; Nandakumar, R; Nandi, A; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, T D; Nguyen-Mau, C; Nieswand, S; Niet, R; Nikitin, N; Nikodem, T; Nogay, A; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Ogilvy, S; Oldeman, R; Onderwater, C J G; Otalora Goicochea, J M; Otto, A; Owen, P; Oyanguren, A; Pais, P R; Palano, A; Palutan, M; Papanestis, A; Pappagallo, M; Pappalardo, L L; Parker, W; Parkes, C; Passaleva, G; Pastore, A; Patel, G D; Patel, M; Patrignani, C; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perret, P; Pescatore, L; Petridis, K; Petrolini, A; Petrov, A; Petruzzo, M; Picatoste Olloqui, E; Pietrzyk, B; Pikies, M; Pinci, D; Pistone, A; Piucci, A; Placinta, V; Playfer, S; Plo Casasus, M; Poikela, T; Polci, F; Poluektov, A; Polyakov, I; Polycarpo, E; Pomery, G J; Popov, A; Popov, D; Popovici, B; Poslavskii, S; Potterat, C; Price, E; Price, J D; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Quagliani, R; Rachwal, B; Rademacker, J H; Rama, M; Ramos Pernas, M; Rangel, M S; Raniuk, I; Ratnikov, F; Raven, G; Redi, F; Reichert, S; Dos Reis, A C; Remon Alepuz, C; Renaudin, V; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Lopez, J A; Rodriguez Perez, P; Rogozhnikov, A; Roiser, S; Rollings, A; Romanovskiy, V; Romero Vidal, A; Ronayne, J W; Rotondo, M; Rudolph, M S; Ruf, T; Ruiz Valls, P; Saborido Silva, J J; Sadykhov, E; Sagidova, N; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santimaria, M; Santovetti, E; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrina, D; Schael, S; Schellenberg, M; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmelzer, T; Schmidt, B; Schneider, O; Schopper, A; Schreiner, H F; Schubert, K; Schubiger, M; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Semennikov, A; Sergi, A; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Siddi, B G; Silva Coutinho, R; Silva de Oliveira, L; Simi, G; Simone, S; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, E; Smith, I T; Smith, J; Smith, M; Snoek, H; Soares Lavra, L; Sokoloff, M D; Soler, F J P; Souza De Paula, B; Spaan, B; Spradlin, P; Sridharan, S; Stagni, F; Stahl, M; Stahl, S; Stefko, P; Stefkova, S; Steinkamp, O; Stemmle, S; Stenyakin, O; Stevens, H; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Stramaglia, M E; Straticiuc, M; Straumann, U; Sun, L; Sutcliffe, W; Swientek, K; Syropoulos, V; Szczekowski, M; Szumlak, T; T'Jampens, S; Tayduganov, A; Tekampe, T; Tellarini, G; Teubert, F; Thomas, E; van Tilburg, J; Tilley, M J; Tisserand, V; Tobin, M; Tolk, S; Tomassetti, L; Tonelli, D; Topp-Joergensen, S; Toriello, F; Tournefier, E; Tourneur, S; Trabelsi, K; Traill, M; Tran, M T; Tresch, M; Trisovic, A; Tsaregorodtsev, A; Tsopelas, P; Tully, A; Tuning, N; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vacca, C; Vagnoni, V; Valassi, A; Valat, S; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; van Veghel, M; Velthuis, J J; Veltri, M; Veneziano, G; Venkateswaran, A; Vernet, M; Vesterinen, M; Viana Barbosa, J V; Viaud, B; Vieira, D; Vieites Diaz, M; Viemann, H; Vilasis-Cardona, X; Vitti, M; Volkov, V; Vollhardt, A; Voneki, B; Vorobyev, A; Vorobyev, V; Voß, C; de Vries, J A; Vázquez Sierra, C; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wang, J; Ward, D R; Wark, H M; Watson, N K; Websdale, D; Weiden, A; Whitehead, M; Wicht, J; Wilkinson, G; Wilkinson, M; Williams, M; Williams, M P; Williams, M; Williams, T; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wraight, K; Wyllie, K; Xie, Y; Xing, Z; Xu, Z; Yang, Z; Yao, Y; Yin, H; Yu, J; Yuan, X; Yushchenko, O; Zarebski, K A; Zavertyaev, M; Zhang, L; Zhang, Y; Zhelezov, A; Zheng, Y; Zhu, X; Zhukov, V; Zucchelli, S

2017-06-30

Asymmetries in the time-dependent rates of D^{0}→K^{+}K^{-} and D^{0}→π^{+}π^{-} decays are measured in a pp collision data sample collected with the LHCb detector during LHC Run 1, corresponding to an integrated luminosity of 3  fb^{-1}. The asymmetries in effective decay widths between D^{0} and D[over ¯]^{0} decays, sensitive to indirect CP violation, are measured to be A_{Γ}(K^{+}K^{-})=(-0.30±0.32±0.10)×10^{-3} and A_{Γ}(π^{+}π^{-})=(0.46±0.58±0.12)×10^{-3}, where the first uncertainty is statistical and the second systematic. These measurements show no evidence for CP violation and improve on the precision of the previous best measurements by nearly a factor of two.

Male-specific expression of Sox9 during gonad development of crocodile and mouse is mediated by alternative splicing of its proline-glutamine-alanine rich domain.

PubMed

Agrawal, Raman; Wessely, Oliver; Anand, Amit; Singh, Lalji; Aggarwal, Ramesh K

2009-08-01

The initial trigger for sexual differentiation is regulated by multiple ways during embryonic development. In vertebrates, chromosome-based mechanisms generally known as genetic sex determination are prevalent; however, some species, such as many reptilians, display temperature-dependent sex determination. The Sry-related transcription factor, Sox9, which is expressed by an evolutionary conserved gene, has been shown to be a key player in the process of sex determination. In the present study, we report the identification and expression of crocodile homolog of Sox9 (cpSox9) from the Indian Mugger, Crocodylus palustris. We show that cpSox9 undergoes extensive alternative splicing around the proline-glutamine-alanine rich transactivation domain that results in cpSox9 variants with presumably impaired or reduced transactivation potential. The multiple isoforms were also detected in various embryonic tissues, with some of them displaying a differential expression profile. With respect to sex differentiation, a putative unspliced full-length cpSox9 could be detected only in the genital ridge-adrenal-mesonephros complex of male, but not female embryos during the temperature-sensitive period. Importantly, we further show that this phenomenon was not restricted to the temperature-dependent sex determination species C. palustris, but was also observed in the mouse, a species exhibiting genetic sex determination. Thus, the present study describes, for the first time, a complete coding locus of Sox9 homolog from a temperature-dependent sex determination species. More importantly, we demonstrate an evolutionarily conserved role of alternative splicing resulting in transcriptional diversity and male-sex specific expression of Sox9 during testis development in vertebrates (i.e. irrespective of their underlying sex-determination mechanisms).

Cysteine protease 30 (CP30) contributes to adhesion and cytopathogenicity in feline Tritrichomonas foetus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gould, Emily N.; Giannone, Richard; Kania, Stephen A.

Tritrichomonas foetus ( T. foetus) is a flagellated protozoan parasite that is recognized as a significant cause of diarrhea in domestic cats with a prevalence rate as high as 30%. No drugs have been shown to consistently eliminate T. foetus infection in all cats. Cysteine proteases (CPs) have been identified as mediators of T. foetus-induced adhesion-dependent cytotoxicity to the intestinal epithelium. These CPs represent novel targets for the treatment of feline trichomonosis. However, cats also produce CPs that are part of life-critical systems. Thus, parasitic CPs need to be selectively targeted to reduce the potential for host toxicity. Previous studiesmore » have demonstrated the importance of a specific CP, CP30, in mediating bovine and human trichomonad cytopathogenicity. This CP has also recently been identified in feline T. foetus, although the function of this protease in the feline genotype remains unknown. Furthermore, the study objectives were to characterize the presence of CP30 in feline T. foetus isolates and to evaluate the effect of targeted inhibition of CP30 on feline T. foetus-induced adhesion dependent cytotoxicity.« less

The choroid plexus harbors a circadian oscillator modulated by estrogens.

PubMed

Quintela, Telma; Albuquerque, Tânia; Lundkvist, Gabriella; Carmine Belin, Andrea; Talhada, Daniela; Gonçalves, Isabel; Carro, Eva; Santos, Cecília R A

2018-02-01

The suprachiasmatic nucleus (SCN) of the hypothalamus is considered the master circadian oscillator in mammals. However, extra-SCN structures in the brain also display daily rhythms. Recently, we have demonstrated that the choroid plexus (CP) expresses core clock genes that are subjected to circadian regulation in a sex-dependent manner. By using CP explants cultured from female knock-in mice carrying the Period-luciferase transgene, we show that CP exhibits endogenous circadian rhythms of PERIOD2::LUCIFERASE expression. Furthermore, we demonstrate that estrogen declines following ovariectomy modulates the daily rhythm expression of Bmal1, Per1 and Per2 in female rat CP, corroborating data obtained in experiments where rat CP epithelial cell (CPEC) cultures were incubated with 17β-estradiol (E2). The molecular mechanism underlying these effects was also investigated, and we provide evidence that the estrogen receptor (ER) mediates the response of clock genes to E2. In conclusion, our study proves that the CP harbors a circadian oscillator that is modulated by estrogens and demonstrates that E2 regulation occurs through an estrogen-receptor-dependent mechanism.

FNIRS-based evaluation of cortical plasticity in children with cerebral palsy undergoing constraint-induced movement therapy

NASA Astrophysics Data System (ADS)

Cao, Jianwei; Khan, Bilal; Hervey, Nathan; Tian, Fenghua; Delgado, Mauricio R.; Clegg, Nancy J.; Smith, Linsley; Roberts, Heather; Tulchin-Francis, Kirsten; Shierk, Angela; Shagman, Laura; MacFarlane, Duncan; Liu, Hanli; Alexandrakis, George

2015-03-01

Sensorimotor cortex plasticity induced by constraint-induced movement therapy (CIMT) in six children (10.2 ± 2.1 years old) with hemiplegic cerebral palsy (CP) was assessed by functional near-infrared spectroscopy (fNIRS). The activation laterality index and time-to-peak/duration during a finger tapping task were quantified before, immediately after, and six months after CIMT. Five age-matched healthy children (9.8 ± 1.3 years old) were also imaged at the same time points to provide comparative activation metrics for normal controls. In children with CP the activation time-to-peak/duration for all sensorimotor centers displayed significant normalization immediately after CIMT that persisted six months later. In contrast to this longer term improvement in localized activation response, the laterality index that depended on communication between sensorimotor centers improved immediately after CIMT, but relapsed six months later.

Chronic treatment with CP 55,940 during the peri-adolescent period differentially affects the behavioural responses of male and female rats in adulthood.

PubMed

Biscaia, Miguel; Marín, Susana; Fernández, Beatriz; Marco, Eva M; Rubio, Marina; Guaza, Carmen; Ambrosio, Emilio; Viveros, Maria Paz

2003-11-01

Despite the increasing use of cannabis among adolescents, there is scarce information about the long-term effects of cannabinoid receptor agonists in appropriate animal models. We aimed to investigate the behavioural features of adult male and female Wistar rats that had been exposed to a chronic treatment with the cannabinoid receptor agonist CP 55,940 (CP) during the juvenile period. CP (0.4 mg/kg i.p.) or its corresponding vehicle was administered once daily, from day 35 to day 45. In adulthood, the animals were tested in the holeboard, the open field and the elevated plus-maze, under different stress (illumination) conditions. After a resting period, the serum corticosterone levels (radioimmunoassay) of the animals were measured. The effects of CP on food intake and somatic growth were monitored throughout the experimental period. The CP treatment induced significant sex-dependent effects on holeboard activity, as well as a decrease in the level of emotionality/anxiety in the open field and in the plus-maze. The animals receiving CP also showed diminished food intake and body weights during the treatment period, but both parameters recovered normal values during the period after treatment. No significant effect of the CP treatment on corticosterone levels was found. The results demonstrate that chronic administration of CP during the peri-adolescent period resulted in marked behavioural effects in adulthood. The nature of these effects depended on the sex of the animals and on the specific behavioural test. The possible neurobiological substrates underlying the effects of CP are discussed.

The ventilatory anaerobic threshold is related to, but is lower than, the critical power, but does not explain exercise tolerance at this workrate.

PubMed

Okudan, N; Gökbel, H

2006-03-01

The aim of the present study was to investigate the relationships between critical power (CP), maximal aerobic power and the anaerobic threshold and whether exercise time to exhaustion and work at the CP can be used as an index in the determination of endurance. An incremental maximal cycle exercise test was performed on 30 untrained males aged 18-22 years. Lactate analysis was carried out on capillary blood samples at every 2 minutes. From gas exchange parameters and heart rate and lactate values, ventilatory anaerobic thresholds, heart rate deflection point and the onset of blood lactate accumulation were calculated. CP was determined with linear work-time method using 3 loads. The subjects exercised until they could no longer maintain a cadence above 24 rpm at their CP and exercise time to exhaustion was determined. CP was lower than the power output corresponding to VO2max, higher than the power outputs corresponding to anaerobic threshold. CP was correlated with VO2max and anaerobic threshold. Exercise time to exhaustion and work at CP were not correlated with VO2max and anaerobic threshold. Because of the correlations of the CP with VO2max and anaerobic threshold and no correlation of exercise time to exhaustion and work at the CP with these parameters, we conclude that exercise time to exhaustion and work at the CP cannot be used as an index in the determination of endurance.

Topical CpG Adjuvantation of a Protein-Based Vaccine Induces Protective Immunity to Listeria monocytogenes

PubMed Central

Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.

2014-01-01

Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136

EAST Organizes Drosophila Insulator Proteins in the Interchromosomal Nuclear Compartment and Modulates CP190 Binding to Chromatin

PubMed Central

Golovnin, Anton; Melnikova, Larisa; Shapovalov, Igor; Kostyuchenko, Margarita; Georgiev, Pavel

2015-01-01

Recent data suggest that insulators organize chromatin architecture in the nucleus. The best studied Drosophila insulator proteins, dCTCF (a homolog of the vertebrate insulator protein CTCF) and Su(Hw), are DNA-binding zinc finger proteins. Different isoforms of the BTB-containing protein Mod(mdg4) interact with Su(Hw) and dCTCF. The CP190 protein is a cofactor for the dCTCF and Su(Hw) insulators. CP190 is required for the functional activity of insulator proteins and is involved in the aggregation of the insulator proteins into specific structures named nuclear speckles. Here, we have shown that the nuclear distribution of CP190 is dependent on the level of EAST protein, an essential component of the interchromatin compartment. EAST interacts with CP190 and Mod(mdg4)-67.2 proteins in vitro and in vivo. Over-expression of EAST in S2 cells leads to an extrusion of the CP190 from the insulator bodies containing Su(Hw), Mod(mdg4)-67.2, and dCTCF. In consistent with the role of the insulator bodies in assembly of protein complexes, EAST over-expression led to a striking decrease of the CP190 binding with the dCTCF and Su(Hw) dependent insulators and promoters. These results suggest that EAST is involved in the regulation of CP190 nuclear localization. PMID:26489095

Effectiveness of cytopenia prophylaxis for different filgrastim and pegfilgrastim schedules in a chemotherapy mouse model

PubMed Central

Scholz, Markus; Ackermann, Manuela; Emmrich, Frank; Loeffler, Markus; Kamprad, Manja

2009-01-01

Objectives Recombinant human granulocyte colony-stimulating factor (rhG-CSF) is widely used to treat neutropenia during cytotoxic chemotherapy. The optimal scheduling of rhG-CSF is unknown and can hardly be tested in clinical studies due to numerous therapy parameters affecting outcome (chemotherapeutic regimen, rhG-CSF schedules, individual covariables). Motivated by biomathematical model simulations, we aim to investigate different rhG-CSF schedules in a preclinical chemotherapy mouse model. Methods The time course of hematotoxicity was studied in CD-1 mice after cyclophosphamide (CP) administration. Filgrastim was applied concomitantly in a 2 × 3-factorial design of two dosing options (2 × 20 μg and 4 × 10 μg) and three timing options (directly, one, and two days after CP). Alternatively, a single dose of 40 μg pegfilgrastim was applied at the three timing options. The resulting cytopenia was compared among the schedules. Results Dosing and timing had a significant influence on the effectiveness of filgrastim schedules whereas for pegfilgrastim the timing effect was irrelevant. The best filgrastim and pegfilgrastim schedules exhibited equivalent toxicity. Monocytes dynamics performed analogously to granulocytes. All schedules showed roughly the same lymphotoxicity. Conclusion We conclude that effectiveness of filgrastim application depends heavily on its scheduling during chemotherapy. There is an optimum of timing. Dose splitting is better than concentrated applications. Effectiveness of pegfilgrastim is less dependent on timing. PMID:19707393

Effectiveness of cytopenia prophylaxis for different filgrastim and pegfilgrastim schedules in a chemotherapy mouse model.

PubMed

Scholz, Markus; Ackermann, Manuela; Emmrich, Frank; Loeffler, Markus; Kamprad, Manja

2009-01-01

Recombinant human granulocyte colony-stimulating factor (rhG-CSF) is widely used to treat neutropenia during cytotoxic chemotherapy. The optimal scheduling of rhG-CSF is unknown and can hardly be tested in clinical studies due to numerous therapy parameters affecting outcome (chemotherapeutic regimen, rhG-CSF schedules, individual covariables). Motivated by biomathematical model simulations, we aim to investigate different rhG-CSF schedules in a preclinical chemotherapy mouse model. The time course of hematotoxicity was studied in CD-1 mice after cyclophosphamide (CP) administration. Filgrastim was applied concomitantly in a 2 x 3-factorial design of two dosing options (2 x 20 mug and 4 x 10 mug) and three timing options (directly, one, and two days after CP). Alternatively, a single dose of 40 mug pegfilgrastim was applied at the three timing options. The resulting cytopenia was compared among the schedules. Dosing and timing had a significant influence on the effectiveness of filgrastim schedules whereas for pegfilgrastim the timing effect was irrelevant. The best filgrastim and pegfilgrastim schedules exhibited equivalent toxicity. Monocytes dynamics performed analogously to granulocytes. All schedules showed roughly the same lymphotoxicity. We conclude that effectiveness of filgrastim application depends heavily on its scheduling during chemotherapy. There is an optimum of timing. Dose splitting is better than concentrated applications. Effectiveness of pegfilgrastim is less dependent on timing.

CP violation in multibody B decays from QCD factorization

NASA Astrophysics Data System (ADS)

Klein, Rebecca; Mannel, Thomas; Virto, Javier; Vos, K. Keri

2017-10-01

We test a data-driven approach based on QCD factorization for charmless three-body B-decays by confronting it to measurements of CP violation in B - → π - π + π -. While some of the needed non-perturbative objects can be directly extracted from data, some others can, so far, only be modelled. Although this approach is currently model dependent, we comment on the perspectives to reduce this model dependence. While our model naturally accommodates the gross features of the Dalitz distribution, it cannot quantitatively explain the details seen in the current experimental data on local CP asymmetries. We comment on possible refinements of our simple model and conclude by briefly discussing a possible extension of the model to large invariant masses, where large local CP asymmetries have been measured.

Cotranslational Coat Protein-Mediated Inhibition of Potyviral RNA Translation

PubMed Central

Besong-Ndika, Jane; Ivanov, Konstantin I.; Hafrèn, Anders; Michon, Thierry

2015-01-01

ABSTRACT Potato virus A (PVA) is a single-stranded positive-sense RNA virus and a member of the family Potyviridae. The PVA coat protein (CP) has an intrinsic capacity to self-assemble into filamentous virus-like particles, but the mechanism responsible for the initiation of viral RNA encapsidation in vivo remains unclear. Apart from virion assembly, PVA CP is also involved in the inhibition of viral RNA translation. In this study, we show that CP inhibits PVA RNA translation in a dose-dependent manner, through a mechanism involving the CP-encoding region. Analysis of this region, however, failed to identify any RNA secondary structure(s) preferentially recognized by CP, suggesting that the inhibition depends on CP-CP rather than CP-RNA interactions. In agreement with this possibility, insertion of an in-frame stop codon upstream of the CP sequence led to a marked decrease in the inhibition of viral RNA translation. Based on these results, we propose a model in which the cotranslational interactions between excess CP accumulating in trans and CP translated from viral RNA in cis are required to initiate the translational repression. This model suggests a mechanism for how viral RNA can be sequestered from translation and specifically selected for encapsidation at the late stages of viral infection. IMPORTANCE The main functions of the CP during potyvirus infection are to protect viral RNA from degradation and to transport it locally, systemically, and from host to host. Although virion assembly is a key step in the potyviral infectious cycle, little is known about how it is initiated and how viral RNA is selected for encapsidation. The results presented here suggest that CP-CP rather than CP-RNA interactions are predominantly involved in the sequestration of viral RNA away from translation. We propose that the cotranslational nature of these interactions may represent a mechanism for the selection of viral RNA for encapsidation. A better understanding of the mechanism of virion assembly may lead to development of crops resistant to potyviruses at the level of viral RNA encapsidation, thereby reducing the detrimental effects of potyvirus infections on food production. PMID:25631087

Objectively measured sedentary time in youth with cerebral palsy compared with age-, sex-, and season-matched youth who are developing typically: an explorative study.

PubMed

Obeid, Joyce; Balemans, Astrid C J; Noorduyn, Stephen G; Gorter, Jan Willem; Timmons, Brian W

2014-08-01

Children with cerebral palsy (CP) demonstrate reduced physical activity levels compared with children with typical development. Sedentary behavior, including the duration and frequency of sedentary bouts, has not yet been objectively examined in this population but may have clinical implications for the development of secondary health complications. The aim of this study was to identify time spent sedentary and frequency of breaks interrupting sedentary time in youth with CP compared with youth without CP. It was hypothesized that individuals with CP would spend more hours sedentary than their peers and take fewer breaks to interrupt sedentary time. This was a cross-sectional, prospective study. A convenience sample of 17 ambulatory children with CP (15 boys and 2 girls) (mean age=13.0 years, SD=2.2) and 17 age-, sex-, and season-matched youth who were developing typically (TD group) (mean age=12.9 years, SD=2.5) wore an accelerometer over a 7-day period. Sedentary time (in minutes) and number of breaks from sedentary time, corrected for monitoring and sedentary time, respectively, were examined. Differences between groups were determined with an independent-samples t test. Children with CP engaged in significantly more sedentary time (X̅=47.5 min/h, SD=4.9) compared with the TD group (X̅=43.6 min/h, SD=4.2), with significantly fewer breaks from sedentary time (CP group: X̅=179, SD=70; TD group: X̅=232 breaks/h sedentary, SD=61). The sample included only ambulatory youth with CP, classified as Gross Motor Function Classification System levels I to III. Sedentary time was higher in the CP group and was characterized by less frequent breaks compared with the TD group. Future research should examine the extent to which sedentary time is associated with cardiovascular and metabolic risk in youth with CP. © 2014 American Physical Therapy Association.

Does Categorical Perception in the Left Hemisphere Depend on Language?

ERIC Educational Resources Information Center

Holmes, Kevin J.; Wolff, Phillip

2012-01-01

Categorical perception (CP) refers to the influence of category knowledge on perception and is revealed by a superior ability to discriminate items across categories relative to items within a category. In recent years, the finding that CP is lateralized to the left hemisphere in adults has been interpreted as evidence for a kind of CP driven by…

Formaldehyde activation of mitoxantrone yields CpG and CpA specific DNA adducts

PubMed Central

Parker, Belinda S.; Cutts, Suzanne M.; Cullinane, Carleen; Phillips, Don R.

2000-01-01

Recently we have found that mitoxantrone, like Adriamycin, can be activated by formaldehyde and subsequently form adducts which stabilise double-stranded DNA in vitro. This activation by formaldehyde may be biologically relevant since formaldehyde levels are elevated in those tumours in which mitoxantrone is most cytotoxic. In vitro transcription analysis revealed that these adducts block the progression of RNA polymerase during transcription and cause truncated RNA transcripts. There was an absolute requirement for both mitoxantrone and formaldehyde in transcriptional blockage formation and the activated complex was found to exhibit site specificity, with blockage occurring prior to CpG and CpA sites in the DNA (non-template strand). The stability of the adduct at 37°C was site dependent. The half-lives ranged from 45 min to ~5 h and this was dependent on both the central 2 bp blockage site as well as flanking sequences. The CpG specificity of mitoxantrone adduct sites was also confirmed independently by a λ exonuclease digestion assay. PMID:10648792

Disruption of DNA methylation-dependent long gene repression in Rett syndrome

PubMed Central

Gabel, Harrison W.; Kinde, Benyam Z.; Stroud, Hume; Gilbert, Caitlin S.; Harmin, David A.; Kastan, Nathaniel R.; Hemberg, Martin; Ebert, Daniel H.; Greenberg, Michael E.

2015-01-01

Disruption of the MECP2 gene leads to Rett syndrome (RTT), a severe neurological disorder with features of autism1. MECP2 encodes a methyl-DNA-binding protein2 that has been proposed to function as a transcriptional repressor, but despite numerous studies examining neuronal gene expression in Mecp2 mutants, no clear model has emerged for how MeCP2 regulates transcription3–9. Here we identify a genome-wide length-dependent increase in gene expression in MeCP2 mutant mouse models and human RTT brains. We present evidence that MeCP2 represses gene expression by binding to methylated CA sites within long genes, and that in neurons lacking MeCP2, decreasing the expression of long genes attenuates RTT-associated cellular deficits. In addition, we find that long genes as a population are enriched for neuronal functions and selectively expressed in the brain. These findings suggest that mutations in MeCP2 may cause neurological dysfunction by specifically disrupting long gene expression in the brain. PMID:25762136

Comparison of inter-trial recovery times for the determination of critical power and W' in cycling.

PubMed

Karsten, Bettina; Hopker, James; Jobson, Simon A; Baker, Jonathan; Petrigna, Luca; Klose, Andreas; Beedie, Christopher

2017-07-01

Critical Power (CP) and W' are often determined using multi-day testing protocols. To investigate this cumbersome testing method, the purpose of this study was to compare the differences between the conventional use of a 24-h inter-trial recovery time with those of 3 h and 30 min for the determination of CP and W'. 9 moderately trained cyclists performed an incremental test to exhaustion to establish the power output associated with the maximum oxygen uptake (p[Formula: see text] max ), and 3 protocols requiring time-to-exhaustion trials at a constant work-rate performed at 80%, 100% and 105% of p[Formula: see text] max. Design: Protocol A utilised 24-h inter-trial recovery (CP 24 /W' 24 ), protocol B utilised 3-h inter-trial recovery (CP 3 /W' 3 ), and protocol C used 30-min inter-trial recovery period (CP 0.5 /W' 0.5 ). CP and W' were calculated using the inverse time (1/t) versus power (P) relation (P = W'(1/t) + CP). 95% Limits of Agreement between protocol A and B were -9 to 15 W; -7.4 to 7.8 kJ (CP/W') and between protocol A and protocol C they were -27 to 22 W; -7.2 to 15.1 kJ (CP/W'). Compared to criterion protocol A, the average prediction error of protocol B was 2.5% (CP) and 25.6% (W'), whilst for protocol C it was 3.7% (CP) and 32.9% (W'). 3-h and 30-min inter-trial recovery time protocols provide valid methods of determining CP but not W' in cycling.

Precision measurement of CP violation in B(S)(0)→J/ΨK+K- decays.

PubMed

Aaij, R; Adeva, B; Adinolfi, M; Affolder, A; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Anderson, J; Andreassen, R; Andreotti, M; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Batozskaya, V; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bertolin, A; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Borsato, M; Bowcock, T J V; Bowen, E; Bozzi, C; Brett, D; Britsch, M; Britton, T; Brodzicka, J; Brook, N H; Bursche, A; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casanova Mohr, R C M; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chefdeville, M; Chen, S; Cheung, S-F; Chiapolini, N; Chrzaszcz, M; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Cogoni, V; Cojocariu, L; Collazuol, G; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Corvo, M; Counts, I; Couturier, B; Cowan, G A; Craik, D C; Crocombe, A C; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Dalseno, J; David, P; David, P N Y; Davis, A; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Dean, C-T; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Di Domenico, A; Dijkstra, H; Donleavy, S; Dordei, F; Dorigo, M; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dreimanis, K; Dujany, G; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Ely, S; Esen, S; Evans, H-M; Evans, T; Falabella, A; Färber, C; Farinelli, C; Farley, N; Farry, S; Fay, R; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fol, P; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Fu, J; Furfaro, E; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; García Pardiñas, J; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gastaldi, U; Gauld, R; Gavardi, L; Gazzoni, G; Geraci, A; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianelle, A; Gianì, S; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graverini, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grillo, L; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Henry, L; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Hussain, N; Hutchcroft, D; Hynds, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Karodia, S; Kelsey, M; Kenyon, I R; Ketel, T; Khanji, B; Khurewathanakul, C; Klaver, S; Klimaszewski, K; Kochebina, O; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanfranchi, G; Langenbruch, C; Langhans, B; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Likhomanenko, T; Liles, M; Lindner, R; Linn, C; Lionetto, F; Liu, B; Lohn, S; Longstaff, I; Lopes, J H; Lowdon, P; Lucchesi, D; Luo, H; Lupato, A; Luppi, E; Lupton, O; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Malinin, A; Manca, G; Mancinelli, G; Mapelli, A; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marino, P; Märki, R; Marks, J; Martellotti, G; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Mazurov, A; McCann, M; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M-N; Moggi, N; Molina Rodriguez, J; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Moron, J; Morris, A-B; Mountain, R; Muheim, F; Müller, K; Mussini, M; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Ogilvy, S; Okhrimenko, O; Oldeman, R; Onderwater, C J G; Orlandea, M; Otalora Goicochea, J M; Otto, A; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palombo, F; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Pappalardo, L L; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrignani, C; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perret, P; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Pistone, A; Playfer, S; Plo Casasus, M; Polci, F; Poluektov, A; Polyakov, I; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Price, E; Price, J D; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rachwal, B; Rademacker, J H; Rakotomiaramanana, B; Rama, M; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redi, F; Reichert, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rotondo, M; Rouvinet, J; Ruf, T; Ruiz, H; Ruiz Valls, P; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrina, D; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Semennikov, A; Sepp, I; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Silva Coutinho, R; Simi, G; Sirendi, M; Skidmore, N; Skillicorn, I; Skwarnicki, T; Smith, N A; Smith, E; Smith, E; Smith, J; Smith, M; Snoek, H; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Spradlin, P; Sridharan, S; Stagni, F; Stahl, M; Stahl, S; Steinkamp, O; Stenyakin, O; Sterpka, F; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Straticiuc, M; Straumann, U; Stroili, R; Sun, L; Sutcliffe, W; Swientek, K; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Tellarini, G; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Todd, J; Tolk, S; Tomassetti, L; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Trisovic, A; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vacca, C; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viana Barbosa, J V V B; Viaud, B; Vieira, D; Vieites Diaz, M; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; de Vries, J A; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Websdale, D; Whitehead, M; Wiedner, D; Wilkinson, G; Wilkinson, M; Williams, M P; Williams, M; Wilschut, H W; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wright, S; Wyllie, K; Xie, Y; Xing, Z; Xu, Z; Yang, Z; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L

2015-01-30

The time-dependent CP asymmetry in B(s)(0)→J/ψK+K- decays is measured using pp collision data, corresponding to an integrated luminosity of 3.0  fb-1, collected with the LHCb detector at center-of-mass energies of 7 and 8 TeV. In a sample of 96,000 B(s)(0)→J/ψK+K- decays, the CP-violating phase ϕs is measured, as well as the decay widths ΓL and ΓH of the light and heavy mass eigenstates of the B(s)(0)-B[over ¯]s0 system. The values obtained are ϕs=-0.058±0.049±0.006  rad, Γs≡(ΓL+ΓH)/2=0.6603±0.0027±0.0015  ps-1, and ΔΓs≡ΓL-ΓH=0.0805±0.0091±0.0032  ps-1, where the first uncertainty is statistical and the second, systematic. These are the most precise single measurements of those quantities to date. A combined analysis with Bs0→J/ψπ+π- decays gives ϕs=-0.010±0.039  rad. All measurements are in agreement with the standard model predictions. For the first time, the phase ϕs is measured independently for each polarization state of the K+K- system and shows no evidence for polarization dependence.

The effect of simulating weight gain on the energy cost of walking in unimpaired children and children with cerebral palsy.

PubMed

Plasschaert, Frank; Jones, Kim; Forward, Malcolm

2008-12-01

To examine the effect of simulating weight gain on the energy cost of walking in children with cerebral palsy (CP) compared with unimpaired children. Repeated measures, matched subjects, controlled. University hospital clinical gait and movement analysis laboratory. Children (n=42) with CP and unimpaired children (n=42). Addition of 10% of body mass in weight belt. Energy cost of walking parameters consisting of walking speed, Physiological Cost Index, Total Heart Beat Index, oxygen uptake (VO2), gross oxygen cost, nondimensional net oxygen cost, and net oxygen cost with speed normalized to height were measured by using a breath-by-breath gas analysis system (K4b2) and a light beam timing gate system arranged around a figure 8 track. Two walking trials were performed in random order, with and the other without wearing a weighted belt. Children with CP and their unimpaired counterparts responded in fundamentally different ways to weight gain. The unimpaired population maintained speed and VO2 but the children with CP trended toward a drop in their speed and an increase in their VO2. The oxygen consumption of children with CP showed a greater dependence on mass than the unimpaired group (P=.043). An increase of a relatively small percentage in body mass began to significantly impact the energy cost of walking in children with CP. This result highlights the need for weight control to sustain the level of functional walking in these children.

Intramuscular Administration of a Synthetic CpG-Oligodeoxynucleotide Modulates Functional Responses of Neutrophils of Neonatal Foals

PubMed Central

Cohen, Noah D.; Bourquin, Jessica R.; Bordin, Angela I.; Kuskie, Kyle R.; Brake, Courtney N.; Weaver, Kaytee B.; Liu, Mei; Felippe, M. Julia B.; Kogut, Michael H.

2014-01-01

Neutrophils play an important role in protecting against infection. Foals have age-dependent deficiencies in neutrophil function that may contribute to their predisposition to infection. Thus, we investigated the ability of a CpG-ODN formulated with Emulsigen to modulate functional responses of neutrophils in neonatal foals. Eighteen foals were randomly assigned to receive either a CpG-ODN with Emulsigen (N = 9) or saline intramuscularly at ages 1 and 7 days. At ages 1, 3, 9, 14, and 28, blood was collected and neutrophils were isolated from each foal. Neutrophils were assessed for basal and Rhodococcus equi-stimulated mRNA expression of the cytokines interferon-γ (IFN-γ), interleukin (IL)-4, IL-6, and IL-8 using real-time PCR, degranulation by quantifying the amount of β-D glucuronidase activity, and reactive oxygen species (ROS) generation using flow cytometry. In vivo administration of the CpG-ODN formulation on days 1 and 7 resulted in significantly (P<0.05) increased IFN-γ mRNA expression by foal neutrophils on days 3, 9, and 14. Degranulation was significantly (P<0.05) lower for foals in the CpG-ODN-treated group than the control group at days 3 and 14, but not at other days. No effect of treatment on ROS generation was detected. These results indicate that CpG-ODN administration to foals might improve innate and adaptive immune responses that could protect foals against infectious diseases and possibly improve responses to vaccination. PMID:25333660

Remark on Majorana CP phases in neutrino mixing and leptogenesis

NASA Astrophysics Data System (ADS)

Kitabayashi, Teruyuki; Koizumi, Naoto

2014-05-01

We estimate Majorana CP phases for a simple flavor neutrino mixing matrix which has been reported by Qu and Ma. Sizes of Majorana CP phases are evaluated in the study of the neutrinoless double beta decay and a particular leptogenesis scenario. We find the dependence of the physically relevant Majorana CP phase on the mass of lightest right-handed neutrino in the minimal seesaw model and the effective Majorana neutrino mass which is related with the half-life of the neutrinoless double beta decay.

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Observation of rat's colon polyps in real time by mini-endoscopy and raman spectroscopy

NASA Astrophysics Data System (ADS)

Andriana, Bibin Bintang; Mahardika, Anggara; Taketani, Akihiro; Sato, Hidetoshi

2018-02-01

Colorectal adenoma (CA) is a disease caused by various factors (such as genetic factors or environmental exposures). The appearance of colon polyp (CP) within colorectal might indicate the hint of CA development. Ball-lens hollow fiber Raman probe (BHRP) may has a high capability for detection of CA in living experimental animal and have already tested to rat's CP in this study, which was designed to collaborate between BHRP with mini-endoscopy to observe the biochemical alteration within normal colon tissue and rat's colon polyps in real time. BHRP and mini-endoscopy can distinguish the differences in their finger print spectra and make pictures the control and CP in the real time. At the first step, the real situation of normal colon and Rat's CP were washed by saline and observed with mini-endoscopy. BHRP was introduced to Dextran sodium sulphate (DSS)-induced Rat's CP to detect some of biochemical alteration. The main purpose of this study was to introduce mini-endoscopy to guide the BHRP for diagnosing of CP in real time and to compare it with spectra of normal colon (control group) in living rat. As the result, BHRP can provide the differences in band of control and CP group, which can inform that the biochemical of normal and CP has changed. As a major parameter to distinct normal and CP tissue were phosphatidylinositol, phosphodiester group, lipid, and collagen. Mini endoscopy and BHRP is very sensitive devices for diagnosing of CP in real time.

Cysteine protease 30 (CP30) contributes to adhesion and cytopathogenicity in feline Tritrichomonas foetus.

PubMed

Gould, Emily N; Giannone, Richard; Kania, Stephen A; Tolbert, M Katherine

2017-09-15

Tritrichomonas foetus (T. foetus) is a flagellated protozoan parasite that is recognized as a significant cause of diarrhea in domestic cats with a prevalence rate as high as 30%. No drugs have been shown to consistently eliminate T. foetus infection in all cats. Cysteine proteases (CPs) have been identified as mediators of T. foetus-induced adhesion-dependent cytotoxicity to the intestinal epithelium. These CPs represent novel targets for the treatment of feline trichomonosis. However, cats also produce CPs that are part of life-critical systems. Thus, parasitic CPs need to be selectively targeted to reduce the potential for host toxicity. Previous studies have demonstrated the importance of a specific CP, CP30, in mediating bovine and human trichomonad cytopathogenicity. This CP has also recently been identified in feline T. foetus, although the function of this protease in the feline genotype remains unknown. Therefore, the study objectives were to characterize the presence of CP30 in feline T. foetus isolates and to evaluate the effect of targeted inhibition of CP30 on feline T. foetus-induced adhesion dependent cytotoxicity. The presence of CP30 in feline T. foetus isolates was identified by In gel zymography and proteomic analysis, indirect immunofluorescence (IF), and flow cytometry using a rabbit polyclonal antibody that targets bovine T. foetus CP30 (α-CP30). The effect of inhibition of CP30 activity on T. foetus adhesion and cytotoxicity was determined using CFSE-labeled feline T. foetus and crystal violet spectrophotometric assays in a previously validated co-culture model. CP30 expression was confirmed in all feline T. foetus isolates tested by all assays. Targeted inhibition of feline T. foetus CP30 resulted in decreased T. foetus adhesion to and cytotoxicity towards IPEC-J2 monolayers compared to rabbit IgG-treated T. foetus isolates. These studies establish that CP30 is expressed by feline T. foetus isolates and may be an important virulence factor in the cytopathogenicity of feline T. foetus. The results of these studies provide strong evidence-based justification for investigation of CP30 as a novel target for the treatment of feline trichomonosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Longitudinal associations between conduct problems and depressive symptoms among girls and boys with early conduct problems.

PubMed

Poirier, Martine; Déry, Michèle; Temcheff, Caroline E; Toupin, Jean; Verlaan, Pierrette; Lemelin, Jean-Pascal

2016-07-01

Youth with conduct problems (CP) may experience high rates of depressive symptoms (DS). However, little is known about the direction of the longitudinal associations between CP and DS in this specific population. Although girls with CP appear at greater risk than boys for presenting comorbid depression, empirical research on gender differences in these associations is even sparser. The current study used autoregressive latent trajectory models to compare four perspectives with hypotheses regarding the longitudinal associations between CP and DS, while taking into account the evolution of both problems. We also examined gender differences in the longitudinal associations. A total of 345 children (40.6 % female) presenting with a high level of CP in early elementary school (mean age at study inception = 8.52; SD = .94) were evaluated annually over a four-year period (5 measurement time points). The results revealed that CP and DS were quite stable over time. Moreover, CP and DS showed strong covariation at each measurement time point, but only one significant positive cross-lagged association between the two processes, indicating that higher levels of DS at time 3 were associated with higher levels of CP 1 year later. No differences were observed in the longitudinal associations between CP and DS in boys and girls. Given the comorbidity and stability of CP and DS, these findings suggest that DS should be systematically evaluated among children with early clinically significant CP, and treatment plans should include interventions aimed at both CP and DS among children who present with both types of problems.

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

Enduring abolishment of remote but not recent expression of conditioned fear by the blockade of calcium-permeable AMPA receptors before extinction training.

PubMed

Zelena, Dóra; Mikics, Éva; Balázsfi, Diána; Varga, János; Klausz, Barbara; Urbán, Eszter; Sipos, Eszter; Biró, László; Miskolczi, Christina; Kovács, Krisztina; Ferenczi, Szilamér; Haller, József

2016-06-01

Calcium-permeable (GluA2 subunit-free) AMPA receptors (CP-AMPAR) play prominent roles in fear extinction; however, no blockers of these receptors were studied in tests relevant to extinction learning so far. The CP-AMPAR antagonist IEM-1460 was administered once before extinction trainings, which were started either 1 or 28 days after fear conditioning (FC). We used a mild extinction protocol that durably decreased but did not abolish conditioned fear. The messenger RNA (mRNA) expression of GluA1 and GluA2 subunits were investigated at both time points in the ventromedial prefrontal cortex (vmPFC) and amygdala. IEM-1460 transiently facilitated extinction 1 day after conditioning, but learned fear spontaneously recovered 4 weeks later. When the extinction protocol was applied 28 days after training, IEM-1460 enhanced extinction memory, moreover abolished conditioned fear for at least a month. The expression of GluA1 and GluA2 mRNAs was increased at both time points in the vmPFC. In the basolateral and central amygdala, the GluA1/GluA2 mRNA ratio increased, suggesting a shift towards the preponderance of GluA1 over GluA2 expression. AMPAR blockade lastingly enhanced the extinction of remote but not recent fear memories. Time-dependent changes in AMPA receptor subunit mRNA expression may explain the differential effects of CP-AMPAR blockade on recent and remote conditioned fear, further supporting the notion that the mechanisms maintaining learned fear change over time. Our findings suggest clinical implications for CP-AMPAR blockers, particularly for acquired anxieties (e.g., post-traumatic stress disorder) which have a slow onset and are durable.

Caffeine enhances and accelerates the expression of sensitization induced by coca paste indicating its relevance as a main adulterant.

PubMed

Prieto, José P; Galvalisi, Martín; López-Hill, Ximena; Meikle, María N; Abin-Carriquiry, Juan A; Scorza, Cecilia

2015-08-01

Caffeine is an active adulterant found in several drugs of abuse including coca paste (CP). We had previously demonstrated that caffeine potentiated the acute stimulant effect induced by CP seized samples. The role of caffeine in the expression of sensitization elicited by a CP seized sample (CP1) was here evaluated. CP1 (equivalent dose of 10 mg/kg of cocaine), cocaine (pure, 10 mg/kg), a combination of cocaine 10 mg/kg plus caffeine 2.5 mg/kg (CP1-surrogate) and saline (control) were intraperitoneally injected in male rats under two different sensitization schedules. Ambulatory locomotion was recorded in 58 animals. After five daily CP1 injections and 5 days of withdrawal, CP1-challenged animals displayed a more robust sensitization than cocaine-treated animals. When a 3 injections-regime of CP1-surrogate or cocaine was assayed, only CP1-surrogate was able to elicit sensitization. Caffeine enhances and accelerates the CP1-induced sensitization. Results may shed light on the fast and high dependence observed in CP users. © American Academy of Addiction Psychiatry.

Impact of warped extra dimensions on the dipole coefficients in b → sγ transitions

NASA Astrophysics Data System (ADS)

Malm, Raoul; Neubert, Matthias; Schmell, Christoph

2016-04-01

We calculate the electro- and chromomagnetic dipole coefficients C 7 γ,8 g and {tilde{C}}_{7γ, 8g} in the context of the minimal Randall-Sundrum (RS) model with a Higgs sector localized on the IR brane using the five-dimensional (5D) approach, where the coefficients are expressed in terms of integrals over 5D propagators. Since we keep the full dependence on the Yukawa matrices, the integral expressions are formally valid to all orders in v 2/ M KK 2 . In addition we relate our results to the expressions obtained in the Kaluza-Klein (KK) decomposed theory and show the consistency in both pictures analytically and numerically, which presents a non-trivial cross-check. In Feynman-'t Hooft gauge, the dominant corrections from virtual KK modes arise from the scalar parts of the W ±-boson penguin diagrams, including the contributions from the scalar component of the 5D gauge-boson field and from the charged Goldstone bosons in the Higgs sector. The size of the KK corrections depends on the parameter y *, which sets the upper bound for the anarchic 5D Yukawa matrices. We find that for y * ≳ 1 the KK corrections are proportional to y ∗ 2 . We discuss the phenomenological implications of our results for the branching ratio Br(overline{B}to {X}_sγ ) , the time-dependent CP asymmetry S K ∗ γ , the direct CP asymmetry A CP b → sγ and the CP asymmetry difference Δ A CP b → sγ . We can derive a lower bound on the first KK gluon resonance of 3 .8 TeV for y * = 3, requiring that at least 10% of the RS parameter space covers the experimental 2 σ error margins. We further discuss the branching ratio Br(overline{B}to {X}_s{l}+{l}-) and compare our predictions for C 7γ,9,10 and {tilde{C}}_{7γ, 9,10} with phenomenological results derived from model-independent analyses.

Transverse water relaxation in whole blood and erythrocytes at 3T, 7T, 9.4T, 11.7T and 16.4T; determination of intracellular hemoglobin and extracellular albumin relaxivities.

PubMed

Grgac, Ksenija; Li, Wenbo; Huang, Alan; Qin, Qin; van Zijl, Peter C M

2017-05-01

Blood is a physiological substance with multiple water compartments, which contain water-binding proteins such as hemoglobin in erythrocytes and albumin in plasma. Knowing the water transverse (R 2 ) relaxation rates from these different blood compartments is a prerequisite for quantifying the blood oxygenation level-dependent (BOLD) effect. Here, we report the Carr-Purcell-Meiboom-Gill (CPMG) based transverse (R 2CPMG ) relaxation rates of water in bovine blood samples circulated in a perfusion system at physiological temperature in order to mimic blood perfusion in humans. R 2CPMG values of blood plasma, lysed packed erythrocytes, lysed plasma/erythrocyte mixtures, and whole blood at 3 T, 7 T, 9.4 T, 11.7 T and 16.4 T were measured as a function of hematocrit or hemoglobin concentration, oxygenation, and CPMG inter-echo spacing (τ cp ). R 2CPMG in lysed cells showed a small τ cp dependence, attributed to the water exchange rate between free and hemoglobin-bound water to be much faster than τ cp . This was contrary to the tangential dependence in whole blood, where a much slower exchange between cells and blood plasma applies. Whole blood data were fitted as a function of τ cp using a general tangential correlation time model applicable for exchange as well as diffusion contributions to R 2CPMG , and the intercept R 20blood at infinitely short τ cp was determined. The R 20blood values at different hematocrit and the R 2CPMG values of lysed erythrocyte/plasma mixtures at different hemoglobin concentration were used to determine the relaxivity of hemoglobin inside the erythrocyte (r 2Hb ) and albumin (r 2Alb ) in plasma. The r 2Hb values obtained from lysed erythrocytes and whole blood were comparable at full oxygenation. However, while r 2Hb determined from lysed cells showed a linear dependence on oxygenation, this dependence became quadratic in whole blood. This possibly suggests an additional relaxation effect inside intact cells, perhaps due to hemoglobin proximity to the erythrocyte membrane. However, we cannot exclude that this is a consequence of the simple tangential model used to remove relaxation contributions from exchange and diffusion. The extensive data set presented should be useful for future theory development for the transverse relaxation of blood. Copyright © 2016 Elsevier Inc. All rights reserved.

The kinetics and mechanism of the organo-iridium catalysed racemisation of amines.

PubMed

Stirling, Matthew J; Mwansa, Joseph M; Sweeney, Gemma; Blacker, A John; Page, Michael I

2016-08-07

The dimeric iodo-iridium complex [IrCp*I2]2 (Cp* = pentamethylcyclopentadiene) is an efficient catalyst for the racemisation of secondary and tertiary amines at ambient and higher temperatures with a low catalyst loading. The racemisation occurs with pseudo-first-order kinetics and the corresponding four rate constants were obtained by monitoring the time dependence of the concentrations of the (R) and (S) enantiomers starting with either pure (R) or (S) and show a first-order dependence on catalyst concentration. Low temperature (1)H NMR data is consistent with the formation of a 1 : 1 complex with the amine coordinated to the iridium and with both iodide anions still bound to the metal-ion, but at the higher temperatures used for kinetic studies binding is weak and so no saturation zero-order kinetics are observed. A cross-over experiment with isotopically labelled amines demonstrates the intermediate formation of an imine which can dissociate from the iridium complex. Replacing the iodides in the catalyst by other ligands or having an amide substituent in Cp* results in a much less effective catalysts for the racemisation of amines. The rate constants for a deuterated amine yield a significant primary kinetic isotope effect kH/kD = 3.24 indicating that hydride transfer is involved in the rate-limiting step.

Interactions of Pre-Symbolic Children with Developmental Disabilities with Their Mothers and Siblings

ERIC Educational Resources Information Center

Singh, Susheel Joginder; Iacono, Teresa; Gray, Kylie M.

2015-01-01

Background: Depending on the severity of their disabilities, children with Down syndrome (DS) and with cerebral palsy (CP) may remain pre-symbolic for prolonged periods of time. When interacting with pre-symbolic children, communication partners have a role in identifying which of their behaviours are communicative, to be able to respond to those…

[Peptidergic nootropic therapy in cerebral palsy associated with epilepsy].

PubMed

Kholin, A A; Zavadenko, N N; Il Ina, E S; Kolpakchi, L M; Fedonyuk, I D; Bembeeva, R C; Esipova, E S

To assess the efficacy and safety of сortexin in the treatment of children with cerebral palsy (CP) combined with epilepsy. Eighty-four patients (55 boys and 29 girls), aged from 1 to 11 years, with CP combined with epilepsy received cortexin together with antiepileptic drugs (AEDs). Cortexin was administered in doses of 5-10 mg depending on the patient's age and body weight intramuscularly during hospitalization. Cortexin as add-on to AEDs reduced for more than two times the number of seizures, along with improvement of motor function, in 31 (36.9%) patients. The improvement of motor function, but without a significant decrease in epileptic seizures, was achieved in 15 (17.8%) of the patients. Reduction of epileptic seizures frequency (>2 times), but without a significant effect on motor function, was observed in 14 cases (16.7%). Twenty-three patients (27.4%) did not respond the therapy. The aggravation of epileptic seizures during cortexin therapy was observed in only 1 girl with West syndrome (1.2%), and this was significantly lower than the probability of seizures aggravation on AED. Polypeptide nootropic medication cortexin demonstrated efficacy and safety as adjunctive therapy in children with CP combined with epilepsy.

Unraveling the sequence-dependent polymorphic behavior of d(CpG) steps in B-DNA.

PubMed

Dans, Pablo Daniel; Faustino, Ignacio; Battistini, Federica; Zakrzewska, Krystyna; Lavery, Richard; Orozco, Modesto

2014-10-01

We have made a detailed study of one of the most surprising sources of polymorphism in B-DNA: the high twist/low twist (HT/LT) conformational change in the d(CpG) base pair step. Using extensive computations, complemented with database analysis, we were able to characterize the twist polymorphism in the d(CpG) step in all the possible tetranucleotide environment. We found that twist polymorphism is coupled with BI/BII transitions, and, quite surprisingly, with slide polymorphism in the neighboring step. Unexpectedly, the penetration of cations into the minor groove of the d(CpG) step seems to be the key element in promoting twist transitions. The tetranucleotide environment also plays an important role in the sequence-dependent d(CpG) polymorphism. In this connection, we have detected a previously unexplored intramolecular C-H···O hydrogen bond interaction that stabilizes the low twist state when 3'-purines flank the d(CpG) step. This work explains a coupled mechanism involving several apparently uncorrelated conformational transitions that has only been partially inferred by earlier experimental or theoretical studies. Our results provide a complete description of twist polymorphism in d(CpG) steps and a detailed picture of the molecular choreography associated with this conformational change. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Sources and Fates of Carbamyl Phosphate: A Labile Energy-Rich Molecule with Multiple Facets.

PubMed

Shi, Dashuang; Caldovic, Ljubica; Tuchman, Mendel

2018-06-12

Carbamyl phosphate (CP) is well-known as an essential intermediate of pyrimidine and arginine/urea biosynthesis. Chemically, CP can be easily synthesized from dihydrogen phosphate and cyanate. Enzymatically, CP can be synthesized using three different classes of enzymes: (1) ATP-grasp fold protein based carbamyl phosphate synthetase (CPS); (2) Amino-acid kinase fold carbamate kinase (CK)-like CPS (anabolic CK or aCK); and (3) Catabolic transcarbamylase. The first class of CPS can be further divided into three different types of CPS as CPS I, CPS II, and CPS III depending on the usage of ammonium or glutamine as its nitrogen source, and whether N -acetyl-glutamate is its essential co-factor. CP can donate its carbamyl group to the amino nitrogen of many important molecules including the most well-known ornithine and aspartate in the arginine/urea and pyrimidine biosynthetic pathways. CP can also donate its carbamyl group to the hydroxyl oxygen of a variety of molecules, particularly in many antibiotic biosynthetic pathways. Transfer of the carbamyl group to the nitrogen group is catalyzed by the anabolic transcarbamylase using a direct attack mechanism, while transfer of the carbamyl group to the oxygen group is catalyzed by a different class of enzymes, CmcH/NodU CTase, using a different mechanism involving a three-step reaction, decomposition of CP to carbamate and phosphate, transfer of the carbamyl group from carbamate to ATP to form carbamyladenylate and pyrophosphate, and transfer of the carbamyl group from carbamyladenylate to the oxygen group of the substrate. CP is also involved in transferring its phosphate group to ADP to generate ATP in the fermentation of many microorganisms. The reaction is catalyzed by carbamate kinase, which may be termed as catabolic CK (cCK) in order to distinguish it from CP generating CK. CP is a thermally labile molecule, easily decomposed into phosphate and cyanate, or phosphate and carbamate depending on the pH of the solution, or the presence of enzyme. Biological systems have developed several mechanisms including channeling between enzymes, increased affinity of CP to enzymes, and keeping CP in a specific conformation to protect CP from decomposition. CP is highly important for our health as both a lack of, or decreased, CP production and CP accumulation results in many disease conditions.

Asymmetric dark matter and CP violating scatterings in a UV complete model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baldes, Iason; Bell, Nicole F.; Millar, Alexander J.

We explore possible asymmetric dark matter models using CP violating scatterings to generate an asymmetry. In particular, we introduce a new model, based on DM fields coupling to the SM Higgs and lepton doublets, a neutrino portal, and explore its UV completions. We study the CP violation and asymmetry formation of this model, to demonstrate that it is capable of producing the correct abundance of dark matter and the observed matter-antimatter asymmetry. Crucial to achieving this is the introduction of interactions which violate CP with a T{sup 2} dependence.

Pure circular polarization electroluminescence at room temperature with spin-polarized light-emitting diodes.

PubMed

Nishizawa, Nozomi; Nishibayashi, Kazuhiro; Munekata, Hiro

2017-02-21

We report the room-temperature electroluminescence (EL) with nearly pure circular polarization (CP) from GaAs-based spin-polarized light-emitting diodes (spin-LEDs). External magnetic fields are not used during device operation. There are two small schemes in the tested spin-LEDs: first, the stripe-laser-like structure that helps intensify the EL light at the cleaved side walls below the spin injector Fe slab, and second, the crystalline AlO x spin-tunnel barrier that ensures electrically stable device operation. The purity of CP is depressively low in the low current density ( J ) region, whereas it increases steeply and reaches close to the pure CP when J > 100 A/cm 2 There, either right- or left-handed CP component is significantly suppressed depending on the direction of magnetization of the spin injector. Spin-dependent reabsorption, spin-induced birefringence, and optical spin-axis conversion are suggested to account for the observed experimental results.

From Geometry Optimization to Time Dependent Molecular Structure Modeling: Method Developments, ab initio Theories and Applications

NASA Astrophysics Data System (ADS)

Liang, Wenkel

This dissertation consists of two general parts: (I) developments of optimization algorithms (both nuclear and electronic degrees of freedom) for time-independent molecules and (II) novel methods, first-principle theories and applications in time dependent molecular structure modeling. In the first part, we discuss in specific two new algorithms for static geometry optimization, the eigenspace update (ESU) method in nonredundant internal coordinate that exhibits an enhanced performace with up to a factor of 3 savings in computational cost for large-sized molecular systems; the Car-Parrinello density matrix search (CP-DMS) method that enables direct minimization of the SCF energy as an effective alternative to conventional diagonalization approach. For the second part, we consider the time dependence and first presents two nonadiabatic dynamic studies that model laser controlled molecular photo-dissociation for qualitative understandings of intense laser-molecule interaction, using ab initio direct Ehrenfest dynamics scheme implemented with real-time time-dependent density functional theory (RT-TDDFT) approach developed in our group. Furthermore, we place our special interest on the nonadiabatic electronic dynamics in the ultrafast time scale, and presents (1) a novel technique that can not only obtain energies but also the electron densities of doubly excited states within a single determinant framework, by combining methods of CP-DMS with RT-TDDFT; (2) a solvated first-principles electronic dynamics method by incorporating the polarizable continuum solvation model (PCM) to RT-TDDFT, which is found to be very effective in describing the dynamical solvation effect in the charge transfer process and yields a consistent absorption spectrum in comparison to the conventional linear response results in solution. (3) applications of the PCM-RT-TDDFT method to study the intramolecular charge-transfer (CT) dynamics in a C60 derivative. Such work provides insights into the characteristics of ultrafast dynamics in photoexcited fullerene derivatives, and aids in the rational design for pre-dissociative exciton in the intramolecular CT process in organic solar cells.

Physical properties of superbulky lanthanide metallocenes: synthesis and extraordinary luminescence of [Eu(II)(Cp(BIG))2] (Cp(BIG) = (4-nBu-C6H4)5-cyclopentadienyl).

PubMed

Harder, Sjoerd; Naglav, Dominik; Ruspic, Christian; Wickleder, Claudia; Adlung, Matthias; Hermes, Wilfried; Eul, Matthias; Pöttgen, Rainer; Rego, Daniel B; Poineau, Frederic; Czerwinski, Kenneth R; Herber, Rolfe H; Nowik, Israel

2013-09-09

The superbulky deca-aryleuropocene [Eu(Cp(BIG))2], Cp(BIG) = (4-nBu-C6H4)5-cyclopentadienyl, was prepared by reaction of [Eu(dmat)2(thf)2], DMAT = 2-Me2N-α-Me3Si-benzyl, with two equivalents of Cp(BIG)H. Recrystallizyation from cold hexane gave the product with a surprisingly bright and efficient orange emission (45% quantum yield). The crystal structure is isomorphic to those of [M(Cp(BIG))2] (M = Sm, Yb, Ca, Ba) and shows the typical distortions that arise from Cp(BIG)⋅⋅⋅Cp(BIG) attraction as well as excessively large displacement parameter for the heavy Eu atom (U(eq) = 0.075). In order to gain information on the true oxidation state of the central metal in superbulky metallocenes [M(Cp(BIG))2] (M = Sm, Eu, Yb), several physical analyses have been applied. Temperature-dependent magnetic susceptibility data of [Yb(Cp(BIG))2] show diamagnetism, indicating stable divalent ytterbium. Temperature-dependent (151)Eu Mössbauer effect spectroscopic examination of [Eu(Cp(BIG))2] was examined over the temperature range 93-215 K and the hyperfine and dynamical properties of the Eu(II) species are discussed in detail. The mean square amplitude of vibration of the Eu atom as a function of temperature was determined and compared to the value extracted from the single-crystal X-ray data at 203 K. The large difference in these two values was ascribed to the presence of static disorder and/or the presence of low-frequency torsional and librational modes in [Eu(Cp(BIG))2]. X-ray absorbance near edge spectroscopy (XANES) showed that all three [Ln(Cp(BIG))2] (Ln = Sm, Eu, Yb) compounds are divalent. The XANES white-line spectra are at 8.3, 7.3, and 7.8 eV, for Sm, Eu, and Yb, respectively, lower than the Ln2O3 standards. No XANES temperature dependence was found from room temperature to 100 K. XANES also showed that the [Ln(Cp(BIG))2] complexes had less trivalent impurity than a [EuI2(thf)x] standard. The complex [Eu(Cp(BIG))2] shows already at room temperature strong orange photoluminescence (quantum yield: 45 %): excitation at 412 nm (24,270 cm(-1)) gives a symmetrical single band in the emission spectrum at 606 nm (νmax =16495 cm(-1), FWHM: 2090 cm(-1), Stokes-shift: 2140 cm(-1)), which is assigned to a 4f(6)5d(1) → 4f(7) transition of Eu(II). These remarkable values compare well to those for Eu(II)-doped ionic host lattices and are likely caused by the rigidity of the [Eu(Cp(BIG))2] complex. Sharp emission signals, typical for Eu(III), are not visible. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Time- and concentration-dependent increases in cell proliferation in rats and mice administered vinyl acetate in drinking water.

PubMed

Valentine, Rudolph; Bamberger, J R; Szostek, B; Frame, S R; Hansen, J F; Bogdanffy, M S

2002-06-01

Chronic administration of vinyl acetate (VA) in drinking water to rats and mice has produced upper digestive tract neoplasms. These tumors were believed to arise from the intracellular metabolism of VA by carboxylesterases to cytotoxic and genotoxic compounds. We hypothesized that prolonged VA exposure at high concentrations would induce cytotoxicity and a restorative cell proliferation (CP). These endpoints were measured in F-344 rats and BDF1 mice administered drinking water containing 0, 1000, 5000, 10,000, or 24,000 ppm VA for 92 days. On test days, Days 1, 8, 29, and 92, upper digestive tract histopathology and oral cavity CP (pulsed 5-bromodeoxyuridine [BrdU] to measure S-phase DNA synthesis) were evaluated. Analysis of test solutions showed that VA spontaneously hydrolyzed, slowly releasing acetic acid and thereby lowering pH. Statistically significant, concentration-related increases in CP occurred in basal cells of the mandibular oral cavity mucosa of mice at 10,000 and 24,000 ppm but only after 92 days. CP increases were approximately 2.4- and 3.4-fold above controls and were considered to be toxicologically significant. Some statistically significant increases in CP were also measured in the oral cavity mucosa of rats; however, these changes were considered to be of equivocal biological relevance. No histopathological evidence of mucosal injury was seen in either species. The absence of cytotoxicity in the upper digestive tract mucosa suggests that the increased CP at high administered VA concentrations may be due to a mitogenic response, ostensibly from the loss of cell growth controls in oral cavity mucosa.

Neutral D→KK^{*} Decays as Discovery Channels for Charm CP Violation.

PubMed

Nierste, Ulrich; Schacht, Stefan

2017-12-22

We point out that the CP asymmetries in the decays D^{0}→K_{S}K^{*0} and D^{0}→K_{S}K[over ¯]^{*0} are potential discovery channels for charm CP violation in the standard model. We stress that no flavor tagging is necessary, the untagged CP asymmetry a_{CP}^{dir}(D[over (-)]→K_{S}K^{*0}) is essentially equal to the tagged one, so that the untagged measurement comes with a significant statistical gain. Depending on the relevant strong phase, |a_{CP}^{dir,untag}| can be as large as 0.003. The CP asymmetry is dominantly generated by exchange diagrams and does not require nonvanishing penguin amplitudes. While the CP asymmetry is smaller than in the case of D^{0}→K_{S}K_{S}, the experimental analysis is more efficient due to the prompt decay K^{*0}→K^{+}π^{-}. One may further search for favorable strong phases in the Dalitz plot in the vicinity of the K^{*0} peak.

Transcription of the Epstein-Barr virus nuclear antigen 1 (EBNA1) gene occurs before induction of the BCR2 (Cp) EBNA gene promoter during the initial stages of infection in B cells.

PubMed

Schlager, S; Speck, S H; Woisetschläger, M

1996-06-01

The purpose of this study was to gain insights into the regulation of Epstein-Barr virus (EBV) gene transcription during the establishment of viral latency in B cells. During the early stages of EBV infection in B lymphocytes, transcription of six viral nuclear antigens (EBNAs) is initiated from an early promoter (Wp). This is followed by a switch of promoter usage to an upstream promoter, Cp, whose activity is autoregulated by both EBNA1 and EBNA2. Previously it was demonstrated that infection of primary B cells with EBNA2-negative (EBNA2-) EBNA4-mutant (EBNA4mut) virus resulted only in the expression of mutant EBNA4 protein and failure to express the other EBNA gene products (C. Rooney H. G. Howe, S. H. Speck, and G. Miller, J. Virol. 63:1531-1539, 1989). We extended this research to demonstrate that Wp-to-Cp switching did not occur upon infection of primary B cells with an EBNA2- EBNA4mut virus (M. Woisetschlaeger, X. W. Jin, C. N. Yandara, L. A. Furmanski, J. L. Strominger, and S. H. Speck, Proc. Natl. Acad. Sci. USA 88:3942-3946, 1991). Further characterization of this phenomenon led to the identification of an EBNA2-dependent enhancer upstream of Cp. On the basis of these data, a model was proposed in which initial transcription from Wp gives rise to the expression of EBNA2 and EBNA4, and then transcription is upregulated from Cp via the EBNA2- dependent enhancer (Woisetschlaeger et al., as noted above). Implicit in this model is that transcription of the EBNA1 and EBNA3a to -3c genes is dependent on the switch from Wp to Cp, since primary cells infected with EBNA2- EBNA4mut virus fail to switch and also fail to express these viral antigens. Here we critically evaluate this model and demonstrate, in contrast to the predictions of the model, that transcription of both the EBNA1 and EBNA2 genes precedes activation of Cp. Furthermore, the level of EBNA1 gene transcription was strongly reduced in primary B cells infected with EBNA2- EBNA4mut virus compared with that of cells infected with wild-type virus. Switching to Cp, as well as EBNA1 gene transcription, was observed upon infection of EBV-negative Burkitt's lymphoma (BL) cell lines with EBNA2- EBNA4mut virus, thus establishing a correlation between early EBNA1 gene transcription and upregulation of transcription initiation from Cp. However, in EBV-negative BL cell lines infected with EBNA2- EBNA4mut virus, transcription of the EBNA1 gene at early time points postinfection initiated from Qp, the EBNA1 gene promoter active in group I BL cells (B. C. Schaefer, J. L. Strominger, and S. H. Speck, Proc. Natl. Acad. Sci. USA 92:10565-10569, 1995), rather than from Wp. The data support a model in which EBNA1 plays an important role in the cascade of events leading to successful switching from Wp to Cp and subsequent immortalization of the infected B cell.

Effect of the additives on clouding behavior and thermodynamics of coenzyme Q10-Kolliphor HS15 micelle aqueous solutions

NASA Astrophysics Data System (ADS)

Hu, Li; Zhang, Jing; Zhu, Chao; Pan, Hong-chun; Liu, Hong

2017-11-01

Herein we investigate the effect of different additives (electrolytes, amino acids, PEG, and sugars) on the cloud points (CP) of coenzyme Q10 (CoQ10) - Kolliphor HS15 (HS15) micelle aqueous solutions. The CP values were decreased with the increase of electrolytes and sugars, following: CPAl3+ < CPMg2+ < CPCa2+ < CPNa+ < CPK+ < CPNH4+; CPdisaccharide < CPmonosaccharide. The presences of Arginine and Tryptophan significantly increased the CP; while the other amino acids reduced the CP. A depression of CP for CoQ10-HS15 micelle solution with PEG was molecular weight of PEG dependent. The significant thermodynamic parameters were also evaluated and discussed.

Near-bottom suspended matter concentration on the Continental Shelf during storms: estimates based on in situ observations of light transmission and a particle size dependent transmissometer calibration

USGS Publications Warehouse

Moody, J.A.; Butman, B.; Bothner, Michael H.

1987-01-01

A laboratory calibration of Sea Tech and Montedoro-Whitney beam transmissometers shows a linear relation between light attenuation coefficient (cp) and suspended matter concentration (SMC) for natural sediments and for glass beads. However the proportionality constant between cp and SMC depends on the particle diameter and particle type. Thus, to measure SMC, observations of light attenuation must be used with a time-variable calibration when suspended particle characteristics change with time. Because of this variable calibration, time series of light attenuation alone may not directly reflect SMC and must be interpreted with care.The near-bottom concentration of suspended matter during winter storms on the U.S. East Coast Continental Shelf is estimated from light transmission measurements made 2 m above the bottom and from the size distribution of suspended material collected simultaneously in sediment traps 3 m above the bottom. The average concentrations during six storms between December 1979 and February 1980 in the Middle Atlantic Bight ranged from 2 to 4 mg l1 (maximum concentration of 7 mg l1) and 8 to 12 mg l1 (maximum concentration of 22 mg l1) on the south flank of Georges Bank.

Long-Range Intramolecular Electronic Communication in a Trinuclear Ruthenium Tropolonate Complex.

PubMed

Yoshida, Jun; Kuwahara, Kyohei; Suzuki, Kota; Yuge, Hidetaka

2017-02-20

Dinuclear and trinuclear ruthenium complexes, [Ru(trop) 2 (C 2 trop)Ru(dppe)Cp] [2b; trop = tropolonato, C 2 trop = ethynyltropolonato, dppe = 1,2-bis(diphenylphosphino)ethane] and [Ru(trop){(C 2 trop)Ru(dppe)Cp} 2 ] (3), were synthesized, and their electronic and electrochemical properties were investigated in comparison with our previously reported complex [Ru(acac) 2 (C 2 trop)Ru(dppe)Cp] (2a). The electron-donating Ru II (dppe)Cp unit and electron-accepting Ru III O 6 unit are connected by C 2 trop in these complexes. 2a incorporates acetylacetonate as an ancillary ligand, while 2b and 3 incorporate tropolonate as an ancillary ligand. Every complex, 2a, 2b, and 3, exhibits similar UV-vis-near-IR (NIR) absorption spectra, demonstrating the lack of explicit intramolecular electronic communication between the units at least in the neutral state. The weak NIR absorption in 2a further diminished upon electrochemical oxidation, indicating almost no electronic communication between the units. In contrast, 2b and 3 exhibit broad NIR absorptions upon oxidation. Additionally, 3 exhibits four stepwise redox couples in the electrochemical study, which are formally attributed to [Ru II (trop) 3 ] - /[Ru III (trop) 3 ], two [Ru II (dppe)Cp]/[Ru III (dppe)Cp] + , and [Ru III (trop) 3 ]/[Ru IV (trop) 3 ] + couples. Clear separation of the redox couples attributed to the two terminal [Ru(dppe)Cp] units demonstrates the thermodynamic stability of the intermediate oxidation states with respect to disproportionation. Further electrochemical studies using an electrolyte including perfluorinated weakly coordinating anions and density functional theory/time-dependent density functional theory calculations confirmed the effect of ancillary ligands, acetylacetonate and tropolonate. In the case of 2a, electronic delocalization over the whole complex, especially over the [Ru(acac) 2 (trop)] unit, appears to be small. In contrast, the electronic communication between [Ru(dppe)Cp] and [Ru(trop) 3 ] units in 3 seems to be enhanced upon oxidation, resulting in the long-range intramolecular electronic communication.

Blm10 facilitates nuclear import of proteasome core particles

PubMed Central

Weberruss, Marion H; Savulescu, Anca F; Jando, Julia; Bissinger, Thomas; Harel, Amnon; Glickman, Michael H; Enenkel, Cordula

2013-01-01

Short-lived proteins are degraded by proteasome complexes, which contain a proteolytic core particle (CP) but differ in the number of regulatory particles (RPs) and activators. A recently described member of conserved proteasome activators is Blm10. Blm10 contains 32 HEAT-like modules and is structurally related to the nuclear import receptor importin/karyopherin β. In proliferating yeast, RP-CP assemblies are primarily nuclear and promote cell division. During quiescence, RP-CP assemblies dissociate and CP and RP are sequestered into motile cytosolic proteasome storage granuli (PSG). Here, we show that CP sequestration into PSG depends on Blm10, whereas RP sequestration into PSG is independent of Blm10. PSG rapidly clear upon the resumption of cell proliferation and proteasomes are relocated into the nucleus. Thereby, Blm10 facilitates nuclear import of CP. Blm10-bound CP serves as an import receptor–cargo complex, as Blm10 mediates the interaction with FG-rich nucleoporins and is dissociated from the CP by Ran-GTP. Thus, Blm10 represents the first CP-dedicated nuclear import receptor in yeast. PMID:23982732

Intratumoral CpG-B promotes anti-tumoral neutrophil, cDC, and T cell cooperation without reprograming tolerogenic pDC.

PubMed

Humbert, Marion; Guery, Leslie; Brighouse, Dale; Lemeille, Sylvain; Hugues, Stephanie

2018-03-27

Cancer immunotherapies utilize distinct mechanisms to harness the power of the immune system to eradicate cancer cells. Therapeutic vaccines, aimed at inducing active immune responses against an existing cancer, are highly dependent on the immunological microenvironment, where many immune cell types display high levels of plasticity and, depending on the context, promote very different immunological outcomes. Among them, plasmacytoid dendritic cells (pDC), known to be highly immunogenic upon inflammation, are maintained in a tolerogenic state by the tumor microenvironment. Here we report that intratumoral (i.t.) injection of established solid tumors with CpG oligonucleotides-B (CpG-B) inhibits tumor growth. Interestingly, control of tumor growth was independent of tumor-associated (TA) pDC, which remained refractory to CpG-B stimulation and whose depletion did not alter the efficacy of the treatment. Instead, tumor growth inhibition subsequent to i.t. CpG-B injection depended on the recruitment of neutrophils into the milieu, resulting in the activation of conventional dendritic cells (cDC), subsequent increased anti-tumor T cell priming in draining lymph nodes, and enhanced effector T cell infiltration in the tumor microenvironment. These results reinforce the concept that intratumoral delivery of TLR9 agonists alters the tumor microenvironment by improving the anti-tumor activity of both innate and adaptive immune cells. Copyright ©2018, American Association for Cancer Research.

βTrCP controls the lysosome-mediated degradation of CDK1, whose accumulation correlates with tumor malignancy.

PubMed

Herrero-Ruiz, Joaquín; Mora-Santos, Mar; Giráldez, Servando; Sáez, Carmen; Japón, Miguel A; Tortolero, Maria; Romero, Francisco

2014-09-15

In mammals, cell cycle progression is controlled by cyclin-dependent kinases, among which CDK1 plays important roles in the regulation of the G2/M transition, G1 progression and G1/S transition. CDK1 is highly regulated by its association to cyclins, phosphorylation and dephosphorylation, changes in subcellular localization, and by direct binding of CDK inhibitor proteins. CDK1 steady-state protein levels are held constant throughout the cell cycle by a coordinated regulation of protein synthesis and degradation. We show that CDK1 is ubiquitinated by the E3 ubiquitin ligase SCFβTrCP and degraded by the lysosome. Furthermore, we found that DNA damage not only triggers the stabilization of inhibitory phosphorylation sites on CDK1 and repression of CDK1 gene expression, but also regulates βTrCP-induced CDK1 degradation in a cell type-dependent manner. Specifically, treatment with the chemotherapeutic agent doxorubicin in certain cell lines provokes CDK1 degradation and induces apoptosis, whereas in others it inhibits destruction of the protein. These observations raise the possibility that different tumor types, depending on their pathogenic spectrum mutations, may display different sensitivity to βTrCP-induced CDK1 degradation after DNA damage. Finally, we found that CDK1 accumulation in patients' tumors shows a negative correlation with βTrCP and a positive correlation with the degree of tumor malignancy.

On the Temperature Dependence of Enzyme-Catalyzed Rates.

PubMed

Arcus, Vickery L; Prentice, Erica J; Hobbs, Joanne K; Mulholland, Adrian J; Van der Kamp, Marc W; Pudney, Christopher R; Parker, Emily J; Schipper, Louis A

2016-03-29

One of the critical variables that determine the rate of any reaction is temperature. For biological systems, the effects of temperature are convoluted with myriad (and often opposing) contributions from enzyme catalysis, protein stability, and temperature-dependent regulation, for example. We have coined the phrase "macromolecular rate theory (MMRT)" to describe the temperature dependence of enzyme-catalyzed rates independent of stability or regulatory processes. Central to MMRT is the observation that enzyme-catalyzed reactions occur with significant values of ΔCp(‡) that are in general negative. That is, the heat capacity (Cp) for the enzyme-substrate complex is generally larger than the Cp for the enzyme-transition state complex. Consistent with a classical description of enzyme catalysis, a negative value for ΔCp(‡) is the result of the enzyme binding relatively weakly to the substrate and very tightly to the transition state. This observation of negative ΔCp(‡) has important implications for the temperature dependence of enzyme-catalyzed rates. Here, we lay out the fundamentals of MMRT. We present a number of hypotheses that arise directly from MMRT including a theoretical justification for the large size of enzymes and the basis for their optimum temperatures. We rationalize the behavior of psychrophilic enzymes and describe a "psychrophilic trap" which places limits on the evolution of enzymes in low temperature environments. One of the defining characteristics of biology is catalysis of chemical reactions by enzymes, and enzymes drive much of metabolism. Therefore, we also expect to see characteristics of MMRT at the level of cells, whole organisms, and even ecosystems.

Berberine Suppresses Cyclin D1 Expression through Proteasomal Degradation in Human Hepatoma Cells.

PubMed

Wang, Ning; Wang, Xuanbin; Tan, Hor-Yue; Li, Sha; Tsang, Chi Man; Tsao, Sai-Wah; Feng, Yibin

2016-11-15

The aim of this study is to explore the underlying mechanism on berberine-induced Cyclin D1 degradation in human hepatic carcinoma. We observed that berberine could suppress both in vitro and in vivo expression of Cyclin D1 in hepatoma cells. Berberine exhibits dose- and time-dependent inhibition on Cyclin D1 expression in human hepatoma cell HepG2. Berberine increases the phosphorylation of Cyclin D1 at Thr286 site and potentiates Cyclin D1 nuclear export to cytoplasm for proteasomal degradation. In addition, berberine recruits the Skp, Cullin, F-box containing complex-β-Transducin Repeat Containing Protein (SCF β-TrCP ) complex to facilitate Cyclin D1 ubiquitin-proteasome dependent proteolysis. Knockdown of β-TrCP blocks Cyclin D1 turnover induced by berberine; blocking the protein degradation induced by berberine in HepG2 cells increases tumor cell resistance to berberine. Our results shed light on berberine's potential as an anti-tumor agent for clinical cancer therapy.

Berberine Suppresses Cyclin D1 Expression through Proteasomal Degradation in Human Hepatoma Cells

PubMed Central

Wang, Ning; Wang, Xuanbin; Tan, Hor-Yue; Li, Sha; Tsang, Chi Man; Tsao, Sai-Wah; Feng, Yibin

2016-01-01

The aim of this study is to explore the underlying mechanism on berberine-induced Cyclin D1 degradation in human hepatic carcinoma. We observed that berberine could suppress both in vitro and in vivo expression of Cyclin D1 in hepatoma cells. Berberine exhibits dose- and time-dependent inhibition on Cyclin D1 expression in human hepatoma cell HepG2. Berberine increases the phosphorylation of Cyclin D1 at Thr286 site and potentiates Cyclin D1 nuclear export to cytoplasm for proteasomal degradation. In addition, berberine recruits the Skp, Cullin, F-box containing complex-β-Transducin Repeat Containing Protein (SCFβ-TrCP) complex to facilitate Cyclin D1 ubiquitin-proteasome dependent proteolysis. Knockdown of β-TrCP blocks Cyclin D1 turnover induced by berberine; blocking the protein degradation induced by berberine in HepG2 cells increases tumor cell resistance to berberine. Our results shed light on berberine′s potential as an anti-tumor agent for clinical cancer therapy. PMID:27854312

Complete daVinci versus laparoscopic pyeloplasty: cost analysis.

PubMed

Bhayani, Sam B; Link, Richard E; Varkarakis, John M; Kavoussi, Louis R

2005-04-01

Computer-assisted pyeloplasty with the daVinci system is an emerging technique to treat ureteropelvic junction (UPJ) obstruction. A relative cost analysis was performed assessing this technology in comparison with purely laparoscopic pyeloplasty. Eight patients underwent computer-assisted (daVinci) dismembered pyeloplasty (CP) via a transperitoneal four-port approach. They were compared with 13 patients who underwent purely laparoscopic pyeloplasty (LP). All patients had a primary UPJ obstruction and were matched for age, sex, and body mass index. The cost of equipment and capital depreciation for both procedures, as well as assessment of room set-up time, takedown time, and personnel were analyzed. Surgeons and nursing staff for both groups were experienced in both laparoscopy and daVinci procedures. One- and two-way financial analysis was performed to assess relative costs. The mean set-up and takedown time was 71 minutes for CP and 49 minutes for LP. The mean length of stay was 2.3 days for CP and 2.5 days for LP. The mean operating room (OR) times for CP and LP were 176 and 210 minutes, respectively. There were no complications in either group. One-way cost analysis with an economic model showed that LP is more cost effective than CP at our hospital if LP OR time is <338 minutes. With adjustment to a volume of 500 daVinci cases/year, CP is still not as cost effective as LP. Two-way sensitivity analysis shows that in-room time must still be <130 minutes and yearly cases must be >500 to obtain cost equivalence for CP. Perioperative parameters for CP are encouraging. However, the costs are a clear disadvantage. In our hospital, it is more cost effective to teach and perform LP than to perform CP.

77 FR 22840 - Petition for Waiver of Compliance

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-17

... Control Point (CP) 55 to now include Minson siding; incorporating trackwork improvements and changes to... approved NJT's S&TC improvements between CP45 and CP70 (which includes CP Ross, Minson siding, and... future Pennsauken transfer station on the single track south of CP Ross at Milepost 4.9 will add time to...

MeCP2 overexpression inhibits proliferation, migration and invasion of C6 glioma by modulating ERK signaling and gene expression.

PubMed

Sharma, Kedarlal; Singh, Juhi; Frost, Emma E; Pillai, Prakash P

2018-05-01

MethylCpG binding protein-2 (MeCP2) is an epigenetic regulator and essential for brain development. MeCP2 mutations are associated with a spectrum of neuro-developmental disorders that vary depending on the patient gender, most notably Rett Syndrome. MeCP2 is essential for normal neuronal maturation, and glial cell function in the brain. Besides, its role in neurodevelopmental disorders, MeCP2 is involved in many cancers such as breast, colorectal, lung, liver, and prostate cancer. Glioma is the most lethal form of brain cancer. Studies have shown that dysfunctional epigenetic regulation plays a crucial role in glioma progression. Further, previous studies have suggested a role for MeCP2 in glioma pathogenesis. In this study, we show that MeCP2 may play a critical role in the suppression of glioma progression. Stable overexpression of MeCP2in C6 glioma cells inhibits proliferation, migration, invasion, and adhesion. Moreover, MeCP2 overexpression inhibits pERKand BDNF expression while inducing GFAP expression in C6 glioma. These findings suggest that MeCP2 may play a crucial role in suppression of glioma progression. Copyright © 2018 Elsevier B.V. All rights reserved.

Effects of oral N-acetylcysteine on fatigue, critical power, and W' in exercising humans.

PubMed

Corn, Sarah D; Barstow, Thomas J

2011-09-15

The accumulation of reactive oxygen species (ROS) is associated with muscular fatigue. The antioxidant N-acetylcysteine (NAC) can extend time to fatigue (TTF), but the effect appears to be exercise intensity dependent. The purpose of this study was to determine the effects of an acute oral dose of NAC on time to fatigue (TTF), critical power (CP), W' (curvature constant), V(O2) kinetics and muscle EMG during cycling exercise. Male (n=7) subjects performed four tests at power outputs corresponding to 80, 90, 100, and 110% of the peak power output achieved during the incremental test (Pmax) under NAC and placebo (PLA) conditions. TTF was increased only in the 80% Pmax trial (p=0.033). CP was higher with NAC (NAC: 232±28 W versus PLA: 226±31 W; p=0.032), but W' tended to decrease (NAC: 15.5±3.8 kJ versus W': 16.4±4.5 kJ; p=0.10). The change in W' was negatively related to the change in CP (r = -0.96). MdPF and RMS of EMG tended to change less with NAC. There were no significant differences in V(O2) kinetics. These results demonstrate that oral NAC was successful in extending time to fatigue at 80% Pmax but not at higher work rates. Copyright © 2011 Elsevier B.V. All rights reserved.

Gadolinium-loaded chitosan nanoparticles for neutron-capture therapy: Influence of micrometric properties of the nanoparticles on tumor-killing effect.

PubMed

Ichikawa, Hideki; Uneme, Takeshi; Andoh, Tooru; Arita, Yuya; Fujimoto, Takuya; Suzuki, Minoru; Sakurai, Yoshinori; Shinto, Hiroyuki; Fukasawa, Tomonori; Fujii, Fumihiko; Fukumori, Yoshinobu

2014-06-01

As a nanoparticulate device for controlled delivery of Gd in NCT, the authors have developed gadolinium-loaded chitosan nanoparticles (Gd-nanoCPs). In the present study, influence of micrometric properties such as particle size, particle-surface charge and Gd content of Gd-nanoCPs on tumor-killing effect by Gd-NCT was investigated with Gd-nanoCPs. Two types of Gd-nanoCPs with different mean particle size, zeta potential and Gd-content (Gd-nanoCP-400; 391nm, 28mV, 9wt% and Gd-nanoCP-200; 214nm, 19mV, 24wt%) could be prepared by using chitosans with different molecular weights. Gd-nanoCPs incorporating 1.2mg of natural Gd were injected intratumorally once or twice to mice subcutaneously-bearing B16F10 melanoma. Eight hours after the last administration, thermal neutron was irradiated to tumor region of the mice. Remarkable tumor-growth was observed in both hot and cold control groups. In contrast, Gd-NCT groups showed significant tumor-growth suppression effect, though their efficacy was found to depend on the micrometric properties of Gd-nanoCPs. In particular, the Gd-nanoCP-200 exhibited stronger tumor-killing effect than the Gd-nanoCP-400 at the same Gd dose and it was still similar to Gd-nanoCP-400 in tumor-growth suppressing effect even at the half of Gd dose of Gd-nanoCP-400. This significance in tumor-killing effect would be ascribed from a higher Gd retention in the tumor tissue and an improved distribution of Gd with intratumorally administered Gd-nanoCP-200. Indeed, the Gd concentration in tumor tissue at the time corresponding to the onset of thermal neutron irradiation was determined to be significantly higher in Gd-nanoCP-200, compared with Gd-nanoCP-400. These results demonstrated that appropriate modification of Gd-nanoCPs in micrometric properties would be an effective way to improve the retention of Gd in the tumor tissue after intratumoral injection, leading to the enhanced tumor-killing effect in Gd-NCT. Copyright © 2013 Elsevier Ltd. All rights reserved.

Novel genotype of Tritrichomonas foetus from cattle in Southern Africa.

PubMed

Casteriano, Andrea; Molini, Umberto; Kandjumbwa, Kornelia; Khaiseb, Siegfried; Frey, Caroline F; Šlapeta, Jan

2016-12-01

Bovine trichomonosis caused by Tritrichomonas foetus is a significant reproductive disease of cattle. Preputial samples were collected using sheath washing technique in bulls in Namibia. Thirty-six trichomonad cultures were characterized using the TaqMan-probe commercial real-time polymerase chain reaction (PCR) diagnostic assay (VetMAX™-Gold Trich Detection Kit) and CYBR real-time PCR assay based on TFR3/4 primers. Diagnostic real-time PCRs and DNA sequencing of the internal transcribed region confirmed presence of T. foetus in 35 out of 36 samples. Multilocus genotyping using cysteine proteases (CP1, CP2, CP4, CP5, CP6, CP7, CP8, CP9) and malate dehydrogenase (MDH1) gene sequences demonstrate that the T. foetus in Namibia are genetically distinct from those characterized elsewhere. We report the discovery of a novel genotype of T. foetus in Namibian cattle, distinct from other T. foetus genotypes in Europe, South and North America and Australia. We suggest recognition of a 'Southern African' genotype of T. foetus. Identification of the new genotype of T. foetus demonstrates the need for wider global sampling to fully understand the diversity and origin of T. foetus causing disease in cattle or cats.

Diverse Reactivity of ECp* (E = Al, Ga) toward Low-Coordinate Transition Metal Amides [TM(N(SiMe3)2)2] (TM = Fe, Co, Zn): Insertion, Cp* Transfer, and Orthometalation.

PubMed

Weßing, Jana; Göbel, Christoph; Weber, Birgit; Gemel, Christian; Fischer, Roland A

2017-03-20

The reactivity of the carbenoid group 13 metal ligands ECp* (E = Al, Ga) toward low valent transition metal complexes [TM(btsa) 2 ] (TM = Fe, Co, Zn; btsa = bis(trimethylsilyl)amide) was investigated, revealing entirely different reaction patterns for E = Al and Ga. Treatment of [Co(btsa) 2 ] with AlCp* yields [Cp*Co(μ-H)(Al(κ 2 -(CH 2 SiMe 2 )NSiMe 3 )(btsa))] (1) featuring an unusual heterometallic bicyclic structure that results from the insertion of AlCp* into the TM-N bond with concomitant ligand rearrangement including C-H activation at one amide ligand. For [Fe(btsa) 2 ], complete ligand exchange gives FeCp* 2 , irrespective of the employed stoichiometric ratio of the reactants. In contrast, treatment of [TM(btsa) 2 ] (TM = Fe, Co) with GaCp* forms the 1:1 and 1:2 adducts [(GaCp*)Co(btsa) 2 ] (2) and [(GaCp*) 2 Fe(btsa) 2 ] (3), respectively. The tendency of AlCp* to undergo Cp* transfer to the TM center appears to be dependent on the nature of the TM center: For [Zn(btsa) 2 ], no Cp* transfer is observed on reaction with AlCp*; instead, the insertion product [Zn(Al(η 2 -Cp*)(btsa)) 2 ] (4) is formed. In the reaction of [Co(btsa) 2 ] with the trivalent [Cp*AlH 2 ], transfer of the amide ligands without further ligand rearrangement is observed, leading to [Co(μ-H) 4 (Al(η 2 -Cp*)(btsa)) 2 ] (5).

Impaired autophagy induces chronic atrophic pancreatitis in mice via sex- and nutrition-dependent processes.

PubMed

Diakopoulos, Kalliope N; Lesina, Marina; Wörmann, Sonja; Song, Liang; Aichler, Michaela; Schild, Lorenz; Artati, Anna; Römisch-Margl, Werner; Wartmann, Thomas; Fischer, Robert; Kabiri, Yashar; Zischka, Hans; Halangk, Walter; Demir, Ihsan Ekin; Pilsak, Claudia; Walch, Axel; Mantzoros, Christos S; Steiner, Jörg M; Erkan, Mert; Schmid, Roland M; Witt, Heiko; Adamski, Jerzy; Algül, Hana

2015-03-01

Little is known about the mechanisms of the progressive tissue destruction, inflammation, and fibrosis that occur during development of chronic pancreatitis. Autophagy is involved in multiple degenerative and inflammatory diseases, including pancreatitis, and requires the protein autophagy related 5 (ATG5). We created mice with defects in autophagy to determine its role in pancreatitis. We created mice with pancreas-specific disruption of Atg5 (Ptf1aCreex1;Atg5F/F mice) and compared them to control mice. Pancreata were collected and histology, immunohistochemistry, transcriptome, and metabolome analyses were performed. ATG5-deficient mice were placed on diets containing 25% palm oil and compared with those on a standard diet. Another set of mice received the antioxidant N-acetylcysteine. Pancreatic tissues were collected from 8 patients with chronic pancreatitis (CP) and compared with pancreata from ATG5-deficient mice. Mice with pancreas-specific disruption of Atg5 developed atrophic CP, independent of β-cell function; a greater proportion of male mice developed CP than female mice. Pancreata from ATG5-deficient mice had signs of inflammation, necrosis, acinar-to-ductal metaplasia, and acinar-cell hypertrophy; this led to tissue atrophy and degeneration. Based on transcriptome and metabolome analyses, ATG5-deficient mice produced higher levels of reactive oxygen species than control mice, and had insufficient activation of glutamate-dependent metabolism. Pancreata from these mice had reduced autophagy, increased levels of p62, and increases in endoplasmic reticulum stress and mitochondrial damage, compared with tissues from control mice; p62 signaling to Nqo1 and p53 was also activated. Dietary antioxidants, especially in combination with palm oil-derived fatty acids, blocked progression to CP and pancreatic acinar atrophy. Tissues from patients with CP had many histologic similarities to those from ATG5-deficient mice. Mice with pancreas-specific disruption of Atg5 develop a form of CP similar to that of humans. CP development appears to involve defects in autophagy, glutamate-dependent metabolism, and increased production of reactive oxygen species. These mice might be used to identify therapeutic targets for CP. Copyright © 2015 AGA Institute. Published by Elsevier Inc. All rights reserved.

In silico analysis, seasonal variation and gonadotropic regulation of jag1 and its receptor notch1 in testis of spotted snakehead Channa punctatus.

PubMed

Roy, Alivia; Basak, Reetuparna; Rai, Umesh

2018-05-14

The present study in seasonally breeding spotted snakehead Channa punctatus, for the first time in nonmammalian vertebrates, demonstrated correlation between reproductive phase-dependent testicular expression of ligand Jag1/receptor Notch1 and spermatogenic events. Testicular transcriptome sequencing data from our earlier study in C. punctatus was used in the present study to select the best transcript for jag1 (cpjag1) and notch1 (cpnotch1). The transcripts cpjag1 and cpnotch1 encoded full-length putative proteins of 1215 (cpJag1) and 2475 (cpNotch1) amino acids, respectively. A marked homology in the extracellular domains of Jag1 and Notch1 was observed following their alignment with respective proteins from different vertebrates, suggesting conservation in ligand-receptor interaction in C. punctatus. Both cpJag1 and cpNotch1 showed phylogenetic closeness with their teleostean counterparts, especially with that of Perciformes. Temporal expression of cpjag1 and cpnotch1 in testis depending on reproductive phases showed an appreciably high expression during spermatogenically inactive resting and postspawning phases when seminiferous lobules consisted of spermatogonial stem cells and undifferentiated spermatogonia. Their expression sharply declined during spermatogenically active preparatory and spawning phases. It appears that involvement of cpjag1/cpnotch1 is restricted to inactive phases when spermatogonial stem cells renew themselves and replenish undifferentiated spermatogonia. This assumption is ascertained by an experimental study in which high level of testicular cpjag1/cpnotch1 expression in control fish of resting phase markedly decreased after administration of human chorionic gonadotropin that is known to induce proliferation and differentiation of spermatogonia and spawning of spermatozoa. Copyright © 2018. Published by Elsevier Inc.

Corticosteroid dependent and independent effects of a cannabinoid agonist on core temperature, motor activity, and prepulse inhibition of the acoustic startle reflex in Wistar rats.

PubMed

Avdesh, Avdesh; Cornelisse, Vincent; Martin-Iverson, Mathew Thomas

2012-03-01

There are inconsistent reports on the effects of cannabinoid agonists on prepulse inhibition of the startle reflex (PPI) with increases, decreases, and no effects. It has been hypothesized that the conflicting observations may be as a result of modulation of the effects of cannabinoid agonists by the regulation of corticosteroid release. The purpose of the present study was to determine the effects of CP55940, a cannabinoid agonist, and metyrapone, a corticosteroid synthesis inhibitor on core temperature, motor activity, the startle reflex, and PPI. Startle responses were measured in 64 male Wistar rats while varying startling stimulus intensities, analogous to dose-response curves. A stimulus potency measure (ES(50)) and a response measure, the maximal achievable response (R (MAX)) were derived from the stimulus-response curves. CP55940 reduced core temperature and motor activity; these effects were potentiated by metyrapone. CP55940 increased R (MAX) of startle in the absence of a prepulse by a corticosteroid-dependent mechanism but decreased it when metyrapone was administered before CP55940, a corticosteroid-independent mechanism. The inverse of stimulus potency (ES(50)) was not affected by either drug alone but was increased by the combined drugs. CP55940 increased the prepulse motor gating effects and decreased the prepulse sensory gating effects of the same prepulses but only when given after metyrapone. The most parsimonious interpretation of these effects is that CP55940 has some effects through corticosteroid-dependent actions and opposite effects by corticosteroid-independent actions. These two putative sites of actions affect stimulus gating opposite to their effects on response gating.

Effect of Selective Prostaglandin E2 EP2 Receptor Agonist CP-533,536 on Voiding Efficiency in Rats with Midodrine-Induced Functional Urethral Obstruction.

PubMed

Kurihara, Ryoko; Imazumi, Katsunori; Takamatsu, Hajime; Ishizu, Kenichiro; Yoshino, Taiji; Masuda, Noriyuki

2016-05-01

We investigated the effect of the selective prostaglandin E2 EP2 receptor agonist CP-533,536 on voiding efficiency in rats with midodrine-induced functional urethral obstruction. The effect of CP-533,536 (0.03-0.3 mg/kg, intravenous [i.v.]) on urethral perfusion pressure (UPP) was investigated in anesthetized rats pre-treated with midodrine (1 mg/kg, i.v.), which forms an active metabolite that acts as an α1 -adrenoceptor agonist. The effect of CP-533,536 (0.03-0.3 mg/kg, i.v.) on cystometric parameters was also investigated in anesthetized rats. In addition, the effect of CP-533,536 (0.03-0.3 mg/kg, i.v.) on residual urine volume (RV) and voiding efficiency (VE) was investigated in conscious rats treated with midodrine (1 mg/kg, i.v.). CP-533,536 dose-dependently decreased UPP elevated by midodrine in anesthetized rats. In contrast, CP-533,536 did not affect maximum voiding pressure, intercontraction interval, or intravesical threshold pressure. In conscious rats, midodrine (1 mg/kg, i.v.) markedly increased RV and reduced VE. CP-533,536 dose-dependently ameliorated increases in RV and decreases in VE induced by midodrine. These results suggest that a selective EP2 receptor agonist could ameliorate the elevation of RV and improve the reduction of VE in rats with functional urethral obstruction caused by stimulation of α1 -adrenoceptors. The mechanism of action might be not potentiation of bladder contraction but rather preferential relief of urethral constriction. © 2014 Wiley Publishing Asia Pty Ltd.

Furfural-tolerant Zymomonas mobilis derived from error-prone PCR-based whole genome shuffling and their tolerant mechanism.

PubMed

Huang, Suzhen; Xue, Tingli; Wang, Zhiquan; Ma, Yuanyuan; He, Xueting; Hong, Jiefang; Zou, Shaolan; Song, Hao; Zhang, Minhua

2018-04-01

Furfural-tolerant strain is essential for the fermentative production of biofuels or chemicals from lignocellulosic biomass. In this study, Zymomonas mobilis CP4 was for the first time subjected to error-prone PCR-based whole genome shuffling, and the resulting mutants F211 and F27 that could tolerate 3 g/L furfural were obtained. The mutant F211 under various furfural stress conditions could rapidly grow when the furfural concentration reduced to 1 g/L. Meanwhile, the two mutants also showed higher tolerance to high concentration of glucose than the control strain CP4. Genome resequencing revealed that the F211 and F27 had 12 and 13 single-nucleotide polymorphisms. The activity assay demonstrated that the activity of NADH-dependent furfural reductase in mutant F211 and CP4 was all increased under furfural stress, and the activity peaked earlier in mutant than in control. Also, furfural level in the culture of F211 was also more rapidly decreased. These indicate that the increase in furfural tolerance of the mutants may be resulted from the enhanced NADH-dependent furfural reductase activity during early log phase, which could lead to an accelerated furfural detoxification process in mutants. In all, we obtained Z. mobilis mutants with enhanced furfural and high concentration of glucose tolerance, and provided valuable clues for the mechanism of furfural tolerance and strain development.

Toward a unified interpretation of quark and lepton mixing from flavor and CP symmetries

NASA Astrophysics Data System (ADS)

Li, Cai-Chang; Lu, Jun-Nan; Ding, Gui-Jun

2018-02-01

We discussed the scenario that a discrete flavor group combined with CP symmetry is broken to Z 2 × CP in both neutrino and charged lepton sectors. All lepton mixing angles and CP violation phases are predicted to depend on two free parameters θ l and θ ν varying in the range of [0 , π). As an example, we comprehensively study the lepton mixing patterns which can be derived from the flavor group Δ(6 n 2) and CP symmetry. Three kinds of phenomenologically viable lepton mixing matrices are obtained up to row and column permutations. We further extend this approach to the quark sector. The precisely measured quark mixing angles and CP invariant can be accommodated for certain values of the free parameters θ u and θ d . A simultaneous description of quark and lepton flavor mixing structures can be achieved from a common flavor group Δ(6 n 2) and CP, and accordingly the smallest value of the group index n is n = 7.

Cartilage preservation by inhibition of Janus kinase 3 in two rodent models of rheumatoid arthritis

PubMed Central

Milici, Anthony J; Kudlacz, Elizabeth M; Audoly, Laurent; Zwillich, Samuel; Changelian, Paul

2008-01-01

Introduction CP-690550 is a small molecule inhibitor of Janus kinase 3 (JAK3), a critical enzyme in the signaling pathway of multiple cytokines (interleukin (IL)-2, -7, -15 and -21) that are important in various T cell functions including development, activation and homeostasis. The purpose of this study was to evaluate CP-690550 in murine collagen-induced (CIA) and rat adjuvant-induced (AA) models of rheumatoid arthritis (RA). Methods CIA and AA were induced using standard protocols and animals received the JAK3 inhibitor via osmotic mini-pump infusion at doses ranging from 1.5–15 mg/kg/day following disease induction. Arthritis was assessed by clinical scores in the CIA models and paw swelling monitored using a plethysmometer in the AA model until study conclusion, at which time animals were killed and evaluated histologically. Results CP-690550 dose-dependently decreased endpoints of disease in both RA models with greater than 90% reduction observed at the highest administered dose. An approximate ED50 of approximately 1.5 mg/kg/day was determined for the compound based upon disease endpoints in both RA models examined and corresponds to CP-690550 serum levels of 5.8 ng/ml in mice (day 28) and 24 ng/ml in rats (day 24). The compound also reduced inflammatory cell influx and joint damage as measured histologically. Animals receiving a CP-690550 dose of 15 mg/k/d showed no histological evidence of disease. Conclusion The efficacy observed with CP-690550 in CIA and AA suggests JAK3 inhibition may represent a novel therapeutic target for the treatment of RA. PMID:18234077

Electroencephalographic study of chlorpromazine alone or combined with alpha-lipoic acid in a model of schizophrenia induced by ketamine in rats.

PubMed

Sampaio, Luis Rafael Leite; Borges, Lucas Teixeira Nunes; Barbosa, Talita Matias; Matos, Natalia Castelo Branco; Lima, Ricardo de Freitas; Oliveira, Mariana Nascimento de; Gularte, Viviane Nóbrega; Patrocínio, Manoel Cláudio Azevedo; Macêdo, Danielle; Vale, Otoni Cardoso do; Vasconcelos, Silvânia Maria Mendes de

2017-03-01

Schizophrenia is characterized by behavioral symptoms, brain function impairments and electroencephalographic (EEG) changes. Dysregulation of immune responses and oxidative imbalance underpins this mental disorder. The present study aimed to investigate the effects of the typical antipsychotic chlorpromazine (CP) alone or combined with the natural antioxidant alpha-lipoic acid (ALA) on changes in the hippocampal average spectral power induced by ketamine (KET). Three days after stereotactic implantation of electrodes, male Wistar rats were divided into groups treated for 10 days with saline (control) or KET (10 mg/kg, IP). CP (1 or 5 mg/kg, IP) alone or combined with ALA (100 mg/kg, P.O.) was administered 30 min before KET or saline. Hippocampal EEG recordings were taken on the 1st, 5th and 10th days of treatment immediately after the last drug administration. KET significantly increased average spectral power of delta and gamma-high bands on the 5th and 10th days of treatment when compared to control. Gamma low-band significantly increased on the 1st, 5th and 10th days when compared to control group. This effect of KET was prevented by CP alone or combined with ALA. Indeed, the combination of ALA 100 + CP1 potentiated the inhibitory effects of CP1 on gamma low-band oscillations. In conclusion, our results showed that KET presents excitatory and time-dependent effects on hippocampal EEG bands activity. KET excitatory effects on EEG were prevented by CP alone and in some situations potentiated by its combination with ALA. Copyright © 2016 Elsevier Ltd. All rights reserved.

Endogenous and exogenous porphyrins as photosensitizers in the Hep-2 human carcinoma cell line.

PubMed

Alvarez, M G; Milanesio, M; Rivarola, V; Durantini, E; Batlle, A; Fukuda, H

2009-07-01

The photodynamic activity of three photosensitizers (PS): AL-induced PPIX, the porphyrin derivative 5-(4-trimethylammoniumphenyl)-10, 5, 20-tris (2,4,6- trimethoxyphenyl) porphyrin (CP) and the molecular dyad porphyrin-C(60) (P-C(60)), the last two incorporated into liposomal vesicles, was evaluated on Hep-2 human larynx carcinoma cell line. ALA-induced accumulation of the endogenous PS PPIX, reached saturation values between 5 and 24 h incubation time; the maximal PPIX content was 5.7 nmol/106 cells. The same intracellular level was accumulated when the cationic porphyrin CP was used, while the amount of P-C(60) attained was 1.5 nmol/106 cells. Under violet-blue exciting light, the fluorescence of PPIX and P-C(60) was found in the cytoplasm showing a granular appearance indicating lysosomal localization. CP was mainly detected as a filamentous pattern characteristic of mitochondrial localization. No dark cytotoxicity was observed using 1mM ALA, 5 microM CP and 1 microM P-C(60) after 24 h incubation. Cell morphology was analyzed using Hoechst-33258, toluidine blue staining, TUNEL assay and DNA fragmentation, 24 h after irradiation with 54 J/cm2. When photosensitized with ALA and P-C(60), chromatine condensation characteristic of apoptotic cell death was found; instead, 58 % of necrotic cells were observed with CP. The results show that in the Hep-2 cells, of the three PS analyzed, the molecular dyad P-C(60) was more efficient than CP and PPIX, and confirm that PDT can induce different mechanisms of cell death depending on the PS and the irradiation dose.

Measurement of CKM-angle γ with Charmed B 0 Meson Decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baak, Max Arjen

2007-02-05

This thesis reports measurements of the time-dependent CP asymmetries in fully reconstructed B 0 → (D (*)∓π ± and B 0 → D ∓ ρ ± ) decays in approximately 232 million Y(4S) → Bmore » $$\\bar{B}$$ events, collected with the BABAR detector at the PEP-II asymmetric-energy B factory at the Stanford Linear Accelerator Center in California, as published in Ref. [14]. The phenomenon of CP violation allows one to distinguish between matter and antimatter, and, as such, is one of the essential ingredients needed to explain the apparent abundance of matter over antimatter in the universe. The Standard Model describes the observed elementary particles in terms of three generations of quarks and leptons, as well as the weak, electromagnetic, and strong interactions between them. In the Standard Model, CP violation is incorporated in the Cabibbo-Kobayashi-Maskawa (CKM) matrix, which describes the weak interactions between the quarks. The weak interactions between quarks are described by coupling constants that are functions of three real parameters and one irreducible complex phase. The magnitude of all CP violating effects in the Standard Model is related to this complex phase. The measurement of the CP violating phase of the CKM matrix is an important part of the present scientific program in particle physics. Violation of the CP symmetry manifests itself as a non-zero area of the Unitarity Triangle. The Unitarity Triangle needs to be overconstrained by experimental measurements in order to demonstrate that the CKM mechanism is the correct explanation of this phenomenon. No stringent measurement of the CKM-angle γ is yet available.« less

The Choroid Plexus Functions as a Niche for T-Cell Stimulation Within the Central Nervous System

PubMed Central

Strominger, Itai; Elyahu, Yehezqel; Berner, Omer; Reckhow, Jensen; Mittal, Kritika; Nemirovsky, Anna; Monsonego, Alon

2018-01-01

The choroid plexus (CP) compartment in the ventricles of the brain comprises fenestrated vasculature and, therefore, it is permeable to blood-borne mediators of inflammation. Here, we explored whether T-cell activation in the CP plays a role in regulating central nervous system (CNS) inflammation. We show that CD4 T cells injected into the lateral ventricles adhere to the CP, transmigrate across its epithelium, and undergo antigen-specific activation and proliferation. This process is enhanced following peripheral immune stimulation and significantly impacts the immune signaling induced by the CP. Ex vivo studies demonstrate that T-cell harboring the CP through its apical surface is a chemokine- and adhesion molecule-dependent process. We suggest that, within the CNS, the CP serves an immunological niche, which rapidly responds to peripheral inflammation and, thereby, promotes two-way T-cell trafficking that impact adaptive immunity in the CNS. PMID:29868025

A comparative study of the mechanical behaviour of thermally oxidised commercially pure titanium and zirconium.

PubMed

Alansari, A; Sun, Y

2017-10-01

The objective of this study is to compare the mechanical behaviour of thermally oxidised commercially pure titanium (CP-Ti) and commercially pure zirconium (CP-Zr). For this purpose, these two bio-metals were thermally oxidised under the same condition (650°C for 6h) and the oxidised specimens were characterised using various analytical and experimental techniques, including oxygen uptake analysis, layer thickness and hardness measurements, scratch tests, dry sliding friction and wear tests and tribocorrosion tests in Ringer's solution. The results show that under the present thermal oxidation condition, 4 times more oxygen is introduced into CP-Zr than into CP-Ti and the oxide layer produced on CP-Zr is nearly 6 times thicker than that on CP-Ti. Thermally oxidised CP-Zr possesses a higher hardness, a deeper hardening depth and better scratch resistance than thermally oxidised CP-Ti. Under dry sliding and tribocorrosion conditions, thermally oxidised CP-Zr also possesses much better resistance to material removal and a higher load bearing capacity than thermally oxidised CP-Ti. Thus, thermally oxidised Zr possesses much better mechanical behaviour than thermally oxidised Ti. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pure circular polarization electroluminescence at room temperature with spin-polarized light-emitting diodes

PubMed Central

Nishibayashi, Kazuhiro

2017-01-01

We report the room-temperature electroluminescence (EL) with nearly pure circular polarization (CP) from GaAs-based spin-polarized light-emitting diodes (spin-LEDs). External magnetic fields are not used during device operation. There are two small schemes in the tested spin-LEDs: first, the stripe-laser-like structure that helps intensify the EL light at the cleaved side walls below the spin injector Fe slab, and second, the crystalline AlOx spin-tunnel barrier that ensures electrically stable device operation. The purity of CP is depressively low in the low current density (J) region, whereas it increases steeply and reaches close to the pure CP when J > 100 A/cm2. There, either right- or left-handed CP component is significantly suppressed depending on the direction of magnetization of the spin injector. Spin-dependent reabsorption, spin-induced birefringence, and optical spin-axis conversion are suggested to account for the observed experimental results. PMID:28174272

The roles of prostaglandin endoperoxides, thromboxane A2 and adenosine diphosphate in collagen-induced aggregation in man and the rat.

PubMed Central

Emms, H.; Lewis, G. P.

1986-01-01

The effects of aspirin, carboxyheptylimidazole (CHI) and creatine phosphate/creatine phosphokinase (CP/CPK) on platelet aggregation and thromboxane B2 (TxB2) formation induced by collagen have been examined in vitro. Platelets from two species, man and the rat, have been used. In man, aspirin and CHI abolished TxB2 production but only partially inhibited aggregation. CP/CPK partially inhibited aggregation and TxB2 formation. In the rat, aspirin and CHI abolished TxB2 formation but had no effect on aggregation. CP/CPK completely inhibited aggregation and partially inhibited TxB2 generation. In man, collagen-induced aggregation is largely dependent on ADP and to a lesser extent on arachidonate metabolites whereas, in the rat, ADP alone mediates aggregation induced by this agonist. The results with CP/CPK suggest that TxB2 formation is dependent either on the prior release of platelet ADP or on aggregation itself rather than being responsible for the aggregation response. PMID:3082399

Measurement of the CP-violating phase ϕ(s) in the decay B(s)(0) → J/ψϕ.

PubMed

Aaij, R; Abellan Beteta, C; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Bailey, D S; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Constantin, F; Contu, A; Cook, A; Coombes, M; Corti, G; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Bonal, F; Domingo Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Estève, L; Falabella, A; Fanchini, E; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koppenburg, P; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Messi, R; Miglioranzi, S; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Musy, M; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Nedos, M; Needham, M; Neufeld, N; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrella, A; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, A C; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Topp-Joergensen, S; Torr, N; Tournefier, E; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Voss, H; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zverev, E; Zvyagin, A

2012-03-09

We present a measurement of the time-dependent CP-violating asymmetry in B(s)(0) → J/ψϕ decays, using data collected with the LHCb detector at the LHC. The decay time distribution of B(s)(0) → J/ψϕ is characterized by the decay widths Γ(H) and Γ(L) of the heavy and light mass eigenstates, respectively, of the B(s)(0) - B(s)(0) system and by a CP-violating phase ϕ(s). In a sample of about 8500 B(s)(0) → J/ψϕ events isolated from 0.37  fb(-1) of pp collisions at sqrt[s] = 7  TeV, we measure ϕ(s) = 0.15 ± 0.18(stat) ± 0.06(syst)  rad. We also find an average B(s)(0) decay width Γ(s) ≡ (Γ(L) + Γ(H))/2 = 0.657 ± 0.009(stat) ± 0.008(syst)  ps(-1) and a decay width difference ΔΓ(s) ≡ Γ(L) - Γ(H) = 0.123 ± 0.029(stat) ± 0.011(syst)  ps(-1). Our measurement is insensitive to the transformation (ϕ(s),ΔΓ(s)) ↦ (π - ϕ(s), -ΔΓ(s)).

Kinematics of the tooth tapping movement.

PubMed

Widmalm, S E; Hedegård, B

1977-07-01

Electrical activity in the masseter muscles and tooth contact vibrations were recorded simultaneously from subjects tapping their teeth slowly into maximal intercuspidation and again with maximal frequency. High speed cinephotography was also used with four of the ten subjects. Three main parts could be distinguished on the obtained graphical representation of the tooth tapping movement: tooth contact phase (TCP), opening phase (OP) and closing phase (CP). Tapping frequency was increased by decreasing the jaw opening degree and the durations of TCP, OP and CP. The jaw velocity immediately before tooth contact, which may be of significance for the reflex response, was however not increased. The average jaw speed was nevertheless increased from 10 to 15 cm/s since the turning from OP to CP was more abrupt in high than in low frequency tapping. The duration of electrical activity after tooth contact was significantly shorter at tapping with high than with low frequency. The teeth maintained contact without detectable rebound between each open-close cycle. The OP started about 100 ms after the cessation of electrical activity both at low and high tapping frequency. The time between end of electrical activity and the start of a new OP was supposed to be dependent upon the relaxation time of the masseter muscles.

Activation of the Early B-Cell-Specific mb-1 (Ig-α) Gene by Pax-5 Is Dependent on an Unmethylated Ets Binding Site

PubMed Central

Maier, Holly; Colbert, Jeff; Fitzsimmons, Daniel; Clark, Dawn R.; Hagman, James

2003-01-01

Methylation of cytosine in CpG dinucleotides promotes transcriptional repression in mammals by blocking transcription factor binding and recruiting methyl-binding proteins that initiate chromatin remodeling. Here, we use a novel cell-based system to show that retrovirally expressed Pax-5 protein activates endogenous early B-cell-specific mb-1 genes in plasmacytoma cells, but only when the promoter is hypomethylated. CpG methylation does not directly affect binding of the promoter by Pax-5. Instead, methylation of an adjacent CpG interferes with assembly of ternary complexes comprising Pax-5 and Ets proteins. In electrophoretic mobility shift assays, recruitment of Ets-1 is blocked by methylation of the Ets site (5′CCGGAG) on the antisense strand. In transfection assays, selective methylation of a single CpG within the Pax-5-dependent Ets site greatly reduces mb-1 promoter activity. Prior demethylation of the endogenous mb-1 promoter is required for its activation by Pax-5 in transduced cells. Although B-lineage cells have only unmethylated mb-1 genes and do not modulate methylation of the mb-1 promoter during development, other tissues feature high percentages of methylated alleles. Together, these studies demonstrate a novel DNA methylation-dependent mechanism for regulating transcriptional activity through the inhibition of DNA-dependent protein-protein interactions. PMID:12612069

Effect of magnetic anisotropy and particle size distribution on temperature dependent magnetic hyperthermia in Fe3O4 ferrofluids

NASA Astrophysics Data System (ADS)

Palihawadana Arachchige, Maheshika; Nemala, Humeshkar; Naik, Vaman; Naik, Ratna

Magnetic hyperthermia (MHT) has a great potential as a non-invasive cancer therapy technique. Specific absorption rate (SAR) which measures the efficiency of heat generation, mainly depends on magnetic properties of nanoparticles such as saturation magnetization (Ms) and magnetic anisotropy (K) which depend on the size and shape. Therefore, MHT applications of magnetic nanoparticles often require a controllable synthesis to achieve desirable magnetic properties. We have synthesized Fe3O4 nanoparticles using two different methods, co-precipitation (CP) and hydrothermal (HT) techniques to produce similar XRD crystallite size of 12 nm, and subsequently coated with dextran to prepare ferrofluids for MHT. However, TEM measurements show average particle sizes of 13.8 +/-3.6 nm and 14.6 +/-3.6 nm for HT and CP samples, implying the existence of an amorphous surface layer for both. The MHT data show the two samples have very different SAR values of 110 W/g (CP) and 40W/g (HT) at room temperature, although they have similar Ms of 70 +/-4 emu/g regardless of their different TEM sizes. We fitted the temperature dependent SAR using linear response theory to explain the observed results. CP sample shows a larger magnetic core with a narrow size distribution and a higher K value compared to that of HT sample.

Heat capacity changes in RNA folding: application of perturbation theory to hammerhead ribozyme cold denaturation

PubMed Central

Mikulecky, Peter J.; Feig, Andrew L.

2004-01-01

In proteins, empirical correlations have shown that changes in heat capacity (ΔCP) scale linearly with the hydrophobic surface area buried upon folding. The influence of ΔCP on RNA folding has been widely overlooked and is poorly understood. In addition to considerations of solvent reorganization, electrostatic effects might contribute to ΔCPs of folding in polyanionic species such as RNAs. Here, we employ a perturbation method based on electrostatic theory to probe the hot and cold denaturation behavior of the hammerhead ribozyme. This treatment avoids much of the error associated with imposing two-state folding models on non-two-state systems. Ribozyme stability is perturbed across a matrix of solvent conditions by varying the concentration of NaCl and methanol co-solvent. Temperature-dependent unfolding is then monitored by circular dichroism spectroscopy. The resulting array of unfolding transitions can be used to calculate a ΔCP of folding that accurately predicts the observed cold denaturation temperature. We confirm the accuracy of the calculated ΔCP by using isothermal titration calorimetry, and also demonstrate a methanol-dependence of the ΔCP. We weigh the strengths and limitations of this method for determining ΔCP values. Finally, we discuss the data in light of the physical origins of the ΔCPs for RNA folding and consider their impact on biological function. PMID:15282329

Oxidative Degradation of Chlorophenolic Compounds with Modified-Fenton Process Using Pyrite as the Catalyst

NASA Astrophysics Data System (ADS)

Kantar, Cetin; Urken, Ozge; Oral, Ozlem; Kaplan, Iremsu; Ayman Oz, Nilgun

2017-04-01

Oxidative dehalogenation has been shown to be a viable and cost effective process for dealing with a particularly persistent class of contaminants (e.g., chlorophenolic compounds (CP)) often found in contaminated soil and ground water. Here, the degradation of various chlorophenolic compounds (e.g., 2-CP, 4-CP, 2,3-di CP, 2,4-di CP, 2,4,6-tri CP, 2,3,4,6-Tetra CP) was investigated by modified Fenton process using pyrite as source of Fe2+ (catalyst) . The effects of different parameters such as chlorophenol type, pH and chlorophenol, pyrite and H2O2 concentrations on the degradation kinetics of chlorophenols were studied in batch reactors. Our results show that while the rate of chloropehenol degradation increased with decreasing solution pH, no direct correlation was observed between H2O2 concentration and chlorophenol degradation, indicating a complex mechanism involved in CP degradation by modified Fenton process. The batch results also show that the CP degradation was highly dependent on CP type, the number and location of chloride ions in the structure. Overall, the results of this study suggest that pyrite can be effectively used in reactive treatment barriers for in-situ treatment of subsurface systems contaminated with chlorophenols.

Investigation of a less rare-earth permanent-magnet machine with the consequent pole rotor

NASA Astrophysics Data System (ADS)

Bai, Jingang; Liu, Jiaqi; Wang, Mingqiao; Zheng, Ping; Liu, Yong; Gao, Haibo; Xiao, Lijun

2018-05-01

Due to the rising price of rare-earth materials, permanent-magnet (PM) machines in different applications have a trend of reducing the use of rare-earth materials. Since iron-core poles replace half of PM poles in the consequent pole (CP) rotor, the PM machine with CP rotor can be a promising candidate for less rare-earth PM machine. Additionally, the investigation of CP rotor in special electrical machines, like hybrid excitation permanent-magnet PM machine, bearingless motor, etc., has verified the application feasibility of CP rotor. Therefore, this paper focuses on design and performance of PM machines when traditional PM machine uses the CP rotor. In the CP rotor, all the PMs are of the same polarity and they are inserted into the rotor core. Since the fundamental PM flux density depends on the ratio of PM pole to iron-core pole, the combination rule between them is investigated by analytical and finite-element methods. On this basis, to comprehensively analyze and evaluate PM machine with CP rotor, four typical schemes, i.e., integer-slot machines with CP rotor and surface-mounted PM (SPM) rotor, fractional-slot machines with CP rotor and SPM rotor, are designed to investigate the performance of PM machine with CP rotor, including electromagnetic performance, anti-demagnetization capacity and cost.

Thermophysical Properties of Cold and Vacuum Plasma Sprayed Cu-Cr-X Alloys, NiAl and NiCrAlY Coatings. Part 2; Specific Heat Capacity

NASA Technical Reports Server (NTRS)

Raj, S. V.

2017-01-01

Part I of the paper discussed the temperature dependencies of the electrical resistivities, thermal conductivities, thermal diffusivities and total hemispherical emissivities of several vacuum plasma sprayed (VPS) and cold sprayed copper alloy monolithic coatings, VPS NiAl, VPS NiCrAlY, extruded GRCop-84 and as-cast Cu-17(wt.%)Cr-5%Al. Part II discusses the temperature dependencies of the constant pressure specific heat capacities, CP, of these coatings. The data were empirically were regression-fitted with the equation: CP = AT4 + BT3 + CT2 + DT +E where T is the absolute temperature and A, B, C, D and E are regression constants. The temperature dependencies of the molar enthalpy, molar entropy and Gibbs molar free energy determined from experimental values of molar specific heat capacity are reported. Calculated values of CP using the Neumann-Kopp (NK) rule were in poor agreement with experimental data. Instead, a modification of the Neumann-Kopp rule was found to predict values closer to the experimental data with an absolute deviation less than 6.5%. The specific molar heat capacities for all the alloys did not agree with the Dulong-Petit law, and CP is greater than 3R, where R is the universal gas constant, were measured for all the alloys except NiAl for which CP is less than 3R at all temperatures.

βTrCP controls the lysosome-mediated degradation of CDK1, whose accumulation correlates with tumor malignancy

PubMed Central

Herrero-Ruiz, Joaquín; Mora-Santos, Mar; Giráldez, Servando; Sáez, Carmen; Japón, Miguel Á.; Tortolero, Maria; Romero, Francisco

2014-01-01

In mammals, cell cycle progression is controlled by cyclin-dependent kinases, among which CDK1 plays important roles in the regulation of the G2/M transition, G1 progression and G1/S transition. CDK1 is highly regulated by its association to cyclins, phosphorylation and dephosphorylation, changes in subcellular localization, and by direct binding of CDK inhibitor proteins. CDK1 steady-state protein levels are held constant throughout the cell cycle by a coordinated regulation of protein synthesis and degradation. We show that CDK1 is ubiquitinated by the E3 ubiquitin ligase SCFβTrCP and degraded by the lysosome. Furthermore, we found that DNA damage not only triggers the stabilization of inhibitory phosphorylation sites on CDK1 and repression of CDK1 gene expression, but also regulates βTrCP-induced CDK1 degradation in a cell type-dependent manner. Specifically, treatment with the chemotherapeutic agent doxorubicin in certain cell lines provokes CDK1 degradation and induces apoptosis, whereas in others it inhibits destruction of the protein. These observations raise the possibility that different tumor types, depending on their pathogenic spectrum mutations, may display different sensitivity to βTrCP-induced CDK1 degradation after DNA damage. Finally, we found that CDK1 accumulation in patients’ tumors shows a negative correlation with βTrCP and a positive correlation with the degree of tumor malignancy. PMID:25149538

Gamma-radiation and isotopic effect on the critical behavior in triglycine selenate crystals

NASA Astrophysics Data System (ADS)

Kassem, M. E.; Hamed, A. E.; Abulnasr, L.; Abboudy, S.

1994-11-01

Isotopic effects in pure and γ-irradiated triglycine selenate crystals were investigated using the specific heat ( Cp) technique. The obtained results showed an interesting dependence of the critical behavior of Cp on the deuterium content. With increasing content of deuterium, the character of the phase transition changed from a second order (γ-type) to a first order transition. After γ-irradiation, the behavior of Cp around the phase transition region was essentially affected. The transition temperature, Tc, decreased and Δ Cp depressed, and the transition became broad. It was noted that the effect of γ-irradiation is opposite to the isotopic effect.

Mechanism of Mitochondrial Transcription Factor A Attenuation of CpG-Induced Antibody Production

PubMed Central

Saifee, Jessica F.; Torres, Raul M.; Janoff, Edward N.

2016-01-01

Mitochondrial transcription factor A (TFAM) had previously been shown to act as a damage associated molecular pattern with the ability to enhance CpG-A phosphorothioate oligodeoxynucleotide (ODN)-mediated stimulation of IFNα production from human plasmacytoid dendritic cells. Examination of the mechanism by which TFAM might influence CpG ODN mediated innate immune responses revealed that TFAM binds directly, tightly and selectively to the structurally related CpG-A, -B, and -C ODN. TFAM also modulated the ability of the CpG-B or -C to stimulate the production of antibodies from human B cells. TFAM showed a dose-dependent modulation of CpG-B, and -C -induced antibody production from human B cells in vitro, with enhancement of high dose and inhibition of low doses of CpG stimulation. This effect was linked to the ability of TFAM to directly inhibit the binding of CpG ODNs to B cells, in a manner consistent with the relative binding affinities of TFAM for the ODNs. These data suggest that TFAM alters the free concentration of the CpG available to stimulate B cells by sequestering this ODN in a TFAM-CpG complex. Thus, TFAM has the potential to decrease the pathogenic consequences of exposure to natural CpG-like hypomethylated DNA in vivo, as well as such as that found in traumatic injury, infection, autoimmune disease and during pregnancy. PMID:27280778

A Copula-Based Conditional Probabilistic Forecast Model for Wind Power Ramps

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hodge, Brian S; Krishnan, Venkat K; Zhang, Jie

Efficient management of wind ramping characteristics can significantly reduce wind integration costs for balancing authorities. By considering the stochastic dependence of wind power ramp (WPR) features, this paper develops a conditional probabilistic wind power ramp forecast (cp-WPRF) model based on Copula theory. The WPRs dataset is constructed by extracting ramps from a large dataset of historical wind power. Each WPR feature (e.g., rate, magnitude, duration, and start-time) is separately forecasted by considering the coupling effects among different ramp features. To accurately model the marginal distributions with a copula, a Gaussian mixture model (GMM) is adopted to characterize the WPR uncertaintymore » and features. The Canonical Maximum Likelihood (CML) method is used to estimate parameters of the multivariable copula. The optimal copula model is chosen based on the Bayesian information criterion (BIC) from each copula family. Finally, the best conditions based cp-WPRF model is determined by predictive interval (PI) based evaluation metrics. Numerical simulations on publicly available wind power data show that the developed copula-based cp-WPRF model can predict WPRs with a high level of reliability and sharpness.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baldes, Iason; Bell, Nicole F.; Millar, Alexander J.

We explore possible asymmetric dark matter models using CP violating scatterings to generate an asymmetry. In particular, we introduce a new model, based on DM fields coupling to the SM Higgs and lepton doublets, a neutrino portal, and explore its UV completions. We study the CP violation and asymmetry formation of this model, to demonstrate that it is capable of producing the correct abundance of dark matter and the observed matter-antimatter asymmetry. Crucial to achieving this is the introduction of interactions which violate CP with a T{sup 2} dependence.

Precise discussion of time-reversal asymmetries in B-meson decays

DOE PAGES

Morozumi, Takuya; Okane, Hideaki; Umeeda, Hiroyuki

2015-02-26

BaBar collaboration announced that they observed time reversal (T) asymmetry through B meson system. In the experiment, time dependencies of two distinctive processes, B_ →B¯ 0 and B¯ 0 → B_ (– expresses CP value) are compared with each other. In our study, we examine event number difference of these two processes. In contrast to the BaBar asymmetry, the asymmetry of events number includes the overall normalization difference for rates. Time dependence of the asymmetry is more general and it includes terms absent in one used by BaBar collaboration. Both of the BaBar asymmetry and ours are naively thought tomore » be T-odd since two processes compared are related with flipping time direction. We investigate the time reversal transformation property of our asymmetry. Using our notation, one can see that the asymmetry is not precisely a T-odd quantity, taking into account indirect CP and CPT violation of K meson systems. The effect of ϵK is extracted and gives rise to O(10 –3) contribution. The introduced parameters are invariant under rephasing of quarks so that the coefficients of our asymmetry are expressed as phase convention independent quantities. Some combinations of the asymmetry enable us to extract parameters for wrong sign decays of B d meson, CPT violation, etc. As a result, we also study the reason why the T-even terms are allowed to contribute to the asymmetry, and find that several conditions are needed for the asymmetry to be a T-odd quantity.« less

A study of time-dependent CP-violating asymmetries in B0->J/psiK0S and B0->psi(2S)K0S decays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrera, Barbara

We present a preliminary measurement of time-dependent CP-violating asymmetries in B{sup 0} {yields} J/{psi} K{sub S}{sup 0} and B{sup 0} {yields} {psi}(2S)K{sub S}{sup 0} decays recorded by the BABAR detector at the PEP-II asymmetric-energy B Factory at SLAC. The data sample consists of 9.0 fb{sup -1} collected at the {Upsilon}(4S) resonance and 0.8 fb{sup -1} off-resonance. One of the neutral B mesons, produced in pairs at the {Upsilon}(4S), is fully reconstructed. The flavor of the other neutral B meson is tagged at the time of its decay, mainly with the charge of identified leptons and kaons. A neural network taggingmore » algorithm is used to recover events without a clear lepton or kaon tag. The time difference between the decays is determined by measuring the distance between the decay vertices. Wrong-tag probabilities and the time resolution function are measured with samples of fully-reconstructed semileptonic and hadronic neutral B final states. The value of the asymmetry amplitude, sin2{beta}, is determined from a maximum likelihood fit to the time distribution of 120 tagged B{sup 0} {yields} J/{psi} K{sub S}{sup 0} and B{sup 0} {yields} {psi}(2S) K{sub S}{sup 0} candidates to be sin2{beta} = 0.12 {+-} 0.37(stat) {+-} 0.09(syst) (preliminary).« less

Isolation and Compositional Analysis of a CP12-Associated Complex of Calvin Cycle Enzymes from Nicotiana tabacum

USDA-ARS?s Scientific Manuscript database

CP12 is a small intrinsically unstructured protein that forms a multiprotein complex with two Calvin Cycle enzymes, phosphoribulokinase (PRK) and NAD(P)-dependent glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The complex can be reconstituted in vitro from recombinant proteins under conditions t...

The effect of cerebral palsy on arithmetic accuracy is mediated by working memory, intelligence, early numeracy, and instruction time.

PubMed

Jenks, Kathleen M; de Moor, Jan; van Lieshout, Ernest C D M; Maathuis, Karel G B; Keus, Inge; Gorter, Jan Willem

2007-01-01

The development of addition and subtraction accuracy was assessed in first graders with cerebral palsy (CP) in both mainstream (16) and special education (41) and a control group of first graders in mainstream education (16). The control group out-performed the CP groups in addition and subtraction accuracy and this difference could not be fully explained by differences in intelligence. Both CP groups showed evidence of working memory deficits. The three groups exhibited different developmental patterns in the area of early numeracy skills. Children with CP in special education were found to receive less arithmetic instruction and instruction time was positively related to arithmetic accuracy. Structural equation modeling revealed that the effect of CP on arithmetic accuracy is mediated by intelligence, working memory, early numeracy, and instruction time.

Organometallic oxides: Preparation, structure, and chemical and physical properties of paramagnetic ((. eta. -C sub 5 H sub 5 )NbCl(. mu. -A)) sup 3 (. mu. sub 3 -OH)(. mu. sub 3 -O) (A = Cl, OH) and other oxo-hydroxo clusters of niobium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bottomley, F.; Keizer, P.N.; White, P.S.

Hydrolysis of Cp{prime}NbCl{sub 4} (Cp{prime} = {eta}{sup 5}-C{sub 5}H{sub 5} (Cp), {eta}-C{sub 5}H{sub 4}Me (Cp{sup 1})) in tetrahydrofuran (THF) gave a mixture of products of general formula (Cp{prime}NbL{sub 4}){sub 2}({mu}-O), where L{sub 4} is a combination of H{sub 2}O and terminal or bridging Cl that gives eight-coordinate, pentavalent, niobium. For Cp{prime} = Cp, a major constituent of the mixture is (CpNb(H{sub 2}O)Cl{sub 3}){sub 2}({mu}-O) {times} 2THF {times} 0.05Et{sub 2}O (1), the structure of which was determined by X-ray diffraction. Reduction of (Cp{prime}NbL{sub 4}){sub 2}({mu}-O) with aluminum powder gave the cluster (Cp{prime}NbCl({mu}-Cl)){sub 3}({mu}{sub 3}-OH)({mu}{sub 3}-O) (2). The structure of 2 (Cp{prime}more » = Cp) as the THF adduct was determined by X-ray diffraction. Crystal data: monoclinic; P2{sub 1}/c; a = 9.966 (1) {angstrom}, b = 12.471 (2) {angstrom}, c = 20.321 (2) {angstrom}, {beta} = 93.86 (1){degree}.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Topping, R.J.; Stone, M.P.; Brush, C.K.

The {sup 1}H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25{degree}C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25{degree}C, the various conformational state in the mixture are in rapid exchange on the NMR time scale.more » Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5{degree}C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C{sup +}:G base pairs.« less

Performance of three reflectance calibration methods for airborne hyperspectral spectrometer data.

PubMed

Miura, Tomoaki; Huete, Alfredo R

2009-01-01

In this study, the performances and accuracies of three methods for converting airborne hyperspectral spectrometer data to reflectance factors were characterized and compared. The "reflectance mode (RM)" method, which calibrates a spectrometer against a white reference panel prior to mounting on an aircraft, resulted in spectral reflectance retrievals that were biased and distorted. The magnitudes of these bias errors and distortions varied significantly, depending on time of day and length of the flight campaign. The "linear-interpolation (LI)" method, which converts airborne spectrometer data by taking a ratio of linearly-interpolated reference values from the preflight and post-flight reference panel readings, resulted in precise, but inaccurate reflectance retrievals. These reflectance spectra were not distorted, but were subject to bias errors of varying magnitudes dependent on the flight duration length. The "continuous panel (CP)" method uses a multi-band radiometer to obtain continuous measurements over a reference panel throughout the flight campaign, in order to adjust the magnitudes of the linear-interpolated reference values from the preflight and post-flight reference panel readings. Airborne hyperspectral reflectance retrievals obtained using this method were found to be the most accurate and reliable reflectance calibration method. The performances of the CP method in retrieving accurate reflectance factors were consistent throughout time of day and for various flight durations. Based on the dataset analyzed in this study, the uncertainty of the CP method has been estimated to be 0.0025 ± 0.0005 reflectance units for the wavelength regions not affected by atmospheric absorptions. The RM method can produce reasonable results only for a very short-term flight (e.g., < 15 minutes) conducted around a local solar noon. The flight duration should be kept shorter than 30 minutes for the LI method to produce results with reasonable accuracies. An important advantage of the CP method is that the method can be used for long-duration flight campaigns (e.g., 1-2 hours). Although this study focused on reflectance calibration of airborne spectrometer data, the methods evaluated in this study and the results obtained are directly applicable to ground spectrometer measurements.

A synthetic peptide derived from alpha-fetoprotein inhibits the estradiol-induced proliferation of mammary tumor cells in culture through the modulation of p21.

PubMed

Sierralta, Walter D; Epuñan, María J; Reyes, José M; Valladares, Luis E; Pino, Ana M

2008-01-01

A stable cyclized 9-mer peptide (cP) containing the active site of alpha-alpha fetoprotein (alphaFP) has been shown to be effective for prevention of estrogen-stimulated tumor cell proliferation in culture or of xenographt growth in immunodeficient mice. cP does not block 17beta-estradiol (E2) binding to its receptors, but rather appears to interfere with intracellular processing of the signal that supports growth. To obtain insight on that mechanism we studied the effect of cP on the proliferation of MCF-7 cells in culture. Proliferation in the presence of 2 microM E2 is decreased up to 40% upon addition of 2 microg ml(-1) cP to the medium; the presence of cP did not increase cell death, cP reduced also the proliferation of estrogen-dependent ZR75-1 cells but had no effect on autonomous MDA-MB-231 cells, cP did not modify the number of binding sites for labeled E2 or affected cell death. We detected increased nuclear p21Cip1 immunoreactivity after cP treatment. Our results suggest that cP acts via p21Cip1 to slow the process of MCF-7 cells through the cycle.

Small molecule CP-31398 induces reactive oxygen species-dependent apoptosis in human multiple myeloma

PubMed Central

Arihara, Yohei; Takada, Kohichi; Kamihara, Yusuke; Hayasaka, Naotaka; Nakamura, Hajime; Murase, Kazuyuki; Ikeda, Hiroshi; Iyama, Satoshi; Sato, Tsutomu; Miyanishi, Koji; Kobune, Masayoshi; Kato, Junji

2017-01-01

Reactive oxygen species (ROS) are normal byproducts of a wide variety of cellular processes. ROS have dual functional roles in cancer cell pathophysiology. At low to moderate levels, ROS act as signaling transducers to activate cell proliferation, migration, invasion, and angiogenesis. In contrast, high levels of ROS induce cell death. In multiple myeloma (MM), ROS overproduction is the trigger for apoptosis induced by several anticancer compounds, including proteasome inhibitors. However, no drugs for which oxidative stress is the main mechanism of action are currently used for treatment of MM in clinical situations. In this study, we demonstrate that the p53-activating small molecule CP-31398 (CP) effectively inhibits the growth of MM cell lines and primary MM isolates from patients. CP also suppresses the growth of MM xenografts in mice. Mechanistically, CP was found to induce intrinsic apoptosis in MM cells via increasing ROS production. Interestingly, CP-induced apoptosis occurs regardless of the p53 status, suggesting that CP has additional mechanisms of action. Our findings thus indicate that CP could be an attractive candidate for treatment of MM patients harboring p53 abnormalities; this satisfies an unmet clinical need, as such individuals currently have a poor prognosis. PMID:29029480

Small molecule CP-31398 induces reactive oxygen species-dependent apoptosis in human multiple myeloma.

PubMed

Arihara, Yohei; Takada, Kohichi; Kamihara, Yusuke; Hayasaka, Naotaka; Nakamura, Hajime; Murase, Kazuyuki; Ikeda, Hiroshi; Iyama, Satoshi; Sato, Tsutomu; Miyanishi, Koji; Kobune, Masayoshi; Kato, Junji

2017-09-12

Reactive oxygen species (ROS) are normal byproducts of a wide variety of cellular processes. ROS have dual functional roles in cancer cell pathophysiology. At low to moderate levels, ROS act as signaling transducers to activate cell proliferation, migration, invasion, and angiogenesis. In contrast, high levels of ROS induce cell death. In multiple myeloma (MM), ROS overproduction is the trigger for apoptosis induced by several anticancer compounds, including proteasome inhibitors. However, no drugs for which oxidative stress is the main mechanism of action are currently used for treatment of MM in clinical situations. In this study, we demonstrate that the p53-activating small molecule CP-31398 (CP) effectively inhibits the growth of MM cell lines and primary MM isolates from patients. CP also suppresses the growth of MM xenografts in mice. Mechanistically, CP was found to induce intrinsic apoptosis in MM cells via increasing ROS production. Interestingly, CP-induced apoptosis occurs regardless of the p53 status, suggesting that CP has additional mechanisms of action. Our findings thus indicate that CP could be an attractive candidate for treatment of MM patients harboring p53 abnormalities; this satisfies an unmet clinical need, as such individuals currently have a poor prognosis.

CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

PubMed Central

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

2013-01-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

PubMed

Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

2013-12-01

Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.

PubMed

Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick

2010-06-01

Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.

Expression regulation by a methyl-CpG binding domain in an E. coli based, cell-free TX-TL system

NASA Astrophysics Data System (ADS)

Schenkelberger, M.; Shanak, S.; Finkler, M.; Worst, E. G.; Noireaux, V.; Helms, V.; Ott, A.

2017-04-01

Cytosine methylation plays an important role in the epigenetic regulation of eukaryotic gene expression. The methyl-CpG binding domain (MBD) is common to a family of eukaryotic transcriptional regulators. How MBD, a stretch of about 80 amino acids, recognizes CpGs in a methylation dependent manner, and as a function of sequence, is only partly understood. Here we show, using an Escherichia coli cell-free expression system, that MBD from the human transcriptional regulator MeCP2 performs as a specific, methylation-dependent repressor in conjunction with the BDNF (brain-derived neurotrophic factor) promoter sequence. Mutation of either base flanking the central CpG pair changes the expression level of the target gene. However, the relative degree of repression as a function of MBD concentration remains unaltered. Molecular dynamics simulations that address the DNA B fiber ratio and the handedness reveal cooperative transitions in the promoter DNA upon MBD binding that correlate well with our experimental observations. We suggest that not only steric hindrance, but also conformational changes of the BDNF promoter as a result of MBD binding are required for MBD to act as a specific inhibitory element. Our work demonstrates that the prokaryotic transcription machinery can reproduce features of epigenetic mammalian transcriptional regulatory elements.

Improved interface and electrical properties of atomic layer deposited Al2O3/4H-SiC

NASA Astrophysics Data System (ADS)

Suvanam, Sethu Saveda; Usman, Muhammed; Martin, David; Yazdi, Milad. G.; Linnarsson, Margareta; Tempez, Agnès; Götelid, Mats; Hallén, Anders

2018-03-01

In this paper we demonstrate a process optimization of atomic layer deposited Al2O3 on 4H-SiC resulting in an improved interface and electrical properties. For this purpose the samples have been treated with two pre deposition surface cleaning processes, namely CP1 and CP2. The former is a typical surface cleaning procedure used in SiC processing while the latter have an additional weak RCA1 cleaning step. In addition to the cleaning and deposition, the effects of post dielectric annealing (PDA) at various temperatures in N2O ambient have been investigated. Analyses by scanning electron microscopy show the presence of structural defects on the Al2O3 surface after annealing at 500 and 800 °C. These defects disappear after annealing at 1100 °C, possibly due to densification of the Al2O3 film. Interface analyses have been performed using X-ray photoelectron spectroscopy (XPS) and time-of-flight medium energy ion scattering (ToF MEIS). Both these measurements show the formation of an interfacial SiOx (0 < x < 2) layer for both the CP1 and CP2, displaying an increased thickness for higher temperatures. Furthermore, the quality of the sub-oxide interfacial layer was found to depend on the pre deposition cleaning. In conclusion, an improved interface with better electrical properties is shown for the CP2 sample annealed at 1100 °C, resulting in lower oxide charges, strongly reduced flatband voltage and leakage current, as well as higher breakdown voltage.

Dual Inhibition of Ca(+2) Influx and Phosphodiesterase Enzyme Provides Scientific Base for the Medicinal Use of Chrozophora prostrata Dalz. in Respiratory Disorders.

PubMed

Arshad, Usman; Bashir, Samra; -Ur-Rehman, Najeeb; Yaqub, Tahir; Gilani, Anwarul-Hassan

2016-06-01

The crude ethanolic extract of Chrozophora prostrata (Cp.Cr) was tested using in vivo and ex vivo assays for its possible bronchodilatory effects in order to validate its medicinal use in respiratory disorders, like asthma and cough. Cp.Cr exhibited dose-dependent inhibition of carbachol (CCh)-induced bronchospasm in anesthetized rats, similar to aminophylline. When tested on guinea-pig tracheal preparations, Cp.Cr caused relaxation of both CCh (1 μM) and high K(+) (80 mM)-induced contractions with comparable potencies, similar to papaverine, a dual inhibitor of phosphodiesterse (PDE) and Ca(+2) influx. Pre-treatment of the tracheal tissues with Cp.Cr resulted in potentiation of the inhibitory effect of isoprenaline on CCh-induced contractions, like that caused by papaverine indicative of PDE inhibitory activity, which was confirmed when Cp.Cr concentration dependently (1 and 3 mg/mL) increased intracellular cAMP levels of the tracheal preparations, like papaverine. Cp.Cr shifted concentrationresponse curves of Ca(+2) constructed in guinea-pig tracheal preparation towards right with suppression of the maximum response, similar to both verapamil and papaverine. These data indicate bronchodilator activity of Chrozophora prostrata mediated possibly through dual inhibition of PDE and Ca(+2) influx, thus, showing therapeutic potential in asthma with effect enhancing and side-effect neutralizing potential Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Early-life seizures alter synaptic calcium-permeable AMPA receptor function and plasticity

PubMed Central

Lippman-Bell, Jocelyn J.; Zhou, Chengwen; Sun, Hongyu; Feske, Joel S.; Jensen, Frances E.

2016-01-01

Calcium (Ca2+)-mediated1 signaling pathways are critical to synaptic plasticity. In adults, the NMDA glutamate receptor (NMDAR) represents a major route for activity-dependent synaptic Ca2+ entry. However, during neonatal development, when synaptic plasticity is high, many AMPA glutamate receptors (AMPARs) are also permeable to Ca2+ (CP-AMPAR) due to low GluA2 subunit expression, providing an additional route for activity- and glutamate-dependent Ca2+ influx and subsequent signaling. Therefore, altered hippocampal Ca2+ signaling may represent an age-specific pathogenic mechanism. We thus aimed to assess Ca2+ responses 48 hours after hypoxia-induced neonatal seizures (HS) in postnatal day (P)10 rats, a post-seizure time point at which we previously reported LTP attenuation. We found that Ca2+ responses were higher in brain slices from post-HS rats than in controls and this increase was CP-AMPAR-dependent. To determine whether synaptic CP-AMPAR expression was also altered post-HS, we assessed the expression of GluA2 at hippocampal synapses and the expression of long-term depression (LTD), which has been linked to the presence of synaptic GluA2. Here we report a decrease 48 hours after HS in synaptic GluA2 expression at synapses and LTD in hippocampal CA1. Given the potentially critical role of AMPAR trafficking in disease progression, we aimed to establish whether post-seizure in vivo AMPAR antagonist treatment prevented the enhanced Ca2+ responses, changes in GluA2 synaptic expression, and diminished LTD. We found that NBQX treatment prevents all three of these post-seizure consequences, further supporting a critical role for AMPARs as an age-specific therapeutic target. PMID:27521497

Measurement of the Difference of Time-Integrated CP Asymmetries in D^{0}→K^{-}K^{+} and D^{0}→π^{-}π^{+} Decays.

PubMed

Aaij, R; Abellán Beteta, C; Adeva, B; Adinolfi, M; Affolder, A; Ajaltouni, Z; Akar, S; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves, A A; Amato, S; Amerio, S; Amhis, Y; An, L; Anderlini, L; Andreassi, G; Andreotti, M; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; d'Argent, P; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Badalov, A; Baesso, C; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Batozskaya, V; Battista, V; Bay, A; Beaucourt, L; Beddow, J; Bedeschi, F; Bediaga, I; Bel, L J; Bellee, V; Belloli, N; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bertolin, A; Betti, F; Bettler, M-O; van Beuzekom, M; Bifani, S; Billoir, P; Bird, T; Birnkraut, A; Bizzeti, A; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borgheresi, A; Borghi, S; Borisyak, M; Borsato, M; Bowcock, T J V; Bowen, E; Bozzi, C; Braun, S; Britsch, M; Britton, T; Brodzicka, J; Brook, N H; Buchanan, E; Burr, C; Bursche, A; Buytaert, J; Cadeddu, S; Calabrese, R; Calvi, M; Calvo Gomez, M; Campana, P; Campora Perez, D; Capriotti, L; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carniti, P; Carson, L; Carvalho Akiba, K; Casse, G; Cassina, L; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cavallero, G; Cenci, R; Charles, M; Charpentier, Ph; Chefdeville, M; Chen, S; Cheung, S-F; Chiapolini, N; Chrzaszcz, M; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coco, V; Cogan, J; Cogneras, E; Cogoni, V; Cojocariu, L; Collazuol, G; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Corvo, M; Couturier, B; Cowan, G A; Craik, D C; Crocombe, A; Cruz Torres, M; Cunliffe, S; Currie, R; D'Ambrosio, C; Dall'Occo, E; Dalseno, J; David, P N Y; Davis, A; De Aguiar Francisco, O; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Dean, C-T; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Demmer, M; Derkach, D; Deschamps, O; Dettori, F; Dey, B; Di Canto, A; Di Ruscio, F; Dijkstra, H; Donleavy, S; Dordei, F; Dorigo, M; Dosil Suárez, A; Dovbnya, A; Dreimanis, K; Dufour, L; Dujany, G; Dungs, K; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Ely, S; Esen, S; Evans, H M; Evans, T; Falabella, A; Färber, C; Farley, N; Farry, S; Fay, R; Fazzini, D; Ferguson, D; Fernandez Albor, V; Ferrari, F; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fiorini, M; Firlej, M; Fitzpatrick, C; Fiutowski, T; Fleuret, F; Fohl, K; Fol, P; Fontana, M; Fontanelli, F; Forshaw, D C; Forty, R; Frank, M; Frei, C; Frosini, M; Fu, J; Furfaro, E; Gallas Torreira, A; Galli, D; Gallorini, S; Gambetta, S; Gandelman, M; Gandini, P; Gao, Y; García Pardiñas, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gavardi, L; Gazzoni, G; Gerick, D; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gianì, S; Gibson, V; Girard, O G; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graverini, E; Graziani, G; Grecu, A; Griffith, P; Grillo, L; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadavizadeh, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Han, X; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; He, J; Head, T; Heijne, V; Heister, A; Hennessy, K; Henrard, P; Henry, L; Hernando Morata, J A; van Herwijnen, E; Heß, M; Hicheur, A; Hill, D; Hoballah, M; Hombach, C; Hulsbergen, W; Humair, T; Hushchyn, M; Hussain, N; Hutchcroft, D; Hynds, D; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jalocha, J; Jans, E; Jawahery, A; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Jurik, N; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Karodia, S; Kecke, M; Kelsey, M; Kenyon, I R; Kenzie, M; Ketel, T; Khairullin, E; Khanji, B; Khurewathanakul, C; Kirn, T; Klaver, S; Klimaszewski, K; Kochebina, O; Kolpin, M; Komarov, I; Koopman, R F; Koppenburg, P; Kozeiha, M; Kravchuk, L; Kreplin, K; Kreps, M; Krokovny, P; Kruse, F; Krzemien, W; Kucewicz, W; Kucharczyk, M; Kudryavtsev, V; Kuonen, A K; Kurek, K; Kvaratskheliya, T; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lanfranchi, G; Langenbruch, C; Langhans, B; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Lemos Cid, E; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Likhomanenko, T; Liles, M; Lindner, R; Linn, C; Lionetto, F; Liu, B; Liu, X; Loh, D; Longstaff, I; Lopes, J H; Lucchesi, D; Lucio Martinez, M; Luo, H; Lupato, A; Luppi, E; Lupton, O; Lusiani, A; Machefert, F; Maciuc, F; Maev, O; Maguire, K; Malde, S; Malinin, A; Manca, G; Mancinelli, G; Manning, P; Mapelli, A; Maratas, J; Marchand, J F; Marconi, U; Marin Benito, C; Marino, P; Marks, J; Martellotti, G; Martin, M; Martinelli, M; Martinez Santos, D; Martinez Vidal, F; Martins Tostes, D; Massacrier, L M; Massafferri, A; Matev, R; Mathad, A; Mathe, Z; Matteuzzi, C; Mauri, A; Maurin, B; Mazurov, A; McCann, M; McCarthy, J; McNab, A; McNulty, R; Meadows, B; Meier, F; Meissner, M; Melnychuk, D; Merk, M; Merli, A; Michielin, E; Milanes, D A; Minard, M-N; Mitzel, D S; Molina Rodriguez, J; Monroy, I A; Monteil, S; Morandin, M; Morawski, P; Mordà, A; Morello, M J; Moron, J; Morris, A B; Mountain, R; Muheim, F; Müller, D; Müller, J; Müller, K; Müller, V; Mussini, M; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nandi, A; Nasteva, I; Needham, M; Neri, N; Neubert, S; Neufeld, N; Neuner, M; Nguyen, A D; Nguyen-Mau, C; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Novoselov, A; O'Hanlon, D P; Oblakowska-Mucha, A; Obraztsov, V; Ogilvy, S; Okhrimenko, O; Oldeman, R; Onderwater, C J G; Osorio Rodrigues, B; Otalora Goicochea, J M; Otto, A; Owen, P; Oyanguren, A; Palano, A; Palombo, F; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Pappalardo, L L; Pappenheimer, C; Parker, W; Parkes, C; Passaleva, G; Patel, G D; Patel, M; Patrignani, C; Pearce, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perret, P; Pescatore, L; Petridis, K; Petrolini, A; Petruzzo, M; Picatoste Olloqui, E; Pietrzyk, B; Pikies, M; Pinci, D; Pistone, A; Piucci, A; Playfer, S; Plo Casasus, M; Poikela, T; Polci, F; Poluektov, A; Polyakov, I; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Price, E; Price, J D; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Quagliani, R; Rachwal, B; Rademacker, J H; Rama, M; Ramos Pernas, M; Rangel, M S; Raniuk, I; Raven, G; Redi, F; Reichert, S; Dos Reis, A C; Renaudin, V; Ricciardi, S; Richards, S; Rihl, M; Rinnert, K; Rives Molina, V; Robbe, P; Rodrigues, A B; Rodrigues, E; Rodriguez Lopez, J A; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Ronayne, J W; Rotondo, M; Ruf, T; Ruiz Valls, P; Saborido Silva, J J; Sagidova, N; Saitta, B; Salustino Guimaraes, V; Sanchez Mayordomo, C; Sanmartin Sedes, B; Santacesaria, R; Santamarina Rios, C; Santimaria, M; Santovetti, E; Sarti, A; Satriano, C; Satta, A; Saunders, D M; Savrina, D; Schael, S; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmelzer, T; Schmidt, B; Schneider, O; Schopper, A; Schubiger, M; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Semennikov, A; Sergi, A; Serra, N; Serrano, J; Sestini, L; Seyfert, P; Shapkin, M; Shapoval, I; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, V; Shires, A; Siddi, B G; Silva Coutinho, R; Silva de Oliveira, L; Simi, G; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, E; Smith, I T; Smith, J; Smith, M; Snoek, H; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Spradlin, P; Sridharan, S; Stagni, F; Stahl, M; Stahl, S; Stefkova, S; Steinkamp, O; Stenyakin, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Stracka, S; Straticiuc, M; Straumann, U; Sun, L; Sutcliffe, W; Swientek, K; Swientek, S; Syropoulos, V; Szczekowski, M; Szumlak, T; T'Jampens, S; Tayduganov, A; Tekampe, T; Tellarini, G; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Todd, J; Tolk, S; Tomassetti, L; Tonelli, D; Topp-Joergensen, S; Tournefier, E; Tourneur, S; Trabelsi, K; Traill, M; Tran, M T; Tresch, M; Trisovic, A; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ukleja, A; Ustyuzhanin, A; Uwer, U; Vacca, C; Vagnoni, V; Valenti, G; Vallier, A; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; van Veghel, M; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vieites Diaz, M; Vilasis-Cardona, X; Volkov, V; Vollhardt, A; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; de Vries, J A; Waldi, R; Wallace, C; Wallace, R; Walsh, J; Wang, J; Ward, D R; Watson, N K; Websdale, D; Weiden, A; Whitehead, M; Wicht, J; Wilkinson, G; Wilkinson, M; Williams, M; Williams, M P; Williams, M; Williams, T; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wormser, G; Wotton, S A; Wraight, K; Wright, S; Wyllie, K; Xie, Y; Xu, Z; Yang, Z; Yu, J; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, L; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zhukov, V; Zucchelli, S

2016-05-13

A search for CP violation in D^{0}→K^{-}K^{+} and D^{0}→π^{-}π^{+} decays is performed using pp collision data, corresponding to an integrated luminosity of 3  fb^{-1}, collected using the LHCb detector at center-of-mass energies of 7 and 8 TeV. The flavor of the charm meson is inferred from the charge of the pion in D^{*+}→D^{0}π^{+} and D^{*-}→D[over ¯]^{0}π^{-} decays. The difference between the CP asymmetries in D^{0}→K^{-}K^{+} and D^{0}→π^{-}π^{+} decays, ΔA_{CP}≡A_{CP}(K^{-}K^{+})-A_{CP}(π^{-}π^{+}), is measured to be [-0.10±0.08(stat)±0.03(syst)]%. This is the most precise measurement of a time-integrated CP asymmetry in the charm sector from a single experiment.

Sex-dependent effects of periadolescent exposure to the cannabinoid agonist CP-55,940 on morphine self-administration behaviour and the endogenous opioid system.

PubMed

Biscaia, Miguel; Fernández, Beatriz; Higuera-Matas, Alejandro; Miguéns, Miguel; Viveros, Maria-Paz; García-Lecumberri, Carmen; Ambrosio, Emilio

2008-04-01

Early cannabinoid consumption may predispose individuals to the misuse of addictive drugs later in life. However, there is a lack of experimental evidence as to whether cannabinoid exposure during adolescence might differently affect opiate reinforcing efficacy and the opioid system in adults of both sexes. Our aim was to examine whether periadolescent chronic exposure to the cannabinoid agonist CP-55,940 could exert sex-dependent effects on morphine reinforcing and the opioid system in adulthood. Morphine reinforcing was studied under a progressive ratio (PR) reinforcement schedule in adult male and female rats that previously acquired morphine self-administration under a fixed ratio 1 (FR1) schedule. Binding levels and functionality of mu-opioid receptors were also evaluated. Periadolescent cannabinoid exposure altered morphine self-administration and the opioid system in adult rats in a sex-dependent manner. CP-55,940-exposed males exhibited higher self-administration rates under a FR1, but not under a PR schedule. In females, CP-55,940 did not modify morphine self-administration under either schedule. Moreover, CP-55,940 also increased mu-opioid receptor levels in the subcallosal streak of pre-treated animals and decreased mu-opioid receptor functionality in the nucleus accumbens shell but again, only in males. Our data indicate that adult male rats exposed to the cannabinoid in adolescence self-administer more morphine than females, but only when the demands required by the schedule of reinforcement are low, which might be related to the decrease in mu-opioid receptor functionality in the NAcc-shell observed in these animals.

Khz-cp (crude polysaccharide extract obtained from the fusion of Ganoderma lucidum and Polyporus umbellatus mycelia) induces apoptosis by increasing intracellular calcium levels and activating P38 and NADPH oxidase-dependent generation of reactive oxygen species in SNU-1 cells.

PubMed

Kim, Tae Hwan; Kim, Ju Sung; Kim, Zoo Haye; Huang, Ren Bin; Chae, Young Lye; Wang, Ren Sheng

2014-07-10

Khz-cp is a crude polysaccharide extract that is obtained after nuclear fusion in Ganoderma lucidum and Polyporus umbellatus mycelia (Khz). It inhibits the growth of cancer cells. Khz-cp was extracted by solvent extraction. The anti-proliferative activity of Khz-cp was confirmed by using Annexin-V/PI-flow cytometry analysis. Intracellular calcium increase and measurement of intracellular reactive oxygen species (ROS) were performed by using flow cytometry and inverted microscope. SNU-1 cells were treated with p38, Bcl-2 and Nox family siRNA. siRNA transfected cells was employed to investigate the expression of apoptotic, growth and survival genes in SNU-1 cells. Western blot analysis was performed to confirm the expression of the genes. In the present study, Khz-cp induced apoptosis preferentially in transformed cells and had only minimal effects on non-transformed cells. Furthermore, Khz-cp was found to induce apoptosis by increasing the intracellular Ca2+ concentration ([Ca2+]i) and activating P38 to generate reactive oxygen species (ROS) via NADPH oxidase and the mitochondria. Khz-cp-induced apoptosis was caspase dependent and occurred via a mitochondrial pathway. ROS generation by NADPH oxidase was critical for Khz-cp-induced apoptosis, and although mitochondrial ROS production was also required, it appeared to occur secondary to ROS generation by NADPH oxidase. Activation of NADPH oxidase was shown by the translocation of the regulatory subunits p47phox and p67phox to the cell membrane and was necessary for ROS generation by Khz-cp. Khz-cp triggered a rapid and sustained increase in [Ca2+]i that activated P38. P38 was considered to play a key role in the activation of NADPH oxidase because inhibition of its expression or activity abrogated membrane translocation of the p47phox and p67phox subunits and ROS generation. In summary, these data indicate that Khz-cp preferentially induces apoptosis in cancer cells and that the signaling mechanisms involve an increase in [Ca2+]i, P38 activation, and ROS generation via NADPH oxidase and mitochondria.

Time trends in the etiology of chronic pancreatitis in South India.

PubMed

Rajesh, Gopalakrishna; Girish, Banavara Narasimhamurthy; Panicker, Suprabha; Balakrishnan, Vallath

2014-01-01

Recent reports indicate a decline in prevalence of classical tropical chronic pancreatitis (TCP). We studied the etiologies and risk factors over a 14-year period at a tertiary care university hospital. We compared the etiology in chronic pancreatitis (CP) patients presenting and followed-up in our Pancreas Clinic over two time periods (2000-06 and 2007-13). Idiopathic chronic pancreatitis (ICP) was the predominant etiology seen over the two time periods. However an increase in prevalence of alcoholic chronic pancreatitis (ACP) during the latter time period suggests that it may be emerging as a dominant etiology over recent years. Hypertriglyceridemia and hyperparathyroidism were uncommon causes of non-alcoholic CP. Autoimmune pancreatitis was noted only during 2007-13, but remains a rare cause of CP. There are multiple risk factors for CP in our population. The high prevalence of ICP indicates need closer examination of risk factors and ICP pathogenesis. ACP appears to be emerging as a dominant cause of CP which suggests a need to reorient preventive strategies.

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Loss of myogenic potential and fusion capacity of muscle stem cells isolated from contractured muscle in children with cerebral palsy.

PubMed

Domenighetti, Andrea A; Mathewson, Margie A; Pichika, Rajeswari; Sibley, Lydia A; Zhao, Leyna; Chambers, Henry G; Lieber, Richard L

2018-04-25

Cerebral palsy (CP) is the most common cause of pediatric neurodevelopmental and physical disability in the United States. It is defined as a group of motor disorders caused by a non-progressive perinatal insult to the brain. While the brain lesion is non-progressive, there is a progressive, lifelong impact on skeletal muscles, which are shorter, spastic, and may develop debilitating contractures. Satellite cells are resident muscle stem cells that are indispensable for postnatal growth and regeneration of skeletal muscles. Here we measured the myogenic potential of satellite cells isolated from contractured muscles in children with CP. When compared to typically developing (TD) children, satellite cell-derived myoblasts from CP differentiated more slowly (Slope: 0.013{plus minus}0.013 CP vs. 0.091{plus minus}0.024 TD over 24 hours, P<0.001) and fused less (Fusion Index: 21.3{plus minus}8.6 CP vs. 81.3{plus minus}7.7 TD after 48 hours, P<0.001) after exposure to low-serum conditions that stimulated myotube formation. This impairment was associated with downregulation of several markers important for myoblast fusion and myotube formation, including DNA methylation-dependent inhibition of pro-myogenic Integrin Beta 1D (ITGB1D) protein expression levels (-50% at 42 hours), and ~25% loss of integrin-mediated FAK kinase phosphorylation. The cytidine analog 5-Azacytidine (5-AZA), a demethylating agent, restored ITGB1D levels and promoted myogenesis in CP cultures. Our data demonstrate that muscle contractures in CP are associated with loss of satellite cell myogenic potential that is dependent on DNA methylation patterns affecting expression of genetic programs associated with muscle stem cell differentiation and muscle fiber formation.

Mitochondria-Targeted Nitroxide, Mito-CP, Suppresses Medullary Thyroid Carcinoma Cell Survival In Vitro and In Vivo

PubMed Central

Starenki, Dmytro

2013-01-01

Context: Medullary thyroid carcinoma (MTC) is a neuroendocrine tumor mainly caused by mutations in the RET proto-oncogene. For MTC therapy, the U.S. Food and Drug Administration recently approved vandetanib and cabozantinib, multikinase inhibitors targeting RET and other tyrosine kinase receptors of vascular endothelial growth factor, epidermal growth factor, or hepatocyte growth factor. Nevertheless, not all patients with the progressive MTC respond to these drugs, requiring the development of additional therapeutic modalities that have distinct activity. Objective: We aimed to evaluate mitochondria-targeted carboxy-proxyl (Mito-CP), a mitochondria-targeted redox-sensitive agent, for its tumor-suppressive efficacy against MTC. Design: In vitro cultures of 2 human MTC cell lines, TT and MZ-CRC-1, and TT xenografts in mice were treated with Mito-CP in comparison with vandetanib. The effects on cell survival/death, RET expression, mitochondrial integrity, and oxidative stress were determined. Results: Contrary to vandetanib, Mito-CP induced RET downregulation and strong cytotoxic effects in both cell lines in vitro, including caspase-dependent apoptosis. These effects were accompanied by mitochondrial membrane depolarization, decreased oxygen consumption, and increased oxidative stress in cells. Intriguingly, Mito-CP–induced cell death, but not RET downregulation, was partially inhibited by the reactive oxygen species scavenger, N-acetyl-cysteine, indicating that Mito-CP mediates tumor-suppressive effects via redox-dependent as well as redox-independent mechanisms. Orally administered Mito-CP effectively suppressed TT xenografts in mice, with an efficacy comparable to vandetanib and relatively low toxicity to animals. Conclusion: Our results suggest that Mito-CP can effectively suppress MTC cell growth/survival via a mechanism distinct from vandetanib effects. Mitochondrial targeting may be a potential strategy for MTC therapy. PMID:23509102

Sonic Hedgehog promotes proliferation of Notch-dependent monociliated choroid plexus tumour cells

PubMed Central

Li, Li; Grausam, Katie B.; Wang, Jun; Lun, Melody P.; Ohli, Jasmin; Lidov, Hart G. W.; Calicchio, Monica L.; Zeng, Erliang; Salisbury, Jeffrey L.; Wechsler-Reya, Robert J.; Lehtinen, Maria K.; Schüller, Ulrich; Zhao, Haotian

2016-01-01

Aberrant Notch signaling has been linked to many cancers including choroid plexus (CP) tumours, a group of rare and predominantly pediatric brain neoplasms. We developed animal models of CP tumours by inducing sustained expression of Notch1 that recapitulate properties of human CP tumours with aberrant NOTCH signaling. Whole transcriptome and functional analyses showed that tumour cell proliferation is associated with Sonic Hedgehog (Shh) in the tumour microenvironment. Unlike CP epithelial cells, which have multiple primary cilia, tumour cells possess a solitary primary cilium as a result of Notch-mediated suppression of multiciliate diffferentiation. A Shh-driven signaling cascade in the primary cilium occurs in tumour cells but not in epithelial cells. Lineage studies show that CP tumours arise from mono-ciliated progenitors in the roof plate characterized by elevated Notch signaling. Abnormal SHH signaling and distinct ciliogenesis are detected in human CP tumours, suggesting SHH pathway and cilia differentiation as potential therapeutic avenues. PMID:26999738

Early Seizures Prematurely Unsilence Auditory Synapses to Disrupt Thalamocortical Critical Period Plasticity.

PubMed

Sun, Hongyu; Takesian, Anne E; Wang, Ting Ting; Lippman-Bell, Jocelyn J; Hensch, Takao K; Jensen, Frances E

2018-05-29

Heightened neural excitability in infancy and childhood results in increased susceptibility to seizures. Such early-life seizures are associated with language deficits and autism that can result from aberrant development of the auditory cortex. Here, we show that early-life seizures disrupt a critical period (CP) for tonotopic map plasticity in primary auditory cortex (A1). We show that this CP is characterized by a prevalence of "silent," NMDA-receptor (NMDAR)-only, glutamate receptor synapses in auditory cortex that become "unsilenced" due to activity-dependent AMPA receptor (AMPAR) insertion. Induction of seizures prior to this CP occludes tonotopic map plasticity by prematurely unsilencing NMDAR-only synapses. Further, brief treatment with the AMPAR antagonist NBQX following seizures, prior to the CP, prevents synapse unsilencing and permits subsequent A1 plasticity. These findings reveal that early-life seizures modify CP regulators and suggest that therapeutic targets for early post-seizure treatment can rescue CP plasticity. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

PubMed Central

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

2016-01-01

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

PubMed

Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

A Novel Cyclophilin B Gene in the Red Tide Dinoflagellate Cochlodinium polykrikoides: Molecular Characterizations and Transcriptional Responses to Environmental Stresses.

PubMed

Abassi, Sofia; Wang, Hui; Park, Bum Soo; Park, Jong-Woo; Ki, Jang-Seu

2017-01-01

The marine dinoflagellate Cochlodinium polykrikoides is one of the most common ichthyotoxic species that causes harmful algal blooms (HABs), which leads to ecological damage and huge economic loss in aquaculture industries. Cyclophilins (CYPs) belong to the immunophilin superfamily, and they may play a role in the survival mechanisms of the dinoflagellate in stress environments. In the present study, we identified a novel cyclophilin gene from C. polykrikoides and examined physiological and gene transcriptional responses to biocides copper sulphate (CuSO 4 ) and sodium hypochlorite (NaOCl). The full length of CpCYP was 903 bp, ranging from the dinoflagellate splice leader (DinoSL) sequence to the polyA tail, comprising a 639 bp ORF, a 117 bp 5'-UTR, and a 147 bp 3'-UTR. Motif and phylogenetic comparisons showed that CpCYP was affiliated to group B of CYP. In biocide stressors, cell counts, chlorophyll a , and photosynthetic efficiency ( Fv / Fm ) of C. polykrikoides were considerably decreased in both exposure time- and dose-dependent manners. In addition, CpCYP gene expression was significantly induced after 24 h exposure to the biocide-treated stress conditions. These results indicate an effect of the biocides on the cell physiology and expression profile of CpCYP , suggesting that the gene may play a role in environmental stress responses.

75 FR 53287 - Combined Notice of Filings No. 2

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-31

..., September 14, 2010. Docket Numbers: ER10-2338-000. Applicants: CP Power Sales Nineteen, L.L.C. Description: CP Power Sales Nineteen, L.L.C. submits tariff filing per 35.12: CP Power Sales Nineteen, L.L.C... Date: 5 p.m. Eastern Time on Tuesday, September 14, 2010. Docket Numbers: ER10-2339-000. Applicants: CP...

Study of CP Violation in Dalitz-Plot Analyses of B-Meson Decays to Three Kaons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindquist, Brian

The Standard Model (SM) explains CP violation in terms of the CKM matrix. The BABAR experiment was designed mainly to test the CKM model in B decays. B decays that proceed through b → s loop diagrams, of which B {yields} KKK decays are an example, are sensitive to new physics effects that could lead to deviations from the CKM predictions for CP violation. We present studies of CP violation in the decays B + → K +K -K +, B + → K S 0K S 0K +, and B 0 → K +K -K S 0, using a Dalitz plot amplitude analysis. These studies are based on approximately 470 million Bmore » $$\\bar{B}$$ decays collected by BABAR at the PEP-II collider at SLAC. We perform measurements of time-dependent CP violation in B 0 → K +K -K S 0, including B 0 → ΦK S 0. We measure a CP-violating phase β eff (ΦK S 0) = 0.36 ± 0.11 ± 0.04 rad., in agreement with the SM. This is the world's most precise measurement of this quantity. We also measure direct CP asymmetries in all three decay modes, including the direct CP asymmetry A CP (ΦK +) = (12.8 ± 4.4 ± 1.3)%, which is 2.8 sigma away from zero. This measurement is in tension with the SM, which predicts an asymmetry of a few percent. We also study the resonant and nonresonant features in the B → KKK Dalitz plots. We find that the hypothetical scalar f X(1500) resonance, introduced by prior analyses to explain an unknown peak in the m KK spectrum, cannot adequately describe the data. We conclude instead that the f X(1500) can be explained as the sum of the f 0(1500), f' 2(1525), and f 0(1710) resonances, removing the need for the hypothetical f X(1500). We also find that an exponential nonresonant model, used by previous analyses to describe the broad nonresonant feature seen in B → KKK decays, cannot fully model the data. We introduce a new nonresonant model that contains more free parameters, allows for phase motion, and contains both S-wave and P-wave components.« less

The mechanistic bases of the power–time relationship: muscle metabolic responses and relationships to muscle fibre type

PubMed Central

Black, Matthew I.; DiMenna, Fred J.; Blackwell, Jamie R.; Schmidt, Jakob Friis; Thompson, Christopher; Wylie, Lee J.; Mohr, Magni; Bangsbo, Jens; Krustrup, Peter; Jones, Andrew M.

2016-01-01

Key points The power‐asymptote (critical power; CP) of the hyperbolic power–time relationship for high‐intensity exercise defines a threshold between steady‐state and non‐steady‐state exercise intensities and the curvature constant (W′) indicates a fixed capacity for work >CP that is related to a loss of muscular efficiency.The present study reports novel evidence on the muscle metabolic underpinnings of CP and W′ during whole‐body exercise and their relationships to muscle fibre type.We show that the W′ is not correlated with muscle fibre type distribution and that it represents an elevated energy contribution from both oxidative and glycolytic/glycogenolytic metabolism.We show that there is a positive correlation between CP and highly oxidative type I muscle fibres and that muscle metabolic steady‐state is attainable CP.Our findings indicate a mechanistic link between the bioenergetic characteristics of muscle fibre types and the power–time relationship for high‐intensity exercise. Abstract We hypothesized that: (1) the critical power (CP) will represent a boundary separating steady‐state from non‐steady‐state muscle metabolic responses during whole‐body exercise and (2) that the CP and the curvature constant (W′) of the power–time relationship for high‐intensity exercise will be correlated with type I and type IIx muscle fibre distributions, respectively. Four men and four women performed a 3 min all‐out cycling test for the estimation of CP and constant work rate (CWR) tests slightly >CP until exhaustion (T lim), slightly CP T lim isotime to test the first hypothesis. Eleven men performed 3 min all‐out tests and donated muscle biopsies to test the second hypothesis. Below CP, muscle [PCr] [42.6 ± 7.1 vs. 49.4 ± 6.9 mmol (kg d.w.)−1], [La−] [34.8 ± 12.6 vs. 35.5 ± 13.2 mmol (kg d.w.)−1] and pH (7.11 ± 0.08 vs. 7.10 ± 0.11) remained stable between ∼12 and 24 min (P > 0.05 for all), whereas these variables changed with time >CP such that they were greater [[La−] 95.6 ± 14.1 mmol (kg d.w.)−1] and lower [[PCr] 24.2 ± 3.9 mmol (kg d.w.)−1; pH 6.84 ± 0.06] (P < 0.05) at T lim (740 ± 186 s) than during the

The daughter centriole controls ciliogenesis by regulating Neurl-4 localization at the centrosome

PubMed Central

Loukil, Abdelhalim; Tormanen, Kati

2017-01-01

The two centrioles of the centrosome differ in age and function. Although the mother centriole mediates most centrosome-dependent processes, the role of the daughter remains poorly understood. A recent study has implicated the daughter centriole in centriole amplification in multiciliated cells, but its contribution to primary ciliogenesis is unclear. We found that manipulations that prevent daughter centriole formation or induce its separation from the mother abolish ciliogenesis. This defect was caused by stabilization of the negative ciliogenesis regulator CP110 and was corrected by CP110 depletion. CP110 dysregulation may be caused by effects on Neurl-4, a daughter centriole–associated ubiquitin ligase cofactor, which was required for ciliogenesis. Centrosome-targeted Neurl-4 was sufficient to restore ciliogenesis in cells with manipulated daughter centrioles. Interestingly, early during ciliogenesis, Neurl-4 transiently associated with the mother centriole in a process that required mother–daughter centriole proximity. Our data support a model in which the daughter centriole promotes ciliogenesis through Neurl-4–dependent regulation of CP110 levels at the mother centriole. PMID:28385950

50 CFR 679.5 - Recordkeeping and reporting (R&R).

Code of Federal Regulations, 2014 CFR

2014-10-01

... CV trw CP lgl/pot CP trw MS Submit to ... Time limit (1) White X X X X X Must retain, permanently...: CP = catcher/processor; CV = catcher vessel; lgl = longline; trw = trawl; MS = mothership. (2...

50 CFR 679.5 - Recordkeeping and reporting (R&R).

Code of Federal Regulations, 2013 CFR

2013-10-01

... CV trw CP lgl/pot CP trw MS Submit to ... Time limit (1) White X X X X X Must retain, permanently...: CP = catcher/processor; CV = catcher vessel; lgl = longline; trw = trawl; MS = mothership. (2...

Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

PubMed Central

Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

2016-01-01

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

Optical properties, excitation energy and primary charge transfer in photosystem II: theory meets experiment.

PubMed

Renger, Thomas; Schlodder, Eberhard

2011-01-01

In this review we discuss structure-function relationships of the core complex of photosystem II, as uncovered from analysis of optical spectra of the complex and its subunits. Based on descriptions of optical difference spectra including site directed mutagenesis we propose a revision of the multimer model of the symmetrically arranged reaction center pigments, described by an asymmetric exciton Hamiltonian. Evidence is provided for the location of the triplet state, the identity of the primary electron donor, the localization of the cation and the secondary electron transfer pathway in the reaction center. We also discuss the stationary and time-dependent optical properties of the CP43 and CP47 subunits and the excitation energy transfer and trapping-by-charge-transfer kinetics in the core complex. Copyright © 2011 Elsevier B.V. All rights reserved.

43 CFR Appendix I to Part 11 - Methods for Estimating the Areas of Ground Water and Surface Water Exposure During the...

Code of Federal Regulations, 2010 CFR

2010-10-01

... the initial mixing distance, is estimated by: Cp=25(Wi)/(T0.7 Q) where Cp is the peak concentration... equation: Tp=9.25×106 Wi/(QCp) where Tp is the time estimate, in hours, and Wi, Cp, and Q are defined above... downstream location, past the initial mixing distance, is estimated by: Cp=C(q)/(Q+ where Cp and Q are...

43 CFR Appendix I to Part 11 - Methods for Estimating the Areas of Ground Water and Surface Water Exposure During the...

Code of Federal Regulations, 2012 CFR

2012-10-01

... the initial mixing distance, is estimated by: Cp=25(Wi)/(T0.7 Q) where Cp is the peak concentration... equation: Tp=9.25×106 Wi/(QCp) where Tp is the time estimate, in hours, and Wi, Cp, and Q are defined above... downstream location, past the initial mixing distance, is estimated by: Cp=C(q)/(Q+ where Cp and Q are...

43 CFR Appendix I to Part 11 - Methods for Estimating the Areas of Ground Water and Surface Water Exposure During the...

Code of Federal Regulations, 2013 CFR

2013-10-01

... the initial mixing distance, is estimated by: Cp=25(Wi)/(T0.7 Q) where Cp is the peak concentration... equation: Tp=9.25×106 Wi/(QCp) where Tp is the time estimate, in hours, and Wi, Cp, and Q are defined above... downstream location, past the initial mixing distance, is estimated by: Cp=C(q)/(Q+ where Cp and Q are...

43 CFR Appendix I to Part 11 - Methods for Estimating the Areas of Ground Water and Surface Water Exposure During the...

Code of Federal Regulations, 2011 CFR

2011-10-01

... the initial mixing distance, is estimated by: Cp=25(Wi)/(T0.7 Q) where Cp is the peak concentration... equation: Tp=9.25×106 Wi/(QCp) where Tp is the time estimate, in hours, and Wi, Cp, and Q are defined above... downstream location, past the initial mixing distance, is estimated by: Cp=C(q)/(Q+ where Cp and Q are...

43 CFR Appendix I to Part 11 - Methods for Estimating the Areas of Ground Water and Surface Water Exposure During the...

Code of Federal Regulations, 2014 CFR

2014-10-01

... the initial mixing distance, is estimated by: Cp=25(Wi)/(T0.7 Q) where Cp is the peak concentration... equation: Tp=9.25×106 Wi/(QCp) where Tp is the time estimate, in hours, and Wi, Cp, and Q are defined above... downstream location, past the initial mixing distance, is estimated by: Cp=C(q)/(Q+ where Cp and Q are...

Ultrasonic green synthesis of an Ag/CP nanocomposite for enhanced photodegradation effectiveness.

PubMed

Chang, Hai Ning; Hou, Suo Xia; Hao, Zeng Chuan; Cui, Guang Hua

2018-01-01

A nanoparticle of cobalt(II) coordination polymer (CP), [Co(L)(npht)] n (1) (H 2 npht=4-nitrophthalic acid, L=1,3-bis(5,6-dimethylbenzimidazol-1-ylmethyl)benzene) and its nanocomposite (Ag/CP 1) were obtained by the sonochemical approach and characterized by IR, elemental analysis, thermogravimetric analyses (TGA), scanning electron microscopy (SEM), transmission electron microscopy (TEM), X-ray photoelectron spectroscopy (XPS), and X-ray powder diffraction (XRPD). CP 1 shows a 1D double chain containing two different helical chains, which is further extended into a two-dimensional supramolecular framework by C-H⋯O hydrogen bonding interactions. The photoluminescence properties and photocatalytic properties of the nanoparticles of CP 1 and Ag/CP 1 on the degradation of methylene blue (MB) were investigated, Ag/CP 1 exhibited excellent photocatalytic activity under UV and visible light, which can be attributed to the strong interactions between Ag nanorods and CP 1, which lead to electron-hole pair separation between Ag nanorods and CP 1. In addition, the photocatalytic mechanism is also carried out by introducing t-butyl alcohol (TBA) as a widely used ·OH scavenger. The influence of ultrasound irradiation time and power on the morphology and size of the nanostructure CP 1 were studied. The results indicated that a decrease in time and an increase in power led to a decrease of particle size. Copyright © 2017 Elsevier B.V. All rights reserved.

Expression of Leptin and Visfatin in Gingival Tissues of Chronic Periodontitis With and Without Type 2 Diabetes Mellitus: A Study Using Enzyme-Linked Immunosorbent Assay and Real-Time Polymerase Chain Reaction.

PubMed

Ghallab, Noha A; Amr, Eman M; Shaker, Olfat G

2015-07-01

The aim of this study is to investigate the protein and gene expression of leptin and visfatin in gingival tissue from patients with chronic periodontitis (CP), patients with CP and type 2 diabetes mellitus (T2DM), and healthy individuals. The study includes 50 individuals: 10 healthy individuals, 20 patients with CP, and 20 patients with CP and T2DM. Plaque index, gingival index, probing depth, and clinical attachment loss were measured, and gingival biopsies were obtained. Leptin and visfatin protein expression in gingival tissues was determined using enzyme-linked immunosorbent assay, and messenger RNA (mRNA) expression was measured via real-time polymerase chain reaction. The highest leptin mRNA and protein expression was observed in the control group and was significantly (P ≤0.05) different from the CP and CP+T2DM groups. Gingival tissues from patients with CP and T2DM had a significant increase in visfatin and a decrease in leptin gene and protein expression (P <0.05) compared with both controls and patients with CP. Expression of leptin and visfatin in the gingival tissues suggests a possible role for these adipokines in the pathogenesis of CP and T2DM.

Modeling of threonine requirement in fast-growing chickens, depending on age, sex, protein deposition, and dietary threonine efficiency.

PubMed

Samadi; Liebert, F

2006-11-01

In addition to dose-response studies, modeling of N utilization, depending on intake of the first limiting amino acid in the diet, is one of the tools for assessing amino acid requirements in growing animals. Based on a verified nonlinear N-utilization model and following the principles of the diet dilution technique, N-balance experiments were conducted to estimate the Thr requirement of fast-growing chickens (genotype Cobb), depending on age, sex, CP deposition. and efficiency of dietary Thr utilization. Different predictions were made for the feed intake to conclude the optimal Thr concentration in the feed. The results are based on N-balance experiments with a total of 144 male and 144 female growing chickens within 4 age periods (I: 10 to 25 d; II: 30 to 45 d; III: 50 to 65 d; IV: 70 to 85 d), using diets with graded protein supply (6.6, 13, 19.6, 25.1, 31.8, and 37.6% CP in DM) from high-protein soybean meal with a constant amino acid ratio and Thr as the first limiting amino acid (3.87 g of Thr/100 g of CP; dietary Lys:Thr = 1:0.54). The observed optimal Thr concentration (% of feed) was influenced by age, sex, level of CP deposition, dietary efficiency of Thr utilization, and predicted feed intake. For male chickens, assuming an average CP deposition (60% of the potential) and average efficiency of Thr utilization, 0.78% (10 to 25 d), 0.73% (30 to 45 d), 0.65% (50 to 65 d), and 0.55% (70 to 85 d) total dietary Thr were observed as optimal total Thr concentration in the diet (corresponding to 60, 135, 160, and 180 g of daily feed intake, respectively). Data are discussed in context with the main factors of influence like age, sex, level of daily CP deposition, efficiency of dietary Thr utilization, and predicted feed intake.

50 CFR 679.5 - Recordkeeping and reporting (R&R).

Code of Federal Regulations, 2012 CFR

2012-10-01

... ... Logsheets found in these logbooks CV lgl/pot CV trw CP lgl/pot CP trw MS Submit to ... Time limit (1) White... vessel's catch is off-loaded Note: CP = catcher/processor; CV = catcher vessel; lgl = longline; trw...

50 CFR 679.5 - Recordkeeping and reporting (R&R).

Code of Federal Regulations, 2010 CFR

2010-10-01

... ... Logsheets found in these logbooks CV lgl/pot CV trw CP lgl/pot CP trw MS Submit to ... Time limit (1) White... vessel's catch is off-loaded Note: CP = catcher/processor; CV = catcher vessel; lgl = longline; trw...

50 CFR 679.5 - Recordkeeping and reporting (R&R).

Code of Federal Regulations, 2011 CFR

2011-10-01

... ... Logsheets found in these logbooks CV lgl/pot CV trw CP lgl/pot CP trw MS Submit to ... Time limit (1) White... vessel's catch is off-loaded Note: CP = catcher/processor; CV = catcher vessel; lgl = longline; trw...

A Matter of Low Self-Control? Exploring Differences Between Child Pornography Possessors and Child Pornography Producers/Distributers Using Self-Control Theory.

PubMed

Clevenger, Shelly L; Navarro, Jordana N; Jasinski, Jana L

2016-09-01

This study examined the demographic and background characteristic differences between those arrested for child pornography (CP) possession (only), or CP production/distribution, or an attempted or completed sexual exploitation of a minor (SEM) that involved the Internet in some capacity within the context of self-control theory using data from the second wave of the National Juvenile Online Victimization Study (N-JOV2). Results indicate few demographic similarities, which thereby suggest these are largely heterogeneous groupings of individuals. Results also indicate CP producers/distributers engaged in a greater number of behaviors indicative of low self-control compared with CP possessors. Specifically, offenders arrested for CP production/distribution were more likely to have (a) had problems with drugs/alcohol at the time of the crime and (b) been previously violent. In contrast, the only indicator of low self-control that reached statistical significance for CP possessors was the previous use of violence. Moreover, in contrast to CP producers/distributers, full-time employment and marital status may be important factors to consider in the likelihood of arrest for CP possessors, which is congruent with the tenets of self-control theory. © The Author(s) 2014.

Treatment of BG-1 Ovarian Cancer Cells Expressing Estrogen Receptors with Lambda-cyhalothrin and Cypermethrin Caused a Partial Estrogenicity Via an Estrogen Receptor-dependent Pathway

PubMed Central

Kim, Cho-Won; Go, Ryeo-Eun

2015-01-01

Synthetic pyrethroids (SPs) are the most common pesticides which are recently used for indoor pest control. The widespread use of SPs has resulted in the increased exposure to wild animals and humans. Recently, some SPs are suspected as endocrine disrupting chemicals (EDCs) and have been assessed for their potential estrogenicity by adopting various analyzing assays. In this study, we examined the estrogenic effects of lambda-cyhalothrin (LC) and cypermethrin (CP), the most commonly used pesticides in Korea, using BG-1 ovarian cancer cells expressing estrogen receptors (ERs). To evaluate the estrogenic activities of two SPs, LC and CP, we employed MTT assay and reverse-transcription polymerase chain reaction (RT-PCR) in LC or CP treated BG-1 ovarian cancer cells. In MTT assay, LC (10−6 M) and CP (10−5 M) significantly induced the growth of BG-1 cancer cells. LC or CP-induced cell growth was antagonized by addition of ICI 182,720 (10−8 M), an ER antagonist, suggesting that this effect appears to be mediated by an ER-dependent manner. Moreover, RT-PCR results showed that transcriptional level of cyclin D1, a cell cycle-regulating gene, was significantly up-regulated by LC and CP, while these effects were reversed by co-treatment of ICI 182,780. However, p21, a cyclin D-ckd-4 inhibitor gene, was not altered by LC or CP. Moreover, ERα expression was not significantly changed by LC and CP, while downregulated by E2. Finally, in xenografted mouse model transplanted with human BG-1 ovarian cancer cells, E2 significantly increased the tumor volume compare to a negative control, but LC did not. Taken together, these results suggest that LC and CP may possess estrogenic potentials by stimulating the growth of BG-1 ovarian cancer cells via partially ER signaling pathway associated with cell cycle as did E2, but this estrogenic effect was not found in in vivo mouse model. PMID:26877835

Para-psychobiotic Lactobacillus gasseri CP2305 ameliorates stress-related symptoms and sleep quality.

PubMed

Nishida, K; Sawada, D; Kawai, T; Kuwano, Y; Fujiwara, S; Rokutan, K

2017-12-01

To confirm the stress-relieving effects of heat-inactivated, enteric-colonizing Lactobacillus gasseri CP2305 (paraprobiotic CP2305) in medical students taking a cadaver dissection course. Healthy students (21 males and 11 females) took paraprobiotic CP2305 daily for 5 weeks during a cadaver dissection course. The General Health Questionnaire and the Pittsburgh Sleep Quality Index were employed to assess stress-related somatic symptoms and sleep quality respectively. The aggravation of stress-associated somatic symptoms was observed in female students (P = 0·029). Sleep quality was improved in the paraprobiotic CP2305 group (P = 0·038), particularly in men (P = 0·004). Among men, paraprobiotic CP2305 shortened sleep latency (P = 0·035) and increased sleep duration (P = 0·048). Diarrhoea-like symptoms were also effectively controlled with CP2305 (P = 0·005) in men. Thus, we observed sex-related differences in the effects of paraprobiotic CP2305. In addition, CP2305 affected the growth of faecal Bacteroides vulgatus and Dorea longicatena, which are involved in intestinal inflammation. CP2305 is a potential paraprobiotic that regulates stress responses, and its beneficial effects may depend on specific cell component(s). This study characterizes the effects of a stress-relieving para-psychobiotic in humans. © 2017 The Authors. Journal of Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

Putrescine-Dependent Re-Localization of TvCP39, a Cysteine Proteinase Involved in Trichomonas vaginalis Cytotoxicity

PubMed Central

Carvajal-Gamez, Bertha Isabel; Quintas-Granados, Laura Itzel; Arroyo, Rossana; Vázquez-Carrillo, Laura Isabel; Ramón-Luing, Lucero De los Angeles; Carrillo-Tapia, Eduardo; Alvarez-Sánchez, María Elizbeth

2014-01-01

Polyamines are involved in the regulation of some Trichomonas vaginalis virulence factors such as the transcript, proteolytic activity, and cytotoxicity of TvCP65, a cysteine proteinase (CP) involved in the trichomonal cytotoxicity. In this work, we reported the putrescine effect on TvCP39, other CP that also participate in the trichomonal cytotoxicity. Parasites treated with 1,4-diamino-2-butanone (DAB) (an inhibitor of putrescine biosynthesis), diminished the amount and proteolytic activity of TvCP39 as compared with untreated parasites. Inhibition of putrescine biosynthesis also reduced ∼80% the tvcp39 mRNA levels according to RT-PCR and qRT-PCR assays. Additionally, actinomycin D-treatment showed that the tvcp39 mRNA half-life decreased in the absence of putrescine. However, this reduction was restored by exogenous putrescine addition, suggesting that putrescine is necessary for tvcp39 mRNA stability. TvCP39 was localized in the cytoplasm but, in DAB treated parasites transferred into exogenous putrescine culture media, TvCP39 was re-localized to the nucleus and nuclear periphery of trichomonads. Interestingly, the amount and proteolytic activity of TvCP39 was recovered as well as the tvcp39 mRNA levels were restored when putrescine exogenous was added to the DAB-treated parasites. In conclusion, our data show that putrescine regulate the TvCP39 expression, protein amount, proteolytic activity, and cellular localization. PMID:25251406

Effects of acute and repeated dosing of the synthetic cannabinoid CP55,940 on intracranial self-stimulation in mice*

PubMed Central

Grim, Travis W.; Wiebelhaus, Jason M.; Negus, S. Stevens; Lichtman, Aron H.

2015-01-01

Background Synthetic cannabinoids have emerged as a significant public health concern. To increase the knowledge of how these molecules interact on brain reward processes, we investigated the effects of CP55,940, a high efficacy synthetic CB1 receptor agonist, in a frequency-rate intracranial self-stimulation (ICSS) procedure. Methods The impact of acute and repeated administration (seven days) of CP55,940 on operant responding for electrical brain stimulation of the medial forebrain bundle was investigated in C57BL/6J mice. Results CP55,940 attenuated ICSS in a dose-related fashion (ED50 (95% C.L.) = 0.15 (0.12–0.18) mg/kg). This effect was blocked by the CB1 receptor antagonist rimonabant. Tolerance developed quickly, though not completely, to the rate-decreasing effects of CP55,940 (0.3 mg/kg). Abrupt discontinuation of drug did not alter baseline responding for up to seven days. Moreover, rimonabant (10 mg/kg) challenge did not alter ICSS responding in mice treated repeatedly with CP55,940. Conclusions The finding that CP55,940 reduced ICSS in mice with no evidence of facilitation at any dose is consistent with synthetic cannabinoid effects on ICSS in rats. CP55,940-induced ICSS depression was mediated through a CB1 receptor mechanism. Additionally, tolerance and dependence following repeated CP55,940 administration were dissociable. Thus, CP55,940 does not produce reward-like effects in ICSS under these conditions. PMID:25772438

Molecular characterization of the NADPH oxidase complex in the ergot fungus Claviceps purpurea: CpNox2 and CpPls1 are important for a balanced host-pathogen interaction.

PubMed

Schürmann, Janine; Buttermann, Dagmar; Herrmann, Andrea; Giesbert, Sabine; Tudzynski, Paul

2013-10-01

Reactive oxygen species producing NADPH oxidase (Nox) complexes are involved in defense reactions in animals and plants while they trigger infection-related processes in pathogenic fungi. Knowledge about the composition and localization of these complexes in fungi is limited; potential components identified thus far include two to three catalytical subunits, a regulatory subunit (NoxR), the GTPase Rac, the scaffold protein Bem1, and a tetraspanin-like membrane protein (Pls1). We showed that, in the biotrophic grass-pathogen Claviceps purpurea, the catalytical subunit CpNox1 is important for infection. Here, we present identification of major Nox complex partners and a functional analysis of CpNox2 and the tetraspanin CpPls1. We show that, as in other fungi, Nox complexes are important for formation of sclerotia; CpRac is, indeed, a complex partner because it interacts with CpNoxR, and CpNox1/2 and CpPls1 are associated with the endoplasmatic reticulum. However, unlike in all other fungi, Δcppls1 is more similar to Δcpnox1 than to Δcpnox2, and CpNox2 is not essential for infection. In contrast, Δcpnox2 shows even more pronounced disease symptoms, indicating that Cpnox2 controls the infection process and moderates damage to the host. These data confirm that fungal Nox complexes have acquired specific functions dependent of the lifestyle of the pathogen.

Solute concentration at a well in non-Gaussian aquifers under constant and time-varying pumping schedule

NASA Astrophysics Data System (ADS)

Libera, Arianna; de Barros, Felipe P. J.; Riva, Monica; Guadagnini, Alberto

2017-10-01

Our study is keyed to the analysis of the interplay between engineering factors (i.e., transient pumping rates versus less realistic but commonly analyzed uniform extraction rates) and the heterogeneous structure of the aquifer (as expressed by the probability distribution characterizing transmissivity) on contaminant transport. We explore the joint influence of diverse (a) groundwater pumping schedules (constant and variable in time) and (b) representations of the stochastic heterogeneous transmissivity (T) field on temporal histories of solute concentrations observed at an extraction well. The stochastic nature of T is rendered by modeling its natural logarithm, Y = ln T, through a typical Gaussian representation and the recently introduced Generalized sub-Gaussian (GSG) model. The latter has the unique property to embed scale-dependent non-Gaussian features of the main statistics of Y and its (spatial) increments, which have been documented in a variety of studies. We rely on numerical Monte Carlo simulations and compute the temporal evolution at the well of low order moments of the solute concentration (C), as well as statistics of the peak concentration (Cp), identified as the environmental performance metric of interest in this study. We show that the pumping schedule strongly affects the pattern of the temporal evolution of the first two statistical moments of C, regardless the nature (Gaussian or non-Gaussian) of the underlying Y field, whereas the latter quantitatively influences their magnitude. Our results show that uncertainty associated with C and Cp estimates is larger when operating under a transient extraction scheme than under the action of a uniform withdrawal schedule. The probability density function (PDF) of Cp displays a long positive tail in the presence of time-varying pumping schedule. All these aspects are magnified in the presence of non-Gaussian Y fields. Additionally, the PDF of Cp displays a bimodal shape for all types of pumping schemes analyzed, independent of the type of heterogeneity considered.

C-Phycocyanin Confers Protection against Oxalate-Mediated Oxidative Stress and Mitochondrial Dysfunctions in MDCK Cells

PubMed Central

Farooq, Shukkur M.; Boppana, Nithin B.; Asokan, Devarajan; Sekaran, Shamala D.; Shankar, Esaki M.; Li, Chunying; Gopal, Kaliappan; Bakar, Sazaly A.; Karthik, Harve S.; Ebrahim, Abdul S.

2014-01-01

Oxalate toxicity is mediated through generation of reactive oxygen species (ROS) via a process that is partly dependent on mitochondrial dysfunction. Here, we investigated whether C-phycocyanin (CP) could protect against oxidative stress-mediated intracellular damage triggered by oxalate in MDCK cells. DCFDA, a fluorescence-based probe and hexanoyl-lysine adduct (HEL), an oxidative stress marker were used to investigate the effect of CP on oxalate-induced ROS production and membrane lipid peroxidation (LPO). The role of CP against oxalate-induced oxidative stress was studied by the evaluation of mitochondrial membrane potential by JC1 fluorescein staining, quantification of ATP synthesis and stress-induced MAP kinases (JNK/SAPK and ERK1/2). Our results revealed that oxalate-induced cells show markedly increased ROS levels and HEL protein expression that were significantly decreased following pre-treatment with CP. Further, JC1 staining showed that CP pre-treatment conferred significant protection from mitochondrial membrane permeability and increased ATP production in CP-treated cells than oxalate-alone-treated cells. In addition, CP treated cells significantly decreased the expression of phosphorylated JNK/SAPK and ERK1/2 as compared to oxalate-alone-treated cells. We concluded that CP could be used as a potential free radical-scavenging therapeutic strategy against oxidative stress-associated diseases including urolithiasis. PMID:24691130

A measurement of the CP asymmetry difference between Λ c + → pK - K + and pπ-π+ decays

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Alfonso Albero, A.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Atzeni, M.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L. J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M. O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bizzeti, A.; Bjørn, M.; Blake, T.; Blanc, F.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bordyuzhin, I.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M. G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S. F.; Chitic, S.-G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Da Silva, C. L.; Dall'Occo, E.; Dalseno, J.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Del Buono, L.; Dembinski, H.-P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Durham, J. M.; Dutta, D.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Ferguson, D.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Lopes, L.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fontana, M.; Fontanelli, F.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Furfaro, E.; Färber, C.; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabowski, J. P.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hancock, T. H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hopchev, P. H.; Hu, W.; Huang, W.; Huard, Z. C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Ibis, P.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kazeev, N.; Kecke, M.; Keizer, F.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Kopecna, R.; Koppenburg, P.; Kosmyntseva, A.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Kress, F.; Krokovny, P.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.-R.; Li, T.; Li, Y.; Li, Z.; Liang, X.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M. W.; Malde, S.; Malecki, B.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J. V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Millard, E.; Minard, M.-N.; Minzoni, L.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Nogay, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Ossowska, A.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Pereima, D.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pietrzyk, G.; Pikies, M.; Pinci, D.; Pisani, F.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Polci, F.; Poli Lener, M.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Qin, J.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Robbe, P.; Robert, A.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Ruiz Vidal, J.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H. F.; Schubiger, M.; Schune, M. H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E. S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, I. T.; Smith, J.; Smith, M.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M. E.; Straticiuc, M.; Straumann, U.; Sun, J.; Sun, L.; Swientek, K.; Syropoulos, V.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Tourinho Jadallah Aoude, R.; Tournefier, E.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T. A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Walsh, J.; Wang, J.; Wang, Y.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Weisser, C.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wyllie, K.; Xie, Y.; Xu, M.; Xu, Q.; Xu, Z.; Xu, Z.; Yang, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J. B.; Zucchelli, S.

2018-03-01

The difference between the CP asymmetries in the decays Λ c + → pK - K + and Λ c + → pπ - π + is presented. Proton-proton collision data taken at centre-of-mass energies of 7 and 8 TeV collected by the LHCb detector in 2011 and 2012 are used, corresponding to an integrated luminosity of 3 fb-1. The Λ c + candidates are reconstructed as part of the Λ b 0 → Λ c + μ - X decay chain. In order to maximize the cancellation of production and detection asymmetries in the difference, the final-state kinematic distributions of the two samples are aligned by applying phase-space-dependent weights to the Λ c + → pπ - π + sample. This alters the definition of the integrated CP asymmetry to A CP wgt ( pπ - π +). Both samples are corrected for reconstruction and selection efficiencies across the five-dimensional Λ c + decay phase space. The difference in CP asymmetries is found to be Δ {A}_{CP}^{wgt}={A}_{CP}(p{K}-{K}+) - {A}_{CP}^{wgt}(p{π}-{π}+) = (0.30 ± 0.91 ± 0.61) %, where the first uncertainty is statistical and the second is systematic.

Molecular structures and excited states of CpM(CO)(2) (Cp = eta(5)-C(5)H(5); M = Rh, Ir) and [Cl(2)Rh(CO)(2)](-). Theoretical evidence for a competitive charge transfer mechanism.

PubMed

Hu, Zhenming; Boyd, Russell J; Nakatsuji, Hiroshi

2002-03-20

Molecular structures and excited states of CpM(CO)(2) (Cp = eta(5)-C(5)H(5); M = Rh, Ir) and [Cl(2)Rh(CO)(2)](-) complexes have been investigated using the B3LYP and the symmetry-adapted cluster (SAC)/SAC-configuration interaction (SAC-CI) theoretical methods. All the dicarbonyl complexes have singlet ground electronic states with large singlet-triplet separations. Thermal dissociations of CO from the parent dicarbonyls are energetically unfavorable. CO thermal dissociation is an activation process for [Cl(2)Rh(CO)(2)](-) while it is a repulsive potential for CpM(CO)(2). The natures of the main excited states of CpM(CO)(2) and [Cl(2)Rh(CO)(2)](-) are found to be quite different. For [Cl(2)Rh(CO)(2)](-), all the strong transitions are identified to be metal to ligand CO charge transfer (MLCT) excitations. A significant feature of the excited states of CpM(CO)(2) is that both MLCT excitation and a ligand Cp to metal and CO charge transfer excitation are strongly mixed in the higher energy states with the latter having the largest oscillator strength. A competitive charge transfer excited state has therefore been identified theoretically for CpRh(CO)(2) and CpIr(CO)(2). The wavelength dependence of the quantum efficiencies for the photoreactions of CpM(CO)(2) reported by Lees et al. can be explained by the existence of two different types of excited states. The origin of the low quantum efficiencies for the C-H/S-H bond activations of CpM(CO)(2) can be attributed to the smaller proportion of the MLCT excitation in the higher energy states.

A nuclear fraction of turnip crinkle virus capsid protein is important for elicitation of the host resistance response.

PubMed

Kang, Sung-Hwan; Qu, Feng; Morris, T Jack

2015-12-02

The N-terminal 25 amino acids (AAs) of turnip crinkle virus (TCV) capsid protein (CP) are recognized by the resistance protein HRT to trigger a hypersensitive response (HR) and systemic resistance to TCV infection. This same region of TCV CP also contains a motif that interacts with the transcription factor TIP, as well as a nuclear localization signal (NLS). However, it is not yet known whether nuclear localization of TCV CP is needed for the induction of HRT-mediated HR and resistance. Here we present new evidence suggesting a tight correlation between nuclear inclusions formed by CP and the manifestation of HR. We show that a fraction of TCV CP localized to cell nuclei to form discrete inclusion-like structures, and a mutated CP (R6A) known to abolish HR failed to form nuclear inclusions. Notably, TIP-CP interaction augments the inclusion-forming activity of CP by tethering inclusions to the nuclear membrane. This TIP-mediated augmentation is also critical for HR resistance, as another CP mutant (R8A) known to elicit a less restrictive HR, though still self-associated into nuclear inclusions, failed to direct inclusions to the nuclear membrane due to its inability to interact with TIP. Finally, exclusion of CP from cell nuclei abolished induction of HR. Together, these results uncovered a strong correlation between nuclear localization and nuclear inclusion formation by TCV CP and induction of HR, and suggest that CP nuclear inclusions could be the key trigger of the HRT-dependent, yet TIP-reinforced, resistance to TCV. Copyright © 2015 Elsevier B.V. All rights reserved.

Biological sex and the risk of cerebral palsy in Victoria, Australia.

PubMed

Reid, Susan M; Meehan, Elaine; Gibson, Catherine S; Scott, Heather; Delacy, Michael J

2016-02-01

Males typically outnumber females in cerebral palsy (CP) cohorts. To better understand this 'male disadvantage' and provide insight into causal pathways to CP, this study used 1983 to 2009 Australian CP and population birth cohorts to identify associations and trends with respect to biological sex and CP. Within birth gestation groups, sex ratios were calculated to evaluate any male excess in the CP cohort compared with livebirths, neonatal deaths, neonatal mortality and survival rates, neonatal survivors, and CP rates in survivors. Sex- and gestation-specific trends in neonatal mortality, CP rates, and CP sex ratios were assessed by plotting their annual frequencies and fitting quadratic curves. Over-representation of males in preterm live births partly explained the male excess in the CP cohort after preterm birth, especially at 28 to 31 weeks. Higher CP rates in male neonatal survivors also contributed to the male excess in CP, particularly at <28 and 37+ weeks. Higher neonatal mortality rates in males at all gestations had little impact on the CP sex ratio. There was no clearly discernible change over time in the CP sex ratio. Gestation-specific associations between sex and CP provide insight into causal pathways to CP and suggest sex-specific differences in response to neuroprotective strategies. © 2016 The Authors. Developmental Medicine & Child Neurology © 2016 Mac Keith Press.

Origin of the F685 and F695 fluorescence in photosystem II.

PubMed

Andrizhiyevskaya, Elena G; Chojnicka, Agnieszka; Bautista, James A; Diner, Bruce A; van Grondelle, Rienk; Dekker, Jan P

2005-06-01

The emission spectra of CP47-RC and core complexes of Photosystem II (PS II) were measured at different temperatures and excitation wavelengths in order to establish the origin of the emission and the role of the core antenna in the energy transfer and charge separation processes in PS II. Both types of particles reveal strong dependences of spectral shape and yield on temperature. The results indicate that the well-known F-695 emission at 77 K arises from excitations that are trapped on a red-absorbing CP47 chlorophyll, whereas the F-685 nm emission at 77 K arises from excitations that are transferred slowly from 683 nm states in CP47 and CP43 to the RC, where they are trapped by charge separation. We conclude that F-695 at 77 K originates from the low-energy part of the inhomogeneous distribution of the 690 nm absorbing chlorophyll of CP47, while at 4 K the fluorescence originates from the complete distribution of the 690 nm chlorophyll of CP47 and from the low-energy part of the inhomogeneous distribution of one or more CP43 chlorophylls.

Immunization against leishmaniasis by PLGA nanospheres encapsulated with autoclaved Leishmania major (ALM) and CpG-ODN.

PubMed

Tafaghodi, Mohsen; Khamesipour, Ali; Jaafari, Mahmoud R

2011-05-01

Various adjuvants and delivery systems have been evaluated for increasing the protective immune responses against leishmaniasis and mostly have been shown not to be effective enough. In this study, poly(D,L-lactide-co-glycolide) (PLGA) nanospheres as an antigen delivery system and CpG-ODN as an immunoadjuvant have been used for the first time to enhance the immune response against autoclaved Leishmania major (ALM). PLGA nanospheres were prepared by a double-emulsion (W/O/W) technique. Particulate characteristics were studied by scanning electron microscopy and particle size analysis. Mean diameter of ALM + CpG-ODN-loaded nanospheres was 300 ± 128 nm. BALB/c mice were immunized three times in 3-week intervals using ALM plus CpG-ODN-loaded nanospheres [(ALM + CpG-ODN)(PLGA)], ALM encapsulated PLGA nanospheres [(ALM)(PLGA)], (ALM)(PLGA) + CpG, ALM + CpG, ALM alone, or phosphate buffer solution (PBS). The intensity of infection induced by L. major challenge was assessed by measuring size of footpad swelling. The strongest protection, showed by significantly (P<0.05) smaller footpad, was observed in mice immunized with (ALM + CpG-ODN)(PLGA). The (ALM)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG were also showed a significantly (P<0.05) smaller footpad swelling compared to the groups received either PBS or ALM alone. The mice immunized with (ALM + CpG-ODN)(PLGA), (ALM)(PLGA) + CpG, and ALM + CpG showed the highest IgG2a/IgG1 ratio, interferon-γ production, and lowest interleukin-4 production compared to the other groups. It is concluded that when both PLGA nanospheres and CpG-ODN adjuvants were used simultaneously, it induce stronger immune response and enhance protection rate against Leishmania infection.

Encapsulation efficacy of natural and synthetic photosensitizers by silica nanoparticles for photodynamic applications.

PubMed

Makhadmeh, Ghaseb Naser; Abdul Aziz, Azlan; Abdul Razak, Khairunisak; Abu Noqta, Osama

2015-12-01

This study analysed the physical effects of Cichorium Pumilum (CP), as a natural photosensitizer (PS), and Protoporphyrin IX (PpIX), as a synthetic PS, encapsulated with silica nanoparticles (SiNPs) in photodynamic therapy. The optimum concentrations of CP and PpIX, needed to destroy Red Blood Cells (RBC), were determined and the efficacy of encapsulated CP and PpIX were compared with naked CP and PpIX was verified. The results confirmed the applicability of CP and PpIX encapsulated in SiNPs on RBCs, and established a relationship between the encapsulated CP and PpIX concentration and the time required to rupture 50% of the RBCs (t50). The CP and PpIX encapsulated in SiNPs exhibited higher efficacy compared with that of naked CP and PpIX, respectively, and CP had less efficacy compared with PpIX.

Dehydrogenation, disproportionation and transfer hydrogenation reactions of formic acid catalyzed by molybdenum hydride compounds.

PubMed

Neary, Michelle C; Parkin, Gerard

2015-03-01

The cyclopentadienyl molybdenum hydride compounds, Cp R Mo(PMe 3 ) 3- x (CO) x H (Cp R = Cp, Cp*; x = 0, 1, 2 or 3), are catalysts for the dehydrogenation of formic acid, with the most active catalysts having the composition Cp R Mo(PMe 3 ) 2 (CO)H. The mechanism of the catalytic cycle is proposed to involve (i) protonation of the molybdenum hydride complex, (ii) elimination of H 2 and coordination of formate, and (iii) decarboxylation of the formate ligand to regenerate the hydride species. NMR spectroscopy indicates that the nature of the resting state depends on the composition of the catalyst. For example, (i) the resting states for the CpMo(CO) 3 H and CpMo(PMe 3 )(CO) 2 H systems are the hydride complexes themselves, (ii) the resting state for the CpMo(PMe 3 ) 3 H system is the protonated species [CpMo(PMe 3 ) 3 H 2 ] + , and (iii) the resting state for the CpMo(PMe 3 ) 2 (CO)H system is the formate complex, CpMo(PMe 3 ) 2 (CO)(κ 1 -O 2 CH), in the presence of a high concentration of formic acid, but CpMo(PMe 3 ) 2 (CO)H when the concentration of acid is low. While CO 2 and H 2 are the principal products of the catalytic reaction induced by Cp R Mo(PMe 3 ) 3- x (CO) x H, methanol and methyl formate are also observed. The generation of methanol is a consequence of disproportionation of formic acid, while methyl formate is a product of subsequent esterification. The disproportionation of formic acid is a manifestation of a transfer hydrogenation reaction, which may also be applied to the reduction of aldehydes and ketones. Thus, CpMo(CO) 3 H also catalyzes the reduction of a variety of ketones and aldehydes to alcohols by formic acid, via a mechanism that involves ionic hydrogenation.

Ruminally undegradable protein content and digestibility for forages using the mobile bag in situ technique.

PubMed

Buckner, C D; Klopfenstein, T J; Rolfe, K M; Griffin, W A; Lamothe, M J; Watson, A K; MacDonald, J C; Schacht, W H; Schroeder, P

2013-06-01

Four experiments were conducted to evaluate RUP content and digestibility for smooth bromegrass, subirrigated meadow, upland native range, and warm-season grasses. Samples were collected from esophageally cannulated cows or ruminally cannulated steers. Forages were ruminally incubated in in situ bags for durations of time based on 75% of total mean retention time, which was based on IVDMD and rate of passage calculations. One-half of the bags were duodenally incubated and excreted in the feces, and NDIN was analyzed on all bags for RUP calculations. Crude protein was numerically greater early in the growing cycle for grasses compared with later as grasses matured (P ≤ 0.32). The RUP was 13.3%, 13.3%, and 19.7% of CP for smooth bromegrass, subirrigated meadow, and upland native range, respectively. These values tended to be lower early in the growth cycle and increased (linear P ≤ 0.13) as forages matured for warm-season grasses and subirrigated meadows. Because both CP and RUP content change throughout the growing season, expressing RUP as a percentage of DM gives more consistent averages compared with RUP as a percentage of CP. Coefficient of variation values for RUP as a percentage of DM averaged 0.21 over all 4 experiments compared with 0.26 for RUP as a percentage of CP. Average RUP as a percentage of DM was 2.03%, 1.53%, and 1.94% for smooth bromegrass, subirrigated meadow, and upland native range, respectively. Total tract indigestible protein (TTIDP) linearly increased with maturity for subirrigated meadow samples (P < 0.01). A quadratic response (P ≤ 0.06) for TTIDP was observed in smooth bromegrass and warm-season grass samples. Digestibility of RUP varied considerably, ranging from 25% to 60%. Subirrigated meadow, native range, and smooth bromegrass samples tended to have linear decreases (P ≤ 0.11) in RUP digestibility throughout the growing season. The amount of digested RUP was fairly consistent across experiments and averages for smooth bromegrass, subirrigated meadow, and upland native range were 0.92%, 0.64%, and 0.49% of DM, respectively. Warm-season grasses in Exp. 2 had greater RUP (4.31% of DM) and amount of RUP digested (2.26% of DM), possibly because of cattle selecting for leadplant that contains more CP than the grasses. Forages can vary in CP, RUP, TTIDP, and RUP digestibility depending on the forage type, year, and time within year, but RUP digestibility is likely less than what previous sources have reported.

Plastic and locally adapted phenology in cambial seasonality and production of xylem and phloem cells in Picea abies from temperate environments.

PubMed

Gričar, Jožica; Prislan, Peter; Gryc, Vladimír; Vavrčík, Hanuš; de Luis, Martin; Cufar, Katarina

2014-08-01

Despite its major economic importance and the vulnerability of Picea abies (L.) H. Karst. to climate change, how its radial growth at intra-annual resolution is influenced by weather conditions in forest stands with a high production capacity has scarcely been explored. Between 2009 and 2011, phenological variation in seasonal cambial cell production (CP) was analysed in adult P. abies trees from three contrasting sites, differing in altitude and latitude. The results indicate that the timing of cambial CP is a highly synchronic process within populations since in all cases the cambium simultaneously started and stopped producing xylem and phloem cells. Our results also demonstrate that the phenology of cambial CP is highly variable and plastic between years, depending on seasonal temperature and precipitation variation. Differences among sites, however, are only partially explained by different environmental (elevation and altitude) and climatic conditions, suggesting that local adaptation may also play a decisive role in the strategy of P. abies for adapting wood and phloem increments to function optimally under local conditions. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The parental non-equivalence of imprinting control regions during mammalian development and evolution.

PubMed

Schulz, Reiner; Proudhon, Charlotte; Bestor, Timothy H; Woodfine, Kathryn; Lin, Chyuan-Sheng; Lin, Shau-Ping; Prissette, Marine; Oakey, Rebecca J; Bourc'his, Déborah

2010-11-18

In mammals, imprinted gene expression results from the sex-specific methylation of imprinted control regions (ICRs) in the parental germlines. Imprinting is linked to therian reproduction, that is, the placenta and imprinting emerged at roughly the same time and potentially co-evolved. We assessed the transcriptome-wide and ontology effect of maternally versus paternally methylated ICRs at the developmental stage of setting of the chorioallantoic placenta in the mouse (8.5dpc), using two models of imprinting deficiency including completely imprint-free embryos. Paternal and maternal imprints have a similar quantitative impact on the embryonic transcriptome. However, transcriptional effects of maternal ICRs are qualitatively focused on the fetal-maternal interface, while paternal ICRs weakly affect non-convergent biological processes, with little consequence for viability at 8.5dpc. Moreover, genes regulated by maternal ICRs indirectly influence genes regulated by paternal ICRs, while the reverse is not observed. The functional dominance of maternal imprints over early embryonic development is potentially linked to selection pressures favoring methylation-dependent control of maternal over paternal ICRs. We previously hypothesized that the different methylation histories of ICRs in the maternal versus the paternal germlines may have put paternal ICRs under higher mutational pressure to lose CpGs by deamination. Using comparative genomics of 17 extant mammalian species, we show here that, while ICRs in general have been constrained to maintain more CpGs than non-imprinted sequences, the rate of CpG loss at paternal ICRs has indeed been higher than at maternal ICRs during evolution. In fact, maternal ICRs, which have the characteristics of CpG-rich promoters, have gained CpGs compared to non-imprinted CpG-rich promoters. Thus, the numerical and, during early embryonic development, functional dominance of maternal ICRs can be explained as the consequence of two orthogonal evolutionary forces: pressure to tightly regulate genes affecting the fetal-maternal interface and pressure to avoid the mutagenic environment of the paternal germline.

The Parental Non-Equivalence of Imprinting Control Regions during Mammalian Development and Evolution

PubMed Central

Bestor, Timothy H.; Woodfine, Kathryn; Lin, Chyuan-Sheng; Lin, Shau-Ping; Prissette, Marine; Oakey, Rebecca J.; Bourc'his, Déborah

2010-01-01

In mammals, imprinted gene expression results from the sex-specific methylation of imprinted control regions (ICRs) in the parental germlines. Imprinting is linked to therian reproduction, that is, the placenta and imprinting emerged at roughly the same time and potentially co-evolved. We assessed the transcriptome-wide and ontology effect of maternally versus paternally methylated ICRs at the developmental stage of setting of the chorioallantoic placenta in the mouse (8.5dpc), using two models of imprinting deficiency including completely imprint-free embryos. Paternal and maternal imprints have a similar quantitative impact on the embryonic transcriptome. However, transcriptional effects of maternal ICRs are qualitatively focused on the fetal-maternal interface, while paternal ICRs weakly affect non-convergent biological processes, with little consequence for viability at 8.5dpc. Moreover, genes regulated by maternal ICRs indirectly influence genes regulated by paternal ICRs, while the reverse is not observed. The functional dominance of maternal imprints over early embryonic development is potentially linked to selection pressures favoring methylation-dependent control of maternal over paternal ICRs. We previously hypothesized that the different methylation histories of ICRs in the maternal versus the paternal germlines may have put paternal ICRs under higher mutational pressure to lose CpGs by deamination. Using comparative genomics of 17 extant mammalian species, we show here that, while ICRs in general have been constrained to maintain more CpGs than non-imprinted sequences, the rate of CpG loss at paternal ICRs has indeed been higher than at maternal ICRs during evolution. In fact, maternal ICRs, which have the characteristics of CpG-rich promoters, have gained CpGs compared to non-imprinted CpG-rich promoters. Thus, the numerical and, during early embryonic development, functional dominance of maternal ICRs can be explained as the consequence of two orthogonal evolutionary forces: pressure to tightly regulate genes affecting the fetal-maternal interface and pressure to avoid the mutagenic environment of the paternal germline. PMID:21124941

Effect of anomalous tbW vertex on decay-lepton distributions in e+ e-® tt(bar) and CP-violating asymmetries

NASA Astrophysics Data System (ADS)

Rindani, Saurabh D.

2000-06-01

We obtain analytic expressions for the energy and polar-angle double differential distributions of a secondary lepton l+(l-) arising from the decay of t (tbar) in with an anomalous tbW decay vertex. We also obtain analytic expressions for the various differential cross-sections with the lepton energy integrated over. In this case, we find that the angular distributions of the secondary lepton do not depend on the anomalous coupling in the decay, regardless of possible anomalous couplings occurring in the production amplitude for . Our study includes the effect of longitudinal e- and e+ beam polarization. We also study the lepton energy and beam polarization dependence of certain CP-violating lepton angular asymmetries arising from an anomalous tbW decay vertex and compare them with the asymmetries arising due to CP-violation in the production process due to the top electric or weak dipole moment.

Analytical validation of bovine plasma ceruloplasmin measurement by p-phenylenediamine oxidation and effect of storage time and freezing temperature.

PubMed

Hussein, Hussein Awad; Staufenbiel, Rudolf

2017-10-04

Determination of ceruloplasmin (Cp) activity in plasma can provide an objective measure of the health of dairy cows as well as it can be used for various diagnostic purposes. The current study was designed to perform an analytical validation of a method for the determination of plasma Cp activity in dairy cows and to evaluate the influences of plasma storage times and temperatures as well as freeze-thaw cycles on the activity of this enzyme. This cohort was carried out on ten cows. For each cow, 24 aliquots of plasma, which were stored at different temperature regimes, were prepared. Both intra- and interassay coefficients of variation (CVs) were determined. The linearity was evaluated using bovine plasma Cp standard. The mean values of intra- and interassay CVs were 1.08 and 2.12%, respectively. Results of linearity testing showed a high correlation coefficient (r = 0.998, P < 0.001). After 3 days of storage at room temperature and refrigeration, the plasma activity of Cp was significantly lowered (P < 0.05). Plasma samples kept at freezing for 3 months revealed insignificant changes in the activity of Cp. Repeated freeze-thaw cycles for three times had no significant influence on the activity of Cp. The method is easy and may be valid at values of Cp ranging from 100 to 1000 mg/L. It seems that keeping of plasma samples at room temperature and refrigeration longer than 3 days is unsuitable for Cp measurement. In addition, Cp remains stable in plasma samples stored at freezing as well as repeat freeze-thaw cycles.

Cannabinoids increase conditioned ultrasonic vocalisations and cat odour avoidance in rats: strain differences in drug-induced anxiety.

PubMed

Arnold, Jonathon C; Dielenberg, Robert A; McGregor, Iain S

2010-10-23

Genetic disposition modulates the psychoactive effects of cannabis. Cannabinoids have a greater impact on brain regions that subserve anxiety in Wistar compared to Lewis strain rats. Here we aim to show that this correlates with strain differences in cannabinoid-induced anxiety-related behaviour. Lewis and Wistar rats were administered vehicle or the synthetic cannabinoid receptor agonist, CP 55,940 (10, 25 and 50μg/kg) before testing in the conditioned ultrasonic vocalization (USV), cat odour avoidance or open area avoidance models. Animals were placed in a chamber in which they had previously received footshock. Wistar but not Lewis rats re-exposed under the influence of all CP 55,940 doses emitted significantly more USVs than vehicle-treated rats. In the cat odour avoidance model, rats were exposed to cat odour and given the opportunity to hide in a small box. In Wistar but not Lewis rats, 50μg/kg of CP 55,940 magnified hiding behaviour promoted by cat odour exposure. Animals were also tested in the open area avoidance model which occurred in the same arena as the predatory avoidance model but without cat odour. In Wistar, but not Lewis rats, 25 and 50μg/kg of CP 55,940 increased the avoidance of the open space. CP 55,940 increased anxiety-related behaviour in Wistar rats but not Lewis rats providing a model to dissect the genetic basis of cannabinoid-induced anxiety. We show for the first time that cannabinoids magnify conditioned USVs and cat odour avoidance behaviour dependent on the strain being tested. Crown Copyright © 2010. Published by Elsevier Inc. All rights reserved.

Synthetic generation of myocardial blood-oxygen-level-dependent MRI time series via structural sparse decomposition modeling.

PubMed

Rusu, Cristian; Morisi, Rita; Boschetto, Davide; Dharmakumar, Rohan; Tsaftaris, Sotirios A

2014-07-01

This paper aims to identify approaches that generate appropriate synthetic data (computer generated) for cardiac phase-resolved blood-oxygen-level-dependent (CP-BOLD) MRI. CP-BOLD MRI is a new contrast agent- and stress-free approach for examining changes in myocardial oxygenation in response to coronary artery disease. However, since signal intensity changes are subtle, rapid visualization is not possible with the naked eye. Quantifying and visualizing the extent of disease relies on myocardial segmentation and registration to isolate the myocardium and establish temporal correspondences and ischemia detection algorithms to identify temporal differences in BOLD signal intensity patterns. If transmurality of the defect is of interest pixel-level analysis is necessary and thus a higher precision in registration is required. Such precision is currently not available affecting the design and performance of the ischemia detection algorithms. In this work, to enable algorithmic developments of ischemia detection irrespective to registration accuracy, we propose an approach that generates synthetic pixel-level myocardial time series. We do this by 1) modeling the temporal changes in BOLD signal intensity based on sparse multi-component dictionary learning, whereby segmentally derived myocardial time series are extracted from canine experimental data to learn the model; and 2) demonstrating the resemblance between real and synthetic time series for validation purposes. We envision that the proposed approach has the capacity to accelerate development of tools for ischemia detection while markedly reducing experimental costs so that cardiac BOLD MRI can be rapidly translated into the clinical arena for the noninvasive assessment of ischemic heart disease.

Identification and expression analysis of cobia (Rachycentron canadum) Toll-like receptor 9 gene.

PubMed

Byadgi, Omkar; Puteri, Dinda; Lee, Yan-Horn; Lee, Jai-Wei; Cheng, Ta-Chih

2014-02-01

Cobia culture is hindered by bacterial infection (Photobacterium damselae subsp. piscicida) and in order to study the effect of P. damselae subsp. piscicida challenge and CpG ODN stimulation on cobia Toll like receptor 9 (RCTLR9), we used PCR to clone RCTLR9 gene and qRT-PCR to quantify gene expression. The results indicated that RCTLR9 cDNA contains 3141 bp. It encodes 1047 amino acids containing 16 typical structures of leucine-rich repeats (LRRs) including an LRRTYP, LRRCT and a motif involved in PAMP binding was identified at position 240-253 amino acid. Broad expression of RCTLR9 was found in larval, juvenile and adult stages irrespective of the tissues. In larval stage, RCTLR9 mRNA expression decreased at 5 d and then increased at 10 dph. At juvenile stage cobia, the expression was significantly high (p < 0.05) in spleen and intestine compared to gill, kidney, liver and skin. However, at adult stage, the significant high expression was found in gill and intestine. Cobia challenged with P. damselae subsp. piscicida showed significant increase in RCTLR9 expression at 24 h post challenge in intestine, spleen and liver, while in kidney the expression was peak at 12 h and later it decreased at 24 h. The highest expression was 40 fold increase in spleen and the lowest expression was ∼3.6 fold increase in liver. Cobia stimulated with CpG oligonucleotides showed that the induction of these genes was CpG ODN type and time dependent. In spleen and liver, CpG ODNs 1668 and 2006 injected group showed high expression of RCTLR9, IL-1β, chemokine CC compared to other groups. Meanwhile, CpG ODN 2006 has induced high expression of IgM. The CpG ODNs 2395 have induced significant high expression of Mx in spleen and liver. These results demonstrates the potential of using CpG ODN to enhance cobia resistance to P. damselae subsp. piscicida infection and use as an adjuvant in vaccine development. Copyright © 2013 Elsevier Ltd. All rights reserved.

Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Tingting; Department of Pharmacology, Uniformed Services University of the Health Sciences, Bethesda, Maryland; Chen, Man

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a singlemore » site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination. Black-Right-Pointing-Pointer Single CpG methylation located at Pax6 binding motif regulates StAR expression.« less

Nucleotide-dependent switch in proteasome assembly mediated by the Nas6 chaperone

PubMed Central

Li, Frances; Tian, Geng; Langager, Deanna; Sokolova, Vladyslava; Finley, Daniel; Park, Soyeon

2017-01-01

The proteasome is assembled via the nine-subunit lid, nine-subunit base, and 28-subunit core particle (CP). Previous work has shown that the chaperones Rpn14, Nas6, Hsm3, and Nas2 each bind a specific ATPase subunit of the base and antagonize base–CP interaction. Here, we show that the Nas6 chaperone also obstructs base–lid association. Nas6 alternates between these two inhibitory modes according to the nucleotide state of the base. When ATP cannot be hydrolyzed, Nas6 interferes with base–lid, but not base–CP, association. In contrast, under conditions of ATP hydrolysis, Nas6 obstructs base–CP, but not base–lid, association. Modeling of Nas6 into cryoelectron microscopy structures of the proteasome suggests that Nas6 controls both base–lid affinity and base–CP affinity through steric hindrance; Nas6 clashes with the lid in the ATP-hydrolysis–blocked proteasome, but clashes instead with the CP in the ATP-hydrolysis–competent proteasome. Thus, Nas6 provides a dual mechanism to control assembly at both major interfaces of the proteasome. PMID:28137839

Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

PubMed Central

Goffin, Darren; Allen, Megan; Zhang, Le; Amorim, Maria; Wang, I-Ting Judy; Reyes, Arith-Ruth S.; Mercado-Berton, Amy; Ong, Caroline; Cohen, Sonia; Hu, Linda; Blendy, Julie A.; Carlson, Gregory C.; Siegel, Steve J.; Greenberg, Michael E.; Zhou, Zhaolan (Joe)

2011-01-01

Mutations in the MECP2 gene cause the autism spectrum disorder Rett Syndrome (RTT). One of the most common mutations associated with RTT occurs at MeCP2 Threonine 158 converting it to Methionine (T158M) or Alanine (T158A). To understand the role of T158 mutation in the pathogenesis of RTT, we generated knockin mice recapitulating MeCP2 T158A mutation. Here we show a causal role for T158A mutation in the development of RTT-like phenotypes including developmental regression, motor dysfunction, and learning and memory deficits. These phenotypes resemble those in Mecp2-null mice and manifest through a reduction in MeCP2 binding to methylated DNA and a decrease in MeCP2 protein stability. Importantly, the age-dependent development of event-related neuronal responses are disrupted by MeCP2 mutation, suggesting that impaired neuronal circuitry underlies the pathogenesis of RTT and that assessment of event-related potentials may serve as a biomarker for RTT and treatment evaluation. PMID:22119903

Promoter methylation assay of SASH1 gene in hepatocellular carcinoma.

PubMed

Peng, Liu; Wei, He; Liren, Li

2014-01-01

To analyse the relationship between the expression of SASH1 and its methylation level in human hepatocellular carcinoma. Expression levels of SASH1 were examined with real-time PCR (RT-PCR) in tissues and cells, and methylation analysis was performed with MassArray. The expression levels of SASH1 were strongly reduced in liver cancer tissues compared with adjacent normal tissues. Quantitative methylation analysis by MassArray revealed different CpG sites in SASH1 promoter shared similar methylation pattern between liver cancer tissues and adjacent normal tissues and the CpG sites of significant difference in methylation level were found as follows: CpG_3, CpG_17, CpG_21.22, CpG_25, CpG_26.27, CpG_28, CpG_34.35.36 and CpG_51.52. Moreover, 5-aza-2'-deoxycytidine treatment of Hep-G2 cell line caused significant elevation of SASH1 mRNA. Based on these data, we propose that increase of DNA methylation degree in the promoter region of SASH1 gene, particularly CpG_26.27 sites, possibly repressed SASH1 expression in liver cancer.

CP110 exhibits novel regulatory activities during centriole assembly in Drosophila

PubMed Central

Franz, Anna; Roque, Hélio; Saurya, Saroj; Dobbelaere, Jeroen

2013-01-01

CP110 is a conserved centriole protein implicated in the regulation of cell division, centriole duplication, and centriole length and in the suppression of ciliogenesis. Surprisingly, we report that mutant flies lacking CP110 (CP110Δ) were viable and fertile and had no obvious defects in cell division, centriole duplication, or cilia formation. We show that CP110 has at least three functions in flies. First, it subtly influences centriole length by counteracting the centriole-elongating activity of several centriole duplication proteins. Specifically, we report that centrioles are ∼10% longer than normal in CP110Δ mutants and ∼20% shorter when CP110 is overexpressed. Second, CP110 ensures that the centriolar microtubules do not extend beyond the distal end of the centriole, as some centriolar microtubules can be more than 50 times longer than the centriole in the absence of CP110. Finally, and unexpectedly, CP110 suppresses centriole overduplication induced by the overexpression of centriole duplication proteins. These studies identify novel and surprising functions for CP110 in vivo in flies. PMID:24297749

Demographic and service-use profiles of individuals using the CarePayment program for hospital-related medical debt: results from a nationwide survey of guarantors.

PubMed

Lessard, Laura; Solomon, Julie

2016-07-15

Many Americans find themselves with problems paying medical bills, and medical debt can lead to numerous negative financial, social and access to healthcare outcomes. One potential market-based solution to these challenges is to provide financing options that have patient-friendly terms while complying with increasingly complex federal lending regulations. CarePayment (CP) is one entity that provides zero interest financing to individuals from participating medical facilities. An independent, initial outcome study was undertaken to understand the demographic and medical debt-related outcomes of CP users. This information is integral to understanding whether and how this program can ameliorate the negative consequences of medical debt. A nationwide telephone survey was conducted with a random sample of 8122 guarantors who were paying off CarePayment debt as of January 1, 2015. Respondents were asked about their demographic characteristics as well as self-report of negative outcomes typically associated with medical debt. Analyses included descriptive statistics along with logistic regression models comparing first-time CP users and those with higher amounts of CP debt to others. The most commonly reported financial challenge related to medical bills was problems paying or being unable to pay medical bills (59.5 %). The most commonly reported access-to-care challenges were skipping a medical test or treatment recommended by a doctor (32.9 %) and having a medical problem but not going to the doctor/clinic (30.3 %). Comparisons between first-time and repeat CP users suggest that first-time users were significantly more likely to report several negative outcomes and those with both CP and non-CP debt were significantly more likely to report nearly all of the undesirable financial and access outcomes that were assessed compared to those with only CP debt. The results suggest that CP use, especially repeat CP use, may be associated with a reduction in many negative outcomes of medical debt. In addition, while we found that individuals with only CP debt fared better than those with both CP debt and other medical debt, 60 % of our sample had more than one source of medical debt. This suggests that the beneficial impact of CP could be increased by expanding access to the program.

Next-generation sequencing identifies major DNA methylation changes during progression of Ph+ chronic myeloid leukemia

PubMed Central

Heller, G; Topakian, T; Altenberger, C; Cerny-Reiterer, S; Herndlhofer, S; Ziegler, B; Datlinger, P; Byrgazov, K; Bock, C; Mannhalter, C; Hörmann, G; Sperr, W R; Lion, T; Zielinski, C C; Valent, P; Zöchbauer-Müller, S

2016-01-01

Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML. PMID:27211271

Genes involved in thoracic exoskeleton formation during the pupal-to-adult molt in a social insect model, Apis mellifera.

PubMed

Soares, Michelle Prioli Miranda; Barchuk, Angel Roberto; Simões, Ana Carolina Quirino; Dos Santos Cristino, Alexandre; de Paula Freitas, Flávia Cristina; Canhos, Luísa Lange; Bitondi, Márcia Maria Gentile

2013-08-28

The insect exoskeleton provides shape, waterproofing, and locomotion via attached somatic muscles. The exoskeleton is renewed during molting, a process regulated by ecdysteroid hormones. The holometabolous pupa transforms into an adult during the imaginal molt, when the epidermis synthe3sizes the definitive exoskeleton that then differentiates progressively. An important issue in insect development concerns how the exoskeletal regions are constructed to provide their morphological, physiological and mechanical functions. We used whole-genome oligonucleotide microarrays to screen for genes involved in exoskeletal formation in the honeybee thoracic dorsum. Our analysis included three sampling times during the pupal-to-adult molt, i.e., before, during and after the ecdysteroid-induced apolysis that triggers synthesis of the adult exoskeleton. Gene ontology annotation based on orthologous relationships with Drosophila melanogaster genes placed the honeybee differentially expressed genes (DEGs) into distinct categories of Biological Process and Molecular Function, depending on developmental time, revealing the functional elements required for adult exoskeleton formation. Of the 1,253 unique DEGs, 547 were upregulated in the thoracic dorsum after apolysis, suggesting induction by the ecdysteroid pulse. The upregulated gene set included 20 of the 47 cuticular protein (CP) genes that were previously identified in the honeybee genome, and three novel putative CP genes that do not belong to a known CP family. In situ hybridization showed that two of the novel genes were abundantly expressed in the epidermis during adult exoskeleton formation, strongly implicating them as genuine CP genes. Conserved sequence motifs identified the CP genes as members of the CPR, Tweedle, Apidermin, CPF, CPLCP1 and Analogous-to-Peritrophins families. Furthermore, 28 of the 36 muscle-related DEGs were upregulated during the de novo formation of striated fibers attached to the exoskeleton. A search for cis-regulatory motifs in the 5'-untranslated region of the DEGs revealed potential binding sites for known transcription factors. Construction of a regulatory network showed that various upregulated CP- and muscle-related genes (15 and 21 genes, respectively) share common elements, suggesting co-regulation during thoracic exoskeleton formation. These findings help reveal molecular aspects of rigid thoracic exoskeleton formation during the ecdysteroid-coordinated pupal-to-adult molt in the honeybee.

Time burden of caring and depression among parents of individuals with cerebral palsy.

PubMed

Park, Eun-Young; Nam, Su-Jung

2018-01-30

The presence of an individual with disability in a family affects the whole family. Families of individuals with cerebral palsy (CP) experience increased psychological anxiety and financial problems; specifically, parents tend to feel time pressure and struggle to maintain their social and cultural activities. t-Tests and ANOVA with post hoc Tukey tests were used to compare caregiving time, time pressure, and depression between parents. Multivariate logistic regression analysis was used to examine the effect of caregiving time and time pressure on depression in parents. Regarding depression, 58 (38.2%) respondents scored ≥16 on the Center for Epidemiological Studies - Depression scale. Respondents supporting a preschool child spent more time than those supporting adults did; those supporting adults reported less time pressure than those supporting individuals of other ages. Caregiving time's effect on depression was not supported, whereas increased time pressure raised the risk of depression. The frequency of depression among parents supporting individuals with CP exceeded preceding findings. Time pressure due to support appears to directly predict depression. Total time spent caring appears unrelated to depression. Implications for Rehabilitation It is necessary to prepare various community and family support systems in order to relieve parental caregivers' burden and exhaustion. Interventions should focus on parents with higher time pressure than parents with high caregiving time. Physical and psychological difficulties experienced by parents supporting a child with a disability vary with the child's life stage, meaning that families' care burden partly depends on the age of the individual with disabilities.

Efficacy and safety of CP-945,598, a selective cannabinoid CB1 receptor antagonist, on weight loss and maintenance.

PubMed

Aronne, Louis J; Finer, Nick; Hollander, Priscilla A; England, Richard D; Klioze, Solomon S; Chew, Robert D; Fountaine, Robert J; Powell, Coralie M; Obourn, John D

2011-07-01

Three double-blind, placebo-controlled, three-parallel-group, multicenter phase 3 trials were conducted to assess the efficacy and safety of CP-945,598 for weight loss and weight-loss maintenance. Two trials were designed to be 2 years in duration (in obese and overweight patients) and one as a 1-year study (in obese and overweight patients with type 2 diabetes). However, the 2-year trials and the CP-945,598 development program were terminated before completion due to changing regulatory perspectives of CB1 receptor-related drugs. In total, 1,253 and 2,536 participants in the two 2-year multinational and North American studies were randomized to 10-mg CP-945,598 (n = 360; 718); 20-mg CP-945,598 (n = 534, 1,084) and placebo (n = 359, 734), respectively; and 975 participants were randomized to 10-mg CP-945,598 (n = 318); 20-mg CP-945,598 (n = 320); and placebo (n = 337) in the 1-year multinational diabetes trial. Baseline demographics were similar between treatment groups within each trial. One year of treatment with CP-945,598 resulted in a dose-related mean percentage reduction from baseline body-weight in all trials. A significant proportion of all participants also achieved 5% and 10% weight loss after 1 year. In participants with mainly well-controlled type 2 diabetes, the combination of lifestyle and CP-945,598 induced substantial improvements in glycemic control. The most frequent adverse events (AEs) for CP-945,598 were: diarrhea, nausea, nasopharyngitis, and headache. Self-reported experiences of anxiety and suicidal thoughts were higher with CP-945,598 than placebo, as were the incidence of depression and depressed mood. However, the reported increases in psychiatric symptoms were not consistently dose dependent.

V-1 regulates capping protein activity in vivo

PubMed Central

Jung, Goeh; Wu, Xufeng S.; Piszczek, Grzegorz; Chen, Bi-Chang; Betzig, Eric; Hammer, John A.

2016-01-01

Capping Protein (CP) plays a central role in the creation of the Arp2/3-generated branched actin networks comprising lamellipodia and pseudopodia by virtue of its ability to cap the actin filament barbed end, which promotes Arp2/3-dependent filament nucleation and optimal branching. The highly conserved protein V-1/Myotrophin binds CP tightly in vitro to render it incapable of binding the barbed end. Here we addressed the physiological significance of this CP antagonist in Dictyostelium, which expresses a V-1 homolog that we show is very similar biochemically to mouse V-1. Consistent with previous studies of CP knockdown, overexpression of V-1 in Dictyostelium reduced the size of pseudopodia and the cortical content of Arp2/3 and induced the formation of filopodia. Importantly, these effects scaled positively with the degree of V-1 overexpression and were not seen with a V-1 mutant that cannot bind CP. V-1 is present in molar excess over CP, suggesting that it suppresses CP activity in the cytoplasm at steady state. Consistently, cells devoid of V-1, like cells overexpressing CP described previously, exhibited a significant decrease in cellular F-actin content. Moreover, V-1–null cells exhibited pronounced defects in macropinocytosis and chemotactic aggregation that were rescued by V-1, but not by the V-1 mutant. Together, these observations demonstrate that V-1 exerts significant influence in vivo on major actin-based processes via its ability to sequester CP. Finally, we present evidence that V-1’s ability to sequester CP is regulated by phosphorylation, suggesting that cells may manipulate the level of active CP to tune their “actin phenotype.” PMID:27791032

V-1 regulates capping protein activity in vivo.

PubMed

Jung, Goeh; Alexander, Christopher J; Wu, Xufeng S; Piszczek, Grzegorz; Chen, Bi-Chang; Betzig, Eric; Hammer, John A

2016-10-25

Capping Protein (CP) plays a central role in the creation of the Arp2/3-generated branched actin networks comprising lamellipodia and pseudopodia by virtue of its ability to cap the actin filament barbed end, which promotes Arp2/3-dependent filament nucleation and optimal branching. The highly conserved protein V-1/Myotrophin binds CP tightly in vitro to render it incapable of binding the barbed end. Here we addressed the physiological significance of this CP antagonist in Dictyostelium, which expresses a V-1 homolog that we show is very similar biochemically to mouse V-1. Consistent with previous studies of CP knockdown, overexpression of V-1 in Dictyostelium reduced the size of pseudopodia and the cortical content of Arp2/3 and induced the formation of filopodia. Importantly, these effects scaled positively with the degree of V-1 overexpression and were not seen with a V-1 mutant that cannot bind CP. V-1 is present in molar excess over CP, suggesting that it suppresses CP activity in the cytoplasm at steady state. Consistently, cells devoid of V-1, like cells overexpressing CP described previously, exhibited a significant decrease in cellular F-actin content. Moreover, V-1-null cells exhibited pronounced defects in macropinocytosis and chemotactic aggregation that were rescued by V-1, but not by the V-1 mutant. Together, these observations demonstrate that V-1 exerts significant influence in vivo on major actin-based processes via its ability to sequester CP. Finally, we present evidence that V-1's ability to sequester CP is regulated by phosphorylation, suggesting that cells may manipulate the level of active CP to tune their "actin phenotype."

Comparison of titanium soaked in 5 M NaOH or 5 M KOH solutions

PubMed Central

Kim, Christina; Kendall, Matthew R.; Miller, Matthew A.; Long, Courtney L.; Larson, Preston R.; Humphrey, Mary Beth; Madden, Andrew S.; Tas, A. Cuneyt

2012-01-01

Commercially pure titanium plates/coupons and pure titanium powders were soaked for 24 h in 5 M NaOH and 5 M KOH solutions, under identical conditions, over the temperature range of 37° to 90°C. Wettability of the surfaces of alkali-treated cpTi coupons were studied by using contact angle goniometry. cpTi coupons soaked in 5 M NaOH or 5 M KOH solutions were found to have hydrophilic surfaces. Hydrous alkali titanate nanofibers and nanotubes were identified with SEM/EDXS and grazing incidence XRD. Surface areas of Ti powders increased >50–220 times, depending on the treatment, when soaked in the above solutions. A solution was developed to coat amorphous calcium phosphate, instead of hydroxyapatite, on Ti coupon surfaces. In vitro cell culture tests were performed with osteoblast-like cells on the alkali-treated samples. PMID:23565038

Amino Acid Oxidation Increases with Dietary Protein Content in Adult Neutered Male Cats as Measured Using [1-13C]Leucine and [15N2]Urea.

PubMed

Wester, Timothy J; Weidgraaf, Karin; Hekman, Margreet; Ugarte, Claudia E; Forsyth, Sandra F; Tavendale, Michael H

2015-11-01

Cats are unique among domestic animals in that they are obligate carnivores and have a high protein requirement. However, there are few data on protein turnover and amino acid (AA) metabolism in cats. The aim of this study was to examine the effects of dietary protein content on urea production and Leu metabolism in cats. Eighteen neutered male cats (4.4 ± 0.11 kg body weight, aged 4.6 ± 0.41 y) fed to maintain body weight for 3 wk with 15%, 40%, or 65% metabolizable energy intake as crude protein (CP) had [1-(13)C]Leu administered in the fed state. Urea production was measured by the infusion of [(15)N2]urea. Leu flux, nonoxidative Leu disposal (NOLD; protein synthesis), Leu rate of appearance (Ra; protein degradation), and Leu oxidation were determined. Urea production and Leu oxidation were both ∼ 3 times greater in cats fed 65% CP compared with those fed 15% CP, whereas those fed 40% CP were ∼ 1.6 times greater (P < 0.05). Leu flux was 1.9 and 1.3 times greater in cats fed 65% CP compared with those fed 15% and 40% CP (P < 0.001). Almost 39% of total Leu flux was oxidized by cats fed 15% CP, whereas this increased to 58% in cats fed 65% CP (P < 0.002). There were no differences for Ra, but cats fed 65% CP tended to have 30% greater NOLD (P = 0.09) and to be in positive protein balance (P = 0.08) compared with those fed 15% CP. The high protein requirement of cats combined with a low rate of whole-body protein synthesis ensures that an obligate demand of AAs for energy or glucose (or both) can be met in an animal that evolved with a diet high in protein with very little or no carbohydrate. © 2015 American Society for Nutrition.

cpSRP43 Is a Novel Chaperone Specific for Light-harvesting Chlorophyll a,b-binding Proteins*

PubMed Central

Falk, Sebastian; Sinning, Irmgard

2010-01-01

The biosynthesis of most membrane proteins is directly coupled to membrane insertion, and therefore, molecular chaperones are not required. The light-harvesting chlorophyll a,b-binding proteins (LHCPs) present a prominent exception as they are synthesized in the cytoplasm, and after import into the chloroplast, they are targeted and inserted into the thylakoid membrane. Upon arrival in the stroma, LHCPs form a soluble transit complex with the chloroplast signal recognition particle (cpSRP) consisting of an SRP54 homolog and the unique cpSRP43 composed of three chromodomains and four ankyrin repeats. Here we describe that cpSRP43 alone prevents aggregation of LHCP by formation of a complex with nanomolar affinity, whereas cpSRP54 is not required for this chaperone activity. Other stromal chaperones like trigger factor cannot replace cpSRP43, which implies that LHCPs require a specific chaperone. Although cpSRP43 does not have an ATPase activity, it can dissolve aggregates of LHCPs similar to chaperones of the Hsp104/ClpB family. We show that the LHCP-cpSRP43 interaction is predominantly hydrophobic but strictly depends on an intact DPLG motif between the second and third transmembrane region. The cpSRP43 ankyrin repeats that provide the binding site for the DPLG motif are sufficient for the chaperone function, whereas the chromodomains are dispensable. Taken together, we define cpSRP43 as a highly specific chaperone for LHCPs in addition to its established function as a targeting factor for this family of membrane proteins. PMID:20498370

Three flavor neutrino oscillations in matter: Flavor diagonal potentials, the adiabatic basis, and the CP phase

NASA Astrophysics Data System (ADS)

Kneller, James P.; McLaughlin, Gail C.

2009-09-01

We discuss the three neutrino flavor evolution problem with general, flavor-diagonal, matter potentials and a fully parametrized mixing matrix that includes CP violation, and derive expressions for the eigenvalues, mixing angles, and phases. We demonstrate that, in the limit that the mu and tau potentials are equal, the eigenvalues and matter mixing angles θ˜12 and θ˜13 are independent of the CP phase, although θ˜23 does have CP dependence. Since we are interested in developing a framework that can be used for S matrix calculations of neutrino flavor transformation, it is useful to work in a basis that contains only off-diagonal entries in the Hamiltonian. We derive the “nonadiabaticity” parameters that appear in the Hamiltonian in this basis. We then introduce the neutrino S matrix, derive its evolution equation and the integral solution. We find that this new Hamiltonian, and therefore the S matrix, in the limit that the μ and τ neutrino potentials are the same, is independent of both θ˜23 and the CP violating phase. In this limit, any CP violation in the flavor basis can only be introduced via the rotation matrices, and so effects which derive from the CP phase are then straightforward to determine. We then show explicitly that the electron neutrino and electron antineutrino survival probability is independent of the CP phase in this limit. Conversely, if the CP phase is nonzero and mu and tau matter potentials are not equal, then the electron neutrino survival probability cannot be independent of the CP phase.

MeCP2 regulates Tet1-catalyzed demethylation, CTCF binding, and learning-dependent alternative splicing of the BDNF gene in Turtle

PubMed Central

Zheng, Zhaoqing; Ambigapathy, Ganesh; Keifer, Joyce

2017-01-01

MECP2 mutations underlying Rett syndrome cause widespread misregulation of gene expression. Functions for MeCP2 other than transcriptional are not well understood. In an ex vivo brain preparation from the pond turtle Trachemys scripta elegans, an intraexonic splicing event in the brain-derived neurotrophic factor (BDNF) gene generates a truncated mRNA transcript in naïve brain that is suppressed upon classical conditioning. MeCP2 and its partners, splicing factor Y-box binding protein 1 (YB-1) and methylcytosine dioxygenase 1 (Tet1), bind to BDNF chromatin in naïve but dissociate during conditioning; the dissociation correlating with decreased DNA methylation. Surprisingly, conditioning results in new occupancy of BDNF chromatin by DNA insulator protein CCCTC-binding factor (CTCF), which is associated with suppression of splicing in conditioning. Knockdown of MeCP2 shows it is instrumental for splicing and inhibits Tet1 and CTCF binding thereby negatively impacting DNA methylation and conditioning-dependent splicing regulation. Thus, mutations in MECP2 can have secondary effects on DNA methylation and alternative splicing. DOI: http://dx.doi.org/10.7554/eLife.25384.001 PMID:28594324

Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

PubMed

Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

1999-01-01

We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

A multi-scale model of dislocation plasticity in α-Fe: Incorporating temperature, strain rate and non-Schmid effects

DOE PAGES

Lim, H.; Hale, L. M.; Zimmerman, J. A.; ...

2015-01-05

In this study, we develop an atomistically informed crystal plasticity finite element (CP-FE) model for body-centered-cubic (BCC) α-Fe that incorporates non-Schmid stress dependent slip with temperature and strain rate effects. Based on recent insights obtained from atomistic simulations, we propose a new constitutive model that combines a generalized non-Schmid yield law with aspects from a line tension (LT) model for describing activation enthalpy required for the motion of dislocation kinks. Atomistic calculations are conducted to quantify the non-Schmid effects while both experimental data and atomistic simulations are used to assess the temperature and strain rate effects. The parameterized constitutive equationmore » is implemented into a BCC CP-FE model to simulate plastic deformation of single and polycrystalline Fe which is compared with experimental data from the literature. This direct comparison demonstrates that the atomistically informed model accurately captures the effects of crystal orientation, temperature and strain rate on the flow behavior of siangle crystal Fe. Furthermore, our proposed CP-FE model exhibits temperature and strain rate dependent flow and yield surfaces in polycrystalline Fe that deviate from conventional CP-FE models based on Schmid's law.« less

Formulation of vaccines containing CpG oligonucleotides and alum

PubMed Central

Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

2007-01-01

CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

Feeding and gastrointestinal problems in children with cerebral palsy.

PubMed

Erkin, Gulten; Culha, Canan; Ozel, Sumru; Kirbiyik, Eylem Gulsen

2010-09-01

The aim of our study was to identify feeding and gastrointestinal system (GIS) problems in children with cerebral palsy (CP), and to evaluate the relationship between these problems and the severity of CP. A total of 120 children with CP were enrolled consecutively into the study (67 males, 53 females; mean age: 6.0±2.4 years; range: 2-12 years). The children were classified according to the Swedish classification as diplegic, hemiplegic, or quadriplegic. Severity of CP was classified based on the Gross Motor Function Classification System. The amount of time that the caregiver allocated to mealtimes, modifications of the food, as well as feeding and GIS problems was evaluated. Feeding dysfunction was classified as mild, moderate, or severe. Comparisons of GIS and feeding disorders and the severity of CP were carried out using χ test. The results indicated lack of appetite in 46 of the 120 children (38.3%), sialorrhea in 37 (30.8%), constipation in 30 (25%), difficulty in swallowing in 23 (19.2%), and feeding dysfunction in 26 (21.7%). On the basis of the Gross Motor Function Classification System (GMFCS), the incidence of GIS problems and feeding dysfunction was found to be significantly higher in the children classified in the severe group. The time taken to consume meals was significantly longer among children with feeding dysfunction. Feeding and GIS problems are frequent in children with CP, and more marked in those with severe CP. Approximately one fourth of children with CP suffer from feeding dysfunction, and more time has to be allocated to consume meals.

Modeling the expenditure and reconstitution of work capacity above critical power.

PubMed

Skiba, Philip Friere; Chidnok, Weerapong; Vanhatalo, Anni; Jones, Andrew M

2012-08-01

The critical power (CP) model includes two constants: the CP and the W' [P = (W' / t) + CP]. The W' is the finite work capacity available above CP. Power output above CP results in depletion of the W' complete depletion of the W' results in exhaustion. Monitoring the W' may be valuable to athletes during training and competition. Our purpose was to develop a function describing the dynamic state of the W' during intermittent exercise. After determination of V˙O(2max), CP, and W', seven subjects completed four separate exercise tests on a cycle ergometer on different days. Each protocol comprised a set of intervals: 60 s at a severe power output, followed by 30-s recovery at a lower prescribed power output. The intervals were repeated until exhaustion. These data were entered into a continuous equation predicting balance of W' remaining, assuming exponential reconstitution of the W'. The time constant was varied by an iterative process until the remaining modeled W' = 0 at the point of exhaustion. The time constants of W' recharge were negatively correlated with the difference between sub-CP recovery power and CP. The relationship was best fit by an exponential (r = 0.77). The model-predicted W' balance correlated with the temporal course of the rise in V˙O(2) (r = 0.82-0.96). The model accurately predicted exhaustion of the W' in a competitive cyclist during a road race. We have developed a function to track the dynamic state of the W' during intermittent exercise. This may have important implications for the planning and real-time monitoring of athletic performance.

ParticiPAte CP: a protocol of a randomised waitlist controlled trial of a motivational and behaviour change therapy intervention to increase physical activity through meaningful participation in children with cerebral palsy

PubMed Central

Boyd, Roslyn N; Elliott, Catherine

2017-01-01

Introduction Children with cerebral palsy (CP) participate in leisure-time physical activities (PA) less often, with less intensity and reduced diversity than their typically developing peers. Participation in leisure-time physical activities may be an important source of habitual physical activity (HPA) for children with CP, who as a group have lower levels of HPA and increased sedentary time compared with their typically developing peers. The proposed study aims to compare the efficacy of a participation focused therapy (ParticiPAte CP) to usual care in a pragmatic, randomised waitlist controlled trial. Methods and analysis Thirty-six children with CP (18 in each group), classified as Gross Motor Function Classification System levels I to III, aged between 8 and 12 years will be recruited across South East Queensland, Australia. Children will be randomised to receive either ParticiPAte CP or waitlist usual care using concealed allocation. ParticiPAte CP is an individually tailored, goal-directed intervention model of pragmatic participation-focused therapy using a toolbox of evidence-based strategies in the treatment of children with CP. This will include goal-setting; identification of barriers and facilitators to participation goals, strategy formation and planning and communication guided by principles of Self-Determination Theory using strategies of Motivational Interviewing. The intervention comprises 8 weekly sessions of 1 hour duration conducted by a physiotherapist in the child's home or community. Trial registration number ACTRN12615001064594. PMID:28790038

Anti-aggressive effect elicited by coca-paste in isolation-induced aggression of male rats: influence of accumbal dopamine and cortical serotonin.

PubMed

Meikle, María Noel; Prieto, José Pedro; Urbanavicius, Jessika; López, Ximena; Abin-Carriquiry, Juan Andrés; Prunell, Giselle; Scorza, María Cecilia

2013-09-01

Coca-paste (CP), an illicit drug of abuse, has been frequently associated with aggressive and impulsive behaviors in humans. However, preclinical studies have not been carried out in order to characterize CP effects on aggression. The acute effect of CP, cocaine and caffeine (the main adulterant present in seized samples) on aggression was assessed using the isolation-induced aggression paradigm in male rats. The dopaminergic (DA) neurotransmission in the nucleus accumbens (NAcc) and serotonergic (5-HT) activity in the frontal cortex were explored. CP and cocaine induced a similar anti-aggressive effect on isolated rats although CP-treated animals showed a shorter latency to the first attack. Aggressive behavior was not increased per se by caffeine. Social investigation time was slightly reduced only by cocaine while exploratory activity and time spent walking were increased by the three drugs. Accumbal DA levels were significantly augmented by CP, cocaine and caffeine, although differences in DOPAC and HVA levels were evidenced. A decrease in DA turnover was only observed after CP and cocaine administration. Increased cortical 5-HT levels with a concomitant decrease in 5-HT turnover were observed after CP and cocaine whereas caffeine did not alter it. As cocaine but not caffeine reduced aggression, it seems like cocaine content was mainly responsible for CP anti-aggressive action; however, the presence of caffeine in CP may have a role in the shorter latency to attack compared to cocaine. Despite the increase in NAcc DA, the enhancement of cortical 5-HT levels can likely underlie the anti-aggression observed in CP-treated animals. © 2013 Elsevier Inc. All rights reserved.

Effect of viscosity on tear drainage and ocular residence time.

PubMed

Zhu, Heng; Chauhan, Anuj

2008-08-01

An increase in residence time of dry eye medications including artificial tears will likely enhance therapeutic benefits. The drainage rates and the residence time of eye drops depend on the viscosity of the instilled fluids. However, a quantitative understanding of the dependence of drainage rates and the residence time on viscosity is lacking. The current study aims to develop a mathematical model for the drainage of Newtonian fluids and also for power-law non-Newtonian fluids of different viscosities. This study is an extension of our previous study on the mathematical model of tear drainage. The tear drainage model is modified to describe the drainage of Newtonian fluids with viscosities higher than the tear viscosity and power-law non-Newtonian fluids with rheological parameters obtained from fitting experimental data in literature. The drainage rate through canaliculi was derived from the modified drainage model and was incorporated into a tear mass balance to calculate the transients of total solute quantity in ocular fluids and the bioavailability of instilled drugs. For Newtonian fluids, increasing the viscosity does not affect the drainage rate unless the viscosity exceeds a critical value of about 4.4 cp. The viscosity has a maximum impact on drainage rate around a value of about 100 cp. The trends are similar for shear thinning power law fluids. The transients of total solute quantity, and the residence time agrees at least qualitatively with experimental studies. A mathematical model has been developed for the drainage of Newtonian fluids and power-law fluids through canaliculi. The model can quantitatively explain different experimental observations on the effect of viscosity on the residence of instilled fluids on the ocular surface. The current study is helpful for understanding the mechanism of fluid drainage from the ocular surface and for improving the design of dry eye treatments.

A peptide derived from alpha-fetoprotein inhibits the proliferation induced by estradiol in mammary tumor cells in culture.

PubMed

Sierralta, Walter D; Epuñan, Maria J; Reyes, José M; Valladares, Luis E; Andersen, Thomas T; Bennett, James A; Jacobson, Herbert I; Pino, Ana M

2008-01-01

This study was aimed to obtain additional information on the activity of a cyclized 9-amino acid peptide (cP) containing the active site of alpha fetoprotein, which inhibits the estrogen-stimulated proliferation of tumor cells in culture and of xenografts in immunodeficient mice. Breast cancer cells cultured in the presence of 2 nM estradiol were exposed to cP for different periods and their proliferation, estradiol binding parameters, clustering tendency and expression of E-cadherin and p21Cip1 were analyzed by biochemical and cell biology methods. The proliferation of MCF7 cells was significantly decreased by the addition of 2 microg/ml cP to the medium. cP did not increase cell death rate nor alter the number of binding sites for estradiol nor the endogenous aromatase activity of MCF7 cells. cP also decreased the proliferation of estrogen-dependent ZR75-1 cells but had no effect on estrogen-independent MDA-MB-231 cells. An increased nuclear p21Cip1 expression detected after cP treatment suggests that cP slows MCF7 cell proliferation via this regulator. We propose that cP could represent a novel breast cancer therapeutic agent whose mechanism of action is different from that of tamoxifen or of inhibitors of aromatase.

The effects of administration of the Lactobacillus gasseri strain CP2305 on quality of life, clinical symptoms and changes in gene expression in patients with irritable bowel syndrome.

PubMed

Nobutani, K; Sawada, D; Fujiwara, S; Kuwano, Y; Nishida, K; Nakayama, J; Kutsumi, H; Azuma, T; Rokutan, K

2017-01-01

To clarify the effects of Lactobacillus gasseri CP2305 (CP2305) on quality of life and clinical symptoms and its functional mechanisms in patients with irritable bowel syndrome (IBS). After the patients were administered CP2305 daily for 4 weeks, the IBS-severity index score was significantly improved compared with that of the placebo group, and this improvement was accompanied by a reduction in health-related worry and changes in intestinal microbiota. The gene expression profiling of the peripheral blood leucocytes showed that CP2305 treatment significantly up-regulated genes related to eukaryotic initiation factor 2 (EIF2) signalling. Eighty-two genes were down-regulated in IBS patients compared with healthy controls. The expression of 23 of these genes exhibited a CP2305-dependent increase associated with an improvement in IBS severity. The majority of the restored genes were related to EIF2 signalling. CP2305 administration is a potential candidate therapeutic option for patients with IBS. Although probiotics have been proposed to benefit IBS patients, objective clinical evidence and elucidation of the functional mechanism remain insufficient. Our study demonstrated that CP2305 administration beneficially influences IBS patients in both subjective and objective evaluations, and gene expression profiling provided insights into the functional mechanism. © 2016 The Society for Applied Microbiology.

Absorption characteristic of paeoniflorin-6'-O-benzene sulfonate (CP-25) in in situ single-pass intestinal perfusion in rats.

PubMed

Yang, Xiao-Dan; Wang, Chun; Zhou, Peng; Yu, Jun; Asenso, James; Ma, Yong; Wei, Wei

2016-09-01

1. Paeoniflorin-6'-O-benzene sulfonate (CP-25) was synthesized to improve the poor oral absorption of paeoniflorin (Pae). 2. This study was performed to investigate the absorptive behavior and mechanism of CP-25 in in situ single-pass intestinal perfusion in rats, using Pae as a control. 3. The results showed that intestinal absorption of CP-25 was neither segmental nor sex dependent. However, the main segment of intestine that absorbed Pae was the duodenum. Furthermore, passive transport was confirmed to be the main absorption pattern of CP-25. More importantly, the absorption of CP-25 was much higher than Pae in the small intestine. 4. Among the ABC transporter inhibitors, the absorption rate of Pae increased in the presence of P-gp inhibitors verapamil and GF120918, which indicated that Pae was a substrate of P-glycoprotein (P-gp), however, such was not observed in the presence of breast cancer resistance protein and multidrug resistance-associated protein 2. Finally, the ABC transporter inhibitors did not have any significant impact on CP-25 as demonstrated in the parallel studies. 5. CP-25 could improve the poor absorption of Pae, which may be attributed to both the lipid solubility enhancement and its resistance to P-gp-mediated efflux.

Characterization of Helper Virus-Independent Cytopathogenic Classical Swine Fever Virus Generated by an In Vivo RNA Recombination System

PubMed Central

Gallei, Andreas; Rümenapf, Till; Thiel, Heinz-Jürgen; Becher, Paul

2005-01-01

Molecular analyses revealed that most cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In contrast to bovine viral diarrhea virus (BVDV), cp classical swine fever virus (CSFV) field isolates were rarely detected and always represented helper virus-dependent subgenomes. To investigate RNA recombination in more detail, we recently established an in vivo system allowing the efficient generation of recombinant cp BVDV strains in cell culture after transfecting a synthetic subgenomic and nonreplicatable transcript into cells being infected with noncp BVDV (A. Gallei, A. Pankraz, H.-J. Thiel, and P. Becher, J. Virol. 78:6271-6281, 2004). Using an analogous approach, the first helper virus-independent cp CSFV strain (CP G1) has now been generated by RNA recombination. Accordingly, this study demonstrates the applicability of RNA recombination for designing new viral RNA genomes. The genomic RNA of CP G1 has a calculated size of 18.139 kb, almost 6 kb larger than all previously described CSFV genomes. It contains cellular sequences encoding a polyubiquitin fragment directly upstream of the nonstructural protein NS3 coding gene together with a duplication of viral sequences. CP G1 induces a cytopathic effect on different tissue culture cell lines from pigs and cattle. Subsequent analyses addressed growth kinetics, expression of NS3, and genetic stability of CP G1. PMID:15681445

Oral and intraperitoneal administration of phosphorothioate oligodeoxynucleotides leads to control of Cryptosporidium parvum infection in neonatal mice.

PubMed

Barrier, Mathieu; Lacroix-Lamandé, Sonia; Mancassola, Roselyne; Auray, Gaël; Bernardet, Nelly; Chaussé, Anne-Marie; Uematsu, Satoshi; Akira, Shizuo; Laurent, Fabrice

2006-05-15

Neonates are particularly vulnerable to infections, in part because of the incomplete development of their immune system. Recent advances in immunostimulatory treatments based on conserved microbial components led us to assess the potential of oligodeoxynucleotides (ODNs) for decreasing the sensitivity of neonates to Cryptosporidium parvum infection. Neonate mice were treated orally or intraperitoneally (ip) with CpG ODNs or non-CpG ODNs 24 h before C. parvum infection, and parasite load and cytokine up-regulation were evaluated. CpG ODN 1668 and non-CpG ODN 1668 administered orally, as well as CpG ODN 1668 administered ip, induced an 80%-95% decrease in intestinal parasite load 6 days after infection. Intraperitoneal and oral pretreatment with CpG ODN 1668 led to a strong initial up-regulation of cytokines and CD69 messenger RNA in the intestine and a decrease in parasite load by a Toll-like receptor 9 (TLR9)-dependent mechanism. By contrast, oral administration of non-CpG ODN 1668 decreased parasite load by a TLR9-independent mechanism. The control of neonatal C. parvum infection by ip or oral administration of ODNs is feasible by 2 different mechanisms: (1) the well-known interaction involving CpG/TLR9, leading to the production of cytokines and lymphocyte activation, and (2) a new unknown mechanism that is independent of TLR9 and effective orally.

Peptidergic contribution to posttetanic potentiation at a central synapse of aplysia.

PubMed

Koh, Hae-Young; Weiss, Klaudiusz R

2005-08-01

Posttetanic potentiation (PTP)-like phenomena appear to be mediated by a variety of mechanisms. Although neuropeptides are located in a large number of neurons and many neuropeptides, like PTP, can enhance synaptic transmission, there is a paucity of studies indicating that peptides may actually participate in PTP. Here, we utilize a single central synapse in the feeding circuit of Aplysia to investigate a possible peptidergic contribution to PTP in the CNS. The cholinergic command-like interneuron, cerebral-buccal interneuron 2 (CBI-2), contains two neuropeptides, feeding circuit activating peptide (FCAP) and cerebral peptide 2 (CP2). Previous studies showed that tetanic prestimulation or repeated stimulation of CBI-2, as well as perfusion of FCAP and CP2, increase the size of the cholinergic excitatory postsynaptic potentials (EPSPs) that CBI-2 evokes in the motoneurons B61/62 and shorten the latency to initiate B61/62 firing in response to CBI-2 stimulation. We used temperature-dependent suppression of peptide release and occlusion experiments to examine the possible contribution of FCAP and CP2 to PTP at the CBI-2 to B61/62 synapse. When peptide release was suppressed, perfusion of exogenous peptides increased the size of posttetanic EPSPs. In contrast, when peptide release was not suppressed, exogenous peptides did not enhance the size of posttetanic EPSPs, thus indicating occlusion. Temperature manipulation and occlusion experiments also indicated that peptides extend PTP duration. This peptide-dependent prolongation of PTP has functional consequences in that it extends the duration of time during which the latency to initiate B61/62 firing in response to CBI-2 stimulation is shortened.

Free factor XIII activation peptide (fAP-FXIII) is a regulator of factor XIII activity via factor XIII-B.

PubMed

Dodt, Johannes; Pasternack, Ralf; Seitz, Rainer; Volkers, Peter

2016-02-01

In a factor XIIIa (FXIIIa) generation assay with recombinant FXIII-A2 (rFXIII-A2 ) free FXIII activation peptide (fAP-FXII) prolonged the time to peak (TTP) but did not affect the area under the curve (AUC) or concentration at peak (CP). Addition of recombinant factorXIII-B2 (rFXIII-B2 ) restored the characteristics of the FXIIIa generation parameters (AUC, TTP and CP) to those observed for plasma FXIII (FXIII-A2 B2 ). FXIII-A2 B2 reconstituted from rFXIII-A2 and rFXIII-B2 showed a similar effect on AUC, TTP and CP in the presence of fAP-FXII as observed for plasma FXIII-A2 B2 , indicating a role for FXIII-B in this observation. An effect of fAP-FXIII on thrombin, the proteolytic activator of FXIII, was excluded by thrombin generation assays and clotting experiments. In a purified system, fAP-FXIII did not interfere with the FXIIIa activity development of thrombin-cleaved rFXIII-A2 (rFXIII-A2 ') also excluding direct inhibition of FXIIIa. However, FXIIIa activity development of FXIII-A2 'B2 was inhibited in a concentration-dependent manner by fAP-FXIII, indicating that an interaction between AP-FXIII and FXIII-B2 contributes to the overall stability of FXIII-A2 'B2 . In addition to its well-known role, FXIII-B also contributes to FXIII-A2 B2 stability or dissociation depending on fAP-FXIII and calcium concentrations. © 2015 John Wiley & Sons Ltd.

The effect of a calcium phosphate mouth rinse on (chemo) radiation induced oral mucositis in head and neck cancer patients: a prospective study.

PubMed

Stokman, M A; Burlage, F R; Spijkervet, F K L

2012-08-01

Promising results of a calcium phosphate (CP) mouth rinse on reduced severity of oral mucositis have been reported. The aim of this study was to determine the effect of a CP mouth rinse on the frequency, duration and severity of (chemo) radiation induced oral mucositis in patients with head-neck cancer. patients with oral malignancies, treated with (chemo) radiotherapy, were included. Patients rinsed four times a day with a CP mouth rinse. Patients not willing to rinse with the CP mouth rinse served as control. Mucositis was scored according to the WHO score at baseline and twice a week during the full course of (chemo) radiotherapy. Patient's self-reported mouth-throat soreness (MTS) was evaluated at the same time interval using a diary in the CP mouth rinse group. The outcomes on MTS were compared with a historical control group. Fifty-two patients were analysed: 25 CP mouth rinse group, 11 control group and 16 historical group. There was no significant difference between the CP group and control group on development and severity of oral mucositis. No significant difference was found for subjective outcomes on MTS between the CP group and the historical group. The CP mouth rinse seems to have no influence on the frequency, duration and severity of oral mucositis during (chemo) radiation in patients with head and neck cancer. A trend to develop less MTS for drinking and eating was found when applying the CP mouth rinse. © 2012 John Wiley & Sons A/S.

Observation of the decay Λ b 0 → pK - μ + μ - and a search for CP violation

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Balagura, V.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Baszczyk, M.; Batozskaya, V.; Batsukh, B.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Bird, T.; Birnkraut, A.; Bitadze, A.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bonivento, W.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britsch, M.; Britton, T.; Brodzicka, J.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Calabrese, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S. F.; Chobanova, V.; Chrzaszcz, M.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Dall'Occo, E.; Dalseno, J.; David, P. N. Y.; Davis, A.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Dungs, K.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Déléage, N.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fay, R.; Fazzini, D.; Ferguson, D.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Furfaro, E.; Färber, C.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Griffith, P.; Grillo, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hatch, M.; He, J.; Head, T.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hombach, C.; Hopchev, P. H.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kecke, M.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Koliiev, S.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Kosmyntseva, A.; Kozachuk, A.; Kozeiha, M.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, T.; Li, Y.; Likhomanenko, T.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, X.; Loh, D.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Maev, O.; Maguire, K.; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Manning, P.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Minard, M.-N.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morawski, P.; Mordà, A.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Mussini, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Nogay, A.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Otalora Goicochea, J. M.; Otto, A.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Popov, A.; Popov, D.; Popovici, B.; Poslavskii, S.; Potterat, C.; Price, E.; Price, J. D.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schubert, K.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Snoek, H.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stevens, H.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Toriello, F.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y.; Xing, Z.; Xu, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zucchelli, S.

2017-06-01

A search for CP violation in the decay Λ b 0 → pK - μ + μ - is presented. This decay is mediated by flavour-changing neutral-current transitions in the Standard Model and is potentially sensitive to new sources of CP violation. The study is based on a data sample of proton-proton collisions recorded with the LHCb experiment, corresponding to an integrated luminosity of 3 fb-1. The Λ b 0 → pK - μ + μ - decay is observed for the first time, and two observables that are sensitive to different manifestations of CP violation are measured, Δ A_{CP}≡ A_{CP}({Λ}_b^0\\to p{K}-{μ}+{μ}-)-{A}_{CP}({Λ}_b^0\\to p{K}-J/ψ ) and a {a}_{CP}^{\\widehat{T}- odd} , where the latter is based on asymmetries in the angle between the μ + μ - and pK - decay planes.

Mechanism-Based Condition Screening for Sustainable Catalysis in Single-Electron Steps by Cyclic Voltammetry.

PubMed

Liedtke, Theresa; Spannring, Peter; Riccardi, Ludovico; Gansäuer, Andreas

2018-04-23

A cyclic-voltammetry-based screening method for Cp 2 TiX-catalyzed reactions is introduced. Our mechanism-based approach enables the study of the influence of various additives on the electrochemically generated active catalyst Cp 2 TiX, which is in equilibrium with catalytically inactive [Cp 2 TiX 2 ] - . Thioureas and ureas are most efficient in the generation of Cp 2 TiX in THF. Knowing the precise position of the equilibrium between Cp 2 TiX and [Cp 2 TiX 2 ] - allowed us to identify reaction conditions for the bulk electrolysis of Cp 2 TiX 2 complexes and for Cp 2 TiX-catayzed radical arylations without having to carry out the reactions. Our time- and resource-efficient approach is of general interest for the design of catalytic reactions that proceed in single-electron steps. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

CpG-ODN Shapes Alum Adjuvant Activity Signaling via MyD88 and IL-10

PubMed Central

Mirotti, Luciana; Alberca Custódio, Ricardo Wesley; Gomes, Eliane; Rammauro, Florencia; de Araujo, Eliseu Frank; Garcia Calich, Vera Lucia; Russo, Momtchilo

2017-01-01

Aluminum-containing adjuvants usually referred as Alum are considered as T helper type-2 (Th2) adjuvants, while agonists of toll-like receptors (TLRs) are viewed as adjuvants that favor Th1/Th17 immunity. Alum has been used in numerous vaccine formulations; however, its undesired pro-Th2 adjuvant activity constitutes a caveat for Alum-based vaccines. Combining Alum with TLR-dependent, pro-Th1/Th17 adjuvants might dampen the pro-Th2 activity and improve the effectiveness of vaccine formulations. Here, using the ovalbumin (OVA) model of allergic lung inflammation, we found that sensitization with the synthetic TLR9 agonist, which is composed of oligodeoxynucleotides containing CpG motifs adsorbed to Alum, inhibited the development of OVA-induced lung allergic Th2 responses without shifting toward a Th1 pattern. The conversion of T cell immunity from the polarized allergic Th2 response to a non-polarized form by sensitization with OVA/Alum/CpG was dependent on MyD88 signaling in myeloid cells. Notably, sensitization of IL-10-deficient mice with OVA/Alum/CpG resulted in the development of neutrophilic lung inflammation associated with IFNγ production. However, in IL-10/IL-12-deficient mice, it resulted in neutrophilic inflammation dominated by IL-17 production. We conclude that OVA/Alum/CpG sensitization signaling via MyD88 and IL-10 molecules results in non-polarized immunity. Conversely, OVA/Alum/CpG sensitization in presence of MyD88 but absence of IL-10 or IL-10/IL-12 molecules results, respectively, in neutrophilic inflammation associated with IFNγ or IL-17 production. Our work provides novel OVA models of lung inflammation and suggests that Alum/CpG-based formulations might be of potential use in anti-allergic or anti-infectious processes. PMID:28220116

Can manual ability be measured with a generic ABILHAND scale? A cross-sectional study conducted on six diagnostic groups

PubMed Central

Arnould, Carlyne; Vandervelde, Laure; Batcho, Charles Sèbiyo; Penta, Massimo; Thonnard, Jean-Louis

2012-01-01

Objectives Several ABILHAND Rasch-built manual ability scales were previously developed for chronic stroke (CS), cerebral palsy (CP), rheumatoid arthritis (RA), systemic sclerosis (SSc) and neuromuscular disorders (NMD). The present study aimed to explore the applicability of a generic manual ability scale unbiased by diagnosis and to study the nature of manual ability across diagnoses. Design Cross-sectional study. Setting Outpatient clinic homes (CS, CP, RA), specialised centres (CP), reference centres (CP, NMD) and university hospitals (SSc). Participants 762 patients from six diagnostic groups: 103 CS adults, 113 CP children, 112 RA adults, 156 SSc adults, 124 NMD children and 124 NMD adults. Primary and secondary outcome measures Manual ability as measured by the ABILHAND disease-specific questionnaires, diagnosis and nature (ie, uni-manual or bi-manual involvement and proximal or distal joints involvement) of the ABILHAND manual activities. Results The difficulties of most manual activities were diagnosis dependent. A principal component analysis highlighted that 57% of the variance in the item difficulty between diagnoses was explained by the symmetric or asymmetric nature of the disorders. A generic scale was constructed, from a metric point of view, with 11 items sharing a common difficulty among diagnoses and 41 items displaying a category-specific location (asymmetric: CS, CP; and symmetric: RA, SSc, NMD). This generic scale showed that CP and NMD children had significantly less manual ability than RA patients, who had significantly less manual ability than CS, SSc and NMD adults. However, the generic scale was less discriminative and responsive to small deficits than disease-specific instruments. Conclusions Our finding that most of the manual item difficulties were disease-dependent emphasises the danger of using generic scales without prior investigation of item invariance across diagnostic groups. Nevertheless, a generic manual ability scale could be developed by adjusting and accounting for activities perceived differently in various disorders. PMID:23117570

Analytical investigation of microwave resonances of a curling probe for low and high-pressure plasma diagnostics

NASA Astrophysics Data System (ADS)

Arshadi, Ali; Brinkmann, Ralf Peter

2017-01-01

The concept of ‘active plasma resonance spectroscopy’ (APRS) has attracted greater interest in recent years as an established plasma diagnostic technique. The APRS describes a class of related methods utilizing the intrinsic ability of plasma to resonate at or near the electron plasma frequency {ω\\text{pe}} . The Curling probe (CP) as a novel realization of the APRS idea, is a miniaturized spiral slot embedded flatly in the chamber wall. Consequently, a plasma diagnostic technique with minimum disturbance and without metal contamination can be developed. To measure the plasma parameters the CP is fed with a weak frequency-swept signal from the exterior of the plasma chamber by a network analyzer which also records the response of the plasma versus the frequency. The resonance behavior is strongly dependent on the electron density and the gas pressure. The CP has also the advantage of resonating at a frequency greater than {ω\\text{pe}} which is dependent on the spiral’s length. The double resonance characteristic gives the CP the ability to be applied in varying plasma regimes. Assuming that the spiralization does not have a considerable effect on the resonances, a ‘straightened’ infinite length CP has recently been investigated (Arshadi and Brinkmann 2016 Plasma Sources Sci. Technol. 25 045014) to obtain the surface wave resonances. This work generalizes the approach and models the CP by a rectangular slot-type resonator located between plasma and quartz. Cold plasma theory and Maxwell’s equations are utilized to compute the electromagnetic fields propagating into the plasma by the diffraction of an incident plane wave at the slot. A mathematical model is employed and both kinds of resonances are derived. The analytical study of this paper shows good agreement with the numerical results of the probe inventors.

Toxicogenomic profiling in maternal and fetal rodent brains following gestational exposure to chlorpyrifos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moreira, Estefania G.; Department of Physiological Sciences, State University of Londrina, Londrina, PR; Yu Xiaozhong

2010-06-15

Considering the wide variety of effects that have been reported to occur in the developmental neurotoxicity of chlorpyrifos (CP) and the lack of consensus on their dependence of brain acetylcholinesterase (AChE) activity inhibition, we applied microarray technology to explore dose-dependent alterations in transcriptional response in the fetal and maternal C57BL/6 mouse brain after daily gestational exposure (days 6 to 17) to CP (2, 4, 10, 12 or 15 mg/kg, sc). We identified significantly altered genes across doses and assessed for overrepresentation of Gene Ontology (GO) biological processes and KEGG pathways. We further clustered genes based on their expression profiles acrossmore » doses and repeated the GO/pathways analysis for each cluster. The dose-effect relationship of CP on gene expression, both at the gene and pathway levels was non-monotonic and not necessarily related to brain AChE inhibition. The largest impact was observed in the 10 mg/kg dose group which was also the LOAEL for brain AChE inhibition. In the maternal brain, lower doses (4 mg/kg) influenced GO categories and pathways such as cell adhesion, behavior, lipid metabolism, long-term potentiation, nervous system development, neurogenesis, synaptic transmission. In the fetal brain, lower doses (2 and/or 4 mg/kg) significantly altered cell division, translation, transmission of nerve impulse, chromatin modification, long-term potentiation. In addition, some genes involved in nervous system development and signaling were shown to be specifically influenced by these lower CP doses. Our approach was sensitive and reflected the diversity of responses known to be disrupted by CP and highlighted possible additional consequences of CP neurotoxicity, such as disturbance of the ubiquitin proteasome system.« less

Treatment of crude oil-contaminated water with chemically modified natural fiber

NASA Astrophysics Data System (ADS)

Onwuka, Jude Chinedu; Agbaji, Edith Bolanle; Ajibola, Victor Olatunji; Okibe, Friday Godwin

2018-06-01

The dependence of Nigerian Government on foreign technology for oil spill cleanup in its water bodies does not add local content value in the development of the Nation's economy. Acetylation of natural cellulose gives a material with high sorption capacity for oil in water. This research investigates crude oil sorption from water using acetylated and unacetylated lignocellulose. Oil palm empty fruit bunch (OPEFB) and cocoa pod (CP) were acetylated under mild conditions. The acetylated (modified) and unacetylated (unmodified) sorbents were used to sorb oil from water, and their sorption capacities and mechanisms were compared. Paired t test showed there was significant difference in the sorption capacities of modified and unmodified sorbents. Sorption of oil from water was found to be time and concentration dependent. Equilibrium studies showed that CP has higher sorption capacity than OPEFB and acetylation enhanced the crude sorption capacities of the sorbents. Crude oil sorption from water is a monolayer process that might have progressed from multilayer processes. Kinetic studies showed that sorption of crude oil by the sorbents was diffusion-controlled with the aid of physisorption and chemisorption mechanisms. Fourier transform infrared and scanning electron microscope analyses showed clear evidence of successful acetylation and oil sorption.

Role of Replication and CpG Methylation in Fragile X Syndrome CGG Deletions in Primate Cells

PubMed Central

Nichol Edamura, Kerrie; Leonard, Michelle R.; Pearson, Christopher E.

2005-01-01

Instability of the fragile X CGG repeat involves both maternally derived expansions and deletions in the gametes of full-mutation males. It has also been suggested that the absence of aberrant CpG methylation may enhance repeat deletions through an unknown process. The effect of CGG tract length, DNA replication direction, location of replication initiation, and CpG methylation upon CGG stability were investigated using an SV40 primate replication system. Replication-dependant deletions with 53 CGG repeats were observed when replication was initiated proximal to the repeat, with CGG as the lagging-strand template. When we initiated replication further from the repeat, while maintaining CGG as the lagging-strand template or using CCG as the lagging-strand template, significant instability was not observed. CpG methylation of the unstable template stabilized the repeat, decreasing both the frequency and the magnitude of deletion events. Furthermore, CpG methylation slowed the efficiency of replication for all templates. Interestingly, replication forks displayed no evidence of a block at the CGG repeat tract, regardless of replication direction or CpG methylation status. Templates with 20 CGG repeats were stable under all circumstances. These results reveal that CGG deletions occur during replication and are sensitive to replication-fork dynamics, tract length, and CpG methylation. PMID:15625623

Serum ceruloplasmin protein expression and activity increases in iron-deficient rats and is further enhanced by higher dietary copper intake

PubMed Central

Ranganathan, Perungavur N.; Lu, Yan; Jiang, Lingli; Kim, Changae

2011-01-01

Increases in serum and liver copper content are noted during iron deficiency in mammals, suggesting that copper-dependent processes participate during iron deprivation. One point of intersection between the 2 metals is the liver-derived, multicopper ferroxidase ceruloplasmin (Cp) that is important for iron release from certain tissues. The current study sought to explore Cp expression and activity during physiologic states in which hepatic copper loading occurs (eg, iron deficiency). Weanling rats were fed control or low iron diets containing low, normal, or high copper for ∼ 5 weeks, and parameters of iron homeostasis were measured. Liver copper increased in control and iron-deficient rats fed extra copper. Hepatic Cp mRNA levels did not change; however, serum Cp protein was higher during iron deprivation and with higher copper consumption. In-gel and spectrophotometric ferroxidase and amine oxidase assays demonstrated that Cp activity was enhanced when hepatic copper loading occurred. Interestingly, liver copper levels strongly correlated with Cp protein expression and activity. These observations support the possibility that liver copper loading increases metallation of the Cp protein, leading to increased production of the holo enzyme. Moreover, this phenomenon may play an important role in the compensatory response to maintain iron homeostasis during iron deficiency. PMID:21768302

Unique Epstein-Barr virus (EBV) latent gene expression, EBNA promoter usage and EBNA promoter methylation status in chronic active EBV infection.

PubMed

Yoshioka, Mikio; Kikuta, Hideaki; Ishiguro, Nobuhisa; Ma, Xiaoming; Kobayashi, Kunihiko

2003-05-01

Chronic active Epstein-Barr virus infection (CAEBV) has been considered to be a non-neoplastic T-cell lymphoproliferative disease associated with Epstein-Barr virus (EBV) infection. In EBV-associated diseases, the cell phenotype-dependent differences in EBV latent gene expression may reflect the strategy of the virus in relation to latent infection. We previously reported that EBV latent gene expression was restricted; EBV nuclear antigen 1 (EBNA1) transcripts were consistently detected in all spleen samples from five CAEBV patients, but EBNA2 transcripts were detected in only one sample. EBV latent gene expression is controlled by distinct usage of three EBNA promoters (Cp, Wp and Qp). In this study, we examined the EBNA promoter usage by RT-PCR and the methylation status in the Cp and Wp regions using bisulfite PCR analysis in spleen samples from CAEBV patients. EBNA1 transcripts were unexpectedly initiated not from Qp but from Cp in all samples in spite of the restricted form of latency. Furthermore, while Cp was active, Cp was heavily methylated, indicating that CAEBV has unique EBV latent gene expression, EBNA promoter usage and EBNA promoter methylation status, in part due to unique splicing of Cp-initiated transcripts and an activation mechanism in hypermethylated Cp.

Review and comparison of geometric distortion correction schemes in MR images used in stereotactic radiosurgery applications

NASA Astrophysics Data System (ADS)

Pappas, E. P.; Dellios, D.; Seimenis, I.; Moutsatsos, A.; Georgiou, E.; Karaiskos, P.

2017-11-01

In Stereotactic Radiosurgery (SRS), MR-images are widely used for target localization and delineation in order to take advantage of the superior soft tissue contrast they exhibit. However, spatial dose delivery accuracy may be deteriorated due to geometric distortions which are partly attributed to static magnetic field inhomogeneity and patient/object-induced chemical shift and susceptibility related artifacts, known as sequence-dependent distortions. Several post-imaging sequence-dependent distortion correction schemes have been proposed which mainly employ the reversal of read gradient polarity. The scope of this work is to review, evaluate and compare the efficacy of two proposed correction approaches. A specially designed phantom which incorporates 947 control points (CPs) for distortion detection was utilized. The phantom was MR scanned at 1.5T using the head coil and the clinically employed pulse sequence for SRS treatment planning. An additional scan was performed with identical imaging parameters except for reversal of read gradient polarity. In-house MATLAB routines were developed for implementation of the signal integration and average-image distortion correction techniques. The mean CP locations of the two MR scans were regarded as the reference CP distribution. Residual distortion was assessed by comparing the corrected CP locations with corresponding reference positions. Mean absolute distortion on frequency encoding direction was reduced from 0.34mm (original images) to 0.15mm and 0.14mm following application of signal integration and average-image methods, respectively. However, a maximum residual distortion of 0.7mm was still observed for both techniques. The signal integration method relies on the accuracy of edge detection and requires 3-4 hours of post-imaging computational time. The average-image technique is a more efficient (processing time of the order of seconds) and easier to implement method to improve geometric accuracy in such applications.

Flux flow and flux dynamics in high-Tc superconductors

NASA Technical Reports Server (NTRS)

Bennett, L. H.; Turchinskaya, M.; Swartzendruber, L. J.; Roitburd, A.; Lundy, D.; Ritter, J.; Kaiser, D. L.

1991-01-01

Because high temperature superconductors, including BYCO and BSSCO, are type 2 superconductors with relatively low H(sub c 1) values and high H(sub c 2) values, they will be in a critical state for many of their applications. In the critical state, with the applied field between H(sub c 1) and H(sub c 2), flux lines have penetrated the material and can form a flux lattice and can be pinned by structural defects, chemical inhomogeneities, and impurities. A detailed knowledge of how flux penetrates the material and its behavior under the influence of applied fields and current flow, and the effect of material processing on these properties, is required in order to apply, and to improve the properties of these superconductors. When the applied field is changed rapidly, the time dependence of flux change can be divided into three regions, an initial region which occurs very rapidly, a second region in which the magnetization has a 1n(t) behavior, and a saturation region at very long times. A critical field is defined for depinning, H(sub c,p) as that field at which the hysteresis loop changes from irreversible to reversible. As a function of temperature, it is found that H(sub c,p) is well described by a power law with an exponent between 1.5 and 2.5. The behavior of H(sub c,p) for various materials and its relationship to flux flow and flux dynamics are discussed.

Characterization of Spasticity in Cerebral Palsy: Dependence of Catch Angle on Velocity

ERIC Educational Resources Information Center

Wu, Yi-Ning; Ren, Yupeng; Goldsmith, Ashlee; Gaebler, Deborah; Liu, Shu Q.; Zhang, Li-Qun

2010-01-01

Aim: To evaluate spasticity under controlled velocities and torques in children with cerebral palsy (CP) using a manual spasticity evaluator. Method: The study involved 10 children with spastic CP (six males, four females; mean age 10y 1mo, SD 2y 9mo, range 7-16y; one with quadriplegia, six with right hemiplegia, three with left hemiplegia; Gross…

Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

PubMed Central

Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

2013-01-01

Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude of cytokine induction by varying the strength of condensation of the CpG oligodeoxynucleotides. Conclusion Although the loading capacity of BNNS coated with low molecular weight chitosan preparations was the lowest of all the preparations, they induced the highest levels of cytokines. PMID:23674892

ALBI versus Child-Pugh grading systems for liver function in patients with hepatocellular carcinoma.

PubMed

Na, Seong K; Yim, Sun Y; Suh, Sang J; Jung, Young K; Kim, Ji H; Seo, Yeon S; Yim, Hyung J; Yeon, Jong E; Byun, Kwan S; Um, Soon H

2018-04-01

The prognostic performance of the albumin-bilirubin (ALBI) grade in hepatocellular carcinoma (HCC) as an objective method of assessing liver function was investigated. Data from 2099 patients with HCC in Korea were collected and analyzed retrospectively. The discriminative performance of ALBI grade was compared with Child-Pugh (C-P) grade for different stages or treatments. The median follow up duration was 16.2 months (range: 1.0-124.9). The median survival times were 49.7 months for C-P grade A (65.8%), 12.4 months for C-P grade B (25.5%), and 4.2 months for C-P grade C (8.6%) (P < 0.001). The median survival times were 84.2 months for ALBI grade 1 (32.8%), 25.5 months for ALBI grade 2 (53.5%), and 7.7 months for ALBI grade 3 (13.7%) (P < 0.001). In early UICC stages, ALBI grade showed better discriminative performance than C-P grade. In curative treatments, ALBI grade also showed better discriminative performance than C-P grade (Harrell's C: 0.624 (C-P grade) vs 0.667 [ALBI grade]). ALBI grade provided better prognostic performance in survival analysis and better distribution of the grades than C-P grade in HCC, suggesting that ALBI grade could be a good alternative grading system for liver function in patients with HCC. © 2018 Wiley Periodicals, Inc.

The coat protein of Alternanthera mosaic virus is the elicitor of a temperature-sensitive systemic necrosis in Nicotiana benthamiana, and interacts with a host boron transporter protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Hyoun-Sub, E-mail: hyounlim@cnu.ac.kr; Nam, Jiryun, E-mail: jilyoon@naver.com; Seo, Eun-Young, E-mail: sey22@cnu.ac.kr

Different isolates of Alternanthera mosaic virus (AltMV; Potexvirus), including four infectious clones derived from AltMV-SP, induce distinct systemic symptoms in Nicotiana benthamiana. Virus accumulation was enhanced at 15 °C compared to 25 °C; severe clone AltMV 3-7 induced systemic necrosis (SN) and plant death at 15 °C. No interaction with potexvirus resistance gene Rx was detected, although SN was ablated by silencing of SGT1, as for other cases of potexvirus-induced necrosis. Substitution of AltMV 3-7 coat protein (CP{sub SP}) with that from AltMV-Po (CP{sub Po}) eliminated SN at 15 °C, and ameliorated symptoms in Alternanthera dentata and soybean. Substitution ofmore » only two residues from CP{sub Po} [either MN(13,14)ID or LA(76,77)IS] efficiently ablated SN in N. benthamiana. CP{sub SP} but not CP{sub Po} interacted with Arabidopsis boron transporter protein AtBOR1 by yeast two-hybrid assay; N. benthamiana homolog NbBOR1 interacted more strongly with CP{sub SP} than CP{sub Po} in bimolecular fluorescence complementation, and may affect recognition of CP as an elicitor of SN. - Highlights: • Alternanthera mosaic virus CP is an elicitor of systemic necrosis in N. benthamiana. • Virus-induced systemic necrosis is enhanced at 15 °C compared to 25 °C. • Induction of systemic necrosis is dependent on as few as two CP amino acid residues. • These residues are at subunit interfaces within the same turn of the virion helix. • Inducer/non-inducer CPs interact differentially with a boron transporter protein.« less

(Pentamethylcyclopentadienyl)molybdenum(IV) chloride. Synthesis, structure, and properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abugideiri, F.; Desai, J.U.; Gordon, J.C.

1994-08-17

Three different syntheses of trichloro(pentamethylcyclopentadienyl)molybdenum(IV) are described, I.E. (1) thermal decarbonylation of Cp{sup *}MoCl{sub 3}(CO){sub 2}, (2) reduction of Cp{sup *}MoCl{sub 4}, and (3) chlorination of [Cp{sup *}MoCl{sub 2}]{sub 2}. A fourth route (conproportionation of [Cp{sup *}MoCl{sub 2}]{sub 2} and Cp{sup *}MoCl{sub 4}) has been investigated by {sup 1}H-NMR. The product has a dinuclear, dichloro-bridged structure with a four-legged piano stool geometry around each metal atom; the two piano stools have a mutual anti arrangement and the two metals are 3.888(1) {Angstrom} from each other, indicating the absence of a direct metal-metal bonding interaction. Crystal data: monoclinic, space group P2{submore » 1}/n, a = 8.424(1) {Angstrom}, b = 13.323(4) {Angstrom}, c = 11.266(2) {Angstrom}, {beta} = 93.87(1){degrees}, V = 1261.6(8) {Angstrom}{sup 3}, Z = 2, R = 0.038, R{sub w} = 0.057 for 127 parameters and 1350 observed reflections with F{sub o}{sup 2} > 3{sigma}(F{sub o}{sup 2}). The temperature dependent magnetic moment of the material could be fit to the sum of two Bleany-Bowers equations. [Cp{sup *}MoCl{sub 3}]{sub 2} reacts readily with CO, Cl{sup {minus}}, and PMe{sub 3} to afford Cp{sup *}MoCl{sub 3}(CO){sub 2}, [Cp{sup *}MoCl{sub 4}]{sup {minus}}, and Cp{sup *}MoCl{sub 3}(PMe{sub 3}), respectively, while the reaction with 1,2-bis(diphenylphosphino)ethane (dppe) affords the reduction product Cp{sup *}MoCl{sub 2}(dppe).« less

Ceruloplasmin copper induces oxidant damage by a redox process utilizing cell-derived superoxide as reductant

NASA Technical Reports Server (NTRS)

Mukhopadhyay, C. K.; Fox, P. L.

1998-01-01

Oxidative damage by transition metals bound to proteins may be an important pathogenic mechanism. Ceruloplasmin (Cp) is a Cu-containing plasma protein thought to be involved in oxidative modification of lipoproteins. We have previously shown that Cp increased cell-mediated low-density lipoprotein (LDL) oxidation by a process requiring cell-derived superoxide, but the underlying chemical mechanism(s) is (are) unknown. We now show that superoxide reduction of Cp Cu is a critical reaction in cellular LDL oxidation. By bathocuproine disulfonate (BCS) binding and by superoxide utilization, we showed that exogenous superoxide reduces a single Cp Cu atom, the same Cu required for LDL oxidation. The Cu atom remained bound to Cp during the redox cycle. Three avenues of evidence showed that vascular cells reduce Cp Cu by a superoxide-dependent process. The 2-fold higher rate of Cp Cu reduction by smooth muscle cells (SMC) compared to endothelial cells (EC) was consistent with their relative rates of superoxide release. Furthermore, Cp Cu reduction by cells was blocked by Cu,Zn superoxide dismutase (SOD1). Finally, the level of superoxide produced by EC and SMC was sufficient to cause the amount of Cu reduction observed. An important role of Cp Cu reduction in LDL oxidation was suggested by results showing that SOD1 inhibited Cp Cu reduction and LDL oxidation by SMC with equal potency, while tumor necrosis factor-alpha stimulated both processes. In summary, these results show that superoxide is a critical cellular reductant of divalent transition metals involved in oxidation, and that protein-bound Cu is a substrate for this reaction. The role of these mechanisms in oxidative processes in vivo has yet to be defined.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity.

PubMed

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M; Tinder, Teresa L; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J; Mukherjee, Pinku

2012-11-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo.

Intratumoral delivery of CpG-conjugated anti-MUC1 antibody enhances NK cell anti-tumor activity

PubMed Central

Schettini, Jorge; Kidiyoor, Amritha; Besmer, Dahlia M.; Tinder, Teresa L.; Roy, Lopamudra Das; Lustgarten, Joseph; Gendler, Sandra J.

2013-01-01

Monoclonal antibodies (mAbs) against tumor-associated antigens are useful anticancer agents. Antibody-dependent cellular cytotoxicity (ADCC) is one of the major mechanisms responsible for initiating natural killer cell (NK)-mediated killing of tumors. However, the regulation of ADCC via NK cells is poorly understood. We have investigated the cytolytic activity of NK cells against pancreatic cancer cells that were coated with an antibody directed against the human tumor antigen, Mucin-1 designated HMFG-2, either alone or conjugated to CpG oligodeoxynucleotide (CpG ODN). Conjugated antibodies were tested for their ability to elicit ADCC in vitro and in vivo against pancreatic cancer cells. NK cells cultured in the presence of immobilized CpG ODN, HMFG-2 Ab, or CpG ODN-conjugated HMFG-2 Ab were able to up-regulate perforin similarly. Interestingly, a significant higher ADCC was observed when CpG ODN-conjugated HMFG-2-coated tumor cells were co-cultured with NK cells compared to unconjugated HMFG-2 Ab or CpG ODN alone. Moreover, MyD88-deficient NK cells can perform ADCC in vitro. Furthermore, intratumoral injections of CpG ODN-conjugated HMFG-2 induced a significant reduction in tumor burden in vivo in an established model of pancreatic tumor in nude mice compared to CpG ODN or the HMFG-2 alone. Depletion of macrophages or NK cells before treatment confirmed that both cells were required for the anti-tumor response in vivo. Results also suggest that CpG ODN and HMFG-2 Ab could be sensed by NK cells on the mAb-coated tumor cells triggering enhanced ADCC in vitro and in vivo. PMID:22543528

Recovery of Vestibulo-Ocular Reflex Symmetry After an Acute Unilateral Peripheral Vestibular Deficit: Time Course and Correlation With Canal Paresis.

PubMed

Allum, John H J; Cleworth, T; Honegger, Flurin

2016-07-01

We investigated how response asymmetries and deficit side response amplitudes for head accelerations used clinically to test the vestibular ocular reflex (VOR) are correlated with caloric canal paresis (CP) values. 30 patients were examined at onset of an acute unilateral peripheral vestibular deficit (aUPVD) and 3, 6, and 13 weeks later with three different VOR tests: caloric, rotating chair (ROT), and video head impulse tests (vHIT). Response changes over time were fitted with an exponential decay model and compared with using linear regression analysis. Recovery times (to within 10% of steady state) were similar for vHIT-asymmetry and CP (>10 weeks) but shorter for ROT asymmetry (<4 weeks). Regressions with CP were similar (vHIT asymmetry, R = 0.68, ROT, R = 0.62). Responses to the deficit side were also equally well correlated with CP values (R = 0.71). Specificity for vHIT and 20 degrees/s ROT deficit side responses was 100% in comparison to CP values, sensitivity was 74% for vHIT, 75% for ROT. A decrease in normal side responses occurred for ROT but not for vHIT at 3 weeks. Normal side responses were weekly correlated with CP for ROT (R = 0.49) but not for vHIT (R = 0.17). These results indicate that vHIT deficit side VOR gains are slightly better correlated with CP values than ROT, probably because of similar recovery time courses of vHIT and caloric responses and the lack of normal side vHIT changes. However, specificity and sensitivity is the same for vHIT and ROT tests.

Validation of accelerometer cut points in toddlers with and without cerebral palsy.

PubMed

Oftedal, Stina; Bell, Kristie L; Davies, Peter S W; Ware, Robert S; Boyd, Roslyn N

2014-09-01

The purpose of this study was to validate uni- and triaxial ActiGraph cut points for sedentary time in toddlers with cerebral palsy (CP) and typically developing children (TDC). Children (n = 103, 61 boys, mean age = 2 yr, SD = 6 months, range = 1 yr 6 months-3 yr) were divided into calibration (n = 65) and validation (n = 38) samples with separate analyses for TDC (n = 28) and ambulant (Gross Motor Function Classification System I-III, n = 51) and nonambulant (Gross Motor Function Classification System IV-V, n = 25) children with CP. An ActiGraph was worn during a videotaped assessment. Behavior was coded as sedentary or nonsedentary. Receiver operating characteristic-area under the curve analysis determined the classification accuracy of accelerometer data. Predictive validity was determined using the Bland-Altman analysis. Classification accuracy for uniaxial data was fair for the ambulatory CP and TDC group but poor for the nonambulatory CP group. Triaxial data showed good classification accuracy for all groups. The uniaxial ambulatory CP and TDC cut points significantly overestimated sedentary time (bias = -10.5%, 95% limits of agreement [LoA] = -30.2% to 9.1%; bias = -17.3%, 95% LoA = -44.3% to 8.3%). The triaxial ambulatory and nonambulatory CP and TDC cut points provided accurate group-level measures of sedentary time (bias = -1.5%, 95% LoA = -20% to 16.8%; bias = 2.1%, 95% LoA = -17.3% to 21.5%; bias = -5.1%, 95% LoA = -27.5% to 16.1%). Triaxial accelerometers provide useful group-level measures of sedentary time in children with CP across the spectrum of functional abilities and TDC. Uniaxial cut points are not recommended.

ParticiPAte CP: a protocol of a randomised waitlist controlled trial of a motivational and behaviour change therapy intervention to increase physical activity through meaningful participation in children with cerebral palsy.

PubMed

Reedman, Sarah Elizabeth; Boyd, Roslyn N; Elliott, Catherine; Sakzewski, Leanne

2017-08-07

Children with cerebral palsy (CP) participate in leisure-time physical activities (PA) less often, with less intensity and reduced diversity than their typically developing peers. Participation in leisure-time physical activities may be an important source of habitual physical activity (HPA) for children with CP, who as a group have lower levels of HPA and increased sedentary time compared with their typically developing peers. The proposed study aims to compare the efficacy of a participation focused therapy (ParticiPAte CP) to usual care in a pragmatic, randomised waitlist controlled trial. Thirty-six children with CP (18 in each group), classified as Gross Motor Function Classification System levels I to III, aged between 8 and 12 years will be recruited across South East Queensland, Australia. Children will be randomised to receive either ParticiPAte CP or waitlist usual care using concealed allocation. ParticiPAte CP is an individually tailored, goal-directed intervention model of pragmatic participation-focused therapy using a toolbox of evidence-based strategies in the treatment of children with CP. This will include goal-setting; identification of barriers and facilitators to participation goals, strategy formation and planning and communication guided by principles of Self-Determination Theory using strategies of Motivational Interviewing. The intervention comprises 8 weekly sessions of 1 hour duration conducted by a physiotherapist in the child's home or community. ACTRN12615001064594. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

External tube pancreatostomy reduces the risk of mortality associated with completion pancreatectomy for symptomatic fistulas complicating pancreaticoduodenectomy.

PubMed

Ribero, Dario; Amisano, Marco; Zimmitti, Giuseppe; Giraldi, Francesco; Ferrero, Alessandro; Capussotti, Lorenzo

2013-02-01

This study aimed to compare the outcome of a pancreas-preserving technique consisting in a two-step procedure (external tube pancreatostomy (ETP) after resection of dehisced anastomosis followed by late anastomosis completion) with that of completion pancreatectomy (CP) for grade C fistulas complicating pancreaticoduodenectomies (PDs). CP is the most commonly performed operation to treat a dehisced pancreato-jejunal anastomosis associated with deteriorating clinical status or hemorrhage. However, mortality of CP is high and long-term consequences are severe. All consecutive patients who underwent PD between 1990 and 2010 were identified. Clinicopathological data, operative details, and outcomes were analyzed. Out of 370 patients, 112 (30.2 %) developed a pancreatic fistula, which was severe (grade C) in 47 cases. Forty-two patients were treated surgically by CP (n = 23; median time following PD, 10 days), ETP (n = 9; median time following PD, 8 days) or other various procedures (n = 10). Indications for re-operation and operative time of CP and ETP (207.5' versus 170', respectively) were similar, while postoperative mortality was significantly higher after CP (43.5 % versus 0 %, p = 0.030). Moreover, the need for a second emergency re-operation was threefold higher after CP than after ETP (39.1 % versus 11.1 %). After a median of 88 days, seven patients completed the pancreato-jejunal anastomosis without major complications or mortality. After a median follow-up of 14 months, none of the ETP patients developed diabetes. External tube pancreatostomy significantly reduces the mortality associated with emergency CP. Thus, it should always be considered when deciding the treatment option in emergency surgery for severe pancreatic fistulas.

Theoretical description of the mixed-field orientation of asymmetric-top molecules: A time-dependent study

NASA Astrophysics Data System (ADS)

Omiste, Juan J.; González-Férez, Rosario

2016-12-01

We present a theoretical study of the mixed-field-orientation of asymmetric-top molecules in tilted static electric field and nonresonant linearly polarized laser pulse by solving the time-dependent Schrödinger equation. Within this framework, we compute the mixed-field orientation of a state-selected molecular beam of benzonitrile (C7H5N ) and compare with the experimental observations [J. L. Hansen et al., Phys. Rev. A 83, 023406 (2011), 10.1103/PhysRevA.83.023406] and with our previous time-independent descriptions [J. J. Omiste et al., Phys. Chem. Chem. Phys. 13, 18815 (2011), 10.1039/c1cp21195a]. For an excited rotational state, we investigate the field-dressed dynamics for several field configurations as those used in the mixed-field experiments. The nonadiabatic phenomena and their consequences on the rotational dynamics are analyzed in detail.

Search for CP violation in the phase space of D0 → π+π-π+π- decays

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Baldini, W.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baszczyk, M.; Batozskaya, V.; Batsukh, B.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Bel, L. J.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Bird, T.; Birnkraut, A.; Bitadze, A.; Bizzeti, A.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bonivento, W.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britsch, M.; Britton, T.; Brodzicka, J.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Cadeddu, S.; Calabrese, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Castillo Garcia, L.; Cattaneo, M.; Cauet, Ch.; Cavallero, G.; Cenci, R.; Chamont, D.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S.-F.; Chobanova, V.; Chrzaszcz, M.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Coco, V.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collazuol, G.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Dall'Occo, E.; Dalseno, J.; David, P. N. Y.; Davis, A.; De Aguiar Francisco, O.; De Bruyn, K.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C.-T.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Dungs, K.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Déléage, N.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fay, R.; Fazzini, D.; Ferguson, D.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiore, M.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Furfaro, E.; Färber, C.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Grabalosa Gándara, M.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Griffith, P.; Grillo, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hall, S.; Hamilton, B.; Han, X.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Harrison, J.; Hatch, M.; He, J.; Head, T.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; Hernando Morata, J. A.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hombach, C.; Hopchev, H.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hussain, N.; Hutchcroft, D.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Kanso, W.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kecke, M.; Kelsey, M.; Kenyon, I. R.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Koliiev, S.; Kolpin, M.; Komarov, I.; Koopman, R. F.; Koppenburg, P.; Kosmyntseva, A.; Kozachuk, A.; Kozeiha, M.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kurek, K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.-P.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Likhomanenko, T.; Lindner, R.; Linn, C.; Lionetto, F.; Liu, B.; Liu, X.; Loh, D.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Maev, O.; Maguire, K.; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Manning, P.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurin, B.; Mazurov, A.; McCann, M.; McCarthy, J.; McNab, A.; McNulty, R.; Meadows, B.; Meier, F.; Meissner, M.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Minard, M.-N.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morawski, P.; Mordà, A.; Morello, M. J.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Mussini, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, A. D.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Novoselov, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Otalora Goicochea, J. M.; Otto, A.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palombo, F.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, G. D.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pistone, A.; Piucci, A.; Playfer, S.; Plo Casasus, M.; Poikela, T.; Polci, F.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Popov, A.; Popov, D.; Popovici, B.; Poslavskii, S.; Potterat, C.; Price, E.; Price, J. D.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Quagliani, R.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rodriguez Perez, P.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schubert, K.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Snoek, H.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Stracka, S.; Straticiuc, M.; Straumann, U.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szczekowski, M.; Szumlak, T.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Teklishyn, M.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Topp-Joergensen, S.; Toriello, F.; Tournefier, E.; Tourneur, S.; Trabelsi, K.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vallier, A.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Vernet, M.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y.; Xing, Z.; Xu, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhokhov, A.; Zhu, X.; Zhukov, V.; Zucchelli, S.; LHCb Collaboration

2017-06-01

A search for time-integrated CP violation in the Cabibbo-suppressed decay D0 →π+π-π+π- is performed using an unbinned, model-independent technique known as the energy test. This is the first application of the energy test in four-body decays. The search is performed for P-even CP asymmetries and, for the first time, is extended to probe the P-odd case. Using proton-proton collision data corresponding to an integrated luminosity of 3.0 fb-1 collected by the LHCb detector at centre-of-mass energies of √{ s} = 7 TeV and 8 TeV, the world's best sensitivity to CP violation in this decay is obtained. The data are found to be consistent with the hypothesis of CP symmetry with a p-value of (4.6 ± 0.5)% in the P-even case, and marginally consistent with a p-value of (0.6 ± 0.2)% in the P-odd case, corresponding to a significance for CP non-conservation of 2.7 standard deviations.

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

PubMed Central

Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

Pyrethroid Insecticide Cypermethrin Accelerates Pubertal Onset in Male Mice via Disrupting Hypothalamic-Pituitary-Gonadal Axis.

PubMed

Ye, Xiaoqing; Li, Feixue; Zhang, Jianyun; Ma, Huihui; Ji, Dapeng; Huang, Xin; Curry, Thomas E; Liu, Weiping; Liu, Jing

2017-09-05

Pyrethroids, a class of insecticides that are widely used worldwide, have been identified as endocrine-disrupting chemicals (EDCs). Our recent epidemiological study reported on an association of increased pyrethroids exposure with elevated gonadotropins levels and earlier pubertal development in Chinese boys. In this study, we further investigated the effects of cypermethrin (CP), one of the most ubiquitous pyrethroid insecticides, on hypothalamic-pituitary-gonadal (HPG) axis and pubertal onset in male animal models. Early postnatal exposure to CP at environmentally relevant doses (0.5, 5, and 50 μg/kg CP) significantly accelerated the age of puberty onset in male mice. Administration of CP induced a dose-dependent increase in serum levels of luteinizing hormone (LH), follicle-stimulating hormone (FSH) and testosterone in male mice. CP did not affect gonadotropin-releasing hormone (GnRH) gene expression in the hypothalamus, but CP at higher concentrations stimulated GnRH pulse frequency. CP could induce the secretion of LH and FSH, as well as the expression of gonadotropin subunit genes [chorionic gonadotropin α (CGα), LHβ, and FSHβ] in pituitary gonadotropes. CP stimulated testosterone production and the expression of steroidogenesis-related genes [steroidogenic acute regulatory (StAR) and Cytochrome p 450, family 11, subfamily A, polypeptide 1 (CYP11A1)] in testicular Leydig cells. The interference with hypothalamic sodium channels as well as calcium channels in pituitary gonadotropes and testicular Leydig cells was responsible for CP-induced HPG axis maturation. Our findings established in animal models provide further evidence for the biological plausibility of pyrethroid exposure as a potentially environmental contributor to earlier puberty in males.

The non-peptide CRH1-antagonist CP-154,526 elicits a paradoxical route-dependent activation of the HPA axis.

PubMed

Zaretsky, Dmitry V; Zaretskaia, Maria V; Sarkar, Sumit; Rusyniak, Daniel E; DiMicco, Joseph A

2017-07-13

The corticotropin-releasing hormone (CRH) plays an important role in mediating physiological response to stress and is thought to be involved in the development of various psychiatric disorders. In this paper, we compare the differences between the effect of intraperitoneal (i.p.) and intraarterial (i.a.) administration of the non-peptide CRH 1 antagonist CP-154,526 (CP) (10 and 20mg/kg) on plasma adrenocorticotropic hormone levels (ACTH), heart rate, MAP, and c-Fos expression in the paraventricular nucleus of the hypothalamus. Intraperitoneal, but not i.a., injection of CP resulted in an increase in plasma ACTH (from 105±13 to 278±51pg/ml after 20mg/kg). This effect was accompanied by a dramatic increase in c-Fos expression in cells immunoreactive for CRH in the paraventricular nucleus of the hypothalamus. When the drug was administered i.p., CP-induced activation of the HPA appears to mask the inhibitory effect of CP on stress-induced ACTH secretion, an effect which was readily apparent when the drug was given i.a. Intraperitoneal administration of CP also increased the baseline MAP which may account for previous reports that treatment with this drug attenuated the increases associated with stress. CP given by either route had no effect on baseline heart rate or stress-induced tachycardia. Thus, in all studies in which CP 154,526 is given, the route of delivery must be given careful consideration. Copyright © 2017 Elsevier B.V. All rights reserved.

Protein tyrosine phosphatase encoded in Cotesia plutellae bracovirus suppresses a larva-to-pupa metamorphosis of the diamondback moth, Plutella xylostella.

PubMed

Kim, Jiwan; Hepat, Rahul; Lee, Daeweon; Kim, Yonggyun

2013-09-01

Parasitization by an endoparasitoid wasp, Cotesia plutellae, inhibits a larva-to-pupa metamorphosis of the diamondback moth, Plutella xylostella. This study tested an inhibitory effect of C. plutellae bracovirus (CpBV) on the metamorphosis of P. xylostella. Parasitized P. xylostella exhibited significantly reduced prothoracic gland (PTG) development at the last instar compared to nonparasitized larvae. Expression of the ecdysone receptor (EcR) was markedly suppressed during the last instar larvae parasitized by C. plutellae. By contrast, expression of the insulin receptor (InR) significantly increased in the parasitized larvae. Microinjection of CpBV significantly inhibited the larva-to-pupa metamorphosis of nonparasitized larvae in a dose-dependent manner. Injection of CpBV also inhibited the expression of the EcR and increased the expression of the InR. Individual CpBV segments were transiently expressed in its encoded genes in nonparasitized larvae and screened to determine antimetamorphic viral gene(s). Out of 21 CpBV segments, two viral segments (CpBV-S22 and CpBV-S27) were proved to inhibit larva-to-pupa metamorphosis by transient expression assay. RNA interference of each gene encoded in the viral segments was applied to determine antimetamorphic gene(s). Protein tyrosine phosphatase, early expressed gene, and four hypothetical genes were selected to be associated with the antimetamorphic activity of CpBV. These results suggest that antimetamorphosis of P. xylostella parasitized by C. plutellae is induced by inhibiting PTG development and subsequent ecdysteroid signaling with viral factors of CpBV. Copyright © 2013 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lazzaro, Alfio

Note that the main goal of this thesis work is the measurement of the branching fractions, charge asymmetry, and Time-Dependent CP Violation in η'K 0 mode. All other measurements are reported here for completion because they are connected by similar physics arguments. They are part of the Milan analysis activity, done by undergraduate students. They should not be considered as done in this thesis work. The measurements of the two body-modes ηη, ηΦ, and η'Φare used to determine a theoretical bound based on SU(3) flavor symmetry for the difference between SM prediction and the experimental measurements of CP violation parametersmore » in b → s loop-dominated modes. In general for this estimation we need to measure the branching fractions (or upper limits) of neutral B decays to two-body modes with η', η, Φ, ω, π 0, K 0, K* 0 [13, 14, 15, 16]. There is an important issue related to the branching fractions of η'K (charged and neutral) modes. Since the discover of B → η'K in 1997 [17] with high branching fraction (higher than expected), it was found that the corresponding mode with η is suppressed. This fact was pointed out by Lipkin in 1991 [18]. In particular, using arguments concerning the η-η' mixing angle and the parity of K or K* we can say that η'K and vK* are enhanced, while ηK and η'K* are suppressed. This scheme is experimentally verified. The branching fraction of all these modes are already measured, but the B 0 → ηK 0. So it is important to measure also this mode to complete the scenario. Finally we report on the measurements of the radiative modes B → η'Kγ and of the three-body mode B → η'η'K. Both cases are good candidates to manifest effects due to NP in CP violations [19, 20]. For all measurements we use an unbinned maximum likelihood fit to extract the number of signal yields and CP parameters. To perform these fits we have developed a flexible program in C++ language, called MiFit, which has taken a consistent part of the work described in this thesis. This program is used in all Milan analyses. All these measurements have been presented in conferences and published in Physical Review Letters or Physics Review D (Rapid Communication). These measurements are official BABAR results, approved by the Collaboration. The thesis is structured in eight chapters. In the first chapter we describe the CP violation and how it is explained in the SM. We give the theoretical description of the modes studied in this thesis. We report also the latest main results for the CP violation. In the second chapter we describe the BABAR detector with a description of each sub-detector. In the third chapter we describe the software used by the collaboration, in particular the code used in the events reconstruction, which is described in the fourth chapter. In the fifth chapter we describe the software used to selected the events and the MiFit program. After that, in the sixth chapter we show the discriminating variables used for the events selection and how the selection is done. In the last two chapters we report the analyses and results of the branching fractions and charge asymmetries measurements and the time-dependent CP asymmetries analysis of the mode B 0 → η'K 0, respectively.« less

Neutrino CP phases from sneutrino chaotic inflation

NASA Astrophysics Data System (ADS)

Nakayama, Kazunori; Takahashi, Fuminobu; Yanagida, Tsutomu T.

2017-10-01

We study if the minimal sneutrino chaotic inflation is consistent with a flavor symmetry of the Froggatt-Nielsen type, to derive testable predictions on the Dirac and Majorana CP violating phases, δ and α. For successful inflation, the two right-handed neutrinos, i.e., the inflaton and stabilizer fields, must be degenerate in mass. First we find that the lepton flavor symmetry structure becomes less manifest in the light neutrino masses in the seesaw mechanism, and this tendency becomes most prominent when right-handed neutrinos are degenerate. Secondly, the Dirac CP phase turns out to be sensitive to whether the shift symmetry breaking depends on the lepton flavor symmetry. When the flavor symmetry is imposed only on the stabilizer Yukawa couplings, distributions of the CP phases are peaked at δ ≃ ± π / 4 , ± 3 π / 4 and α = 0, while the vanishing and maximal Dirac CP phases are disfavored. On the other hand, when the flavor symmetry is imposed on both the inflaton and stabilizer Yukawa couplings, it is rather difficult to explain the observed neutrino data, and those parameters consistent with the observation prefer the vanishing CP phases δ = 0 , π and α = 0.

Yeast Mitochondrial Leucyl-tRNA Synthetase CP1 Domain Has Functionally Diverged to Accommodate RNA Splicing at Expense of Hydrolytic Editing*

PubMed Central

Sarkar, Jaya; Poruri, Kiranmai; Boniecki, Michal T.; McTavish, Katherine K.; Martinis, Susan A.

2012-01-01

The yeast mitochondrial leucyl-tRNA synthetase (ymLeuRS) performs dual essential roles in group I intron splicing and protein synthesis. A specific LeuRS domain called CP1 is responsible for clearing noncognate amino acids that are misactivated during aminoacylation. The ymLeuRS CP1 domain also plays a critical role in splicing. Herein, the ymLeuRS CP1 domain was isolated from the full-length enzyme and was active in RNA splicing in vitro. Unlike its Escherichia coli LeuRS CP1 domain counterpart, it failed to significantly hydrolyze misaminoacylated tRNALeu. In addition and in stark contrast to the yeast domain, the editing-active E. coli LeuRS CP1 domain failed to recapitulate the splicing activity of the full-length E. coli enzyme. Although LeuRS-dependent splicing activity is rooted in an ancient adaptation for its aminoacylation activity, these results suggest that the ymLeuRS has functionally diverged to confer a robust splicing activity. This adaptation could have come at some expense to the protein's housekeeping role in aminoacylation and editing. PMID:22383526

CpG island methylator phenotype in colorectal cancer

PubMed Central

Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

1999-01-01

Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

The 3-min all-out test is valid for determining critical power but not anaerobic work capacity in tethered running

PubMed Central

2018-01-01

The purpose of the study was to investigate if the 3-min all-out test (3MT) is valid for obtaining critical power intensity (CP) and the amount of work that can be performed above CP (W’) on non-motorized treadmills in tethered running. Eight physically active individuals (24 ± 3 years; 78.3 ± 8.7 kg; 179 ± 5 cm; 9.0 ± 2.5% body fat) performed four different efforts at constant intensity to exhaustion in order to determine CP and W’. The mechanical power values obtained were subsequently plotted with their corresponding time to exhaustion (limit time) for application of three mathematical models: power hyperbolic versus time limit (Hyp), linear power versus 1/time (P vs 1/t) and linear work versus time limit (Ԏ vs t). The 3MT test was carried out on the last day to determine end power (EP) and anaerobic capacity (WEP) using this methodology. EP value of 181.7 ± 52 was similar (p = 0.486) to 178.2 ± 61 (CP Hyp), 191.4 ± 55 (Ԏ vs t) and 188.3 ± 55 (P vs 1/t). WEP value of 17.9 ± 4.8 was not similar (p = 0.000) to 50.2 ± 15.3 (CP Hyp), 44.8 ± 8.7 (Ԏ vs t) and 45.5 ± 8.4 (P vs 1/t). Positive results (r = 0.78–0.98 and ICC = 0.88–0.99) of Pearson correlation and intraclass correlation (ICC–absolute agreement) were found for aerobic applications of conventional CP and 3MT. For anaerobic data, only the three models of conventional CP were correlated (r = 0.76–0.93); however, W’ from the three models was not correlated with WEP (r = 0.37–0.52). The results of this study suggest that 3MT in tethered running on non-motorized treadmills is a valid test for estimating CP aerobic parameters in a single day of application but not anaerobic parameters of W’. PMID:29444141

Chemoprotection by D-methionine against cisplatin-induced side-effects: insight from in vitro studies using human plasma.

PubMed

Sooriyaarachchi, Melani; White, Wade M; Narendran, Aru; Gailer, Jürgen

2014-03-01

Animal studies have shown that the nephrotoxicity and ototoxicity of the anti-cancer drug cisplatin (CP) can be ameliorated by the co-administration with D-methionine. The molecular mechanisms of this activity, however, are not well understood. Since CP is intravenously administered, the underlying chemistry may involve the interaction of CP-derived Pt-species with D-methionine in the bloodstream. Our previous studies have shown that the chemoprotective agents N-acetyl-l-cysteine and sodium thiosulfate modulate the metabolism of CP in human plasma in vitro, albeit in a different manner. Using a metallomics approach, we show that the incubation of human plasma with D-methionine and CP (molar ratio of 20 : 1) leads to the formation of a Pt-D-methionine complex independent of the order of addition. These results were corroborated by analogous experiments that were carried out using PBS-buffer instead of plasma. In addition, CP and D-methionine were added simultaneously to PBS-buffer and samples were analyzed at certain time intervals by the same metallomics method and LC-ESI-MS over a ∼21 h time period. Whereas the intermediate [Pt(NH3)Cl(D-methionine)](+) species was detected between 1-4 h, only the terminal [Pt(D-methionine)2](+) complex was present 21 h later. Combined, these studies demonstrate that in plasma and at the 20 : 1 D-methionine : CP molar ratio, an early CP hydrolysis product reacts with D-methionine to form a 1 : 1 complex that is followed by the formation of a 2 : 1 compound at a later time point. The formation of these Pt-D-methionine species may therefore play an important role in the processes by which D-methionine protects mammalian organisms against CP-induced toxicities.

Multiplex, Rapid, and Sensitive Isothermal Detection of Nucleic-Acid Sequence by Endonuclease Restriction-Mediated Real-Time Multiple Cross Displacement Amplification.

PubMed

Wang, Yi; Wang, Yan; Zhang, Lu; Liu, Dongxin; Luo, Lijuan; Li, Hua; Cao, Xiaolong; Liu, Kai; Xu, Jianguo; Ye, Changyun

2016-01-01

We have devised a novel isothermal amplification technology, termed endonuclease restriction-mediated real-time multiple cross displacement amplification (ET-MCDA), which facilitated multiplex, rapid, specific and sensitive detection of nucleic-acid sequences at a constant temperature. The ET-MCDA integrated multiple cross displacement amplification strategy, restriction endonuclease cleavage and real-time fluorescence detection technique. In the ET-MCDA system, the functional cross primer E-CP1 or E-CP2 was constructed by adding a short sequence at the 5' end of CP1 or CP2, respectively, and the new E-CP1 or E-CP2 primer was labeled at the 5' end with a fluorophore and in the middle with a dark quencher. The restriction endonuclease Nb.BsrDI specifically recognized the short sequence and digested the newly synthesized double-stranded terminal sequences (5' end short sequences and their complementary sequences), which released the quenching, resulting on a gain of fluorescence signal. Thus, the ET-MCDA allowed real-time detection of single or multiple targets in only a single reaction, and the positive results were observed in as short as 12 min, detecting down to 3.125 fg of genomic DNA per tube. Moreover, the analytical specificity and the practical application of the ET-MCDA were also successfully evaluated in this study. Here, we provided the details on the novel ET-MCDA technique and expounded the basic ET-MCDA amplification mechanism.

CT-1-CP-induced ventricular electrical remodeling in mice.

PubMed

Chen, Shu-fen; Wei, Tao-zhi; Rao, Li-ya; Xu, Ming-guang; Dong, Zhan-ling

2015-02-01

The chronic effects of carboxyl-terminal polypeptide of Cardiotrophin-1 (CT-1-CP) on ventricular electrical remodeling were investigated. CT-1-CP, which contains 16 amino acids in sequence of the C-terminal of Cardiotrophin-1, was selected and synthesized, and then administered to Kunming mice (aged 5 weeks) by intraperitoneal injection (500 ng·g⁻¹·day⁻¹) (4 groups, n=10 and female: male=1:1 in each group) for 1, 2, 3 and 4 weeks, respectively. The control group (n=10, female: male=1:1) was injected by physiological saline for 4 weeks. The epicardial monophasic action potential (MAP) was recorded by using a contact-type MAP electrode placed vertically on the left ventricular (LV) epicardium surface, and the electrocardiogram (ECG) signal in lead II was monitored synchronously. ECG intervals (RR, PR, QRS and QT) and the amplitude of MAP (Am), the maximum upstroke velocity (Vmax), as well as action potential durations (APDs) at different repolarization levels (APD30, APD50, APD70, and APD90) of MAP were determined and analyzed in detail. There were no significant differences in RR and P intervals between CT-1-CP-treated groups and control group, but the PR segment and the QRS complex were greater in the former than in the latter (F=2.681 and 5.462 respectively, P<0.05). Though QT interval and the corrected QT interval (QTc) were shorter in CT-1-CP-treated groups than in control group, the QT dispersion (QTd) of them was greater in the latter than in the former (F=3.090, P<0.05) and increased with the time. The ECG monitoring synchronously with the MAP showed that the compression of MAP electrode on the left ventricular epicardium induced performance similar to myocardium ischemia. As compared with those before chest-opening, the PR segment and QT intervals remained basically unchanged in control group, but prolonged significantly in all CT-1-CP-treated groups and the prolongation of QT intervals increased gradually along with the time of exposure to CT-1-CP. The QRS complex had no significant change in control group, one-week and three-week CT-1-CP-treated groups, but prolonged significantly in two-week and four-week CT-1-CP-treated groups. Interestingly, the QTd after chest-opening was significantly greater than that before chest-opening in control group (t=5.242, P<0.01), but decreased along with the time in CT-1-CP-treated groups. The mean MAP amplitude, Vmax and APD were greater in CT-1-CP-treated groups than those in control group, and became more obvious along with the time. The APD in four CT-1-CP-treat groups was prolonged mainly in middle to final repolarization phase. The difference among these groups became significant in middle phase (APD50) (F=6.076, P<0.01) and increased furthermore in late and final phases (APD70: F=10.054; APD90: F=18.691, P<0.01) along with the time of injection of CT-1-CP. The chronic action of CT-1-CP might induce the adapting alteration in cardiac conductivity and ventricular repolarization. The amplitude and the Vmax of the anterior LV epicardial MAP increased obviously, and the APD prolonged mainly in late and final phase of repolarization.

CpG methylation at the USF binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a

PubMed Central

Qiao, Huan; May, James M.

2013-01-01

SVCT2 is the major transporter mediating vitamin C uptake in most organs. Its expression is driven by two promoters (CpG-poor exon 1a promoter and CpG-rich exon 1b promoter). In this work we mapped discrete elements within the proximal CpG-poor promoter responsible for the exon 1a transcription. We identified two E boxes for USF binding and one Y box for NF-Y binding. We further show that the formation of an NFY/USF complex on the exon 1a promoter amplifies each other's ability to bind to the promoter in a cooperativity-dependent manner and is absolutely required for the full activity of the exon 1a promoter. The analysis of the CpG site located at the upstream USF binding site in the promoter showed a strong correlation between expression and demethylation. It was also shown that the exon 1a transcription was induced in cell culture treated with demethylating agent decitabine. The specific methylation of this CpG site impaired both the binding of USF and the formation of the functional NF-Y/USF complex as well as promoter activity, suggesting its importance for the cell-specific transcription. Thus CpG methylation at the upstream USF binding site functions in establishing and maintaining cell-specific transcription from the CpG-poor SVCT2 exon 1a promoter. PMID:21770893

Effectiveness of adaptive pretend play on affective expression and imagination of children with cerebral palsy.

PubMed

Hsieh, Hsieh-Chun

2012-01-01

Children with cerebral palsy (CP) have difficulty participating in role-pretending activities. The concept of adaptive play makes play accessible by modifying play materials for different needs or treatment goals for children with CP. This study examines the affective expressions and imagination in children with CP as a function of ordinary versus adaptive pretend play. The Affect in Play Scale-Brief Rating measured the affective expression and imagination for 29 children with CP and 29 typically developing children (mean age=7.34 years). Two groups of children were observed while playing with a standard set of ordinary toys for ten times and with a standard procedure of adaptive pretend play for ten times. The results show significantly different affective expressions and imagination between the two groups. Typically developing children displayed much more affective expression and imagination. However, a more positive influence of affective expression and imagination occurred in children with CP than in typically developing children. In repeated measures analysis, the frequency of positive affective expression and imagination of children with CP was higher when pretending with adaptive toys. Adaptive pretend play can promote more role-pretending behaviors and a sense of environmental control during the manipulating process for children with CP. Copyright © 2012 Elsevier Ltd. All rights reserved.

Radiative Dileptonic Decays of B-Meson in the General Two Higgs Doublet Model

NASA Astrophysics Data System (ADS)

Erkol, G.; Turan, G.

2002-05-01

We investigate the exclusive B → γ ℓ + ℓ - decay in the general two Higgs Doublet Model (model III) including the neutral Higgs boson effects with an emphasis on possible CP-violating effects. For this decay, we analyze the dependencies of the forward-backward asymmetry of the lepton pair, AFB, CP-violating asymmetry, ACP, and the CP-violating asymmetry in forward-backward asymmetry, ACP(AFB), on the model parameters and also on the neutral Higgs boson effects. We have found that AFB˜ 10-1, 10-2, ACP˜ 10-2, 10-1 and ACP(AFB) ˜ 10-2, 10-1 depending on the relative magnitude of the Yukawa couplings bar ξ N,ttU and bar ξ N,bbD in the model III. We also observe that these physical quantities are sensitive to the model parameters and neutral Higgs boson effects are quite sizable for some values of the coupling bar ξ N,τ τ D.

Analysis of Crosstalk in 3D Circularly Polarized LCDs Depending on the Vertical Viewing Location.

PubMed

Zeng, Menglin; Nguyen, Truong Q

2016-03-01

Crosstalk in circularly polarized (CP) liquid crystal display (LCD) with polarized glasses (passive 3D glasses) is mainly caused by two factors: 1) the polarizing system including wave retarders and 2) the vertical misalignment (VM) of light between the LC module and the patterned retarder. We show that the latter, which is highly dependent on the vertical viewing location, is a much more significant factor of crosstalk in CP LCD than the former. There are three contributions in this paper. Initially, a display model for CP LCD, which accurately characterizes VM, is proposed. A novel display calibration method for the VM characterization that only requires pictures of the screen taken at four viewing locations. In addition, we prove that the VM-based crosstalk cannot be efficiently reduced by either preprocessing the input images or optimizing the polarizing system. Furthermore, we derive the analytic solution for the viewing zone, where the entire screen does not have the VM-based crosstalk.

Particle-type dependence of azimuthal anisotropy and nuclear modification of particle production in Au+Au collisions at square root of sNN=200 GeV.

PubMed

Adams, J; Adler, C; Aggarwal, M M; Ahammed, Z; Amonett, J; Anderson, B D; Anderson, M; Arkhipkin, D; Averichev, G S; Badyal, S K; Balewski, J; Barannikova, O; Barnby, L S; Baudot, J; Bekele, S; Belaga, V V; Bellwied, R; Berger, J; Bezverkhny, B I; Bhardwaj, S; Bhaskar, P; Bhati, A K; Bichsel, H; Billmeier, A; Bland, L C; Blyth, C O; Bonner, B E; Botje, M; Boucham, A; Brandin, A; Bravar, A; Cadman, R V; Cai, X Z; Caines, H; Calderón de la Barca Sánchez, M; Carroll, J; Castillo, J; Castro, M; Cebra, D; Chaloupka, P; Chattopadhyay, S; Chen, H F; Chen, Y; Chernenko, S P; Cherney, M; Chikanian, A; Choi, B; Christie, W; Coffin, J P; Cormier, T M; Cramer, J G; Crawford, H J; Das, D; Das, S; Derevschikov, A A; Didenko, L; Dietel, T; Dong, W J; Dong, X; Draper, J E; Du, F; Dubey, A K; Dunin, V B; Dunlop, J C; Dutta Majumdar, M R; Eckardt, V; Efimov, L G; Emelianov, V; Engelage, J; Eppley, G; Erazmus, B; Estienne, M; Fachini, P; Faine, V; Faivre, J; Fatemi, R; Filimonov, K; Filip, P; Finch, E; Fisyak, Y; Flierl, D; Foley, K J; Fu, J; Gagliardi, C A; Gagunashvili, N; Gans, J; Ganti, M S; Gaudichet, L; Germain, M; Geurts, F; Ghazikhanian, V; Ghosh, P; Gonzalez, J E; Grachov, O; Grigoriev, V; Gronstal, S; Grosnick, D; Guedon, M; Guertin, S M; Gupta, A; Gushin, E; Gutierrez, T D; Hallman, T J; Hardtke, D; Harris, J W; Heinz, M; Henry, T W; Heppelmann, S; Herston, T; Hippolyte, B; Hirsch, A; Hjort, E; Hoffmann, G W; Horsley, M; Huang, H Z; Huang, S L; Humanic, T J; Igo, G; Ishihara, A; Jacobs, P; Jacobs, W W; Janik, M; Jiang, H; Johnson, I; Jones, P G; Judd, E G; Kabana, S; Kaneta, M; Kaplan, M; Keane, D; Khodyrev, V Yu; Kiryluk, J; Kisiel, A; Klay, J; Klein, S R; Klyachko, A; Koetke, D D; Kollegger, T; Kopytine, M; Kotchenda, L; Kovalenko, A D; Kramer, M; Kravtsov, P; Kravtsov, V I; Krueger, K; Kuhn, C; Kulikov, A I; Kumar, A; Kunde, G J; Kunz, C L; Kutuev, R Kh; Kuznetsov, A A; Lamont, M A C; Landgraf, J M; Lange, S; Lansdell, C P; Lasiuk, B; Laue, F; Lauret, J; Lebedev, A; Lednický, R; LeVine, M J; Li, C; Li, Q; Lindenbaum, S J; Lisa, M A; Liu, F; Liu, L; Liu, Z; Liu, Q J; Ljubicic, T; Llope, W J; Long, H; Longacre, R S; Lopez-Noriega, M; Love, W A; Ludlam, T; Lynn, D; Ma, J; Ma, Y G; Magestro, D; Mahajan, S; Mangotra, L K; Mahapatra, D P; Majka, R; Manweiler, R; Margetis, S; Markert, C; Martin, L; Marx, J; Matis, H S; Matulenko, Yu A; McShane, T S; Meissner, F; Melnick, Yu; Meschanin, A; Messer, M; Miller, M L; Milosevich, Z; Minaev, N G; Mironov, C; Mishra, D; Mitchell, J; Mohanty, B; Molnar, L; Moore, C F; Mora-Corral, M J; Morozov, D A; Morozov, V; de Moura, M M; Munhoz, M G; Nandi, B K; Nayak, S K; Nayak, T K; Nelson, J M; Nevski, P; Nikitin, V A; Nogach, L V; Norman, B; Nurushev, S B; Odyniec, G; Ogawa, A; Okorokov, V; Oldenburg, M; Olson, D; Paic, G; Pandey, S U; Pal, S K; Panebratsev, Y; Panitkin, S Y; Pavlinov, A I; Pawlak, T; Perevoztchikov, V; Perkins, C; Peryt, W; Petrov, V A; Phatak, S C; Picha, R; Planinic, M; Pluta, J; Porile, N; Porter, J; Poskanzer, A M; Potekhin, M; Potrebenikova, E; Potukuchi, B V K S; Prindle, D; Pruneau, C; Putschke, J; Rai, G; Rakness, G; Raniwala, R; Raniwala, S; Ravel, O; Ray, R L; Razin, S V; Reichhold, D; Reid, J G; Renault, G; Retiere, F; Ridiger, A; Ritter, H G; Roberts, J B; Rogachevski, O V; Romero, J L; Rose, A; Roy, C; Ruan, L J; Sahoo, R; Sakrejda, I; Salur, S; Sandweiss, J; Savin, I; Schambach, J; Scharenberg, R P; Schmitz, N; Schroeder, L S; Schweda, K; Seger, J; Seliverstov, D; Seyboth, P; Shahaliev, E; Shao, M; Sharma, M; Shestermanov, K E; Shimanskii, S S; Singaraju, R N; Simon, F; Skoro, G; Smirnov, N; Snellings, R; Sood, G; Sorensen, P; Sowinski, J; Spinka, H M; Srivastava, B; Stanislaus, S; Stock, R; Stolpovsky, A; Strikhanov, M; Stringfellow, B; Struck, C; Suaide, A A P; Sugarbaker, E; Suire, C; Sumbera, M; Surrow, B; Symons, T J M; de Toledo, A Szanto; Szarwas, P; Tai, A; Takahashi, J; Tang, A H; Thein, D; Thomas, J H; Tikhomirov, V; Tokarev, M; Tonjes, M B; Trainor, T A; Trentalange, S; Tribble, R E; Trivedi, M D; Trofimov, V; Tsai, O; Ullrich, T; Underwood, D G; Van Buren, G; VanderMolen, A M; Vasiliev, A N; Vasiliev, M; Vigdor, S E; Viyogi, Y P; Voloshin, S A; Waggoner, W; Wang, F; Wang, G; Wang, X L; Wang, Z M; Ward, H; Watson, J W; Wells, R; Westfall, G D; Whitten, C; Wieman, H; Willson, R; Wissink, S W; Witt, R; Wood, J; Wu, J; Xu, N; Xu, Z; Xu, Z Z; Yamamoto, E; Yepes, P; Yurevich, V I; Zanevski, Y V; Zborovský, I; Zhang, H; Zhang, W M; Zhang, Z P; Zołnierczuk, P A; Zoulkarneev, R; Zoulkarneeva, J; Zubarev, A N

2004-02-06

We present STAR measurements of the azimuthal anisotropy parameter v(2) and the binary-collision scaled centrality ratio R(CP) for kaons and lambdas (Lambda+Lambda) at midrapidity in Au+Au collisions at square root of s(NN)=200 GeV. In combination, the v(2) and R(CP) particle-type dependencies contradict expectations from partonic energy loss followed by standard fragmentation in vacuum. We establish p(T) approximately 5 GeV/c as the value where the centrality dependent baryon enhancement ends. The K(0)(S) and Lambda+Lambda v(2) values are consistent with expectations of constituent-quark-number scaling from models of hadron formation by parton coalescence or recombination.

Poly-L-arginine synergizes with oligodeoxynucleotides containing CpG-motifs (CpG-ODN) for enhanced and prolonged immune responses and prevents the CpG-ODN-induced systemic release of pro-inflammatory cytokines.

PubMed

Lingnau, Karen; Egyed, Alena; Schellack, Carola; Mattner, Frank; Buschle, Michael; Schmidt, Walter

2002-10-04

This study describes an entirely synthetic vaccine composed of antigenic peptides (T cell epitopes), oligodeoxynucleotides containing CpG-motifs (CpG-ODN) and poly-L-arginine (pR). CpG-ODN are known to be potent inducers of predominantly type 1-like immune responses, while polycationic amino acids, like pR, facilitate the uptake of antigens into antigen presenting cells (APCs). We demonstrate that the application of peptides and pR/CpG-ODN results in strongly enhanced peptide-specific immune responses as compared to the application of peptides with either of the immunomodulators alone. High numbers of antigen-specific T cells can be observed even after only one injection of the vaccine for a remarkably long period of time (at least 372 days). Furthermore, the potentially harmful systemic release of pro-inflammatory cytokines induced upon injection of CpG-ODN is inhibited. Thus, the combined application of CpG-ODN and pR may represent a novel vaccine strategy in humans.

FRET analysis of CP12 structural interplay by GAPDH and PRK.

PubMed

Moparthi, Satish Babu; Thieulin-Pardo, Gabriel; de Torres, Juan; Ghenuche, Petru; Gontero, Brigitte; Wenger, Jérôme

2015-03-13

CP12 is an intrinsically disordered protein playing a key role in the regulation of the Benson-Calvin cycle. Due to the high intrinsic flexibility of CP12, it is essential to consider its structural modulation induced upon binding to the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK) enzymes. Here, we report for the first time detailed structural modulation about the wild-type CP12 and its site-specific N-terminal and C-terminal disulfide bridge mutants upon interaction with GAPDH and PRK by Förster resonance energy transfer (FRET). Our results indicate an increase in CP12 compactness when the complex is formed with GAPDH or PRK. In addition, the distributions in FRET histograms show the elasticity and conformational flexibility of CP12 in all supra molecular complexes. Contrarily to previous beliefs, our FRET results importantly reveal that both N-terminal and C-terminal site-specific CP12 mutants are able to form the monomeric (GAPDH-CP12-PRK) complex. Copyright © 2015 Elsevier Inc. All rights reserved.

Effects of Methylphenidate and Behavior Modification on the Social and Academic Behavior of Children with Disruptive Behavior Disorders: The Moderating Role of Callous/Unemotional Traits

ERIC Educational Resources Information Center

Waschbusch, Daniel A.; Carrey, Normand J.; Willoughby, Michael T.; King, Sara; Andrade, Brendan F.

2007-01-01

This study examined whether response to behavior modification with and without methylphenidate differed for children with attention-deficit/hyperactivity disorder (ADHD) and conduct problems (CP) depending on the presence of callous/unemotional (CU) traits. Participants were 37 children ages 7 to 12, including 19 with ADHD/CP-only and 18 with…

Synergistic activity of biocides and antibiotics on resistant bacteria from organically produced foods.

PubMed

Fernández Fuentes, Miguel Angel; Abriouel, Hikmate; Gadea, Rebeca; Pérez Pulido, Rubén; Gálvez, Antonio; Ortega, Elena

2014-10-01

Synergism between biocides and antibiotics was investigated in 20 biocide and antibiotic-resistant bacterial strains that were previously isolated from organically produced foods, according to their antimicrobial resistance profiles. Most of the antibiotic/biocide combinations yielded synergistic interactions, reducing the inhibitory concentrations of biocides and antibiotics by 4- to 16-fold. Among enterococci, synergism with biocides was detected for amoxicillin (AM), cefuroxime (CX), erythromycin (EM), ciprofloxacin (CP), and trimethoprim/sulphametoxazol (T/S). Among staphylococci, interactions were synergistic (AM) and either synergistic or indifferent (CX and EM, depending on biocide). Among the three methicillin-resistant Staphylococcus aureus clinical strains included in the study, the combinations of methicillin and triclosan or hexachlorophene acted synergistically in all strains, but interactions were either synergistic or indifferent for the other biocides, depending on the strain. All combinations tested were synergistic for Lactobacillus (AM, CX, EM, and CP) and Micrococcus (AM, EM). In Salmonella, interactions were indifferent (AM, CX, EM, and CP) or synergistic (T/S). Synergism with biocides was also detected in Klebsiella isolates (AM, CX, and T/S), Enterobacter sp. (AM, CX, EM, and T/S), Pantoea (AM, CX, EM, CP, and T/S), and Chryseobacterium sp. (EM). These results suggest that combinations of biocides and antibiotics may open new possibilities to combat antimicrobial resistance.

Characterization of a lambda-cyhalothrin metabolizing glutathione S-transferase CpGSTd1 from Cydia pomonella (L.).

PubMed

Liu, Jiyuan; Yang, Xueqing; Zhang, Yalin

2014-11-01

In insects, glutathione S-transferases (GSTs) are enzymes involved in detoxification of insecticides. However, few data are available for the codling moth, Cydia pomonella (L.). In this study, we cloned a delta class GST gene CpGSTd1 from C. pomonella. Real-time quantitative PCR shows that CpGSTd1 was up-regulated with aging, and the mRNA level of CpGSTd1 was higher in the fat body and silk glands than in other tissues. The expression level of CpGSTd1 exposure to insecticide suggests that CpGSTd1 is up-regulated after chlorpyrifos-methyl and lambda-cyhalothrin treatments. Both lambda-cyhalothrin and chlorpyrifos-methyl altered GST activity in vivo. The purified CpGSTd1 protein exhibits a high catalytic efficiency with CDNB and was inhibited by lambda-cyhalothrin and chlorpyrifos-methyl in vitro. Metabolism assays indicate that lambda-cyhalothrin was significantly metabolized while chlorpyrifos-methyl was not metabolized by CpGSTd1. Binding free energy analysis suggests that CpGSTd1 binding is tighter with lambda-cyhalothrin than with chlorpyrifos-methyl. Our study suggests that CpGSTd1 plays a key role in the metabolism of insecticides in C. pomonella.

QuickView video preview software of colon capsule endoscopy: reliability in presenting colorectal polyps as compared to normal mode reading.

PubMed

Farnbacher, Michael J; Krause, Horst H; Hagel, Alexander F; Raithel, Martin; Neurath, Markus F; Schneider, Thomas

2014-03-01

OBJECTIVE. Colon capsule endoscopy (CCE) proved to be highly sensitive in detection of colorectal polyps (CP). Major limitation is the time-consuming video reading. The aim of this prospective, double-center study was to assess the theoretical time-saving potential and its possible impact on the reliability of "QuickView" (QV), in the presentation of CP as compared to normal mode (NM). METHODS. During NM reading of 65 CCE videos (mean patient´s age 56 years), all frames showing CPs were collected and compared to the number of frames presented by QV at increasing QV settings (10, 20, ... 80%). Reliability of QV in presenting polyps <6 mm and ≥6 mm (significant polyp), and identifying patients for subsequent therapeutic colonoscopy, capsule egestion rate, cleansing level, and estimated time-saving potential were assessed. RESULTS. At a 30% QV setting, the QV video presented 89% of the significant polyps and 86% of any polyps with ≥1 frame (per-polyp analysis) identified in NM before. At a 10% QV setting, 98% of the 52 patients with significant polyps could be identified (per-patient analysis) by QV video analysis. Capsule excretion rate was 74% and colon cleanliness was adequate in 85%. QV´s presentation rate correlates to the QV setting, the polyp size, and the number of frames per finding. CONCLUSIONS. Depending on its setting, the reliability of QV in presenting CP as compared to NM reading is notable. However, if no significant polyp is presented by QV, NM reading must be performed afterwards. The reduction of frames to be analyzed in QV might speed up identification of candidates for therapeutic colonoscopy.

Paternal psychosocial characteristics and corporal punishment of their 3-year-old children.

PubMed

Lee, Shawna J; Perron, Brian E; Taylor, Catherine A; Guterman, Neil B

2011-01-01

This study uses data from 2,309 biological fathers who participated in the Fragile Families and Child Well-Being Study (FFCWS) to examine associations between psychosocial characteristics and levels of corporal punishment (CP) toward their 3-year-old children over the past month. Results indicate that 61% of the fathers reported no CP over the past month, 23% reported using CP once or twice, and 16% reported using CP a few times in the past month or more. In multivariate models controlling for important sociodemographic factors as well as characteristics of the child, fathers' parenting stress, major depression, heavy alcohol use, and drug use were significantly associated with greater use of CP, whereas involvement with the child and generalized anxiety disorder were not. Girls were less likely to be the recipient of CP than were boys, and child externalizing behavior problems but not internalizing behavior problems were associated with more CP.

38 CFR 21.8070 - Basic duration of a vocational training program.

Code of Federal Regulations, 2010 CFR

2010-07-01

... vocational rehabilitation, the CP or VRC will estimate the time the child needs to complete a vocational... training period the eligible child needs, the CP or VRC must determine that: (1) The proposed vocational.... In calculating the proposed program's length, the CP or VRC will follow the procedures in § 21.8074(a...

The discovery reach of CP violation in neutrino oscillation with non-standard interaction effects

NASA Astrophysics Data System (ADS)

Rahman, Zini; Dasgupta, Arnab; Adhikari, Rathin

2015-06-01

We have studied the CP violation discovery reach in a neutrino oscillation experiment with superbeam, neutrino factory and monoenergetic neutrino beam from the electron capture process. For NSI satisfying model-dependent bound for shorter baselines (like CERN-Fréjus set-up) there is insignificant effect of NSI on the the discovery reach of CP violation due to δ. Particularly, for the superbeam and neutrino factory we have also considered relatively longer baselines for which there could be significant NSI effects on CP violation discovery reach for higher allowed values of NSI. For the monoenergetic beam only shorter baselines are considered to study CP violation with different nuclei as neutrino sources. Interestingly for non-standard interactions—{{\\varepsilon }eμ } and {{\\varepsilon }eτ } of neutrinos with matter during propagation in longer baselines in the superbeam, there is the possibility of better discovery reach of CP violation than that with only Standard Model interactions of neutrinos with matter. For complex NSI we have shown the CP violation discovery reach in the plane of Dirac phase δ and NSI phase {{φ }ij}. The CP violation due to some values of δ remain unobservable with present and near future experimental facilities in the superbeam and neutrino factory. However, in the presence of some ranges of off-diagonal NSI phase values there are some possibilities of discovering total CP violation for any {{δ }CP} value even at 5σ confidence level for neutrino factory. Our analysis indicates that for some values of NSI phases total CP violation may not be at all observable for any values of δ. Combination of shorter and longer baselines could indicate in some cases the presence of NSI. However, in general for NSIs ≲ 1 the CP violation discovery reach is better in neutrino factory set-ups. Using a neutrino beam from the electron capture process for nuclei 50110Sn and 152Yb, we have shown the discovery reach of CP violation in a neutrino oscillation experiment. Particularly for 50110Sn nuclei CP violation could be found for about 51% of the possible δ values for a baseline of 130 km with boost factor γ =500. Although the nuclei 152Yb is technically more feasible for the production of a mono-energetic beam, it is found to be unsuitable in obtaining good discovery reach of CP violation.

Prediction of CpG-island function: CpG clustering vs. sliding-window methods

PubMed Central

2010-01-01

Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

Multi-scale Modeling of Plasticity in Tantalum.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Hojun; Battaile, Corbett Chandler.; Carroll, Jay

In this report, we present a multi-scale computational model to simulate plastic deformation of tantalum and validating experiments. In atomistic/ dislocation level, dislocation kink- pair theory is used to formulate temperature and strain rate dependent constitutive equations. The kink-pair theory is calibrated to available data from single crystal experiments to produce accurate and convenient constitutive laws. The model is then implemented into a BCC crystal plasticity finite element method (CP-FEM) model to predict temperature and strain rate dependent yield stresses of single and polycrystalline tantalum and compared with existing experimental data from the literature. Furthermore, classical continuum constitutive models describingmore » temperature and strain rate dependent flow behaviors are fit to the yield stresses obtained from the CP-FEM polycrystal predictions. The model is then used to conduct hydro- dynamic simulations of Taylor cylinder impact test and compared with experiments. In order to validate the proposed tantalum CP-FEM model with experiments, we introduce a method for quantitative comparison of CP-FEM models with various experimental techniques. To mitigate the effects of unknown subsurface microstructure, tantalum tensile specimens with a pseudo-two-dimensional grain structure and grain sizes on the order of millimeters are used. A technique combining an electron back scatter diffraction (EBSD) and high resolution digital image correlation (HR-DIC) is used to measure the texture and sub-grain strain fields upon uniaxial tensile loading at various applied strains. Deformed specimens are also analyzed with optical profilometry measurements to obtain out-of- plane strain fields. These high resolution measurements are directly compared with large-scale CP-FEM predictions. This computational method directly links fundamental dislocation physics to plastic deformations in the grain-scale and to the engineering-scale applications. Furthermore, direct and quantitative comparisons between experimental measurements and simulation show that the proposed model accurately captures plasticity in deformation of polycrystalline tantalum.« less

Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

PubMed Central

Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

2016-01-01

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners. PMID:27100087

Fundamental movement skills and physical activity among children with and without cerebral palsy.

PubMed

Capio, Catherine M; Sit, Cindy H P; Abernethy, Bruce; Masters, Rich S W

2012-01-01

Fundamental movement skills (FMS) proficiency is believed to influence children's physical activity (PA), with those more proficient tending to be more active. Children with cerebral palsy (CP), who represent the largest diagnostic group treated in pediatric rehabilitation, have been found to be less active than typically developing children. This study examined the association of FMS proficiency with PA in a group of children with CP, and compared the data with a group of typically developing children. Five FMS (run, jump, kick, throw, catch) were tested using process- and product-oriented measures, and accelerometers were used to monitor PA over a 7-day period. The results showed that children with CP spent less time in moderate to vigorous physical activity (MVPA), but more time in sedentary behavior than typically developing children. FMS proficiency was negatively associated with sedentary time and positively associated with time spent in MVPA in both groups of children. Process-oriented FMS measures (movement patterns) were found to have a stronger influence on PA in children with CP than in typically developing children. The findings provide evidence that FMS proficiency facilitates activity accrual among children with CP, suggesting that rehabilitation and physical education programs that support FMS development may contribute to PA-related health benefits. Copyright © 2012 Elsevier Ltd. All rights reserved.

Predicting the Soil Phosphorus Dynamics of the Ploughed Layer Under Continuous Cultivation and P Fertilization

NASA Astrophysics Data System (ADS)

Morel, C.; Augusto, L.; Gallet-Budynek, A. S.

2011-12-01

One major component of the biogeochemical cycling of phosphorus (P) in soils is the plant-available soil P. Its sound management, to minimize the loss of soil P to surface waters while ensuring enough P to sustain soil fertility, requires being able to predict the long term dynamics of plant-available soil P with the P budget. We examined the ability of a simple model to predict the change in plant-available soil P of the ploughed layer for almost 3 decades of continuous cultivation and P fertilization. We used a process-based assessment of plant-availability that considers both the concentration (Cp) of phosphate ions (Pi) in solution and the time-dependent amount (Pr) of Pi bound to the soil solid phase that can diffuse towards solution that equilibrates with time Pi in solution under the effect of a gradient of concentration. Soil analyses were performed in batch experiment on soil suspensions using a 32Pi-dilution method at steady-state. The modeling considered the difference between P inputs minus P outputs. This annual P budget was partitioned between Cp and Pr for one year. Every year the P budget was calculated as the added P to soil minus the P removed in grain yields and the P that leaves the plough layer by leaching estimated as the simulated Cp value multiplied by the annual volume of drainage water. Other fluxes that can play a role in P cycling such as atmospheric deposit, preferential, subsurface and surface flows were neglected. We analyzed archived soil samples, taken up every 3-4 years from a long-term field experiment (1972-2000) on a sandy soil under temperate climate. It comprised 4 replicates and 3 annual rates of P application as commercial superphosphate: 0, 44 and 96 kg Pha-1 yr-1. The crop was a monoculture of irrigated-maize. Grain yields and their P content were determined every year for all plots. The overall corn grain yield over almost 3 decades was: 11.6 t ha-1 yr-1 (mean P content of grain = 3.0 g P kg¬-1). The starting Cp value in 1972 was 1.31 mg P L. At the end of the experiment, the measured Cp values ranged from 0.44 to 3.86 mg P L-1 due to the cumulative P budget which varied between -825 to +1400 kg-1 ha-1 including the calculated leached P beyond the plough layer (from -129 to -384 kg P ha-1). Experimental Pr values vs. Cp and time were highly and closely (r2=0.94; n=108) fitted by a single kinetic Freundlich equation, irrespective of the year of sampling. This equation was used to calculate Pr value after one year. To test the predictive capability of the model, we compared the simulated Cp values by the model to the field-observed Cp values. The model reproduced the most important patterns of the fate of soil P for the different P fertilization treatments. Simulated Cp values were not significantly different from the field-observed Cp values for the 0 and 44 kg P ha-1 yr-1 treatments, but some discrepancies were observed for the 96 kg P ha-1 yr-1 treatment. The next step in the generalization of our results would be to test the model performance in other field conditions. This investigation highlights the importance of long-term field experiments with archived soil samples and complete database on plant biomass for understanding P cycling and soil P dynamics.

Ceruloplasmin: Macromolecular Assemblies with Iron-Containing Acute Phase Proteins

PubMed Central

Samygina, Valeriya R.; Sokolov, Alexey V.; Bourenkov, Gleb; Petoukhov, Maxim V.; Pulina, Maria O.; Zakharova, Elena T.; Vasilyev, Vadim B.; Bartunik, Hans; Svergun, Dmitri I.

2013-01-01

Copper-containing ferroxidase ceruloplasmin (Cp) forms binary and ternary complexes with cationic proteins lactoferrin (Lf) and myeloperoxidase (Mpo) during inflammation. We present an X-ray crystal structure of a 2Cp-Mpo complex at 4.7 Å resolution. This structure allows one to identify major protein–protein interaction areas and provides an explanation for a competitive inhibition of Mpo by Cp and for the activation of p-phenylenediamine oxidation by Mpo. Small angle X-ray scattering was employed to construct low-resolution models of the Cp-Lf complex and, for the first time, of the ternary 2Cp-2Lf-Mpo complex in solution. The SAXS-based model of Cp-Lf supports the predicted 1∶1 stoichiometry of the complex and demonstrates that both lobes of Lf contact domains 1 and 6 of Cp. The 2Cp-2Lf-Mpo SAXS model reveals the absence of interaction between Mpo and Lf in the ternary complex, so Cp can serve as a mediator of protein interactions in complex architecture. Mpo protects antioxidant properties of Cp by isolating its sensitive loop from proteases. The latter is important for incorporation of Fe3+ into Lf, which activates ferroxidase activity of Cp and precludes oxidation of Cp substrates. Our models provide the structural basis for possible regulatory role of these complexes in preventing iron-induced oxidative damage. PMID:23843990

Photodissociation dynamics of gaseous CpCo(CO)2 and ligand exchange reactions of CpCoH2 with C3H4, C3H6, and NH3.

PubMed

Oana, Melania; Nakatsuka, Yumiko; Albert, Daniel R; Davis, H Floyd

2012-05-31

The photodissociation dynamics of CpCo(CO)(2) was studied in a molecular beam using photofragment translational energy spectroscopy with 157 nm photoionization detection of the metallic products. At 532 and 355 nm excitation, the dominant one-photon channel involved loss of a single CO ligand producing CpCoCO. The product angular distributions were isotropic, and a large fraction of excess energy appeared as product vibrational excitation. Production of CpCO + 2CO resulted from two-photon absorption processes. The two-photon dissociation of mixtures containing CpCo(CO)(2) and H(2) at the orifice of a pulsed nozzle was used to produce a novel 16-electron unsaturated species, CpCoH(2). Transition metal ligand exchange reactions, CpCoH(2) + L → CpCoL + H(2) (L = propyne, propene, or ammonia), were studied under single-collision conditions for the first time. In all cases, ligand exchange occurred via 18-electron association complexes with lifetimes comparable to their rotational periods. Although ligand exchange reactions were not detected from CpCoH(2) collisions with methane or propane (L = CH(4) or C(3)H(8)), a molecular beam containing CpCoCH(4) was produced by photolysis of mixtures containing CpCo(CO)(2) and CH(4).

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5.

PubMed

Therien, Jesse B; Artz, Jacob H; Poudel, Saroj; Hamilton, Trinity L; Liu, Zhenfeng; Noone, Seth M; Adams, Michael W W; King, Paul W; Bryant, Donald A; Boyd, Eric S; Peters, John W

2017-01-01

The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro , with CpII capturing excess reducing equivalents under nitrogen fixation conditions. Comparison of the primary sequences of CpI and CpII and their homologs provides an initial basis for identifying key structural determinants that modulate hydrogen production and hydrogen oxidation activities.

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5

DOE PAGES

Therien, Jesse B.; Artz, Jacob H.; Poudel, Saroj; ...

2017-07-12

Here, the first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogenmore » production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with CpII capturing excess reducing equivalents under nitrogen fixation conditions. Comparison of the primary sequences of CpI and CpII and their homologs provides an initial basis for identifying key structural determinants that modulate hydrogen production and hydrogen oxidation activities.« less

The Physiological Functions and Structural Determinants of Catalytic Bias in the [FeFe]-Hydrogenases CpI and CpII of Clostridium pasteurianum Strain W5

PubMed Central

Therien, Jesse B.; Artz, Jacob H.; Poudel, Saroj; Hamilton, Trinity L.; Liu, Zhenfeng; Noone, Seth M.; Adams, Michael W. W.; King, Paul W.; Bryant, Donald A.; Boyd, Eric S.; Peters, John W.

2017-01-01

The first generation of biochemical studies of complex, iron-sulfur-cluster-containing [FeFe]-hydrogenases and Mo-nitrogenase were carried out on enzymes purified from Clostridium pasteurianum (strain W5). Previous studies suggested that two distinct [FeFe]-hydrogenases are expressed differentially under nitrogen-fixing and non-nitrogen-fixing conditions. As a result, the first characterized [FeFe]-hydrogenase (CpI) is presumed to have a primary role in central metabolism, recycling reduced electron carriers that accumulate during fermentation via proton reduction. A role for capturing reducing equivalents released as hydrogen during nitrogen fixation has been proposed for the second hydrogenase, CpII. Biochemical characterization of CpI and CpII indicated CpI has extremely high hydrogen production activity in comparison to CpII, while CpII has elevated hydrogen oxidation activity in comparison to CpI when assayed under the same conditions. This suggests that these enzymes have evolved a catalytic bias to support their respective physiological functions. Using the published genome of C. pasteurianum (strain W5) hydrogenase sequences were identified, including the already known [NiFe]-hydrogenase, CpI, and CpII sequences, and a third hydrogenase, CpIII was identified in the genome as well. Quantitative real-time PCR experiments were performed in order to analyze transcript abundance of the hydrogenases under diazotrophic and non-diazotrophic growth conditions. There is a markedly reduced level of CpI gene expression together with concomitant increases in CpII gene expression under nitrogen-fixing conditions. Structure-based analyses of the CpI and CpII sequences reveal variations in their catalytic sites that may contribute to their alternative physiological roles. This work demonstrates that the physiological roles of CpI and CpII are to evolve and to consume hydrogen, respectively, in concurrence with their catalytic activities in vitro, with CpII capturing excess reducing equivalents under nitrogen fixation conditions. Comparison of the primary sequences of CpI and CpII and their homologs provides an initial basis for identifying key structural determinants that modulate hydrogen production and hydrogen oxidation activities. PMID:28747909

Candida pyralidae killer toxin disrupts the cell wall of Brettanomyces bruxellensis in red grape juice.

PubMed

Mehlomakulu, N N; Prior, K J; Setati, M E; Divol, B

2017-03-01

The control of the wine spoilage yeast Brettanomyces bruxellensis using biological methods such as killer toxins (instead of the traditional chemical methods, e.g. SO 2 ) has been the focus of several studies within the last decade. Our previous research demonstrated that the killer toxins CpKT1 and CpKT2 isolated from the wine yeast Candida pyralidae were active and stable under winemaking conditions. In this study, we report the possible mode of action of CpKT1 on B. bruxellensis cells in red grape juice. Brettanomyces bruxellensis cells were exposed to CpKT1 either directly or through co-inoculation with C. pyralidae. This exposure yielded a temporary or permanent decline of the spoilage yeast population depending on the initial cell concentration. Scanning electron microscopy revealed cell surface abrasion while propidium iodide viability staining showed that CpKT1 caused plasma membrane damage on B. bruxellensis cells. Our data show that the exposure to CpKT1 resulted in increased levels of β-glucan, suggesting a compensatory response of the sensitive cells. The toxin CpKT1 causes cell membrane and cell wall damage in B. bruxellensis. Candida pyralidae shows potential to be used as a biocontrol agent against B. bruxellensis in grape juice/wine. © 2016 The Society for Applied Microbiology.

Preparation of TiO(2) layers on cp-Ti and Ti6Al4V by thermal and anodic oxidation and by sol-gel coating techniques and their characterization.

PubMed

Velten, D; Biehl, V; Aubertin, F; Valeske, B; Possart, W; Breme, J

2002-01-01

The excellent biocompatibility of titanium and its alloys used, for example, for medical devices, is associated with the properties of their surface oxide. For a better understanding of the tissue reaction in contact with the oxide layer, knowledge of the chemical and physical properties of this layer is of increasing interest. In this study, titania films were produced on cp-Ti and Ti6Al4V substrates by thermal oxidation, anodic oxidation, and by the sol-gel process. The thickness and structure of the films produced under different conditions were determined by ellipsometry, infrared spectroscopy, and X-ray diffraction measurements. The corrosion properties of these layers were investigated by current density-potential curves under physiological conditions. The oxide layers produced on cp-Ti and Ti6Al4V by thermal oxidation consist of TiO(2) in the rutile structure. For the anodized samples the structure of TiO(2) is a mixture of amorphous phase and anatase. The structure of the coatings produced by the sol-gel process for a constant annealing time depends on the annealing temperature, and with increasing temperature successively amorphous, anatase, and rutile structure is observed. Compared to the uncoated, polished substrate with a natural oxide layer, the corrosion resistance of cp-Ti and Ti6Al4V is increased for the samples with an oxide layer thickness of about 100 nm, independent of the oxidation procedure. Copyright 2001 John Wiley & Sons, Inc.

Microplate array diagonal gel electrophoresis (MADGE), CpG-PCR and temporal thermal ramp-MADGE (Melt-MADGE) for single nucleotide analyses in populations.

PubMed

Day, I N; O'Dell, S D; Spanakis, E; Weavind, G P

1999-02-01

Important requirements for molecular genetic epidemiological studies are economy, sample parallelism, convenience of setup and accessibility, goals inadequately met by existent approaches. We invented microplate array diagonal gel electrophoresis (MADGE) to gain simultaneously the advantages of simple setup, 96-well microplate compatibility, horizontal electrophoresis, and the resolution of polyacrylamide. At essentially no equipment cost (one simple plastic gel former), 10-100-fold savings on time for sample coding, liquid transfers, and data documentation, in addition to volume reductions and gel re-use, can be achieved. MADGE is compatible with ARMS, restriction analysis and other pattern analyses. CpG-PCR is a general PCR approach to CpG sites (10-20% of all human single base variation): both primers have 3' T, and are abutted to the CpG, forcing a TaqI restriction site if the CpG is intact. Typically, a 52 bp PCR product is then cut in half. CpG-PCR also illustrates that PAGE-MADGE readily permits analysis of 'ultrashort' PCRs. Melt-MADGE employs real-time-variable-temperature electrophoresis to examine duplex mobility during melting, achieving DGGE-like de novo, mutation scanning, but with the conveniences of arbitrary programmability, MADGE compatibility and short run time. This suite of methods enhances our capability to type or scan thousands of samples simultaneously, by 10-100-fold.

Cytotect®CP as salvage therapy in patients with CMV infection following allogeneic hematopoietic cell transplantation: a multicenter retrospective study.

PubMed

Alsuliman, Tamim; Kitel, Caroline; Dulery, Rémy; Guillaume, Thierry; Larosa, Fabrice; Cornillon, Jérôme; Labussière-Wallet, Helene; Médiavilla, Clémence; Belaiche, Stéphanie; Delage, Jeremy; Alain, Sophie; Yakoub-Agha, Ibrahim

2018-04-13

Cytomegalovirus is one of the main contributing factors to high mortality rates in patients undergoing allogeneic hematopoietic cell transplantation (allo-HCT). The main factors of treatment failure are both drug resistance and intolerance. In some cases, Cytotect®CP CMV-hyperimmune globulin is used as salvage therapy. This study aims to investigate the safety and efficacy of Cytotect®CP as a salvage therapy in patients with CMV infection after allo-HCT. Twenty-three consecutive patients received Cytotect®CP for CMV infection after prior CMV therapy. At the time of Cytotect®CP introduction, 17 patients (74%) had developed acute GVHD and 15 patients (64%) were receiving steroid treatment; Cytotect®CP was used as monotherapy (n = 7) and in combination (n = 16). Overall, response was observed in 18 patients (78%) with a median time of 15 days (range: 3-51). Of the 18 responders, 4 experienced CMV reactivation, while 5 responders died within 100 days of beginning treatment. Of these 5 deaths, 4 were due to causes unrelated to CMV. Estimated 100-day OS from the introduction of Cytotect®CP was 69.6%. No statistically significant difference was observed in 100-day OS between responders and non-responders (73.7% vs 50.0%, p = 0.258). Cytotect®CP as salvage therapy is effective and well-tolerated. Given its safety profile, early treatment use should be considered.

Screening of Potential Inhibitor against Coat Protein of Apple Chlorotic Leaf Spot Virus.

PubMed

Purohit, Rituraj; Kumar, Sachin; Hallan, Vipin

2018-06-01

In this study, we analyzed Coat protein (CP) of Apple chlorotic leaf spot virus (ACLSV), an important latent virus on Apple. Incidence of the virus is upto 60% in various apple cultivars, affecting yield losses of the order of 10-40% (depending upon the cultivar). CP plays an important role as the sole building block of the viral capsid. Homology approach was used to model 193 amino acid sequence of the coat protein. We used various servers such as ConSurf, TargetS, OSML, COACH, COFACTOR for the prediction of active site residues in coat protein. Virtual screening strategy was employed to search potential inhibitors for CP. Top twenty screened molecules considered for drugability, and toxicity analysis and one potential molecule was further analyzed by docking analysis. Here, we reported a potent molecule which could inhibit the formation of viron assembly by targeting the CP protein of virus.

Electric properties of nanostructure (FeCoZr)x(CaF2)(100-x) produced in argon Ar atmosphere

NASA Astrophysics Data System (ADS)

Bondariev, Vitalii; Czarnacka, Karolina; Boiko, Oleksandr

2015-09-01

The paper presents frequency f and temperature Tp dependences of conductivity σ, capacitance Cp and phase shift angle θ for the nanocomposite metal-dielectric (FeCoZr)x(CaF2)(100-x). Samples of nanocomposite were produced by ion-beam sputtering in pure argon Ar atmosphere. Partial pressure of gas Ar in the ion source pAr=1.1×10-1Pa. Contains of metallic phase in tested sample is x = 54.6 at.%. Studies carried out by stand to measuring of AC electrical properties of nanocomposites and semiconductors. The measurements have been performed using alternating current within the frequency range of 50 Hz - 1 MHz for measuring temperatures ranging from 77 K to 373 K. On the frequency-temperature dependence of phase shift angle θ at low frequencies phase shift have capacitive character and at high frequencies - inductive. Position of fmin on the frequency dependence on capacitance Cp corresponds exactly to the resonance frequency fR for which the angle θ crosses zero. Analysis of the results showed that phenomena similar to phenomena in conventional circuit RLC occur in the nanocomposite (CoFeZr)54.6(CaF2)45.4. Jumping recharging between the defects leads to the formation of dipoles and consequently to the increase of permittivity. After a time τ electron returns to the first defect and dipole disappears. The formation of inductance in nanocomposite is associated with return jumps of electrons from defect with negative charge to the defect with positive charge, set by the time, which are characterized by low values of activation energy.

Elimination of Routine Contact Precautions for Endemic Methicillin-Resistant Staphylococcus aureus and Vancomycin-Resistant Enterococcus: A Retrospective Quasi-Experimental Study.

PubMed

Martin, Elise M; Russell, Dana; Rubin, Zachary; Humphries, Romney; Grogan, Tristan R; Elashoff, David; Uslan, Daniel Z

2016-11-01

OBJECTIVE To evaluate the impact of discontinuation of contact precautions (CP) for methicillin-resistant Staphylococcus aureus (MRSA) and vancomycin-resistant Enterococcus (VRE) and expansion of chlorhexidine gluconate (CHG) use on the health system. DESIGN Retrospective, nonrandomized, observational, quasi-experimental study. SETTING Two California hospitals. PARTICIPANTS Inpatients. METHODS We compared hospital-wide laboratory-identified clinical culture rates (as a marker of healthcare-associated infections) 1 year before and after routine CP for endemic MRSA and VRE were discontinued and CHG bathing was expanded to all units. Culture data from patients and cost data on material utilization were collected. Nursing time spent donning personal protective equipment was assessed and quantified using time-driven activity-based costing. RESULTS Average positive culture rates before and after discontinuing CP were 0.40 and 0.32 cultures/100 admissions for MRSA (P=.09), and 0.48 and 0.40 cultures/100 admissions for VRE (P=.14). When combining isolation gown and CHG costs, the health system saved $643,776 in 1 year. Before the change, 28.5% intensive care unit and 19% medicine/surgery beds were on CP for MRSA/VRE. On the basis of average room entries and donning time, estimated nursing time spent donning personal protective equipment for MRSA/VRE before the change was 45,277 hours/year (estimated cost, $4.6 million). CONCLUSION Discontinuing routine CP for endemic MRSA and VRE did not result in increased rates of MRSA or VRE after 1 year. With cost savings on materials, decreased healthcare worker time, and no concomitant increase in possible infections, elimination of routine CP may add substantial value to inpatient care delivery. Infect Control Hosp Epidemiol 2016;1-8.

Non-specific actions of the non-peptide tachykinin receptor antagonists, CP-96,345, RP 67580 and SR 48968, on neurotransmission.

PubMed Central

Wang, Z. Y.; Tung, S. R.; Strichartz, G. R.; Håkanson, R.

1994-01-01

1. Three non-peptide tachykinin receptor antagonists, CP-96,345, RP 67580 and SR 48968, were found to inhibit the electrically-evoked, tachykinin-mediated contractile responses of the rabbit iris sphincter in a concentration-dependent fashion; the pIC50 values were 5.6 +/- 0.01, 5.4 +/- 0.07 and 4.8 +/- 0.03, respectively. 2. These antagonists also inhibited the electrically-evoked, parasympathetic response of the rabbit iris sphincter and the sympathetic response of the guinea-pig vas deferens in a concentration-dependent manner; the pIC50 values were 0.3-1.2 log units lower than those recorded for the tachykinin-mediated responses. 3. Two local anaesthetics, bupivacaine and oxybuprocaine, were also found to inhibit the tachykinin-mediated, cholinergic and sympathetic contractile responses in these tissues in a concentration-dependent manner; the concentration ranges for producing the inhibition were similar to those of the non-peptide tachykinin receptor antagonists. 4. On the sciatic nerves of frogs, the tachykinin receptor antagonists inhibited action potentials in a concentration-dependent manner; the potency of the three drugs was similar to that of bupivacaine. 5. Our results suggest that, in addition to blocking tachykinin receptors, the non-peptide tachykinin receptor antagonists, CP-96,345, RP 67580 and SR 48968, may exert non-specific inhibitory effects on neurotransmission. PMID:8012694

Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

PubMed

Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

2011-12-01

Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

The macrophage cytoskeleton acts as a contact sensor upon interaction with Entamoeba histolytica to trigger IL-1β secretion

PubMed Central

Moreau, France; Gorman, Hayley

2017-01-01

Entamoeba histolytica (Eh) is the causative agent of amebiasis, one of the major causes of dysentery-related morbidity worldwide. Recent studies have underlined the importance of the intercellular junction between Eh and host cells as a determinant in the pathogenesis of amebiasis. Despite the fact that direct contact and ligation between Eh surface Gal-lectin and EhCP-A5 with macrophage α5β1 integrin are absolute requirements for NLRP3 inflammasome activation and IL-1β release, many other undefined molecular events and downstream signaling occur at the interface of Eh and macrophage. In this study, we investigated the molecular events at the intercellular junction that lead to recognition of Eh through modulation of the macrophage cytoskeleton. Upon Eh contact with macrophages key cytoskeletal-associated proteins were rapidly post-translationally modified only with live Eh but not with soluble Eh proteins or fragments. Eh ligation with macrophages rapidly activated caspase-6 dependent cleavage of the cytoskeletal proteins talin, Pyk2 and paxillin and caused robust release of the pro-inflammatory cytokine, IL-1β. Macrophage cytoskeletal cleavages were dependent on Eh cysteine proteinases EhCP-A1 and EhCP-A4 but not EhCP-A5 based on pharmacological blockade of Eh enzyme inhibitors and EhCP-A5 deficient parasites. These results unravel a model where the intercellular junction between macrophages and Eh form an area of highly interacting proteins that implicate the macrophage cytoskeleton as a sensor for Eh contact that leads downstream to subsequent inflammatory immune responses. PMID:28837696

The poly(rC)-binding protein αCP2 is a noncanonical factor in X. laevis cytoplasmic polyadenylation

PubMed Central

Vishnu, Melanie R.; Sumaroka, Marina; Klein, Peter S.; Liebhaber, Stephen A.

2011-01-01

Post-transcriptional control of mRNA stability and translation is central to multiple developmental pathways. This control can be linked to cytoplasmic polyadenylation in certain settings. In maturing Xenopus oocytes, specific mRNAs are targeted for polyadenylation via recruitment of the Cytoplasmic Polyadenylation Element (CPE) binding protein (CPEB) to CPE(s) within the 3′ UTR. Cytoplasmic polyadenylation is also critical to early embryonic events, although corresponding determinants are less defined. Here, we demonstrate that the Xenopus ortholog of the poly(rC) binding protein αCP2 can recruit cytoplasmic poly(A) polymerase activity to mRNAs in Xenopus post-fertilization embryos, and that this recruitment relies on cis sequences recognized by αCP2. We find that the hα-globin 3′ UTR, a validated mammalian αCP2 target, constitutes an effective target for cytoplasmic polyadenylation in Xenopus embryos, but not during Xenopus oocyte maturation. We further demonstrate that the cytoplasmic polyadenylation activity is dependent on the action of the C-rich αCP-binding site in conjunction with the adjacent AAUAAA. Consistent with its ability to target mRNA for poly(A) addition, we find that XαCP2 associates with core components of the Xenopus cytoplasmic polyadenylation complex, including the cytoplasmic poly(A) polymerase XGLD2. Furthermore, we observe that the C-rich αCP-binding site can robustly enhance the activity of a weak canonical oocyte maturation CPE in early embryos, possibly via a direct interaction between XαCP2 and CPEB1. These studies establish XαCP2 as a novel cytoplasmic polyadenylation trans factor, indicate that C-rich sequences can function as noncanonical cytoplasmic polyadenylation elements, and expand our understanding of the complexities underlying cytoplasmic polyadenylation in specific developmental settings. PMID:21444632

In vitro β-Carotene Bioaccessibility and Lipid Digestion in Emulsions: Influence of Pectin Type and Degree of Methyl-Esterification.

PubMed

Verrijssen, Tina A J; Christiaens, Stefanie; Verkempinck, Sarah H E; Boeve, Jeroen; Grauwet, Tara; Van Loey, Ann M; Salvia-Trujillo, Laura; Hendrickx, Marc E

2016-10-01

Citrus pectin (CP) and sugar beet pectin (SBP) were demethoxylated and fully characterized in terms of pectin properties in order to investigate the influence of the pectin degree of methyl-esterification (DM) and the pectin type on the in vitro β-carotene bioaccessibility and lipid digestion in emulsions. For the CP based emulsions containing β-carotene enriched oil, water and pectin, the β-carotene bioaccessibility, and lipid digestion were higher in the emulsions with pectin with a higher DM (57%; "CP57 emulsion") compared to the emulsions with pectin with a lower DM (30%; "CP30 emulsion") showing that the DM plays an important role. In contrast, in SBP-based emulsions, nor β-carotene bioaccessibility nor lipid digestion were dependent on pectin DM. Probably here, other pectin properties are more important factors. It was observed that β-carotene bioaccessibility and lipid digestion were lower in the CP30 emulsion in comparison with the CP57, SBP32, and SBP58 emulsions. However, the β-carotene bioaccessibility of CP57 emulsion was similar to that of the SBP emulsions, whereas the lipid digestion was not. It seems that pectin type and pectin DM (in case of CP) are determining which components can be incorporated into micelles. Because carotenoids and lipids have different structures and polarities, their incorporation may be different. This knowledge can be used to engineer targeted (digestive) functionalities in food products. If both high β-carotene bioaccessibility and high lipid digestion are targeted, SBP emulsions are the best options. The CP57 emulsion can be chosen if high β-carotene bioaccessibility but lower lipid digestion is desired. © 2016 Institute of Food Technologists®.

Antisense Suppression of the Small Chloroplast Protein CP12 in Tobacco Alters Carbon Partitioning and Severely Restricts Growth1[W

PubMed Central

Howard, Thomas P.; Fryer, Michael J.; Singh, Prashant; Metodiev, Metodi; Lytovchenko, Anna; Obata, Toshihiro; Fernie, Alisdair R.; Kruger, Nicholas J.; Quick, W. Paul; Lloyd, Julie C.; Raines, Christine A.

2011-01-01

The thioredoxin-regulated chloroplast protein CP12 forms a multienzyme complex with the Calvin-Benson cycle enzymes phosphoribulokinase (PRK) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PRK and GAPDH are inactivated when present in this complex, a process shown in vitro to be dependent upon oxidized CP12. The importance of CP12 in vivo in higher plants, however, has not been investigated. Here, antisense suppression of CP12 in tobacco (Nicotiana tabacum) was observed to impact on NAD-induced PRK and GAPDH complex formation but had little effect on enzyme activity. Additionally, only minor changes in photosynthetic carbon fixation were observed. Despite this, antisense plants displayed changes in growth rates and morphology, including dwarfism and reduced apical dominance. The hypothesis that CP12 is essential to separate oxidative pentose phosphate pathway activity from Calvin-Benson cycle activity, as proposed in cyanobacteria, was tested. No evidence was found to support this role in tobacco. Evidence was seen, however, for a restriction to malate valve capacity, with decreases in NADP-malate dehydrogenase activity (but not protein levels) and pyridine nucleotide content. Antisense repression of CP12 also led to significant changes in carbon partitioning, with increased carbon allocation to the cell wall and the organic acids malate and fumarate and decreased allocation to starch and soluble carbohydrates. Severe decreases were also seen in 2-oxoglutarate content, a key indicator of cellular carbon sufficiency. The data presented here indicate that in tobacco, CP12 has a role in redox-mediated regulation of carbon partitioning from the chloroplast and provides strong in vivo evidence that CP12 is required for normal growth and development in plants. PMID:21865489

Flavonoid fraction of Cajanus cajan prohibited the mutagenic properties of cyclophosphamide in mice in vivo.

PubMed

Abo-Zeid, Mona A M; Abdel-Samie, Negm S; Farghaly, Ayman A; Hassan, Emad M

2018-02-01

Cajanus cajan (L.) is a Pigeon pea cultivated in tropical and subtropical areas. It contains many bioactive components. The present study aimed to assess the antimutagenic efficacy of a flavonoid fraction of Cajanus cajan (FFCC) to reduce cytotoxicity and genotoxicity induced by cyclophosphamide (CP). We assessed genotoxic and cytotoxic effects using chromosome aberration, in mouse bone-marrow cells and spermatocytes, cell viability and DNA damage, in mouse bone-marrow cells. Animals received FFCC at concentrations 50,100 and 200 mg/kg b wt by oral gavage, and injected simultaneously with CP (20 mg/kg b wt) for 24 h. The results revealed that FFCC was safe and its effect was normal compared to control group. Moreover, we observed significant inhibition of CP-induced chromosome abnormalities in both, somatic and germ, cells (p ≪ 0.05) after concurrent administration of different concentrations of FFCC and CP. FFCC reduced chromosome aberrations by 14.29%, 25.21% and 28.57% in somatic cells, and 25.35%, 35.21% and 49.29% in germ cells after simultaneous treatment with CP respectively. Additionally, FFCC improved the cell viability of bone-marrow cells in a concentration-dependent manner when administered concurrently with CP. Similarly, FFCC diminished DNA damage (p ≪ 0.05) in CP-treated animals. The inhibitory index of tail DNA (%) reached 90.6% at the highest concentration of FFCC when administered simultaneously with CP. In conclusion, the flavonoid extract improved cell viability and protected animal cells from the cytotoxic and genotoxic effects exhibited by CP. Cajanus cajan flavonoids might contain the antioxidant bioactivity that effectively lessened chromosome aberrations and DNA damage induced by mutagenic agents. Copyright © 2017 Elsevier B.V. All rights reserved.

Investigation and Evaluation of an in Situ Interpolymer Complex of Carbopol with Polyvinylpyrrolidone as a Matrix for Gastroretentive Tablets of Ranitidine Hydrochloride.

PubMed

Yusif, Rehab Mohammad; Abu Hashim, Irhan Ibrahim; Mohamed, Elham Abdelmonem; El Rakhawy, Mohamed Magdy

2016-01-01

Carbopol (CP) is a biocompatible bioadhesive polymer used as a matrix for gastroretentive (GR) tablets, however, its rapid hydration shortens its bioadhesion and floating when incorporated in effervescent formulae. The interpolymer complexation of CP with polyvinylpyrrolidone (PVP) significantly reduced the excessive hydration of CP, prolonging floating and maintaining the mucoadhesiveness. In early attempts, a lengthy process was followed to prepare such an interpolymer complex. In this study, an in situ interpolymer complexation between CP and two grades of PVP (K25 and K90) in 0.1 N HCl was investigated and characterized by Fourier transform infrared spectroscopy (FT-IR) and differential scanning calorimetry (DSC). Hence, directly compressed GR tablets of different combinations of PVP and CP with sodium bicarbonate (SB) as an effervescent agent were examined for prolonged gastroretention and sustained release of ranitidine hydrochloride (RHCl) as a model drug. Tablets were evaluated for in vitro buoyancy, bioadhesiveness, swelling, and drug release in 0.1 N HCl. All GR tablets containing PVP-CP combinations achieved more prolonged floating (>24 h) than CP tablets (5.2 h). Their bioadhesiveness, swelling, and drug release were dependent on the PVP molecular weight and its ratio to CP. Drug release profiles of all formulae followed non-Fickian diffusion. Formula containing the PVP K90-CP combination at a respective ratio of 1 : 3 (P90C13) was a promising system, exhibiting good floating and bioadhesive properties as well as sustained drug release. Abdominal X-ray imaging of P90C13 formula, loaded with barium sulfate, in six healthy volunteers showed a mean gastric retention period of 6.8±0.3 h.

Cytosine-phosphate-guanine oligodeoxynucleotides containing GACGTT motifs enhance the immune responses elicited by keyhole limpet hemocyanin antigen in dairy cattle.

PubMed

Chu, Chun-Yen; Lee, Shang-Chun; Liu, Shyh-Shyan; Lin, Yu-Ming; Shen, Perng-Chi; Yu, Chi; Lee, Kuo-Hua; Zhao, Xin; Lee, Jai-Wei

2011-10-01

Adjuvants are important components of vaccine formulations. Effective adjuvants line innate and adaptive immunity by signaling through pathogen recognition receptors. Synthetic cytosine-phosphate-guanine (CpG) oligodeoxynucleotides (ODNs) have been shown to have potentials as adjuvants for vaccines. However, the immunostimulatory effect of CpG is species-specific and depends on the sequence of CpG motifs. A CpG ODN (2135), containing 3 identical copies of GTCGTT motif, was previously reported to have the strongest effects on bovine peripheral blood mononuclear cells (PBMC). Based on the sequence of 2135, we replaced the GTCGTT motif with 11 other sequences containing CG and investigated their effects on bovine lymphocyte proliferation. Results showed that the CpG ODNs containing 3 copies of GACGTT motif had the highest lymphocyte stimulation index (7.91±1.18), which was significantly (P<0.05) higher than that of 2135 (4.25±0.56). The CpG ODNs containing 3 copies of GACGTT motif also significantly increased the mRNA expression of interferon (IFN)-α, interleukin (IL)-12, and IL-21 in bovine PBMC. When dairy cows were immunized with the keyhole limpet hemocyanin (KLH) antigen formulated with CpG ODNs containing 3 copies of GACGTT, production of KLH-specific antibodies in serum and in milk whey was significantly (P<0.05) enhanced. IFN-γ in whole blood stimulated by KLH was also significantly (P<0.05) increased in cows immunized with KLH plus CpG ODNs. Our results indicate that CpG ODNs containing 3 copies of the GACGTT motifs is a potential adjuvant for bovine vaccines.

Harvesting model uncertainty for the simulation of interannual variability

NASA Astrophysics Data System (ADS)

Misra, Vasubandhu

2009-08-01

An innovative modeling strategy is introduced to account for uncertainty in the convective parameterization (CP) scheme of a coupled ocean-atmosphere model. The methodology involves calling the CP scheme several times at every given time step of the model integration to pick the most probable convective state. Each call of the CP scheme is unique in that one of its critical parameter values (which is unobserved but required by the scheme) is chosen randomly over a given range. This methodology is tested with the relaxed Arakawa-Schubert CP scheme in the Center for Ocean-Land-Atmosphere Studies (COLA) coupled general circulation model (CGCM). Relative to the control COLA CGCM, this methodology shows improvement in the El Niño-Southern Oscillation simulation and the Indian summer monsoon precipitation variability.

Quantitative Measures of Swallowing Deficits in Patients With Parkinson's Disease.

PubMed

Ellerston, Julia K; Heller, Amanda C; Houtz, Daniel R; Kendall, Katherine A

2016-05-01

Dysphagia and associated aspiration pneumonia are commonly reported sequelae of Parkinson's disease (PD). Previous studies of swallowing in patients with PD have described prolonged pharyngeal transit time, delayed onset of pharyngeal transit, cricopharyngeal (CP) achalasia, reduced pharyngeal constriction, and slowed hyolaryngeal elevation. These studies were completed using inconsistent evaluation methodology, reliance on qualitative analysis, and a lack of a large control group, resulting in concerns regarding diagnostic precision. The purpose of this study was to investigate swallowing function in patients with PD using a norm-referenced, quantitative approach. This retrospective study includes 34 patients with a diagnosis of PD referred to a multidisciplinary voice and swallowing clinic. Modified barium swallow studies were performed using quantitative measures of pharyngeal transit time, hyoid displacement, CP sphincter opening, area of the pharynx at maximal constriction, and timing of laryngeal vestibule closure relative to bolus arrival at the CP sphincter. Reduced pharyngeal constriction was found in 30.4%, and a delay in airway closure relative to arrival of the bolus at the CP sphincter was the most common abnormality, present in 62% of patients. Previously reported findings of prolonged pharyngeal transit, poor hyoid elevation, and CP achalasia were not identified as prominent features. © The Author(s) 2015.

TLR9 is critical for glioma stem cell maintenance and targeting.

PubMed

Herrmann, Andreas; Cherryholmes, Gregory; Schroeder, Anne; Phallen, Jillian; Alizadeh, Darya; Xin, Hong; Wang, Tianyi; Lee, Heehyoung; Lahtz, Christoph; Swiderski, Piotr; Armstrong, Brian; Kowolik, Claudia; Gallia, Gary L; Lim, Michael; Brown, Christine; Badie, Behnam; Forman, Stephen; Kortylewski, Marcin; Jove, Richard; Yu, Hua

2014-09-15

Understanding supports for cancer stem-like cells in malignant glioma may suggest therapeutic strategies for their elimination. Here, we show that the Toll-like receptor TLR9 is elevated in glioma stem-like cells (GSC) in which it contributes to glioma growth. TLR9 overexpression is regulated by STAT3, which is required for GSC maintenance. Stimulation of TLR9 with a CpG ligand (CpG ODN) promoted GSC growth, whereas silencing TLR9 expression abrogated GSC development. CpG-ODN treatment induced Frizzled4-dependent activation of JAK2, thereby activating STAT3. Targeted delivery of siRNA into GSC was achieved via TLR9 using CpG-siRNA conjugates. Through local or systemic treatment, administration of CpG-Stat3 siRNA to silence STAT3 in vivo reduced GSC along with glioma growth. Our findings identify TLR9 as a functional marker for GSC and a target for the delivery of efficacious therapeutics for glioma treatment. Cancer Res; 74(18); 5218-28. ©2014 AACR. ©2014 American Association for Cancer Research.

Competitive sorption affinity of sulfonamides and chloramphenicol antibiotics toward functionalized biochar for water and wastewater treatment.

PubMed

Ahmed, Mohammad Boshir; Zhou, John L; Ngo, Huu Hao; Guo, Wenshan; Johir, Md Abu Hasan; Belhaj, Dalel

2017-08-01

Competitive sorption of sulfamethazine (SMT), sulfamethoxazole (SMX), sulfathiazole (STZ) and chloramphenicol (CP) toward functionalized biochar (fBC) was highly pH dependent with maximum sorption at pH ∼4.0-4.25. Equilibrium data were well represented by the Langmuir and Freundlich models in the order STZ>SMX>CP>SMT. Kinetics data were slightly better fitted by the pseudo second-order model than pseudo first-order and intra-particle-diffusion models. Maximum sorptive interactions occurred at pH 4.0-4.25 through H-bonds formations for neutral sulfonamides species and through negative charge assisted H-bond (CAHB) formation for CP, in addition to π-π electron-donor-acceptor (EDA) interactions. EDA was the main mechanism for the sorption of positive sulfonamides species and CP at pH<2.0. Sorption of negative sulfonamides species and CP at pH>7.0 was regulated by H-bond formation and proton exchange with water by forming CAHB, respectively. The results suggested fBC to be highly efficient in removing antibiotics mixture. Copyright © 2017 Elsevier Ltd. All rights reserved.

Neuronal activity related to spontaneous and capsaicin-induced rhythmical jaw movements in the rat.

PubMed

Ohta, M; Sasamoto, K; Kobayashi, J

1998-02-01

Intraoral capsaicin induced rhythmical jaw movements (RJM) in anesthetized rats. Neurons in the trigeminal spinal nucleus caudalis or the cortico-peduncular (CP) axons were extracellularly recorded. Capsaicin excited dose-dependently most caudalis neurons, which were activated by stimulation of the oral cavity and/or the tooth pulp and activated during spontaneous or induced RJM. Ten of 55 CP axons were antidromically activated by stimulation of the contralateral trigeminal motor nucleus. All antidromic and 29 other CP axons discharged prior to the spontaneous RJM, but most of them did not during capsaicin-induced RJM. These neuronal activities possibly initiate spontaneous RJM although the activities of caudalis neurons are necessary for capsicin-induced RJM.

On-chip synthesis of circularly polarized emission of light with integrated photonic circuits.

PubMed

He, Li; Li, Mo

2014-05-01

The helicity of circularly polarized (CP) light plays an important role in the light-matter interaction in magnetic and quantum material systems. Exploiting CP light in integrated photonic circuits could lead to on-chip integration of novel optical helicity-dependent devices for applications ranging from spintronics to quantum optics. In this Letter, we demonstrate a silicon photonic circuit coupled with a 2D grating emitter operating at a telecom wavelength to synthesize vertically emitting, CP light from a quasi-TE waveguide mode. Handedness of the emitted circular polarized light can be thermally controlled with an integrated microheater. The compact device footprint enables a small beam diameter, which is desirable for large-scale integration.

A mechanism-based pharmacokinetic-enzyme model for cyclophosphamide autoinduction in breast cancer patients

PubMed Central

Hassan, M; Svensson, U S H; Ljungman, P; Björkstrand, B; Olsson, H; Bielenstein, M; Abdel-Rehim, M; Nilsson, C; Johansson, M; Karlsson, M O

1999-01-01

Aims This study investigated the pharmacokinetics of cyclophosphamide (CP) and its main metabolite 4-hydroxycyclophosphamide (4-OH-CP) in patients with breast cancer undergoing high dose chemotherapy prior to autologous stem cell transplantation. An enzyme turn-over model was also developed to study the time course of cyclophosphamide induction. Methods Fourteen patients received a combination of CP (6 g m−2), thiotepum (500 mg m−2) and carboplatin (800 mg m−2) as a 96 h infusion. Plasma concentrations of CP and 4-OH-CP were determined with h.p.l.c. and a pharmacokinetic and enzyme turn-over model applied to data using NONMEM. Results CP plasma concentrations were described by a two-compartment model with a noninducible and an inducible pathway, the latter forming 4-OH-CP. In the final enzyme model, CP affects the amount of enzymes by increasing the enzyme production rate. CP concentrations decreased during the infusion with no subsequent change in 4-OH-CP concentrations. CP inducible and noninducible clearance were estimated to 1.76 l h−1 (90% C.I. 0.92–2.58) and 1.14 l h−1 (0.31–1.85), respectively. The induction resulted in an approximately doubled CP clearance through the inducible pathway at the end of treatment. The model predicted the enzyme turn-over half-life to be 24 h. Conclusions The presented mechanism-based enzyme induction model where the pharmacokinetics of the inducer and the enzyme pool counterbalance each other successfully described CP autoinduction. It is reasonable to believe that CP affects its own elimination by increasing the enzyme production rate and thereby increasing the amount of enzyme by which CP is eliminated. PMID:10594468

38 CFR 21.8072 - Authorizing training, services, and assistance beyond the initial individualized written plan of...

Code of Federal Regulations, 2010 CFR

2010-07-01

... CP or VRC sets aside the child's achievement of that vocational goal under § 21.8284. (Authority: 38 U.S.C. 1804(b) through (e), 1814) (c) Responsibility for authorizing a program extension. A CP or... program limit of 48 months if the CP or VRC determines that the child needs the additional time to...

Ambulatory Physical Activity Performance in Youth With Cerebral Palsy and Youth Who Are Developing Typically

PubMed Central

Bjornson, Kristie F; Belza, Basia; Kartin, Deborah; Logsdon, Rebecca; McLaughlin, John F

2007-01-01

Background and Purpose Assessment of walking activity in youth with cerebral palsy (CP) has traditionally been “capacity-based.” The purpose of this study was to describe the day-to-day ambulatory activity “performance” of youth with CP compared with youth who were developing typically. Subjects Eighty-one youth with CP, aged 10 to 13 years, who were categorized as being in Gross Motor Function Classification System (GMFCS) levels I to III and 30 age-matched youth who were developing typically were recruited. Methods Using a cross-sectional design, participants wore the StepWatch monitor for 7 days while documenting average daily total step counts, percentage of all time active, ratio of medium to low activity levels, and percentage of time at high activity levels. Results The youth with CP demonstrated significantly lower levels of all outcomes than the comparison group. Discussion and Conclusion Daily walking activity and variability decreased as functional walking level (GMFCS level) decreased. Ambulatory activity performance within the context of the daily life for youth with CP appears valid and feasible as an outcome for mobility interventions in CP. PMID:17244693

Youth and young adults with cerebral palsy: their use of physician and hospital services.

PubMed

Young, Nancy L; Gilbert, Thomas K; McCormick, Anna; Ayling-Campos, Anne; Boydell, Katherine; Law, Mary; Fehlings, Darcy L; Mukherjee, Shubhra; Wedge, John H; Williams, Jack I

2007-06-01

To examine patterns of health care utilization among youth and young adults who have cerebral palsy (CP) and to provide information to guide the development of health services for adults who have CP. This study analyzed health insurance data for outpatient physician visits and hospital admissions for a 4-year period. Six children's treatment centers in Ontario, Canada. The sample included 587 youth and 477 adults with CP identified from health records. Youths were 13 to 17 years of age, and adults were 23 to 32 years of age at the end of the data range. Not applicable. We computed the annual rates of outpatient physician visits and hospitalizations per 1000 persons and compared these with rates for the general population. Annual rates of outpatient physician visits were 6052 for youth and 6404 for adults with CP, 2.2 times and 1.9 times higher, respectively, than rates for age-matched peers (P<.01). Specialists provided 28.4% of youth visits but only 18.8% of adult visits. Annual hospital admission rates were 180 for youth and 98 for adults with CP, 4.3 times and 10.6 times higher, respectively, than rates for age-matched peers (P<.01). It appears that youth and adults with CP continue to have complex care needs and rely heavily on the health care system. Comprehensive services are essential to support their health as they move into youth and adulthood. However, there appear to be gaps in the adult health care system, such as limited access to specialist physicians.

Ballistic V50 Evaluation of TIMET Ti108

DTIC Science & Technology

2018-02-01

complete penetration (CP) or partial penetration (PP). Since a CP was determined on the initial shots of both projectiles, the impact velocities...Ti-108 Material Target Data Shot Time: Results X-Ray Times Residual Velocity: Phantom Velocity: Launch Package: Total (grams) Case Size: Expected...H16168-5 Ti-108 Material Target Data Shot Time: Results X-Ray Times Residual Velocity: Phantom Velocity: Launch Package: Total (grams) Case Size

Improvement of charge-pumping electrically detected magnetic resonance and its application to silicon metal-oxide-semiconductor field-effect transistor

NASA Astrophysics Data System (ADS)

Hori, Masahiro; Tsuchiya, Toshiaki; Ono, Yukinori

2017-01-01

Charge-pumping electrically detected magnetic resonance (CP EDMR), or EDMR in the CP mode, is improved and applied to a silicon metal-oxide-semiconductor field-effect transistor (MOSFET). Real-time monitoring of the CP process reveals that high-frequency transient currents are an obstacle to signal amplification for EDMR. Therefore, we introduce cutoff circuitry, leading to a detection limit for the number of spins as low as 103 for Si MOS interface defects. With this improved method, we demonstrate that CP EDMR inherits one of the most important features of the CP method: the gate control of the energy window of the detectable interface defects for spectroscopy.

A semi-mechanistic model of CP-690,550-induced reduction in neutrophil counts in patients with rheumatoid arthritis.

PubMed

Gupta, Pankaj; Friberg, Lena E; Karlsson, Mats O; Krishnaswami, Sriram; French, Jonathan

2010-06-01

CP-690,550, a selective inhibitor of the Janus kinase family, is being developed as an oral disease-modifying antirheumatic drug for the treatment of rheumatoid arthritis (RA). A semi-mechanistic model was developed to characterize the time course of drug-induced absolute neutrophil count (ANC) reduction in a phase 2a study. Data from 264 RA patients receiving 6-week treatment (placebo, 5, 15, 30 mg bid) followed by a 6-week off-treatment period were analyzed. The model included a progenitor cell pool, a maturation chain comprising transit compartments, a circulation pool, and a feedback mechanism. The model was adequately described by system parameters (BASE(h), ktr(h), gamma, and k(circ)), disease effect parameters (DIS), and drug effect parameters (k(off) and k(D)). The disease manifested as an increase in baseline ANC and reduced maturation time due to increased demand from the inflammation site. The drug restored the perturbed system parameters to their normal values via an indirect mechanism. ANC reduction due to a direct myelosuppressive drug effect was not supported. The final model successfully described the dose- and time-dependent changes in ANC and predicted the incidence of neutropenia at different doses reasonably well.

Recognition of platinum-DNA adducts by HMGB1a.

PubMed

Ramachandran, Srinivas; Temple, Brenda; Alexandrova, Anastassia N; Chaney, Stephen G; Dokholyan, Nikolay V

2012-09-25

Cisplatin (CP) and oxaliplatin (OX), platinum-based drugs used widely in chemotherapy, form adducts on intrastrand guanines (5'GG) in genomic DNA. DNA damage recognition proteins, transcription factors, mismatch repair proteins, and DNA polymerases discriminate between CP- and OX-GG DNA adducts, which could partly account for differences in the efficacy, toxicity, and mutagenicity of CP and OX. In addition, differential recognition of CP- and OX-GG adducts is highly dependent on the sequence context of the Pt-GG adduct. In particular, DNA binding protein domain HMGB1a binds to CP-GG DNA adducts with up to 53-fold greater affinity than to OX-GG adducts in the TGGA sequence context but shows much smaller differences in binding in the AGGC or TGGT sequence contexts. Here, simulations of the HMGB1a-Pt-DNA complex in the three sequence contexts revealed a higher number of interface contacts for the CP-DNA complex in the TGGA sequence context than in the OX-DNA complex. However, the number of interface contacts was similar in the TGGT and AGGC sequence contexts. The higher number of interface contacts in the CP-TGGA sequence context corresponded to a larger roll of the Pt-GG base pair step. Furthermore, geometric analysis of stacking of phenylalanine 37 in HMGB1a (Phe37) with the platinated guanines revealed more favorable stacking modes correlated with a larger roll of the Pt-GG base pair step in the TGGA sequence context. These data are consistent with our previous molecular dynamics simulations showing that the CP-TGGA complex was able to sample larger roll angles than the OX-TGGA complex or either CP- or OX-DNA complexes in the AGGC or TGGT sequences. We infer that the high binding affinity of HMGB1a for CP-TGGA is due to the greater flexibility of CP-TGGA compared to OX-TGGA and other Pt-DNA adducts. This increased flexibility is reflected in the ability of CP-TGGA to sample larger roll angles, which allows for a higher number of interface contacts between the Pt-DNA adduct and HMGB1a.

LC/QTOF profile and preliminary stability studies of an enriched flavonoid fraction of Cecropia pachystachya Trécul leaves with potential antidepressant-like activity.

PubMed

Ortmann, Caroline Flach; Abelaira, Helena Mendes; Réus, Gislaine Zilli; Ignácio, Zuleide Maria; Chaves, Vitor Clasen; Dos Santos, Talitha Caldas; de Carvalho, Pâmela; Carlessi, Anelise Scussel; Bruchchen, Livia; Danielski, Lucineia G; Cardoso, Simone Gonçalves; de Campos, Angela Machado; Petronilho, Fabricia; Rebelo, Joyce; Dos Santos Morais, Meline Oliveira; Vuolo, Francieli; Dal-Pizzol, Felipe; Streck, Emilio Luiz; Quevedo, João; Reginatto, Flávio Henrique

2017-11-01

There is increasing interest in natural antioxidants that are candidates for the prevention of brain damage occurring in major depressive disorders. Cecropia pachystachya is a tropical tree species of Central and South America and a rich source of polyphenols, particularly flavonoids. The aim of this study was to characterize the flavonoid profile of an enriched flavonoid fraction of C. pachystachya (EFF-Cp) and evaluate the antidepressant-like effects of its acute administration in behavior, cytokine levels, oxidative stress and energy metabolism parameters. The EFF-Cp chemical characterization was performed by HPLC/DAD and LC/QTOF. The antidepressant-like effects were performed by the forced swimming test, splash test and open field test. EFF-Cp revealed 15 flavonoids, including seven new glycosyl flavonoids for C. pachystachya. Quantitatively, EFF-Cp showed isoorientin (43.46 mg/g), orientin (23.42 mg/g) and isovitexin (17.45 mg/g) as major C-glycosyl flavonoids. In addition, EFF-Cp at doses 50 and 100 mg/kg reduced the immobility time in the forced swimming test, without changing the locomotor activity and grooming time. In addition, EFF-Cp was able to prevent the oxidative damage in some brain areas. In conclusion, the results of this study suggest that EFF-Cp exerts antidepressant-like effects with its antioxidant properties. Copyright © 2017 John Wiley & Sons, Ltd.

New endoscopic "scissors" to treat Zenker's diverticulum (with video).

PubMed

Ramchandani, Mohan; Nageshwar Reddy, D

2013-10-01

Zenker's diverticulum (ZD) is a rare disorder but is associated with significant morbidity. Cricopharyngeal (CP) myotomy is the mainstay of treatment, and various flexible endoscopic techniques have been used for division of the septum. However, there is a constant need for improvement in accessories. To evaluate the safety and effectiveness of a new electrocautery endoscopic scissor for CP myotomy in patients with symptomatic ZD. Observational human study. Tertiary-care hospital. This study involved 3 patients with symptomatic ZD. Flexible endoscopic CP myotomy was performed by using a novel scissors-type grasping device. CP myotomy involved 4 steps: (1) opening of the forceps, (2) grasping the muscle fiber, (3) closure of the forceps with application of gentle traction, and (4) dissection of muscle fibers by using cutting current. Intraprocedural bleeding was controlled with the same instrument by grasping vessels and applying coagulation current. Overall feasibility and performance, procedure time to achieve complete CP myotomy. CP myotomy was successfully performed in all patients. Mean procedure time was 10.6 minutes. There were no major adverse events. Minor intraprocedure bleeding occurred in 1 patient. Single arm, limited number of patients. The new instrument has potential advantages in comparison with standard instruments used for CP myotomy. The advantages of this new technique are better control of cutting and hemostatic abilities. Copyright © 2013 American Society for Gastrointestinal Endoscopy. Published by Mosby, Inc. All rights reserved.

In Vivo Control of CpG and Non-CpG DNA Methylation by DNA Methyltransferases

PubMed Central

Arand, Julia; Spieler, David; Karius, Tommy; Branco, Miguel R.; Meilinger, Daniela; Meissner, Alexander; Jenuwein, Thomas; Xu, Guoliang; Leonhardt, Heinrich; Wolf, Verena; Walter, Jörn

2012-01-01

The enzymatic control of the setting and maintenance of symmetric and non-symmetric DNA methylation patterns in a particular genome context is not well understood. Here, we describe a comprehensive analysis of DNA methylation patterns generated by high resolution sequencing of hairpin-bisulfite amplicons of selected single copy genes and repetitive elements (LINE1, B1, IAP-LTR-retrotransposons, and major satellites). The analysis unambiguously identifies a substantial amount of regional incomplete methylation maintenance, i.e. hemimethylated CpG positions, with variant degrees among cell types. Moreover, non-CpG cytosine methylation is confined to ESCs and exclusively catalysed by Dnmt3a and Dnmt3b. This sequence position–, cell type–, and region-dependent non-CpG methylation is strongly linked to neighboring CpG methylation and requires the presence of Dnmt3L. The generation of a comprehensive data set of 146,000 CpG dyads was used to apply and develop parameter estimated hidden Markov models (HMM) to calculate the relative contribution of DNA methyltransferases (Dnmts) for de novo and maintenance DNA methylation. The comparative modelling included wild-type ESCs and mutant ESCs deficient for Dnmt1, Dnmt3a, Dnmt3b, or Dnmt3a/3b, respectively. The HMM analysis identifies a considerable de novo methylation activity for Dnmt1 at certain repetitive elements and single copy sequences. Dnmt3a and Dnmt3b contribute de novo function. However, both enzymes are also essential to maintain symmetrical CpG methylation at distinct repetitive and single copy sequences in ESCs. PMID:22761581

A first-in-human phase I and pharmacokinetic study of CP-4126 (CO-101), a nucleoside analogue, in patients with advanced solid tumours.

PubMed

Venugopal, B; Awada, A; Evans, T R J; Dueland, S; Hendlisz, A; Rasch, W; Hernes, K; Hagen, S; Aamdal, S

2015-10-01

CP-4126 (gemcitabine elaidate, previously CO-101) is a lipid-drug conjugate of gemcitabine designed to circumvent human equilibrative nucleoside transporter1-related resistance to gemcitabine. The purpose of this study was to determine the maximum tolerated dose (MTD) and the recommended phase II dose (RP2D) of CP-4126, and to describe its pharmacokinetic profile. Eligible patients with advanced refractory solid tumours, and adequate performance status, haematological, renal and hepatic function, were treated with one of escalating doses of CP-4126 administered by a 30-min intravenous infusion on days 1, 8 and 15 of a 28-day cycle. Blood and urine samples were collected to determine the pharmacokinetics (PKs) of CP-4126. Forty-three patients, median age 59 years (range 18-76; male = 27, female = 16), received one of ten dose levels (30-1600 mg/m(2)). Dose-limiting toxicities included grade 3 anaemia, grade 3 fatigue and grade 3 elevation of transaminases. The MTD and RP2D were 1250 mg/m(2) on basis of the toxicity and PK data. CP-4126 followed dose-dependent kinetics and maximum plasma concentrations occurred at the end of CP-4126 infusion. Seven patients achieved stable disease sustained for ≥3 months, including two patients with pancreatic cancer who had progressed on or after gemcitabine exposure. CP-4126 was well tolerated with comparable toxicity profile to gemcitabine. Future studies are required to determine its anti-tumour efficacy, either alone or in combination with other cytotoxic chemotherapy regimens.

Age, ocular magnification, and circumpapillary retinal nerve fiber layer thickness

NASA Astrophysics Data System (ADS)

Wang, Mengyu; Elze, Tobias; Li, Dian; Baniasadi, Neda; Wirkner, Kerstin; Kirsten, Toralf; Thiery, Joachim; Loeffler, Markus; Engel, Christoph; Rauscher, Franziska G.

2017-12-01

Optical coherence tomography (OCT) manufacturers graphically present circumpapillary retinal nerve fiber layer thickness (cpRNFLT) together with normative limits to support clinicians in diagnosing ophthalmic diseases. The impact of age on cpRNFLT is typically implemented by linear models. cpRNFLT is strongly location-specific, whereas previously published norms are typically restricted to coarse sectors and based on small populations. Furthermore, OCT devices neglect impacts of lens or eye size on the diameter of the cpRNFLT scan circle so that the diameter substantially varies over different eyes. We investigate the impact of age and scan diameter reported by Spectralis spectral-domain OCT on cpRNFLT in 5646 subjects with healthy eyes. We provide cpRNFLT by age and diameter at 768 angular locations. Age/diameter were significantly related to cpRNFLT on 89%/92% of the circle, respectively (pointwise linear regression), and to shifts in cpRNFLT peak locations. For subjects from age 42.1 onward but not below, increasing age significantly decreased scan diameter (r=-0.28, p<0.001), which suggests that pathological cpRNFLT thinning over time may be underestimated in elderly compared to younger subjects, as scan diameter decrease correlated with cpRNFLT increase. Our detailed numerical results may help to generate various correction models to improve diagnosing and monitoring optic neuropathies.

Regulation of mitosis-meiosis transition by the ubiquitin ligase β-TrCP in male germ cells.

PubMed

Nakagawa, Tadashi; Zhang, Teng; Kushi, Ryo; Nakano, Seiji; Endo, Takahiro; Nakagawa, Makiko; Yanagihara, Noriko; Zarkower, David; Nakayama, Keiko

2017-11-15

The mitosis-meiosis transition is essential for spermatogenesis. Specific and timely downregulation of the transcription factor DMRT1, and consequent induction of Stra8 expression, is required for this process in mammals, but the molecular mechanism has remained unclear. Here, we show that β-TrCP, the substrate recognition component of an E3 ubiquitin ligase complex, targets DMRT1 for degradation and thereby controls the mitosis-meiosis transition in mouse male germ cells. Conditional inactivation of β-TrCP2 in male germ cells of β-TrCP1 knockout mice resulted in sterility due to a lack of mature sperm. The β-TrCP-deficient male germ cells did not enter meiosis, but instead underwent apoptosis. The induction of Stra8 expression was also attenuated in association with the accumulation of DMRT1 at the Stra8 promoter in β-TrCP-deficient testes. DMRT1 contains a consensus β-TrCP degron sequence that was found to bind β-TrCP. Overexpression of β-TrCP induced the ubiquitylation and degradation of DMRT1. Heterozygous deletion of Dmrt1 in β-TrCP-deficient spermatogonia increased meiotic cells with a concomitant reduction of apoptosis. Collectively, our data indicate that β-TrCP regulates the transition from mitosis to meiosis in male germ cells by targeting DMRT1 for degradation. © 2017. Published by The Company of Biologists Ltd.

Unravelling the shape and structural assembly of the photosynthetic GAPDH-CP12-PRK complex from Arabidopsis thaliana by small-angle X-ray scattering analysis.

PubMed

Del Giudice, Alessandra; Pavel, Nicolae Viorel; Galantini, Luciano; Falini, Giuseppe; Trost, Paolo; Fermani, Simona; Sparla, Francesca

2015-12-01

Oxygenic photosynthetic organisms produce sugars through the Calvin-Benson cycle, a metabolism that is tightly linked to the light reactions of photosynthesis and is regulated by different mechanisms, including the formation of protein complexes. Two enzymes of the cycle, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and phosphoribulokinase (PRK), form a supramolecular complex with the regulatory protein CP12 with the formula (GAPDH-CP122-PRK)2, in which both enzyme activities are transiently inhibited during the night. Small-angle X-ray scattering analysis performed on both the GAPDH-CP12-PRK complex and its components, GAPDH-CP12 and PRK, from Arabidopsis thaliana showed that (i) PRK has an elongated, bent and screwed shape, (ii) the oxidized N-terminal region of CP12 that is not embedded in the GAPDH-CP12 complex prefers a compact conformation and (iii) the interaction of PRK with the N-terminal region of CP12 favours the approach of two GAPDH tetramers. The interaction between the GAPDH tetramers may contribute to the overall stabilization of the GAPDH-CP12-PRK complex, the structure of which is presented here for the first time.

Sensitivity enhancement by multiple-contact cross-polarization under magic-angle spinning.

PubMed

Raya, J; Hirschinger, J

2017-08-01

Multiple-contact cross-polarization (MC-CP) is applied to powder samples of ferrocene and l-alanine under magic-angle spinning (MAS) conditions. The method is described analytically through the density matrix formalism. The combination of a two-step memory function approach and the Anderson-Weiss approximation is found to be particularly useful to derive approximate analytical solutions for single-contact Hartmann-Hahn CP (HHCP) and MC-CP dynamics under MAS. We show that the MC-CP sequence requiring no pulse-shape optimization yields higher polarizations at short contact times than optimized adiabatic passage through the HH condition CP (APHH-CP) when the MAS frequency is comparable to the heteronuclear dipolar coupling, i.e., when APHH-CP through a single sideband matching condition is impossible or difficult to perform. It is also shown that the MC-CP sideband HH conditions are generally much broader than for single-contact HHCP and that efficient polarization transfer at the centerband HH condition can be reintroduced by rotor-asynchronous multiple equilibrations-re-equilibrations with the proton spin bath. Boundary conditions for the successful use of the MC-CP experiment when relying on spin-lattice relaxation for repolarization are also examined. Copyright © 2017 Elsevier Inc. All rights reserved.

Sensitivity enhancement by multiple-contact cross-polarization under magic-angle spinning

NASA Astrophysics Data System (ADS)

Raya, J.; Hirschinger, J.

2017-08-01

Multiple-contact cross-polarization (MC-CP) is applied to powder samples of ferrocene and L-alanine under magic-angle spinning (MAS) conditions. The method is described analytically through the density matrix formalism. The combination of a two-step memory function approach and the Anderson-Weiss approximation is found to be particularly useful to derive approximate analytical solutions for single-contact Hartmann-Hahn CP (HHCP) and MC-CP dynamics under MAS. We show that the MC-CP sequence requiring no pulse-shape optimization yields higher polarizations at short contact times than optimized adiabatic passage through the HH condition CP (APHH-CP) when the MAS frequency is comparable to the heteronuclear dipolar coupling, i.e., when APHH-CP through a single sideband matching condition is impossible or difficult to perform. It is also shown that the MC-CP sideband HH conditions are generally much broader than for single-contact HHCP and that efficient polarization transfer at the centerband HH condition can be reintroduced by rotor-asynchronous multiple equilibrations-re-equilibrations with the proton spin bath. Boundary conditions for the successful use of the MC-CP experiment when relying on spin-lattice relaxation for repolarization are also examined.

The effects of moderate fatigue on dynamic balance control and attentional demands.

PubMed

Simoneau, Martin; Bégin, François; Teasdale, Normand

2006-09-28

During daily activities, the active control of balance often is a task per se (for example, when standing in a moving bus). Other constraints like fatigue can add to the complexity of this balance task. In the present experiment, we examined how moderate fatigue induced by fast walking on a treadmill challenged dynamic balance control. We also examined if the attentional demands for performing the balance task varied with fatigue. Subjects (n = 10) performed simultaneously a dynamic balance control task and a probe reaction time task (RT) (serving as an indicator of attentional demands) before and after three periods of moderate fatigue (fast walking on a treadmill). For the balance control task, the real-time displacement of the centre of pressure (CP) was provided on a monitor placed in front of the subject, at eye level. Subjects were asked to keep their CP within a target (moving box) moving upward and downward on the monitor. The tracking performance was measured (time spent outside the moving box) and the CP behavior analyzed (mean CP speed and mean frequency of the CP velocity). Moderate fatigue led to an immediate decrement of the performance on the balance control task; increase of the percentage of time spent outside the box and increase of the mean CP speed. Across the three fatigue periods, subjects improved their tracking performance and reduced their mean CP speed. This was achieved by increasing their frequency of actions; mean frequency of the CP velocity were higher for the fatigue periods than for the no fatigue periods. Fatigue also induced an increase in the attentional demands suggesting that more cognitive resources had to be allocated to the balance task with than without fatigue. Fatigue induced by fast walking had an initial negative impact on the control of balance. Nonetheless, subjects were able to compensate the effect of the moderate fatigue by increasing the frequency of actions. This adaptation, however, required that a greater proportion of the cognitive resources be allocated to the active control of the balance task.

The impact of manufacturing variables on in vitro release of clobetasol 17-propionate from pilot scale cream formulations.

PubMed

Fauzee, Ayeshah Fateemah Beebee; Khamanga, Sandile Maswazi; Walker, Roderick Bryan

2014-12-01

The purpose of the study was to evaluate the effect of different homogenization speeds and times, anchor speeds and cooling times on the viscosity and cumulative % clobetasol 17-propionate released per unit area at 72 h from pilot scale cream formulations. A 2(4) full factorial central composite design for four independent variables were investigated. Thirty pilot scale batches of cream formulations were manufactured using a Wintech® cream/ointment plant. The viscosity and in vitro release of CP were monitored and compared to an innovator product that is commercially available on the South African market, namely, Dermovate® cream. Contour and three-dimensional response surface plots were produced and the viscosity and cumulative % CP released per unit area at 72 h were found to be primarily dependent on the homogenization and anchor speeds. An increase in the homogenization and anchor speeds appeared to exhibit a synergistic effect on the resultant viscosity of the cream whereas an antagonistic effect was observed for the in vitro release of CP from the experimental cream formulations. The in vitro release profiles were best fitted to a Higuchi model and diffusion proved to be the dominant mechanism of drug release that was confirmed by use of the Korsmeyer-Peppas model. The research was further validated and confirmed by the high prognostic ability of response surface methodology (RSM) with a resultant mean percentage error of (±SD) 0.17 ± 0.093 suggesting that RSM may be an efficient tool for the development and optimization of topical formulations.

High-performance colossal permittivity materials of (Nb + Er) co-doped TiO2 for large capacitors and high-energy-density storage devices.

PubMed

Tse, Mei-Yan; Wei, Xianhua; Hao, Jianhua

2016-09-21

The search for colossal permittivity (CP) materials is imperative because of their potential for promising applications in the areas of device miniaturization and energy storage. High-performance CP materials require high dielectric permittivity, low dielectric loss and relatively weak dependence of frequency- and temperature. In this work, we first investigate the CP behavior of rutile TiO2 ceramics co-doped with niobium and erbium, i.e., (Er0.5Nb0.5)xTi1-xO2. Excellent dielectric properties were observed in the materials, including a CP of up to 10(4)-10(5) and a low dielectric loss (tan δ) down to 0.03, which are lower than that of the previously reported co-doped TiO2 CP materials when measured at 1 kHz. Stabilities of frequency and temperature were also accomplished via doping Er and Nb. Valence states of the elements in the material were analyzed using X-ray photoelectron spectroscopy. The Er induced secondary phases were observed using elemental mapping and energy-dispersive spectrometry. Consequently, this work may provide comprehensive guidance to develop high-performance CP materials for fully solid-state capacitor and energy storage applications.

RNAi-independent role for Argonaute2 in CTCF/CP190 chromatin insulator function

PubMed Central

Moshkovich, Nellie; Nisha, Parul; Boyle, Patrick J.; Thompson, Brandi A.; Dale, Ryan K.; Lei, Elissa P.

2011-01-01

A major role of the RNAi pathway in Schizosaccharomyces pombe is to nucleate heterochromatin, but it remains unclear whether this mechanism is conserved. To address this question in Drosophila, we performed genome-wide localization of Argonaute2 (AGO2) by chromatin immunoprecipitation (ChIP)-seq in two different embryonic cell lines and found that AGO2 localizes to euchromatin but not heterochromatin. This localization pattern is further supported by immunofluorescence staining of polytene chromosomes and cell lines, and these studies also indicate that a substantial fraction of AGO2 resides in the nucleus. Intriguingly, AGO2 colocalizes extensively with CTCF/CP190 chromatin insulators but not with genomic regions corresponding to endogenous siRNA production. Moreover, AGO2, but not its catalytic activity or Dicer-2, is required for CTCF/CP190-dependent Fab-8 insulator function. AGO2 interacts physically with CTCF and CP190, and depletion of either CTCF or CP190 results in genome-wide loss of AGO2 chromatin association. Finally, mutation of CTCF, CP190, or AGO2 leads to reduction of chromosomal looping interactions, thereby altering gene expression. We propose that RNAi-independent recruitment of AGO2 to chromatin by insulator proteins promotes the definition of transcriptional domains throughout the genome. PMID:21852534

Measurement of CP violation in B 0 → J/ ψK S 0 and B 0 → ψ(2 S) K S 0 decays

NASA Astrophysics Data System (ADS)

Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Alexander, M.; Alfonso Albero, A.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves, A. A.; Amato, S.; Amerio, S.; Amhis, Y.; An, L.; Anderlini, L.; Andreassi, G.; Andreotti, M.; Andrews, J. E.; Appleby, R. B.; Archilli, F.; d'Argent, P.; Arnau Romeu, J.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Babuschkin, I.; Bachmann, S.; Back, J. J.; Badalov, A.; Baesso, C.; Baker, S.; Balagura, V.; Baldini, W.; Baranov, A.; Barlow, R. J.; Barschel, C.; Barsuk, S.; Barter, W.; Baryshnikov, F.; Batozskaya, V.; Battista, V.; Bay, A.; Beaucourt, L.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Beiter, A.; Bel, L. J.; Beliy, N.; Bellee, V.; Belloli, N.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Beranek, S.; Berezhnoy, A.; Bernet, R.; Berninghoff, D.; Bertholet, E.; Bertolin, A.; Betancourt, C.; Betti, F.; Bettler, M.-O.; van Beuzekom, M.; Bezshyiko, Ia.; Bifani, S.; Billoir, P.; Birnkraut, A.; Bizzeti, A.; Bjørn, M.; Blake, T.; Blanc, F.; Blusk, S.; Bocci, V.; Boettcher, T.; Bondar, A.; Bondar, N.; Bordyuzhin, I.; Borgheresi, A.; Borghi, S.; Borisyak, M.; Borsato, M.; Bossu, F.; Boubdir, M.; Bowcock, T. J. V.; Bowen, E.; Bozzi, C.; Braun, S.; Britton, T.; Brodzicka, J.; Brundu, D.; Buchanan, E.; Burr, C.; Bursche, A.; Buytaert, J.; Byczynski, W.; Cadeddu, S.; Cai, H.; Calabrese, R.; Calladine, R.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D. H.; Capriotti, L.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carniti, P.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Cassina, L.; Cattaneo, M.; Cavallero, G.; Cenci, R.; Chamont, D.; Chapman, M. G.; Charles, M.; Charpentier, Ph.; Chatzikonstantinidis, G.; Chefdeville, M.; Chen, S.; Cheung, S. F.; Chitic, S.-G.; Chobanova, V.; Chrzaszcz, M.; Chubykin, A.; Ciambrone, P.; Cid Vidal, X.; Ciezarek, G.; Clarke, P. E. L.; Clemencic, M.; Cliff, H. V.; Closier, J.; Cogan, J.; Cogneras, E.; Cogoni, V.; Cojocariu, L.; Collins, P.; Colombo, T.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombs, G.; Coquereau, S.; Corti, G.; Corvo, M.; Costa Sobral, C. M.; Couturier, B.; Cowan, G. A.; Craik, D. C.; Crocombe, A.; Cruz Torres, M.; Currie, R.; D'Ambrosio, C.; Da Cunha Marinho, F.; Dall'Occo, E.; Dalseno, J.; Davis, A.; De Aguiar Francisco, O.; De Capua, S.; De Cian, M.; De Miranda, J. M.; De Paula, L.; De Serio, M.; De Simone, P.; Dean, C. T.; Decamp, D.; Del Buono, L.; Dembinski, H.-P.; Demmer, M.; Dendek, A.; Derkach, D.; Deschamps, O.; Dettori, F.; Dey, B.; Di Canto, A.; Di Nezza, P.; Dijkstra, H.; Dordei, F.; Dorigo, M.; Dosil Suárez, A.; Douglas, L.; Dovbnya, A.; Dreimanis, K.; Dufour, L.; Dujany, G.; Durante, P.; Dzhelyadin, R.; Dziewiecki, M.; Dziurda, A.; Dzyuba, A.; Easo, S.; Ebert, M.; Egede, U.; Egorychev, V.; Eidelman, S.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; Ely, S.; Esen, S.; Evans, H. M.; Evans, T.; Falabella, A.; Farley, N.; Farry, S.; Fazzini, D.; Federici, L.; Ferguson, D.; Fernandez, G.; Fernandez Declara, P.; Fernandez Prieto, A.; Ferrari, F.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fini, R. A.; Fiorini, M.; Firlej, M.; Fitzpatrick, C.; Fiutowski, T.; Fleuret, F.; Fohl, K.; Fontana, M.; Fontanelli, F.; Forshaw, D. C.; Forty, R.; Franco Lima, V.; Frank, M.; Frei, C.; Fu, J.; Funk, W.; Furfaro, E.; Färber, C.; Gabriel, E.; Gallas Torreira, A.; Galli, D.; Gallorini, S.; Gambetta, S.; Gandelman, M.; Gandini, P.; Gao, Y.; Garcia Martin, L. M.; García Pardiñas, J.; Garra Tico, J.; Garrido, L.; Garsed, P. J.; Gascon, D.; Gaspar, C.; Gavardi, L.; Gazzoni, G.; Gerick, D.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gianì, S.; Gibson, V.; Girard, O. G.; Giubega, L.; Gizdov, K.; Gligorov, V. V.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorelov, I. V.; Gotti, C.; Govorkova, E.; Grabowski, J. P.; Graciani Diaz, R.; Granado Cardoso, L. A.; Graugés, E.; Graverini, E.; Graziani, G.; Grecu, A.; Greim, R.; Griffith, P.; Grillo, L.; Gruber, L.; Gruberg Cazon, B. R.; Grünberg, O.; Gushchin, E.; Guz, Yu.; Gys, T.; Göbel, C.; Hadavizadeh, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S. C.; Hamilton, B.; Han, X.; Hancock, T. H.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S. T.; Hasse, C.; Hatch, M.; He, J.; Hecker, M.; Heinicke, K.; Heister, A.; Hennessy, K.; Henrard, P.; Henry, L.; van Herwijnen, E.; Heß, M.; Hicheur, A.; Hill, D.; Hombach, C.; Hopchev, P. H.; Hu, W.; Huard, Z. C.; Hulsbergen, W.; Humair, T.; Hushchyn, M.; Hutchcroft, D.; Ibis, P.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jalocha, J.; Jans, E.; Jawahery, A.; Jiang, F.; John, M.; Johnson, D.; Jones, C. R.; Joram, C.; Jost, B.; Jurik, N.; Kandybei, S.; Karacson, M.; Kariuki, J. M.; Karodia, S.; Kazeev, N.; Kecke, M.; Kelsey, M.; Kenzie, M.; Ketel, T.; Khairullin, E.; Khanji, B.; Khurewathanakul, C.; Kirn, T.; Klaver, S.; Klimaszewski, K.; Klimkovich, T.; Koliiev, S.; Kolpin, M.; Komarov, I.; Kopecna, R.; Koppenburg, P.; Kosmyntseva, A.; Kotriakhova, S.; Kozeiha, M.; Kravchuk, L.; Kreps, M.; Kress, F.; Krokovny, P.; Kruse, F.; Krzemien, W.; Kucewicz, W.; Kucharczyk, M.; Kudryavtsev, V.; Kuonen, A. K.; Kvaratskheliya, T.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; Leflat, A.; Lefrançois, J.; Lefèvre, R.; Lemaitre, F.; Lemos Cid, E.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, P.-R.; Li, T.; Li, Y.; Li, Z.; Likhomanenko, T.; Lindner, R.; Lionetto, F.; Lisovskyi, V.; Liu, X.; Loh, D.; Loi, A.; Longstaff, I.; Lopes, J. H.; Lucchesi, D.; Lucio Martinez, M.; Luo, H.; Lupato, A.; Luppi, E.; Lupton, O.; Lusiani, A.; Lyu, X.; Machefert, F.; Maciuc, F.; Macko, V.; Mackowiak, P.; Maddrell-Mander, S.; Maev, O.; Maguire, K.; Maisuzenko, D.; Majewski, M. W.; Malde, S.; Malinin, A.; Maltsev, T.; Manca, G.; Mancinelli, G.; Marangotto, D.; Maratas, J.; Marchand, J. F.; Marconi, U.; Marin Benito, C.; Marinangeli, M.; Marino, P.; Marks, J.; Martellotti, G.; Martin, M.; Martinelli, M.; Martinez Santos, D.; Martinez Vidal, F.; Martins Tostes, D.; Massacrier, L. M.; Massafferri, A.; Matev, R.; Mathad, A.; Mathe, Z.; Matteuzzi, C.; Mauri, A.; Maurice, E.; Maurin, B.; Mazurov, A.; McCann, M.; McNab, A.; McNulty, R.; Mead, J. V.; Meadows, B.; Meaux, C.; Meier, F.; Meinert, N.; Melnychuk, D.; Merk, M.; Merli, A.; Michielin, E.; Milanes, D. A.; Millard, E.; Minard, M.-N.; Minzoni, L.; Mitzel, D. S.; Mogini, A.; Molina Rodriguez, J.; Mombächer, T.; Monroy, I. A.; Monteil, S.; Morandin, M.; Morello, M. J.; Morgunova, O.; Moron, J.; Morris, A. B.; Mountain, R.; Muheim, F.; Mulder, M.; Müller, D.; Müller, J.; Müller, K.; Müller, V.; Naik, P.; Nakada, T.; Nandakumar, R.; Nandi, A.; Nasteva, I.; Needham, M.; Neri, N.; Neubert, S.; Neufeld, N.; Neuner, M.; Nguyen, T. D.; Nguyen-Mau, C.; Nieswand, S.; Niet, R.; Nikitin, N.; Nikodem, T.; Nogay, A.; O'Hanlon, D. P.; Oblakowska-Mucha, A.; Obraztsov, V.; Ogilvy, S.; Oldeman, R.; Onderwater, C. J. G.; Ossowska, A.; Otalora Goicochea, J. M.; Owen, P.; Oyanguren, A.; Pais, P. R.; Palano, A.; Palutan, M.; Papanestis, A.; Pappagallo, M.; Pappalardo, L. L.; Parker, W.; Parkes, C.; Passaleva, G.; Pastore, A.; Patel, M.; Patrignani, C.; Pearce, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perret, P.; Pescatore, L.; Petridis, K.; Petrolini, A.; Petrov, A.; Petruzzo, M.; Picatoste Olloqui, E.; Pietrzyk, B.; Pikies, M.; Pinci, D.; Pisani, F.; Pistone, A.; Piucci, A.; Placinta, V.; Playfer, S.; Plo Casasus, M.; Polci, F.; Poli Lener, M.; Poluektov, A.; Polyakov, I.; Polycarpo, E.; Pomery, G. J.; Ponce, S.; Popov, A.; Popov, D.; Poslavskii, S.; Potterat, C.; Price, E.; Prisciandaro, J.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Pullen, H.; Punzi, G.; Qian, W.; Quagliani, R.; Quintana, B.; Rachwal, B.; Rademacker, J. H.; Rama, M.; Ramos Pernas, M.; Rangel, M. S.; Raniuk, I.; Ratnikov, F.; Raven, G.; Ravonel Salzgeber, M.; Reboud, M.; Redi, F.; Reichert, S.; dos Reis, A. C.; Remon Alepuz, C.; Renaudin, V.; Ricciardi, S.; Richards, S.; Rihl, M.; Rinnert, K.; Rives Molina, V.; Robbe, P.; Robert, A.; Rodrigues, A. B.; Rodrigues, E.; Rodriguez Lopez, J. A.; Rogozhnikov, A.; Roiser, S.; Rollings, A.; Romanovskiy, V.; Romero Vidal, A.; Ronayne, J. W.; Rotondo, M.; Rudolph, M. S.; Ruf, T.; Ruiz Valls, P.; Ruiz Vidal, J.; Saborido Silva, J. J.; Sadykhov, E.; Sagidova, N.; Saitta, B.; Salustino Guimaraes, V.; Sanchez Mayordomo, C.; Sanmartin Sedes, B.; Santacesaria, R.; Santamarina Rios, C.; Santimaria, M.; Santovetti, E.; Sarpis, G.; Sarti, A.; Satriano, C.; Satta, A.; Saunders, D. M.; Savrina, D.; Schael, S.; Schellenberg, M.; Schiller, M.; Schindler, H.; Schmelling, M.; Schmelzer, T.; Schmidt, B.; Schneider, O.; Schopper, A.; Schreiner, H. F.; Schubiger, M.; Schune, M.-H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Semennikov, A.; Sepulveda, E. S.; Sergi, A.; Serra, N.; Serrano, J.; Sestini, L.; Seuthe, A.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, V.; Siddi, B. G.; Silva Coutinho, R.; Silva de Oliveira, L.; Simi, G.; Simone, S.; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, E.; Smith, I. T.; Smith, J.; Smith, M.; Soares Lavra, l.; Sokoloff, M. D.; Soler, F. J. P.; Souza De Paula, B.; Spaan, B.; Spradlin, P.; Sridharan, S.; Stagni, F.; Stahl, M.; Stahl, S.; Stefko, P.; Stefkova, S.; Steinkamp, O.; Stemmle, S.; Stenyakin, O.; Stepanova, M.; Stevens, H.; Stone, S.; Storaci, B.; Stracka, S.; Stramaglia, M. E.; Straticiuc, M.; Straumann, U.; Sun, J.; Sun, L.; Sutcliffe, W.; Swientek, K.; Syropoulos, V.; Szumlak, T.; Szymanski, M.; T'Jampens, S.; Tayduganov, A.; Tekampe, T.; Tellarini, G.; Teubert, F.; Thomas, E.; van Tilburg, J.; Tilley, M. J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tomassetti, L.; Tonelli, D.; Toriello, F.; Tourinho Jadallah Aoude, R.; Tournefier, E.; Traill, M.; Tran, M. T.; Tresch, M.; Trisovic, A.; Tsaregorodtsev, A.; Tsopelas, P.; Tully, A.; Tuning, N.; Ukleja, A.; Usachov, A.; Ustyuzhanin, A.; Uwer, U.; Vacca, C.; Vagner, A.; Vagnoni, V.; Valassi, A.; Valat, S.; Valenti, G.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vecchi, S.; van Veghel, M.; Velthuis, J. J.; Veltri, M.; Veneziano, G.; Venkateswaran, A.; Verlage, T. A.; Vernet, M.; Vesterinen, M.; Viana Barbosa, J. V.; Viaud, B.; Vieira, D.; Vieites Diaz, M.; Viemann, H.; Vilasis-Cardona, X.; Vitti, M.; Volkov, V.; Vollhardt, A.; Voneki, B.; Vorobyev, A.; Vorobyev, V.; Voß, C.; de Vries, J. A.; Vázquez Sierra, C.; Waldi, R.; Wallace, C.; Wallace, R.; Walsh, J.; Wang, J.; Ward, D. R.; Wark, H. M.; Watson, N. K.; Websdale, D.; Weiden, A.; Weisser, C.; Whitehead, M.; Wicht, J.; Wilkinson, G.; Wilkinson, M.; Williams, M.; Williams, M. P.; Williams, M.; Williams, T.; Wilson, F. F.; Wimberley, J.; Winn, M.; Wishahi, J.; Wislicki, W.; Witek, M.; Wormser, G.; Wotton, S. A.; Wraight, K.; Wyllie, K.; Xie, Y.; Xu, M.; Xu, Z.; Yang, Z.; Yang, Z.; Yao, Y.; Yin, H.; Yu, J.; Yuan, X.; Yushchenko, O.; Zarebski, K. A.; Zavertyaev, M.; Zhang, L.; Zhang, Y.; Zhelezov, A.; Zheng, Y.; Zhu, X.; Zhukov, V.; Zonneveld, J. B.; Zucchelli, S.

2017-11-01

A measurement is presented of decay-time-dependent CP violation in the decays B 0 → J/ ψ K S 0 and B 0 → ψ(2 S) K S 0 , where the J/ ψ is reconstructed from two electrons and the ψ(2 S) from two muons. The analysis uses a sample of pp collision data recorded with the LHCb experiment at centre-of-mass energies of 7 and 8 TeV, corresponding to an integrated luminosity of 3 fb-1. The CP -violation observables are measured to be C({B}^0\\to J/ψ {K}S^0)=0.12± 0.07± 0.02, {}S({B}^0\\to J/ψ {K}S^0)=0.83± 0.08± 0.01, {}C({B}^0\\to ψ (2S){K}S^0)=-0.05± 0.10± 0.01, {}S({B}^0\\to ψ (2S){K}S^0)=0.84± 0.10± 0.01, where C describes CP violation in the direct decay, and S describes CP violation in the interference between the amplitudes for the direct decay and for the decay after {B}^0-{\\overline{B}}^0 oscillation. The first uncertainties are statistical and the second are systematic. The two sets of results are compatible with the previous LHCb measurement using B 0 → J/ ψ K S 0 decays, where the J/ ψ meson was reconstructed from two muons. The averages of all three sets of LHCb results are C({B}^0\\to [c\\overline{c}]{K}S^0)=-0.017± 0.029, {}S({B}^0\\to [c\\overline{c}]{K}S^0)=0.760± 0.034, under the assumption that higher-order contributions to the decay amplitudes are negligible. The uncertainties include statistical and systematic contributions. [Figure not available: see fulltext.

Identifying the Tunneling Site in Strong-Field Ionization of H_{2}^{+}.

PubMed

Liu, Kunlong; Barth, Ingo

2017-12-15

The tunneling site of the electron in a molecule exposed to a strong laser field determines the initial position of the ionizing electron and, as a result, has a large impact on the subsequent ultrafast electron dynamics on the polyatomic Coulomb potential. Here, the tunneling site of the electron of H_{2}^{+} ionized by a strong circularly polarized (CP) laser pulse is studied by numerically solving the time-dependent Schrödinger equation. We show that the electron removed from the down-field site is directly driven away by the CP field and the lateral photoelectron momentum distribution (LPMD) exhibits a Gaussian-like distribution, whereas the corresponding LPMD of the electron removed from the up-field site differs from the Gaussian shape due to the Coulomb focusing and scattering by the down-field core. Our current study presents the direct evidence clarifying a long-standing controversy over the tunneling site in H_{2}^{+} and raises the important role of the tunneling site in strong-field molecular ionization.

Simultaneous Right and Left Heart Real-Time, Free-Breathing CMR Flow Quantification Identifies Constrictive Physiology

PubMed Central

Thavendiranathan, Paaladinesh; Verhaert, David; Walls, Michael C.; Bender, Jacob A.; Rajagopalan, Sanjay; Chung, Yiu-Cho; Simonetti, Orlando P.; Raman, Subha V.

2015-01-01

OBJECTIVES The purpose of this study was to evaluate the ability of a novel cardiac magnetic resonance (CMR) real-time phase contrast (RT-PC) flow measurement technique to reveal the discordant respirophasic changes in mitral and tricuspid valve in flow indicative of the abnormal hemodynamics seen in constrictive pericarditis (CP). BACKGROUND Definitive diagnosis of CP requires identification of constrictive hemodynamics with or without pericardial thickening. CMR to date has primarily provided morphological assessment of the pericardium. METHODS Sixteen patients (age 57 ± 13 years) undergoing CMR to assess known or suspected CP and 10 controls underwent RT-PC that acquired simultaneous mitral valve and tricuspid valve inflow velocities over 10 s of unrestricted breathing. The diagnosis of CP was confirmed via clinical history, diagnostic imaging, cardiac catheterization, intraoperative findings, and histopathology. RESULTS Ten patients had CP, all with increased pericardial thickness (6.2 ± 1.0 mm). RT-PC imaging demonstrated discordant respirophasic changes in atrioventricular valve inflow velocities in all CP patients, with mean ± SD mitral valve and tricuspid valve inflow velocity variation of 46 ± 20% and 60 ± 15%, respectively, compared with 16 ± 8% and 24 ± 11% in patients without CP (p < 0.004 vs. patients with CP for both) and 17 ± 5% and 31 ± 13% in controls (p < 0.001 vs. patients with CP for both). There was no difference in atrioventricular valve inflow velocity variation between patients without CP compared with controls (p > 0.3 for both). Respiratory variation exceeding 25% across the mitral valve yielded a sensitivity of 100%, a specificity of 100%, and an area under the receiver-operating characteristic curve of 1.0 to detect CP physiology. Using a cutoff of 45%, variation of transtricuspid valve velocity had a sensitivity of 90%, a specificity of 88%, and an area under the receiver-operating characteristic curve of 0.98. CONCLUSIONS Accentuated and discordant respirophasic changes in mitral valve and tricuspid valve inflow velocities characteristic of CP can be identified noninvasively with RT-PC CMR. When incorporated into existing CMR protocols for imaging pericardial morphology, RT-PC CMR provides important hemodynamic evidence with which to make a definite diagnosis of CP. PMID:22239888

Ectopic Expression of BnaC.CP20.1 Results in Premature Tapetal Programmed Cell Death in Arabidopsis.

PubMed

Song, Liping; Zhou, Zhengfu; Tang, Shan; Zhang, Zhiqiang; Xia, Shengqian; Qin, Maomao; Li, Bao; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Fu, Tingdong; Tu, Jinxing

2016-09-01

Tapetal programmed cell death (PCD) is essential in pollen grain development, and cysteine proteases are ubiquitous enzymes participating in plant PCD. Although the major papain-like cysteine proteases (PLCPs) have been investigated, the exact functions of many PLCPs are still poorly understood in PCD. Here, we identified a PLCP gene, BnaC.CP20.1, which was closely related to XP_013596648.1 from Brassica oleracea. Quantitative real-time PCR analysis revealed that BnaC.CP20.1 expression was down-regulated in male-sterile lines in oilseed rape, suggesting a connection between this gene and male sterility. BnaC.CP20.1 is especially active in the tapetum and microspores in Brassica napus from the uninucleate stage until formation of mature pollen grains during anther development. On expression of BnaC.CP20.1 prior to the tetrad stage, BnA9::BnaC.CP20.1 transgenic lines in Arabidopsis thaliana showed a male-sterile phenotype with shortened siliques containing fewer or no seeds by self-crossing. Scanning electron microscopy indicated that the reticulate exine was defective in aborted microspores. Callose degradation was delayed and microspores were not released from the tetrad in a timely fashion. Additionally, the terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL) assay indicated that BnaC.CP20.1 ectopic expression led to premature tapetal PCD. Transmission electron microscopy analyses further demonstrated that the pollen abortion was due to the absence of tectum connections to the bacula in the transgenic anthers. These findings suggest that timely expression of BnaC.CP20.1 is necessary for tapetal degeneration and pollen wall formation. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Neurologic Correlates of Gait Abnormalities in Cerebral Palsy: Implications for Treatment

PubMed Central

Zhou, Joanne; Butler, Erin E.; Rose, Jessica

2017-01-01

Cerebral palsy (CP) is the most common movement disorder in children. A diagnosis of CP is often made based on abnormal muscle tone or posture, a delay in reaching motor milestones, or the presence of gait abnormalities in young children. Neuroimaging of high-risk neonates and of children diagnosed with CP have identified patterns of neurologic injury associated with CP, however, the neural underpinnings of common gait abnormalities remain largely uncharacterized. Here, we review the nature of the brain injury in CP, as well as the neuromuscular deficits and subsequent gait abnormalities common among children with CP. We first discuss brain injury in terms of mechanism, pattern, and time of injury during the prenatal, perinatal, or postnatal period in preterm and term-born children. Second, we outline neuromuscular deficits of CP with a focus on spastic CP, characterized by muscle weakness, shortened muscle-tendon unit, spasticity, and impaired selective motor control, on both a microscopic and functional level. Third, we examine the influence of neuromuscular deficits on gait abnormalities in CP, while considering emerging information on neural correlates of gait abnormalities and the implications for strategic treatment. This review of the neural basis of gait abnormalities in CP discusses what is known about links between the location and extent of brain injury and the type and severity of CP, in relation to the associated neuromuscular deficits, and subsequent gait abnormalities. Targeted treatment opportunities are identified that may improve functional outcomes for children with CP. By providing this context on the neural basis of gait abnormalities in CP, we hope to highlight areas of further research that can reduce the long-term, debilitating effects of CP. PMID:28367118

Lp-estimates on diffusion processes

NASA Astrophysics Data System (ADS)

Yan, Litan; Zhu, Bei

2005-03-01

Let be a diffusion process on given by where B=(Bt)t[greater-or-equal, slanted]0 is a standard Brownian motion starting at zero and [mu],[sigma] are two continuous functions on , and [sigma](x)>0 if x[not equal to]0. For a nonnegative continuous function [phi] we define the functional by , t[greater-or-equal, slanted]0. Then under suitable conditions we establish the relationship between Lp-norm of sup0[less-than-or-equals, slant]t[less-than-or-equals, slant][tau]Xt and Lp-norm of J[tau] for all stopping times [tau]. In particular, for a Bessel process Z of dimension [delta]>0 starting at zero, we show that the inequalities hold for all 00, where Cp and cp are some positive constants depending only on p, and H[mu],h[mu] are the inverses of x|->(e2[mu]x-2[mu]x-1)/2[mu]2 and x|->(e-2[mu]x+2[mu]x-1)/2[mu]2 on (0,[infinity]), respectively.

Rapid “Breath-Print” of Liver Cirrhosis by Proton Transfer Reaction Time-of-Flight Mass Spectrometry. A Pilot Study.

PubMed Central

Morisco, Filomena; Aprea, Eugenio; Lembo, Vincenzo; Fogliano, Vincenzo; Vitaglione, Paola; Mazzone, Giovanna; Cappellin, Luca; Gasperi, Flavia; Masone, Stefania; De Palma, Giovanni Domenico; Marmo, Riccardo; Caporaso, Nicola; Biasioli, Franco

2013-01-01

The aim of the present work was to test the potential of Proton Transfer Reaction Time-of-Flight Mass Spectrometry (PTR-ToF-MS) in the diagnosis of liver cirrhosis and the assessment of disease severity by direct analysis of exhaled breath. Twenty-six volunteers have been enrolled in this study: 12 patients (M/F 8/4, mean age 70.5 years, min-max 42–80 years) with liver cirrhosis of different etiologies and at different severity of disease and 14 healthy subjects (M/F 5/9, mean age 52.3 years, min-max 35–77 years). Real time breath analysis was performed on fasting subjects using a buffered end-tidal on-line sampler directly coupled to a PTR-ToF-MS. Twelve volatile organic compounds (VOCs) resulted significantly differently in cirrhotic patients (CP) compared to healthy controls (CTRL): four ketones (2-butanone, 2- or 3- pentanone, C8-ketone, C9-ketone), two terpenes (monoterpene, monoterpene related), four sulphur or nitrogen compounds (sulfoxide-compound, S-compound, NS-compound, N-compound) and two alcohols (heptadienol, methanol). Seven VOCs (2-butanone, C8-ketone, a monoterpene, 2,4-heptadienol and three compounds containing N, S or NS) resulted significantly differently in compensate cirrhotic patients (Child-Pugh A; CP-A) and decompensated cirrhotic subjects (Child-Pugh B+C; CP-B+C). ROC (Receiver Operating Characteristic) analysis was performed considering three contrast groups: CP vs CTRL, CP-A vs CTRL and CP-A vs CP-B+C. In these comparisons monoterpene and N-compound showed the best diagnostic performance. Conclusions Breath analysis by PTR-ToF-MS was able to distinguish cirrhotic patients from healthy subjects and to discriminate those with well compensated liver disease from those at more advanced severity stage. A breath-print of liver cirrhosis was assessed for the first time. PMID:23573204

The search for permanent electric dipole moments, in particular for the one of the neutron

ScienceCinema

Kirch, Klaus

2018-05-04

Nonzero permanent electric dipole moments (EDM) of fundamental systems like particles, nuclei, atoms or molecules violate parity and time reversal invariance. Invoking the CPT theorem, time reversal violation implies CP violation. Although CP-violation is implemented in the standard electro-weak theory, EDM generated this way remain undetectably small. However, this CP-violation also appears to fail explaining the observed baryon asymmetry of our universe. Extensions of the standard theory usually include new CP violating phases which often lead to the prediciton of larger EDM. EDM searches in different systems are complementary and various efforts worldwide are underway, but no finite value could be established yet. An improved search for the EDM of the neutron requires, among other things, much better statistics. At PSI, we are presently commissioning a new high intensity source of ultracold neutrons. At the same time, with an international collaboration, we are setting up for a new measurement of the neutron EDM which is starting this year.

38 CFR 21.8072 - Authorizing training, services, and assistance beyond the initial individualized written plan of...

Code of Federal Regulations, 2012 CFR

2012-07-01

... section unless a CP or VRC sets aside the child's achievement of that vocational goal under § 21.8284. (Authority: 38 U.S.C. 1804(b) through (e), 1814) (c) Responsibility for authorizing a program extension. A CP... maximum program limit of 48 months if the CP or VRC determines that the child needs the additional time to...

38 CFR 21.8072 - Authorizing training, services, and assistance beyond the initial individualized written plan of...

Code of Federal Regulations, 2011 CFR

2011-07-01

... section unless a CP or VRC sets aside the child's achievement of that vocational goal under § 21.8284. (Authority: 38 U.S.C. 1804(b) through (e), 1814) (c) Responsibility for authorizing a program extension. A CP... maximum program limit of 48 months if the CP or VRC determines that the child needs the additional time to...

38 CFR 21.8072 - Authorizing training, services, and assistance beyond the initial individualized written plan of...

Code of Federal Regulations, 2014 CFR

2014-07-01

... section unless a CP or VRC sets aside the child's achievement of that vocational goal under § 21.8284. (Authority: 38 U.S.C. 1804(b) through (e), 1814) (c) Responsibility for authorizing a program extension. A CP... maximum program limit of 48 months if the CP or VRC determines that the child needs the additional time to...

38 CFR 21.8072 - Authorizing training, services, and assistance beyond the initial individualized written plan of...

Code of Federal Regulations, 2013 CFR

2013-07-01

... section unless a CP or VRC sets aside the child's achievement of that vocational goal under § 21.8284. (Authority: 38 U.S.C. 1804(b) through (e), 1814) (c) Responsibility for authorizing a program extension. A CP... maximum program limit of 48 months if the CP or VRC determines that the child needs the additional time to...

Non-Ceruloplasmin Copper Distincts Subtypes in Alzheimer's Disease: a Genetic Study of ATP7B Frequency.

PubMed

Squitti, Rosanna; Ventriglia, Mariacarla; Gennarelli, Massimo; Colabufo, Nicola A; El Idrissi, Imane Ghafir; Bucossi, Serena; Mariani, Stefania; Rongioletti, Mauro; Zanetti, Orazio; Congiu, Chiara; Rossini, Paolo M; Bonvicini, Cristian

2017-01-01

Meta-analyses show that serum copper non-bound-to-ceruloplasmin (non-Cp-Cu) is higher in patients with Alzheimer's disease (AD). ATP7B gene variants associate with AD, modulating the size of non-Cp-Cu pool. However, a dedicated genetic study comparing AD patients after stratification for a copper biomarker to demonstrate the existence of a copper subtype of AD has not yet been carried out. An independent patient sample of 287 AD patients was assessed for non-Cp-Cu serum concentrations, rs1801243, rs1061472, and rs732774 ATP7B genetic variants and the APOE4 genotype. Patients were stratified into two groups based on a non-Cp-Cu cutoff (1.9 μM). Single-locus and haplotype-group analyses were performed to define their frequencies in dependence of the non-Cp-Cu group. The two AD subgroups did not differ regarding age, sex, MMSE score, or APOE4 frequency allele, while they did differ regarding non-Cp-Cu concentrations in serum, allele, genotype, and haplotype frequencies of rs1061472 A > G and rs732774 C > T after multiple testing corrections. AD patients with a GG genotype had a 1.76-fold higher risk of having a non-Cp-Cu higher than 1.9 μmol/L (p = 0.029), and those with a TT genotype for rs732774 C > T of 1.8-fold (p = 0.018). After 100,000 permutations for multiple testing corrections, the haplotype containing the AC alleles appeared more frequently in AD patients with normal non-Cp-Cu [43 vs. 33 %; Pm = 0.03], while the haplotype containing the GT risk alleles appeared more frequently in the higher non-Cp-Cu AD (66 vs. 55 %; Pm = 0.01). Genetic heterogeneity sustains a copper AD metabolic subtype; non-Cp-Cu is a marker of this copper AD.

RNA Polymerase II Stalling Promotes Nucleosome Occlusion and pTEFb Recruitment to Drive Immortalization by Epstein-Barr Virus

PubMed Central

Palermo, Richard D.; Webb, Helen M.; West, Michelle J.

2011-01-01

Epstein-Barr virus (EBV) immortalizes resting B-cells and is a key etiologic agent in the development of numerous cancers. The essential EBV-encoded protein EBNA 2 activates the viral C promoter (Cp) producing a message of ∼120 kb that is differentially spliced to encode all EBNAs required for immortalization. We have previously shown that EBNA 2-activated transcription is dependent on the activity of the RNA polymerase II (pol II) C-terminal domain (CTD) kinase pTEFb (CDK9/cyclin T1). We now demonstrate that Cp, in contrast to two shorter EBNA 2-activated viral genes (LMP 1 and 2A), displays high levels of promoter-proximally stalled pol II despite being constitutively active. Consistent with pol II stalling, we detect considerable pausing complex (NELF/DSIF) association with Cp. Significantly, we observe substantial Cp-specific pTEFb recruitment that stimulates high-level pol II CTD serine 2 phosphorylation at distal regions (up to +75 kb), promoting elongation. We reveal that Cp-specific pol II accumulation is directed by DNA sequences unfavourable for nucleosome assembly that increase TBP access and pol II recruitment. Stalled pol II then maintains Cp nucleosome depletion. Our data indicate that pTEFb is recruited to Cp by the bromodomain protein Brd4, with polymerase stalling facilitating stable association of pTEFb. The Brd4 inhibitor JQ1 and the pTEFb inhibitors DRB and Flavopiridol significantly reduce Cp, but not LMP1 transcript production indicating that Brd4 and pTEFb are required for Cp transcription. Taken together our data indicate that pol II stalling at Cp promotes transcription of essential immortalizing genes during EBV infection by (i) preventing promoter-proximal nucleosome assembly and ii) necessitating the recruitment of pTEFb thereby maintaining serine 2 CTD phosphorylation at distal regions. PMID:22046134

Recent Results with Transatlantic GeTT Campaign

DTIC Science & Technology

1999-12-01

which are driven by H-masers. Frequent comparisons between GPS CP and TWSTFT throughout the campaign allow a comparison of the long-term stability of...the two entirely independent techniques. Small discrepancies between the time transfer by GPS CP and the time transfer by TWSTFT have been observed...density for the GeTT values in comparison to the other time-transfer methods: two-way satellite time and frequency transfer ( TWSTFT ) and Circular T

Inactive and sedentary lifestyles amongst ambulatory adolescents and young adults with cerebral palsy

PubMed Central

2014-01-01

Background To assess physical behaviour, including physical activity and sedentary behaviour, of ambulatory adolescents and young adults with cerebral palsy (CP). We compared participant physical behaviour to that of able-bodied persons and assessed differences related to Gross Motor Functioning Classification System (GMFCS) level and CP distribution (unilateral/bilateral). Methods In 48 ambulatory persons aged 16 to 24 years with spastic CP and in 32 able-bodied controls, physical behaviour was objectively determined with an accelerometer-based activity monitor. Total duration, intensity and type of physical activity were assessed and sedentary time was determined (lying and sitting). Furthermore, distribution of walking bouts and sitting bouts was specified. Results Adolescents and young adults with CP spent 8.6% of 24 hours physically active and 79.5% sedentary, corresponding with respectively 123 minutes and 1147 minutes per 24 hours. Compared to able-bodied controls, persons with CP participated 48 minutes less in physical activities (p < 0.01) and spent 80 minutes more sedentary per 24 hours (p < 0.01). Physical behaviour was not different between persons with GMFCS level I and II and only number of short sitting bouts were significantly more prevalent in persons with bilateral CP compared to unilateral CP (p < 0.05). Conclusions Ambulatory adolescents and young adults with CP are less physically active and spend more time sedentary compared to able-bodied persons, suggesting that this group may be at increased risk for health problems related to less favourable physical behaviour. Trial registration Nederlands trial register: NTR1785 PMID:24708559

Time Trials Versus Time-to-Exhaustion Tests: Effects on Critical Power, W', and Oxygen-Uptake Kinetics.

PubMed

Karsten, Bettina; Baker, Jonathan; Naclerio, Fernando; Klose, Andreas; Bianco, Antonino; Nimmerichter, Alfred

2018-02-01

To investigate single-day time-to-exhaustion (TTE) and time-trial (TT) -based laboratory tests values of critical power (CP), W prime (W'), and respective oxygen-uptake-kinetic responses. Twelve cyclists performed a maximal ramp test followed by 3 TTE and 3 TT efforts interspersed by 60 min recovery between efforts. Oxygen uptake ( V ˙ O 2 ) was measured during all trials. The mean response time was calculated as a description of the overall [Formula: see text]-kinetic response from the onset to 2 min of exercise. TTE-determined CP was 279 ± 52 W, and TT-determined CP was 276 ± 50 W (P = .237). Values of W' were 14.3 ± 3.4 kJ (TTE W') and 16.5 ± 4.2 kJ (TT W') (P = .028). While a high level of agreement (-12 to 17 W) and a low prediction error of 2.7% were established for CP, for W' limits of agreements were markedly lower (-8 to 3.7 kJ), with a prediction error of 18.8%. The mean standard error for TTE CP values was significantly higher than that for TT CP values (2.4% ± 1.9% vs 1.2% ± 0.7% W). The standard errors for TTE W' and TT W' were 11.2% ± 8.1% and 5.6% ± 3.6%, respectively. The [Formula: see text] response was significantly faster during TT (~22 s) than TTE (~28 s). The TT protocol with a 60-min recovery period offers a valid, time-saving, and less error-filled alternative to conventional and more recent testing methods. Results, however, cannot be transferred to W'.

Chitosan/nanohydroxyapatite composite based scallop shells as an efficient adsorbent for mercuric ions: Static and dynamic adsorption studies.

PubMed

Hassan, Asaad F; Hrdina, Radim

2018-04-01

Chitosan/nanohydroxyapatite composites based on scallop shells (CP12, CP14 and CP21) were prepared with different chitosan: nanohydroxyapatite ratios (1:2, 1:4 and 2:1, respectively). Nanohydroxyapatite (P), chitosan(C) and their composites were characterized by means of TGA, XRD, N 2 adsorption/desorption analysis, SEM, Zeta potential and FTIR. The BET surface area ranged between 189 and 512 m 2 /g. Static adsorption of Hg +2 was tested for the effect of adsorbent dosage, pH, time and initial Hg +2 concentrations indicating that maximum static adsorption capacity was confirmed by CP12 (111.6 mg/g). Static adsorption well fitted with Langmuir adsorption isotherm and Pseudo-second order kinetic models. CP12 was selected for dynamic adsorption of Hg +2 considering the effect of bed height, flow rate and the effect of Hg +2 concentrations. Maximum dynamic adsorption capacity was confirmed at bed height of 3 cm, 2.0 mL/min flow rate and 300 mg/L as Hg +2 concentration with breakthrough time (t b ) and exhaustion time (t e ) of 9 and 21 h. Yoon-Nelson and Thomas models best described the experimental Hg +2 breakthrough curve model. After static adsorption, EDTA solution confirmed the maximum desorption efficiency. The validity of CP12 was tested through three cycles of column dynamic adsorption-desorption. Copyright © 2017 Elsevier B.V. All rights reserved.

In silico cloning and characterization of the TGA (TGACG MOTIF-BINDING FACTOR) transcription factors subfamily in Carica papaya.

PubMed

Idrovo Espín, Fabio Marcelo; Peraza-Echeverria, Santy; Fuentes, Gabriela; Santamaría, Jorge M

2012-05-01

The TGA transcription factors belong to the subfamily of bZIP group D that play a major role in disease resistance and development. Most of the TGA identified in Arabidopsis interact with the master regulator of SAR, NPR1 that controls the expression of PR genes. As a first approach to determine the possible involvement of these transcription factors in papaya defense, we characterized Arabidopsis TGA orthologs from the genome of Carica papaya cv. SunUp. Six orthologs CpTGA1 to CpTGA6, were identified. The predicted CpTGA proteins were highly similar to AtTGA sequences and probably share the same DNA binding properties and transcriptional regulation features. The protein sequences alignment evidenced the presence of conserved domains, characteristic of this group of transcription factors. The phylogeny showed that CpTGA evolved into three different subclades associated with defense and floral development. This is the first report of basal expression patterns assessed by RT-PCR, from the whole subfamily of CpTGA members in different tissues from papaya cv. Maradol mature plants. Overall, CpTGA1, CpTGA3 CpTGA6 and CpTGA4 showed a basal expression in all tissues tested; CpTGA2 expressed strongly in all tissues except in petioles while CpTGA5 expressed only in petals and to a lower extent in petioles. Although more detailed studies in anthers and other floral structures are required, we suggest that CpTGA5 might be tissue-specific, and it might be involved in papaya floral development. On the other hand, we report here for the first time, the expression of the whole family of CpTGA in response to salicylic acid (SA). The expression of CpTGA3, CpTGA4 and CpTGA6 increased in response to SA, what would suggest its involvement in the SAR response in papaya. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

Development of a sensitive and quantitative diagnostic assay for fish nervous necrosis virus based on two-target real-time PCR.

PubMed

Dalla Valle, L; Toffolo, V; Lamprecht, M; Maltese, C; Bovo, G; Belvedere, P; Colombo, L

2005-10-31

The aim of the present work was to develop two new independent SYBR Green I-based real-time PCR assays for both detection and quantification of betanodavirus, an RNA virus that infects several species of marine teleost fish causing massive mortalities in larvae and juveniles. The assays utilized two pairs of primers targeting highly conserved regions of both the RNA molecules forming the betanodavirus genome: RNA1 encoding the RNA-dependent RNA polymerase (RdRP) and RNA2 encoding the coat protein (CP). The specificity of amplifications was monitored by the melting analysis and agarose gel electrophoresis of the amplified products. The applicability of these assays was confirmed with 21 betanodavirus strains, covering all the four main clades. In addition, a BLAST (NCBI) search with the primer sequences showed no genomic cross-reactivity with other viruses. The new assays were able to quantify concentrations of betanodavirus genes ranging from 10(1) to 10(8) copies per reaction. The intra-assay coefficients of variation (CV) of threshold cycle (Ct) values of the assays were 1.5% and 1.4% for CP and RdRP RNAs, respectively. The inter-assay CVs of Ct values were 2.3% and 2.4% for CP and RdRP RNAs, respectively. Moreover, regression analysis showed a significant correlation (R2>0.97) between genome number, as determined by real-time PCR assays and the corresponding virus titer expressed as TCID50/ml of two different betanodavirus strains propagated in cell culture. The two assays were compared with a previously established one-step RT-PCR assay and with the classical virus isolation test and found to be more sensitive. In conclusion, the developed real-time RT-PCR assays are a reliable, specific and sensitive tool for the quantitative diagnosis of betanodavirus.

Structure of 10 N in 9 C+p resonance scattering

DOE PAGES

Hooker, J.; Rogachev, G. V.; Goldberg, V. Z.; ...

2017-03-17

We studied the structure of exotic nucleus 10N using 9C+p resonance scattering. Two ℓ=0 resonances were found to be the lowest states in 10N. Furthermore, the ground state of 10N is unbound with respect to proton decay by 2.2(2) or 1.9(2) MeV depending on the 2 -or 1 -spin-parity assignment, and the first excited state is unbound by 2.8(2) MeV.

High-resolution analysis of CpG methylation and in vivo protein-DNA interactions at the alternative Epstein-Barr virus latency promoters Qp and Cp in the nasopharyngeal carcinoma cell line C666-1.

PubMed

Bakos, Agnes; Banati, Ferenc; Koroknai, Anita; Takacs, Maria; Salamon, Daniel; Minarovits-Kormuta, Susanna; Schwarzmann, Fritz; Wolf, Hans; Niller, Hans Helmut; Minarovits, Janos

2007-10-01

Transcripts for the Epstein-Barr virus (EBV) encoded nuclear antigens (EBNAs) are initiated at alternative promoters (Wp, Cp, for EBNA 1-6 transcripts and Qp, for EBNA 1 transcripts only) located in the BamHI W, C or Q fragment of the viral genome. To understand the host-cell dependent expression of EBNAs in EBV-associated tumors (lymphomas and carcinomas) and in vitro transformed cell lines, it is necessary to analyse the regulatory mechanisms governing the activity of the alternative promoters of EBNA transcripts. Such studies focused mainly on lymphoid cell lines carrying latent EBV genomes, due to the lack of EBV-associated carcinoma cell lines maintaining latent EBV genomes during cultivation in tissue culture. We took advantage of the unique nasopharyngeal carcinoma cell line, C666-1, harboring EBV genomes, and undertook a detailed analysis of CpG methylation patterns and in vivo protein-DNA interactions at the latency promoters Qp and Cp. We found that the active, unmethylated Qp was marked with strong footprints of cellular transcription factors and the viral protein EBNA 1. In contrast, we could not detect binding of relevant transcription factors to the methylated, silent Cp. We concluded that the epigenetic marks at Qp and Cp in C666-1 cells of epithelial origin resemble those of group I Burkitt's lymphoma cell lines.

Arsenic(V) removal from aqueous solutions using an anion exchanger derived from coconut coir pith and its recovery.

PubMed

Anirudhan, T S; Unnithan, Maya R

2007-01-01

The performance of a new anion exchanger (AE) prepared from coconut coir pith (CP), for the removal of arsenic(V) [As(V)] from aqueous solutions was evaluated in this study. The adsorbent (CP-AE) carrying dimethylaminohydroxypropyl weak base functional group was synthesized by the reaction of CP with epichlorohydrin and dimethylamine followed by treatment of hydrochloric acid. IR spectroscopy results confirm the presence of -NH(+)(CH(3))(2)Cl(-) group in the adsorbent. XRD studies confirm the decrease of crystallinity in CP-AE compared to CP, and it favours the protrusion of the functional group into the aqueous medium. Batch experiments were conducted to examine the efficiency of the adsorbent on As(V) removal. Maximum removal of 99.2% was obtained for an initial concentration of 1 mgl(-1) As(V) at pH 7.0 and an adsorbent dose of 2 gl(-1). The kinetics of sorption of As(V) onto CP-AE was described using the pseudo-second-order model. The equilibrium isotherms were determined for different temperatures and the results were analysed using the Langmuir equation. The temperature dependence indicates an exothermic process. Utility of the adsorbent was tested by removing As(V) from simulated groundwater. Regeneration studies were performed using 0.1N HCl. Batch adsorption-desorption studies illustrate that CP-AE could be used to remove As(V) from ground water and other industrial effluents.

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

PubMed

Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

Adolescent exposure to nicotine and/or the cannabinoid agonist CP 55,940 induces gender-dependent long-lasting memory impairments and changes in brain nicotinic and CB(1) cannabinoid receptors.

PubMed

Mateos, B; Borcel, E; Loriga, R; Luesu, W; Bini, V; Llorente, R; Castelli, M P; Viveros, M-P

2011-12-01

We have analysed the long-term effects of adolescent (postnatal day 28-43) exposure of male and female rats to nicotine (NIC, 1.4 mg/kg/day) and/or the cannabinoid agonist CP 55,940 (CP, 0.4 mg/kg/day) on the following parameters measured in the adulthood: (1) the memory ability evaluated in the object location task (OL) and in the novel object test (NOT); (2) the anxiety-like behaviour in the elevated plus maze; and (3) nicotinic and CB(1) cannabinoid receptors in cingulated cortex and hippocampus. In the OL, all pharmacological treatments induced significant decreases in the DI of females, whereas no significant effects were found among males. In the NOT, NIC-treated females showed a significantly reduced DI, whereas the effect of the cannabinoid agonist (a decrease in the DI) was only significant in males. The anxiety-related behaviour was not changed by any drug. Both, nicotine and cannabinoid treatments induced a long-lasting increase in CB(1) receptor activity (CP-stimulated GTPγS binding) in male rats, and the nicotine treatment also induced a decrease in nicotinic receptor density in the prefrontal cortex of females. The results show gender-dependent harmful effects of both drugs and long-lasting changes in CB(1) and nicotinic receptors.

Individual lipid encapsulated microbubble radial oscillations: Effects of fluid viscosity

PubMed Central

Helfield, Brandon; Chen, Xucai; Qin, Bin; Villanueva, Flordeliza S.

2016-01-01

Ultrasound-stimulated microbubble dynamics have been shown to be dependent on intrinsic bubble properties, including size and shell characteristics. The effect of the surrounding environment on microbubble response, however, has been less investigated. In particular, microbubble optimization studies are generally conducted in water/saline, characterized by a 1 cP viscosity, for application in the vasculature (i.e., 4 cP). In this study, ultra-high speed microscopy was employed to investigate fluid viscosity effects on phospholipid encapsulated microbubble oscillations at 1 MHz, using a single, eight-cycle pulse at peak negative pressures of 100 and 250 kPa. Microbubble oscillations were shown to be affected by fluid viscosity in a size- and pressure-dependent manner. In general, the oscillation amplitudes exhibited by microbubbles between 3 and 6 μm in 1 cP fluid were larger than in 4 cP fluid, reaching a maximum of 1.7-fold at 100 kPa for microbubbles 3.8 μm in diameter and 1.35-fold at 250 kPa for microbubbles 4.8 μm in diameter. Simulation results were in broad agreement at 250 kPa, however generally underestimated the effect of fluid viscosity at 100 kPa. This is the first experimental demonstration documenting the effects of surrounding fluid viscosity on microbubble oscillations, resulting in behavior not entirely predicted by current microbubble models. PMID:26827018

Substrate dependent stability of conducting polymer coatings on medical electrodes.

PubMed

Green, Rylie A; Hassarati, Rachelle T; Bouchinet, Lucie; Lee, Chaekyung S; Cheong, Gin L M; Yu, Jin F; Dodds, Christopher W; Suaning, Gregg J; Poole-Warren, Laura A; Lovell, Nigel H

2012-09-01

Conducting polymer (CP) coatings on medical electrodes have the potential to provide superior performance when compared to conventional metallic electrodes, but their stability is strongly dependant on the substrate properties. The aim of this study was to examine the effect of laser roughening of underlying platinum (Pt) electrode surfaces on the mechanical, electrical and biological performance of CP coatings. In addition, the impact of dopant type on electrical performance and stability was assessed. The CP poly(ethylene dioxythiophene) (PEDOT) was coated on Pt microelectrode arrays, with three conventional dopant ions. The in vitro electrical characteristics were assessed by cyclic voltammetry and biphasic stimulation. Results showed that laser roughening of the underlying substrate did not affect the charge injection limit of the coated material, but significantly improved the passive stability and chronic stimulation lifetime without failure of the coating. Accelerated material ageing and long-term biphasic stimulus studies determined that some PEDOT variants experienced delamination within as little as 10 days when the underlying Pt was smooth, but laser roughening to produce a surface index of 2.5 improved stability, such that more than 1.3 billion stimulation cycles could be applied without evidence of failure. PEDOT doped with paratoluene sulfonate (PEDOT/pTS) was found to be the most stable CP on roughened Pt, and presented a surface topography which encouraged neural cell attachment. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

Cpe1786/IscR of Clostridium perfringens represses expression of genes involved in Fe-S cluster biogenesis.

PubMed

André, Gaelle; Haudecoeur, Elise; Courtois, Emmanuelle; Monot, Marc; Dupuy, Bruno; Rodionov, Dmitry A; Martin-Verstraete, Isabelle

2017-05-01

Cpe1786 of Clostridium perfringens is an Rrf2-type regulator containing the three-cysteine residues coordinating a Fe-S in IscR, the repressor controlling Fe-S homeostasis in enterobacteria. The cpe1786 gene formed an operon with iscSU involved in Fe-S biogenesis and tmrU. This operon was transcribed from a σ A -dependent promoter. We showed that in the heterologous host Bacillus subtilis, Cpe1786, renamed IscR Cp , negatively controlled its own transcription. We constructed an iscR mutant in C. perfringens. We then compared the expression profile of strain 13 and of the iscR mutant. IscR Cp controlled expression of genes involved in Fe-S biogenesis, in amino acid or sugar metabolisms, in fermentation pathways and in host compound utilization. We then demonstrated, using a ChIP-PCR experiment, that IscR Cp interacted with its promoter region in vivo in C. perfringens and with the promoter of cpe2093 encoding an amino acid ABC transporter. We utilized a comparative genomic approach to infer a candidate IscR binding motif and reconstruct IscR regulons in clostridia. We showed that point mutations in the conserved motif of 29 bp identified upstream of iscR decreased the cysteine-dependent repression of iscR mediated by IscR Cp . Copyright © 2016 Institut Pasteur. All rights reserved.

Thermal Chemistry of Cp*W(NO)(CH2CMe3)(H)(L) Complexes (L = Lewis Base).

PubMed

Fabulyak, Diana; Handford, Rex C; Holmes, Aaron S; Levesque, Taleah M; Wakeham, Russell J; Patrick, Brian O; Legzdins, Peter; Rosenfeld, Devon C

2017-01-03

The complexes trans-Cp*W(NO)(CH 2 CMe 3 )(H)(L) (Cp* = η 5 -C 5 Me 5 ) result from the treatment of Cp*W(NO)(CH 2 CMe 3 ) 2 in n-pentane with H 2 (∼1 atm) in the presence of a Lewis base, L. The designation of a particular geometrical isomer as cis or trans indicates the relative positions of the alkyl and hydrido ligands in the base of a four-legged piano-stool molecular structure. The thermal behavior of these complexes is markedly dependent on the nature of L. Some of them can be isolated at ambient temperatures [e.g., L = P(OMe) 3 , P(OPh) 3 , or P(OCH 2 ) 3 CMe]. Others undergo reductive elimination of CMe 4 via trans to cis isomerization to generate the 16e reactive intermediates Cp*W(NO)(L). These intermediates can intramolecularly activate a C-H bond of L to form 18e cis complexes that may convert to the thermodynamically more stable trans isomers [e.g., Cp*W(NO)(PPh 3 ) initially forms cis-Cp*W(NO)(H)(κ 2 -PPh 2 C 6 H 4 ) that upon being warmed in n-pentane at 80 °C isomerizes to trans-Cp*W(NO)(H)(κ 2 -PPh 2 C 6 H 4 )]. Alternatively, the Cp*W(NO)(L) intermediates can effect the intermolecular activation of a substrate R-H to form trans-Cp*W(NO)(R)(H)(L) complexes [e.g., L = P(OMe) 3 or P(OCH 2 ) 3 CMe; R-H = C 6 H 6 or Me 4 Si] probably via their cis isomers. These latter activations are also accompanied by the formation of some Cp*W(NO)(L) 2 disproportionation products. An added complication in the L = P(OMe) 3 system is that thermolysis of trans-Cp*W(NO)(CH 2 CMe 3 )(H)(P(OMe) 3 ) results in it undergoing an Arbuzov-like rearrangement and being converted mainly into [Cp*W(NO)(Me)(PO(OMe) 2 )] 2 , which exists as a mixture of two isomers. All new complexes have been characterized by conventional and spectroscopic methods, and the solid-state molecular structures of most of them have been established by single-crystal X-ray crystallographic analyses.

Delayed suppression of hippocampal cell proliferation in rats following inescapable shocks.

PubMed

Fornal, Casimir A; Stevens, Joanne; Barson, Jessica R; Blakley, Gregory G; Patterson-Buckendahl, Patricia; Jacobs, Barry L

2007-01-26

Adult Sprague-Dawley rats were exposed to a single session of 100 inescapable tail shocks (IS). Bromodeoxyuridine (BrdU) was administered 1 h, 2 days or 7 days later and hippocampal cell proliferation (CP) was assessed after a 2-h survival period. Measures of plasma corticosterone (CORT) levels were also obtained. Despite a large increase in CORT immediately following IS, no associated change in CP was observed. In fact, the only significant change in CP was seen 7 days after IS, at a time when CORT was unchanged from control levels. These data raise questions about the general nature of the relationship between CORT and CP. They also suggest that, under some conditions, changes in hippocampal CP may emerge only after an "incubation period".

[Effect of CP Metronomic Chemotherapy on RPMI 8226 Cell Proli-feration and Notch1/NF-κB Signaling Pathway In Vitro].

PubMed

Guo, Lie-Ping; Zhou, Fan; Shi, Hao-Tian; Chen, Hai-Min; Lin, Chen-Hui; Chen, Xiao-Ling; Hou, Jian

2016-10-01

To investigate the effect of metronomic chemotherapy of low dose phosphoramide combined with prednisolone (CP metronomic chemotherapy) on proliferation and apoptosis of RPMI 8226 cells, and to explore its regulating effect on Notch1/NF-κB signaling pathways. Experiment was divided into the DMSO control group, and the phosphoramide mustard (PM) group, the prednisolone group, the phosphoramide mustard plus prednisolone group (the CP group). RPMI 8226 cells were treated with different drugs, CCK-8 method was used to detect cell proliferation, flow cytometry was used to detect the cell cycle and apoptosis, reverse transcription PCR was used to detect Notch1 and NF-κB mRNA expression level. Compared with DMSO control group, RPMI8226 cell proliferation inhibition rate in all the PM, prednisolone and CP groups increased significantly with prolonging of time (r of 0.994,0.996,0.999, respectively, P<0.001). And at the same time, the inhibitory rate of cell proliferation was significantly different; the cell inhibitory rate in PM group was lowest, that in CP group was highgest, that in prednissone group was intermediate (P<0.01). After 48 hours, compared with the DMSO control group, the G 1 /G 0 cell proportion in treatment group increased significantly, S phase cell proportion decreased significantly, especially in PM and CP groups. The G 2 /M phase cell proportion increased in PM group, while reduced in the prednisolone and the CP groups. After 48 hours, compared with the DMSO control group, RPMI 8226 cell apoptosis rate increased as follow: in PM, pre-dnisolone and CP group(P<0.01). After 48 hours, compared with the DMSO control group, Notch1 and NF-κB mRNA expression in the prednisolone, the PM and the CP group decreased significantly(P<0.001). CP metronomic chemotherapy can significantly reduce RPMI 8226 cell proliferation, promote RPMI 8226 cell apoptosis, arrest RPMI 8226 cells mainly in the G 1 /G 0 phase, and significantly reduce Notch1 and NF-κB expression levels. It is suggested that Notch1/NF-κB signaling pathways is involved in CP metronomic chemotherapy for MM.

Real-Time Noninvasive Assessment of Pancreatic ATP Levels During Cold Preservation

PubMed Central

Scott, W.E.; Matsumoto, S.; Tanaka, T.; Avgoustiniatos, E.S.; Graham, M.L.; Williams, P.C.; Tempelman, L.A.; Sutherland, D.E.; Hering, B.J.; Hammer, B.E.; Papas, K.K.

2008-01-01

31P-NMR spectroscopy was utilized to investigate rat and porcine pancreatic ATP:Pi ratios to assess the efficacy of existing protocols for cold preservation (CP) in maintaining organ quality. Following sacrifice, rat pancreata were immediately excised or left enclosed in the body for 15 minutes of warm ischemia (WI). After excision, rat pancreata were stored at 6°C to 8°C using histidine-tryptophan-ketoglutarate solution (HTK) presaturated with air (S1), HTK presaturated with O2 (S2), or the HTK/perfluorodecalin two-layer method (TLM) with both liquids presaturated with O2 (S3). 31P-NMR spectra were sequentially collected at 3, 6, 9, 12, and 24 hours of CP from pancreata stored with each of the three protocols examined. The ATP:Pi ratio for rat pancreata exposed to 15 minutes of WI and stored with S3 increased during the first 9 hours of CP, approaching values observed for organs procured with no WI. A marked reduction in the ATP:Pi ratio was observed beyond 12 hours of CP with S3. After 6 hours of CP, the ATP:Pi ratio was highest for S3, substantially decreased for S2, and below detection for S1. In sharp contrast to the rat model, ATP was barely detectable in porcine pancreata exposed to minimal warm ischemia (<15 minutes) stored with the TLM regardless of CP time. We conclude that 31P-NMR spectroscopy is a powerful tool that can be used to (1) noninvasively evaluate pancreata prior to islet isolation, (2) assess the efficacy of different preservation protocols, (3) precisely define the timing of reversible versus irreversible damage, and (4) assess whether intervention will extend this timing. PMID:18374082

Mitochondrial-targeted antioxidants represent a promising approach for prevention of cisplatin-induced nephropathy

PubMed Central

Mukhopadhyay, Partha; Horváth, Béla; Zsengellér, Zsuzsanna; Zielonka, Jacek; Tanchian, Galin; Holovac, Eileen; Kechrid, Malek; Patel, Vivek; Stillman, Isaac E.; Parikh, Samir M.; Joseph, Joy; Kalyanaraman, Balaraman; Pacher, Pál

2011-01-01

Cisplatin is a widely used anti-neoplastic agent; however, its major limitation is the development of dose-dependent nephrotoxicity whose precise mechanisms are poorly understood. Here we show that mitochondrial dysfunction is not only a feature of cisplatin nephrotoxicity, but that targeted delivery of superoxide dismutase mimetics to mitochondria largely prevents the renal effects of cisplatin. Cisplatin induced renal oxidative stress, deterioration of mitochondrial structure and function, an intense inflammatory response, histopathological injury, and renal dysfunction. A single systemic dose of mitochondrially-targeted antioxidants, MitoQ or Mito-CP, dose-dependently prevented cisplatin-induced renal dysfunction. Mito-CP also prevented mitochondrial injury and dysfunction, renal inflammation, and tubular injury and apoptosis. Despite being broadly renoprotective against cisplatin, Mito-CP did not diminish cisplatin’s anti-neoplastic effect in a human bladder cancer cell line. Our results highlight the central role of mitochondrially generated oxidants in the pathogenesis of cisplatin nephrotoxicity. Since similar compounds appear to be safe in humans, mitochondrially-targeted antioxidants may represent a novel therapeutic approach against cisplatin nephrotoxicity. PMID:22120494

Anisotropy measurement of pyrolytic carbon layers of coated particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vesyolkin, Ju. A., E-mail: Ju.Ves@yandex.ru; Ivanov, A. S., E-mail: asi.kiae@gmail.com; Trushkina, T. V.

2015-12-15

Equipment at the National Research Center Kurchatov Institute intended for the anisotropy determination of pyrolytic carbon layers in coated particles (CPs) of the GT-MGR reactor is tested and calibrated. The dependence of the anisotropy coefficient on the size of the measurement region is investigated. The results of measuring the optical anisotropy factor (OPTAF) for an aluminum mirror, rutile crystal, and available CP samples with the known characteristics measured previously using ORNL equipment (United States) are presented. In addition, measurements of CP samples prepared at VNIINM are performed. A strong dependence of the data on the preparation quality of metallographic sectionsmore » is found. Our investigations allow us to make the conclusion on the working capacity of the existing equipment for measuring the anisotropy of pyrolytic carbon CP coatings using the equipment at the Kurchatov Institute with the relative error of about 1%. It is shown that the elimination of the errors caused by the stochastic fluctuations in a measuring path by mathematical processing of the signal allows us to decrease the relative error of OPTAF measurements to ∼0.3%.« less

Adsorptive removal of 2-chlorophenol by low-cost coir pith carbon.

PubMed

Namasivayam, C; Kavitha, D

2003-03-17

Adsorption of 2-chlorophenol (2-CP) by coir pith carbon was carried out by varying the parameters such as agitation time, 2-CP concentration, adsorbent dose, pH and temperature. Adsorption equilibrium reached at 40, 60, 80 and 100 min for 2-CP concentration of 10, 20, 30 and 40 mg/l, respectively. Adsorption followed second-order kinetics. The adsorption equilibrium data obeyed Freundlich isotherm. Acidic pH was favorable for the adsorption of 2-CP. Desorption studies showed that chemisorption plays a major role in the adsorption process. Copyright 2003 Elsevier Science B.V.

Dark matter and dark energy from the solution of the strong CP problem.

PubMed

Mainini, Roberto; Bonometto, Silvio A

2004-09-17

The Peccei-Quinn (PQ) solution of the strong CP problem requires the existence of axions, which are viable candidates for dark matter. If the Nambu-Goldstone potential of the PQ model is replaced by a potential V(|Phi|) admitting a tracker solution, the scalar field |Phi| can account for dark energy, while the phase of Phi yields axion dark matter. If V is a supergravity (SUGRA) potential, the model essentially depends on a single parameter, the energy scale Lambda. Once we set Lambda approximately equal to 10(10) GeV at the quark-hadron transition, |Phi| naturally passes through values suitable to solve the strong CP problem, later growing to values providing fair amounts of dark matter and dark energy.

Transfer of motor learning from virtual to natural environments in individuals with cerebral palsy.

PubMed

de Mello Monteiro, Carlos Bandeira; Massetti, Thais; da Silva, Talita Dias; van der Kamp, John; de Abreu, Luiz Carlos; Leone, Claudio; Savelsbergh, Geert J P

2014-10-01

With the growing accessibility of computer-assisted technology, rehabilitation programs for individuals with cerebral palsy (CP) increasingly use virtual reality environments to enhance motor practice. Thus, it is important to examine whether performance improvements in the virtual environment generalize to the natural environment. To examine this issue, we had 64 individuals, 32 of which were individuals with CP and 32 typically developing individuals, practice two coincidence-timing tasks. In the more tangible button-press task, the individuals were required to 'intercept' a falling virtual object at the moment it reached the interception point by pressing a key. In the more abstract, less tangible task, they were instructed to 'intercept' the virtual object by making a hand movement in a virtual environment. The results showed that individuals with CP timed less accurate than typically developing individuals, especially for the more abstract task in the virtual environment. The individuals with CP did-as did their typically developing peers-improve coincidence timing with practice on both tasks. Importantly, however, these improvements were specific to the practice environment; there was no transfer of learning. It is concluded that the implementation of virtual environments for motor rehabilitation in individuals with CP should not be taken for granted but needs to be considered carefully. Copyright © 2014 Elsevier Ltd. All rights reserved.

Progression from acute to chronic pancreatitis: prognostic factors, mortality, and natural course.

PubMed

Nøjgaard, Camilla; Becker, Ulrik; Matzen, Peter; Andersen, Jens Rikardt; Holst, Claus; Bendtsen, Flemming

2011-11-01

Knowledge of the natural course of acute pancreatitis (AP) and risk of progression to chronic pancreatitis (CP) is limited. The aims were to describe: (1) the incidence of progression from AP to CP, (2) prognostic factors for progression, and (3) the natural course and mortality of progressive AP. During 1977 to 1982, patients admitted to hospitals in Copenhagen with a diagnosis of AP or CP were included in a prospective cohort and followed up by the Danish registries in 2008. The subcohort analyses comprised 352 AP patients. Progressive AP was found in 85 patients (24.1%) during follow-up; 48.2% developed from alcoholic AP, 47.0% from idiopathic AP, and 4.8% from other causes. The mortality rate for patients with progressive AP was 2.7 times higher than in patients with nonprogressive acute pancreatitis, and 5.3 to 6.5 times higher than in the background population. In Cox regression analyses corrected for age, only smoking was of significance for the progression from AP to CP. Acute pancreatitis can progress to CP, not only from alcoholic but also from nonalcoholic AP. Smoking was the strongest risk factor associated with progression. The mortality rate for these patients was 5 to 6 times the mortality rate in the population.

Heteronuclear proton assisted recoupling

NASA Astrophysics Data System (ADS)

De Paëpe, Gaël; Lewandowski, Józef R.; Loquet, Antoine; Eddy, Matt; Megy, Simon; Böckmann, Anja; Griffin, Robert G.

2011-03-01

We describe a theoretical framework for understanding the heteronuclear version of the third spin assisted recoupling polarization transfer mechanism and demonstrate its potential for detecting long-distance intramolecular and intermolecular 15N-13C contacts in biomolecular systems. The pulse sequence, proton assisted insensitive nuclei cross polarization (PAIN-CP) relies on a cross term between 1H-15N and 1H-13C dipolar couplings to mediate zero- and/or double-quantum 15N-13C recoupling. In particular, using average Hamiltonian theory we derive effective Hamiltonians for PAIN-CP and show that the transfer is mediated by trilinear terms of the form N±C∓Hz (ZQ) or N±C±Hz (DQ) depending on the rf field strengths employed. We use analytical and numerical simulations to explain the structure of the PAIN-CP optimization maps and to delineate the appropriate matching conditions. We also detail the dependence of the PAIN-CP polarization transfer with respect to local molecular geometry and explain the observed reduction in dipolar truncation. In addition, we demonstrate the utility of PAIN-CP in structural studies with 15N-13C spectra of two uniformly 13C,15N labeled model microcrystalline proteins—GB1, a 56 amino acid peptide, and Crh, a 85 amino acid domain swapped dimer (MW = 2 × 10.4 kDa). The spectra acquired at high magic angle spinning frequencies (ωr/2π > 20 kHz) and magnetic fields (ω0H/2π = 700-900 MHz) using moderate rf fields, yield multiple long-distance intramonomer and intermonomer 15N-13C contacts. We use these distance restraints, in combination with the available x-ray structure as a homology model, to perform a calculation of the monomer subunit of the Crh protein.

Evaluation of chemically diverse 5-HT₂c receptor agonists on behaviours motivated by food and nicotine and on side effect profiles.

PubMed

Higgins, G A; Silenieks, L B; Lau, W; de Lannoy, I A M; Lee, D K H; Izhakova, J; Coen, K; Le, A D; Fletcher, P J

2013-04-01

Selective 5-HT2C receptor agonists, such as lorcaserin, are being developed for the treatment of obesity. Studies suggest that they may also have therapeutic potential for addictive behaviours including nicotine dependence, although few drugs of this class have been evaluated. The primary aim was to evaluate the highly selective 5-HT2C agonist, CP-809101, against food-motivated (operant FR5 and progressive ratio schedules, palatability-induced feeding) and nicotine-motivated (intravenous self-administration, drug discrimination) behaviours in rats and to compare with equivalent findings for the structurally distinct 5-HT2C receptor agonists lorcaserin and Ro 60-0175. The secondary aims were to evaluate the side effect profiles of lorcaserin and CP-809101 and to determine the plasma levels of lorcaserin at a dose (1 mg/kg) that reduces both food and nicotine reinforcement for comparison to plasma concentrations reported in human trials. CP-809101 (0.3-3 mg/kg SC) reduced responding for both nicotine and food and blocked the discriminative stimulus properties of nicotine in a similar manner to lorcaserin and Ro 60-0175. Behaviours such as hypolocomotion, chewing and ptosis became evident following both CP-809101 and lorcaserin administration at higher doses. Plasma levels of lorcaserin were of similar range to those reported in obesity trials. These studies support the utility of 5-HT2C agonists as a therapeutic approach to treat nicotine dependence. Plasma exposure levels after acute lorcaserin treatment suggest that equivalent dosages could be used to evaluate these drugs in obesity and smoking cessation trials. Finally, there may be differences in the side effect profiles between lorcaserin and CP-809101, raising the possibility for tolerability differences amongst 5-HT2C agonists.

A polysaccharide fraction of adlay seed (Coixlachryma-jobi L.) induces apoptosis in human non-small cell lung cancer A549 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xiangyi; Liu, Wei; Wu, Junhua

Highlights: Black-Right-Pointing-Pointer A polysaccharide from adlay seed, its molecular mass, optical rotation and sugars was determined. Black-Right-Pointing-Pointer We demonstrated that a polysaccharide from adlay can induce apoptosis in cancer cells. Black-Right-Pointing-Pointer The polysaccharide inhibited the metabolism and proliferation of NSCLC A549 cells. Black-Right-Pointing-Pointer The polysaccharide may trigger apoptosis via the mitochondria-dependent pathway. -- Abstract: Different seed extracts from Coix lachryma-jobi (adlay seed) have been used for the treatment of various cancers in China, and clinical data support the use of these extracts for cancer therapy; however, their underlying molecular mechanisms have not been well defined. A polysaccharide fraction, designated asmore » CP-1, was extracted from the C.lachryma-jobi L. var. using the ethanol subsiding method. CP-1 induced apoptosis in A549 cells in a dose-dependent manner, as determined by MTT assay. Apoptotic bodies were observed in the cells by scanning electronic microscopy. Apoptosis and DNA accumulation during S-phase of the cell cycle were determined by annexin V-FITC and PI staining, respectively, and measured by flow cytometry. CP-1 also extended the comet tail length on single cell gel electrophoresis, and disrupted the mitochondrial membrane potential. Further analysis by western blotting showed that the expression of caspase-3 and caspase-9 proteins was increased. Taken together, our results demonstrate that CP-1 is capable of inhibiting A549 cell proliferation and inducing apoptosis via a mechanism primarily involving the activation of the intrinsic mitochondrial pathway. The assay data suggest that in addition to its nutritional properties, CP-1 is a very promising candidate polysaccharide for the development of anti-cancer medicines.« less

Chronic Pancreatitis and Fracture: A Retrospective, Population-Based Veterans Administration Study.

PubMed

Munigala, Satish; Agarwal, Banke; Gelrud, Andres; Conwell, Darwin L

2016-03-01

There is increasing evidence that chronic pancreatitis (CP) is a risk factor for osteoporotic fracture, but data on males with CP and fracture prevalence are sparse. We determined the association of sex and age using a large Veterans Administration database. This was a retrospective analysis (1998-2007). Patients with CP (International Classification of Diseases code 577.1) and control subjects (without CP) were identified after exclusions and fracture prevalence (vertebral, hip, and wrist) were recorded. 453,912 Veterans Administration patients were identified (control subjects: 450,655 and patients with CP: 3257). Mean ages of control subjects and CP were 53.6 and 54.2 years (P < 0.014). Patients with CP had higher odds ratios of total fractures (2.35; 95% confidence interval [CI], 2.00-2.77), vertebral fracture 2.11 (95% CI, 1.44-3.01), hip fracture 3.49 (95% CI, 2.78-4.38), and wrist fracture 1.68 (95% CI, 1.29-2.18) when compared with control subjects. After adjusting for age group and etiology, patients with CP had increased odds of total fractures, vertebral fractures, and hip fractures (P < 0.05). In this male-predominate Veterans Administration study, patients with CP were at increased risk of osteoporotic fractures. The risk was higher for hip fracture (>3 times) in patients with CP compared with control subjects. All patients with CP older than 45 years, irrespective of sex, should be screened for bone mineral density loss.

A Hybrid Approach for CpG Island Detection in the Human Genome.

PubMed

Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

2016-01-01

CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

A Study into Advanced Guidance Laws Using Computational Methods

DTIC Science & Technology

2011-12-01

0; for ii = 2:index integral = integral+(t(ii)-t(ii-1))*u2(ii-1); end J = 20*min(range)^2+integral/1000; 73 outtxt = [’Time (s...0.67*LN; % nose CP XCPW = LN+XW+0.7*CRW-0.2*CTW; % wing CP AN = 0.67*LN*DIAM...0.5*(LENGTH-LN)))/(AN+AB); % body CP %--- Area computations ------------------------------------- SW = 0.5*HW*(CTW+CRW)+CRW*WXT; % wing

Systematic review and meta-analysis of the effect of equine assisted activities and therapies on gross motor outcome in children with cerebral palsy.

PubMed

Tseng, Sung-Hui; Chen, Hung-Chou; Tam, Ka-Wai

2013-01-01

To evaluate the literature on the efficacy of equine assisted activities and therapies (EAAT) on gross motor outcomes representing the ICF component of body functions and activity in children with cerebral palsy (CP). We conducted a systematic review and meta-analysis of randomized controlled trials and observational studies of hippotherapy (HPOT) and therapeutic horseback riding (TR) for children with spastic CP. Gross motor outcomes, assessed via muscle activity and muscle tone, gait, posture and Gross Motor Function Measures (GMFM) were evaluated. Five TR studies and nine HPOT studies were included. Our meta-analysis indicated that short-term HPOT (total riding time 8-10 min) significantly reduced asymmetrical activity of the hip adductor muscles. HPOT could improve postural control in children with spastic CP, GMFCS level < 5. However, the evidence did not show a statistically significant effect on GMFM after long-term HPOT or TR (total riding time, 8-22 h) in children with spastic CP. This systematic review found insufficient evidence to support the claim that long-term TR or HPOT provide a significant benefit to children with spastic CP. We found no statistically significant evidence of either therapeutic effect or maintenance effects on the gross motor activity status in CP children.

Arrests for child pornography production: data at two time points from a national sample of U.S. law enforcement agencies.

PubMed

Wolak, Janis; Finkelhor, David; Mitchell, Kimberly J; Jones, Lisa M

2011-08-01

This study collected information on arrests for child pornography (CP) production at two points (2000-2001 and 2006) from a national sample of more than 2,500 law enforcement agencies. In addition to providing descriptive data about an understudied crime, the authors examined whether trends in arrests suggested increasing CP production, shifts in victim populations, and challenges to law enforcement. Arrests for CP production more than doubled from an estimated 402 in 2000-2001 to an estimated 859 in 2006. Findings suggest the increase was related to increased law enforcement activity rather than to growth in the population of CP producers. Adolescent victims increased, but there was no increase in the proportion of arrest cases involving very young victims or violent images. Producers distributed images in 23% of arrest cases, a proportion that did not change over time. This suggests that much CP production may be primarily for private use. Proactive law enforcement operations increased, as did other features consistent with a robust law enforcement response.

The KCNQ1 gene polymorphism as a shared genetic risk for rheumatoid arthritis and chronic periodontitis in Japanese adults: A pilot case-control study.

PubMed

Kobayashi, Tetsuo; Kido, Jun-Ichi; Ishihara, Yuichi; Omori, Kazuhiro; Ito, Satoshi; Matsuura, Takato; Bando, Takashi; Wada, Jun; Murasawa, Akira; Nakazono, Kiyoshi; Mitani, Akio; Takashiba, Shogo; Nagata, Toshihiko; Yoshie, Hiromasa

2018-03-01

A number of studies have suggested a bidirectional relationship of periodontitis with rheumatoid arthritis (RA) and type 2 diabetes mellitus (T2DM). However, the genetic factors that underlie these relationships have not been elucidated. We conducted a multicenter case-control study that included 185 patients with RA and chronic periodontitis (CP), 149 patients with T2DM and CP, 251 patients with CP, and 130 systemically and periodontally healthy controls from a cohort of Japanese adults to assess the shared genetic risk factors for RA and CP as well as for T2DM and CP. A total of 17 candidate single nucleotide polymorphisms (SNPs) associated with RA, T2DM, and CP were genotyped. Multiple logistic regression analyses revealed that the KCNQ1 rs2237892 was significantly associated with comorbidity of RA and CP (P = 0.005) after adjustment for age, sex, and smoking status. The carriers of the T allele among patients with RA and CP showed significantly higher disease activity scores including 28 joints using C-reactive protein values than the non-carriers (P = 0.02), although the age, female percentage, and smoking status were comparable. Other SNPs were not associated with comorbidity of RA and CP, T2DM and CP, or susceptibility to CP. The results of the present pilot study suggest for the first time that the KCNQ1 rs2237892 may constitute a shared genetic risk factor for RA and CP, but not for T2DM and CP in Japanese adults. © 2018 American Academy of Periodontology.

Characterization and developmental expression of genes encoding the early carotenoid biosynthetic enzymes in Citrus paradisi Macf.

PubMed

Costa, Marcio G C; Moreira, Cristina D; Melton, John R; Otoni, Wagner C; Moore, Gloria A

2012-02-01

In the present study, the full-length cDNA sequences of PSY, PDS, and ZDS, encoding the early carotenoid biosynthetic enzymes in the carotenoid pathway of grapefruit (Citrus paradisi), were isolated and characterized for the first time. CpPSY contained a 1311-bp open reading frame (ORF) encoding a polypeptide of 436 amino acids, CpPDS contained a 1659-bp ORF encoding a polypeptide of 552 amino acids, and CpZDS contained a 1713-bp ORF encoding a polypeptide of 570 amino acids. Phylogenetic analysis indicated that CpPSY shares homology with PSYs from Citrus, tomato, pepper, Arabidopsis, and the monocot PSY1 group, while CpPDS and CpZDS are most closely related to orthologs from Citrus and tomato. Expression analysis revealed fluctuations in CpPSY, CpPDS, and CpZDS transcript abundance and a non-coordinated regulation between the former and the two latter genes during fruit development in albedo and juice vesicles of white ('Duncan') and red ('Flame') grapefruits. A 3× higher upregulation of CpPSY expression in juice vesicles of red-fleshed 'Flame' as compared to white-fruited 'Duncan' was observed in the middle stages of fruit development, which correlates with the well documented accumulation pattern of lycopene in red grapefruit. Together with previous data, our results suggest that the primary mechanism controlling lycopene accumulation in red grapefruit involves the transcriptional upregulation of CpPSY, which controls the flux into the carotenoid pathway, and the downregulated expression of CpLCYB2, which controls the step of cyclization of lycopene in chromoplasts during fruit ripening. A correlation between CpPSY expression and fruit color evolution in red grapefruit is demonstrated.

MMP13, TIMP2 and TGFB3 Gene Polymorphisms in Brazilian Chronic Periodontitis and Periimplantitis Subjects.

PubMed

Gonçalves Junior, Roberto; Pinheiro, Aristides da Rosa; Schoichet, José Jorge; Nunes, Carlos Henrique Ramirez; Gonçalves, Rackel; Bonato, Leticia Ladeira; Quinelato, Valquiria; Antunes, Leonardo Santos; Küchler, Erika Calvano; Lobo, Julie; Villas-Bôas, Ricardo de Mello; Vieira, Alexandre Rezende; Granjeiro, José Mauro; Casado, Priscila Ladeira

2016-01-01

Subjects susceptible to chronic periodontitis (CP) show a high risk for the development of periimplantitis (PI). Both diseases are multifactorial, presenting similarities in their pathophysiology and polygenic profile. MMP-13 (matrix metalloproteinases 13/ collagenase 3) is a collagenolytic enzyme, which expression is induced by TGF beta 3 (transforming growth factor type 3) in human gingival fibroblasts and inhibited by TIMP-2 (tissue inhibitor of metalloproteinase type 2). The aim of this study was to investigate the occurrence of periimplantitis (PI) in subjects with history of chronic periodontitis (CP) and polymorphisms frequency in MMP13, TIMP2 and TGFB3 genes. One hundred and sixty-three volunteers received dental implant placement were submitted to oral and radiographic examination in order to identify past history of CP or presence of PI. Volunteers were divided into 4 groups: Control (without PI and CP, n=72), CP (with CP and without PI, n=28), PI (with PI and without CP, n=28) and diseased (with CP and PI, n=35). The chi-square test correlated genotypes in specific regions of MMP13 (rs2252070), TIMP2 (rs7501477) and TGFB3 (rs2268626) genes, considering the interaction between CP and PI. The results showed that volunteers with CP had 3.2 times more susceptibility to develop PI (p=0.0004) compared to those without CP. No significant association was observed in MMP13, TIMP2 and TGFB3 genes with CP or PI. CP is a risk factor to develop PI, however, there is no association of both diseases with polymorphisms in the MMP13, TIMP2 and TGFB3 genes.

Silencing of the CaCP Gene Delays Salt- and Osmotic-Induced Leaf Senescence in Capsicum annuum L.

PubMed Central

Xiao, Huai-Juan; Yin, Yan-Xu; Chai, Wei-Guo; Gong, Zhen-Hui

2014-01-01

Cysteine proteinases have been known to participate in developmental processes and in response to stress in plants. Our present research reported that a novel CP gene, CaCP, was involved in leaf senescence in pepper (Capsicum annuum L.). The full-length CaCP cDNA is comprised of 1316 bp, contains 1044 nucleotides in open reading frame (ORF), and encodes a 347 amino acid protein. The deduced protein belongs to the papain-like cysteine proteases (CPs) superfamily, containing a highly conserved ERFNIN motif, a GCNGG motif and a conserved catalytic triad. This protein localized to the vacuole of plant cells. Real-time quantitative PCR analysis revealed that the expression level of CaCP gene was dramatically higher in leaves and flowers than that in roots, stems and fruits. Moreover, CaCP transcripts were induced upon during leaf senescence. CaCP expression was upregulated by plant hormones, especially salicylic acid. CaCP was also significantly induced by abiotic and biotic stress treatments, including high salinity, mannitol and Phytophthora capsici. Loss of function of CaCP using the virus-induced gene-silencing technique in pepper plants led to enhanced tolerance to salt- and osmotic-induced stress. Taken together, these results suggest that CaCP is a senescence-associated gene, which is involved in developmental senescence and regulates salt- and osmotic-induced leaf senescence in pepper. PMID:24823878

Chicken pox after pediatric liver transplantation.

PubMed

Levitsky, Josh; Kalil, Andre C; Meza, Jane L; Hurst, Glenn E; Freifeld, Alison

2005-12-01

Previous case series have reported serious complications of chicken pox (CP) after pediatric liver transplantation (PLT), mainly due to visceral dissemination. The goal of our study was to determine the incidence, risk factors, and outcomes of CP after PLT. A case-control study of all CP infections in pediatric transplant recipients followed at our center from September 1993 to April 2004 was performed. Data were collected before and after infection and at the same time points in age-, gender-, and transplant year-matched controls. Potential risk factors prior to CP and adverse outcomes after infection were compared between cases and controls. Twenty (6.2%) developed CP at a median of 1.8 yr (0.6-4.8) after PLT. All CP infections were cutaneous, with no evidence of organ involvement. Twelve were hospitalized: 9 only to receive intravenous acyclovir and 3 stayed > or =2 weeks for other complications. Risk factors were not statistically different among cases and controls. Of the outcomes analyzed, cases were significantly more likely to develop non-CP infections within one year of CP than controls (Hazard Ratio = 12.6, 95% confidence interval = 3.1-51.7; P < 0.001). These infections were often bacterial and occurred long after CP infection. In conclusion, CP is uncommon after PLT and has a low likelihood of organ dissemination. No risk factors were identified. Some cases required prolonged hospitalizations. Close monitoring for the development of late bacterial infections is warranted.

Anionic Hosts for the Incorporation of Cationic Guests

PubMed Central

Peresypkina, Eugenia; Heindl, Claudia; Virovets, Alexander; Brake, Helena; Mädl, Eric

2018-01-01

Abstract Pentaphosphaferrocene [Cp*Fe(η5‐P5)] (1 a) represents an excellent building block for the template‐directed synthesis of spherical supramolecules. Here, the self‐assembly of 1 a with CuI and CuII halides in the presence of the template complexes [FeCp2][PF6], [CoCp2][PF6] and [CoCp2] is reported, testifying to the redox behavior of the formed supramolecules. The oxidation or reduction capacity of these reactive complexes does not inhibit their template impact and, for the first time, the cationic metallocene [CoCp2]+ is enclosed in unprecedented anionic organometallic hosts. Furthermore, the large variety of structural motifs, as icosahedral, trigonal antiprismatic, cuboidal and tetragonal antiprismatic arrangements of 1 a units are realized in the supramolecules [FeCp2]@[{1 a}12(CuBr)17.3] (3), [CoCp2]+ 3{[CoCp2]+@[{1 a}8Cu24.25Br28.25(CH3CN)6]4−} (4), {[Cp2Co]+@[{1 a}8(CuI)28 (CH3CN)9.8]}{[Cp2Co]+@[{1 a)}8Cu24.4I26.4(CH3CN)8]2−} (5), and [{1 a}3{(1 a)2NH}3Cu16I10(CH3CN)7] (6), respectively. PMID:29236336

Icosahedral quasicrystal Al71Pd21Mn08 and its ξ' approximant: Linear expansivity, specific heat, magnetic susceptibility, electrical resistivity, and elastic constants

NASA Astrophysics Data System (ADS)

Swenson, C. A.; Fisher, I. R.; Anderson, N. E.; Canfield, P. C.; Migliori, A.

2002-05-01

Linear thermal expansivity (α, 1-300 K), heat capacity (Cp, 1-108 K), magnetic susceptibility (χ, 1-300 K), and electrical resistivity (ρ, 1-300 K) measurements are reported for a single-grain i-Al71Pd21Mn08 quasicrystal and its Al72Pd25Mn03 approximant, and 300 K elastic constants for the quasicrystal. The approximant α (αAp) and Cp (CpAp) data show ``metallic'' behavior, while the previously reported onset of a transition to a spin-glass state (Tf<1.8 K) dominates αQ and CpQ below 11 K. CpAp and CpQ superimpose above 16 K when plotted vs T/Θ0 using the experimental Θ0Ap=455(3) K and an adjusted Θ0ApQ=480(4) K. The 300 K elastic constants extrapolated to T=0 give Θel0Q=505(1) K, suggesting that the normalization is valid only above 16 K. The lattice contribution to CpAp (and, indirectly, CpQ) shows strong (unique) deviations from Debye-like behavior (+3% at 0.84 K for the CpAp data fit). The various Grüneisen parameters (Γ) that are calculated from these data all are positive and normal in magnitude except for a large limiting approximant lattice value, Γlat0Ap=11.3, which may be related to the large dispersion effects in Cp. For the approximant, the combination of anisotropic and large resistivities, a small diamagnetic susceptibility, and a ``large'' linear (electronic) contribution to CpAp (γAp=0.794 mJ/mol K2) suggests the existence of a pseudogap in the electronic density of states. The unusually large, highly volume dependent, dispersion at low temperatures for the quasicrystal and its approximant are not consistent with inelastic neutron scattering and other data, and raise questions about the role of phonons in quasicrystals. The present 300 K resistivities can be used with a published correlation to estimate γQ~0.25 mJ/mol K2.

Enhancement of cordyceps polysaccharide production via biosynthetic pathway analysis in Hirsutella sinensis.

PubMed

Lin, Shan; Liu, Zhi-Qiang; Baker, Peter James; Yi, Ming; Wu, Hui; Xu, Feng; Teng, Yi; Zheng, Yu-Guo

2016-11-01

The addition of various sulfates for enhanced cordyceps polysaccharide (CP) production in submerged cultivation of H. sinensis was investigated, and manganese sulfate was found the most effective. 2mM of manganese sulfate on 0day (d) was investigated as the optimal adding condition, and the CP production reached optimum with 5.33%, increasing by 93.3% compared with the control. Furthermore, the consumption of three main precursors of CP was studied over cultivation under two conditions. Intracellular mannose content decreased by 43.1% throughout 6days cultivation, which corresponded to CP accumulation rate sharply increased from 0 d to 6 d, and mannose was considered as the most preferred precursor for generating CP. Subsequently, mannose biosynthetic pathway was constructed and verified for the first time in H. sinensis, which constituted the important part of CP biosynthesis, and transcriptional levels of the biosynthetic genes were studied. Transcriptional level of gene cpsA was significantly up-regulated 5.35-fold and it was a key gene involved both in mannose and CP biosynthesis. This study demonstrated that manganese sulfate addition is an efficient and simple way to improve CP production. Transcriptional analysis based on biosynthetic pathway was helpful to find key genes and better understand CP biosynthesis. Copyright © 2016 Elsevier B.V. All rights reserved.

Trunk and Hip Muscle Activation Patterns Are Different During Walking in Young Children With and Without Cerebral Palsy

PubMed Central

Lee, Samuel C.K.; VanSant, Ann F.; Barbe, Mary F.; Lauer, Richard T.

2010-01-01

Background Poor control of postural muscles is a primary impairment in people with cerebral palsy (CP). Objective The purpose of this study was to investigate differences in the timing characteristics of trunk and hip muscle activity during walking in young children with CP compared with children with typical development (TD). Methods Thirty-one children (16 with TD, 15 with CP) with an average of 28.5 months of walking experience participated in this observational study. Electromyographic data were collected from 16 trunk and hip muscles as participants walked at a self-selected pace. A custom-written computer program determined onset and offset of activity. Activation and coactivation data were analyzed for group differences. Results The children with CP had greater total activation and coactivation for all muscles except the external oblique muscle and differences in the timing of activation for all muscles compared with the TD group. The implications of the observed muscle activation patterns are discussed in reference to existing postural control literature. Limitations The potential influence of recording activity from adjacent deep trunk muscles is discussed, as well as the influence of the use of an assistive device by some children with CP. Conclusions Young children with CP demonstrate excessive, nonreciprocal trunk and hip muscle activation during walking compared with children with TD. Future studies should investigate the efficacy of treatments to reduce excessive muscle activity and improve coordination of postural muscles in CP. PMID:20430948

G1/S phase progression is regulated by PLK1 degradation through the CDK1/βTrCP axis.

PubMed

Giráldez, Servando; Galindo-Moreno, María; Limón-Mortés, M Cristina; Rivas, A Cristina; Herrero-Ruiz, Joaquín; Mora-Santos, Mar; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

2017-07-01

Polo-like kinase 1 (PLK1) is a serine/threonine kinase involved in several stages of the cell cycle, including the entry and exit from mitosis, and cytokinesis. Furthermore, it has an essential role in the regulation of DNA replication. Together with cyclin A, PLK1 also promotes CDH1 phosphorylation to trigger its ubiquitination and degradation, allowing cell cycle progression. The PLK1 levels in different type of tumors are very high compared to normal tissues, which is consistent with its role in promoting proliferation. Therefore, several PLK1 inhibitors have been developed and tested for the treatment of cancer. Here, we further analyzed PLK1 degradation and found that cytoplasmic PLK1 is ubiquitinated and subsequently degraded by the SCF βTrCP /proteasome. This procedure is triggered when heat shock protein (HSP) 90 is inhibited with geldanamycin, which results in misfolding of PLK1. We also identified CDK1 as the major kinase involved in this degradation. Our work shows for the first time that HSP90 inhibition arrests cell cycle progression at the G 1 /S transition. This novel mechanism inhibits CDH1 degradation through CDK1-dependent PLK1 destruction by the SCF βTrCP /proteasome. In these conditions, CDH1 substrates do not accumulate and cell cycle arrests, providing a novel pathway for regulation of the cell cycle at the G 1 -to-S boundary.-Giráldez, S., Galindo-Moreno, M., Limón-Mortés, M. C., Rivas, A. C., Herrero-Ruiz, J., Mora-Santos, M., Sáez, C., Japón, M. Á., Tortolero, M., Romero, F. G 1 /S phase progression is regulated by PLK1 degradation through the CDK1/βTrCP axis. © FASEB.

A dinucleotide motif in oligonucleotides shows potent immunomodulatory activity and overrides species-specific recognition observed with CpG motif.

PubMed

Kandimalla, Ekambar R; Bhagat, Lakshmi; Zhu, Fu-Gang; Yu, Dong; Cong, Yan-Ping; Wang, Daqing; Tang, Jimmy X; Tang, Jin-Yan; Knetter, Cathrine F; Lien, Egil; Agrawal, Sudhir

2003-11-25

Bacterial and synthetic DNAs containing CpG dinucleotides in specific sequence contexts activate the vertebrate immune system through Toll-like receptor 9 (TLR9). In the present study, we used a synthetic nucleoside with a bicyclic heterobase [1-(2'-deoxy-beta-d-ribofuranosyl)-2-oxo-7-deaza-8-methyl-purine; R] to replace the C in CpG, resulting in an RpG dinucleotide. The RpG dinucleotide was incorporated in mouse- and human-specific motifs in oligodeoxynucleotides (oligos) and 3'-3-linked oligos, referred to as immunomers. Oligos containing the RpG motif induced cytokine secretion in mouse spleen-cell cultures. Immunomers containing RpG dinucleotides showed activity in transfected-HEK293 cells stably expressing mouse TLR9, suggesting direct involvement of TLR9 in the recognition of RpG motif. In J774 macrophages, RpG motifs activated NF-kappa B and mitogen-activated protein kinase pathways. Immunomers containing the RpG dinucleotide induced high levels of IL-12 and IFN-gamma, but lower IL-6 in time- and concentration-dependent fashion in mouse spleen-cell cultures costimulated with IL-2. Importantly, immunomers containing GTRGTT and GARGTT motifs were recognized to a similar extent by both mouse and human immune systems. Additionally, both mouse- and human-specific RpG immunomers potently stimulated proliferation of peripheral blood mononuclear cells obtained from diverse vertebrate species, including monkey, pig, horse, sheep, goat, rat, and chicken. An immunomer containing GTRGTT motif prevented conalbumin-induced and ragweed allergen-induced allergic inflammation in mice. We show that a synthetic bicyclic nucleotide is recognized in the C position of a CpG dinucleotide by immune cells from diverse vertebrate species without bias for flanking sequences, suggesting a divergent nucleotide motif recognition pattern of TLR9.

Nicotine Induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

PubMed Central

Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

2011-01-01

Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt −377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. PMID:21971485

Differences between primary auditory cortex and auditory belt related to encoding and choice for AM sounds

PubMed Central

Niwa, Mamiko; Johnson, Jeffrey S.; O’Connor, Kevin N.; Sutter, Mitchell L.

2013-01-01

We recorded from middle-lateral (ML) and primary (A1) auditory cortex while macaques discriminated amplitude modulated (AM) from unmodulated noise. Compared to A1, ML had a higher proportion of neurons that encode increasing AM depth by decreasing their firing-rates (‘decreasing’ neurons), particularly with responses that were not synchronized to the modulation. Choice probability (CP) analysis revealed that A1 and ML activity were different during the first half of the test stimulus. In A1, significant CP begins prior to the test stimulus, remains relatively constant (or increases slightly) during the stimulus and increases greatly within 200 ms of lever-release. Neurons in ML behave similarly, except that significant CP disappears during the first half of the stimulus and reappears during the second half and pre-release periods. CP differences between A1 and ML depend on neural response type. In ML (but not A1), when activity is lower during the first half of the stimulus in non-synchronized ‘decreasing’ neurons, the monkey is more likely to report AM. Neurons that both increase firing rate with increasing modulation depth (‘increasing’ neurons) and synchronize their responses to AM had similar choice-related activity dynamics in ML and A1. The results suggest that, when ascending the auditory system, there is a transformation in coding AM from primarily synchronized ‘increasing’ responses in A1 to non-synchronized and dual (‘increasing’/’decreasing’) coding in ML. This sensory transformation is accompanied by changes in the timing of activity related to choice, suggesting functional differences between A1 and ML related to attention and/or behavior. PMID:23658177

All-Atom Continuous Constant pH Molecular Dynamics With Particle Mesh Ewald and Titratable Water.

PubMed

Huang, Yandong; Chen, Wei; Wallace, Jason A; Shen, Jana

2016-11-08

Development of a pH stat to properly control solution pH in biomolecular simulations has been a long-standing goal in the community. Toward this goal recent years have witnessed the emergence of the so-called constant pH molecular dynamics methods. However, the accuracy and generality of these methods have been hampered by the use of implicit-solvent models or truncation-based electrostatic schemes. Here we report the implementation of the particle mesh Ewald (PME) scheme into the all-atom continuous constant pH molecular dynamics (CpHMD) method, enabling CpHMD to be performed with a standard MD engine at a fractional added computational cost. We demonstrate the performance using pH replica-exchange CpHMD simulations with titratable water for a stringent test set of proteins, HP36, BBL, HEWL, and SNase. With the sampling time of 10 ns per replica, most pK a 's are converged, yielding the average absolute and root-mean-square deviations of 0.61 and 0.77, respectively, from experiment. Linear regression of the calculated vs experimental pK a shifts gives a correlation coefficient of 0.79, a slope of 1, and an intercept near 0. Analysis reveals inadequate sampling of structure relaxation accompanying a protonation-state switch as a major source of the remaining errors, which are reduced as simulation prolongs. These data suggest PME-based CpHMD can be used as a general tool for pH-controlled simulations of macromolecular systems in various environments, enabling atomic insights into pH-dependent phenomena involving not only soluble proteins but also transmembrane proteins, nucleic acids, surfactants, and polysaccharides.

In vitro and in vivo pharmacology of CP-945,598, a potent and selective cannabinoid CB(1) receptor antagonist for the management of obesity.

PubMed

Hadcock, John R; Griffith, David A; Iredale, Phillip A; Carpino, Phillip A; Dow, Robert L; Black, Shawn C; O'Connor, Rebecca; Gautreau, Denise; Lizano, Jeffrey S; Ward, Karen; Hargrove, Diane M; Kelly-Sullivan, Dawn; Scott, Dennis O

2010-04-02

Cannabinoid CB(1) receptor antagonists exhibit pharmacologic properties favorable for the treatment of metabolic disease. CP-945,598 (1-[9-(4-chlorophenyl)-8-(2-chlorophenyl)-9H-purin-6-yl]-4-ethylamino piperidine-4-carboxylic acid amide hydrochloride) is a recently discovered selective, high affinity, competitive CB(1) receptor antagonist that inhibits both basal and cannabinoid agonist-mediated CB(1) receptor signaling in vitro and in vivo. CP-945,598 exhibits sub-nanomolar potency at human CB(1) receptors in both binding (K(i)=0.7 nM) and functional assays (K(i)=0.2 nM). The compound has low affinity (K(i)=7600 nM) for human CB(2) receptors. In vivo, CP-945,598 reverses four cannabinoid agonist-mediated CNS-driven responses (hypo-locomotion, hypothermia, analgesia, and catalepsy) to a synthetic cannabinoid receptor agonist. CP-945,598 exhibits dose and concentration-dependent anorectic activity in two models of acute food intake in rodents, fast-induced re-feeding and spontaneous, nocturnal feeding. CP-945,598 also acutely stimulates energy expenditure in rats and decreases the respiratory quotient indicating a metabolic switch to increased fat oxidation. CP-945,598 at 10mg/kg promoted a 9%, vehicle adjusted weight loss in a 10 day weight loss study in diet-induced obese mice. Concentration/effect relationships combined with ex vivo brain CB(1) receptor occupancy data were used to evaluate efficacy in behavioral, food intake, and energy expenditure studies. Together, these in vitro, ex vivo, and in vivo data indicate that CP-945,598 is a novel CB(1) receptor competitive antagonist that may further our understanding of the endocannabinoid system. 2010 Elsevier Inc. All rights reserved.

Adaptations in AMPA receptor transmission in the nucleus accumbens contributing to incubation of cocaine craving

PubMed Central

Loweth, Jessica A.; Tseng, Kuei Y.; Wolf, Marina E.

2013-01-01

Cue-induced cocaine craving in rodents intensifies or “incubates” during the first months of withdrawal from long access cocaine self-administration. This incubation phenomenon is relevant to human users who achieve abstinence but exhibit persistent vulnerability to cue-induced relapse. It is well established that incubation of cocaine craving involves complex neuronal circuits. Here we will focus on neuroadaptations in the nucleus accumbens (NAc), a region of convergence for pathways that control cocaine seeking. A key adaptation is a delayed (~3–4 weeks) accumulation of Ca2+-permeable AMPAR receptors (CP-AMPARs) in synapses on medium spiny neurons (MSN) of the NAc. These CP-AMPARs mediate the expression of incubation after prolonged withdrawal, although different mechanisms must be responsible during the first weeks of withdrawal, prior to CP-AMPAR accumulation. The cascade of events leading to CP-AMPAR accumulation is still unclear. However, several candidate mechanisms have been identified. First, mGluR1 has been shown to negatively regulate CP-AMPAR levels in NAc synapses, and it is possible that a withdrawal-dependent decrease in this effect may help explain CP-AMPAR accumulation during incubation. Second, an increase in phosphorylation of GluA1 subunits (at the protein kinase A site) within extrasynaptic homomeric GluA1 receptors (CP-AMPARs) may promote their synaptic insertion and oppose their removal. Finally, elevation of brain-derived neurotrophic factor (BDNF) levels in the NAc may contribute to maintenance of incubation after months of withdrawal, although incubation-related increases in BDNF accumulation do not account for CP-AMPAR accumulation. Receptors and pathways that negatively regulate incubation, such as mGluR1, are promising targets for the development of therapeutic strategies to help recovering addicts maintain abstinence. PMID:23727437

Continuous measurements of bedload transport rates in a small glacial river catchment in the summer season (Spitsbergen)

NASA Astrophysics Data System (ADS)

Kociuba, Waldemar; Janicki, Grzegorz

2014-05-01

The study on bedload transport was conducted on the gravel-bed Scott River catchment with a glacial alimentation regime, located in the NW part of the Wedel Jarlsberg Land (Spitsbergen) with subpolar climatic conditions. In the melt season of 2010, bedload transport rate was continuously monitored at 24-hour intervals by means of four River Bedload Trap devices aligned across the width of the channel. The maximum bedload transport rate varied strongly at portions of the cross section from 16 to 152 kg m- 1 d- 1 in cross-profile I (c-p I) and 4 to 125 kg m- 1 d- 1 in cross-profile II (c-p II). The maximum channel-mean bedload transport rate (qa) amounted to 54 kg m- 1 d- 1 (c-p I) and 35 kg m- 1 d- 1 (c-p II). Mean daily bedload discharge (Qb) was estimated at a level of 97 kg day- 1 (c-p I) and 35 kg m- 1 d- 1 (c-p II), and the total bedload yield was determined at approx. 4345 kg in the measurement period (2086 kg — c-p I; 2203 kg — c-p II from 13.07 to 10.08). The analysis of the relationship between channel-mean bedload transport rate and water velocity or shear stress revealed a significant value of the correlation coefficient (R2 = 0.6). Discharge and rate of bedload transport were dependent on the weather and number of days with flood discharge. Approx. 58% of the entire discharged bedload was transported during 3 violent ablation-precipitation floods. Bedload grain size distribution was right-skewed and showed moderate sorting.

Trichocystatin-2 (TC-2): an endogenous inhibitor of cysteine proteinases in Trichomonas vaginalis is associated with TvCP39.

PubMed

Puente-Rivera, Jonathan; Ramón-Luing, Lucero de los Ángeles; Figueroa-Angulo, Elisa Elvira; Ortega-López, Jaime; Arroyo, Rossana

2014-09-01

The causal agent of trichomoniasis is a parasitic protist, Trichomonas vaginalis, which is rich in proteolytic activity, primarily carried out by cysteine proteases (CPs). Some CPs are known virulence factors. T. vaginalis also possesses three genes encoding endogenous cystatin-like CP inhibitors. The aim of this study was to identify and characterize one of these CP inhibitors. Using two-dimensional gel electrophoresis (2-DE) and mass spectrometry (MS), a cystatin-like peptidase inhibitor dubbed Trichocystatin-2 (TC-2) was identified in the T. vaginalis active degradome in association with TvCP39, a 39kDa CP involved in cytotoxicity. To characterize the TC-2 inhibitor, we cloned and expressed the tvicp-2 gene, purified the recombinant protein (TC-2r), and produced a specific polyclonal antibody (α-TC-2r). This antibody recognized a 10kDa protein band by western blotting. An indirect immunofluorescence assay (IFA) and cell fractionation assays using the α-TC-2r antibody showed that TC-2 was localized in the cytoplasm and lysosomes and that it colocalized with TvCP39. TC-2r showed inhibitory activity against papain, cathepsin-L, and TvCP39 in trichomonad extracts and live parasites but not legumain-like CPs. Live trichomonads treated with TC-2r showed reduced trichomonal cytotoxicity to HeLa cell monolayers in a TC-2r-concentration-dependent manner. In this study, we identified and characterized an endogenous cystatin-like inhibitor in T. vaginalis, TC-2, which is associated with TvCP39 and appears to regulate the cellular damage caused by T. vaginalis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mapping of Variable DNA Methylation Across Multiple Cell Types Defines a Dynamic Regulatory Landscape of the Human Genome.

PubMed

Gu, Junchen; Stevens, Michael; Xing, Xiaoyun; Li, Daofeng; Zhang, Bo; Payton, Jacqueline E; Oltz, Eugene M; Jarvis, James N; Jiang, Kaiyu; Cicero, Theodore; Costello, Joseph F; Wang, Ting

2016-04-07

DNA methylation is an important epigenetic modification involved in many biological processes and diseases. Many studies have mapped DNA methylation changes associated with embryogenesis, cell differentiation, and cancer at a genome-wide scale. Our understanding of genome-wide DNA methylation changes in a developmental or disease-related context has been steadily growing. However, the investigation of which CpGs are variably methylated in different normal cell or tissue types is still limited. Here, we present an in-depth analysis of 54 single-CpG-resolution DNA methylomes of normal human cell types by integrating high-throughput sequencing-based methylation data. We found that the ratio of methylated to unmethylated CpGs is relatively constant regardless of cell type. However, which CpGs made up the unmethylated complement was cell-type specific. We categorized the 26,000,000 human autosomal CpGs based on their methylation levels across multiple cell types to identify variably methylated CpGs and found that 22.6% exhibited variable DNA methylation. These variably methylated CpGs formed 660,000 variably methylated regions (VMRs), encompassing 11% of the genome. By integrating a multitude of genomic data, we found that VMRs enrich for histone modifications indicative of enhancers, suggesting their role as regulatory elements marking cell type specificity. VMRs enriched for transcription factor binding sites in a tissue-dependent manner. Importantly, they enriched for GWAS variants, suggesting that VMRs could potentially be implicated in disease and complex traits. Taken together, our results highlight the link between CpG methylation variation, genetic variation, and disease risk for many human cell types. Copyright © 2016 Gu et al.

Reaction of BH4- with [Mo2Cp2(mu-SMe)n] species to give tetrahydroborato, hydrido or dimetallaborane compounds: control of product by ancillary ligands.

PubMed

Cabon, Nolwenn; Petillon, Francois Y; Schollhammer, Philippe; Talarmin, Jean; Muir, Kenneth W

2004-09-07

The reaction of mono- or dichloro-dimolybdenum(III) complexes [Mo2Cp2(mu-SMe)2(mu-Cl)(mu-Y)] (Cp=eta5-C5H5; 1, Y=SMe; 2, Y=PPh2; 3, Y=Cl) with NaBH4 at room temperature gave in high yields tetrahydroborato (8), hydrido (9) or metallaborane (12) complexes depending on the ancillary ligands. The correct formulation of derivatives and has been unambigously determined by X-ray diffraction methods. That of the hydrido compound 9 has been established in solution by NMR analysis and confirmed by an X-ray study of the mu-azavinylidene derivative [Mo2Cp2(mu-SMe)2(mu-PPh2)(mu-N=CHMe)] (10) obtained from the insertion of acetonitrile into the Mo-H bond of 9. Reaction of NaBH4 with nitrile derivatives, [Mo2Cp2(mu-SMe)4-n(CH3CN)2n]n+(5, n=1; 6 n=2), afforded the tetrahydroborato compound 8, together with a mu-azavinylidene species [Mo2Cp2(mu-SMe)3(mu-N=CHMe)](14), when n=1, and the metallaborane complex 12, together with a mixed borohydrato-azavinylidene derivative [Mo2Cp2(mu-SMe)2(mu-BH4)(mu-N=CHMe)] (13), when n=2. The molecular structures of these complexes have been confirmed by X-ray analysis. Preparations of some of the starting complexes (3 and 4) are also described, as are the molecular structures of the precursors [Mo2Cp2(mu-SMe)2(mu-X)(mu-Y)] (1, X/Y=Cl/SMe; 2, X/Y=Cl/PPh2; 4, X/Y=SMe/PPh2).

Adiponectin has a pivotal role in the cardioprotective effect of CP-3(iv), a selective CD36 azapeptide ligand, after transient coronary artery occlusion in mice.

PubMed

Huynh, David N; Bessi, Valérie L; Ménard, Liliane; Piquereau, Jérôme; Proulx, Caroline; Febbraio, Maria; Lubell, William D; Carpentier, André C; Burelle, Yan; Ong, Huy; Marleau, Sylvie

2018-02-01

CD36 is a multiligand receptor involved in lipid metabolism. We investigated the mechanisms underlying the cardioprotective effect of CP-3(iv), an azapeptide belonging to a new class of selective CD36 ligands. The role of CP-3(iv) in mediating cardioprotection was investigated because CD36 signaling leads to activation of peroxisome proliferator-activated receptor-γ, a transcriptional regulator of adiponectin. CP-3(iv) pretreatment reduced infarct size by 54% and preserved hemodynamics in C57BL/6 mice subjected to 30 min coronary ligation and reperfusion but had no effect in CD36-deficient mice. The effects of CP-3(iv) were associated with an increase in circulating adiponectin levels, epididymal fat adiponectin gene expression, and adiponectin transcriptional regulators ( Pparg, Cebpb, Sirt1) after 6 h of reperfusion. Reduced myocardial oxidative stress and apoptosis were observed along with an increase in expression of myocardial adiponectin target proteins, including cyclooxygenase-2, phospho-AMPK, and phospho-Akt. Moreover, CP-3(iv) increased myocardial performance in isolated hearts, whereas blockade of adiponectin with an anti-adiponectin antibody abrogated it. CP-3(iv) exerts cardioprotection against myocardial ischemia and reperfusion (MI/R) injury and dysfunction, at least in part, by increasing circulating and myocardial adiponectin levels. Hence, both paracrine and endocrine effects of adiponectin may contribute to reduced reactive oxygen species generation and apoptosis after MI/R, in a CD36-dependent manner.-Huynh, D. N., Bessi, V. L., Ménard, L., Piquereau, J., Proulx, C., Febbraio, M., Lubell, W. D., Carpentier, A. C., Burelle, Y., Ong, H., Marleau, S. Adiponectin has a pivotal role in the cardioprotective effect of CP-3(iv), a selective CD36 azapeptide ligand, after transient coronary artery occlusion in mice.

Microbiota-Mediated Modulation of Organophosphate Insecticide Toxicity by Species-Dependent Interactions with Lactobacilli in a Drosophila melanogaster Insect Model.

PubMed

Daisley, Brendan A; Trinder, Mark; McDowell, Tim W; Collins, Stephanie L; Sumarah, Mark W; Reid, Gregor

2018-05-01

Despite the benefits to the global food supply and agricultural economies, pesticides are believed to pose a threat to the health of both humans and wildlife. Chlorpyrifos (CP), a commonly used organophosphate insecticide, has poor target specificity and causes acute neurotoxicity in a wide range of species via the suppression of acetylcholinesterase. This effect is exacerbated 10- to 100-fold by chlorpyrifos oxon (CPO), a principal metabolite of CP. Since many animal-associated symbiont microorganisms are known to hydrolyze CP into CPO, we used a Drosophila melanogaster insect model to investigate the hypothesis that indigenous and probiotic bacteria could affect CP metabolism and toxicity. Antibiotic-treated and germfree D. melanogaster insects lived significantly longer than their conventionally reared counterparts when exposed to 10 μM CP. Drosophila melanogaster gut-derived Lactobacillus plantarum , but not Acetobacter indonesiensis , was shown to metabolize CP. Liquid chromatography tandem-mass spectrometry confirmed that the L. plantarum isolate preferentially metabolized CP into CPO when grown in CP-spiked culture medium. Further experiments showed that monoassociating germfree D. melanogaster with the L. plantarum isolate could reestablish a conventional-like sensitivity to CP. Interestingly, supplementation with the human probiotic Lactobacillus rhamnosus GG (a strain that binds but does not metabolize CP) significantly increased the survival of the CP-exposed germfree D. melanogaster This suggests strain-specific differences in CP metabolism may exist among lactobacilli and emphasizes the need for further investigation. In summary, these results suggest that (i) CPO formation by the gut microbiota can have biologically relevant consequences for the host, and (ii) probiotic lactobacilli may be beneficial in reducing in vivo CP toxicity. IMPORTANCE An understudied area of research is how the microbiota (microorganisms living in/on an animal) affects the metabolism and toxic outcomes of environmental pollutants such as pesticides. This study focused specifically on how the microbial biotransformation of chlorpyrifos (CP; a common organophosphate insecticide) affected host exposure and toxicity parameters in a Drosophila melanogaster insect model. Our results demonstrate that the biotransformation of CP by the gut microbiota had biologically relevant and toxic consequences on host health and that certain probiotic lactobacilli may be beneficial in reducing CP toxicity. Since inadvertent pesticide exposure is suspected to negatively impact the health of off-target species, these findings may provide useful information for wildlife conservation and environmental sustainability planning. Furthermore, the results highlight the need to consider microbiota composition differences between beneficial and pest insects in future insecticide designs. More broadly, this study supports the use of beneficial microorganisms to modulate the microbiota-mediated biotransformation of xenobiotics. Copyright © 2018 American Society for Microbiology.

Sensitive detection of cyclophosphamide using DNA-modified carbon paste, pencil graphite and hanging mercury drop electrodes.

PubMed

Palaska, P; Aritzoglou, E; Girousi, S

2007-05-15

The interaction of cyclophosphamide (CP) with calf thymus double-stranded DNA (dsDNA) and thermally denatured single-stranded DNA (ssDNA) immobilized at the carbon paste (CPE) and pencil graphite electrodes (PGE), was studied electrochemically based on oxidation signals of guanine and adenine using differential pulse voltammetry (DPV). As a result of the interaction of CP with DNA, the voltammetric signals of guanine and adenine increased in the case of dsDNA while a slight increase was observed in ssDNA. The effect of experimental parameters such as the interaction time between CP and DNA forms and the concentration of CP, were studied using DPV with CPE and PGE. Additionally, reproducibility and detection limits were determined using both electrodes. A comparison of the analytical performance between CPE and PGE was done. Our results showed that these two different DNA biosensors could be used for the sensitive, rapid and cost effective detection of CP itself as well as of CP-DNA interaction. Furthermore, the interaction of CP with dsDNA and ssDNA was studied in solution and at the electrode surface by means of alternating current voltammetry (ACV) in 0.3M NaCl and 50mM sodium phosphate buffer (pH 8.5) supporting electrolyte, using a hanging mercury drop electrode (HMDE) as working electrode. The conclusions of this study were mainly based on tensammetric peaks I (at -1.183V) and II (-1.419V) of DNA. This study involved the interaction of CP with surface-confined and solution phase DNA where experimental parameters, such as the concentration of CP and the interaction time, were studied. By increasing the concentration of CP, an increase of peak II was observed in both ds and ssDNA, while an increase of peak I was observed only in the case of dsDNA. An overall conclusion of the study using HMDE was that the interaction of CP with surface-confined DNA significantly differed from that with solution phase DNA. The increase of peaks I and II was lower in the case of interaction of CP with surface-confined DNA, probably due to steric positioning of DNA at the electrode surface.

Abnormal temperature dependent behaviors of intersystem crossing and triplet-triplet annihilation in organic planar heterojunction devices

NASA Astrophysics Data System (ADS)

Xiang, Jie; Chen, Yingbing; Yuan, De; Jia, Weiyao; Zhang, Qiaoming; Xiong, Zuhong

2016-09-01

Anomalous temperature dependent magneto-electroluminescence was observed at low and high magnetic field strength from organic planar heterojunction devices incorporated common phosphorescent host materials of N,N'-dicarbazolyl-3,5-benzene (mCP) or 4,4'-N,N'-dicarbazole-biphenyl (CBP) as an emissive layer. We found that intersystem crossing became stronger with decreasing temperature and that triplet-triplet annihilation (TTA) occurred at room temperature but ceased at low temperature. Analyses of the electroluminescence spectra of these devices and their temperature dependences indicated that the population of exciplex states increased at low temperature, which caused the abnormal behavior of intersystem crossing. Additionally, long lifetime of the excitons within mCP or CBP layer may allow TTA to occur at room temperature, while the reduced population of excitons at low temperature may account for the disappearance of TTA even though the excitons had increased lifetime.

Evaluation of the cytotoxic and genotoxic potential of lecithin/chitosan nanoparticles

NASA Astrophysics Data System (ADS)

Taner, Gökçe; Yeşilöz, Recep; Özkan Vardar, Deniz; Şenyiğit, Taner; Özer, Özgen; Degen, Gisela H.; Başaran, Nurşen

2014-02-01

Nanoparticles-based drug targeting delivery systems have been introduced in the treatment for various diseases because of their effective properties, although there have been conflicting results on the toxicity of nanoparticles. In the present study, the aim was to evaluate the cytotoxicity and the genotoxicity of different concentrations of lecithin/chitosan nanoparticles with and without clobetasol-17-propionate (CP) by neutral red uptake (NRU) cytotoxicity assay and single cell gel electrophoresis (Comet) and cytokinesis-blocked micronucleus assays. The IC50 values of lecithin/chitosan nanoparticles with/without CP were found as 1.9 and 1.8 %, respectively, in the NRU cytotoxicity test. High concentrations of lecithin/chitosan nanoparticles induced DNA damage in human lymphocytes as evaluated by comet assay. The micronucleus frequency was increased by the lecithin/chitosan treatment in a dose-dependent manner. Also at the two highest concentrations, a significant increase in micronucleus formation was observed. Lecithin/chitosan nanoparticles with CP did not increase the frequency of micronucleus and also did not induce additional DNA damage when compared with lecithin/chitosan nanoparticles without CP; therefore, CP itself has not found to be genotoxic at the studied concentration.

Cp[prime]M(NO)R[sub 2]: 16-electron piano-stool molecules of molybdenum and tungsten

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legzdins, P.; Veltheer, J.E.

1993-02-01

A long-term goal of this research program is the development of organometallic nitrosyl complexes as specific reactants or selective catalysts for organic or organometallic transformations of practical significance. To attain this goal specifically with Cp[prime]M(NO)R[sub 2] system the authors developed new methods for their synthesis, established their characteristic physical and chemical properties, and are currently endeavoring to exploit those properties which are unique to the complexes. During our investigations, the authors have discovered that the Cp[prime]M(NO)R[sub 2] complexes react with a variety of small molecules, often in an unprecedented manner. The authors have also established several unique transformations that aremore » not exhibited by all members of this group of complexes. Indeed, the authors found that the chemical properties of these systems are often dependent on the metal, the nature of the R groups, and the type of Cp[prime] ligand. In this Account the authors summarize the synthesis, characterization, comparative reactivity, and distinctive chemical properties of the 16-electron Cp[prime]M(NO)R[sub 2] complexes known to date. 35 refs., 7 figs.« less

Histone Variants and Composition in the Developing Brain: Should MeCP2 Care?

PubMed

Zago, Valentina; Pinar-CabezaDeVaca, Cristina; Vincent, John B; Ausio, Juan

2017-01-01

Specific compositional chromatin features distinguish brain/neuronal chromatin from that of other tissues and are critical to this organ and cell type development and neuroplasticity. These features include a significant turnover of the major constitutive chromosomal proteins, including the (canonical) replication-dependent histones, the replication-independent replacement histone variants, as well as the chromatin associated transcriptional regulator MeCP2 (methyl CpG binding protein 2). Alterations of histones and MeCP2 have already been implicated in many brain disorders. Despite the relevance of histone variants to chromatin structure and function, only recently has some exciting literature started to re-emerge that directly relates them to neuron plasticity and cognition. However, the amount of information available on the functional role of these histones is still very limited. The purpose of this review is to focus attention to this important group of chromatin proteins, which, in the brain, possess overlapping structural and functional roles with the highly abundant presence of MeCP2. There is an imperative need to understand how all these proteins communicate with each other, and future research will hopefully provide us with answers.

Deep brain stimulation in cerebral palsy: Challenges and opportunities.

PubMed

Koy, Anne; Timmermann, Lars

2017-01-01

Cerebral palsy (CP) is the most common cause for acquired dystonia in childhood. Pharmacological treatment is often unsatisfactory and side effects are frequently dose-limiting. Data on outcome of DBS in paediatric patients with dyskinetic CP is very limited and heterogeneous. Reasons for the variability in responses are not entirely known yet. Interestingly, some CP-patients seem to improve subjectively on pallidal stimulation but without measurable changes in impairment scales. Besides dystonia scales, the use of sensitive age-dependent assessments tools is therefore reasonable to capture the full effect. As the course of disease duration as well as the age at operation seem to correlate with DBS outcome in patients with dystonia, DBS at an early stage of development might be beneficial for some of these patients. For the future, well-conducted trials as well as data collection in the international registry is of major importance to increase knowledge about DBS in CP patients, especially those implanted at a young age. Furthermore, selection criteria and guidelines or treatment standards are needed to improve the service for children with dyskinetic CP - especially in light of unsatisfactory medical treatment options. Copyright © 2016 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Real-time curling probe monitoring of dielectric layer deposited on plasma chamber wall

NASA Astrophysics Data System (ADS)

Hotta, Masaya; Ogawa, Daisuke; Nakamura, Keiji; Sugai, Hideo

2018-04-01

A microwave resonator probe called a curling probe (CP) was applied to in situ monitoring of a dielectric layer deposited on a chamber wall during plasma processing. The resonance frequency of the CP was analytically found to shift in proportion to the dielectric layer thickness; the proportionality constant was determined from a comparison with the finite-difference time-domain (FDTD) simulation result. Amorphous carbon layers deposited in acetylene inductively coupled plasma (ICP) discharge were monitored using the CP. The measured resonance frequency shift dictated the carbon layer thickness, which agreed with the results from the surface profiler and ellipsometry.

Atomic layer deposition of high-density Pt nanodots on Al2O3 film using (MeCp)Pt(Me)3 and O2 precursors for nonvolatile memory applications

PubMed Central

2013-01-01

Pt nanodots have been grown on Al2O3 film via atomic layer deposition (ALD) using (MeCp)Pt(Me)3 and O2 precursors. Influence of the substrate temperature, pulse time of (MeCp)Pt(Me)3, and deposition cycles on ALD Pt has been studied comprehensively by scanning electron microscopy, transmission electron microscopy, and X-ray photoelectron spectroscopy. Therefore, Pt nanodots with a high density of approximately 2 × 1012 cm-2 have been achieved under optimized conditions: 300°C substrate temperature, 1 s pulse time of (MeCp)Pt(Me)3, and 70 deposition cycles. Further, metal-oxide-semiconductor capacitors with Pt nanodots embedded in ALD Al2O3 dielectric have been fabricated and characterized electrically, indicating noticeable electron trapping capacity, efficient programmable and erasable characteristics, and good charge retention. PMID:23413837

Electronic structures of GeSi nanoislands grown on pit-patterned Si(001) substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ye, Han, E-mail: Dabombyh@aliyun.com; Yu, Zhongyuan

2014-11-15

Patterning pit on Si(001) substrate prior to Ge deposition is an important approach to achieve GeSi nanoislands with high ordering and size uniformity. In present work, the electronic structures of realistic uncapped pyramid, dome, barn and cupola nanoislands grown in (105) pits are systematically investigated by solving Schrödinger equation for heavy-hole, which resorts to inhomogeneous strain distribution and nonlinear composition-dependent band parameters. Uniform, partitioned and equilibrium composition profile (CP) in nanoisland and inverted pyramid structure are simulated separately. We demonstrate the huge impact of composition profile on localization of heavy-hole: wave function of ground state is confined near pit facetsmore » for uniform CP, at bottom of nanoisland for partitioned CP and at top of nanoisland for equilibrium CP. Moreover, such localization is gradually compromised by the size effect as pit filling ratio or pit size decreases. The results pave the fundamental guideline of designing nanoislands on pit-patterned substrates for desired applications.« less

Effect of micronization on the physicochemical properties of insoluble dietary fiber from citrus (Citrus junos Sieb. ex Tanaka) pomace.

PubMed

Ye, Fayin; Tao, Bingbing; Liu, Jia; Zou, Yan; Zhao, Guohua

2016-04-01

The aim of this work was to study the effect of micronization (mechanical and jet grindings) on the physicochemical properties of the insoluble dietary fiber from citrus pomace in comparison with ordinary grinding. The results showed that micronization treatment effectively pulverized the IDF-CP powders to micron scale and significantly increased the soluble dietary fiber content (p < 0.05). Compared with mechanical grinding, jet grinding was more effective in size reduction and resulted in IDF-CP powders with narrower particle size distributions. Micronized IDF-CP powders had smaller particle size, smoother surface, higher fluidity, cation-exchange capacity, and metal cation binding capacity values, but lower water holding capacity, oil holding capacity, and swelling capacity values. These functional properties were significantly dependent on surface area and particle size (D0.5). The present study suggested that micronization treatments could modify functional properties of IDF-CP powders, which promotes their use in food applications. © The Author(s) 2015.

Multiscale Modeling of Structurally-Graded Materials Using Discrete Dislocation Plasticity Models and Continuum Crystal Plasticity Models

NASA Technical Reports Server (NTRS)

Saether, Erik; Hochhalter, Jacob D.; Glaessgen, Edward H.

2012-01-01

A multiscale modeling methodology that combines the predictive capability of discrete dislocation plasticity and the computational efficiency of continuum crystal plasticity is developed. Single crystal configurations of different grain sizes modeled with periodic boundary conditions are analyzed using discrete dislocation plasticity (DD) to obtain grain size-dependent stress-strain predictions. These relationships are mapped into crystal plasticity parameters to develop a multiscale DD/CP model for continuum level simulations. A polycrystal model of a structurally-graded microstructure is developed, analyzed and used as a benchmark for comparison between the multiscale DD/CP model and the DD predictions. The multiscale DD/CP model follows the DD predictions closely up to an initial peak stress and then follows a strain hardening path that is parallel but somewhat offset from the DD predictions. The difference is believed to be from a combination of the strain rate in the DD simulation and the inability of the DD/CP model to represent non-monotonic material response.

Ubc13 and COOH Terminus of Hsp70-interacting Protein (CHIP) Are Required for Growth Hormone Receptor Endocytosis*

PubMed Central

Slotman, Johan A.; da Silva Almeida, Ana C.; Hassink, Gerco C.; van de Ven, Robert H. A.; van Kerkhof, Peter; Kuiken, Hendrik J.; Strous, Ger J.

2012-01-01

Growth hormone receptor (GHR) endocytosis is a highly regulated process that depends on the binding and activity of the multimeric ubiquitin ligase, SCFβTrCP (Skp Cullin F-box). Despite a specific interaction between β-transducin repeat-containing protein (βTrCP) and the GHR, and a strict requirement for ubiquitination activity, the receptor is not an obligatory target for SCFβTrCP-directed Lys48 polyubiquitination. We now show that also Lys63-linked ubiquitin chain formation is required for GHR endocytosis. We identified both the ubiquitin-conjugating enzyme Ubc13 and the ubiquitin ligase COOH terminus of Hsp70 interacting protein (CHIP) as being connected to this process. Ubc13 activity and its interaction with CHIP precede endocytosis of GHR. In addition to βTrCP, CHIP interacts specifically with the cytosolic tails of the dimeric GHR, identifying both Ubc13 and CHIP as novel factors in the regulation of cell surface availability of GHR. PMID:22433856

Implication of the C terminus of the Prunus necrotic ringspot virus movement protein in cell-to-cell transport and in its interaction with the coat protein.

PubMed

Aparicio, Frederic; Pallás, Vicente; Sánchez-Navarro, Jesús

2010-07-01

The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for viral transport. Previous analysis with MPs of other members of the family Bromoviridae has shown that the C-terminal part of these MPs plays a critical role in the interaction with the cognate coat protein (CP) and in cell-to-cell transport. Bimolecular fluorescence complementation and overlay analysis confirm an interaction between the C-terminal 38 aa of PNRSV MP and its cognate CP. Mutational analysis of the C-terminal region of the PNRSV MP revealed that its C-terminal 38 aa are dispensable for virus transport, however, the 4 aa preceding the dispensable C terminus are necessary to target the MP to the plasmodesmata and for the functionality of the protein. The capacity of the PNRSV MP to use either a CP-dependent or a CP-independent cell-to-cell transport is discussed.

An outbreak of chickenpox at a child care centre in Western Australia. Costs to the community and implications for vaccination policy.

PubMed

Vally, Hassan; Dowse, Gary K; Eastwood, Keith; Cameron, Scott

2007-04-01

Between May and June 2002 an outbreak of chickenpox (CP) occurred at a child care centre in Perth, Western Australia. An epidemiological study was undertaken in order to determine the characteristics of the outbreak, assess vaccine effectiveness, and to define the direct and indirect costs associated with CP infections in young children. A cohort study of the outbreak utilising attendance records and a telephone survey of parents was conducted. Of the 211 children attending the child care centre at the time of the outbreak, 44 contracted CP (attack rate 25.7%). In addition, two staff members, five secondary household contacts (secondary attack rate 38.5%) and four secondary non-household associated contacts were infected. There were no severe complications or any hospitalisations recorded in infected persons. Two cases had been vaccinated previously. Vaccine effectiveness for CP of any severity was 78.0% (95% CI 15.4-94.3%) while vaccine effectiveness against severe CP was 100%. Direct costs during this outbreak were estimated to be $54 per case and the total costs, including cost of parental time off work or study, were estimated to be $525.73 per case. Although morbidity associated with CP in young children is not great, infection in childhood is almost universal. This study found that the average costs associated with each CP case were considerable. Since varicella vaccine affords good protection against CP, the recent inclusion of this vaccine in the Australian childhood vaccination schedule should save the community a considerable amount in direct and indirect costs if high coverage rates can be achieved.

Differentiation between non-neural and neural contributors to ankle joint stiffness in cerebral palsy

PubMed Central

2013-01-01

Background Spastic paresis in cerebral palsy (CP) is characterized by increased joint stiffness that may be of neural origin, i.e. improper muscle activation caused by e.g. hyperreflexia or non-neural origin, i.e. altered tissue viscoelastic properties (clinically: “spasticity” vs. “contracture”). Differentiation between these components is hard to achieve by common manual tests. We applied an assessment instrument to obtain quantitative measures of neural and non-neural contributions to ankle joint stiffness in CP. Methods Twenty-three adolescents with CP and eleven healthy subjects were seated with their foot fixated to an electrically powered single axis footplate. Passive ramp-and-hold rotations were applied over full ankle range of motion (RoM) at low and high velocities. Subject specific tissue stiffness, viscosity and reflexive torque were estimated from ankle angle, torque and triceps surae EMG activity using a neuromuscular model. Results In CP, triceps surae reflexive torque was on average 5.7 times larger (p = .002) and tissue stiffness 2.1 times larger (p = .018) compared to controls. High tissue stiffness was associated with reduced RoM (p < .001). Ratio between neural and non-neural contributors varied substantially within adolescents with CP. Significant associations of SPAT (spasticity test) score with both tissue stiffness and reflexive torque show agreement with clinical phenotype. Conclusions Using an instrumented and model based approach, increased joint stiffness in CP could be mainly attributed to higher reflexive torque compared to control subjects. Ratios between contributors varied substantially within adolescents with CP. Quantitative differentiation of neural and non-neural stiffness contributors in CP allows for assessment of individual patient characteristics and tailoring of therapy. PMID:23880287

Differentiation between non-neural and neural contributors to ankle joint stiffness in cerebral palsy.

PubMed

de Gooijer-van de Groep, Karin L; de Vlugt, Erwin; de Groot, Jurriaan H; van der Heijden-Maessen, Hélène C M; Wielheesen, Dennis H M; van Wijlen-Hempel, Rietje M S; Arendzen, J Hans; Meskers, Carel G M

2013-07-23

Spastic paresis in cerebral palsy (CP) is characterized by increased joint stiffness that may be of neural origin, i.e. improper muscle activation caused by e.g. hyperreflexia or non-neural origin, i.e. altered tissue viscoelastic properties (clinically: "spasticity" vs. "contracture"). Differentiation between these components is hard to achieve by common manual tests. We applied an assessment instrument to obtain quantitative measures of neural and non-neural contributions to ankle joint stiffness in CP. Twenty-three adolescents with CP and eleven healthy subjects were seated with their foot fixated to an electrically powered single axis footplate. Passive ramp-and-hold rotations were applied over full ankle range of motion (RoM) at low and high velocities. Subject specific tissue stiffness, viscosity and reflexive torque were estimated from ankle angle, torque and triceps surae EMG activity using a neuromuscular model. In CP, triceps surae reflexive torque was on average 5.7 times larger (p = .002) and tissue stiffness 2.1 times larger (p = .018) compared to controls. High tissue stiffness was associated with reduced RoM (p < .001). Ratio between neural and non-neural contributors varied substantially within adolescents with CP. Significant associations of SPAT (spasticity test) score with both tissue stiffness and reflexive torque show agreement with clinical phenotype. Using an instrumented and model based approach, increased joint stiffness in CP could be mainly attributed to higher reflexive torque compared to control subjects. Ratios between contributors varied substantially within adolescents with CP. Quantitative differentiation of neural and non-neural stiffness contributors in CP allows for assessment of individual patient characteristics and tailoring of therapy.

Transdermal permeation of WIN 55,212-2 and CP 55,940 in human skin in vitro.

PubMed

Valiveti, Satyanarayana; Kiptoo, Paul K; Hammell, Dana C; Stinchcomb, Audra L

2004-06-18

Synthetic cannabinoids have a promising future as treatments for nausea, appetite modulation, pain, and many neurological disorders. Transdermal delivery is a convenient and desirable dosage form for these drugs and health conditions. The aim of the present study was to investigate the in vitro transdermal permeation of two synthetic cannabinoids, WIN 55,212-2 and CP 55,940. Transdermal flux, drug content in the skin, and lag times were measured in split-thickness human abdominal skin in flow-through diffusion cells with receiver solutions of 4% bovine serum albumin (BSA) or 0.5% Brij 98. Differential thermal analysis (DSC) was performed in order to determine heats of fusion, melting points, and relative thermodynamic activities. The in vitro diffusion studies in 0.5% Brij 98 indicated that WIN 55,212-2 diffuses across human skin faster than CP 55,940. The WIN 55,212-2 skin disposition concentration levels were also significantly higher than that of CP 55,940. Correspondingly, CP 55,940 was significantly metabolized in the skin. WIN 55,212-2 flux and skin disposition were significantly lower into 4% BSA than into 0.5% Brij 98 receiver solutions. There was no significant difference in the flux, lag time, and drug content in the skin of CP 55,940 in 4% BSA versus 0.5% Brij 98 receiver solutions. The DSC studies showed that CP 55,940 had a significantly lower melting point, smaller heat of fusion, and corresponding higher calculated thermodynamic activity than the more crystalline WIN 55,212-2 mesylate salt. The permeation results indicated that WIN 55,212-2 mesylate, CP 55,940, and other potent synthetic cannabinoids with these physicochemical properties could be ideal candidates for the development of a transdermal therapeutic system. Copyright 2004 Elsevier B.V.

eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

PubMed

Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

2014-11-07

We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

Disposition of inhaled 1-chloro-2-propanol in F344/N rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bond, J.A.; Birnbaum, L.S.; Dahl, A.R.

1988-09-30

Propylene chlorohydrins, of which 1-chloro-2-propanol (1-CP) is a constituent, used as intermediates in the manufacture of propylene oxide and have been identified as potential air pollutants. The objective of these studies was to determine whether changes in the inhaled exposure concentration would affect the disposition of 1-CP in rats. In addition, experiments were conducted to identify the carbon atom of 1-CP that is metabolized to CO2. Rats were exposed nose-only to (14C)1-CP for 6 hr to 8.3 +/- 1.0 ppm (26.1 +/- 3.2 micrograms/liter air) or 77 +/- 4 ppm (245 +/- 13 micrograms/liter air) (mean +/- SE). There weremore » two major routes of elimination of 14C, urinary and exhalation of CO2, which together accounted for about 80% of the total 14C in excreta and carcass. Half-times for elimination of 14C in urine as 14CO2 were between 3 and 7 hr with no effect of exposure concentration on the elimination half-times for either route. After the end of exposure, kidneys, livers, trachea, and nasal turbinates contained high concentrations of (14C)1-CP equivalents at both exposure concentrations (30-50 nmol 14C/g tissue for the 8 ppm exposure level and 200-350 nmol 14C/g tissue for the 80 ppm exposure level). Elimination of 14C from tissues was biphasic with about 50% of the material in a tissue being rapidly eliminated with a half-time of 1 to 3 hr and the remaining material slowly eliminated with a half-time of 40 to 80 hr. There was no effect of exposure concentration on elimination half-times in tissues. Major metabolites detected in urine and tissues (liver, kidney, and lung) were N-acetyl-S-(hydroxypropyl)cysteine and/or S-(2-hydroxypropyl)-cysteine. Little unmetabolized 1-CP (less than 1%) was detected in analyzed tissues or urine.« less

Monitoring of body position and motion in children with severe cerebral palsy for 24 hours.

PubMed

Sato, Haruhiko; Iwasaki, Toshiyuki; Yokoyama, Misako; Inoue, Takenobu

2014-01-01

To investigate differences in position and body movements between children with severe cerebral palsy (CP) and children with typical development (TD) during the daytime and while asleep at night. Fifteen children with severe quadriplegic CP living at home (GMFCS level V, 7 males, 8 females; mean age 8 years 3 months; range 3-20 years) and 15 children with TD (6 males, 9 females; mean age 8 years 7 months; range 1-16 years) participated. Body position and movements were recorded for 24 h by a body position monitor and a physical activity monitor, respectively. The amount of time spent in one position and the durations of inactive periods during the daytime and during night-time sleep were computed and analyzed for group differences. In children with CP, the mean longest time spent in one position was longer than that in children with TD during night-time sleep (5.6 ± 3.5 h versus 1.6 ± 1.2 h). In contrast, no significant differences were found between the groups during the daytime (1.9 ± 1.1 h versus 1.6 ± 0.7 h). The mean longest time the body remained inactive was longer in the children with CP during both daytime and nighttime sleep (0.6 ± 0.3 h versus 0.3 ± 0.3 h for daytime, 1.4 ± 0.8 h versus 0.7 ± 0.3 h for nighttime). Children with severe CP living at home showed prolonged immobilized posture during night-time sleep when their caregivers would be likely to also be asleep. This may suggest that these children should receive postural care assistance at night.

Optimization of hepatobiliary phase delay time of Gd-EOB-DTPA-enhanced magnetic resonance imaging for identification of hepatocellular carcinoma in patients with cirrhosis of different degrees of severity.

PubMed

Wu, Jian-Wei; Yu, Yue-Cheng; Qu, Xian-Li; Zhang, Yan; Gao, Hong

2018-01-21

To optimize the hepatobiliary phase delay time (HBP-DT) of Gd-EOB-DTPA-enhanced magnetic resonance imaging (GED-MRI) for more efficient identification of hepatocellular carcinoma (HCC) occurring in different degrees of cirrhosis assessed by Child-Pugh (CP) score. The liver parenchyma signal intensity (LPSI), the liver parenchyma (LP)/HCC signal ratios, and the visibility of HCC at HBP-DT of 5, 10, 15, 20, and 25 min ( i.e ., DT-5, DT-10, DT-15, DT-20, and DT-25 ) after injection of Gd-EOB-DTPA were collected and analyzed in 73 patients with cirrhosis of different degrees of severity (including 42 patients suffering from HCC) and 18 healthy adult controls. The LPSI increased with HBP-DT more significantly in the healthy group than in the cirrhosis group ( F = 17.361, P < 0.001). The LP/HCC signal ratios had a significant difference ( F = 12.453, P < 0.001) among various HBP-DT points, as well as between CP-A and CP-B/C subgroups ( F = 9.761, P < 0.001). The constituent ratios of HCC foci identified as obvious hypointensity (+++), moderate hypointensity (++), and mild hypointensity or isointensity (+/-) kept stable from DT-10 to DT-25: 90.6%, 9.4%, and 0.0% in the CP-A subgroup; 50.0%, 50.0%, and 0.0% in the CP-B subgroup; and 0.0%, 0.0%, and 100.0% in the CP-C subgroup, respectively. The severity of liver cirrhosis has significant negative influence on the HCC visualization by GED-MRI. DT-10 is more efficient and practical than other HBP-DT points to identify most of HCC foci emerging in CP-A cirrhosis, as well as in CP-B cirrhosis; but an HBP-DT of 15 min or longer seems more appropriate than DT-10 for visualization of HCC in patients with CP-C cirrhosis.

New results of the spectral observations of CP stars

NASA Astrophysics Data System (ADS)

Polosukhina, N. S.; Shavrina, A. V.; Drake, N. A.; Kudryavtsev, D. O.; Smirnova, M. A.

2010-04-01

The lithium problem in Ap-CP stars has been, for a long time, a subject of debate. Individual characteristics of CP stars, such as high abundance of the rare-earth elements presence of magnetic fields, complicate structure of the surface distribution of chemical elements, rapid oscillations of some CP-stars, make the detection of the lithium lines and the determination of the lithium abundance, a difficult task. During the International Meeting in Slovakia in 1996, the lithium problem in Ap-CP stars was discussed. The results of the Li study carried out in CrAO Polosukhina (1973-1976), the works of Hack & Faraggiana (1963), Wallerstein & Hack (1964), Faraggiana et al. (1992-1996) formed the basis of the International project ‘Lithium in the cool CP-stars with magnetic fields’. The main goal of the project was, using systematical observations of Ap-CP stars with phase rotation in the spectral regions of the resonance doublet Li I 6708 Å and subordinate 6104 Å lithium lines with different telescopes, to create a database, which will permit to explain the physical origin of anomalous Li abundance in the atmospheres of these stars.

Adsorption and photocatalytic degradation of 2-CP in wastewater onto CS/CoFe₂O ₄ nanocomposite synthesized using gamma radiation.

PubMed

Taleb, Manal F Abou

2014-12-19

Photocatalytic degradation of 2-chlorophenol (2-CP) was studied using the photocatalyst chitosane/CoFe2O4 nanocomposite (CS/CF) under visible light. CS/CF nanocomposites were synthesized via gamma irradiation cross-linking method with the aid of sonication. Physical characteristics of CS/CF were studied using infrared spectrophotometer (IR), scanning electron microscopy (SEM), transmission electron microscope (TEM) and ultraviolet-visible (UV-vis) spectroscopy. Their photocatalytic activity was tested for the degradation of 2-CP in aqueous medium using sunlight. The effect of different parameters such as catalyst concentration, 2-CP concentration and reaction pH on degradation was also examined. It was verified that the 2-CP degradation rate fits a pseudo-first-order kinetics for initial 2-CP concentrations between 25 and 100mg/l, at 30°C. The degradation kinetics fit well Langmuir-Hinshelwood rate law. The degradation of (2-CP) follows pseudo-first-order kinetics. Results showed that after the catalyst had been used 5 times repeatedly, the degradation rate was still above 80%. Copyright © 2014 Elsevier Ltd. All rights reserved.

Avian Species and Functional Diversity in Agricultural Landscapes: Does Landscape Heterogeneity Matter?

PubMed Central

2017-01-01

While the positive relationship between avian diversity and habitat heterogeneity is widely accepted, it is primarily based on observed species richness without accounting for imperfect detection. Other facets of diversity such as functional diversity are also rarely explored. We investigated the avian diversity-landscape heterogeneity relationship in agricultural landscapes by considering two aspects of diversity: taxonomic diversity (species richness) estimated from a multi-species dynamic occupancy model, and functional diversity (functional evenness [FEve] and divergence [FDiv]) based on traits of occurring species. We also assessed how agricultural lands enrolled in a conservation program managed on behalf of declining early successional bird species (hereafter CP38 fields, an agri-environment scheme) influenced avian diversity. We analyzed breeding bird data collected at CP38 fields in Mississippi, USA, during 2010–2012, and two principal components of environmental variables: a gradient of heterogeneity (Shannon’s landscape diversity index) and of the amount of CP38 fields (percent cover of CP38 fields; CP38). FEve did not show significant responses to environmental variables, whereas FDiv responded positively to heterogeneity and negatively to CP38. However, most FDiv values did not significantly differ from random expectations along an environmental gradient. When there was a significant difference, FDiv was lower than that expected. Unlike functional diversity, species richness showed a clear pattern. Species richness increased with increasing landscape heterogeneity but decreased with increasing amounts of CP38 fields. Only one species responded negatively to heterogeneity and positively to CP38. Our results suggest that the relationships between avian diversity and landscape heterogeneity may vary depending on the aspect of diversity considered: strong positive effects of heterogeneity on taxonomic diversity, but weakly positive or non-significant effects on functional diversity. Our results also indicate that effectiveness of CP38 in conserving avian diversity, particularly, taxonomic diversity, could be limited without the consideration of landscape heterogeneity. PMID:28125653

Acute Variceal Bleeding: Does Octreotide Improve Outcomes in Patients with Different Functional Hepatic Reserve?

PubMed

Monreal-Robles, Roberto; Cortez-Hernández, Carlos A; González-González, José A; Abraldes, Juan G; Bosques-Padilla, Francisco J; Silva-Ramos, Héctor N; García-Flores, Jorge A; Maldonado-Garza, Héctor J

2018-01-01

Current guidelines do not differentiate in the utilization of vasoactive drugs in patients with cirrhosis and acute variceal bleeding (AVB) depending on liver disease severity. In this retrospective study, clinical outcomes in 100 patients receiving octreotide plus endoscopic therapy (ET) and 216 patients with ET alone were compared in terms of failure to control bleeding, in-hospital mortality, and transfusion requirements stratifying the results according to liver disease severity by Child-Pugh (CP) score and MELD. In patients with CP-A or those with MELD < 10 octreotide was not associated with a better outcome compared to ET alone in terms of hospital mortality (CP-A: 0.0 vs. 0.0%; MELD < 10: 0.0 vs. 2.9%, p = 1.00), failure to control bleeding (CP-A: 8.7 vs. 3.7%, p = 0.58; MELD < 10: 5.3 vs. 4.3%, p = 1.00) and need for transfusion (CP-A: 39.1 vs. 61.1%, p = 0.09; MELD < 10: 63.2 vs. 62.9%, p = 1.00). Those with severe liver dysfunction in the octreotide group showed better outcomes compared to the non-octreotide group in terms of hospital mortality (CP-B/C: 3.9 vs. 13.0%, p = 0.04; MELD ≥ 10: 3.9 vs. 13.3%, p = 0.03) and need for transfusion (CP-B/C: 58.4 vs. 71.6%, p = 0.05; MELD ≥ 10: 50.6 vs. 72.7%, p < 0.01). In multivariate analysis, octreotide was independently associated with in-hospital mortality (p = 0.028) and need for transfusion (p = 0.008) only in patients with severe liver dysfunction (CP-B/C or MELD ≥ 10). Patients with cirrhosis and AVB categorized as CP-A or MELD < 10 had similar clinical outcomes during hospitalization whether or not they received octreotide.

Half-sandwich rhodium(III) transfer hydrogenation catalysts: Reduction of NAD(+) and pyruvate, and antiproliferative activity.

PubMed

Soldevila-Barreda, Joan J; Habtemariam, Abraha; Romero-Canelón, Isolda; Sadler, Peter J

2015-12-01

Organometallic complexes have the potential to behave as catalytic drugs. We investigate here Rh(III) complexes of general formula [(Cp(x))Rh(N,N')(Cl)], where N,N' is ethylenediamine (en), 2,2'-bipyridine (bpy), 1,10-phenanthroline (phen) or N-(2-aminoethyl)-4-(trifluoromethyl)benzenesulfonamide (TfEn), and Cp(x) is pentamethylcyclopentadienyl (Cp*), 1-phenyl-2,3,4,5-tetramethylcyclopentadienyl (Cp(xPh)) or 1-biphenyl-2,3,4,5-tetramethyl cyclopentadienyl (Cp(xPhPh)). These complexes can reduce NAD(+) to NADH using formate as a hydride source under biologically-relevant conditions. The catalytic activity decreased in the order of N,N-chelated ligand bpy > phen > en with Cp* as the η(5)-donor. The en complexes (1-3) became more active with extension to the Cp(X) ring, whereas the activity of the phen (7-9) and bpy (4-6) compounds decreased. [Cp*Rh(bpy)Cl](+) (4) showed the highest catalytic activity, with a TOF of 37.4±2h(-1). Fast hydrolysis of the chlorido complexes 1-10 was observed by (1)H NMR (<10min at 310K). The pKa* values for the aqua adducts were determined to be ca. 8-10. Complexes 1-9 also catalysed the reduction of pyruvate to lactate using formate as the hydride donor. The efficiency of the transfer hydrogenation reactions was highly dependent on the nature of the chelating ligand and the Cp(x) ring. Competition reactions between NAD(+) and pyruvate for reduction by formate catalysed by 4 showed a preference for reduction of NAD(+). The antiproliferative activity of complex 3 towards A2780 human ovarian cancer cells increased by up to 50% when administered in combination with non-toxic doses of formate, suggesting that transfer hydrogenation can induce reductive stress in cancer cells. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Structural Defects in the Regulatory Particle-Core Particle Interface of the Proteasome Induce a Novel Proteasome Stress Response*

PubMed Central

Park, Soyeon; Kim, Woong; Tian, Geng; Gygi, Steven P.; Finley, Daniel

2011-01-01

Proteasomes consist of a 19-subunit regulatory particle (RP) and 28-subunit core particle (CP), an α7β7β7α7 structure. The RP recognizes substrates and translocates them into the CP for degradation. At the RP-CP interface, a heterohexameric Rpt ring joins to a heteroheptameric CP α ring. Rpt C termini insert individually into the α ring pockets to form a salt bridge with a pocket lysine residue. We report that substitutions of α pocket lysine residues produce an unexpected block to CP assembly, arising from a late stage defect in β ring assembly. Substitutions α5K66A and α6K62A resulted in abundant incorporation of immature CP β subunits, associated with a complete β ring, into proteasome holoenzymes. Incorporation of immature CP into the proteasome depended on a proteasome-associated protein, Ecm29. Using ump1 mutants, we identified Ecm29 as a potent negative regulator of RP assembly and confirmed our previous findings that proper RP assembly requires the CP. Ecm29 was enriched on proteasomes of pocket lysine mutants, as well as those of rpt4-Δ1 and rpt6-Δ1 mutants, in which the C-terminal residue, thought to contact the pocket lysine, is deleted. In both rpt6-Δ1 and α6K62A proteasomes, Ecm29 suppressed opening of the CP substrate translocation channel, which is gated through interactions between Rpt C termini and the α pockets. The ubiquitin ligase Hul5 was recruited to these proteasomes together with Ecm29. Proteasome remodeling through the addition of Ecm29 and Hul5 suggests a new layer of the proteasome stress response and may be a common response to structurally aberrant proteasomes or deficient proteasome function. PMID:21878652

The mRNA-stabilizing factor HuR protein is targeted by β-TrCP protein for degradation in response to glycolysis inhibition.

PubMed

Chu, Po-Chen; Chuang, Hsiao-Ching; Kulp, Samuel K; Chen, Ching-Shih

2012-12-21

The mRNA-stabilizing protein HuR acts a stress response protein whose function and/or protein stability are modulated by diverse stress stimuli through posttranslational modifications. Here, we report a novel mechanism by which metabolic stress facilitates proteasomal degradation of HuR in cancer cells. In response to the glucose transporter inhibitor CG-5, HuR translocates to the cytoplasm, where it is targeted by the ubiquitin E3 ligase β-TrCP1 for degradation. The cytoplasmic localization of HuR is facilitated by PKCα-mediated phosphorylation at Ser-318 as the Ser-318 → alanine substitution abolishes the ability of the resulting HuR to bind PKCα and to undergo nuclear export. The mechanistic link between β-TrCP1 and HuR degradation was supported by the ability of ectopically expressed β-TrCP1 to mimic CG-5 to promote HuR degradation and by the protective effect of dominant negative inhibition of β-TrCP1 on HuR ubiquitination and degradation. Substrate targeting of HuR by β-TrCP1 was further verified by coimmunoprecipitation and in vitro GST pull-down assays and by the identification of a β-TrCP1 recognition site. Although HuR does not contain a DSG destruction motif, we obtained evidence that β-TrCP1 recognizes an unconventional motif, (296)EEAMAIAS(304), in the RNA recognition motif 3. Furthermore, mutational analysis indicates that IKKα-dependent phosphorylation at Ser-304 is crucial to the binding of HuR to β-TrCP1. Mechanistically, this HuR degradation pathway differs from that reported for heat shock and hypoxia, which underlies the complexity in the regulation of HuR turnover under different stress stimuli. The ability of glycolysis inhibitors to target the expression of oncogenic proteins through HuR degradation might foster novel strategies for cancer therapy.

The mRNA-stabilizing Factor HuR Protein Is Targeted by β-TrCP Protein for Degradation in Response to Glycolysis Inhibition*

PubMed Central

Chu, Po-Chen; Chuang, Hsiao-Ching; Kulp, Samuel K.; Chen, Ching-Shih

2012-01-01

The mRNA-stabilizing protein HuR acts a stress response protein whose function and/or protein stability are modulated by diverse stress stimuli through posttranslational modifications. Here, we report a novel mechanism by which metabolic stress facilitates proteasomal degradation of HuR in cancer cells. In response to the glucose transporter inhibitor CG-5, HuR translocates to the cytoplasm, where it is targeted by the ubiquitin E3 ligase β-TrCP1 for degradation. The cytoplasmic localization of HuR is facilitated by PKCα-mediated phosphorylation at Ser-318 as the Ser-318 → alanine substitution abolishes the ability of the resulting HuR to bind PKCα and to undergo nuclear export. The mechanistic link between β-TrCP1 and HuR degradation was supported by the ability of ectopically expressed β-TrCP1 to mimic CG-5 to promote HuR degradation and by the protective effect of dominant negative inhibition of β-TrCP1 on HuR ubiquitination and degradation. Substrate targeting of HuR by β-TrCP1 was further verified by coimmunoprecipitation and in vitro GST pull-down assays and by the identification of a β-TrCP1 recognition site. Although HuR does not contain a DSG destruction motif, we obtained evidence that β-TrCP1 recognizes an unconventional motif, 296EEAMAIAS304, in the RNA recognition motif 3. Furthermore, mutational analysis indicates that IKKα-dependent phosphorylation at Ser-304 is crucial to the binding of HuR to β-TrCP1. Mechanistically, this HuR degradation pathway differs from that reported for heat shock and hypoxia, which underlies the complexity in the regulation of HuR turnover under different stress stimuli. The ability of glycolysis inhibitors to target the expression of oncogenic proteins through HuR degradation might foster novel strategies for cancer therapy. PMID:23115237

Avian Species and Functional Diversity in Agricultural Landscapes: Does Landscape Heterogeneity Matter?

PubMed

Lee, Myung-Bok; Martin, James A

2017-01-01

While the positive relationship between avian diversity and habitat heterogeneity is widely accepted, it is primarily based on observed species richness without accounting for imperfect detection. Other facets of diversity such as functional diversity are also rarely explored. We investigated the avian diversity-landscape heterogeneity relationship in agricultural landscapes by considering two aspects of diversity: taxonomic diversity (species richness) estimated from a multi-species dynamic occupancy model, and functional diversity (functional evenness [FEve] and divergence [FDiv]) based on traits of occurring species. We also assessed how agricultural lands enrolled in a conservation program managed on behalf of declining early successional bird species (hereafter CP38 fields, an agri-environment scheme) influenced avian diversity. We analyzed breeding bird data collected at CP38 fields in Mississippi, USA, during 2010-2012, and two principal components of environmental variables: a gradient of heterogeneity (Shannon's landscape diversity index) and of the amount of CP38 fields (percent cover of CP38 fields; CP38). FEve did not show significant responses to environmental variables, whereas FDiv responded positively to heterogeneity and negatively to CP38. However, most FDiv values did not significantly differ from random expectations along an environmental gradient. When there was a significant difference, FDiv was lower than that expected. Unlike functional diversity, species richness showed a clear pattern. Species richness increased with increasing landscape heterogeneity but decreased with increasing amounts of CP38 fields. Only one species responded negatively to heterogeneity and positively to CP38. Our results suggest that the relationships between avian diversity and landscape heterogeneity may vary depending on the aspect of diversity considered: strong positive effects of heterogeneity on taxonomic diversity, but weakly positive or non-significant effects on functional diversity. Our results also indicate that effectiveness of CP38 in conserving avian diversity, particularly, taxonomic diversity, could be limited without the consideration of landscape heterogeneity.

Nutritional and endocrinologic evaluation of patients with craniopharyngioma.

PubMed

Nogueira, Mônica Cristina; Berbel Júnior, Alfredo Sérgio; Koenigkam-Santos, Marcel; Moreira, Ayrton Custódio; Nonino, Carla Barbosa; de Castro, Margaret

2015-12-01

Lesions of hypothalamus or adjacent brain structures by the craniopharyngioma (CP) and/or its treatment, as well as changes in orexigenic and anorexigenic hormones, are possible pathogenic factors for the obesity observed in CP patients. This study assessed anthropometric measurements, food intake, and biochemical markers of CP patients. Weight, height, skinfold thicknesses, circumferences, body composition, food intake evaluation, basal glucose, lipids, insulin, ghrelin, PYY, and HOMA-IR calculation were obtained from CP children (n = 10, 4F, aged 12 ± 4.2yr) and CP adults (n = 27,13F aged 42 ± 13 yr) and from 32 gender and age matched controls. Overweight/obesity was observed in 51.4% of the patients at the diagnosis and increased to 86.5% at the time of the study. Obesity was more frequent in patients with grade 2 hypothalamic involvement. Most anthropometric measurements were similar in patients and controls. Caloric intake was lower in CP adults, without difference between children. Lipid intake was higher in CP patients. Carbohydrate and protein intakes were lower in CP children, with no difference between adult groups. There were no differences in micronutrients intake as well as in insulin and PYY levels, and HOMA-IR between patients and controls. HDL-c was lower in CP adults and ghrelin higher in CP children. There is a high rate of overweight/obesity in CP patients at the diagnosis and throughout the follow-up period. Obesity was associated with degree of hypothalamic involvement but not with caloric intake. Obesity and a lipid rich diet may have contributed to the dyslipidemia observed in CP patients. Copyright © 2015 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

Neural responses to fearful eyes in children with conduct problems and varying levels of callous-unemotional traits.

PubMed

Sebastian, C L; McCrory, E J; Dadds, M R; Cecil, C A M; Lockwood, P L; Hyde, Z H; De Brito, S A; Viding, E

2014-01-01

Children with conduct problems (CP) are a heterogeneous group. Those with high levels of callous-unemotional traits (CP/HCU) appear emotionally under-reactive at behavioural and neural levels whereas those with low levels of CU traits (CP/LCU) appear emotionally over-reactive, compared with typically developing (TD) controls. Investigating the degree to which these patterns of emotional reactivity are malleable may have important translational implications. Instructing participants with CP/HCU to focus on the eyes of fearful faces (i.e. the most salient feature) can ameliorate their fear-recognition deficits, but it is unknown whether this is mediated by amygdala response. It is also unknown whether focusing on fearful eyes is associated with increased amygdala reactivity in CP/LCU. Functional magnetic resonance imaging (fMRI) was used to measure neural responses to fearful and calm faces in children with CP/HCU, CP/LCU and TD controls (n = 17 per group). On half of trials participants looked for a blue dot anywhere within target faces; on the other half, participants were directed to focus on the eye region. Reaction time (RT) data showed that CP/LCU were selectively slowed in the fear/eyes condition. For the same condition, CP/LCU also showed increased amygdala and subgenual anterior cingulate cortex (sgACC)/orbitofrontal cortex (OFC) responses compared with TD controls. RT and amygdala response to fear/eyes were correlated in CP/LCU only. No effects of focusing on the eye region were observed in CP/HCU. These data extend the evidence base suggesting that CU traits index meaningful heterogeneity in conduct problems. Focusing on regulating reactive emotional responses may be a fruitful strategy for children with CP/LCU.

L-Carnitine halts apoptosis and myelosuppression induced by carboplatin in rat bone marrow cell cultures (BMC).

PubMed

Abd-Allah, Adel R A; Al-Majed, Abdulhakeem A; Al-Yahya, Abdulaziz A; Fouda, Soliman I; Al-Shabana, Othman A

2005-07-01

Carboplatin (CP), a second generation platinum compound, is effective against various types of cancers, producing less nephrotoxicity and ototoxicity but more myelotoxicity than cisplatinum. CP-myelosuppression is the rate-limiting step of its clinical use. Prevention of CP-myelosuppression is a major target in the field of chemotherapy. Therefore, the present study investigates the use of L-carnitine (LCR)-an antioxidant, cardioprotective, neuroprotective, and immunostimulant nontoxic natural compound-to protect against CP-induced myelosuppression. The viability of BMC was studied using a trypan blue exclusion technique following incubation with CP and/or LCR as a function of time and concentration. Apoptosis was tested for by detecting the amount of DNA fragmentation and the visualization of DNA ladders upon gel electrophoresis. Bone marrow progenitor cell function was examined by colony forming unit assay. Cellular contents of glutathione (GSH) and malondialdehyde (MDA) were also estimated. Results revealed that LC50 of CP is 4.7 mM and the highest safe concentration of LCR is 5 mM. Co-exposure of LCR+CP rescued BMC viability by 37% compared to the CP-treated cultures. The LCR halts CP-induced apoptosis and it significantly improves the function of the bone marrow progenitors by increasing the number of colony-forming units as a response to granulocyte/macrophage colony stimulating factors. Finally, LCR restores CP-induced GSH depletion and prevents MDA elevation in BMC. In summary, the results suggest that LCR is able to protect against CP-induced myelosuppression, which suggests its use as an adjuvant therapy. This finding merits further investigation into the mechanism(s) of such protection as well as its interaction with CP antitumor activity.

[Clinical symptoms in 35 children and adolescents with craniopharyngeoma at the time of diagnosis].

PubMed

Rohrer, T; Gassmann, K; Buchfelder, M; Wenzel, D; Fahlbusch, R; Dörr, H G

2002-01-01

Hormonal deficiencies, visual disturbances, or cerebral symptoms are often the symptoms through which craniopharyngiomas (CP) first become clinically manifest. As these symptoms can exist for a long period of time various specialists are often consulted before the final diagnosis is made. Between the years 1970 and 1998, 37 children and adolescents with CP were treated in Erlangen. The documents of 35 patients (22 male, 13 female) were evaluated retrospectively. The median age of the children at diagnosis was 9,3 years (1,3 - 15,6 years). The most frequently documented symptoms were: headache 57 % (median duration 7 months; varying from 1 week to 6 years), visual disturbances 45 % (median duration 2 months, range 2 weeks to 10 years), and reduced growth 40 % (median duration 1 year, range 3 months to 5 years). On average the reported symptoms were present for 15 months (median 5 months, time span 1 week to 10 years). The clinical symptoms of CP are non-specific and highly varied. Endocrine disturbances are the primary objective finding. Correct interpretation of the symptoms are required for the early diagnosis of CP.

Texas Red transport across rat and dogfish shark (Squalus acanthias) choroid plexus.

PubMed

Reichel, Valeska; Miller, David S; Fricker, Gert

2008-10-01

Confocal microscopy and image analysis were used to compare driving forces, specificity, and regulation of transport of the fluorescent organic anion, Texas Red (sulforhodamine 101 free acid; TR), in lateral choroid plexus (CP) isolated from rat and an evolutionarily ancient vertebrate, dogfish shark (Squalus acanthias). CP from both species exhibited concentrative, specific, and metabolism-dependent TR transport from bath to subepithelial/vascular space; at steady state, TR accumulation in vascular/subepithelial space was substantially higher than in epithelial cells. In rat CP, steady-state TR accumulation in subepithelial/vascular spaces was reduced by Na(+)-replacement, but was not affected by a 10-fold increase in buffer K(+). In shark CP, Na(+)-replacement did not alter TR accumulation in either tissue compartment; subepithelial/vascular space levels of TR were reduced in high-K(+) medium. In both species, steady-state TR accumulation was not affected by p-aminohippurate or leukotriene C4, suggesting that neither organic anion transporters (SLC22A family) nor multidrug resistance-associated proteins (ABCC family) contributed. In rat CP, digoxin was without effect, indicating that organic anion transporting polypeptide isoform 2 was not involved. Several organic anions reduced cellular and subepithelial/vascular space TR accumulation in both tissues, including estrone sulfate, taurocholate, and the Mrp1 inhibitor MK571. In rat CP, TR accumulation in subepithelial/vascular spaces increased with PKA activation (forskolin), but was not affected by PKC activation (phorbol ester). In shark, neither PKA nor PKC activation specifically affected TR transport. Thus, rat and dogfish shark CP transport TR but do so using different basic mechanisms that respond to different regulatory signals.

Association between F508 deletion in CFTR and chronic pancreatitis risk.

PubMed

Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

2017-09-01

The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

Enhancement of infectious disease vaccines through TLR9-dependent recognition of CpG DNA.

PubMed

McCluskie, M J; Krieg, A M

2006-01-01

The adaptive immune system-with its remarkable ability to generate antigen-specific antibodies and T lymphocytes against pathogens never before "seen" by an organism-is one of the marvels of evolution. However, to generate these responses, the adaptive immune system requires activation by the innate immune system. Toll-like receptors (TLRs) are perhaps the best-understood family of innate immune receptors for detecting infections and stimulating adaptive immune responses. TLR9 appears to have evolved to recognize infections by a subtle structural difference between eukaryotic and prokaryotic/viral DNA; only the former frequently methylates CpG dinucleotides. Used as vaccine adjuvants, synthetic oligodeoxynucleotide (ODN) ligands for TLR9--CpG ODN--greatly enhance the speed and strength of the immune responses to vaccination.

Dependence of particle volume fraction on sound velocity and attenuation of EPDM composites.

PubMed

Kim, K S; Lee, K I; Kim, H Y; Yoon, S W; Hong, S H

2007-05-01

The sound velocity and the attenuation coefficient of EPDM (Ethylene-propylene Diene Monomer) composites incorporated with Silicon Carbide particles (SiCp's) of various volume fractions (0-40%) were experimentally and theoretically investigated. For the experiment a through-transmission technique was used. For the theoretical prediction, some mechanical property models such as Reuss model and Coherent Potential Approximation (CPA) model etc. were employed. The experimental results showed that the sound velocity decreased with the increase of the SiCp volume fraction up to 30% and then increased with the 40 vol% specimen. The attenuation coefficient was increased with the increasing SiCp volume fractions. The modified Reuss model with a longitudinal elastic modulus predicted most well the experimental sound velocity and elastic modulus results.

Survey of the Frequency Dependent Latitudinal Distribution of the Fast Magnetosonic Wave Mode from Van Allen Probes Electric and Magnetic Field Instrument and Integrated Science Waveform Receiver Plasma Wave Analysis

NASA Technical Reports Server (NTRS)

Boardsen, Scott A.; Hospodarsky, George B.; Kletzing, Craig A.; Engebretson, Mark J.; Pfaff, Robert F.; Wygant, John R.; Kurth, William S.; Averkamp, Terrance F.; Bounds, Scott R.; Green, Jim L.;

Studies of the Seriousness of Three Threats to Passage Dependence.

ERIC Educational Resources Information Center

Hanna, Gerald S.; Oaster, Thomas R.

1980-01-01

Certain kinds of multiple-choice reading comprehension questions may be answered correctly at the higher-than-chance level when they are administered without the accompanying passage. These high risk questions do not necessarily lead to passage dependence invalidity. They threaten but do not prove invalidity. (Author/CP)

Effects of ractopamine hydrochloride and dietary protein content on performance, carcass traits and meat quality of Nellore bulls.

PubMed

Cônsolo, N R B; Mesquita, B S; Rodriguez, F D; Rizzi, V G; Silva, L F P

2016-03-01

Ractopamine hydrochloride (RH) alters protein metabolism and improves growth performance in Bos taurus cattle with high carcass fat. Our objective was to evaluate the effects of RH, dietary CP and RH×CP interaction on performance, blood metabolites, carcass characteristics and meat quality of young Nellore bulls. A total of 48 bulls were randomly assigned to four treatments in a 2×2 factorial arrangement. The factors were two levels of dietary CP (100% and 120% of metabolizable protein requirement, defined as CP100 and CP120, respectively), and two levels of RH (0 and 300 mg/animal·per day). Treated animal received RH for the final 35 days before slaughter. Animals were weighed at the beginning of the feedlot period (day 63), at the beginning of ractopamine supplementation (day 0), after 18 days of supplementation (day 18) and before slaughter (day 34). Animals were slaughtered and hot carcass weights recorded. After chilling, carcass data was collected and longissimus samples were obtained for determination of meat quality. The 9-11th rib section was removed for carcass composition analysis. Supplementation with RH increased ADG independently of dietary CP. There was a RH×CP interaction on dry matter intake (DMI), where RH reduced DMI at CP120, with no effect at CP100. Ractopamine improved feed efficiency, without RH×CP interaction. Ractopamine had no effect on plasma creatinine and urea concentration. Greater dietary CP tended to increase blood urea, and there was a RH×CP interaction for plasma total protein. Ractopamine supplementation increased plasma total protein at CP120, and had no effect at CP100. Ractopamine also decreased plasma glucose concentration at CP100, but had no effect at CP120. Ractopamine increased alkaline phosphatase activity at CP120 and had no effect at CP100. There was a tendency for RH to increase longissimus muscle area, independently of dietary CP. Ractopamine did not alter fat thickness; however, fat thickness was reduced by greater CP in the diet. Supplementation with RH decreased meat shear force, but only at day 0 of aging, having no effect after 7, 14 or 21 days. Greater dietary protein increased meat shear force after 0 and 7 days of aging, with no effect after 14 or 21 days. These results demonstrate for the first time the efficacy of ractopamine supplementation to improve gain and feed efficiency of intact Bos indicus males, with relatively low carcass fat content. Ractopamine effects were not further improved by increasing dietary protein content above requirements.

Direct observation of electron emission and recombination processes by time domain measurements of charge pumping current

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Masahiro, E-mail: hori@eng.u-toyama.ac.jp; Watanabe, Tokinobu; Ono, Yukinori

2015-01-26

To analyze the charge pumping (CP) sequence in detail, the source/drain electron current and the substrate hole current under the CP mode of transistors are simultaneously monitored in the time domain. Peaks are observed in both the electron and hole currents, which are, respectively, attributed to the electron emission from the interface defects and to the recombination with holes. The peak caused by the electron emission is found to consist of two components, strongly suggesting that the present time-domain measurement can enable us to resolve different kinds of interface defects. Investigating the correlation between the number of emitted and recombinedmore » electrons reveals that only one of the two components contributes to the CP current for the gate-pulse fall time from 6.25 × 10{sup −4} to 1.25 × 10{sup −2} s.« less

Emergent literacy activities, instructional adaptations and school absence of children with cerebral palsy in special education.

PubMed

Peeters, Marieke; de Moor, Jan; Verhoeven, Ludo

2011-01-01

The goal of the present study was to get an overview of the emergent literacy activities, instructional adaptations and school absence of children with cerebral palsy (CP) compared to normally developing peers. The results showed that there were differences between the groups regarding the amount of emergent literacy instruction. While time dedicated to storybook reading and independent picture-book reading was comparable, the children with CP received fewer opportunities to work with educational software and more time was dedicated to rhyming games and singing. For the children with CP, the level of speech, intellectual, and physical impairments were all related to the amount of time in emergent literacy instruction. Additionally, the amount of time reading precursors is trained and the number of specific reading precursors that is trained is all related to skills of emergent literacy. Copyright © 2010 Elsevier Ltd. All rights reserved.

Both p62/SQSTM1-HDAC6-dependent autophagy and the aggresome pathway mediate CDK1 degradation in human breast cancer.

PubMed

Galindo-Moreno, María; Giráldez, Servando; Sáez, Carmen; Japón, Miguel Á; Tortolero, Maria; Romero, Francisco

2017-08-30

Cyclin-dependent kinase 1 (CDK1) is the central mammalian regulator of cell proliferation and a promising therapeutic target for breast cancer. In fact, CDK1 inhibition downregulates survival and induces apoptosis. Due to its essential role, CDK1 expression and activity are strictly controlled at various levels. We previously described that CDK1 stability is also regulated and that SCF(βTrCP) ubiquitinates CDK1, which is degraded via the lysosomal pathway. In addition, in breast tumors from patients, we found a negative correlation between CDK1 accumulation and βTrCP levels, and a positive correlation with the degree of tumor malignancy. This prompted us to study the molecular mechanism involved in CDK1 clearance. In this report, we determine that both chemotherapeutic agents and proteolytic stress induce CDK1 degradation in human breast cancer MCF7 cells through p62/HDAC6-mediated selective autophagy. On the one hand, CDK1 binds to p62/SQSTM1-LC3 and, on the other hand, it interacts with HDAC6. Both complexes are dependent on the presence of an intact βTrCP-binding motif on CDK1. Furthermore, we also show that CDK1 is recruited to aggresomes in response to proteasome inhibition for an extended period. We propose CDK1 clearance as a potential predictive biomarker of antitumor treatment efficacy.

Epigenetic inactivation of CHFR in human tumors

PubMed Central

Toyota, Minoru; Sasaki, Yasushi; Satoh, Ayumi; Ogi, Kazuhiro; Kikuchi, Takefumi; Suzuki, Hiromu; Mita, Hiroaki; Tanaka, Nobuyuki; Itoh, Fumio; Issa, Jean-Pierre J.; Jair, Kam-Wing; Schuebel, Kornel E.; Imai, Kohzoh; Tokino, Takashi

2003-01-01

Cell-cycle checkpoints controlling the orderly progression through mitosis are frequently disrupted in human cancers. One such checkpoint, entry into metaphase, is regulated by the CHFR gene encoding a protein possessing forkhead-associated and RING finger domains as well as ubiquitin–ligase activity. Although defects in this checkpoint have been described, the molecular basis and prevalence of CHFR inactivation in human tumors are still not fully understood. To address this question, we analyzed the pattern of CHFR expression in a number of human cancer cell lines and primary tumors. We found CpG methylation-dependent silencing of CHFR expression in 45% of cancer cell lines, 40% of primary colorectal cancers, 53% of colorectal adenomas, and 30% of primary head and neck cancers. Expression of CHFR was precisely correlated with both CpG methylation and deacetylation of histones H3 and H4 in the CpG-rich regulatory region. Moreover, CpG methylation and thus silencing of CHFR depended on the activities of two DNA methyltransferases, DNMT1 and DNMT3b, as their genetic inactivation restored CHFR expression. Finally, cells with CHFR methylation had an intrinsically high mitotic index when treated with microtubule inhibitor. This means that cells in which CHFR was epigenetically inactivated constitute loss-of-function alleles for mitotic checkpoint control. Taken together, these findings shed light on a pathway by which mitotic checkpoint is bypassed in cancer cells and suggest that inactivation of checkpoint genes is much more widespread than previously suspected. PMID:12810945

Effect of alkaline treatment of pure titanium and its alloys on the bonding strength of dental veneering resins.

PubMed

Ban, Seiji

2003-07-01

Commercially pure titanium (cpTi), Ti6Al4V, an experimental beta-type titanium (Ti 53.4 wt%, Nb 29 wt %, Ta 13 wt %, and Zr 4.6 wt %), and 12% AuPdAg alloy plates were sandblasted, cleaned in water, and dried. cpTi plates were treated with nine alkaline treatments that differed in the type of alkali, alkaline concentration, soaking temperature, soaking time, and heating temperature. cpTi plates that were only sandblasted or sandblasted and oxidized at 600 degrees C for 1 h in air were also prepared. Finally, the bonding strengths of 11 kinds of surface-treated cpTi to resin were measured using a pull-shear bonding method after immersion in physiologic saline solution at 37 degrees C for 24 h. The bonds of the standard alkaline-treated cpTi and two titanium alloys to resins were 1.5-1.9 times stronger than those of sandblasted specimens (p < 0.01), but no significant effects of the alkaline treatment were observed on the 12% AuPdAg alloy. The greatest bonding strengths were found for cpTi treated with NaOH and KOH and then heated at 600 degrees C (p < 0.01). In conclusion, alkaline treatment is a simple, effective surface modification of titanium that improves bonding to veneering resin. Copyright 2003 Wiley Periodicals, Inc.

Strengthening Mechanisms in Nanostructured Al/SiCp Composite Manufactured by Accumulative Press Bonding

NASA Astrophysics Data System (ADS)

Amirkhanlou, Sajjad; Rahimian, Mehdi; Ketabchi, Mostafa; Parvin, Nader; Yaghinali, Parisa; Carreño, Fernando

2016-10-01

The strengthening mechanisms in nanostructured Al/SiCp composite deformed to high strain by a novel severe plastic deformation process, accumulative press bonding (APB), were investigated. The composite exhibited yield strength of 148 MPa which was 5 and 1.5 times higher than that of raw aluminum (29 MPa) and aluminum-APB (95 MPa) alloys, respectively. A remarkable increase was also observed in the ultimate tensile strength of Al/SiCp-APB composite, 222 MPa, which was 2.5 and 1.2 times greater than the obtained values for raw aluminum (88 MPa) and aluminum-APB (180 MPa) alloys, respectively. Analytical models well described the contribution of various strengthening mechanisms. The contributions of grain boundary, strain hardening, thermal mismatch, Orowan, elastic mismatch, and load-bearing strengthening mechanisms to the overall strength of the Al/SiCp microcomposite were 64.9, 49, 6.8, 2.4, 5.4, and 1.5 MPa, respectively. Whereas Orowan strengthening mechanism was considered as the most dominating strengthening mechanism in Al/SiCp nanocomposites, it was negligible for strengthening the microcomposite. Al/SiCp nanocomposite showed good agreement with quadratic summation model; however, experimental results exhibited good accordance with arithmetic and compounding summation models in the microcomposite. While average grain size of the composite reached 380 nm, it was less than 100 nm in the vicinity of SiC particles as a result of particle-stimulated nucleation mechanism.

Diabetes confers in vitro calcific potential on serum which associates with in vivo vascular calcification.

PubMed

Patidar, Ashish; Singh, Dhruv K; Thakur, Shori; Winocour, Peter; Farrington, Ken; Baydoun, Anwar R

2017-05-01

Although vascular calcification (VC) is prevalent in Type 2 diabetes mellitus (T2DM), underlying mechanisms remain unclear. Neither is it known whether T2DM confers calcific potential (CP) on serum, enabling it to induce VC outside the disease milieu. We, therefore, investigated the CP of serum from controls and subjects with T2DM with and without in vivo VC . Samples from 20 healthy controls and 44 age- and sex-matched patients with T2DM with modification of diet in renal disease estimated glomerular filtration rate (MDRD-4 eGFR) > 60 ml·min -1 were analysed for CP using rat aortic smooth muscle cells in vitro CT scans of femoral arteries identified individuals with in vivo calcification. Serum from subjects with T2DM revealed significantly greater CP than controls. This was further enhanced in the presence of in vivo VC. Addition of β-glycerophosphate (β-GP) plus CaCl 2 increased the CP of T2DM serum but not of controls. Along with age, CP was an independent predictor of the presence of VC. In receiver operator curve (ROC) analysis, CP was a significant predictor of femoral arterial VC (C-statistic 0.70: P =0.009). The distribution of CP was bimodal around a cutoff of 100 nmoles of Ca 2+ protein mg -1 , with a higher proportion of Type 2 diabetes subjects with in vivo calcification (T2DM+) sera above the cutoff value. This group also showed elevated levels of osteoprotegerin (OPG) and matrix Gla protein (MGP). Diabetes confers CP on the serum which is enhanced by the presence of in vivo VC. The CP acquired may be dependent on levels of OPG and MGP. These findings may be clinically relevant for early identification of individuals at risk of VC and for informing therapeutic strategies. © 2017 The Author(s). published by Portland Press Limited on behalf of the Biochemical Society.

CB1 Knockout Mice Unveil Sustained CB2-Mediated Antiallodynic Effects of the Mixed CB1/CB2 Agonist CP55,940 in a Mouse Model of Paclitaxel-Induced Neuropathic Pain.

PubMed

Deng, Liting; Cornett, Benjamin L; Mackie, Ken; Hohmann, Andrea G

2015-07-01

Cannabinoids suppress neuropathic pain through activation of cannabinoid CB1 and/or CB2 receptors; however, unwanted CB1-mediated cannabimimetic effects limit clinical use. We asked whether CP55,940 [(-)-3-[2-hydroxy-4-(1,1-dimethylheptyl)phenyl]-4-(3-hydroxypropyl)cyclohexanol], a potent cannabinoid that binds with similar affinity to CB1 and CB2 in vitro, produces functionally separable CB1- and CB2-mediated pharmacological effects in vivo. We evaluated antiallodynic effects, possible tolerance, and cannabimimetic effects (e.g., hypothermia, catalepsy, CB1-dependent withdrawal signs) after systemic CP55,940 treatment in a mouse model of toxic neuropathy produced by a chemotherapeutic agent, paclitaxel. The contribution of CB1 and CB2 receptors to in vivo actions of CP55,940 was evaluated using CB1 knockout (KO), CB2KO, and wild-type (WT) mice. Low-dose CP55,940 (0.3 mg/kg daily, i.p. ) suppressed paclitaxel-induced allodynia in WT and CB2KO mice, but not CB1KO mice. Low-dose CP55,940 also produced hypothermia and rimonabant-precipitated withdrawal in WT, but not CB1KO, mice. In WT mice, tolerance developed to CB1-mediated hypothermic effects of CP55,940 earlier than to antiallodynic effects. High-dose CP55,940 (10 mg/kg daily, i.p.) produced catalepsy in WT mice, which precluded determination of antiallodynic efficacy but produced sustained CB2-mediated suppression of paclitaxel-induced allodynia in CB1KO mice; these antiallodynic effects were blocked by the CB2 antagonist 6-iodopravadoline (AM630). High-dose CP55,940 did not produce hypothermia or rimonabant-precipitated withdrawal in CB1KO mice. Our results using the mixed CB1/CB2 agonist CP55,940 document that CB1 and CB2 receptor activations produce mechanistically distinct suppression of neuropathic pain. Our study highlights the therapeutic potential of targeting cannabinoid CB2 receptors to bypass unwanted central effects associated with CB1 receptor activation. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Pt/Mo 2C/C-cp as a highly active and stable catalyst for ethanol electrooxidation

DOE PAGES

Lin, Lili; Sheng, Wenchao; Yao, Siyu; ...

2017-02-09

Here, a Pt/Mo 2C/C-cp electrocatalyst with optimized Pt-Mo 2C chemical bonding is synthesized and evaluated for the ethanol oxidation reaction (EOR). The chemical bonding of Mo 2C to Pt particles renders exceptional EOR activity at low potentials, which is 15 and 2.5 times higher than Pt/C and commercial 40% PtRu/C, respectively, at 0.6 V (vs. RHE). The stability of the Pt/Mo 2C/C-cp electrocatalyst is comparable to the commercial 40% PtRu/C catalyst. CO stripping test demonstrates the existence of highly active sites for CO oxidation on the Pt/Mo 2C/C-cp catalyst. In-situ infrared spectroscopic studies of EOR reveal that the excellent anti-poisoningmore » ability of the Pt/Mo 2C/C-cp catalyst is related to the relatively weak binding of carbonyl intermediates over the Pt/Mo 2C/C-cp catalysts.« less

Pt/Mo 2C/C-cp as a highly active and stable catalyst for ethanol electrooxidation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Lili; Sheng, Wenchao; Yao, Siyu

Here, a Pt/Mo 2C/C-cp electrocatalyst with optimized Pt-Mo 2C chemical bonding is synthesized and evaluated for the ethanol oxidation reaction (EOR). The chemical bonding of Mo 2C to Pt particles renders exceptional EOR activity at low potentials, which is 15 and 2.5 times higher than Pt/C and commercial 40% PtRu/C, respectively, at 0.6 V (vs. RHE). The stability of the Pt/Mo 2C/C-cp electrocatalyst is comparable to the commercial 40% PtRu/C catalyst. CO stripping test demonstrates the existence of highly active sites for CO oxidation on the Pt/Mo 2C/C-cp catalyst. In-situ infrared spectroscopic studies of EOR reveal that the excellent anti-poisoningmore » ability of the Pt/Mo 2C/C-cp catalyst is related to the relatively weak binding of carbonyl intermediates over the Pt/Mo 2C/C-cp catalysts.« less

Fluid viscosity affects the fragmentation and inertial cavitation threshold of lipid encapsulated microbubbles

PubMed Central

Helfield, Brandon; Black, John J.; Qin, Bin; Pacella, John; Chen, Xucai; Villanueva, Flordeliza S.

2015-01-01

Ultrasound and microbubble optimization studies for therapeutic applications are often conducted in water/saline, with a fluid viscosity of 1 cP. In an in vivo context, microbubbles are situated in blood, a more viscous fluid (~4 cP). In this study, ultra-high speed microscopy and passive cavitation approaches were employed to investigate the effect of fluid viscosity on microbubble behavior at 1 MHz subject to high pressures (0.25 – 2 MPa). The propensity for individual microbubble (n=220) fragmentation was shown to significantly decrease in 4 cP fluid as compared to 1 cP fluid, despite achieving similar maximum radial excursions. Microbubble populations diluted in 4 cP fluid exhibited decreased wideband emissions (up to 10.2 times), and increasingly distinct harmonic emission peaks (e.g. ultraharmonic) with increasing pressure as compared to 1 cP fluid. These results suggest that in vitro studies should consider an evaluation using physiologic viscosity perfusate before transitioning to in vivo evaluations. PMID:26674676

Changes in Mobility of Children with Cerebral Palsy over Time and across Environmental Settings

ERIC Educational Resources Information Center

Tieman, Beth L.; Palisano, Robert J.; Gracely, Edward J.; Rosenbaum, Peter L.; Chiarello, Lisa A.; O'Neil, Margaret E.

2004-01-01

This study examined changes in mobility methods of children with cerebral palsy (CP) over time and across environmental settings. Sixty-two children with CP, ages 6-14 years and classified as levels II-IV on the Gross Motor Function Classification System, were randomly selected from a larger data base and followed for three to four years. On each…

13C-NMR spectra and contact time experiment for Skjervatjern fulvic and humic acids

USGS Publications Warehouse

Malcolm, R.L.

1992-01-01

The T(CP) and T(1p) time constants for Skjervatjern fulvic and humic acids were determined to be short with T(CP) values ranging from 0.14 ms to 0.53 ms and T(1p) values ranging from 3.3 ms to 5.9 ms. T(CP) or T(1p) time constants at a contact time of 1 ms are favorable for quantification of 13C-NMR spectra. Because of the short T(CP) values, correction factors for signal intensity for various regions of the 13C-NMR spectra would be necessary at contact times greater than 1.1 ms or less than 0.9 ms. T(CP) and T(1p) values have a limited non-homogeneity within Skjervatjern fulvic and humic acids. A pulse delay or repeat time of 700 ms is more than adequate for quantification of these 13C-NMR spectra. Paramagnetic effects in these humic substances are precluded due to low inorganic ash contents, low contents of Fe, Mn, and Co, and low organic free-radical contents. The observed T(CP) values suggest that all the carbon types in Skjervatjern fulvic and humic acids are fully cross-polarized before significant proton relaxation occurs. The 13C-NMR spectra for Skjervatjern fulvic acid is similar to most aquatic fulvic acids as it is predominantly aliphatic, low in aromaticity (fa1 = 24), low in phenolic content, high in carboxyl content, and has no resolution of a methoxyl peak. The 13C-NMR spectra for Skjervatjern humic acid is also similar to most other aquatic humic acids in that it is also predominantly aliphatic, high in aromaticity (fa1 = 38), moderate in phenolic content, moderate in carboxyl content, and has a clear resolution of a methoxyl carbon region. After the consideration of the necessary 13C-NMR experimental conditions, these spectra are considered to be quantitative. With careful consideration of the previously determined 13C-NMR experimental conditions, quantitative spectra can be obtained for humic substances in the future from the HUMEX site. Possible changes in humic substances due to acidification should be determined from 13C-NMR data.