Detection of heavy metal resistance bioluminescence bacteria using microplate bioassay method.

PubMed

Ranjitha, P; Karthy, E S

2012-01-01

Effects of different heavy metals on Vibrio harveyi, V. fischeri, Photobacterium phosphoreum and P. leiognathi were examined. Checkerboard assay was used for the detection of the natural metal tolerance levels of a large number of marine luminous eubacteria. 57 strains of luminous bacteria were investigated for their natural patterns of heavy metal tolerance. The behaviors of these strains were not homogeneous with respect to all metals tested, even within the strains belonging to the same genus. At least 1 to 4 different MICs were detected for every metal except barium and cobalt. Isolated bacteria were tested for the presence of plasmids using the modified alkaline lysis method, was effective for identification of plasmids of different sizes. This study revealed the frequency of the occurrence of plasmids in heavy metal resistance bacteria and inferred that plasmids are highly ubiquitous and predominant in most heavy metal resistant bacteria.

Effect of mental stress on cold pain in chronic tension-type headache sufferers.

PubMed

Cathcart, Stuart; Winefield, Anthony H; Lushington, Kurt; Rolan, Paul

2009-10-01

Mental stress is a noted contributing factor in chronic tension-type headache (CTH), however the mechanisms underlying this are not clearly understood. One proposition is that stress aggravates already increased pain sensitivity in CTH sufferers. This hypothesis could be partially tested by examining effects of mental stress on threshold and supra-threshold experimental pain processing in CTH sufferers. Such studies have not been reported to date. The present study measured pain detection and tolerance thresholds and ratings of supra-threshold pain stimulation from cold pressor test in CTH sufferers (CTH-S) and healthy Control (CNT) subjects exposed to a 60-min stressful mental task, and in CTH sufferers exposed to a 60-min neutral condition (CTH-N). Headache sufferers had lower pain tolerance thresholds and increased pain intensity ratings compared to controls. Pain detection and tolerance thresholds decreased and pain intensity ratings increased during the stress task, with a greater reduction in pain detection threshold and increase in pain intensity ratings in the CTH-S compared to CNT group. The results support the hypothesis that mental stress contributes to CTH through aggravating already increased pain sensitivity in CTH sufferers.

State-of-the-Art Assessment of Testing and Testability of Custom LSI/VLSI Circuits. Volume VI. Redundancy, Testing Circuits, and Codes.

DTIC Science & Technology

1982-10-01

e.g., providing voters in TMR systems and detection-switching requirements in standby-sparing sys- tems. The application of mathematical thoery of...and time redundancy required for error detection and correction, are interrelated. Mathematical modeling, when applied to fault tolerant systems, can...9 1.1 Some Fundamental Principles............................. 11 1.2 Mathematical Theory of

Can HbA1c be Used to Screen for Glucose Abnormalities Among Adults with Severe Mental Illness?

PubMed

Romain, A J; Letendre, E; Akrass, Z; Avignon, A; Karelis, A D; Sultan, A; Abdel-Baki, A

2017-04-01

Aim: Prediabetes and type 2 diabetes are highly prevalent among individuals with serious mental illness and increased by antipsychotic medication. Although widely recommended, many obstacles prevent these patients from obtaining a proper screening for dysglycemia. Currently, glycated hemoglobin (HbA1c), fasting glucose, and 2-hour glucose levels from the oral glucose tolerance test are used for screening prediabetes and type 2 diabetes. The objective of this study was to investigate if HbA1c could be used as the only screening test among individuals with serious mental illness. Methods: Cross sectional study comparing the sensitivity of HbA1c, fasting glucose, and 2-h oral glucose tolerance test to detect dysglycemias in serious mental illness participants referred for metabolic complications. Results: A total of 84 participants (43 female; aged: 38.5±12.8 years; BMI: 35.0±6.8 kg/m²) was included. Regarding prediabetes, 44, 44 and 76% were identified by HbA1c, fasting glucose, and 2 h- oral glucose tolerance test respectively and for type 2 diabetes, 60, 53 and 66% were identified by HbA1c, fasting glucose and 2 h-oral glucose tolerance test. The overlap between the 3 markers was low (8% of participants for prediabetes and 26% for Type 2 diabetes). Sensitivity of HbA1c were moderate (range 40-62.5%), while its specificity was excellent (92-93%). Conclusion: The present study indicates a low agreement between HbA1c, fasting glucose and 2-h oral glucose tolerance test. It appears that these markers do not identify the same participants. Thus, HbA1c may not be used alone to detect all glucose abnormalities among individuals with serious mental illness. © Georg Thieme Verlag KG Stuttgart · New York.

Validation of the BetaStar® Advanced for Tetracyclines Test Kit for the Screening of Bulk Tank and Tanker Truck Milks for the Presence of Tetracycline Drug Residues.

PubMed

Ankrapp, David; Schaus, Benjamin; Clements, Lauren; Klein, Frank; Rice, Jennifer; Rejman, John

2018-05-09

A validation study was conducted for an immunochromatographic method (BetaStar ® Advanced for Tetracyclines) for detection of tetracycline antibiotic residues in raw, commingled bovine milk. The assay was demonstrated to detect tetracycline, chlortetracycline, and oxytetracycline at levels below the FDA tolerance levels but above the maximum sensitivity thresholds established by the National Conference on Interstate Milk Shipments. Results of internal and independent laboratory dose-response studies employing spiked samples were in agreement. All three drugs at the approximate 90/95% sensitivity levels were detected in milk collected from cows that had been treated with the specific drug. Selectivity of the assay was 100%, as no false-positive results were obtained in testing 881 control milk samples. Testing the estimated 90/95 sensitivity level for tetracycline (213 ppb), chlortetracycline (272 ppb), and oxytetracycline (180 ppb) and at 1000 ppb for each antibiotic resulted in 100% positive tests for each tetracycline. Results of ruggedness experiments established the operating parameter tolerances for the test. Results of cross-reactivity testing established that the assay detects certain other tetracycline drugs but does not cross-react with any of 32 drugs belonging to seven different drug classes. Abnormally high bacterial or somatic cell counts (SCC) in raw milk produced no assay interference.

Periodic Application of Concurrent Error Detection in Processor Array Architectures. PhD. Thesis -

NASA Technical Reports Server (NTRS)

Chen, Paul Peichuan

1993-01-01

Processor arrays can provide an attractive architecture for some applications. Featuring modularity, regular interconnection and high parallelism, such arrays are well-suited for VLSI/WSI implementations, and applications with high computational requirements, such as real-time signal processing. Preserving the integrity of results can be of paramount importance for certain applications. In these cases, fault tolerance should be used to ensure reliable delivery of a system's service. One aspect of fault tolerance is the detection of errors caused by faults. Concurrent error detection (CED) techniques offer the advantage that transient and intermittent faults may be detected with greater probability than with off-line diagnostic tests. Applying time-redundant CED techniques can reduce hardware redundancy costs. However, most time-redundant CED techniques degrade a system's performance.

Software fault tolerance using data diversity

NASA Technical Reports Server (NTRS)

Knight, John C.

1991-01-01

Research on data diversity is discussed. Data diversity relies on a different form of redundancy from existing approaches to software fault tolerance and is substantially less expensive to implement. Data diversity can also be applied to software testing and greatly facilitates the automation of testing. Up to now it has been explored both theoretically and in a pilot study, and has been shown to be a promising technique. The effectiveness of data diversity as an error detection mechanism and the application of data diversity to differential equation solvers are discussed.

Study of fault tolerant software technology for dynamic systems

NASA Technical Reports Server (NTRS)

Caglayan, A. K.; Zacharias, G. L.

1985-01-01

The major aim of this study is to investigate the feasibility of using systems-based failure detection isolation and compensation (FDIC) techniques in building fault-tolerant software and extending them, whenever possible, to the domain of software fault tolerance. First, it is shown that systems-based FDIC methods can be extended to develop software error detection techniques by using system models for software modules. In particular, it is demonstrated that systems-based FDIC techniques can yield consistency checks that are easier to implement than acceptance tests based on software specifications. Next, it is shown that systems-based failure compensation techniques can be generalized to the domain of software fault tolerance in developing software error recovery procedures. Finally, the feasibility of using fault-tolerant software in flight software is investigated. In particular, possible system and version instabilities, and functional performance degradation that may occur in N-Version programming applications to flight software are illustrated. Finally, a comparative analysis of N-Version and recovery block techniques in the context of generic blocks in flight software is presented.

Self testing for diabetes mellitus.

PubMed Central

Davies, M; Alban-Davies, H; Cook, C; Day, J

1991-01-01

OBJECTIVE--To develop a simple, economically viable, and effective means of population screening for diabetes mellitus. DESIGN--A postal request system for self testing for glycosuria with foil wrapped dipsticks. Preprandial and postprandial tests were compared with a single postprandial test. The subjects were instructed how to test, and a result card was supplied on which to record and return the result. All those recording a positive test result and 50 people recording a negative result were invited for an oral glucose tolerance test. SETTING--General practice in east Suffolk, list size 11534. PATIENTS--All subjects aged 45-70 years registered with the practice were identified by Suffolk Family Health Services Authority (n = 3057). The 73 subjects known to have diabetes from the practice's register were excluded, leaving 2984 subjects, 2363 (79.2%) of whom responded. 1167 subjects completed the single test and 1196 the two tests. MAIN OUTCOME MEASURES--Response rate and number of patients with glycosuria. Sensitivity, specificity, and positive predictive value of a single postprandial test and preprandial and postprandial tests. Number of new cases of diabetes identified and cost of screening. RESULTS--Of the patients completing the single postprandial test, 29 had a positive result, an oral glucose tolerance test showed that eight (28%) had diabetes, six (21%) impaired glucose tolerance, and 14 (48%) normal glucose tolerance. 44 of the group who tested before and after eating had a positive result; nine (20%) had diabetes, five (11%) impaired tolerance, and 26 (11%) normal tolerance. Screening cost 59p per subject and 81 pounds per case detected. Of the 17 people with previously undiagnosed diabetes, eight were asymptomatic and 11 had not visited their general practitioner in the past three months. CONCLUSIONS--A postal request system for self testing for postprandial glycosuria in people aged 45-70 is a simple and effective method of population screening for diabetes mellitus. PMID:1912918

VKOR variant and sex are the main influencing factors on bromadiolone tolerance of the house mouse (Mus musculus L.).

PubMed

Šćepović, Tanja; Jokić, Goran; Esther, Alexandra; Kataranovski, Dragan; Vukša, Petar; Đedović, Suzana; Vukša, Marina

2016-03-01

After reports of management problems in practice, a survey was conducted to determine the presence of bromadiolone-resistant animals in different house mouse (Mus musculus L.) populations in Serbia. A 21 day no-choice feeding test was carried out to examine the resistance of house mice to bromadiolone. Eighty house mice collected from four locations (ten males and ten females per location) were tested for bromadiolone tolerance. Surviving animals and their F1 offspring were screened for mutations. The influence of VKOR variant, zygosity and sex on bromadiolone tolerance was analysed. Bait intake and changes in body weight revealed different animal responses regarding susceptibility or resistance. Leu128Ser, Tyr139Cys and a new Ala21Thr polymorphism were detected in wild-born survivors and their F1 generation. However, not every individual with the polymorphisms Leu128Ser and Tyr139Cys survived the feeding test. VKOR variants and sex caused variations in bromadiolone tolerance. For the first time it was shown that the VKOR variant, along with sex, is responsible for bromadiolone tolerance in house mice. Other factors influencing bromadiolone tolerance, including sex-specific factors, cannot be excluded. The tolerance levels of VKOR variants should be determined in further studies in order to evaluate the effectiveness of bromadiolone in sustainable management. © 2015 Society of Chemical Industry.

Development and evaluation of a Fault-Tolerant Multiprocessor (FTMP) computer. Volume 3: FTMP test and evaluation

NASA Technical Reports Server (NTRS)

Lala, J. H.; Smith, T. B., III

1983-01-01

The experimental test and evaluation of the Fault-Tolerant Multiprocessor (FTMP) is described. Major objectives of this exercise include expanding validation envelope, building confidence in the system, revealing any weaknesses in the architectural concepts and in their execution in hardware and software, and in general, stressing the hardware and software. To this end, pin-level faults were injected into one LRU of the FTMP and the FTMP response was measured in terms of fault detection, isolation, and recovery times. A total of 21,055 stuck-at-0, stuck-at-1 and invert-signal faults were injected in the CPU, memory, bus interface circuits, Bus Guardian Units, and voters and error latches. Of these, 17,418 were detected. At least 80 percent of undetected faults are estimated to be on unused pins. The multiprocessor identified all detected faults correctly and recovered successfully in each case. Total recovery time for all faults averaged a little over one second. This can be reduced to half a second by including appropriate self-tests.

Rule-based fault diagnosis of hall sensors and fault-tolerant control of PMSM

NASA Astrophysics Data System (ADS)

Song, Ziyou; Li, Jianqiu; Ouyang, Minggao; Gu, Jing; Feng, Xuning; Lu, Dongbin

2013-07-01

Hall sensor is widely used for estimating rotor phase of permanent magnet synchronous motor(PMSM). And rotor position is an essential parameter of PMSM control algorithm, hence it is very dangerous if Hall senor faults occur. But there is scarcely any research focusing on fault diagnosis and fault-tolerant control of Hall sensor used in PMSM. From this standpoint, the Hall sensor faults which may occur during the PMSM operating are theoretically analyzed. According to the analysis results, the fault diagnosis algorithm of Hall sensor, which is based on three rules, is proposed to classify the fault phenomena accurately. The rotor phase estimation algorithms, based on one or two Hall sensor(s), are initialized to engender the fault-tolerant control algorithm. The fault diagnosis algorithm can detect 60 Hall fault phenomena in total as well as all detections can be fulfilled in 1/138 rotor rotation period. The fault-tolerant control algorithm can achieve a smooth torque production which means the same control effect as normal control mode (with three Hall sensors). Finally, the PMSM bench test verifies the accuracy and rapidity of fault diagnosis and fault-tolerant control strategies. The fault diagnosis algorithm can detect all Hall sensor faults promptly and fault-tolerant control algorithm allows the PMSM to face failure conditions of one or two Hall sensor(s). In addition, the transitions between health-control and fault-tolerant control conditions are smooth without any additional noise and harshness. Proposed algorithms can deal with the Hall sensor faults of PMSM in real applications, and can be provided to realize the fault diagnosis and fault-tolerant control of PMSM.

Quantitative sensory testing and pain tolerance in patients with mild to moderate Alzheimer disease compared to healthy control subjects.

PubMed

Jensen-Dahm, Christina; Werner, Mads U; Dahl, Jørgen B; Jensen, Troels Staehelin; Ballegaard, Martin; Hejl, Anne-Mette; Waldemar, Gunhild

2014-08-01

Patients with Alzheimer disease (AD) report pain less frequently than their cognitively intact peers. It has been hypothesized that pain processing is altered in AD. The aim of this study was to investigate agreement and reliability of 3 pain sensitivity tests and to examine pain threshold and tolerance in patients with AD. We examined 29 patients with mild to moderate AD and 29 age- and gender-matched healthy control subjects with quantitative sensory testing, ie, assessments of detection threshold (warmth detection threshold [WDT]) and pain threshold (heat pain threshold [HPT], pressure algometry, cold pressor test), and assessments of tolerance (pressure algometry, cold pressor test). All procedures were done twice on day 1, 1 hour apart, and repeated on day 2. We found no difference between groups for WDT (patient vs control subjects: mean [95% confidence interval]: 35.5°C [33.4°C to 37.6°C] vs 35.4°C [34.3°C to 36.5°C], P=.8) or HPT (41.2°C [40.0°C to 42.4°C] vs 42.3°C [41.1°C to 43.5°C], P=.24). We observed comparable thresholds for pressure algometry (median [25% to 75% interquartile range]: 120 kPa [100 to 142 kPa] vs 131 kPa [113 to 192 kPa], P=.10), but significantly lower tolerance in AD patients (213 kPa [188 to 306 kPa] vs 289 kPa [262 to 360 kPa], P=.008). No differences were found for the cold pressor test. The study demonstrated good replicability of the sensory testing data with comparable data variability, for both groups, which supports the use of these methods in studies of patients with mild to moderate AD. Contrary to previous studies, we observed a reduced pain tolerance in patients with mild to moderate AD, which suggests that the reduced report of pain cannot be explained by reduced processing of painful stimuli. Copyright © 2014 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

Validation of the BetaStar® Advanced for Beta-lactams Test Kit for the Screening of Bulk Tank and Tanker Truck Milks for the Presence of Beta-lactam Drug Residues.

PubMed

Denhartigh, Andrew; Reynolds, Lindsay; Palmer, Katherine; Klein, Frank; Rice, Jennifer; Rejman, John J

2018-05-18

A validation study was conducted for an immunochromatographic method (BetaStar ® Advanced for Beta-lactams) for the detection of beta-lactam residues in raw, commingled bovine milk. The assay detected amoxicillin, ampicillin, cloxacillin, penicillin, cephapirin, and ceftiofur below the U.S. Food and Drug Administration tolerance levels but above the maximum sensitivity thresholds established by the National Conference on Interstate Milk Shipments. The results of internal and independent laboratory dose-response studies employing spiked samples were in agreement. The test detected all six drugs at the approximate 90/95% sensitivity levels in milk from cows treated with each drug. Selectivity of the assay was 100%, as no false-positive results were obtained in testing 1148 control milk samples. Testing the estimated 90/95% sensitivity level for amoxicillin (8.5 ppb), ampicillin (6.9 ppb), cloxacillin (8.9 ppb), penicillin (4.2 ppb), and cephapirin (17.6 ppb), and at 100 ppb for each antibiotic, resulted in 94-100% positive tests for each of the beta-lactam drugs. The results of ruggedness experiments established the operating parameter tolerances for the assay. Cross-reactivity testing established that the assay detects other certain beta-lactam drugs, but it does not cross-react with any of 30 drugs belonging to seven different drug classes. Abnormally high bacterial or somatic cell counts in raw milk produced no assay interference.

Detection of faults and software reliability analysis

NASA Technical Reports Server (NTRS)

Knight, J. C.

1987-01-01

Specific topics briefly addressed include: the consistent comparison problem in N-version system; analytic models of comparison testing; fault tolerance through data diversity; and the relationship between failures caused by automatically seeded faults.

Statistical process control and verifying positional accuracy of a cobra motion couch using step-wedge quality assurance tool.

PubMed

Binny, Diana; Lancaster, Craig M; Trapp, Jamie V; Crowe, Scott B

2017-09-01

This study utilizes process control techniques to identify action limits for TomoTherapy couch positioning quality assurance tests. A test was introduced to monitor accuracy of the applied couch offset detection in the TomoTherapy Hi-Art treatment system using the TQA "Step-Wedge Helical" module and MVCT detector. Individual X-charts, process capability (cp), probability (P), and acceptability (cpk) indices were used to monitor a 4-year couch IEC offset data to detect systematic and random errors in the couch positional accuracy for different action levels. Process capability tests were also performed on the retrospective data to define tolerances based on user-specified levels. A second study was carried out whereby physical couch offsets were applied using the TQA module and the MVCT detector was used to detect the observed variations. Random and systematic variations were observed for the SPC-based upper and lower control limits, and investigations were carried out to maintain the ongoing stability of the process for a 4-year and a three-monthly period. Local trend analysis showed mean variations up to ±0.5 mm in the three-monthly analysis period for all IEC offset measurements. Variations were also observed in the detected versus applied offsets using the MVCT detector in the second study largely in the vertical direction, and actions were taken to remediate this error. Based on the results, it was recommended that imaging shifts in each coordinate direction be only applied after assessing the machine for applied versus detected test results using the step helical module. User-specified tolerance levels of at least ±2 mm were recommended for a test frequency of once every 3 months to improve couch positional accuracy. SPC enables detection of systematic variations prior to reaching machine tolerance levels. Couch encoding system recalibrations reduced variations to user-specified levels and a monitoring period of 3 months using SPC facilitated in detecting systematic and random variations. SPC analysis for couch positional accuracy enabled greater control in the identification of errors, thereby increasing confidence levels in daily treatment setups. © 2017 Royal Brisbane and Women's Hospital, Metro North Hospital and Health Service. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

Implementation of an experimental fault-tolerant memory system

NASA Technical Reports Server (NTRS)

Carter, W. C.; Mccarthy, C. E.

1976-01-01

The experimental fault-tolerant memory system described in this paper has been designed to enable the modular addition of spares, to validate the theoretical fault-secure and self-testing properties of the translator/corrector, to provide a basis for experiments using the new testing and correction processes for recovery, and to determine the practicality of such systems. The hardware design and implementation are described, together with methods of fault insertion. The hardware/software interface, including a restricted single error correction/double error detection (SEC/DED) code, is specified. Procedures are carefully described which, (1) test for specified physical faults, (2) ensure that single error corrections are not miscorrections due to triple faults, and (3) enable recovery from double errors.

ACUTE AND REPEATED INHALATION OF TOLUENE BY RATS PERFORMING A SIGNAL DETECTION TASK LEADS TO BEHAVIORAL TOLERANCE ON SOME PERFORMANCE MEASURES.

EPA Science Inventory

Previous work showed that trichloroethylene (TCE) impairs accuracy and latency in a signal detection task (SDT) in rats, and that these effects abate during repeated exposures if rats inhale TCE during SDT testing. The present experiment compared the effects of acute and repeated...

Fault recovery characteristics of the fault tolerant multi-processor

NASA Technical Reports Server (NTRS)

Padilla, Peter A.

1990-01-01

The fault handling performance of the fault tolerant multiprocessor (FTMP) was investigated. Fault handling errors detected during fault injection experiments were characterized. In these fault injection experiments, the FTMP disabled a working unit instead of the faulted unit once every 500 faults, on the average. System design weaknesses allow active faults to exercise a part of the fault management software that handles byzantine or lying faults. It is pointed out that these weak areas in the FTMP's design increase the probability that, for any hardware fault, a good LRU (line replaceable unit) is mistakenly disabled by the fault management software. It is concluded that fault injection can help detect and analyze the behavior of a system in the ultra-reliable regime. Although fault injection testing cannot be exhaustive, it has been demonstrated that it provides a unique capability to unmask problems and to characterize the behavior of a fault-tolerant system.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katti, Amogh; Di Fatta, Giuseppe; Naughton III, Thomas J

Future extreme-scale high-performance computing systems will be required to work under frequent component failures. The MPI Forum's User Level Failure Mitigation proposal has introduced an operation, MPI_Comm_shrink, to synchronize the alive processes on the list of failed processes, so that applications can continue to execute even in the presence of failures by adopting algorithm-based fault tolerance techniques. This MPI_Comm_shrink operation requires a fault tolerant failure detection and consensus algorithm. This paper presents and compares two novel failure detection and consensus algorithms. The proposed algorithms are based on Gossip protocols and are inherently fault-tolerant and scalable. The proposed algorithms were implementedmore » and tested using the Extreme-scale Simulator. The results show that in both algorithms the number of Gossip cycles to achieve global consensus scales logarithmically with system size. The second algorithm also shows better scalability in terms of memory and network bandwidth usage and a perfect synchronization in achieving global consensus.« less

Diagnostic value of tolerance-related gene expression measured in the recipient alloantigen-reactive T cell fraction.

PubMed

Lim, Dong-Gyun; Park, Youn-Hee; Kim, Sung-Eun; Jeong, Seong-Hee; Kim, Song-Cheol

2013-08-01

The efficient development of tolerance-inducing therapies and safe reduction of immunosuppression should be supported by early diagnosis and prediction of tolerance in transplantation. Using mouse models of donor-specific tolerance to allogeneic skin and islet grafts we tested whether measurement of tolerance-related gene expression in their alloantigen-reactive peripheral T cell fraction efficiently reflected the tolerance status of recipients. We found that Foxp3, Nrn1, and Klrg1 were preferentially expressed in conditions of tolerance compared with rejection or unmanipulated controls if their expression is measured in CD69(+) T cells prepared from coculture of recipient peripheral T cells and donor antigen-presenting cells. The same pattern of gene expression was observed in recipients grafted with either skin or islets, recipients of different genetic origins, and even those taking immunosuppressive drugs. These findings suggest that the expression of tolerance-related genes in the alloantigen-reactive T cell fraction could be used to detect tolerance in the clinic. Copyright © 2013 Elsevier Inc. All rights reserved.

Evolution of resistance and tolerance to herbivores: testing the trade-off hypothesis.

PubMed

Kariñho-Betancourt, Eunice; Núñez-Farfán, Juan

2015-01-01

Background. To cope with their natural enemies, plants rely on resistance and tolerance as defensive strategies. Evolution of these strategies among natural population can be constrained by the absence of genetic variation or because of the antagonistic genetic correlation (trade-off) between them. Also, since plant defenses are integrated by several traits, it has been suggested that trade-offs might occur between specific defense traits. Methodology/Principal Findings. We experimentally assessed (1) the presence of genetic variance in tolerance, total resistance, and leaf trichome density as specific defense trait, (2) the extent of natural selection acting on plant defenses, and (3) the relationship between total resistance and leaf trichome density with tolerance to herbivory in the annual herb Datura stramonium. Full-sib families of D. stramonium were either exposed to natural herbivores (control) or protected from them by a systemic insecticide. We detected genetic variance for leaf trichome density, and directional selection acting on this character. However, we did not detect a negative significant correlation between tolerance and total resistance, or between tolerance and leaf trichome density. We argue that low levels of leaf damage by herbivores precluded the detection of a negative genetic correlation between plant defense strategies. Conclusions/Significance. This study provides empirical evidence of the independent evolution of plant defense strategies, and a defensive role of leaf trichomes. The pattern of selection should favor individuals with high trichomes density. Also, because leaf trichome density reduces damage by herbivores and possess genetic variance in the studied population, its evolution is not constrained.

Evolution of resistance and tolerance to herbivores: testing the trade-off hypothesis

PubMed Central

Kariñho-Betancourt, Eunice

2015-01-01

Background. To cope with their natural enemies, plants rely on resistance and tolerance as defensive strategies. Evolution of these strategies among natural population can be constrained by the absence of genetic variation or because of the antagonistic genetic correlation (trade-off) between them. Also, since plant defenses are integrated by several traits, it has been suggested that trade-offs might occur between specific defense traits. Methodology/Principal Findings. We experimentally assessed (1) the presence of genetic variance in tolerance, total resistance, and leaf trichome density as specific defense trait, (2) the extent of natural selection acting on plant defenses, and (3) the relationship between total resistance and leaf trichome density with tolerance to herbivory in the annual herb Datura stramonium. Full-sib families of D. stramonium were either exposed to natural herbivores (control) or protected from them by a systemic insecticide. We detected genetic variance for leaf trichome density, and directional selection acting on this character. However, we did not detect a negative significant correlation between tolerance and total resistance, or between tolerance and leaf trichome density. We argue that low levels of leaf damage by herbivores precluded the detection of a negative genetic correlation between plant defense strategies. Conclusions/Significance. This study provides empirical evidence of the independent evolution of plant defense strategies, and a defensive role of leaf trichomes. The pattern of selection should favor individuals with high trichomes density. Also, because leaf trichome density reduces damage by herbivores and possess genetic variance in the studied population, its evolution is not constrained. PMID:25780756

A second generation experiment in fault-tolerant software

NASA Technical Reports Server (NTRS)

Knight, J. C.

1986-01-01

Information was collected on the efficacy of fault-tolerant software by conducting two large-scale controlled experiments. In the first, an empirical study of multi-version software (MVS) was conducted. The second experiment is an empirical evaluation of self testing as a method of error detection (STED). The purpose ot the MVS experiment was to obtain empirical measurement of the performance of multi-version systems. Twenty versions of a program were prepared at four different sites under reasonably realistic development conditions from the same specifications. The purpose of the STED experiment was to obtain empirical measurements of the performance of assertions in error detection. Eight versions of a program were modified to include assertions at two different sites under controlled conditions. The overall structure of the testing environment for the MVS experiment and its status are described. Work to date in the STED experiment is also presented.

Distributed Fault-Tolerant Control of Networked Uncertain Euler-Lagrange Systems Under Actuator Faults.

PubMed

Chen, Gang; Song, Yongduan; Lewis, Frank L

2016-05-03

This paper investigates the distributed fault-tolerant control problem of networked Euler-Lagrange systems with actuator and communication link faults. An adaptive fault-tolerant cooperative control scheme is proposed to achieve the coordinated tracking control of networked uncertain Lagrange systems on a general directed communication topology, which contains a spanning tree with the root node being the active target system. The proposed algorithm is capable of compensating for the actuator bias fault, the partial loss of effectiveness actuation fault, the communication link fault, the model uncertainty, and the external disturbance simultaneously. The control scheme does not use any fault detection and isolation mechanism to detect, separate, and identify the actuator faults online, which largely reduces the online computation and expedites the responsiveness of the controller. To validate the effectiveness of the proposed method, a test-bed of multiple robot-arm cooperative control system is developed for real-time verification. Experiments on the networked robot-arms are conduced and the results confirm the benefits and the effectiveness of the proposed distributed fault-tolerant control algorithms.

Ovomucoid (Gal d 1) specific IgE detected by microarray system predict tolerability to boiled hen's egg and an increased risk to progress to multiple environmental allergen sensitisation.

PubMed

Alessandri, C; Zennaro, D; Scala, E; Ferrara, R; Bernardi, M Livia; Santoro, M; Palazzo, P; Mari, A

2012-03-01

Egg allergy is a very common finding in early childhood. Detecting hen's egg (HE) allergy outgrowing and reintroduction of food containing egg is a task for the allergist. We sought to evaluate the suitability of boiled egg food challenge compared with IgE to allergenic molecules from HE white using a microarray system. Sixty-eight children referring to our centre by the family paediatricians for a suspected egg allergy were enrolled. Patients underwent double-blind, placebo-controlled food challenge with boiled and raw eggs. Challenge outcomes were compared with skin tests performed using egg white and yolk commercial extracts, to prick-prick test with boiled and raw egg white and yolk, total IgE, egg white specific IgE detected using ImmunoCAP and IgE to egg allergens available on the immunosolid phase allergen chip (ISAC) 103 microarray. Nineteen subjects (28%) were reactive to both raw and boiled egg, 14 (20.5%) to raw egg only and 35 (51.4%) tolerated both boiled and raw egg. Efficiency analysis was carried out using both raw and boiled egg challenges as gold standard. Forty four of 47 Gal d 1 negative patients tolerated boiled egg (94%). Conversely, 20 of 21 Gal d 1 positive patients reacted to raw egg (95%). None of the other tests was able to discriminate patients' response to HE challenge. Furthermore, Gal d 1 positivity seems to lead to broader environmental allergen IgE sensitization. The Gal d 1 IgE reactivity appears to be a very good predictor of HE clinical allergy. Gal d 1 positive children have a high frequency of HE allergy, whereas Gal d 1 negative children have a high frequency of tolerance to boiled egg. Multiple specific IgE detection by means of ISAC improves the diagnostic approach in HE allergic children, disclosing other food and inhalant allergic sensitizations, anyhow requiring a comprehensive clinical evaluation. © 2011 Blackwell Publishing Ltd.

On Restructurable Control System Theory

NASA Technical Reports Server (NTRS)

Athans, M.

1983-01-01

The state of stochastic system and control theory as it impacts restructurable control issues is addressed. The multivariable characteristics of the control problem are addressed. The failure detection/identification problem is discussed as a multi-hypothesis testing problem. Control strategy reconfiguration, static multivariable controls, static failure hypothesis testing, dynamic multivariable controls, fault-tolerant control theory, dynamic hypothesis testing, generalized likelihood ratio (GLR) methods, and adaptive control are discussed.

Epigenetics of drought-induced trans-generational plasticity: consequences for range limit development

PubMed Central

Alsdurf, Jacob; Anderson, Cynthia; Siemens, David H.

2016-01-01

Genetic variation gives plants the potential to adapt to stressful environments that often exist beyond their geographic range limits. However, various genetic, physiological or developmental constraints might prevent the process of adaptation. Alternatively, environmentally induced epigenetic changes might sustain populations for several generations in stressful areas across range boundaries, but previous work on Boechera stricta, an upland mustard closely related to Arabidopsis, documented a drought-induced trans-generational plastic trade-off that could contribute to range limit development. Offspring of parents who were drought treated had higher drought tolerance, but lower levels of glucosinolate toxins. Both drought tolerance and defence are thought to be needed to expand the range to lower elevations. Here, we used methylation-sensitive amplified fragment length polymorphisms to determine whether environmentally induced DNA methylation and thus epigenetics could be a mechanism involved in the observed trans-generational plastic trade-off. We compared 110 offspring from the same self-fertilizing lineages whose parents were exposed to experimental drought stress treatments in the laboratory. Using three primer combinations, 643 polymorphic epi-loci were detected. Discriminant function analysis (DFA) on the amount of methylation detected resulted in significant combinations of epi-loci that distinguished the parent drought treatments in the offspring. Principal component (PC) and univariate association analyses also detected the significant differences, even after controlling for lineage, planting flat, developmental differences and multiple testing. Univariate tests also indicated significant associations between the amount of methylation and drought tolerance or glucosinolate toxin concentration. One epi-locus that was implicated in DFA, PC and univariate association analysis may be directly involved in the trade-off because increased methylation at this site on the genome decreased drought tolerance, but increased glucosinolate concentration. PMID:26685218

Results of anti-mortem screening methodology to predict prescribed drug withholding periods for flunixin and ceftiofur in heifers

USDA-ARS?s Scientific Manuscript database

Introduction: A simple, cow-side test for the presence of drug residues in live animals would be useful for drug residue avoidance programs. Simple inhibition tests used at slaughter do not detect some drug tolerance concentrations such as those for flunixin and ceftiofur-metabolites. This experim...

SU-F-T-313: Clinical Results of a New Customer Acceptance Test for Elekta VMAT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rusk, B; Fontenot, J

Purpose: To report the results of a customer acceptance test (CAT) for VMAT treatments for two matched Elekta linear accelerators. Methods: The CAT tests were performed on two clinically matched Elekta linear accelerators equipped with a 160-leaf MLC. Functional tests included performance checks of the control system during dynamic movements of the diaphragms, MLC, and gantry. Dosimetric tests included MLC picket fence tests at static and variable dose rates and a diaphragm alignment test, all performed using the on-board EPID. Additionally, beam symmetry during arc delivery was measured at the four cardinal angles for high and low dose rate modesmore » using a 2D detector array. Results of the dosimetric tests were analyzed using the VMAT CAT analysis tool. Results: Linear accelerator 1 (LN1) met all stated CAT tolerances. Linear accelerator 2 (LN2) passed the geometric, beam symmetry, and MLC position error tests but failed the relative dose average test for the diaphragm abutment and all three picket fence fields. Though peak doses in the abutment regions were consistent, the average dose was below the stated tolerance corresponding to a leaf junction that was too narrow. Despite this, no significant differences in patient specific VMAT quality assurance measured were observed between the accelerators and both passed monthly MLC quality assurance performed with the Hancock test. Conclusion: Results from the CAT showed LN2 with relative dose averages in the abutment regions of the diaphragm and MLC tests outside the tolerances resulting from differences in leaf gap distances. Tolerances of the dose average tests from the CAT may be small enough to detect MLC errors which do not significantly affect patient QA or the routine MLC tests.« less

77 FR 6471 - Bacillus thuringiensis Cry2Ae Protein in Cotton; Exemption from the Requirement of a Tolerance

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-08

... analytical method using enzyme- linked immunosorbent assay (ELISA) analyses for the qualitative detection of... study conducted by an independent third party laboratory to evaluate the ELISA test kit's performance as...

Tolerance of Salmonella Enteritidis and Staphylococcus aureus to surface cleaning and household bleach.

PubMed

Kusumaningrum, H D; Paltinaite, R; Koomen, A J; Hazeleger, W C; Rombouts, F M; Beumer, R R

2003-12-01

Effective cleaning and sanitizing of food preparation sites is important because pathogens are readily spread to food contact surfaces after preparation of contaminated raw products. Tolerance of Salmonella Enteritidis and Staphylococcus aureus to surface cleaning by wiping with regular, microfiber, and antibacterial-treated cloths was investigated. Wiping with cleaning cloths resulted in a considerable reduction of microorganisms from surfaces, despite the greater difficulty in removing S. aureus than Salmonella Enteritidis. Depending on the cloth type, S. aureus were reduced on surfaces from initial numbers of approximately 10(5) CFU/100 cm2 to numbers from less than 4 CFU/100 cm2 (below the detection limit) to 100 CFU/100 cm2. Directly after the cloths were used to clean the contaminated surfaces, they contained high numbers of bacteria (10(4) to 10(5) CFU/100 cm2), except for the disposable antibacterial-treated cloths, in which no bacteria could be detected. The tolerance of these pathogens to sodium hypochlorite was studied in the suspension test and in cloths. S. aureus showed a better tolerance for sodium hypochlorite than Salmonella Enteritidis. Inactivation of microorganisms in cloths required a higher concentration of sodium hypochlorite than was needed in the suspension test. Repeated exposure to sodium hypochlorite, however, resulted in an increase in susceptibility to this compound. This study provides essential information about the transfer of bacteria when wiping surfaces and highlights the need for a hygiene procedure with cleaning cloths that sufficiently avoids cross-contamination in the household environment.

Copper tolerance and copper accumulation of herbaceous plants colonizing inactive California copper mines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kruckeberg, A.L.; Wu, L.

1992-06-01

Herbaceous plant species colonizing four copper mine waste sites in northern California were investigated for copper tolerance and copper accumulation. Copper tolerance was found in plant species colonizing soils with high concentrations of soil copper. Seven of the eight plant species tested were found at more than one copper mine. The mines are geographically isolated, which makes dispersal of seeds from one mine to another unlikely. Tolerance has probably evolved independently at each site. The nontolerant field control population of Vulpia microstachya displays significantly higher tolerance to copper at all copper concentration levels tested than the nontolerant Vulpia myrous population,more » and the degree of copper tolerance attained by V. microstachya at the two copper mines was much greater than that found in V. myrous. It suggests that even in these two closely related species, the innate tolerance in their nontolerant populations may reflect their potential for evolution of copper tolerance and their ability to initially colonize copper mine waste sites. The shoot tissue of the copper mine plants of Arenaria douglasii, Bromous mollis, and V. microstachya accumulated less copper than those plants of the same species from the field control sites when the two were grown in identical conditions in nutrient solution containing copper. The root tissue of these mine plants contain more copper than the roots of the nonmine plants. This result suggests that exclusion of copper from the shoots, in part by immobilization in the roots, may be a feature of copper tolerance. No difference in the tissue copper concentration was detected between tolerant and nontolerant plants of Lotus purshianus, Lupinus bicolor, and Trifolium pratense even though the root tissue had more copper than the leaves.« less

Noninvasive type 2 diabetes screening: superior sensitivity to fasting plasma glucose and A1C.

PubMed

Maynard, John D; Rohrscheib, Mark; Way, Jeffrey F; Nguyen, Catriona M; Ediger, Marwood N

2007-05-01

This study compared the performance of a novel noninvasive technology to fasting plasma glucose (FPG) and A1C tests for detecting undiagnosed diabetes and impaired glucose tolerance. The design was a head-to-head evaluation in a naïve population. Consented subjects received FPG and A1C tests and an oral glucose tolerance test (OGTT). Subjects were also measured by a noninvasive device that detects the fluorescence of skin advanced glycation end products. A total of 351 subjects participated. Subjects with 2-h OGTT values > or = 140 mg/dl defined the positive screening class. A total of 84 subjects (23.9% prevalence) screened positive. The performances of the noninvasive device, FPG, and A1C were evaluated for sensitivity and specificity against this classification. At the impaired fasting glucose threshold (FPG = 100 mg/dl), the FPG testing sensitivity was 58% and the specificity was 77.4%. At that same specificity, the sensitivity for A1C testing was 63.8%, while the noninvasive testing sensitivity was 74.7%. The sensitivity advantage of the noninvasive device over both blood tests for detecting diabetes and precursors was statistically significant (P < 0.05). The noninvasive technology showed clinical performance advantages over both FPG and A1C testing. The sensitivity differential indicated that the noninvasive device is capable of identifying 28.8% more individuals in the OGTT-defined positive screening class than FPG testing and 17.1% more than A1C testing. The combination of higher sensitivity and greater convenience--rapid results with no fasting or blood draws--makes the device well suited for opportunistic screening.

The use of automatic programming techniques for fault tolerant computing systems

NASA Technical Reports Server (NTRS)

Wild, C.

1985-01-01

It is conjectured that the production of software for ultra-reliable computing systems such as required by Space Station, aircraft, nuclear power plants and the like will require a high degree of automation as well as fault tolerance. In this paper, the relationship between automatic programming techniques and fault tolerant computing systems is explored. Initial efforts in the automatic synthesis of code from assertions to be used for error detection as well as the automatic generation of assertions and test cases from abstract data type specifications is outlined. Speculation on the ability to generate truly diverse designs capable of recovery from errors by exploring alternate paths in the program synthesis tree is discussed. Some initial thoughts on the use of knowledge based systems for the global detection of abnormal behavior using expectations and the goal-directed reconfiguration of resources to meet critical mission objectives are given. One of the sources of information for these systems would be the knowledge captured during the automatic programming process.

Mercury toxicity in the aquatic oligochaete Sparganophilus pearsei: I. Variation in resistance among populations.

PubMed

Vidal, D E; Horne, A J

2003-08-01

Mercury contamination has become a problem in many San Francisco Bay Area watersheds due to its elevated presence in sediments and aquatic organisms. The present study used laboratory lethal toxicity (LC50) tests to examine the mercury tolerance of aquatic oligochaete worms, Sparganophilus pearsei, from contaminated and uncontaminated areas. The oligochaetes were collected in the following fresh water reservoirs: Sandy Wool (reference area), San Pablo, Lake Anza, Lake Herman, and Guadalupe. These last four reservoirs were contaminated with levels of mercury that ranged from 1.5 to 2 mg/kg (wet weight). Mercury concentrations in sediment and tissue from Sandy Wool were below detection limits and worms from this site were the least tolerant of mercury in laboratory exposures (LC50 = 0.22 mg/L). Worms from the other, more contaminated, reservoirs contained elevated tissue mercury concentrations and were more tolerant in laboratory tests (LC50 = 1.48-2.19 mg/L). The present study demonstrates that different populations of the aquatic oligochaete S. pearsei have developed different tolerances to mercury depending on their previous history of exposure to mercury contamination.

Target Classification of Canonical Scatterers Using Classical Estimation and Dictionary Based Techniques

DTIC Science & Technology

2012-03-22

shapes tested , when the objective parameter set was confined to a dictionary’s de - fined parameter space. These physical characteristics included...8 2.3 Hypothesis Testing and Detection Theory . . . . . . . . . . . . . . . 8 2.4 3-D SAR Scattering Models...basis pursuit de -noising (BPDN) algorithm is chosen to perform extraction due to inherent efficiency and error tolerance. Multiple shape dictionaries

Algorithm-Based Fault Tolerance for Numerical Subroutines

NASA Technical Reports Server (NTRS)

Tumon, Michael; Granat, Robert; Lou, John

2007-01-01

A software library implements a new methodology of detecting faults in numerical subroutines, thus enabling application programs that contain the subroutines to recover transparently from single-event upsets. The software library in question is fault-detecting middleware that is wrapped around the numericalsubroutines. Conventional serial versions (based on LAPACK and FFTW) and a parallel version (based on ScaLAPACK) exist. The source code of the application program that contains the numerical subroutines is not modified, and the middleware is transparent to the user. The methodology used is a type of algorithm- based fault tolerance (ABFT). In ABFT, a checksum is computed before a computation and compared with the checksum of the computational result; an error is declared if the difference between the checksums exceeds some threshold. Novel normalization methods are used in the checksum comparison to ensure correct fault detections independent of algorithm inputs. In tests of this software reported in the peer-reviewed literature, this library was shown to enable detection of 99.9 percent of significant faults while generating no false alarms.

Genome-wide identification of gene expression in contrasting maize inbred lines under field drought conditions reveals the significance of transcription factors in drought tolerance

PubMed Central

Zhang, Xiaojing; Liu, Xuyang; Zhang, Dengfeng; Tang, Huaijun; Sun, Baocheng; Li, Chunhui; Hao, Luyang; Liu, Cheng; Li, Yongxiang; Shi, Yunsu; Xie, Xiaoqing; Song, Yanchun; Wang, Tianyu; Li, Yu

2017-01-01

Drought is a major threat to maize growth and production. Understanding the molecular regulation network of drought tolerance in maize is of great importance. In this study, two maize inbred lines with contrasting drought tolerance were tested in the field under natural soil drought and well-watered conditions. In addition, the transcriptomes of their leaves was analyzed by RNA-Seq. In total, 555 and 2,558 genes were detected to specifically respond to drought in the tolerant and the sensitive line, respectively, with a more positive regulation tendency in the tolerant genotype. Furthermore, 4,700, 4,748, 4,403 and 4,288 genes showed differential expression between the two lines under moderate drought, severe drought and their well-watered controls, respectively. Transcription factors were enriched in both genotypic differentially expressed genes and specifically responsive genes of the tolerant line. It was speculated that the genotype-specific response of 20 transcription factors in the tolerance line and the sustained genotypically differential expression of 22 transcription factors might enhance tolerance to drought in maize. Our results provide new insight into maize drought tolerance-related regulation systems and provide gene resources for subsequent studies and drought tolerance improvement. PMID:28700592

Multi-Sensor Fusion with Interaction Multiple Model and Chi-Square Test Tolerant Filter.

PubMed

Yang, Chun; Mohammadi, Arash; Chen, Qing-Wei

2016-11-02

Motivated by the key importance of multi-sensor information fusion algorithms in the state-of-the-art integrated navigation systems due to recent advancements in sensor technologies, telecommunication, and navigation systems, the paper proposes an improved and innovative fault-tolerant fusion framework. An integrated navigation system is considered consisting of four sensory sub-systems, i.e., Strap-down Inertial Navigation System (SINS), Global Navigation System (GPS), the Bei-Dou2 (BD2) and Celestial Navigation System (CNS) navigation sensors. In such multi-sensor applications, on the one hand, the design of an efficient fusion methodology is extremely constrained specially when no information regarding the system's error characteristics is available. On the other hand, the development of an accurate fault detection and integrity monitoring solution is both challenging and critical. The paper addresses the sensitivity issues of conventional fault detection solutions and the unavailability of a precisely known system model by jointly designing fault detection and information fusion algorithms. In particular, by using ideas from Interacting Multiple Model (IMM) filters, the uncertainty of the system will be adjusted adaptively by model probabilities and using the proposed fuzzy-based fusion framework. The paper also addresses the problem of using corrupted measurements for fault detection purposes by designing a two state propagator chi-square test jointly with the fusion algorithm. Two IMM predictors, running in parallel, are used and alternatively reactivated based on the received information form the fusion filter to increase the reliability and accuracy of the proposed detection solution. With the combination of the IMM and the proposed fusion method, we increase the failure sensitivity of the detection system and, thereby, significantly increase the overall reliability and accuracy of the integrated navigation system. Simulation results indicate that the proposed fault tolerant fusion framework provides superior performance over its traditional counterparts.

Multi-Sensor Fusion with Interaction Multiple Model and Chi-Square Test Tolerant Filter

PubMed Central

Yang, Chun; Mohammadi, Arash; Chen, Qing-Wei

2016-01-01

Motivated by the key importance of multi-sensor information fusion algorithms in the state-of-the-art integrated navigation systems due to recent advancements in sensor technologies, telecommunication, and navigation systems, the paper proposes an improved and innovative fault-tolerant fusion framework. An integrated navigation system is considered consisting of four sensory sub-systems, i.e., Strap-down Inertial Navigation System (SINS), Global Navigation System (GPS), the Bei-Dou2 (BD2) and Celestial Navigation System (CNS) navigation sensors. In such multi-sensor applications, on the one hand, the design of an efficient fusion methodology is extremely constrained specially when no information regarding the system’s error characteristics is available. On the other hand, the development of an accurate fault detection and integrity monitoring solution is both challenging and critical. The paper addresses the sensitivity issues of conventional fault detection solutions and the unavailability of a precisely known system model by jointly designing fault detection and information fusion algorithms. In particular, by using ideas from Interacting Multiple Model (IMM) filters, the uncertainty of the system will be adjusted adaptively by model probabilities and using the proposed fuzzy-based fusion framework. The paper also addresses the problem of using corrupted measurements for fault detection purposes by designing a two state propagator chi-square test jointly with the fusion algorithm. Two IMM predictors, running in parallel, are used and alternatively reactivated based on the received information form the fusion filter to increase the reliability and accuracy of the proposed detection solution. With the combination of the IMM and the proposed fusion method, we increase the failure sensitivity of the detection system and, thereby, significantly increase the overall reliability and accuracy of the integrated navigation system. Simulation results indicate that the proposed fault tolerant fusion framework provides superior performance over its traditional counterparts. PMID:27827832

Armeria maritima from a calamine heap--initial studies on physiologic-metabolic adaptations to metal-enriched soil.

PubMed

Olko, A; Abratowska, A; Zyłkowska, J; Wierzbicka, M; Tukiendorf, A

2008-02-01

Plants of Armeria maritima are found both on unpolluted sites and on soils strongly polluted with heavy metals. Seedlings of A. maritima from a zinc-lead calamine heap in ore-mining region (Bolesław population) and from unpolluted area (Manasterz population) were tested to determine the zinc, cadmium and lead tolerance. In hydroponic experiments Bolesław population was more tolerant to zinc, cadmium and lead. Localization of heavy metals in roots was determined using the histochemical method for detecting metal-complexes with dithizone. Their accumulation was found in root hairs, rhizoderma and at the surface of the central cylinder. Glutathione level in plants increased after metal treatment of both populations. However, its high level was not correlated with phytochelatin production. These metal-binding complexes were not detected in plants exposed to zinc, cadmium or lead. Changes of organic acids concentrations in Armeria treated with metals may suggest their role in metal translocation from roots to shoots. The content of organic acids, especially malate, decreased in the roots and increased in the leaves. These changes may be important in Pb-tolerance of Manasterz population and in Zn-, Cd-tolerance of calamine population from Bolesław.

Recognizing defects in carbon-fiber reinforced plastics

NASA Technical Reports Server (NTRS)

Schuetze, R.; Hillger, W.

1982-01-01

The damage tolerance of structures made of carbon-fiber-reinforced plastic is tested under various loads. Test laminate (73/1/1, 24/9/1, 1465 A) specimens of thickness 1.5-3.2 mm with various defects were subjected to static and dynamic loads. Special attention was given to delamination, and ultrasonic C-scans were made on the specimens. It was shown that cracks from even small defects are detected with great accuracy. The same probes were also X rayed; defects that could not be detected under ordinary X rays were bored and studied under vacuum by a contrast technique. The nondestructive ultrasonic and X ray tests were controlled by partially destructive tests, and good agreement was observed.

Transcriptome profiling of Kentucky bluegrass (Poa pratensis L.) accessions in response to salt stress.

PubMed

Bushman, B Shaun; Amundsen, Keenan L; Warnke, Scott E; Robins, Joseph G; Johnson, Paul G

2016-01-13

Kentucky bluegrass (Poa pratensis L.) is a prominent turfgrass in the cool-season regions, but it is sensitive to salt stress. Previously, a relatively salt tolerant Kentucky bluegrass accession was identified that maintained green colour under consistent salt applications. In this study, a transcriptome study between the tolerant (PI 372742) accession and a salt susceptible (PI 368233) accession was conducted, under control and salt treatments, and in shoot and root tissues. Sample replicates grouped tightly by tissue and treatment, and fewer differentially expressed transcripts were detected in the tolerant PI 372742 samples compared to the susceptible PI 368233 samples, and in root tissues compared to shoot tissues. A de novo assembly resulted in 388,764 transcripts, with 36,587 detected as differentially expressed. Approximately 75 % of transcripts had homology based annotations, with several differences in GO terms enriched between the PI 368233 and PI 372742 samples. Gene expression profiling identified salt-responsive gene families that were consistently down-regulated in PI 372742 and unlikely to contribute to salt tolerance in Kentucky bluegrass. Gene expression profiling also identified sets of transcripts relating to transcription factors, ion and water transport genes, and oxidation-reduction process genes with likely roles in salt tolerance. The transcript assembly represents the first such assembly in the highly polyploidy, facultative apomictic Kentucky bluegrass. The transcripts identified provide genetic information on how this plant responds to and tolerates salt stress in both shoot and root tissues, and can be used for further genetic testing and introgression.

[Hypobaric chamber as a test of the aircrew of Russain Air Forces].

PubMed

Shishov, A A; Olenev, N I; Shishkin, A N; Filatov, V N

2014-04-01

Authors research clinical medical importance of hypobaric ascends to an attitude of 5000 meters for 20 minutes for detection of latent forms of diseases and assessment of professional health and ascends to an attitude of 5000 and 6000 meters for 5 minutes when performing psychophysiological training for high altitude flying. According to test of 1326 pilots of Russian Air Forces, including pilots with different diseases, hypobaric ascends showed high diagnostic effectiveness for the professional health assessment. By using of both methods it was revealed that frequency of detection of decreased tolerance to hypoxia is the same (in average in 2,7 and 3,1% of total number of patients). By ascends in 38 patients (2,9%) was revealed decreased tolerance to hypoxia of medium level. It indicated about low functional state and space capacity of pilots. It was proved that hypobaric ascends of 5000 and 6000 meters for 5 minutes could be considered as an effective method of checkup of aircrew for the aviation physical examination.

Detection of faults and software reliability analysis

NASA Technical Reports Server (NTRS)

Knight, J. C.

1986-01-01

Multiversion or N-version programming was proposed as a method of providing fault tolerance in software. The approach requires the separate, independent preparation of multiple versions of a piece of software for some application. Specific topics addressed are: failure probabilities in N-version systems, consistent comparison in N-version systems, descriptions of the faults found in the Knight and Leveson experiment, analytic models of comparison testing, characteristics of the input regions that trigger faults, fault tolerance through data diversity, and the relationship between failures caused by automatically seeded faults.

Loop-mediated isothermal amplification test for detection of Neisseria gonorrhoeae in urine samples and tolerance of the assay to the presence of urea.

PubMed

Edwards, Thomas; Burke, Patricia A; Smalley, Helen B; Gillies, Liz; Hobbs, Glyn

2014-06-01

A loop-mediated isothermal amplification (LAMP) assay for open reading frame 1 (ORF1) of the glutamine synthetase gene of Neisseria gonorrhoeae was able to tolerate urea concentrations of ≤ 1.8 M, compared with a PCR assay that was functional at concentrations of <100 mM. The LAMP assay was as sensitive as the PCR assay while being faster and simpler to perform. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Validation of a rapid lateral flow test for the simultaneous determination of β-lactam drugs and flunixin in raw milk.

PubMed

Douglas, David; Banaszewski, Katie; Juskelis, Rima; Al-Taher, Fadwa; Chen, Yang; Cappozzo, Jack; McRobbie, Lindsay; Salter, Robert S

2012-07-01

β-Lactam antibiotics are the most commonly used drugs on dairy farms. β-Lactam residues in milk are kept out of the human milk supply with good agricultural practices and mandatory truck screening performed by the dairy industry under Appendix N of the Pasteurized Milk Ordinance. Flunixin, a nonsteroidal and anti-inflammatory drug, appears in dairy cattle tissue residues with a frequency similar to the occurrence of penicillin G. This creates concern that flunixin residues could be in milk and would go undetected under current milk screening programs. A single test that combines mandatory β-lactam screening with voluntary flunixin screening is an economical approach for monitoring and controlling for potential flunixin or 5-hydroxyflunixin, the primary flunixin metabolite marker in milk. The objective of this study was to validate a β-lactam and flunixin rapid lateral flow test (LFT) and compare the results obtained with a liquid chromatography-triple quadrupole tandem mass spectrometry (LC-MS/MS) method for the simultaneous determination of flunixin and 5-hydroxyflunixin in raw milk with a limit of detection of , 1 ppb, equivalent to 1 ng/ml. Using the LFT, three combined manufactured lots of test strips detected penicillin G at 2.0 ppb, ampicillin at 6.8 ppb, amoxicillin at 5.9 ppb, cephapirin at 13.4 ppb, ceftiofur (total metabolites) at 63 ppb, and 5-hydroxyflunixin at 1.9 ppb at least 90% of the time with 95% confidence. The LFT also detected incurred flunixin milk samples that were analyzed with the LC-MS/MS and diluted to tolerance in raw milk. The detection levels for the LFT are lower than the U.S. safe levels or tolerances and qualify the test to be used in compliance with U.S. milk screening programs.

Identifying DNA Methylation Biomarkers for Non-Endoscopic Detection of Barrett’s Esophagus

PubMed Central

Moinova, Helen R.; LaFramboise, Thomas; Lutterbaugh, James D.; Chandar, Apoorva Krishna; Dumot, John; Faulx, Ashley; Brock, Wendy; De la Cruz Cabrera, Omar; Guda, Kishore; Barnholtz-Sloan, Jill S.; Iyer, Prasad G.; Canto, Marcia I.; Wang, Jean S.; Shaheen, Nicholas J.; Thota, Prashanti N.; Willis, Joseph E.; Chak, Amitabh; Markowitz, Sanford D.

2018-01-01

We report a biomarker-based non-endoscopic method for detecting Barrett’s esophagus (BE), based on detecting methylated DNAs retrieved via a swallowable balloon-based esophageal sampling device. BE is the precursor of, and a major recognized risk factor for, developing esophageal adenocarcinoma (EAC). Endoscopy, the current standard for BE detection, is not cost-effective for population screening. We performed genome-wide screening to ascertain regions targeted for recurrent aberrant cytosine methylation in BE, identifying high-frequency methylation within the CCNA1 locus. We tested CCNA1 DNA methylation as a BE biomarker in cytology brushings of the distal esophagus from 173 individuals with or without BE. CCNA1 DNA methylation demonstrated an area under the curve (AUC)=0.95 for discriminating BE-related metaplasia and neoplasia cases versus normal individuals, performing identically to methylation of VIM DNA, an established BE biomarker. When combined, the resulting two biomarker panel was 95% sensitive and 91% specific. These results were replicated in an independent validation cohort of 149 individuals, who were assayed using the same cutoff values for test positivity established in the training population. To progress toward non-endoscopic esophageal screening, we engineered a well-tolerated, swallowable, encapsulated balloon device able to selectively sample the distal esophagus within 5 minutes. In balloon samples from 86 individuals, tests of CCNA1 plus VIM DNA methylation detected BE metaplasia with 90.3% sensitivity and 91.7% specificity. Combining the balloon sampling device with molecular assays of CCNA1 plus VIM DNA methylation enables an efficient, well-tolerated, sensitive, and specific method of screening at-risk populations for BE. PMID:29343623

Glucose tolerance test - non-pregnant

MedlinePlus

Oral glucose tolerance test - non-pregnant; OGTT - non-pregnant; Diabetes - glucose tolerance test; Diabetic - glucose tolerance test ... The most common glucose tolerance test is the oral glucose ... the test begins, a sample of blood will be taken. You will then ...

Value of the intravenous and oral glucose tolerance tests for detecting subtle impairments in insulin sensitivity and beta-cell function in former gestational diabetes.

PubMed

Tura, A; Mari, A; Prikoszovich, T; Pacini, G; Kautzky-Willer, A

2008-08-01

Women with former gestational diabetes mellitus (fGDM) often show defects in both insulin sensitivity and beta-cell function but it is not clear which defect plays the major role or which appears first. This might be because fGDM women are often studied as a unique group and not divided according to their glucose tolerance. Different findings might also be the result of using different tests. Our aim was to study insulin sensitivity and beta-cell function with two independent glucose tolerance tests in fGDM women divided according to their glucose tolerance. A total of 108 fGDM women divided into normal glucose tolerance (IGT; N = 82), impaired glucose metabolism (IGM; N = 20) and overt type 2 diabetes (T2DM; N = 6) groups, and 38 healthy control women (CNT) underwent intravenous (IVGTT) and oral glucose tolerance tests (OGTT). Measurements Insulin sensitivity and beta-cell function were assessed by both the IVGTT and the OGTT. Both tests revealed impaired insulin sensitivity in the normotolerant group compared to controls (IVGTT: 4.2 +/- 0.3 vs. 5.4 +/- 0.4 10(-4) min(-1) (microU/ml)(-1); OGTT: 440 +/- 7 vs. 472 +/- 9 ml min(-1) m(-2)). Conversely, no difference was found in beta-cell function from the IVGTT. However, some parameters of beta-cell function by OGTT modelling analysis were found to be impaired: glucose sensitivity (106 +/- 5 vs. 124 +/- 7 pmol min(-1) m(-2) mm(-1), P = 0.0407) and insulin secretion at 5 mm glucose (168 +/- 9 vs. 206 +/- 10 pmol min(-1) m(-2), P = 0.003). Both insulin sensitivity and beta-cell function are impaired in normotolerant fGDM but the subtle defect in beta-cell function is disclosed only by OGTT modelling analysis.

Lack of correlation of desiccation and radiation tolerance in microorganisms from diverse extreme environments tested under anoxic conditions

PubMed Central

Bohmeier, Maria; Perras, Alexandra K; Schwendner, Petra; Rabbow, Elke; Moissl-Eichinger, Christine; Cockell, Charles S; Vannier, Pauline; Marteinsson, Viggo T; Monaghan, Euan P; Ehrenfreund, Pascale; Garcia-Descalzo, Laura; Gómez, Felipe; Malki, Moustafa; Amils, Ricardo; Gaboyer, Frédéric; Westall, Frances; Cabezas, Patricia; Walter, Nicolas; Rettberg, Petra

2018-01-01

Abstract Four facultative anaerobic and two obligate anaerobic bacteria were isolated from extreme environments (deep subsurface halite mine, sulfidic anoxic spring, mineral-rich river) in the frame MASE (Mars Analogues for Space Exploration) project. The isolates were investigated under anoxic conditions for their survivability after desiccation up to 6 months and their tolerance to ionizing radiation up to 3000 Gy. The results indicated that tolerances to both stresses are strain-specific features. Yersinia intermedia MASE-LG-1 showed a high desiccation tolerance but its radiation tolerance was very low. The most radiation-tolerant strains were Buttiauxella sp. MASE-IM-9 and Halanaerobium sp. MASE-BB-1. In both cases, cultivable cells were detectable after an exposure to 3 kGy of ionizing radiation, but cells only survived desiccation for 90 and 30 days, respectively. Although a correlation between desiccation and ionizing radiation resistance has been hypothesized for some aerobic microorganisms, our data showed that there was no correlation between tolerance to desiccation and ionizing radiation, suggesting that the physiological basis of both forms of tolerances is not necessarily linked. In addition, these results indicated that facultative and obligate anaerobic organisms living in extreme environments possess varied species-specific tolerances to extremes. PMID:29474542

Dynamics Impact Tolerance of Shuttle RCC Leading Edge Panels Using LS-DYNA

NASA Technical Reports Server (NTRS)

Fasanella, Edwin L.; Jackson, Karen E.; Lyle, Karen H.; Jones, Lisa E.; Hardy, Robin C.; Spellman, Regina L.; Carney, Kelly S.; Melis, Matthew E.; Stockwell, Alan E.

2005-01-01

This paper describes a research program conducted to enable accurate prediction of the impact tolerance of the shuttle Orbiter leading-edge wing panels using physics-based codes such as LS-DYNA, a nonlinear, explicit transient dynamic finite element code. The shuttle leading-edge panels are constructed of Reinforced-Carbon-Carbon (RCC) composite material, which is used because of its thermal properties to protect the shuttle during reentry into the Earth's atmosphere. Accurate predictions of impact damage from insulating foam and other debris strikes that occur during launch required materials characterization of expected debris, including strain-rate effects. First, analytical models of individual foam and RCC materials were validated. Next, analytical models of foam cylinders impacting 6- in. x 6-in. RCC flat plates were developed and validated. LS-DYNA pre-test models of the RCC flat plate specimens established the impact velocity of the test for three damage levels: no-detectable damage, non-destructive evaluation (NDE) detectable damage, or visible damage such as a through crack or hole. Finally, the threshold of impact damage for RCC on representative Orbiter wing panels was predicted for both a small through crack and for NDE-detectable damage.

Dynamic Impact Tolerance of Shuttle RCC Leading Edge Panels using LS-DYNA

NASA Technical Reports Server (NTRS)

Fasanella, Edwin; Jackson, Karen E.; Lyle, Karen H.; Jones, Lisa E.; Hardy, Robin C.; Spellman, Regina L.; Carney, Kelly S.; Melis, Matthew E.; Stockwell, Alan E.

2008-01-01

This paper describes a research program conducted to enable accurate prediction of the impact tolerance of the shuttle Orbiter leading-edge wing panels using 'physics-based- codes such as LS-DYNA, a nonlinear, explicit transient dynamic finite element code. The shuttle leading-edge panels are constructed of Reinforced-Carbon-Carbon (RCC) composite material, which issued because of its thermal properties to protect the shuttle during re-entry into the Earth's atmosphere. Accurate predictions of impact damage from insulating foam and other debris strikes that occur during launch required materials characterization of expected debris, including strain-rate effects. First, analytical models of individual foam and RCC materials were validated. Next, analytical models of individual foam cylinders impacting 6-in. x 6-in. RCC flat plates were developed and validated. LS-DYNA pre-test models of the RCC flat plate specimens established the impact velocity of the test for three damage levels: no-detectable damage, non-destructive evaluation (NDE) detectable damage, or visible damage such as a through crack or hole. Finally, the threshold of impact damage for RCC on representative Orbiter wing panels was predicted for both a small through crack and for NDE-detectable damage.

Model-Based Fault Tolerant Control

NASA Technical Reports Server (NTRS)

Kumar, Aditya; Viassolo, Daniel

2008-01-01

The Model Based Fault Tolerant Control (MBFTC) task was conducted under the NASA Aviation Safety and Security Program. The goal of MBFTC is to develop and demonstrate real-time strategies to diagnose and accommodate anomalous aircraft engine events such as sensor faults, actuator faults, or turbine gas-path component damage that can lead to in-flight shutdowns, aborted take offs, asymmetric thrust/loss of thrust control, or engine surge/stall events. A suite of model-based fault detection algorithms were developed and evaluated. Based on the performance and maturity of the developed algorithms two approaches were selected for further analysis: (i) multiple-hypothesis testing, and (ii) neural networks; both used residuals from an Extended Kalman Filter to detect the occurrence of the selected faults. A simple fusion algorithm was implemented to combine the results from each algorithm to obtain an overall estimate of the identified fault type and magnitude. The identification of the fault type and magnitude enabled the use of an online fault accommodation strategy to correct for the adverse impact of these faults on engine operability thereby enabling continued engine operation in the presence of these faults. The performance of the fault detection and accommodation algorithm was extensively tested in a simulation environment.

Direct and ecological costs of resistance and tolerance in the stinging nettle.

PubMed

Puustinen, Susanna; Koskela, Tanja; Mutikainen, Pia

2004-03-01

Plant resistance and tolerance to herbivores, parasites, pathogens, and abiotic factors may involve two types of costs. First, resistance and tolerance may be costly in terms of plant fitness. Second, resistance and tolerance to multiple enemies may involve ecological trade-offs. Our study species, the stinging nettle ( Urtica dioicaL.) has significant variation among seed families in resistance and tolerance as well as costs of resistance and tolerance to the holoparasitic plant Cuscuta europaea L. Here we report on variation among seed families (i.e. genetic) in tolerance to nutrient limitation and in resistance to both mammalian herbivores (i.e. number of stinging trichomes) and an invertebrate herbivore (i.e. inverse of the performance of a generalist snail, Arianta arbustorum). Our results indicate direct fitness costs of snail resistance in terms of host reproduction whereas we did not detect fitness costs of mammalian resistance or tolerance to nutrient limitation. We further tested for ecological trade-offs among tolerance or resistance to the parasitic plant, herbivore resistance, and tolerance to nutrient limitation in the stinging nettle. Tolerance of nettles to nutrient limitation and resistance to mammalian herbivores tended to correlate negatively. However, there were no significant correlations among resistance and tolerance to the different natural enemies (i.e. parasitic plants, snails, and mammals). The results of this greenhouse study thus suggest that resistance and tolerance of nettles to diverse enemies are free to evolve independently of each other but not completely without direct costs in terms of plant fitness.

Fault-tolerant Greenberger-Horne-Zeilinger paradox based on non-Abelian anyons.

PubMed

Deng, Dong-Ling; Wu, Chunfeng; Chen, Jing-Ling; Oh, C H

2010-08-06

We propose a scheme to test the Greenberger-Horne-Zeilinger paradox based on braidings of non-Abelian anyons, which are exotic quasiparticle excitations of topological states of matter. Because topological ordered states are robust against local perturbations, this scheme is in some sense "fault-tolerant" and might close the detection inefficiency loophole problem in previous experimental tests of the Greenberger-Horne-Zeilinger paradox. In turn, the construction of the Greenberger-Horne-Zeilinger paradox reveals the nonlocal property of non-Abelian anyons. Our results indicate that the non-Abelian fractional statistics is a pure quantum effect and cannot be described by local realistic theories. Finally, we present a possible experimental implementation of the scheme based on the anyonic interferometry technologies.

Reliability Assessment for Low-cost Unmanned Aerial Vehicles

NASA Astrophysics Data System (ADS)

Freeman, Paul Michael

Existing low-cost unmanned aerospace systems are unreliable, and engineers must blend reliability analysis with fault-tolerant control in novel ways. This dissertation introduces the University of Minnesota unmanned aerial vehicle flight research platform, a comprehensive simulation and flight test facility for reliability and fault-tolerance research. An industry-standard reliability assessment technique, the failure modes and effects analysis, is performed for an unmanned aircraft. Particular attention is afforded to the control surface and servo-actuation subsystem. Maintaining effector health is essential for safe flight; failures may lead to loss of control incidents. Failure likelihood, severity, and risk are qualitatively assessed for several effector failure modes. Design changes are recommended to improve aircraft reliability based on this analysis. Most notably, the control surfaces are split, providing independent actuation and dual-redundancy. The simulation models for control surface aerodynamic effects are updated to reflect the split surfaces using a first-principles geometric analysis. The failure modes and effects analysis is extended by using a high-fidelity nonlinear aircraft simulation. A trim state discovery is performed to identify the achievable steady, wings-level flight envelope of the healthy and damaged vehicle. Tolerance of elevator actuator failures is studied using familiar tools from linear systems analysis. This analysis reveals significant inherent performance limitations for candidate adaptive/reconfigurable control algorithms used for the vehicle. Moreover, it demonstrates how these tools can be applied in a design feedback loop to make safety-critical unmanned systems more reliable. Control surface impairments that do occur must be quickly and accurately detected. This dissertation also considers fault detection and identification for an unmanned aerial vehicle using model-based and model-free approaches and applies those algorithms to experimental faulted and unfaulted flight test data. Flight tests are conducted with actuator faults that affect the plant input and sensor faults that affect the vehicle state measurements. A model-based detection strategy is designed and uses robust linear filtering methods to reject exogenous disturbances, e.g. wind, while providing robustness to model variation. A data-driven algorithm is developed to operate exclusively on raw flight test data without physical model knowledge. The fault detection and identification performance of these complementary but different methods is compared. Together, enhanced reliability assessment and multi-pronged fault detection and identification techniques can help to bring about the next generation of reliable low-cost unmanned aircraft.

Design, assembly, and metrology of an oil-immersion microscope objective with long working distance

NASA Astrophysics Data System (ADS)

Peng, Wei-Jei; Lin, Wen-Lung; Kuo, Hui-Jean; Ho, Cheng-Fang; Hsu, Wei-Yao

2016-10-01

The design, tolerance sensitivity reduction, assembly, and optical bench test for an oil-immersion microscope objective with long working distance employed in a lattice light-sheet microscope is presented in this paper. In this application, the orthogonal excitation and detection objectives are dipped in an oil medium. The excitation objective focuses the incident laser beam to generate fluorescence on specimen for collecting by detection objective. The excitation objective is custom-designed to meet the requirement specification such as oil-immersion, the long working distance, and numerical aperture (NA) of 0.5, etc. To produce an acceptable point spread function (PSF) for effective excitation, the performance of the objective needs to be close to diffraction limit. Because the tolerance of the modulation transfer function (MTF) is more and more sensitive at higher spatial frequency, it is extremely critical to keep the performance after manufacture. Consequently, an insensitive optical design is very important for relaxing tolerance. We compare the design with and without tolerance sensitivity reduction, and the as-built MTF shows the result. Furthermore, the method for sensitivity reduction is presented. The opto-mechanical design and assembly method are also discussed. Eventually, the objective with five spherical lenses was fabricated. In optical bench test, the depth of the oil is sensitive to MTF, and it leads to the complicated adjustment. For solving this issue, we made an index-matching lens to replace oil for measurement easily. Finally, the measured MTF of the excitation objective can accomplish the requirement specification and successfully employed in a lattice light-sheet microscope.

Acetylcholinesterase Immobilized on Magnetic Beads for Pesticides Detection: Application to Olive Oil Analysis

PubMed Central

Ben Oujji, Najwa; Bakas, Idriss; Istamboulié, Georges; Ait-Ichou, Ihya; Ait-Addi, Elhabib; Rouillon, Régis; Noguer, Thierry

2012-01-01

This work presents the development of bioassays and biosensors for the detection of insecticides widely used in the treatment of olive trees. The systems are based on the covalent immobilisation of acetylcholinesterase on magnetic microbeads using either colorimetry or amperometry as detection technique. The magnetic beads were immobilised on screen-printed electrodes or microtitration plates and tested using standard solutions and real samples. The developed devices showed good analytical performances with limits of detection much lower than the maximum residue limit tolerated by international regulations, as well as a good reproducibility and stability. PMID:22969377

Acute tolerance to spinally administered morphine compares mechanistically with chronically induced morphine tolerance.

PubMed

Fairbanks, C A; Wilcox, G L

1997-09-01

The mechanistic similarity between acutely and chronically induced morphine tolerance has been previously proposed but remains largely unexplored. Our experiments examined the modulation of acutely induced tolerance to spinally administered morphine by agonists that affect the N-methyl-D-aspartate receptor and nitric oxide synthase systems. Antinociception was detected via the hot water (52.5 degrees C) tail flick test in mice. Intrathecal pretreatment with morphine (40 nmol) produced a 9.6-fold rightward shift in the morphine dose-response curve. This shift confirmed the induction of acute spinal morphine tolerance. Intrathecal copretreatment with the receptor antagonists (competitive and noncompetitive, respectively) dizolcipine (MK801, 3 nmol) or LY235959 (4 pmol) and morphine [40 nmol, intrathecally (i.t.)] attenuated acute tolerance to morphine measured 8 hr later. A 60-min pretreatment of 7-nitroindazole (6 nmol, i.t.), a selective neuronal NOS inhibitor, followed by administration of morphine (40 nmol, i.t.) blocked the induction of morphine tolerance. Intrathecal copretreatment with morphine (40 nmol, i.t.) and agmatine (4 nmol, i.t.), an imidazoline, receptor agonist and putative nitric oxide synthase inhibitor, almost completely abolished acute spinal morphine tolerance. The results of these experiments agree with previous reports using models of chronically induced morphine tolerance. This evidence supports the proposal that the mechanisms responsible for acute morphine tolerance parallel those underlying chronic morphine tolerance. This study attests to the powerful predictive value of acute induction as a model for morphine tolerance.

Laboratory Rodent Diets Contain Toxic Levels of Environmental Contaminants: Implications for Regulatory Tests

PubMed Central

Rocque, Louis-Marie; Spiroux de Vendômois, Joël; Séralini, Gilles-Eric

2015-01-01

The quality of diets in rodent feeding trials is crucial. We describe the contamination with environmental pollutants of 13 laboratory rodent diets from 5 continents. Measurements were performed using accredited methodologies. All diets were contaminated with pesticides (1-6 out of 262 measured), heavy metals (2-3 out of 4, mostly lead and cadmium), PCDD/Fs (1-13 out of 17) and PCBs (5-15 out of 18). Out of 22 GMOs tested for, Roundup-tolerant GMOs were the most frequently detected, constituting up to 48% of the diet. The main pesticide detected was Roundup, with residues of glyphosate and AMPA in 9 of the 13 diets, up to 370 ppb. The levels correlated with the amount of Roundup-tolerant GMOs. Toxic effects of these pollutants on liver, neurodevelopment, and reproduction are documented. The sum of the hazard quotients of the pollutants in the diets (an estimator of risk with a threshold of 1) varied from 15.8 to 40.5. Thus the chronic consumption of these diets can be considered at risk. Efforts toward safer diets will improve the reliability of toxicity tests in biomedical research and regulatory toxicology. PMID:26133768

Preliminary design of the redundant software experiment

NASA Technical Reports Server (NTRS)

Campbell, Roy; Deimel, Lionel; Eckhardt, Dave, Jr.; Kelly, John; Knight, John; Lauterbach, Linda; Lee, Larry; Mcallister, Dave; Mchugh, John

1985-01-01

The goal of the present experiment is to characterize the fault distributions of highly reliable software replicates, constructed using techniques and environments which are similar to those used in comtemporary industrial software facilities. The fault distributions and their effect on the reliability of fault tolerant configurations of the software will be determined through extensive life testing of the replicates against carefully constructed randomly generated test data. Each detected error will be carefully analyzed to provide insight in to their nature and cause. A direct objective is to develop techniques for reducing the intensity of coincident errors, thus increasing the reliability gain which can be achieved with fault tolerance. Data on the reliability gains realized, and the cost of the fault tolerant configurations can be used to design a companion experiment to determine the cost effectiveness of the fault tolerant strategy. Finally, the data and analysis produced by this experiment will be valuable to the software engineering community as a whole because it will provide a useful insight into the nature and cause of hard to find, subtle faults which escape standard software engineering validation techniques and thus persist far into the software life cycle.

Matrix effect on baked milk tolerance in children with IgE cow milk allergy.

PubMed

Miceli Sopo, S; Greco, M; Monaco, S; Bianchi, A; Cuomo, B; Liotti, L; Iacono, I D

Children with IgE-mediated cow's milk allergy (IgE-CMA) often tolerate baked milk within a wheat matrix. In our study we evaluated the impact of wheat matrix and of little standardised cooking procedures on tolerance of baked milk. We also tested tolerance versus parmigiano reggiano (PR) and whey-based partially hydrolysed formula (pHF). Forty-eight children with IgE-CMA were enrolled. They underwent prick-by-prick (PbP) and open oral food challenge (OFC) with baked cow's milk (CM), both within a wheat matrix (an Italian cake named ciambellone) and without (in a liquid form), with PR and with pHF. After a passed OFC, children continued to eat the food tolerated. In particular, after passed OFC with ciambellone, children were allowed to eat any food containing CM within a wheat matrix, with the only condition that it was baked at 180°C for at least 30min. Three months after, parents were asked to answer a survey. 81% of children tolerated ciambellone, 56% liquid baked CM, 78% PR and 82% pHF. Negative predictive value of PbP performed with tested foods was 100%. No IgE-mediated adverse reactions were detected at follow-up carried out by the survey. Wheat matrix effect on tolerance of baked milk was relevant in slightly less than half of cases. If our results are confirmed by larger studies, a negative PbP will allow patients to eat processed CM without undergoing OFC. Moreover, in order to guarantee tolerance towards baked milk, strict standardised cooking procedures do not seem to be necessary. Copyright © 2016 SEICAP. Published by Elsevier España, S.L.U. All rights reserved.

Effect of Sustained Human Centrifugation on Autonomic Cardiovascular and Vestibular Function

NASA Technical Reports Server (NTRS)

Schlegel, Todd T.; Wood, Scott J.; Brown, Troy E.; Benavides, Edgar W.; Harm, Deborah L.; Rupert, A. H.

2002-01-01

Repeated exposure to +Gz enhances human baroreflex responsiveness and improves tolerance to cardiovascular stress. However, both sustained exposure to +Gx and changes in otolith function resulting from the gravitational changes of space flight and parabolic flight may adversely affect autonomic cardiovascular function and orthostatic tolerance. HYPOTHESES: Baroreflex function and orthostatic tolerance are acutely improved by a single sustained (30 min) exposure to +3Gz but not +3Gx. Moreover, after 30 min of +3Gx, any changes that occur in autonomic cardiovascular function will relate commensurately to changes in otolith function. METHODS: Twenty-two healthy human subjects were first exposed to 5 min of +3 Gz centrifugation and then subsequently up to a total of30 min of either +3Gz (n = 15) or +3Gx (n = 7) centrifugation. Tests of autonomic cardiovascular function both before and after both types of centrifugation included: (a) power spectral determinations of beat-to-beat R-R intervals and arterial pressures; (b) carotid-cardiac baroreflex tests; ( c) Valsalva tests; and (d) 30-min head-up tilt (HUT) tests. Otolith function was assessed during centrifugation by the linear vestibulo-ocular reflex and both before and after centrifugation by measurements of ocular counter-rolling and dynamic posturography. RESULTS: All four +3Gz subjects who were intolerant to HUT before centrifugation became tolerant to HUT after centrifugation. The operational point of the carotid-cardiac baroreflex and the Valsalva-related baroreflex were also enhanced in the +3Gz group but not in the +3Gx group. No significant vestibular-autonomic relationships were detected, other than a significant vestibular-cerebrovascular interaction reported previously. CONCLUSIONS: A single, sustained exposure to +3 Gz centrifugation acutely improves baroreflex function and orthostatic tolerance whereas a similar exposure to +3 Gx centrifugation appears to have less effect.

Evaluation of Analgesia, Tolerance, and the Mechanism of Action of Morphine-6-O-Sulfate Across Multiple Pain Modalities in Sprague-Dawley Rats.

PubMed

Yadlapalli, Jai Shankar K; Dogra, Navdeep; Walbaum, Anqi W; Wessinger, William D; Prather, Paul L; Crooks, Peter A; Dobretsov, Maxim

2017-09-01

Morphine-6-O-sulfate (M6S) is a mixed μ/δ-opioid receptor (OR) agonist and potential alternative to morphine for treatment of chronic multimodal pain. To provide more support for this hypothesis, the antinociceptive effects of M6S and morphine were compared in tests that access a range of pain modalities, including hot plate threshold (HPT), pinprick sensitivity threshold (PST) and paw pressure threshold tests. Acutely, M6S was 2- to 3-fold more potent than morphine in HPT and PST tests, specifically, derived from best-fit analysis of dose-response relationships of morphine/M6S half-effective dose (ED50) ratios (lower, upper 95% confidence interval [CI]) were 2.8 (2.0-5.8) in HPT and 2.2 (2.1, 2.4) in PST tests. No differences in analgesic drug potencies were detected in the PPT test (morphine/M6S ED50 ratio 1.2 (95% CI, 0.8-1.4). After 7 to 9 days of chronic treatment, tolerance developed to the antinociceptive effects of morphine, but not to M6S, in all 3 pain tests. Morphine-tolerant rats were not crosstolerant to M6S. The antinociceptive effects of M6S were not sensitive to κ-OR antagonists. However, the δ-OR antagonist, naltrindole, blocked M6S-induced antinociception by 55% ± 4% (95% CI, 39-75) in the HPT test, 94% ± 4% (95% CI, 84-105) in the PST test, and 5% ± 17% (95% CI, -47 to 59) or 51% ± 14% (95% CI, 14-84; 6 rats per each group) in the paw pressure threshold test when examined acutely or after 7 days of chronic treatment, respectively. Activity via δ-ORs thus appears to be an important determinant of M6S action. M6S also exhibited favorable antinociceptive and tolerance profiles compared with morphine in 3 different antinociceptive assays, indicating that M6S may serve as a useful alternative for rotation in morphine-tolerant subjects.

Pollution-induced community tolerance in benthic macroinvertebrates of a mildly lead-contaminated lake.

PubMed

Oguma, Andrew Y; Klerks, Paul L

2017-08-01

Pollution-induced community tolerance (PICT) has been used to demonstrate effects of sediment contamination on microbes and meiofauna. Our study explored the potential to detect PICT in benthic macroinvertebrates of a lake with long-term mild lead (Pb) contamination. We collected macrobenthos from two areas in Caddo Lake, Texas, a control area (CO) with a mean sediment Pb level of 11 μg/g and Goose Prairie (GP) where sediment Pb levels averaged 74 μg/g. Upon return to the laboratory, we exposed macroinvertebrates to a lethal lead concentration and assessed 48-h mortality. Mortality of CO macrobenthos was significantly higher than that of GP macrobenthos, providing evidence that these communities differed in their tolerance to lead. A comparison of macrobenthos community composition between the areas showed that the GP macrobenthos lacked metal-sensitive taxa such as gastropods and amphipods (which were present at CO). Similarly, a higher proportion of the GP benthos belonged to metal-tolerant taxa such as isopods and chironomids. Thus, changes in community composition appeared to be at least partly responsible for differences in community tolerance. Our results showed that a sediment Pb concentration below effect-based sediment quality guidelines had a measurable impact on macrobenthos, thus demonstrating that results from single-species toxicity tests may underestimate impacts on communities. This study also confirms that the PICT approach with macroinvertebrates is a feasible and potentially powerful approach for detecting contaminant impacts.

Sensitivity and specificity of modified 100-g oral glucose tolerance tests for diagnosis of gestational diabetes mellitus.

PubMed

Hansarikit, Jarunee; Manotaya, Saknan

2011-05-01

To study the sensitivity and specificity of the modified 100-g oral glucose tolerance test for diagnosis of gestational diabetes mellitus (GDM). Medical records of pregnant women attending the antenatal clinic of King Chulalongkorn Memorial Hospital, Thailand, who underwent a 100-g oral glucose tolerance test (OGTT) during March 2004 to September 2009, were retrospectively reviewed. Three modified criteria were proposed for diagnosis of GDM. The screening efficacy of the modified criteria were assessed, using the National Diabetes Data Group (NDDG) criterion as gold standard. A total of 729 records were reviewed, 511 were included for analysis. Using the NDDG criterion as the gold standard, the modified II criterion has the highest sensitivity of 96.8%, and the highest accuracy of 90.8%. The modified II criterion can detect the same proportion of maternal and neonatal complications, compared to the NDDG criterion. The modified II criterion, using the fasting plasma glucose and 2-hour plasma glucose measurements, showed high sensitivity and accuracy, with moderate specificity for diagnosis of GDM. Its potential use as an alternative to standard 100-g OGTT should be evaluated in the prospective study.

Effectiveness of back-to-back testing

NASA Technical Reports Server (NTRS)

Vouk, Mladen A.; Mcallister, David F.; Eckhardt, David E.; Caglayan, Alper; Kelly, John P. J.

1987-01-01

Three models of back-to-back testing processes are described. Two models treat the case where there is no intercomponent failure dependence. The third model describes the more realistic case where there is correlation among the failure probabilities of the functionally equivalent components. The theory indicates that back-to-back testing can, under the right conditions, provide a considerable gain in software reliability. The models are used to analyze the data obtained in a fault-tolerant software experiment. It is shown that the expected gain is indeed achieved, and exceeded, provided the intercomponent failure dependence is sufficiently small. However, even with the relatively high correlation the use of several functionally equivalent components coupled with back-to-back testing may provide a considerable reliability gain. Implications of this finding are that the multiversion software development is a feasible and cost effective approach to providing highly reliable software components intended for fault-tolerant software systems, on condition that special attention is directed at early detection and elimination of correlated faults.

A Cross-Sectional Study of the Prevalence of Exercise-Induced Hypertension in Childhood Following Repair of Coarctation of the Aorta.

PubMed

Luitingh, Taryn L; Lee, Melissa G Y; Jones, Bryn; Kowalski, Remi; Weskamp Aguero, Sofia; Koleff, Jane; Zannino, Diana; Cheung, Michael M H; d'Udekem, Yves

2018-03-27

Exercise-testing may be a more tolerable method of detecting hypertension in children after coarctation repair compared to gold-standard 24-hour ambulatory blood pressure (BP) monitoring (ABPM). This study aims to determine the prevalence of exercise-induced hypertension and end-organ damage in children after coarctation repair, and the effectiveness of exercise-testing compared to 24-hour ABPM in this population. Exercise-testing (Bruce protocol), transthoracic echocardiogram, 24-hour ABPM, and pulse wave velocity were performed in 41 patients aged 8 to 18 years with previous coarctation repair. Median age at repair was 13 days. Exercise-testing data were compared to healthy paediatric controls. Hypertension was defined as BP >95th percentile on 24-hour ABPM compared to normalised data, and systolic BP (SBP) arbitrarily >200mmHg on exercise-testing. After 13±3years, 39% (14/36) were hypertensive on 24-hour ABPM and 12% (5/41) on exercise-testing. Coarctation patients had a higher peak exercise SBP and reduced endurance compared to controls (164±26mmHg vs. 148±19mmHg, p=0.003; and 13.0±1.7mins vs. 14.2±2.4mins, p=0.007; respectively). All patients with a peak exercise SBP >190mmHg were hypertensive on 24-hour ABPM. Pulse wave velocity was higher in hypertensive patients on exercise-testing and 24-hour ABPM compared to normotensive patients (p=0.004 and p=0.06; respectively). Exercise-testing may be a useful tool to detect hypertension in children and young adults after coarctation repair, particularly in those who do not tolerate 24-hour ABPM. Normative peak exercise BP data for age should be obtained to improve the accuracy of exercise-testing in detecting hypertension. Copyright © 2018 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Advanced information processing system: Fault injection study and results

NASA Technical Reports Server (NTRS)

Burkhardt, Laura F.; Masotto, Thomas K.; Lala, Jaynarayan H.

1992-01-01

The objective of the AIPS program is to achieve a validated fault tolerant distributed computer system. The goals of the AIPS fault injection study were: (1) to present the fault injection study components addressing the AIPS validation objective; (2) to obtain feedback for fault removal from the design implementation; (3) to obtain statistical data regarding fault detection, isolation, and reconfiguration responses; and (4) to obtain data regarding the effects of faults on system performance. The parameters are described that must be varied to create a comprehensive set of fault injection tests, the subset of test cases selected, the test case measurements, and the test case execution. Both pin level hardware faults using a hardware fault injector and software injected memory mutations were used to test the system. An overview is provided of the hardware fault injector and the associated software used to carry out the experiments. Detailed specifications are given of fault and test results for the I/O Network and the AIPS Fault Tolerant Processor, respectively. The results are summarized and conclusions are given.

Resistance to Antibiotics, Biocides, Preservatives and Metals in Bacteria Isolated from Seafoods: Co-Selection of Strains Resistant or Tolerant to Different Classes of Compounds

PubMed Central

Romero, José L.; Grande Burgos, María J.; Pérez-Pulido, Rubén; Gálvez, Antonio; Lucas, Rosario

2017-01-01

Multi-drug resistant bacteria (particularly those producing extended-spectrum β-lactamases) have become a major health concern. The continued exposure to antibiotics, biocides, chemical preservatives, and metals in different settings such as the food chain or in the environment may result in development of multiple resistance or co-resistance. The aim of the present study was to determine multiple resistances (biocides, antibiotics, chemical preservatives, phenolic compounds, and metals) in bacterial isolates from seafoods. A 75.86% of the 87 isolates studied were resistant to at least one antibiotic or one biocide, and 6.90% were multiply resistant to at least three biocides and at least three antibiotics. Significant (P < 0.05) moderate or strong positive correlations were detected between tolerances to biocides, between antibiotics, and between antibiotics with biocides and other antimicrobials. A sub-set of 30 isolates selected according to antimicrobial resistance profile and food type were identified by 16S rDNA sequencing and tested for copper and zinc tolerance. Then, the genetic determinants for biocide and metal tolerance and antibiotic resistance were investigated. The selected isolates were identified as Pseudomonas (63.33%), Acinetobacter (13.33%), Aeromonas (13.33%), Shewanella, Proteus and Listeria (one isolate each). Antibiotic resistance determinants detected included sul1 (43.33% of tested isolates), sul2 (6.66%), blaTEM (16.66%), blaCTX−M (16.66%), blaPSE (10.00%), blaIMP (3.33%), blaNDM−1 (3.33%), floR (16.66%), aadA1 (20.0%), and aac(6′)-Ib (16.66%). The only biocide resistance determinant detected among the selected isolates was qacEΔ1 (10.00%). A 23.30 of the selected isolates were able to grow on media containing 32 mM copper sulfate, and 46.60% on 8 mM zinc chloride. The metal resistance genes pcoA/copA, pcoR, and chrB were detected in 36.66, 6.66, and 13.33% of selected isolates, respectively. Twelve isolates tested positive for both metal and antibiotic resistance genes, including one isolate positive for the carbapenemase gene blaNDM−1 and for pcoA/copA. These results suggest that exposure to metals could co-select for antibiotic resistance and also highlight the potential of bacteria on seafoods to be involved in the transmission of antimicrobial resistance genes. PMID:28912764

Edge detection based on computational ghost imaging with structured illuminations

NASA Astrophysics Data System (ADS)

Yuan, Sheng; Xiang, Dong; Liu, Xuemei; Zhou, Xin; Bing, Pibin

2018-03-01

Edge detection is one of the most important tools to recognize the features of an object. In this paper, we propose an optical edge detection method based on computational ghost imaging (CGI) with structured illuminations which are generated by an interference system. The structured intensity patterns are designed to make the edge of an object be directly imaged from detected data in CGI. This edge detection method can extract the boundaries for both binary and grayscale objects in any direction at one time. We also numerically test the influence of distance deviations in the interference system on edge extraction, i.e., the tolerance of the optical edge detection system to distance deviation. Hopefully, it may provide a guideline for scholars to build an experimental system.

Induction of Multidrug Tolerance in Plasmodium falciparum by Extended Artemisinin Pressure

PubMed Central

Ménard, Sandie; Ben Haddou, Tanila; Ramadani, Arba Pramundita; Ariey, Frédéric; Iriart, Xavier; Beghain, Johann; Bouchier, Christiane; Witkowski, Benoit; Berry, Antoine; Mercereau-Puijalon, Odile

2015-01-01

Plasmodium falciparum resistance to artemisinin derivatives in Southeast Asia threatens global malaria control strategies. Whether delayed parasite clearance, which exposes larger parasite numbers to artemisinins for longer times, selects higher-grade resistance remains unexplored. We investigated whether long-lasting artemisinin pressure selects a novel multidrug-tolerance profile. Although 50% inhibitory concentrations for 10 antimalarial drugs tested were unchanged, drug-tolerant parasites showed higher recrudescence rates for endoperoxides, quinolones, and an antifolate, including partner drugs of recommended combination therapies, but remained susceptible to atovaquone. Moreover, the age range of intraerythrocytic stages able to resist artemisinin was extended to older ring forms and trophozoites. Multidrug tolerance results from drug-induced quiescence, which enables parasites to survive exposure to unrelated antimalarial drugs that inhibit a variety of metabolic pathways. This novel resistance pattern should be urgently monitored in the field because this pattern is not detected by current assays and represents a major threat to antimalarial drug policy. PMID:26401601

A methodology for testing fault-tolerant software

NASA Technical Reports Server (NTRS)

Andrews, D. M.; Mahmood, A.; Mccluskey, E. J.

1985-01-01

A methodology for testing fault tolerant software is presented. There are problems associated with testing fault tolerant software because many errors are masked or corrected by voters, limiter, or automatic channel synchronization. This methodology illustrates how the same strategies used for testing fault tolerant hardware can be applied to testing fault tolerant software. For example, one strategy used in testing fault tolerant hardware is to disable the redundancy during testing. A similar testing strategy is proposed for software, namely, to move the major emphasis on testing earlier in the development cycle (before the redundancy is in place) thus reducing the possibility that undetected errors will be masked when limiters and voters are added.

Effect of 30-min +3 Gz centrifugation on vestibular and autonomic cardiovascular function

NASA Technical Reports Server (NTRS)

Schlegel, Todd T.; Wood, Scott J.; Brown, Troy E.; Harm, Deborah L.; Rupert, A. H.

2003-01-01

INTRODUCTION: Repeated exposure to increased +Gz enhances human baroreflex responsiveness and improves tolerance to cardiovascular stress. However, it is not known whether such enhancements might also result from a single, more prolonged exposure to increased +Gz. Our study was designed to investigate whether baroreflex function and orthostatic tolerance are acutely improved by a single prolonged exposure to +3 Gz, and moreover, whether changes in autonomic cardiovascular function resulting from exposure to increased +Gz are correlated with changes in otolith function. METHODS: We exposed 15 healthy human subjects to +3 Gz centrifugation for up to 30 min or until symptoms of incipient G-induced loss of consciousness (G-LOC) ensued. Tests of autonomic cardiovascular function both before and after centrifugation included: 1) power spectral determinations of beat-to-beat R-R intervals and arterial pressures; 2) carotid-cardiac baroreflex tests; 3) Valsalva tests; and 4) 30-min head-up tilt tests. Otolith function was assessed during centrifugation by the linear vestibulo-ocular reflex and both before and after centrifugation by measurements of ocular counter-rolling and dynamic posturography. RESULTS: Of the 15 subjects who underwent prolonged +3 Gz, 4 were intolerant to 30 min of head-up tilt before centrifugation but became tolerant to such tilt after centrifugation. The Valsalva-related baroreflex as well as a measure of the carotid-cardiac baroreflex were also enhanced after centrifugation. No significant vestibular-autonomic relationships were detected beyond a vestibular-cerebrovascular interaction reported earlier in a subset of seven participants. CONCLUSIONS: A single prolonged exposure to +3 Gz centrifugation acutely improves baroreflex function and orthostatic tolerance.

A Swiss cheese error detection method for real-time EPID-based quality assurance and error prevention.

PubMed

Passarge, Michelle; Fix, Michael K; Manser, Peter; Stampanoni, Marco F M; Siebers, Jeffrey V

2017-04-01

To develop a robust and efficient process that detects relevant dose errors (dose errors of ≥5%) in external beam radiation therapy and directly indicates the origin of the error. The process is illustrated in the context of electronic portal imaging device (EPID)-based angle-resolved volumetric-modulated arc therapy (VMAT) quality assurance (QA), particularly as would be implemented in a real-time monitoring program. A Swiss cheese error detection (SCED) method was created as a paradigm for a cine EPID-based during-treatment QA. For VMAT, the method compares a treatment plan-based reference set of EPID images with images acquired over each 2° gantry angle interval. The process utilizes a sequence of independent consecutively executed error detection tests: an aperture check that verifies in-field radiation delivery and ensures no out-of-field radiation; output normalization checks at two different stages; global image alignment check to examine if rotation, scaling, and translation are within tolerances; pixel intensity check containing the standard gamma evaluation (3%, 3 mm) and pixel intensity deviation checks including and excluding high dose gradient regions. Tolerances for each check were determined. To test the SCED method, 12 different types of errors were selected to modify the original plan. A series of angle-resolved predicted EPID images were artificially generated for each test case, resulting in a sequence of precalculated frames for each modified treatment plan. The SCED method was applied multiple times for each test case to assess the ability to detect introduced plan variations. To compare the performance of the SCED process with that of a standard gamma analysis, both error detection methods were applied to the generated test cases with realistic noise variations. Averaged over ten test runs, 95.1% of all plan variations that resulted in relevant patient dose errors were detected within 2° and 100% within 14° (<4% of patient dose delivery). Including cases that led to slightly modified but clinically equivalent plans, 89.1% were detected by the SCED method within 2°. Based on the type of check that detected the error, determination of error sources was achieved. With noise ranging from no random noise to four times the established noise value, the averaged relevant dose error detection rate of the SCED method was between 94.0% and 95.8% and that of gamma between 82.8% and 89.8%. An EPID-frame-based error detection process for VMAT deliveries was successfully designed and tested via simulations. The SCED method was inspected for robustness with realistic noise variations, demonstrating that it has the potential to detect a large majority of relevant dose errors. Compared to a typical (3%, 3 mm) gamma analysis, the SCED method produced a higher detection rate for all introduced dose errors, identified errors in an earlier stage, displayed a higher robustness to noise variations, and indicated the error source. © 2017 American Association of Physicists in Medicine.

Diagnostic Accuracies of Glycated Hemoglobin, Fructosamine, and Homeostasis Model Assessment of Insulin Resistance in Predicting Impaired Fasting Glucose, Impaired Glucose Tolerance, or New Onset Diabetes After Transplantation.

PubMed

Rosettenstein, Kerri; Viecelli, Andrea; Yong, Kenneth; Nguyen, Hung Do; Chakera, Aron; Chan, Doris; Dogra, Gursharan; Lim, Ee Mun; Wong, Germaine; Lim, Wai H

2016-07-01

New onset diabetes after transplantation (NODAT) is associated with a 3-fold greater risk of cardiovascular disease events, with early identification and treatment potentially attenuating this risk. The optimal screening test to identify those with NODAT remains unclear, and the aim of this study was to examine the diagnostic accuracies of 4 screening tests in identifying impaired fasting glucose, impaired glucose tolerance (IGT), and NODAT. This is a single-center prospective cohort study of 83 nondiabetic kidney transplant recipients between 2008 and 2011. Oral glucose tolerance test was considered the gold standard in identifying IFG/IGT or NODAT. Diagnostic accuracies of random blood glucose, glycated hemoglobin (HBA1c), fructosamine, and Homeostasis Model Assessment-Insulin Resistance in predicting IFG/IGT or NODAT were assessed using the area under the receiver operating characteristic curve. Forty (48%) recipients had IFG/IGT or NODAT. Compared with HBA1c with adjusted area under the curve (AUC) of 0.88 (95% confidence interval [95% CI], 0.77-0.93), fructosamine was the most accurate test with adjusted AUC of 0.92 (95% CI, 0.83-0.96). The adjusted AUCs of random blood glucose and Homeostasis Model Assessment-Insulin Resistance in identifying IFG/IGT were between 0.81 and 0.85. Restricting to identifying IGT/NODAT using 2-hour oral glucose tolerance test (n = 66), fructosamine was the most accurate diagnostic test with adjusted AUC of 0.93 (95% CI, 0.84-0.99), but not statistically different to HBA1c with adjusted AUC of 0.88 (95% CI, 0.76-0.96). Although HBA1c is an acceptable and widely used screening test in detecting IFG/IGT or NODAT, fructosamine may be a more accurate diagnostic test but this needs to be further examined in larger cohorts.

[Tolerance and chronic acceptability of lupine (Lupinus albus var. Multolupa) flour for feeding of young adults].

PubMed

Gattás Zaror, V; Barrera Acevedo, G; Yáñez Soto, E; Uauy-Dagach Imbarack, R

1990-12-01

Cookies enriched with sweet lupin flour were tested for their acceptability and tolerance in young adults, and compared with control cookies. A number of hematological, hepatic and renal tests were performed, as well as the measurement of allergic response, in order to detect possible changes induced by lupin. The study included 31 young adults assigned to two groups which comprised males and females, with mean ages of 26 +/- 6.5, and 27 +/- 5.9 years, respectively. The protein and energy intakes of the subjects were calculated, prior to the study, using the methods of dietary history and the 24-hr recall method. The subjects were free of any abnormalities detectable by medical history, physical examination, biochemical and hematological tests. Body weight and height were measured before the beginning of the study. The ratio weight/height of the individuals was calculated using the Jelliffe's standards. The mean values for the calorie and protein intakes were 1,919 kcal (SD +/- 655) and 59.3 g (SD +/- 22.7). The calorie contents of the control and experimental cookies were 507 and 610 kcal respectively, while the protein contents were 8.4 g and 24.1 g, respectively. The body weight of subjects in both groups increased significantly during the study (P less than 0.01 and P less than 0.02). No significant changes were recorded for other anthropometric parameters, except for the tricipital skinfold (P less than 0.01). Changes observed in hematological parameters were judged to be unrelated to lupin flour. The acceptability and tolerance to high levels of lupin flour were good. The above-mentioned results show that sweet lupin flour is a good and safe source of energy and protein for adults.

Exploring new alleles for frost tolerance in winter rye.

PubMed

Erath, Wiltrud; Bauer, Eva; Fowler, D Brian; Gordillo, Andres; Korzun, Viktor; Ponomareva, Mira; Schmidt, Malthe; Schmiedchen, Brigitta; Wilde, Peer; Schön, Chris-Carolin

2017-10-01

Rye genetic resources provide a valuable source of new alleles for the improvement of frost tolerance in rye breeding programs. Frost tolerance is a must-have trait for winter cereal production in northern and continental cropping areas. Genetic resources should harbor promising alleles for the improvement of frost tolerance of winter rye elite lines. For frost tolerance breeding, the identification of quantitative trait loci (QTL) and the choice of optimum genome-based selection methods are essential. We identified genomic regions involved in frost tolerance of winter rye by QTL mapping in a biparental population derived from a highly frost tolerant selection from the Canadian cultivar Puma and the European elite line Lo157. Lines per se and their testcrosses were phenotyped in a controlled freeze test and in multi-location field trials in Russia and Canada. Three QTL on chromosomes 4R, 5R, and 7R were consistently detected across environments. The QTL on 5R is congruent with the genomic region harboring the Frost resistance locus 2 (Fr-2) in Triticeae. The Puma allele at the Fr-R2 locus was found to significantly increase frost tolerance. A comparison of predictive ability obtained from the QTL-based model with different whole-genome prediction models revealed that besides a few large, also small QTL effects contribute to the genomic variance of frost tolerance in rye. Genomic prediction models assigning a high weight to the Fr-R2 locus allow increasing the selection intensity for frost tolerance by genome-based pre-selection of promising candidates.

Tolerability of a Fully Maturated Cheese in Cow’s Milk Allergic Children: Biochemical, Immunochemical, and Clinical Aspects

PubMed Central

Alessandri, Claudia; Sforza, Stefano; Palazzo, Paola; Lambertini, Francesca; Paolella, Sara; Zennaro, Danila; Rafaiani, Chiara; Ferrara, Rosetta; Bernardi, Maria Livia; Santoro, Mario; Zuzzi, Sara; Giangrieco, Ivana; Dossena, Arnaldo; Mari, Adriano

2012-01-01

Background From patients’ reports and our preliminary observations, a fully maturated cheese (Parmigiano-Reggiano; PR) seems to be well tolerated by a subset of cow’s milk (CM) allergic patients. Objective and Methods To biochemically and immunologically characterize PR samples at different maturation stage and to verify PR tolerability in CM allergic children. Seventy patients, with suspected CM allergy, were enrolled. IgE to CM, α-lactalbumin (ALA), β-lactoglobulin (BLG) and caseins (CAS) were tested using ImmunoCAP, ISAC103 and skin prick test. Patients underwent a double-blind, placebo-controlled food challenge with CM, and an open food challenge with 36 months-maturated PR. Extracts obtained from PR samples were biochemically analyzed in order to determine protein and peptide contents. Pepsin and trypsin-chymotrypsin-pepsin simulated digestions were applied to PR extracts. Each PR extract was investigated by IgE Single Point Highest Inhibition Achievable assay (SPHIAa). The efficiency analysis was carried out using CM and PR oral challenges as gold standards. Results The IgE binding to milk allergens was 100% inhibited by almost all PR preparations; the only difference was for CAS, mainly αS1-CAS. Sixteen patients sensitized to CM tolerated both CM and PR; 29 patients tolerated PR only; 21 patients, reacted to both CM and PR, whereas 4 patients reactive to CM refused to ingest PR. ROC analysis showed that the absence of IgE to BLG measured by ISAC could be a good marker of PR tolerance. The SPHIAa using digested PR preparations showed a marked effect on IgE binding to CAS and almost none on ALA and BLG. Conclusions 58% of patients clinically reactive to CM tolerated fully maturated PR. The preliminary digestion of CAS induced by PR maturation process, facilitating a further loss of allergenic reactivity during gut digestion, might explain the tolerance. This hypothesis seems to work when no IgE sensitization to ISAC BLG is detected. PMID:22829901

Biomechanical tolerance of whole lumbar spines in straightened posture subjected to axial acceleration.

PubMed

Stemper, Brian D; Chirvi, Sajal; Doan, Ninh; Baisden, Jamie L; Maiman, Dennis J; Curry, William H; Yoganandan, Narayan; Pintar, Frank A; Paskoff, Glenn; Shender, Barry S

2018-06-01

Quantification of biomechanical tolerance is necessary for injury prediction and protection of vehicular occupants. This study experimentally quantified lumbar spine axial tolerance during accelerative environments simulating a variety of military and civilian scenarios. Intact human lumbar spines (T12-L5) were dynamically loaded using a custom-built drop tower. Twenty-three specimens were tested at sub-failure and failure levels consisting of peak axial forces between 2.6 and 7.9 kN and corresponding peak accelerations between 7 and 57 g. Military aircraft ejection and helicopter crashes fall within these high axial acceleration ranges. Testing was stopped following injury detection. Both peak force and acceleration were significant (p < 0.0001) injury predictors. Injury probability curves using parametric survival analysis were created for peak acceleration and peak force. Fifty-percent probability of injury (95%CI) for force and acceleration were 4.5 (3.9-5.2 kN), and 16 (13-19 g). A majority of injuries affected the L1 spinal level. Peak axial forces and accelerations were greater for specimens that sustained multiple injuries or injuries at L2-L5 spinal levels. In general, force-based tolerance was consistent with previous shorter-segment lumbar spine testing (3-5 vertebrae), although studies incorporating isolated vertebral bodies reported higher tolerance attributable to a different injury mechanism involving structural failure of the cortical shell. This study identified novel outcomes with regard to injury patterns, wherein more violent exposures produced more injuries in the caudal lumbar spine. This caudal migration was likely attributable to increased injury tolerance at lower lumbar spinal levels and a faster inertial mass recruitment process for high rate load application. Published 2017. This article is a U.S. Government work and is in the public domain in the USA. J Orthop Res 36:1747-1756, 2018. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

7 CFR 801.9 - Tolerances for test weight apparatuses.

Code of Federal Regulations, 2011 CFR

2011-01-01

... PERFORMANCE REQUIREMENTS FOR GRAIN INSPECTION EQUIPMENT § 801.9 Tolerances for test weight apparatuses. The maintenance tolerances for test weight per bushel apparatuses used in performing official inspection services... 7 Agriculture 7 2011-01-01 2011-01-01 false Tolerances for test weight apparatuses. 801.9 Section...

7 CFR 801.9 - Tolerances for test weight apparatuses.

Code of Federal Regulations, 2010 CFR

2010-01-01

... PERFORMANCE REQUIREMENTS FOR GRAIN INSPECTION EQUIPMENT § 801.9 Tolerances for test weight apparatuses. The maintenance tolerances for test weight per bushel apparatuses used in performing official inspection services... 7 Agriculture 7 2010-01-01 2010-01-01 false Tolerances for test weight apparatuses. 801.9 Section...

Clinical experience with video Head Impulse Test in children.

PubMed

Hülse, Roland; Hörmann, Karl; Servais, Jerôme José; Hülse, Manfred; Wenzel, Angela

2015-08-01

A standardized diagnostic protocol for children's vestibular assessment is still missing in daily clinical life. As rotatory chair testing and caloric test are usually not tolerated well by children, the aim of our study was not only to evaluate the importance and practicability of the video head impulse test performed in children with and without balance problems, but also to outline a diagnostic algorithm for children with balance problems. Fifty-five children aged 3-16 years have been included in this prospective monocentric study. Balance was assessed using results from health screening examinations of the participants and results from a specific dizziness questionnaire for children. The children were then divided in two groups: group I without any sign of vestibular development disorder and group II with possible signs for a pathological equilibrium development. Horizontal vestibulo-ocular reflex (HVOR) was assessed using a video-oculography system device (EyeSeeCam(©)). Gain at 40, 60, and 80ms and gain variance has been measured. Furthermore, it was evaluated how calibration of the system was tolerated by the participants, how the test itself was accomplishable in children, and which difficulties arose during testing. Reproducible test results were accomplished in 42 children (75%). Children with no balance problems in history showed a median gain of 1.02 (±0.28). A significant gain reduction between 40 and 80ms was found (P<0.05). Catch-up saccades were found in none of the children. Children with balance problems had a significantly reduced gain. (0.47±0.3; P<0.05) In this group, catch-up saccades could be detected in 4 out of 6 patients. For both groups, performing the test approximately took 20min, which is significantly longer than in adults (P<0.05). Calibration of the system with laser dots was easily doable in children aged 6 and older, whereas children between 3 and 5 years had better calibration results using colorful little icons. Video head impulse test is a sensitive and efficient vestibular test in children, which is tolerated well by children aged 3-16 years. Therefore, video head impulse test can be easily used as a screening tool to detect vestibular dysfunction in the pediatric population. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Integrated Application of Active Controls (IAAC) technology to an advanced subsonic transport project: Test act system validation

NASA Technical Reports Server (NTRS)

1985-01-01

The primary objective of the Test Active Control Technology (ACT) System laboratory tests was to verify and validate the system concept, hardware, and software. The initial lab tests were open loop hardware tests of the Test ACT System as designed and built. During the course of the testing, minor problems were uncovered and corrected. Major software tests were run. The initial software testing was also open loop. These tests examined pitch control laws, wing load alleviation, signal selection/fault detection (SSFD), and output management. The Test ACT System was modified to interface with the direct drive valve (DDV) modules. The initial testing identified problem areas with DDV nonlinearities, valve friction induced limit cycling, DDV control loop instability, and channel command mismatch. The other DDV issue investigated was the ability to detect and isolate failures. Some simple schemes for failure detection were tested but were not completely satisfactory. The Test ACT System architecture continues to appear promising for ACT/FBW applications in systems that must be immune to worst case generic digital faults, and be able to tolerate two sequential nongeneric faults with no reduction in performance. The challenge in such an implementation would be to keep the analog element sufficiently simple to achieve the necessary reliability.

Urinary Glucose Screening for Early Detection of Asymptomatic Type 2 Diabetes in Jeonbuk Province Korean Schoolchildren.

PubMed

Kim, Min Sun; Lee, Dae Yeol

2017-06-01

This study aimed to investigate the prevalence of glucosuria and the characteristics of diabetes in schoolchildren as detected by a school urine glucose screening program implemented from 2010 to 2013 in the Jeonbuk province area of Korea. A total of 110 children without known diabetes were analyzed. They were checked with an oral glucose tolerance test (OGTT) with other laboratory tests and their clinical data were collected. A total of 707,238 schoolchildren from a school population of 1,064,999 were screened for glucosuria. In total, over a 4-year period, 545 schoolchildren (0.077%) were positive for glucosuria on the second urine test. The prevalence of glucosuria was more common among middle and high schoolchildren than among elementary schoolchildren. Among 110 students who completed the OGTT to confirm diabetes, 40 were diagnosed with diabetes mellitus (DM); 39 children, type 2 diabetes mellitus (T2DM) and 1 child, slowly progressive insulin dependent diabetes mellitus (SPIDDM). The mean annual incidence of diabetes was 5.6 per 100,000 schoolchildren and adolescents. The subjects with diabetes diagnosed through the urine screening test showed minimal or no symptoms of diabetes. The students with diabetes were more likely to be woman and obese, and they have a higher body mass index, higher cholesterol, triglyceride, insulin, C-peptide, and fasting glucosuria values than the students with normal glucose tolerance. We identified 40 new cases of diabetes in the Korean schoolchildren with asymptomatic glucosuria on urine glucose screening. This finding shows that school urine glucose screening is a feasible and simple method for early detection of asymptomatic T2DM. © 2017 The Korean Academy of Medical Sciences.

Urinary Glucose Screening for Early Detection of Asymptomatic Type 2 Diabetes in Jeonbuk Province Korean Schoolchildren

PubMed Central

2017-01-01

This study aimed to investigate the prevalence of glucosuria and the characteristics of diabetes in schoolchildren as detected by a school urine glucose screening program implemented from 2010 to 2013 in the Jeonbuk province area of Korea. A total of 110 children without known diabetes were analyzed. They were checked with an oral glucose tolerance test (OGTT) with other laboratory tests and their clinical data were collected. A total of 707,238 schoolchildren from a school population of 1,064,999 were screened for glucosuria. In total, over a 4-year period, 545 schoolchildren (0.077%) were positive for glucosuria on the second urine test. The prevalence of glucosuria was more common among middle and high schoolchildren than among elementary schoolchildren. Among 110 students who completed the OGTT to confirm diabetes, 40 were diagnosed with diabetes mellitus (DM); 39 children, type 2 diabetes mellitus (T2DM) and 1 child, slowly progressive insulin dependent diabetes mellitus (SPIDDM). The mean annual incidence of diabetes was 5.6 per 100,000 schoolchildren and adolescents. The subjects with diabetes diagnosed through the urine screening test showed minimal or no symptoms of diabetes. The students with diabetes were more likely to be woman and obese, and they have a higher body mass index, higher cholesterol, triglyceride, insulin, C-peptide, and fasting glucosuria values than the students with normal glucose tolerance. We identified 40 new cases of diabetes in the Korean schoolchildren with asymptomatic glucosuria on urine glucose screening. This finding shows that school urine glucose screening is a feasible and simple method for early detection of asymptomatic T2DM. PMID:28480657

Graded Aerobic Treadmill Testing in Adolescent Traumatic Brain Injury Patients.

PubMed

Cordingley, Dean M; Girardin, Richard; Morissette, Marc P; Reimer, Karen; Leiter, Jeff; Russell, Kelly; Ellis, Michael J

2017-11-01

To examine the safety and tolerability of clinical graded aerobic treadmill testing in recovering adolescent moderate and severe traumatic brain injury (TBI) patients referred to a multidisciplinary pediatric concussion program. We completed a retrospective case series of two moderate and five severe TBI patients (mean age, 17.3 years) who underwent initial Buffalo Concussion Treadmill Testing at a mean time of 71.6 days (range, 55-87) postinjury. Six patients completed one graded aerobic treadmill test each and one patient underwent initial and repeat testing. There were no complications. Five initial treadmill tests were completely tolerated and allowed an accurate assessment of exercise tolerance. Two initial tests were terminated early by the treatment team because of neurological and cardiorespiratory limitations. As a result of testing, two patients were cleared for aerobic exercise as tolerated and four patients were treated with individually tailored submaximal aerobic exercise programs resulting in subjective improvement in residual symptoms and/or exercise tolerance. Repeat treadmill testing in one patient performed after 1 month of treatment with submaximal aerobic exercise prescription was suggestive of improved exercise tolerance. One patient was able to tolerate aerobic exercise following surgery for posterior glottic stenosis. Preliminary results suggest that graded aerobic treadmill testing is a safe, well tolerated, and clinically useful tool to assess exercise tolerance in appropriately selected adolescent patients with TBI. Future prospective studies are needed to evaluate the effect of tailored submaximal aerobic exercise prescription on exercise tolerance and patient outcomes in recovering adolescent moderate and severe TBI patients.

Low-Dose Cannabinoid Type 2 Receptor Agonist Attenuates Tolerance to Repeated Morphine Administration via Regulating μ-Opioid Receptor Expression in Walker 256 Tumor-Bearing Rats.

PubMed

Zhang, Mingyue; Wang, Kun; Ma, Min; Tian, Songyu; Wei, Na; Wang, Guonian

2016-04-01

Morphine is widely used in patients with moderate and severe cancer pain, whereas the development of drug tolerance remains a major problem associated with opioid use. Previous studies have shown that cannabinoid type 2 (CB2) receptor agonists induce morphine analgesia, attenuate morphine tolerance in normal and neuropathic pain animals, induce transcription of the μ-opioid receptor (MOR) gene in Jurkat T cells, and increase morphine analgesia in cancer pain animals. However, no studies of the effects of CB2 receptor agonists on morphine tolerance in cancer pain have been performed. Therefore, we investigated the effect of repeated intrathecal (IT) injection of the low-dose CB2 receptor agonist AM1241 on the development of morphine tolerance in walker 256 tumor-bearing rats. We also tested the influence of the CB2 receptor agonist AM1241 on MOR protein and messenger ribonucleic acid (mRNA) expression in the rat spinal cord and dorsal root ganglia (DRG). Walker 256 cells were implanted into the plantar region of each rat's right hindpaw. Tumor-bearing rats received IT injection of the CB2 receptor agonist AM1241 or antagonist AM630 with or without morphine subcutaneously twice daily for 8 days. Rats receiving drug vehicle only served as the control group. Mechanical paw withdrawal threshold and thermal paw withdrawal latency were assessed by a von Frey test and hot plate test 30 minutes after drug administration every day. MOR protein and mRNA expression in the spinal cord and DRG were detected after the last day (day 8) of drug administration via Western blot and real-time reverse transcription polymerase chain reaction. The data were analyzed via analysis of variance followed by Student t test with Bonferroni correction for multiple comparisons. Repeated morphine treatments reduced the mechanical withdrawal threshold and thermal latency. Coadministration of a nonanalgetic dose of the CB2 receptor agonist AM1241 with morphine significantly inhibited the development of morphine tolerance and increased the MOR protein expression in the spinal cord and DRG and mRNA expression in the spinal cord in tumor-bearing rats. Our findings indicate that IT injection of a nonanalgetic dose of a CB2 receptor agonist increased the analgesia effect and alleviated tolerance to morphine in tumor-bearing rats, potentially by regulating MOR expression in the spinal cord and DRG. This receptor may be a new target for prevention of the development of opioid tolerance in cancer pain.

Assessing the impacts of salinity and nutrient stress to Ruppia ...

EPA Pesticide Factsheets

Healthy seagrass beds were once found throughout the shallow areas of Narragansett Bay, R.I. but have disappeared due to infilling, pollution and disease. In Greenwich Bay, a highly developed embayment within Narragansett Bay, Ruppia maritima has colonized an area on the northern shore historically dominated by Zostera marina. Ruppia is extremely salinity tolerant, and may also be more nutrient tolerant than Zostera. To test this hypothesis 6-week microcosm experiments were conducted in the summers of 2014 and 2015. Microcosms were renewed daily to simulate tidal flushing and the water column was dosed with a 15N tracer for the first week of the experiments. In the 2014 microcosm experiment two salinity (20, 30 ppt) and four nutrient (0, 5, 10, 30 µM inorganic N) levels were used to test the species’ relative tolerance. This experiment yielded structurally significant results for Ruppia but no significant differences were detected for Zostera. In 2015 this experiment was performed for a second time with lower salinity (5, 30 ppt) and higher nutrients (0, 30, 100, 300, 1000 µM inorganic N) in order to determine Zostera’s tolerance to nutrient and salinity stress and confirm the previously observed Ruppia results. Both species had significant structural responses to the nutrient and salinity variables. Isotopic analysis run on above-ground tissue indicated that with increasing nutrient levels δ15N in the seagrass shoots increased, suggesting that nutrients

A double-blind, placebo-controlled, ascending-dose, randomized study to evaluate the safety, tolerability and effects on cognition of AL-108 after 12 weeks of intranasal administration in subjects with mild cognitive impairment.

PubMed

Morimoto, Bruce H; Schmechel, Don; Hirman, Joe; Blackwell, Andrew; Keith, Julian; Gold, Michael

2013-01-01

AL-108-211 was a placebo-controlled, ascending-dose study that explored the safety, tolerability and efficacy of 12 weeks of treatment with AL-108 in subjects with amnestic mild cognitive impairment. A total of 144 subjects were randomized in a 2:1 drug:placebo ratio. Subjects were enrolled into the low-dose group or placebo and then to the high-dose group or placebo. Pooling of the placebo groups yielded 3 groups (approx. 48/group) whose baseline demographics and disease characteristics were well matched. AL-108 was generally safe and well tolerated. Analyses of efficacy data failed to detect a statistically significant difference between the treatment groups on the composite cognitive memory score. Analyses of the individual cognitive tasks identified signals of potential efficacy in 2 tests of memory and attention. These data suggest that AL-108 was generally safe, well tolerated and merits additional investigation as a treatment for Alzheimer's disease. Copyright © 2013 S. Karger AG, Basel.

DOE Office of Scientific and Technical Information (OSTI.GOV)

DiCostanzo, D; Ayan, A; Woollard, J

Purpose: To automate the daily verification of each patient’s treatment by utilizing the trajectory log files (TLs) written by the Varian TrueBeam linear accelerator while reducing the number of false positives including jaw and gantry positioning errors, that are displayed in the Treatment History tab of Varian’s Chart QA module. Methods: Small deviations in treatment parameters are difficult to detect in weekly chart checks, but may be significant in reducing delivery errors, and would be critical if detected daily. Software was developed in house to read TLs. Multiple functions were implemented within the software that allow it to operate viamore » a GUI to analyze TLs, or as a script to run on a regular basis. In order to determine tolerance levels for the scripted analysis, 15,241 TLs from seven TrueBeams were analyzed. The maximum error of each axis for each TL was written to a CSV file and statistically analyzed to determine the tolerance for each axis accessible in the TLs to flag for manual review. The software/scripts developed were tested by varying the tolerance values to ensure veracity. After tolerances were determined, multiple weeks of manual chart checks were performed simultaneously with the automated analysis to ensure validity. Results: The tolerance values for the major axis were determined to be, 0.025 degrees for the collimator, 1.0 degree for the gantry, 0.002cm for the y-jaws, 0.01cm for the x-jaws, and 0.5MU for the MU. The automated verification of treatment parameters has been in clinical use for 4 months. During that time, no errors in machine delivery of the patient treatments were found. Conclusion: The process detailed here is a viable and effective alternative to manually checking treatment parameters during weekly chart checks.« less

MO-FG-202-01: A Fast Yet Sensitive EPID-Based Real-Time Treatment Verification System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahmad, M; Nourzadeh, H; Neal, B

2016-06-15

Purpose: To create a real-time EPID-based treatment verification system which robustly detects treatment delivery and patient attenuation variations. Methods: Treatment plan DICOM files sent to the record-and-verify system are captured and utilized to predict EPID images for each planned control point using a modified GPU-based digitally reconstructed radiograph algorithm which accounts for the patient attenuation, source energy fluence, source size effects, and MLC attenuation. The DICOM and predicted images are utilized by our C++ treatment verification software which compares EPID acquired 1024×768 resolution frames acquired at ∼8.5hz from Varian Truebeam™ system. To maximize detection sensitivity, image comparisons determine (1) ifmore » radiation exists outside of the desired treatment field; (2) if radiation is lacking inside the treatment field; (3) if translations, rotations, and magnifications of the image are within tolerance. Acquisition was tested with known test fields and prior patient fields. Error detection was tested in real-time and utilizing images acquired during treatment with another system. Results: The computational time of the prediction algorithms, for a patient plan with 350 control points and 60×60×42cm^3 CT volume, is 2–3minutes on CPU and <27 seconds on GPU for 1024×768 images. The verification software requires a maximum of ∼9ms and ∼19ms for 512×384 and 1024×768 resolution images, respectively, to perform image analysis and dosimetric validations. Typical variations in geometric parameters between reference and the measured images are 0.32°for gantry rotation, 1.006 for scaling factor, and 0.67mm for translation. For excess out-of-field/missing in-field fluence, with masks extending 1mm (at isocenter) from the detected aperture edge, the average total in-field area missing EPID fluence was 1.5mm2 the out-of-field excess EPID fluence was 8mm^2, both below error tolerances. Conclusion: A real-time verification software, with EPID images prediction algorithm, was developed. The system is capable of performing verifications between frames acquisitions and identifying source(s) of any out-of-tolerance variations. This work was supported in part by Varian Medical Systems.« less

Field assessment of a snap bean ozone bioindicator system under elevated ozone and carbon dioxide in a free air system

USDA-ARS?s Scientific Manuscript database

Ozone-sensitive (S156) and -tolerant (R123 and R331) genotypes of snap bean (Phaseolus vulgaris L.) were tested as a plant bioindicator system for detecting O3 effects at current and future levels of tropospheric O3 and atmospheric CO2 under field conditions. Plants were exposed to reciprocal combi...

Pavlovian control of cross-tolerance between pentobarbital and ethanol.

PubMed

Cappell, H; Roach, C; Poulos, C X

1981-01-01

Tolerance to several effects of a number of drugs has been shown to depend on Pavlovian conditioning processes. Experiment I extended the compensatory conditioning model (Siegel 1975) to tolerance to the hypothermic effect of pentobarbital (30 mg/kg). In Experiment I, rats that acquired hypothermic tolerance in one environment did not display tolerance when tested in an environment not previously associated with drug administration. In Experiment II, rats were made tolerant to the hypothermic effect of pentobarbital (30 mg/kg) and tested for cross-tolerance to ethanol (2.5 g/kg). Cross-tolerance was observed, but it was significantly reduced if the test was in an environment different from the one in which tolerance to pentobarbital was originally acquired. Thus, the compensatory conditioning model accounts for at least part of the tolerance and cross-tolerance to the thermic effects of alcohol and pentobarbital. The physiological processes in the CNS underlying tolerance and cross-tolerance for these drugs, therefore, are controlled by associative processes.

Interferometric Techniques for Gravitational Wave Detection in Space

NASA Technical Reports Server (NTRS)

Stebbins, Robin T; Bender, Peter L.

2000-01-01

The Laser Interferometer Space Antenna (LISA) mission will detect gravitational waves from galactic and extragalactic sources, most importantly those involving supermassive black holes. The primary goal of this project is to investigate stability and robustness issues associated with LISA interferometry. We specifically propose to study systematic errors arising from: optical misalignments, optical surface errors, thermal effects and pointing tolerances. This report covers the first fiscal year of the grant, from January 1st to December 31st 1999. We have employed an optical modeling tool to evaluate the effect of misplaced and misaligned optical components. Preliminary results seem to indicate that positional tolerances of one micron and angular tolerances of 0.6 millirad produce no significant effect on the achievable contrast of the interference pattern. This report also outlines research plans for the second fiscal year of the grant, from January 1st to December 31st 2000. Since the work under NAG5-6880 has gone more rapidly than projected, our test bed interferometer is operational, and can be used for measurements of effects that cause beam motion. Hence, we will design, build and characterize a sensor for measuring beam motion, and then install it. We are also planning a differential wavefront sensor based on a quadrant photodiode as a first generation sensor.

The US Navy’s Helicopter Integrated Diagnostics System (HIDS) Program: Power Drive Train Crack Detection Diagnostics and Prognostics Life Usage Monitoring and Damage Tolerance; Techniques, Methodologies, and Experiences

DTIC Science & Technology

2000-02-01

HIDS] Program: Power Drive Train Crack Detection Diagnostics and Prognostics ife Usage Monitoring and Damage Tolerance; Techniques, Methodologies, and...and Prognostics , Life Usage Monitoring , and Damage Tolerance; Techniques, Methodologies, and Experiences Andrew Hess Harrison Chin William Hardman...continuing program and deployed engine monitoring systems in fixed to evaluate helicopter diagnostic, prognostic , and wing aircraft, notably on the A

Error Mitigation of Point-to-Point Communication for Fault-Tolerant Computing

NASA Technical Reports Server (NTRS)

Akamine, Robert L.; Hodson, Robert F.; LaMeres, Brock J.; Ray, Robert E.

2011-01-01

Fault tolerant systems require the ability to detect and recover from physical damage caused by the hardware s environment, faulty connectors, and system degradation over time. This ability applies to military, space, and industrial computing applications. The integrity of Point-to-Point (P2P) communication, between two microcontrollers for example, is an essential part of fault tolerant computing systems. In this paper, different methods of fault detection and recovery are presented and analyzed.

The predictive value of specific immunoglobulin E levels in serum for the outcome of the development of tolerance in cow's milk allergy.

PubMed

Martorell, A; García Ara, M C; Plaza, A M; Boné, J; Nevot, S; Echeverria, L; Alonso, E; Garde, J

2008-01-01

Immunoglobulin E-mediated allergy to cow's milk protein (CMP) tends to subside over years of follow-up. The gold standard for detecting such allergy has been the oral challenge test. The development of some other test for determining the correct timing of the oral challenge test would avoid unnecessary patient discomfort. The aim of this study was to determine whether monitoring cow's milk (CM) specific IgE levels over time can be used as a predictor for determining when patients develop clinical tolerance. A prospective 4-year follow-up study was made of 170 patients with IgE-mediated allergy to CMP, involving periodic evaluations (12, 18, 24, 36 and 48 months) with the determination of casein and CM specific IgE on each visit, along with CM challenge testing. ROC curves were used to analyse the sensitivity, specificity and predictive values of the casein and CM specific IgE levels versus the challenge test outcomes at the different moments of follow-up. In the course of follow-up, 140 infants (82 %) became tolerant. Specific IgE levels to CM: 2.58, 2.5, 2.7, 2.26, 5 kU(A)/l and to casein: 0.97, 1.22, 3, 2.39, 2.73 kU(A)/l, respectively, predicted clinical reactivity (greatest diagnostic efficiency values) at the different analysed moments of follow-up (12, 18, 24, 36 and 48 months). Quantification of CMP specific IgE is a useful test for diagnosing symptomatic allergy to CM in the paediatric population, and could eliminate the need to perform oral challenges tests in a significant number of children.

Control system failure monitoring using generalized parity relations. M.S. Thesis Interim Technical Report

NASA Technical Reports Server (NTRS)

Vanschalkwyk, Christiaan Mauritz

1991-01-01

Many applications require that a control system must be tolerant to the failure of its components. This is especially true for large space-based systems that must work unattended and with long periods between maintenance. Fault tolerance can be obtained by detecting the failure of the control system component, determining which component has failed, and reconfiguring the system so that the failed component is isolated from the controller. Component failure detection experiments that were conducted on an experimental space structure, the NASA Langley Mini-Mast are presented. Two methodologies for failure detection and isolation (FDI) exist that do not require the specification of failure modes and are applicable to both actuators and sensors. These methods are known as the Failure Detection Filter and the method of Generalized Parity Relations. The latter method was applied to three different sensor types on the Mini-Mast. Failures were simulated in input-output data that were recorded during operation of the Mini-Mast. Both single and double sensor parity relations were tested and the effect of several design parameters on the performance of these relations is discussed. The detection of actuator failures is also treated. It is shown that in all the cases it is possible to identify the parity relations directly from input-output data. Frequency domain analysis is used to explain the behavior of the parity relations.

The benefits of the 3T3 NRU test in the safety assessment of cosmetics: long-term experience from pre-marketing testing in the Czech Republic.

PubMed

Jírová, D; Kejlová, K; Brabec, M; Bendová, H; Kolárová, H

2003-01-01

We have introduced the 3T3 NRU cytotoxicity test for methodological, economical and ethical reasons as a regular part of tier pre-marketing testing to assess local tolerance of raw materials for cosmetics, household chemicals and final cosmetic products. Using the 3T3 cell line according to the standard INVITTOX protocol No.64 (NRU Assay) the borderline concentration, relevant to the highest tolerated dose, is determined for each material. The toxic effect is reached at different concentration levels specific for individual cosmetics categories, depending on their chemical characteristics. Typical ranges of cytotoxicity for specific categories of cosmetics were established after testing of hundreds of materials. The range lies between 1 microg/ml (anti-dandruff shampoos), up to 2000 microg/ml (toothpastes and mouthwashes). The 3T3 NRU cytotoxicity test is a sensitive tool able to identify more aggressive products, that are also more likely to evoke irritation in human skin. It was even possible to detect protective effects of one natural herbal ingredient. The comparative study of cytotoxicity test results and human patch test results from a group of essential oils is presented. Cytotoxicity tests represent a highly ethical approach for estimation of irritancy. On the basis of in vitro test results suggesting low risk we can proceed to confirmatory tests in human volunteers.

Intraspecific variation in cadmium tolerance and accumulation of a high-biomass tropical tree Averrhoa carambola L.: implication for phytoextraction.

PubMed

Dai, Zi-yun; Shu, Wen-sheng; Liao, Bin; Wan, Cai-yun; Li, Jin-tian

2011-06-01

Averrhoa carambola L., a high-biomass tropical tree, has recently been shown to be a strong accumulator of cadmium (Cd) and has great potential for Cd phytoextraction. In the present study, field studies and a controlled-environment experiment were combined to establish the extent of variation in Cd tolerance and accumulation at the cultivar level using 14 to 19 cultivars of A. carambola. The results indicated that all cultivars tested could accumulate Cd at high but different levels, and that Cd tolerance also varied greatly between these cultivars. It is confirmed that the high Cd tolerance and accumulation capacity are species-level and constitutional traits in A. carambola. However, no correlation was detected between tolerance index and accumulation of Cd in different cultivars, suggesting that the two traits are independent in this woody Cd accumulator. More importantly, cultivar Wuchuan Sweet (WCT) was shown to have the highest Cd-extraction potential; it yielded a high shoot biomass of 30 t ha(-1) in 230 d, and extracted 330 g ha(-1) Cd in the aerial tissues grown in Cd-contaminated field soil, which accounted for 12.8% of the total soil Cd in the top 20 cm of the soil profile.

Performance of glycated haemoglobin (HbA1c) as a screening test for diabetes and impaired glucose tolerance (IGT) in a high risk population--the Brazilian Xavante Indians.

PubMed

Franco, L J; Dal Fabbro, A L; Martinez, E Z; Sartorelli, D S; Silva, A S; Soares, L P; Franco, L F; Kuhn, P C; Vieira-Filho, J P B; Moisés, R S

2014-11-01

To examine the properties of HbA1c to detect diabetes and IGT in adult Brazilian Xavante Indians, a high risk population for diabetes. The survey was carried out between October 2010 and January 2012 and based on a 75 g oral glucose tolerance test (OGTT). Basal and 2h capillary glycaemia were measured by HemoCue Glucose 201+; HbA1c using an automated high-performance liquid chromatography analyzer (Tosoh G7). 630 individuals aged ≥ 20 years were examined and 80 had a previous diagnosis of diabetes. Sensitivity, specificity and accuracy for HbA1c ≥ 6.5% (≥ 48 mmol/mol) were 71.3%, 90.5% and 87.2%. The areas under the ROC curve (AUC) was 0.88 (95%CI: 0.83-0.93). To identify IGT, HbA1c values between 5.7% and 6.4% (39-47 mmol/mol) presented sensitivity, specificity and accuracy of 87.2%, 24.7% and 51.4%, with an AUC of 0.62 (95%CI: 0.57-0.67). The ADA/WHO proposed cut-off of 6.5% (48 mmol/mol) for HbA1c was adequate to detect diabetes among the Xavante. However, the performance of the ADA proposed cut-off points for pre-diabetes, when used to detect IGT was inadequate and should not be recommended. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Probabilistic evaluation of on-line checks in fault-tolerant multiprocessor systems

NASA Technical Reports Server (NTRS)

Nair, V. S. S.; Hoskote, Yatin V.; Abraham, Jacob A.

1992-01-01

The analysis of fault-tolerant multiprocessor systems that use concurrent error detection (CED) schemes is much more difficult than the analysis of conventional fault-tolerant architectures. Various analytical techniques have been proposed to evaluate CED schemes deterministically. However, these approaches are based on worst-case assumptions related to the failure of system components. Often, the evaluation results do not reflect the actual fault tolerance capabilities of the system. A probabilistic approach to evaluate the fault detecting and locating capabilities of on-line checks in a system is developed. The various probabilities associated with the checking schemes are identified and used in the framework of the matrix-based model. Based on these probabilistic matrices, estimates for the fault tolerance capabilities of various systems are derived analytically.

Detection of drought tolerant genes within seedling apple rootstocks in Syria

USDA-ARS?s Scientific Manuscript database

This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

Novel drug and soluble target tolerant antidrug antibody assay for therapeutic antibodies bearing the P329G mutation.

PubMed

Wessels, Uwe; Schick, Eginhard; Ritter, Mirko; Kowalewsky, Frank; Heinrich, Julia; Stubenrauch, Kay

2017-06-01

Bridging immunoassays for detection of antidrug antibodies (ADAs) are typically susceptible to high concentrations of residual drug. Sensitive drug-tolerant assays are, therefore, needed. An immune complex assay to detect ADAs against therapeutic antibodies bearing Pro329Gly mutation was established. The assay uses antibodies specific for the Pro329Gly mutation for capture and human soluble Fcγ receptor for detection. When compared with a bridging assay, the new assay showed similar precision, high sensitivity to IgG1 ADA and dramatically improved drug tolerance. However, it was not able to detect early (IgM-based) immune responses. Applied in combination with a bridging assay, the novel assay serves as orthogonal assay for immunogenicity assessment and allows further characterization of ADA responses.

Demonstration of a quantum error detection code using a square lattice of four superconducting qubits

PubMed Central

Córcoles, A.D.; Magesan, Easwar; Srinivasan, Srikanth J.; Cross, Andrew W.; Steffen, M.; Gambetta, Jay M.; Chow, Jerry M.

2015-01-01

The ability to detect and deal with errors when manipulating quantum systems is a fundamental requirement for fault-tolerant quantum computing. Unlike classical bits that are subject to only digital bit-flip errors, quantum bits are susceptible to a much larger spectrum of errors, for which any complete quantum error-correcting code must account. Whilst classical bit-flip detection can be realized via a linear array of qubits, a general fault-tolerant quantum error-correcting code requires extending into a higher-dimensional lattice. Here we present a quantum error detection protocol on a two-by-two planar lattice of superconducting qubits. The protocol detects an arbitrary quantum error on an encoded two-qubit entangled state via quantum non-demolition parity measurements on another pair of error syndrome qubits. This result represents a building block towards larger lattices amenable to fault-tolerant quantum error correction architectures such as the surface code. PMID:25923200

Demonstration of a quantum error detection code using a square lattice of four superconducting qubits.

PubMed

Córcoles, A D; Magesan, Easwar; Srinivasan, Srikanth J; Cross, Andrew W; Steffen, M; Gambetta, Jay M; Chow, Jerry M

2015-04-29

The ability to detect and deal with errors when manipulating quantum systems is a fundamental requirement for fault-tolerant quantum computing. Unlike classical bits that are subject to only digital bit-flip errors, quantum bits are susceptible to a much larger spectrum of errors, for which any complete quantum error-correcting code must account. Whilst classical bit-flip detection can be realized via a linear array of qubits, a general fault-tolerant quantum error-correcting code requires extending into a higher-dimensional lattice. Here we present a quantum error detection protocol on a two-by-two planar lattice of superconducting qubits. The protocol detects an arbitrary quantum error on an encoded two-qubit entangled state via quantum non-demolition parity measurements on another pair of error syndrome qubits. This result represents a building block towards larger lattices amenable to fault-tolerant quantum error correction architectures such as the surface code.

Switch failure diagnosis based on inductor current observation for boost converters

NASA Astrophysics Data System (ADS)

Jamshidpour, E.; Poure, P.; Saadate, S.

2016-09-01

Face to the growing number of applications using DC-DC power converters, the improvement of their reliability is subject to an increasing number of studies. Especially in safety critical applications, designing fault-tolerant converters is becoming mandatory. In this paper, a switch fault-tolerant DC-DC converter is studied. First, some of the fastest Fault Detection Algorithms (FDAs) are recalled. Then, a fast switch FDA is proposed which can detect both types of failures; open circuit fault as well as short circuit fault can be detected in less than one switching period. Second, a fault-tolerant converter which can be reconfigured under those types of fault is introduced. Hardware-In-the-Loop (HIL) results and experimental validations are given to verify the validity of the proposed switch fault-tolerant approach in the case of a single switch DC-DC boost converter with one redundant switch.

BIOMARKERS OF OPERATIONAL TOLERANCE IN SOLID ORGAN TRANSPLANTATION

PubMed Central

Heidt, Sebastiaan; Wood, Kathryn J.

2012-01-01

Introduction Long-term immunosuppressive therapy represents a huge burden on transplant recipients, but currently cannot be omitted. Improving long-term transplant outcome by immunosuppressive drug withdrawal may be achieved in patients who have developed (partial) immunological unresponsiveness towards their graft, either spontaneously or through tolerance induction. Reliable biomarkers are essential to define such immunological unresponsiveness and will facilitate controlled immunosuppressive drug weaning as well as provide surrogate end-points for tolerance induction trials. Areas covered Tolerance biomarkers have been defined for both liver and kidney transplantation and can accurately identify operationally tolerant transplant recipients retrospectively. These two tolerance fingerprints are remarkably different, indicating the involvement of distinct mechanisms. Limited data suggest that tolerance biomarkers can be detected in immunosuppressed transplant recipients. Whether these patients can safely have their immunosuppressive drugs withdrawn needs to be established. Expert opinion Mechanistic interpretation of the kidney transplant tolerance biomarker profile dominated by B cell markers remains a challenge in light of experimental evidence suggesting the pivotal involvement of regulatory T cells. Therefore, defining animal models that resemble human transplant tolerance is crucial in understanding the underlying mechanisms. Additionally, to ensure patient safety while monitoring for tolerance, it is essential to develop biomarkers to non-invasively detect early signs of rejection as well. PMID:22988481

The Role of Heat Tolerance Testing in Recovery and Return to Duty

DTIC Science & Technology

2008-10-01

CV diseases Hyperthyroidism Pheochromocytoma Infectious diseases Diabetes mellitus Psychiatric illness Parkinsonism Congenital abnormalities: CF...environments. To assess the heat tolerance status of prior heat stroke patient. Heat tolerance test (HTT) “HTT was effective in evaluating the heat tolerance

Detecting damage in full-scale honeycomb sandwich composite curved fuselage panels through frequency response

NASA Astrophysics Data System (ADS)

Leone, Frank A., Jr.; Ozevin, Didem; Mosinyi, Bao; Bakuckas, John G., Jr.; Awerbuch, Jonathan; Lau, Alan; Tan, Tein-Min

2008-03-01

Preliminary tests were conducted using frequency response (FR) characteristics to determine damage initiation and growth in a honeycomb sandwich graphite/epoxy curved panel. This investigation was part of a more general study investigating the damage tolerance characteristics of several such panels subjected to quasi-static internal pressurization combined with hoop and axial loading. The panels were tested at the Full-Scale Aircraft Structural Test Evaluation and Research (FASTER) facility located at the Federal Aviation Administration William J. Hughes Technical Center in Atlantic City, NJ. The overall program objective was to investigate the damage tolerance characteristics of full-scale composite curved aircraft fuselage panels and the evolution of damage under quasi-static loading up to failure. This paper focuses on one aspect of this comprehensive investigation: the effect of state-of-damage on the characteristics of the frequency response of the subject material. The results presented herein show that recording the frequency response could be used for real-time monitoring of damage growth and in determining damage severity in full-scale composites fuselage aircraft structures.

Detection of some safe plant-derived foods for LTP-allergic patients.

PubMed

Asero, Riccardo; Mistrello, Gianni; Roncarolo, Daniela; Amato, Stefano

2007-01-01

Lipid transfer protein (LTP) is a widely cross-reacting plant pan-allergen. Adverse reactions to Rosaceae, tree nuts, peanut, beer, maize, mustard, asparagus, grapes, mulberry, cabbage, dates, orange, fig, kiwi, lupine, fennel, celery, tomato, eggplant, lettuce, chestnut and pineapple have been recorded. To detect vegetable foods to be regarded as safe for LTP-allergic patients. Tolerance/intolerance to a large spectrum of vegetable foods other than Rosaceae, tree nuts and peanut was assessed by interview in 49 subjects monosensitized to LTP and in three distinct groups of controls monosensitized to Bet v 1 (n = 24) or Bet v 2 (n = 18), or sensitized to both LTP and birch pollen (n = 16), all with a history of vegetable food allergy. Patients and controls underwent skin prick test (SPT) with a large spectrum of vegetable foods. The absence of IgE reactivity to foods that were negative in both clinical history and SPT was confirmed by immunoblot analysis and their clinical tolerance was finally assessed by open oral challenge (50 g per food). All patients reported tolerance and showed negative SPT to carrot, potato, banana and melon; these foods scored positive in SPT and elicited clinical symptoms in a significant proportion of patients from all three control groups. All patients tolerated these four foods on oral challenge. Immunoblot analysis confirmed the lack of IgE reactivity to these foods by LTP-allergic patients. Carrot, potato, banana and melon seem safe for LTP-allergic patients. This finding may be helpful for a better management of allergy to LTP.

Effect of ozone on diverse tall fescue germplasm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnston, W.J.; Dickens, R.; Haaland, R.L.

Six tall fescue (Festuca arundinacea Schreb.) genotypes of diverse origin (Algeria, Australia, France, Netherlands, Morocco, and a Kentucky 31 type) were evaluated for O/sub 3/ tolerance under controlled environmental conditions. In two tests on clonal parent material, (1) O/sub 3/ constant 0.3 ppm and exposure varied 0-12 hr and (2) O/sub 3/ concentration varied 0-0.5 ppm and exposure varied 1-3 hr, the Australian and Kentucky 31 selections were superior to all others in O/sub 3/ tolerance. Sixteen-day old polycross progeny of the six selections were exposed to 0.5 ppm O/sub 3/ for 0, 3, or 6 hr. Progeny of themore » Australian and Kentucky 31 selections were superior to some, but not all other selections. Increased duration of exposure increased damage only slightly. It would appear that O/sub 3/ tolerance is a heritable characteristic that can be easily detected and selected for in tall fescue.« less

Should glycated haemoglobin (HbA1c) be used to detect people with type 2 diabetes mellitus and impaired glucose regulation?

PubMed

Mostafa, Samiul A; Davies, Melanie J; Srinivasan, Balasubramanian Thiagarajan; Carey, Marian E; Webb, David; Khunti, Kamlesh

2010-11-01

There is a need to simplify screening tests for type 2 diabetes mellitus (T2DM) so patients can be identified earlier and more efficiently. Glycated haemoglobin (HbA1c) has been recommended by some international organisations as a diagnostic tool for detecting T2DM and impaired glucose regulation (IGR, also termed prediabetes and includes impaired fasting glucose and/or impaired glucose tolerance). The HbA1c cut-point of ≥6.5% (48 mmol/mol) has been selected as diagnostic for T2DM, while the cut-points for IGR are debated by the different international organisations: an International Expert Committee has suggested using HbA1c 6.0-6.4% (42-46 mmol/mol); however, the American Diabetes Association has recommended using HbA1c 5.7-6.4% (39-46 mmol/mol). Some countries will adopt a new method of reporting HbA1c values in millimoles per mole (mmol/mol). Use of HbA1c has some logistical advantages over using an oral glucose tolerance test (OGTT). As patients do not need to fast, appointments do not need to be limited to the morning. The HbA1c result reflects longer term glycaemia and is less affected by recent physical/emotional stress. However, there is some debate as to whether HbA1c should replace fasting plasma glucose or the OGTT. As the two tests detect different people, some individuals with diabetes detected on OGTT will no longer be classified as having T2DM using HbA1c ≥6.5% criteria. Furthermore, some medical conditions can result in HbA1c assay measurements not reflecting glycaemic control over the last 2-3 months; these include haematological disorders, renal failure, and chronic excess alcohol consumption.

Case Study of Using High Performance Commercial Processors in Space

NASA Technical Reports Server (NTRS)

Ferguson, Roscoe C.; Olivas, Zulema

2009-01-01

The purpose of the Space Shuttle Cockpit Avionics Upgrade project (1999 2004) was to reduce crew workload and improve situational awareness. The upgrade was to augment the Shuttle avionics system with new hardware and software. A major success of this project was the validation of the hardware architecture and software design. This was significant because the project incorporated new technology and approaches for the development of human rated space software. An early version of this system was tested at the Johnson Space Center for one month by teams of astronauts. The results were positive, but NASA eventually cancelled the project towards the end of the development cycle. The goal to reduce crew workload and improve situational awareness resulted in the need for high performance Central Processing Units (CPUs). The choice of CPU selected was the PowerPC family, which is a reduced instruction set computer (RISC) known for its high performance. However, the requirement for radiation tolerance resulted in the re-evaluation of the selected family member of the PowerPC line. Radiation testing revealed that the original selected processor (PowerPC 7400) was too soft to meet mission objectives and an effort was established to perform trade studies and performance testing to determine a feasible candidate. At that time, the PowerPC RAD750s were radiation tolerant, but did not meet the required performance needs of the project. Thus, the final solution was to select the PowerPC 7455. This processor did not have a radiation tolerant version, but had some ability to detect failures. However, its cache tags did not provide parity and thus the project incorporated a software strategy to detect radiation failures. The strategy was to incorporate dual paths for software generating commands to the legacy Space Shuttle avionics to prevent failures due to the softness of the upgraded avionics.

Case Study of Using High Performance Commercial Processors in a Space Environment

NASA Technical Reports Server (NTRS)

Ferguson, Roscoe C.; Olivas, Zulema

2009-01-01

The purpose of the Space Shuttle Cockpit Avionics Upgrade project was to reduce crew workload and improve situational awareness. The upgrade was to augment the Shuttle avionics system with new hardware and software. A major success of this project was the validation of the hardware architecture and software design. This was significant because the project incorporated new technology and approaches for the development of human rated space software. An early version of this system was tested at the Johnson Space Center for one month by teams of astronauts. The results were positive, but NASA eventually cancelled the project towards the end of the development cycle. The goal to reduce crew workload and improve situational awareness resulted in the need for high performance Central Processing Units (CPUs). The choice of CPU selected was the PowerPC family, which is a reduced instruction set computer (RISC) known for its high performance. However, the requirement for radiation tolerance resulted in the reevaluation of the selected family member of the PowerPC line. Radiation testing revealed that the original selected processor (PowerPC 7400) was too soft to meet mission objectives and an effort was established to perform trade studies and performance testing to determine a feasible candidate. At that time, the PowerPC RAD750s where radiation tolerant, but did not meet the required performance needs of the project. Thus, the final solution was to select the PowerPC 7455. This processor did not have a radiation tolerant version, but faired better than the 7400 in the ability to detect failures. However, its cache tags did not provide parity and thus the project incorporated a software strategy to detect radiation failures. The strategy was to incorporate dual paths for software generating commands to the legacy Space Shuttle avionics to prevent failures due to the softness of the upgraded avionics.

Improved radiation tolerance of MAPS using a depleted epitaxial layer

NASA Astrophysics Data System (ADS)

Dorokhov, A.; Bertolone, G.; Baudot, J.; Brogna, A. S.; Colledani, C.; Claus, G.; De Masi, R.; Deveaux, M.; Dozière, G.; Dulinski, W.; Fontaine, J.-C.; Goffe, M.; Himmi, A.; Hu-Guo, Ch.; Jaaskelainen, K.; Koziel, M.; Morel, F.; Santos, C.; Specht, M.; Valin, I.; Voutsinas, G.; Wagner, F. M.; Winter, M.

2010-12-01

Tracking performance of Monolithic Active Pixel Sensors (MAPS) developed at IPHC (Turchetta, et al., 2001) [1] have been extensively studied (Winter, et al., 2001; Gornushkin, et al., 2002) [2,3]. Numerous sensor prototypes, called MIMOSA, were fabricated and tested since 1999 in order to optimise the charge collection efficiency and power dissipation, to minimise the noise and to increase the readout speed. The radiation tolerance was also investigated. The highest fluence tolerable for a 10 μm pitch device was found to be ˜1013 neq/cm2, while it was only 2×1012 neq/cm2 for a 20 μm pitch device. The purpose of this paper is to show that the tolerance to non-ionising radiation may be extended up to O(10 14) n eq/cm 2. This goal relies on a fabrication process featuring a 15 μm thin, high resistivity ( ˜1 kΩ cm) epitaxial layer. A sensor prototype (MIMOSA-25) was fabricated in this process to explore its detection performance. The depletion depth of the epitaxial layer at standard CMOS voltages ( <5 V) is similar to the layer thickness. Measurements with m.i.p.s show that the charge collected in the seed pixel is at least twice larger for the depleted epitaxial layer than for the undepleted one, translating into a signal-to-noise ratio (SNR) of ˜50. Tests after irradiation have shown that this excellent performance is maintained up to the highest fluence considered ( 3×1013 neq/cm2), making evidence of a significant extension of the radiation tolerance limits of MAPS. Standing for minimum ionising particle.

Glucose in vaginal secretions before and after oral glucose tolerance testing in women with and without recurrent vulvovaginal candidiasis.

PubMed

Ehrström, Sophia; Yu, Anna; Rylander, Eva

2006-12-01

To measure the change of glucose in vaginal secretions during glucose tolerance testing in women with recurrent vulvovaginal candidiasis and in healthy control subjects. Thirty-eight women with recurrent vulvovaginal candidiasis and 45 healthy, age-matched controls completed a health questionnaire regarding general and gynecologic health and food and alcohol habits. They all underwent an oral glucose tolerance test and a vaginal examination. Vaginal secretion was collected from the proximal part of the vagina. Glucose in plasma and in vaginal secretions were measured at fasting and after 2 hours and analyzed with the hexokinase method. A sample size analysis showed that the number of subjects included in the study was sufficient for a beta value of 0.80, at the significance level of alpha=.05, at a difference in glucose in vaginal secretions of 30% after oral glucose tolerance test. In healthy women, the median level of glucose in vaginal secretions was 5.2 mM before and 3.7 mM after oral glucose tolerance test, and plasma glucose was 5.0 mM before and 5.8 mM after oral glucose tolerance test. No significant difference was seen regarding change of glucose level in vaginal secretions and plasma glucose after testing, compared with before oral glucose tolerance testing. There were no differences between women with recurrent vulvovaginal candidiasis and control subjects regarding change in glucose level in vaginal secretions or in plasma during oral glucose tolerance test. II-2.

Variables affecting results of sodium chloride tolerance test for identification of rapidly growing mycobacteria.

PubMed

Conville, P S; Witebsky, F G

1998-06-01

The sodium chloride tolerance test is often used in the identification of rapidly growing mycobacteria, particularly for distinguishing between Mycobacterium abscessus and Mycobacterium chelonae. This test, however, is frequently unreliable for the identification of some species. In this study we examined the following variables: medium manufacturer, inoculum concentration, and atmosphere and temperature of incubation. Results show that reliability is improved if the test and control slants are inoculated with an organism suspension spectrophotometrically equal to a 1 McFarland standard. Slants should be incubated at 35 degrees C in ambient air and checked weekly for 4 weeks. Growth on control slants should be critically evaluated to determine the adequacy of the inoculum; colonies should number greater than 50. Salt-containing media should be examined carefully to detect pinpoint or tiny colonies, and colonies should number greater than 50 for a positive reaction. Concurrent use of a citrate slant may be helpful for distinguishing between M. abscessus and M. chelonae. Molecular methodologies are probably the most reliable means for the identification of rapidly growing mycobacteria and should be used, if possible, when unequivocal species identification is of particular importance.

Variables Affecting Results of Sodium Chloride Tolerance Test for Identification of Rapidly Growing Mycobacteria

PubMed Central

Conville, Patricia S.; Witebsky, Frank G.

1998-01-01

The sodium chloride tolerance test is often used in the identification of rapidly growing mycobacteria, particularly for distinguishing between Mycobacterium abscessus and Mycobacterium chelonae. This test, however, is frequently unreliable for the identification of some species. In this study we examined the following variables: medium manufacturer, inoculum concentration, and atmosphere and temperature of incubation. Results show that reliability is improved if the test and control slants are inoculated with an organism suspension spectrophotometrically equal to a 1 McFarland standard. Slants should be incubated at 35°C in ambient air and checked weekly for 4 weeks. Growth on control slants should be critically evaluated to determine the adequacy of the inoculum; colonies should number greater than 50. Salt-containing media should be examined carefully to detect pinpoint or tiny colonies, and colonies should number greater than 50 for a positive reaction. Concurrent use of a citrate slant may be helpful for distinguishing between M. abscessus and M. chelonae. Molecular methodologies are probably the most reliable means for the identification of rapidly growing mycobacteria and should be used, if possible, when unequivocal species identification is of particular importance. PMID:9620376

Evaluation of culture- and PCR-based detection methods for Escherichia coli O157:H7 in inoculated ground beeft.

PubMed

Arthur, Terrance M; Bosilevac, Joseph M; Nou, Xiangwu; Koohmaraie, Mohammad

2005-08-01

Currently, several beef processors employ test-and-hold systems for increased quality control of ground beef. In such programs, each lot of product must be tested and found negative for Escherichia coli O157:H7 prior to release of the product into commerce. Optimization of three testing attributes (detection time, specificity, and sensitivity) is critical to the success of such strategies. Because ground beef is a highly perishable product, the testing methodology used must be as rapid as possible. The test also must have a low false-positive result rate so product is not needlessly discarded. False-negative results cannot be tolerated because they would allow contaminated product to be released and potentially cause disease. In this study, two culture-based and three PCR-based methods for detecting E. coli O157:H7 in ground beef were compared for their abilities to meet the above criteria. Ground beef samples were individually spiked with five genetically distinct strains of E. coli O157: H7 at concentrations of 17 and 1.7 CFU/65 g and then subjected to the various testing methodologies. There was no difference (P > 0.05) in the abilities of the PCR-based methods to detect E. coli O157:H7 inoculated in ground beef at 1.7 CFU/65 g. The culture-based systems detected more positive samples than did the PCR-based systems, but the detection times (21 to 48 h) were at least 9 h longer than those for the PCR-based methods (7.5 to 12 h). Ground beef samples were also spiked with potentially cross-reactive strains. The PCR-based systems that employed an immunomagnetic separation step prior to detection produced fewer false-positive results.

Fuel containment and damage tolerance for large composite primary aircraft structures. Phase 1: Testing

NASA Technical Reports Server (NTRS)

Sandifer, J. P.

1983-01-01

Technical problems associated with fuel containment and damage tolerance of composite material wings for transport aircraft were identified. The major tasks are the following: (1) the preliminary design of damage tolerant wing surface using composite materials; (2) the evaluation of fuel sealing and lightning protection methods for a composite material wing; and (3) an experimental investigation of the damage tolerant characteristics of toughened resin graphite/epoxy materials. The test results, the test techniques, and the test data are presented.

Detection of QTLs for salt tolerance in Asian barley (Hordeum vulgare L.) by association analysis with SNP markers

PubMed Central

Sbei, Hanen; Sato, Kazuhiro; Shehzad, Tariq; Harrabi, Moncef; Okuno, Kazutoshi

2014-01-01

Two hundred ninety-six Asian barley (Hordeum vulgare L.) accessions were assessed to detect QTLs underlying salt tolerance by association analysis using a 384 single nucleotide polymorphism (SNP) marker system. The experiment was laid out at the seedling stage in a hydroponic solution under control and 250 mM NaCl solution with three replications of four plants each. Salt tolerance was assessed by leaf injury score (LIS) and salt tolerance indices (STIs) of the number of leaves (NL), shoot length (SL), root length (RL), shoot dry weight (SDW) and root dry weight (RDW). LIS was scored from 1 to 5 according to the severity of necrosis and chlorosis observed on leaves. There was a wide variation in salt tolerance among Asian barley accessions. LIS and STI (SDW) were the most suitable traits for screening salt tolerance. Association was estimated between markers and traits to detect QTLs for LIS and STI (SDW). Seven significant QTLs were located on chromosomes 1H (2 QTLs), 2H (2 QTLs), 3H (1 QTL), 4H (1 QTL) and 5H (1 QTL). Five QTLs were associated with LIS and 2 QTLs with STI (SDW). Two QTLs associated with LIS were newly identified on chromosomes 3H and 4H. PMID:25914593

Freezing and desiccation tolerance in entomopathogenic nematodes: diversity and correlation of traits.

PubMed

Shapiro-Ilan, David I; Brown, Ian; Lewis, Edwin E

2014-03-01

The ability of entomopathogenic nematodes to tolerate environmental stress such as desiccating or freezing conditions, can contribute significantly to biocontrol efficacy. Thus, in selecting which nematode to use in a particular biocontrol program, it is important to be able to predict which strain or species to use in target areas where environmental stress is expected. Our objectives were to (i) compare inter- and intraspecific variation in freeze and desiccation tolerance among a broad array of entomopathogenic nematodes, and (ii) determine if freeze and desiccation tolerance are correlated. In laboratory studies we compared nematodes at two levels of relative humidity (RH) (97% and 85%) and exposure periods (24 and 48 h), and nematodes were exposed to freezing temperatures (-2°C) for 6 or 24 h. To assess interspecific variation, we compared ten species including seven that are of current or recent commercial interest: Heterorhabditis bacteriophora (VS), H. floridensis, H. georgiana, (Kesha), H. indica (HOM1), H. megidis (UK211), Steinernema carpocapsae (All), S. feltiae (SN), S. glaseri (VS), S. rarum (17C&E), and S. riobrave (355). To assess intraspecific variation we compared five strains of H. bacteriophora (Baine, Fl1-1, Hb, Oswego, and VS) and four strains of S. carpocapsae (All, Cxrd, DD136, and Sal), and S. riobrave (355, 38b, 7-12, and TP). S. carpocapsae exhibited the highest level of desiccation tolerance among species followed by S. feltiae and S. rarum; the heterorhabditid species exhibited the least desiccation tolerance and S. riobrave and S. glaseri were intermediate. No intraspecific variation was observed in desiccation tolerance; S. carpocapsae strains showed higher tolerance than all H. bacteriophora or S. riobrave strains yet there was no difference detected within species. In interspecies comparisons, poor freeze tolerance was observed in H. indica, and S. glaseri, S. rarum, and S. riobrave whereas H. georgiana and S. feltiae exhibited the highest freeze tolerance, particularly in the 24-h exposure period. Unlike desiccation tolerance, substantial intraspecies variation in freeze tolerance was observed among H. bacteriophora and S. riobrave strains, yet within species variation was not detected among S. carpocapsae strains. Correlation analysis did not detect a relationship between freezing and desiccation tolerance.

Change Detection in High-Resolution Remote Sensing Images Using Levene-Test and Fuzzy Evaluation

NASA Astrophysics Data System (ADS)

Wang, G. H.; Wang, H. B.; Fan, W. F.; Liu, Y.; Liu, H. J.

2018-04-01

High-resolution remote sensing images possess complex spatial structure and rich texture information, according to these, this paper presents a new method of change detection based on Levene-Test and Fuzzy Evaluation. It first got map-spots by segmenting two overlapping images which had been pretreated, extracted features such as spectrum and texture. Then, changed information of all map-spots which had been treated by the Levene-Test were counted to obtain the candidate changed regions, hue information (H component) was extracted through the IHS Transform and conducted change vector analysis combined with the texture information. Eventually, the threshold was confirmed by an iteration method, the subject degrees of candidate changed regions were calculated, and final change regions were determined. In this paper experimental results on multi-temporal ZY-3 high-resolution images of some area in Jiangsu Province show that: Through extracting map-spots of larger difference as the candidate changed regions, Levene-Test decreases the computing load, improves the precision of change detection, and shows better fault-tolerant capacity for those unchanged regions which are of relatively large differences. The combination of Hue-texture features and fuzzy evaluation method can effectively decrease omissions and deficiencies, improve the precision of change detection.

Detection of faults and software reliability analysis

NASA Technical Reports Server (NTRS)

Knight, John C.

1987-01-01

Multi-version or N-version programming is proposed as a method of providing fault tolerance in software. The approach requires the separate, independent preparation of multiple versions of a piece of software for some application. These versions are executed in parallel in the application environment; each receives identical inputs and each produces its version of the required outputs. The outputs are collected by a voter and, in principle, they should all be the same. In practice there may be some disagreement. If this occurs, the results of the majority are taken to be the correct output, and that is the output used by the system. A total of 27 programs were produced. Each of these programs was then subjected to one million randomly-generated test cases. The experiment yielded a number of programs containing faults that are useful for general studies of software reliability as well as studies of N-version programming. Fault tolerance through data diversity and analytic models of comparison testing are discussed.

Comparison of microbial growth inhibition screening assays with high-pressure liquid chromatography for detection of experimentally incurred penicillin G residues in calves.

PubMed

Musser, Jeffrey M B; Anderson, Kevin L; Boison, Joe O

2002-01-01

Twelve calves were fed milk replacer containing 3.33 ppm penicillin G for one feeding, and 12 calves were fed the medicated milk replacer once daily at a rate of 12% of their body weight for 14 days. Two calves served as controls. Calves were slaughtered 4 to 13 hours after being fed. Kidney, liver, muscle, and urine samples were assayed for penicillin by high-pressure liquid chromatography (HPLC). Penicillin G was not detected in any muscle samples and concentrations of penicillin exceeded the tolerance level (0.05 microg/g) in kidney or liver tissue from 13 of 24 treated-calf carcasses examined by HPLC. The Live Animal Swab Test identified all 13 carcasses with violative drug residues. Using kidney as the test matrix, the Swab Test on Premises identified 10 of 13 carcasses with violative drug residues, while the Calf Antibiotic Sulfa Test identified seven of 13 carcasses with violative residues.

75 FR 26662 - Fluazinam; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-12

... due to systemic toxicity and not a result of frank neurotoxicity. No signs of neurotoxicity were... chromatography with electron capture detection (GC/ECD), is available to enforce the tolerance expression for...) enforcement method is also available to enforce the tolerance expression for wine grapes, which includes...

Effect of Ezetimibe on Insulin Secretion in db/db Diabetic Mice

PubMed Central

Zhong, Yong; Wang, Jun; Gu, Ping; Shao, Jiaqing; Lu, Bin; Jiang, Shisen

2012-01-01

Objective. To investigate the effect of ezetimibe on the insulin secretion in db/db mice. Methods. The db/db diabetic mice aged 8 weeks were randomly assigned into 2 groups and intragastrically treated with ezetimibe or placebo for 6 weeks. The age matched db/m mice served as controls. At the end of experiment, glucose tolerance test was performed and then the pancreas was collected for immunohistochemistry. In addition, in vitro perfusion of pancreatic islets was employed for the detection of insulin secretion in the first phase. Results. In the ezetimibe group, the fasting blood glucose was markedly reduced, and the total cholesterol (TC) and low-density lipoprotein cholesterol (LDL-C) were significantly lowered when compared with those in the control group (P < 0.05). At 120 min after glucose tolerance test, the area under curve in the ezetimibe group was significantly smaller than that in the control group (P < 0.05), but the AUCINS0−30 was markedly higher. In vitro perfusion of pancreatic islets revealed the first phase insulin secretion was improved. In addition, the insulin expression in the pancreas in the ezetimibe group was significantly increased as compared to the control group. Conclusion. Ezetimibe can improve glucose tolerance, recover the first phase insulin secretion, and protect the function of β cells in mice. PMID:23118741

Isolation and identification of halotolerant soil bacteria from coastal Patenga area.

PubMed

Rahman, Shafkat Shamim; Siddique, Romana; Tabassum, Nafisa

2017-10-30

Halotolerant bacteria have multiple uses viz. fermentation with lesser sterility control and industrial production of bioplastics. Moreover, it may increase the crop productivity of coastal saline lands in Bangladesh by transferring the salt tolerant genes into the plants. The study focused on the isolation and identification of the halotolerant bacteria from three soil samples, collected from coastal Patenga area. The samples were inoculated in nutrient media containing a wide range of salt concentrations. All the samples showed 2, 4 and 6% (w/v) salt tolerance. The isolates from Patenga soil (4, 6%) and beach soil (2%) showed catalase activity and all the isolates showed negative results for oxidase activity, indole production, lactose and motility. All the samples provided positive results for dextrose fermentation. Other tests provided mixed results. Based on the morphological characteristics, biochemical tests and ABIS software analysis the isolates fall within the Enterobacteriaceae, Clostridium and Corynebacterium, with a predominance of Vibrios. Overall the isolates can be considered as mild halotolerant, with the best growth observed at lower salinities and no halophilism detected. Among many possibilities, the genes responsible for the salt tolerant trait in these species can be identified, extracted and inserted into the crop plants to form a transgenic plant to result in higher yield for the rest of the year.

Runtime Verification in Context : Can Optimizing Error Detection Improve Fault Diagnosis

NASA Technical Reports Server (NTRS)

Dwyer, Matthew B.; Purandare, Rahul; Person, Suzette

2010-01-01

Runtime verification has primarily been developed and evaluated as a means of enriching the software testing process. While many researchers have pointed to its potential applicability in online approaches to software fault tolerance, there has been a dearth of work exploring the details of how that might be accomplished. In this paper, we describe how a component-oriented approach to software health management exposes the connections between program execution, error detection, fault diagnosis, and recovery. We identify both research challenges and opportunities in exploiting those connections. Specifically, we describe how recent approaches to reducing the overhead of runtime monitoring aimed at error detection might be adapted to reduce the overhead and improve the effectiveness of fault diagnosis.

Optical transillumination tomography with tolerance against refraction mismatch.

PubMed

Haidekker, Mark A

2005-12-01

Optical transillumination tomography (OT) is a laser-based imaging modality where ballistic photons are used for projection generation. Image reconstruction is therefore similar to X-ray computed tomography. This modality promises fast image acquisition, good resolution and contrast, and inexpensive instrumentation for imaging of weakly scattering objects, such as for example tissue-engineered constructs. In spite of its advantages, OT is not widely used. One reason is its sensitivity towards changes in material refractive index along the light path. Beam refraction artefacts cause areas of overestimated tissue density and blur geometric details. A spatial filter, introduced into the beam path to eliminate scattered photons, will also remove refracted photons from the projections. In the projections, zones affected by refraction can be detected by thresholding. By using algebraic reconstruction techniques (ART) in conjunction with suitable interpolation algorithms, reconstruction artefacts can be partly avoided. Reconstructions from a test image were performed. Standard filtered backprojection (FBP) showed a round mean square (RMS) deviation from the original image of 9.9. RMS deviation with refraction-tolerant ART reconstruction was 0.33 and 0.24, depending on the algorithm, compared to 0.57 (FBP) and 0.06 (ART) in a non-refracting case. In addition, modified ART reconstruction allowed detection of small geometric details that were invisible in standard reconstructions. Refraction-tolerant ART may be the key to eliminating one of the major challenges of OT.

40 CFR 63.7525 - What are my monitoring, installation, operation, and maintenance requirements?

Code of Federal Regulations, 2010 CFR

2010-07-01

... tolerance of 1.27 centimeters of water or a transducer with a minimum tolerance of 1 percent of the pressure... use a fabric filter bag leak detection system to comply with the requirements of this subpart, you must install, calibrate, maintain, and continuously operate a bag leak detection system as specified in...

The Dangers of Failure Masking in Fault-Tolerant Software: Aspects of a Recent In-Flight Upset Event

NASA Technical Reports Server (NTRS)

Johnson, C. W.; Holloway, C. M.

2007-01-01

On 1 August 2005, a Boeing Company 777-200 aircraft, operating on an international passenger flight from Australia to Malaysia, was involved in a significant upset event while flying on autopilot. The Australian Transport Safety Bureau's investigation into the event discovered that an anomaly existed in the component software hierarchy that allowed inputs from a known faulty accelerometer to be processed by the air data inertial reference unit (ADIRU) and used by the primary flight computer, autopilot and other aircraft systems. This anomaly had existed in original ADIRU software, and had not been detected in the testing and certification process for the unit. This paper describes the software aspects of the incident in detail, and suggests possible implications concerning complex, safety-critical, fault-tolerant software.

A distributed programming environment for Ada

NASA Technical Reports Server (NTRS)

Brennan, Peter; Mcdonnell, Tom; Mcfarland, Gregory; Timmins, Lawrence J.; Litke, John D.

1986-01-01

Despite considerable commercial exploitation of fault tolerance systems, significant and difficult research problems remain in such areas as fault detection and correction. A research project is described which constructs a distributed computing test bed for loosely coupled computers. The project is constructing a tool kit to support research into distributed control algorithms, including a distributed Ada compiler, distributed debugger, test harnesses, and environment monitors. The Ada compiler is being written in Ada and will implement distributed computing at the subsystem level. The design goal is to provide a variety of control mechanics for distributed programming while retaining total transparency at the code level.

Elevation of pain threshold by vaginal stimulation in women.

PubMed

Whipple, B; Komisaruk, B R

1985-04-01

In 2 studies with 10 women each, vaginal self-stimulation significantly increased the threshold to detect and tolerate painful finger compression, but did not significantly affect the threshold to detect innocuous tactile stimulation. The vaginal self-stimulation was applied with a specially designed pressure transducer assembly to produce a report of pressure or pleasure. In the first study, 6 of the women perceived the vaginal stimulation as producing pleasure. During that condition, the pain tolerance threshold increased significantly by 36.8% and the pain detection threshold increased significantly by 53%. A second study utilized other types of stimuli. Vaginal self-stimulation perceived as pressure significantly increased the pain tolerance threshold by 40.3% and the pain detection threshold by 47.4%. In the second study, when the vaginal stimulation was self-applied in a manner that produced orgasm, the pain tolerance threshold and pain detection threshold increased significantly by 74.6% and 106.7% respectively, while the tactile threshold remained unaffected. A variety of control conditions, including various types of distraction, did not significantly elevate pain or tactile thresholds. We conclude that in women, vaginal self-stimulation decreases pain sensitivity, but does not affect tactile sensitivity. This effect is apparently not due to painful or non-painful distraction.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Passarge, M; Fix, M K; Manser, P

Purpose: To create and test an accurate EPID-frame-based VMAT QA metric to detect gross dose errors in real-time and to provide information about the source of error. Methods: A Swiss cheese model was created for an EPID-based real-time QA process. The system compares a treatmentplan- based reference set of EPID images with images acquired over each 2° gantry angle interval. The metric utilizes a sequence of independent consecutively executed error detection Methods: a masking technique that verifies infield radiation delivery and ensures no out-of-field radiation; output normalization checks at two different stages; global image alignment to quantify rotation, scaling andmore » translation; standard gamma evaluation (3%, 3 mm) and pixel intensity deviation checks including and excluding high dose gradient regions. Tolerances for each test were determined. For algorithm testing, twelve different types of errors were selected to modify the original plan. Corresponding predictions for each test case were generated, which included measurement-based noise. Each test case was run multiple times (with different noise per run) to assess the ability to detect introduced errors. Results: Averaged over five test runs, 99.1% of all plan variations that resulted in patient dose errors were detected within 2° and 100% within 4° (∼1% of patient dose delivery). Including cases that led to slightly modified but clinically equivalent plans, 91.5% were detected by the system within 2°. Based on the type of method that detected the error, determination of error sources was achieved. Conclusion: An EPID-based during-treatment error detection system for VMAT deliveries was successfully designed and tested. The system utilizes a sequence of methods to identify and prevent gross treatment delivery errors. The system was inspected for robustness with realistic noise variations, demonstrating that it has the potential to detect a large majority of errors in real-time and indicate the error source. J. V. Siebers receives funding support from Varian Medical Systems.« less

Sensor fault-tolerant control for gear-shifting engaging process of automated manual transmission

NASA Astrophysics Data System (ADS)

Li, Liang; He, Kai; Wang, Xiangyu; Liu, Yahui

2018-01-01

Angular displacement sensor on the actuator of automated manual transmission (AMT) is sensitive to fault, and the sensor fault will disturb its normal control, which affects the entire gear-shifting process of AMT and results in awful riding comfort. In order to solve this problem, this paper proposes a method of fault-tolerant control for AMT gear-shifting engaging process. By using the measured current of actuator motor and angular displacement of actuator, the gear-shifting engaging load torque table is built and updated before the occurrence of the sensor fault. Meanwhile, residual between estimated and measured angular displacements is used to detect the sensor fault. Once the residual exceeds a determined fault threshold, the sensor fault is detected. Then, switch control is triggered, and the current observer and load torque table estimates an actual gear-shifting position to replace the measured one to continue controlling the gear-shifting process. Numerical and experiment tests are carried out to evaluate the reliability and feasibility of proposed methods, and the results show that the performance of estimation and control is satisfactory.

Effect of Lidocaine on Swallowing During FEES in Patients With Dysphagia.

PubMed

O'Dea, Meredith B; Langmore, Susan E; Krisciunas, Gintas P; Walsh, Michael; Zanchetti, Linsey L; Scheel, Rebecca; McNally, Edel; Kaneoka, Asako Satoh; Guarino, Anthony J; Butler, Susan G

2015-07-01

The aims of this study were to assess the effects of 0.2 mL of 4% atomized lidocaine on swallowing and tolerability during Fiberoptic Endoscopic Evaluation of Swallowing (FEES). A single blinded study was conducted with 17 dysphagic patients, who received 4 standardized boluses in 2 sequential FEES exams under 2 conditions: non-anesthetized (decongestant only) and anesthetized (lidocaine 4%+decongestant). After each procedure, patients rated their pain on the Wong Baker FACES Pain Rating Scale. Clinicians scored each swallow with the Penetration Aspiration Scale (PAS) and an author-developed Residue Rating Scale. Because the assessments were ordinal, a series of Wilcoxon signed-rank tests were conducted to detect differences between the 2 conditions. No significant differences were detected between groups on PAS or residue in the 4 boluses. Pain scores, however, were significantly lower in the anesthetized condition than the decongested-only condition (P=.035). The findings of this study indicated that 0.2 mL of 4% lidocaine enhanced exam tolerability and did not impair the swallow in dysphagic patients. © The Author(s) 2015.

A temperature-tolerant multiplex elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and capillary electrophoresis.

PubMed

Fu, Wei; Wei, Shuang; Wang, Chenguang; Du, Zhixin; Zhu, Pengyu; Wu, Xiyang; Wu, Gang; Zhu, Shuifang

2017-08-15

High throughput screening systems are the preferred solution to meet the urgent requirement of increasing number of genetically modified organisms (GMOs). In this study, we have successfully developed a multiplex GMO element screening system with dual priming oligonucleotide (DPO) primers. This system can detect the cauliflower mosaic virus 35S (CaMV 35S), terminator of nopaline synthase gene (NOS), figwort mosaic virus 35S (FMV 35S) promoter, neomycin phosphotransferaseII (NPTII), Bt Cry 1Ab, phosphinothricin acetyltransferase genes (bar) and Streptomyces viridochromogenes (pat) simultaneously, which covers more than 90% of all authorized GMO species worldwide. This system exhibits a high tolerance to annealing temperatures, high specificity and a limit of detection equal to conventional PCR. A total of 214 samples from markets, national entry-exit agencies, the Institute for Reference Materials and Measurement (IRMM) and the American Oil Chemists' Society (AOCS) were also tested for applicability. This screening system is therefore suitable for GMO screening. Copyright © 2017 Elsevier Ltd. All rights reserved.

Automated Detection of Clouds in Satellite Imagery

NASA Technical Reports Server (NTRS)

Jedlovec, Gary

2010-01-01

Many different approaches have been used to automatically detect clouds in satellite imagery. Most approaches are deterministic and provide a binary cloud - no cloud product used in a variety of applications. Some of these applications require the identification of cloudy pixels for cloud parameter retrieval, while others require only an ability to mask out clouds for the retrieval of surface or atmospheric parameters in the absence of clouds. A few approaches estimate a probability of the presence of a cloud at each point in an image. These probabilities allow a user to select cloud information based on the tolerance of the application to uncertainty in the estimate. Many automated cloud detection techniques develop sophisticated tests using a combination of visible and infrared channels to determine the presence of clouds in both day and night imagery. Visible channels are quite effective in detecting clouds during the day, as long as test thresholds properly account for variations in surface features and atmospheric scattering. Cloud detection at night is more challenging, since only courser resolution infrared measurements are available. A few schemes use just two infrared channels for day and night cloud detection. The most influential factor in the success of a particular technique is the determination of the thresholds for each cloud test. The techniques which perform the best usually have thresholds that are varied based on the geographic region, time of year, time of day and solar angle.

Matrix effect on baked egg tolerance in children with IgE-mediated hen's egg allergy.

PubMed

Miceli Sopo, Stefano; Greco, Monica; Cuomo, Barbara; Bianchi, Annamaria; Liotti, Lucia; Monaco, Serena; Dello Iacono, Iride

2016-08-01

Children with IgE-mediated hen's egg allergy (IgE-HEA) often tolerate baked egg within a wheat matrix. To evaluate the influence of wheat matrix and the effects of little standardized cooking procedures on baked egg tolerance. Fifty-four children with IgE-HEA were enrolled. They underwent prick-by-prick (PbP) tests and open oral food challenges (OFC) performed with baked HE within a wheat matrix (a home-made cake, locally called ciambellone), baked HE without a wheat matrix (in the form of an omelet, locally named frittata) and boiled HE. Three months after passing ciambellone OFC, parents were asked to answer a survey. About 88% of children tolerated ciambellone, 74% frittata, and 56% boiled HE. Negative predictive value of PbP performed with ciambellone, frittata, and boiled HE was 100%. No IgE-mediated adverse reactions were detected at follow-up carried out by the survey. Wheat matrix seemed to be relevant only in few cases. If our results will be confirmed by larger studies, a negative PbP with ciambellone, frittata, or boiled HE will allow patients with IgE-HEA to eat these foods without undergoing OFC. Moreover, our study showed that very strict standardized cooking procedures do not seem to be essential, to guarantee tolerance toward baked HE. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Physiological Limits along an Elevational Gradient in a Radiation of Montane Ground Beetles

PubMed Central

Slatyer, Rachel A.; Schoville, Sean D.

2016-01-01

A central challenge in ecology and biogeography is to determine the extent to which physiological constraints govern the geographic ranges of species along environmental gradients. This study tests the hypothesis that temperature and desiccation tolerance are associated with the elevational ranges of 12 ground beetle species (genus Nebria) occurring on Mt. Rainier, Washington, U.S.A. Species from higher elevations did not have greater cold tolerance limits than lower-elevation species (all species ranged from -3.5 to -4.1°C), despite a steep decline in minimum temperature with elevation. Although heat tolerance limits varied among species (from 32.0 to 37.0°C), this variation was not generally associated with the relative elevational range of a species. Temperature gradients and acute thermal tolerance do not support the hypothesis that physiological constraints drive species turnover with elevation. Measurements of intraspecific variation in thermal tolerance limits were not significant for individuals taken at different elevations on Mt. Rainier, or from other mountains in Washington and Oregon. Desiccation resistance was also not associated with a species’ elevational distribution. Our combined results contrast with previously-detected latitudinal gradients in acute physiological limits among insects and suggest that other processes such as chronic thermal stress or biotic interactions might be more important in constraining elevational distributions in this system. PMID:27043311

Inter-species protein trafficking endows dodder (Cuscuta pentagona) with a host-specific herbicide-tolerant trait.

PubMed

Jiang, Linjian; Qu, Feng; Li, Zhaohu; Doohan, Douglas

2013-06-01

· Besides photosynthates, dodder (Cuscuta spp.) acquires phloem-mobile proteins from host; however, whether this could mediate inter-species phenotype transfer was not demonstrated. Specifically, we test whether phosphinothricin acetyl transferase (PAT) that confers host plant glufosinate herbicide tolerance traffics and functions inter-specifically. · Dodder tendrils excised from hosts can grow in vitro for weeks or resume in vivo by parasitizing new hosts. The level of PAT in in vivo and in vitro dodder tendrils was quantified by enzyme-linked immunosorbent assay. The glufosinate sensitivity was examined by dipping the distal end of in vivo and in vitro tendrils, growing on or excised from LibertyLink (LL; PAT-transgenic and glufosinate tolerant) and conventional (CN; glufosinate sensitive) soybean hosts, into glufosinate solutions for 5 s. After in vitro tendrils excised from LL hosts reparasitized new CN and LL hosts, the PAT level and the glufosinate sensitivity were also examined. · When growing on LL host, dodder tolerated glufosinate and contained PAT at a level of 0.3% of that encountered in LL soybean leaf. After PAT was largely degraded in dodders, they became glufosinate sensitive. PAT mRNA was not detected by reverse transcription PCR in dodders. · In conclusion, the results indicated that PAT inter-species trafficking confers dodder glufosinate tolerance. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

Induction of tolerance towards TNP entails down-regulation of an autoimmune attack.

PubMed Central

Zöller, M; Andrighetto, G

1988-01-01

In order to follow the process of induction and maintainance of tolerance, BALB/c mice were tolerized by free hapten, and effector and regulatory cell interactions were analysed by limiting-dilution (LD) cultures. Injection of trinitrobenzenesulphonic acid (TNBS) resulted, predominantly, in the activation and expansion of self-reactive cytotoxic T cells (CTL), which were observed transiently at frequencies comparable to allo-specific CTL. In addition, self-reactive helper T cells (Th) were activated and expanded in tolerized mice. TNP-specific reactivity was difficult to evaluate, since cytotoxic activity against haptenized self followed the pattern of self-reactivity throughout the test period. But in LD cultures determining proliferation, two populations of Th responding to TNP-self were observed, while only one Th population could be detected in response to self. Expansion/activation of Th and CTL precursors (CTLp) was followed by activation of suppressor T cells (Ts). The suppressor population could be divided into two subpopulations, one interfering with Th, the second interacting directly with CTL (veto cells). The results indicate that during the induction of tolerance, animals pass through an autoimmune attack, with expansion and activation of self-reactive clones (CTL, Th). The final status of non-responsiveness towards TNP is not due to the deletion of effector or regulatory cells, but results from the establishment of a steady state of dominance of self-reactive and TNP-self-reactive suppression. PMID:2965095

Phthalates and heavy metals as endocrine disruptors in food: A study on pre-packed coffee products.

PubMed

De Toni, Luca; Tisato, Francesco; Seraglia, Roberta; Roverso, Marco; Gandin, Valentina; Marzano, Cristina; Padrini, Roberto; Foresta, Carlo

2017-01-01

Phthalate plasticizers and heavy metals are widely recognized to be pollutants that interfere with key developmental processes such as masculinization. We investigated the release of phthalates and heavy metals in coffee brewed from coffee packed in single-serve coffee containers made from different types of materials: metal, biodegradable and plastics. We detected with GC-MS small amounts phthalates, below the tolerated daily risks levels, in all the coffees prepared from the different types of capsules. Specifically, Di (2-ethyl-hexyl)-phthalate and DiBP: Diisobuthyl-pthalate were ubiquitously present despite the high variability among the samples (respective range 0.16-1.87 μg/mL and 0.01-0.36 μg/mL). Whereas, diethyl-phthalate (range 0.20-0.26 μg/mL) and di- n -buthyl-phthalate (range 0.02-0.14 μg/mL) were detected respectively in one and three out of the four types of capsule tested. In contrast, we detected by atomic mass spectrometry on mineralized samples heavy metals lead (Pb) and nickel (Ni), in all coffee tested. PB levels (respective range 0.32-211.57 μg/dose) accounted for 42-79%, whereas Ni levels (respective range 166.25-1950.26 μg/dose) accounted for >100% of the tolerable daily intake. These results add to the already present concerns related to the multiple pathways of human exposure and the ubiquitous presence of these pollutants in consumer products and their long-term effect on human health.

Vancomycin tolerance in enterococci.

PubMed

Saribas, Suat; Bagdatli, Yasar

2004-11-01

Tolerance can be defined as the ability of bacteria to grow in the presence of high concentrations of bactericide antimicrobics, so that the killing action of the drug is avoided but the minimal inhibitory concentration (MIC) remains the same. We investigated vancomycin tolerance in the Enterococcus faecium and Enterococcus faecalis strains isolated from different clinical specimens. Vancomycin was obtained from Sigma Chemical Co. We studied 100 enterococci strains. Fifty-six and 44 of Enterococcus strains were idendified as E. feacalis and E. faecium, respectively. To determine MICs and minimal bactericidal concentration (MBC), we inoculated strains from an overnight agar culture to Muller-Hinton broth and incubated them for 4-6 h at 37 degrees C with shaking to obtain a logarithmic phase culture. The inoculum was controlled by performing a colony count for each test. We determined MBC values and MBC/MIC ratios to study tolerance to vancomycin. Vancomycin tolerance was defined as a high MBC value and an MBC/MIC ratio > or =32. Fifty-six and 44 of the Enterococcus strains were identified as E. faecium and E. faecalis, respectively. Thirty-one E. faecium and 48 E. faecalis were found to be susceptible to vancomycin and these susceptible strains were included in this study. The MICs of susceptible strains ranged from < or =1 to 4 mg/l, the MBCs were > or =512 mg/l. Tolerance was detected in all E. faecalis and E. faecium strains. The standard E. faecalis 21913 strain also exhibited tolerance according to the high MBC value and the MBC/MIC ratio. We defined the tolerant strains as having no bactericidal effect and MBC/MIC > or =32. We found that a 100% tolerance was present in susceptible strains. One of the hypotheses for tolerance is that tolerant cells fail to mobilize or create the autolysins needed for enlargement and division. Our data suggests that tolerance may compromise glycopeptide therapy of serious enterococci infections. To add an aminoglycoside to the glycopeptide therapy unless MBCs are unavailable can be useful in the effective treatment of serious Enterococcus infections.

Wald Sequential Probability Ratio Test for Space Object Conjunction Assessment

NASA Technical Reports Server (NTRS)

Carpenter, James R.; Markley, F Landis

2014-01-01

This paper shows how satellite owner/operators may use sequential estimates of collision probability, along with a prior assessment of the base risk of collision, in a compound hypothesis ratio test to inform decisions concerning collision risk mitigation maneuvers. The compound hypothesis test reduces to a simple probability ratio test, which appears to be a novel result. The test satisfies tolerances related to targeted false alarm and missed detection rates. This result is independent of the method one uses to compute the probability density that one integrates to compute collision probability. A well-established test case from the literature shows that this test yields acceptable results within the constraints of a typical operational conjunction assessment decision timeline. Another example illustrates the use of the test in a practical conjunction assessment scenario based on operations of the International Space Station.

76 FR 55804 - Dicamba; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-09

... Considerations A. Analytical Enforcement Methodology Adequate enforcement methodologies, Methods I and II--gas chromatography with electron capture detection (GC/ECD), are available to enforce the tolerance expression. The...

Ground Testing Strategies for Verifying the Slew Rate Tolerance of Star Trackers

PubMed Central

Dzamba, Tom; Enright, John

2014-01-01

The performance of a star tracker is largely based on the availability of its attitude solution. Several methods exist to assess star tracker availability under both static and dynamic imaging conditions. However, these methods typically make various idealizations that can limit the accuracy of these results. This study aims to increase the fidelity of star tracker availability modeling by accounting for the effects of detection logic and pixel saturation on star detection. We achieve this by developing an analytical model for the focal plane intensity distribution of a star in the presence of sensor slew. Using the developed model, we examine the effects of slew rate on star detection using simulations and lab tests. The developed approach allows us to determine the maximum slew rate for which a star of a given stellar magnitude can still be detected. This information can then be used to describe the availability of a star tracker attitude solution as a function of slew rate, both spatially, across the entire celestial sphere, or locally, along a specified orientation track. PMID:24577522

Fault-Tolerant Computing: An Overview

DTIC Science & Technology

1991-06-01

Addison Wesley:, Reading, MA) 1984. [8] J. Wakerly , Error Detecting Codes, Self-Checking Circuits and Applications , (Elsevier North Holland, Inc.- New York... applicable to bit-sliced organi- zations of hardware. In the first time step, the normal computation is performed on the operands and the results...for error detection and fault tolerance in parallel processor systems while perform- ing specific computation-intensive applications [111. Contrary to

Testing the air pollution tolerances of shade tree cultivars

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karnosky, D.J.

1978-01-01

A program in progress to test the relative air pollution tolerances of some commonly planted shade tree cultivars is described. The relative sulfur dioxide and ozone tolerances of several cultivars of acer, fagus, fraxinus, ginkgo, gleditsia, platanus, and quercus species are being determined by examination of foliar response to short-term, high-concentration fumigations. In a follow-up study, the extent of foliar injury, growth reduction, and mortality caused by air pollution will be examined for the same cultivars grown in test plantings in and around New York City. The correlation of the relative sulfur dioxide and ozone tolerances, as determined by themore » controlled-fumigation tests, with urban survival and growth will be useful in determining the adequacy of acute exposure fumigations in testing the air pollution tolerances of the tree species under study.« less

Development and evaluation of a fault-tolerant multiprocessor (FTMP) computer. Volume 4: FTMP executive summary

NASA Technical Reports Server (NTRS)

Smith, T. B., III; Lala, J. H.

1984-01-01

The FTMP architecture is a high reliability computer concept modeled after a homogeneous multiprocessor architecture. Elements of the FTMP are operated in tight synchronism with one another and hardware fault-detection and fault-masking is provided which is transparent to the software. Operating system design and user software design is thus greatly simplified. Performance of the FTMP is also comparable to that of a simplex equivalent due to the efficiency of fault handling hardware. The FTMP project constructed an engineering module of the FTMP, programmed the machine and extensively tested the architecture through fault injection and other stress testing. This testing confirmed the soundness of the FTMP concepts.

Gyro-based Maximum-Likelihood Thruster Fault Detection and Identification

NASA Technical Reports Server (NTRS)

Wilson, Edward; Lages, Chris; Mah, Robert; Clancy, Daniel (Technical Monitor)

2002-01-01

When building smaller, less expensive spacecraft, there is a need for intelligent fault tolerance vs. increased hardware redundancy. If fault tolerance can be achieved using existing navigation sensors, cost and vehicle complexity can be reduced. A maximum likelihood-based approach to thruster fault detection and identification (FDI) for spacecraft is developed here and applied in simulation to the X-38 space vehicle. The system uses only gyro signals to detect and identify hard, abrupt, single and multiple jet on- and off-failures. Faults are detected within one second and identified within one to five accords,

Parameter Transient Behavior Analysis on Fault Tolerant Control System

NASA Technical Reports Server (NTRS)

Belcastro, Christine (Technical Monitor); Shin, Jong-Yeob

2003-01-01

In a fault tolerant control (FTC) system, a parameter varying FTC law is reconfigured based on fault parameters estimated by fault detection and isolation (FDI) modules. FDI modules require some time to detect fault occurrences in aero-vehicle dynamics. This paper illustrates analysis of a FTC system based on estimated fault parameter transient behavior which may include false fault detections during a short time interval. Using Lyapunov function analysis, the upper bound of an induced-L2 norm of the FTC system performance is calculated as a function of a fault detection time and the exponential decay rate of the Lyapunov function.

Tolerability of a probiotic in subjects with a history of methicillin-resistant Staphylococcus aureus colonisation.

PubMed

Warrack, S; Panjikar, P; Duster, M; Safdar, N

2014-12-01

Methicillin-resistant Staphylococcus aureus (MRSA) is a pathogen of major public health importance. Colonisation precedes infection; thus reducing MRSA carriage may be of benefit for reducing infection. Probiotics represent a novel approach to reducing MRSA carriage. We undertook a pilot feasibility randomised controlled trial of the tolerability and acceptability of probiotics for reducing nasal and intestinal carriage of MRSA. In addition, subjects were screened for vancomycin-resistant enterocococci (VRE). Subjects with a history of MRSA were recruited from a large, academic medical center and randomised to take either a placebo or probiotic (Lactobacillus rhamnosus HN001). Subjects returned to the clinic after four weeks for further testing to determine adherence to the probiotic regimen and colonisation of MRSA. 48 subjects were enrolled and randomised. Nearly 25% were transplant recipients and 30% had diabetes. The probiotic was well tolerated in the study population though minor side effects, such as nausea and bloating, were observed. A majority of the subjects randomised to HN001 had good adherence to the regimen. At the four week time point among subjects randomised to the probiotic, MRSA was detected in 67 and 50% of subjects colonised in the nares and the gastrointestinal tract, respectively. Three subjects who initially tested positive for VRE were negative after four weeks of probiotic exposure. Probiotics were well tolerated in our study population of largely immunocompromised subjects with multiple comorbidities. Adherence to the intervention was good. Probiotics should be studied further for their potential to reduce colonisation by multidrug resistant bacteria.

Some consideration for evaluation of structural integrity of aging aircraft

NASA Astrophysics Data System (ADS)

Terada, Hiroyuki; Asada, Hiroo

The objective of this paper is to examine the achievement and the limitation of state-of-the-art of the methodology of damage tolerant design and the subjects to be solved for further improvement. The topics discussed are: the basic concept of full-scale fatigue testing, fracture mechanics applications, repair of detected damages, inspection technology, and determination of inspection intervals, reliability assessment for practical application, and the importance of various kinds of data acquisition.

Delayed clearance of triglyceride‐rich lipoproteins in young, healthy obese subjects†

PubMed Central

Goll, R.; Lekahl, S.; Moen, O. S.; Florholmen, J.

2015-01-01

Summary Obesity is associated with the metabolic syndrome. The aims were, first, to study the postprandial triglyceride clearance in young, healthy obese subjects and, second, to investigate if fasting triglycerides can predict delayed postprandial triglyceride clearance. Eighteen apparently healthy, obese subjects with no clinical signs of metabolic disturbances participated. Controls were age‐ and sex‐matched, healthy, normal weight subjects. Subclinical markers of metabolic disturbances were assessed by measuring postprandial triglycerides in serum and in chylomicrons by oral fat tolerance test. Postprandial triglyceride clearance for 8 h was assessed indirectly as removal of the lipid from serum during the oral fat tolerance test. Insulin resistance was measured by the homeostasis model assessment of insulin resistance (HOMA‐IR). Twelve (66%) of the apparently healthy obese individuals had insulin resistance measured by HOMA‐IR. There was a delayed clearance of serum triglycerides and chylomicron triglycerides at 6 h when compared with the control group, while, at 8 h, the differences were only detected for the chylomicron triglyceride clearance. Triglyceride response was significantly greater in the obese subjects. Fasting triglycerides in upper normal level predicted a delayed postprandial triglyceride clearance and insulin resistance. In young, apparently healthy obese subjects early metabolic disturbances including insulin resistance and delayed postprandial triglyceride clearance can be detected. Fasting serum triglyceride in upper normal level predicted delayed postprandial triglyceride clearance and insulin resistance. PMID:26469529

[Lactose intolerance in neonates with non-infectious diarrhea].

PubMed

Su, Hui-Min; Jiang, Yi; Hu, Yu-Lian; Yang, Hui; Dong, Tian-Jin

2016-04-01

To investigate the development of lactose intolerance in neonates with non-infectious diarrhea and its association with diarrhea, and to evaluate the diagnostic values of fecal pH value and urine galactose determination for neonatal lactase deficiency. Seventy hospitalized neonates who developed non-infectious diarrhea between October 2012 and June 2015 were enrolled as the diarrhea group, and 162 hospitalized neonates without non-infectious diarrhea were enrolled as the non-diarrhea group. Test paper was used to determine fecal pH value. The galactose oxidase method was used to detect urine galactose. The neonates with positive galactose oxidase were diagnosed with lactase deficiency, and those with lactase deficiency and diarrhea were diagnosed with lactose intolerance. According to the results of urine galactose detection, 69 neonates in the diarrhea group who underwent urine galactose detection were classified into lactose intolerance group (45 neonates) and lactose tolerance group (24 neonates), and their conditions after treatment were compared between the two groups. The follow-up visits were performed for neonates with diarrhea at 3 months after discharge. Fecal pH value and positive rate of urine galactose (65% vs 54%) showed no significant differences between the diarrhea and non-diarrhea groups (P>0.05). Fecal pH value showed no significant difference between the lactose intolerance and lactose tolerance groups (P>0.05), while the neonates in the lactose intolerance group had a significantly longer time to recovery of defecation than those in the lactose tolerance group (P<0.05). The incidence of lactase deficiency is high in neonates, and diarrhea due to lactose intolerance tends to occur. Determination of fecal pH value has no significance in the diagnosis of lactose intolerance in neonates with diarrhea.

Safety, tolerability, and bioavailability of topical SAR 1118, a novel antagonist of lymphocyte function-associated antigen-1: a phase 1b study.

PubMed

Paskowitz, D M; Nguyen, Q D; Gehlbach, P; Handa, J T; Solomon, S; Stark, W; Shaikh, O; Semba, C; Gadek, T R; Do, D V

2012-07-01

A growing body of evidence points to a role for inflammation mediated by lymphocyte function-associated antigen-1 (LFA-1) and its ligand intercellular adhesion molecule-1 in the pathogenesis of diabetic macular oedema. This phase 1b clinical trial assessed the safety, tolerability, and pharmacokinetics of topically administered SAR 1118, a novel LFA-1 antagonist, in human subjects. In this prospective, randomized, double-masked trial, 13 subjects scheduled for vitrectomy received one of three concentrations of topical SAR 1118 (0.1, 1.0, or 5.0%) twice daily for 1 week before surgery. Undiluted aqueous and vitreous samples were collected at surgery and analysed for the concentration of the medication. All subjects completed the entire course of medication. The only adverse events reported were instillation site irritation (4/13, 31%) and dysgeusia (3/13, 23%). These were mild and transient, occurring at the highest dose. Mean concentrations (ng/ml) of SAR 1118 in the aqueous humour were 0.25, 37.2, and 101.1 for the 0.1%, 1.0%, and 5.0% dose groups, respectively. SAR 1118 was below the level of detection (0.5 ng/ml) for all vitreous samples except in a single subject who had a history of prior vitrectomy and a dislocated intraocular lens. Topical SAR 1118 was safe and well tolerated, and dose-dependent levels of drug were detected in aqueous. However, vitreous levels were below the threshold of detection with the concentrations tested. Further investigation of this medication for posterior segment applications would require intravitreal delivery or chemical modification of the drug.

Tolerant compressed sensing with partially coherent sensing matrices

NASA Astrophysics Data System (ADS)

Birnbaum, Tobias; Eldar, Yonina C.; Needell, Deanna

2017-08-01

Most of compressed sensing (CS) theory to date is focused on incoherent sensing, that is, columns from the sensing matrix are highly uncorrelated. However, sensing systems with naturally occurring correlations arise in many applications, such as signal detection, motion detection and radar. Moreover, in these applications it is often not necessary to know the support of the signal exactly, but instead small errors in the support and signal are tolerable. Despite the abundance of work utilizing incoherent sensing matrices, for this type of tolerant recovery we suggest that coherence is actually beneficial . We promote the use of coherent sampling when tolerant support recovery is acceptable, and demonstrate its advantages empirically. In addition, we provide a first step towards theoretical analysis by considering a specific reconstruction method for selected signal classes.

Predictors of Abnormal Glucose Tolerance in the Early Postpartum Period in Patients with Gestational Diabetes.

PubMed

Inoue, Shigeru; Shinagawa, Takaaki; Horinouchi, Takashi; Kozuma, Yutaka; Yonemoto, Koji; Hori, Daizo; Ushijima, Kimio

2016-01-01

This study was designed to investigate the clinical predictors of abnormal glucose tolerance 5-7 weeks after delivery. Subjects were 155 women diagnosed with gestational diabetes mellitus (GDM) between October 2005 and September 2013 whose pregnancy and delivery were managed at our center. Subjects were divided into a normal glucose tolerance group (NGT; n = 113), or abnormal glucose tolerance group (AGT; n = 42) with borderline or overt diabetes mellitus, based on 75-g oral glucose tolerance test (75 gOGTT) results 5-7 weeks after delivery. We extracted profiles by which abnormal glucose tolerance levels 5-7 weeks after delivery were predicted using a classification and regression tree (CART) from parameters measured at the time of GDM diagnosis. Logistic regression analysis was used to determine prediction accuracy. Subjects with fasting plasma glucose (FPG) ≥92 mg/dL and immuno-reactive insulin level <100 μU/mL 60 min after load (IRI60min) at time of diagnosis showed a significantly higher risk of developing abnormal glucose tolerance 5-7 weeks after delivery than subjects with FPG <92 mg/dL (p < 0.0001). Subjects with FPG ≥92 mg/dL and IRI60min ≥ 100 μU/mL had the same risk as those with FPG of <92 mg/dL. Patients with gestational diabetes who met the criteria specified above at diagnosis were at a higher risk of developing diabetes mellitus in the future. By explaining this issue to patients, we expect to improve the rate of postpartum follow-up. This should facilitate early detection of diabetes, and help prevent associated complications.

Role of self-reported individual differences in preference for and tolerance of exercise intensity in fitness testing performance.

PubMed

Hall, Eric E; Petruzzello, Steven J; Ekkekakis, Panteleimon; Miller, Paul C; Bixby, Walter R

2014-09-01

Performance in fitness tests could depend on factors beyond the bioenergetic and skeletomuscular systems, such as individual differences in preference for and tolerance of different levels of exercise-induced somatosensory stimulation. Although such individual-difference variables could play a role in exercise testing and prescription, they have been understudied. The purpose of these studies was to examine the relationships of self-reported preference for and tolerance of exercise intensity with performance in fitness tests. Participants in study I were 516 men and women volunteers from a campus community, and participants in study II were 42 men recruit firefighters undergoing a 6-week training program. Both the Preference and Tolerance scores exhibited significant relationships with performance in several fitness tests and with body composition and physical activity participation. Preference and Tolerance did not change after the training program in study II, despite improvements in objective and perceived fitness, supporting their conceptualization as dispositional traits. Preference and Tolerance scores could be useful not only in ameliorating the current understanding of the determinants of physical performance, but also in personalizing exercise prescriptions and, thus, delivering exercise experiences that are more pleasant, tolerable, and sustainable.

The flaw-detected coating and its applications in R&M of aircrafts

NASA Astrophysics Data System (ADS)

Hu, Feng; Liu, Mabao; Lü, Zhigang

2009-07-01

A monitoring method called ICM (Intelligent Coating Monitoring), which is based mainly on the intelligent coating sensors, has the capability to monitor crack initiation and growth in fatigue test coupons has been suggested in this study. The intelligent coating sensor is normally consisted of three layers: driving layer, sensing layer and protective layer where necessary. Fatigue tests with ICM for various materials demonstrate the capability to detect cracks with l<300μm, corresponding to the increment of the sensing layer's resistance at the level of 0.05Ω. Also, ICM resistance measurements correlate with crack length, permitting crack length monitoring. Numerous applications are under evaluation for ICM in difficult-to-access locations on commercial and military aircrafts. The motivation for the permanently flaw-detected coating monitoring is either (i) to replace an existing inspection that requires substantial disassembly and surface preparation (e.g. inside the fuel tank of an aircraft), or (ii) to take advantage of early detection and apply less invasive life-extension repairs, as well as reduce interruption of service when flaws are detected. Implementation of ICM is expected to improve fleet management practices and modify damage tolerance assumptions.

Tolerance of Erythrocytes in Poultry: Induction and Specificity

PubMed Central

Mitchison, N. A.

1962-01-01

Measurement of the rate of elimination of 51Cr-labelled erythrocytes provides a reliable test of immunity in fowls. Chickens can be rendered tolerant of homologous and turkey erythrocytes, as judged by this test, by receiving a series of transfusions of irradiated blood. The series were arranged so that foreign cells remained present in the circulation from the time of hatching. Tolerance induced by this treatment is generally incomplete, but can last indefinitely. In some chickens the manifestation of tolerance of turkey erythrocytes is delayed, probably because of passive transmission of antibody from the dam. Chickens old enough to react against small transfusions of homologous blood can still be rendered tolerant by massive transfusions. Tolerance of the erythrocytes from an individual donor extends only slightly to those from other donors. Tolerance acquired in this way, through transfusion of irradiated blood, stands in contrast to the more stable and complete tolerance that can be acquired through administration of viable cells. Viable cells, on the other hand, provide a less sensitive test, for birds which tolerate skin homografts often eliminate rapidly erythrocytes from the same donor. PMID:14474652

Unrecognized heart failure and chronic obstructive pulmonary disease (COPD) in frail elderly detected through a near-home targeted screening strategy.

PubMed

van Mourik, Yvonne; Bertens, Loes C M; Cramer, Maarten J M; Lammers, Jan-Willem J; Reitsma, Johannes B; Moons, Karel G M; Hoes, Arno W; Rutten, Frans H

2014-01-01

Reduced exercise tolerance and dyspnea are common in older people, and heart failure (HF) and chronic obstructive pulmonary disease (COPD) are the main causes. We want to determine the prevalence of previously unrecognized HF, COPD, and other chronic diseases in frail older people using a near-home targeted screening strategy. Community-dwelling frail persons aged ≥65 years underwent a 2-step screening strategy. First, they received a questionnaire inquiring about dyspnea and exercise tolerance. Those with exercise intolerance and/or dyspnea were invited to visit their primary care physician's office for a screening program, including medical history taking, physical examination, blood tests, electrocardiography, spirometry, and echocardiography. The final diagnosis of every patient was determined by a panel consisting of 3 physicians. Of the 570 elderly who filled out the questionnaire, 395 (69%) had reduced exercise tolerance or dyspnea. Of these, 389 underwent the screening program: 127 (33.5%, 95% confidence interval, 28.9-38.4%) were newly diagnosed with HF (mainly HF with a preserved ejection fraction [23.5%]), and previously unrecognized COPD was detected in 16.8% (95% confidence interval, 13.4-20.9%). In total, 165 patients (43.9%) received a new diagnosis of either HF, COPD, or both. Other new diagnoses (in 32.7% of the screening program patients) included atrial fibrillation (1.8%), valvular disease (21.4%), (persisting) asthma (3.1%), anemia (12.7%), and thyroid disease (0.6%). No clear explanation for the complaints of 47 patients (12.2%) was found using our strategy. Unrecognized chronic diseases might be detected in community-dwelling frail elderly using a near-home screening strategy that is simple to implement. It remains to be proven, however, whether optimizing treatment of the newly detected diagnoses in this fragile population with multimorbidities and polypharmacy improves quality of life and reduces morbidity and mortality. © Copyright 2014 by the American Board of Family Medicine.

OBIST methodology incorporating modified sensitivity of pulses for active analogue filter components

NASA Astrophysics Data System (ADS)

Khade, R. H.; Chaudhari, D. S.

2018-03-01

In this paper, oscillation-based built-in self-test method is used to diagnose catastrophic and parametric faults in integrated circuits. Sallen-Key low pass filter and high pass filter circuits with different gains are used to investigate defects. Variation in seven parameters of operational amplifier (OP-AMP) like gain, input impedance, output impedance, slew rate, input bias current, input offset current, input offset voltage and catastrophic as well as parametric defects in components outside OP-AMP are introduced in the circuit and simulation results are analysed. Oscillator output signal is converted to pulses which are used to generate a signature of the circuit. The signature and pulse count changes with the type of fault present in the circuit under test (CUT). The change in oscillation frequency is observed for fault detection. Designer has flexibility to predefine tolerance band of cut-off frequency and range of pulses for which circuit should be accepted. The fault coverage depends upon the required tolerance band of the CUT. We propose a modification of sensitivity of parameter (pulses) to avoid test escape and enhance yield. Result shows that the method provides 100% fault coverage for catastrophic faults.

Composite transport wing technology development

NASA Technical Reports Server (NTRS)

Madan, Ram C.

1988-01-01

The design, fabrication, testing, and analysis of stiffened wing cover panels to assess damage tolerance criteria are discussed. The damage tolerance improvements were demonstrated in a test program using full-sized cover panel subcomponents. The panels utilized a hard skin concept with identical laminates of 44-percent 0-degree, 44-percent plus or minus 45-degree, and 12-percent 90-degree plies in the skins and stiffeners. The panel skins were impacted at midbay between the stiffeners, directly over the stiffener, and over the stiffener flange edge. The stiffener blades were impacted laterally. Impact energy levels of 100 ft-lb and 200 ft-lb were used. NASTRAN finite-element analyses were performed to simulate the nonvisible damage that was detected in the panels by nondestructive inspection. A closed-form solution for generalized loading was developed to evaluate the peel stresses in the bonded structure. Two-dimensional delamination growth analysis was developed using the principle of minimum potential energy in terms of closed-form solution for critical strain. An analysis was conducted to determine the residual compressive stress in the panels after impact damage, and the analytical predictions were verified by compression testing of the damaged panels.

Combined use of fasting plasma glucose and glycated hemoglobin A1c in the screening of diabetes and impaired glucose tolerance.

PubMed

Hu, Yaomin; Liu, Wei; Chen, Yawen; Zhang, Ming; Wang, Lihua; Zhou, Huan; Wu, Peihong; Teng, Xiangyu; Dong, Ying; Zhou, Jia wen; Xu, Hua; Zheng, Jun; Li, Shengxian; Tao, Tao; Hu, Yumei; Jia, Yun

2010-09-01

The aim of this study is to assess the validity of combined use of fasting plasma glucose (FPG) and glycated hemoglobin A1c (HbA1c) as screening tests for diabetes and impaired glucose tolerance (IGT) in high-risk subjects. A total of 2,298 subjects were included. All subjects underwent a 75-g oral glucose tolerance test (OGTT) and HbA1c measurement. Receiver operating characteristic curve (ROC curve) analysis was used to examine the sensitivity and specificity of FPG and HbA1c for detecting diabetes and IGT, which was defined according to the 1999 World Health Organization (WHO) criteria. (1) Based on the ROC curve, the optimal cut point of FPG related to diabetes diagnosed by OGTT was 6.1 mmol/l that was associated with a sensitivity and specificity of 81.5 and 81.0%, respectively; The optimal cut point of HbA1c related to diabetes diagnosed by OGTT was 6.1%, which was associated with a sensitivity and specificity of 81.0 and 81.0%, respectively; The screening model using FPG > or = 6.1 mmol/l or HbA1c > or = 6.1% had sensitivity of 96.5% for detecting undiagnosed diabetes; the screening model using FPG > or = 6.1 mmol/l and HbA1c > or = 6.1% had specificity of 96.3% for detecting undiagnosed diabetes. (2) Based on the ROC curve, the optimal cut point of FPG related to IGT diagnosed by OGTT was 5.6 mmol/l that was associated with a sensitivity and specificity of 64.1 and 65.4%, respectively; The optimal cut point of HbA1c related to IGT diagnosed by OGTT was 5.6%, which was associated with a sensitivity and specificity of 66.2 and 51.0%, respectively; The screening model using FPG > or = 5.6 mmol/l or HbA1c > or = 5.6% had sensitivity of 87.9% for detecting undiagnosed IGT; The screening model using FPG > or = 5.6 mmol/l and HbA1c > or = 5.6% had specificity of 82.4% for detecting undiagnosed IGT. Compared with FPG or HbA1c alone, the simultaneous measurement of FPG and HbA1c (FPG and/or HbA1C) might be a more sensitive and specific screening tool for identifying high-risk individuals with diabetes and IGT at an early stage.

78 FR 76987 - Mandipropamid; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2013-12-20

... screening battery. No systemic or dermal toxicity was observed following dermal exposure for 28 days, up to... mass spectrometric detection (LC/MS/MS), is available to enforce the tolerance expression. The method...

Quality Issues in Propulsion

NASA Technical Reports Server (NTRS)

McCarty, John P.; Lyles, Garry M.

1997-01-01

Propulsion system quality is defined in this paper as having high reliability, that is, quality is a high probability of within-tolerance performance or operation. Since failures are out-of-tolerance performance, the probability of failures and their occurrence is the difference between high and low quality systems. Failures can be described at 3 levels: the system failure (which is the detectable end of a failure), the failure mode (which is the failure process), and the failure cause (which is the start). Failure causes can be evaluated & classified by type. The results of typing flight history failures shows that most failures are in unrecognized modes and result from human error or noise, i.e. failures are when engineers learn how things really work. Although the study based on US launch vehicles, a sampling of failures from other countries indicates the finding has broad application. The parameters of the design of a propulsion system are not single valued, but have dispersions associated with the manufacturing of parts. Many tests are needed to find failures, if the dispersions are large relative to tolerances, which could contribute to the large number of failures in unrecognized modes.

Association between glucose intolerance and bacterial colonisation in an adult population with cystic fibrosis, emergence of Stenotrophomonas maltophilia.

PubMed

Lehoux Dubois, C; Boudreau, V; Tremblay, F; Lavoie, A; Berthiaume, Y; Rabasa-Lhoret, R; Coriati, A

2017-05-01

Diabetes is common in cystic fibrosis (CF). Glucose can be detected in the airway when the blood glucose is elevated, which favours bacterial growth. We investigated the relationship between dysglycemia and lung pathogens in CF. Cross-sectional and prospective analysis of CF patients (N=260) who underwent a 2h-oral glucose tolerance test. Clinical data was collected. Stenotrophomonas maltophilia (S. maltophilia) was the sole bacteria increased in dysglycemic (AGT: 20.2%, CFRD: 21.6%) patients compared to normotolerants (NGT: 8.7%). S. maltophilia positive patients with dysglycemia had more pulmonary exacerbation events compared to NGTs (1.22 vs 0.63, P=0.003). The interaction between S. maltophilia colonisation and glucose tolerance status significantly increases the risk of lower lung function (P=0.003). Its growth was not affected by the evolution of the glucose tolerance after three years follow-up. Prevalence of S. maltophilia was higher in dysglycemic patients, supporting the idea that S. maltophilia is a marker of disease severity in CF. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Trade-offs in osmoregulation and parallel shifts in molecular function follow ecological transitions to freshwater in the Alewife

USGS Publications Warehouse

Velotta, Jonathan P.; McCormick, Stephen; Schultz, Eric T.

2015-01-01

Adaptation to freshwater may be expected to reduce performance in seawater because these environments represent opposing selective regimes. We tested for such a trade-off in populations of the Alewife (Alosa pseudoharengus). Alewives are ancestrally anadromous, and multiple populations have been independently restricted to freshwater (landlocked). We conducted salinity challenge experiments, whereby juvenile Alewives from one anadromous and multiple landlocked populations were exposed to freshwater and seawater on acute and acclimation timescales. In response to acute salinity challenge trials, independently derived landlocked populations varied in the degree to which seawater tolerance has been lost. In laboratory-acclimation experiments, landlocked Alewives exhibited improved freshwater tolerance, which was correlated with reductions in seawater tolerance and hypo-osmotic balance, suggesting that trade-offs in osmoregulation may be associated with local adaptation to freshwater. We detected differentiation between life-history forms in the expression of an ion-uptake gene (NHE3), and in gill Na+/K+-ATPase activity. Trade-offs in osmoregulation, therefore, may be mediated by differentiation in ion-uptake and salt-secreting pathways.

Practical Guide to the Management of Acute and Chronic Pain in the Presence of Drug Tolerance for the Healthcare Practitioner

PubMed Central

Vadivelu, Nalini; Singh-Gill, Harman; Kodumudi, Gopal; Kaye, Aaron Joshua; Urman, Richard D.; Kaye, Alan David

2014-01-01

Background Drug tolerance has been on the rise in recent years worldwide, and consequently, pain management in our population has become challenging. Methods Discussed in this review are commonly abused drugs and considerations for treating acute and chronic pain states in patients with substance disorders. Results After marijuana, alcohol, and tobacco, the most widely abused substances are oxycodone (Oxycontin), diazepam (Valium), and methylphenidate (Ritalin). Urine testing can detect metabolites of drugs used by patients and is useful for assessing drug abuse, medication diversion, and drug interactions. The comprehensive treatment of pain in a patient with addictive disorder or tolerance must address 3 issues: the patient's addiction, any associated psychiatric conditions, and the patient's pain. Eliciting a detailed history of drug abuse—illicit drugs as well as prescription drugs—and ascertaining if the patient is currently enrolled in a methadone maintenance program for the treatment of drug addiction is vital. Conclusion Medical observation, supportive care, multidisciplinary pain management, and timely interventions as necessary are the keys to safe outcomes in these patients. PMID:25249810

Noise-tolerant instantaneous heart rate and R-peak detection using short-term autocorrelation for wearable healthcare systems.

PubMed

Fujii, Takahide; Nakano, Masanao; Yamashita, Ken; Konishi, Toshihiro; Izumi, Shintaro; Kawaguchi, Hiroshi; Yoshimoto, Masahiko

2013-01-01

This paper describes a robust method of Instantaneous Heart Rate (IHR) and R-peak detection from noisy electrocardiogram (ECG) signals. Generally, the IHR is calculated from the R-wave interval. Then, the R-waves are extracted from the ECG using a threshold. However, in wearable bio-signal monitoring systems, noise increases the incidence of misdetection and false detection of R-peaks. To prevent incorrect detection, we introduce a short-term autocorrelation (STAC) technique and a small-window autocorrelation (SWAC) technique, which leverages the similarity of QRS complex waveforms. Simulation results show that the proposed method improves the noise tolerance of R-peak detection.

Resistance to Elsinoë Ampelina and Expression of Related Resistant Genes in Vitis Rotundifolia Michx. Grapes

PubMed Central

Louime, Clifford; Lu, Jiang; Onokpise, Oghenekome; Vasanthaiah, Hemanth K. N.; Kambiranda, Devaiah; Basha, Sheikh M.; Yun, Hae Keun

2011-01-01

Muscadine grapes (Vitis rotundifolia Michx) are considered as excellent genetic resources for grape breeding programs as they are known for their hardiness and resistance to pests and diseases. However, contrary to popular belief, our study indicated that not all muscadine cultivars are resistant to anthracnose disease. In order to identify a source of genetic tolerance towards anthracnose among muscadine cultivars, a series of in-situ and ex-situ experiments were conducted through strict and sensitive screening processes. Two consecutive years of field evaluation of 54 grape cultivars showed various levels of anthracnose incidence among the cultivars between a scale of 0 (tolerant) to 5 (highly-susceptible). Resistance bioassay by inoculation of different spore densities of Elsinoë ampelina on 40 cultivars presented similar results and was consistent with those obtained from the field test. A real-time PCR analysis was conducted to investigate differences of gene expression between susceptible and tolerant cultivars and to confirm results by phenotypic identification. Expression of genes encoding chalcone synthase, stilbene synthase, polygalacturonase-inhibiting protein, chitinase and lipid transfer-protein was only detected in tolerant cultivars. Resistant muscadine cultivars identified in this study could be excellent candidates for grape disease resistance breeding programs. PMID:21747689

Damage tolerance certification of a fighter horizontal stabilizer

NASA Astrophysics Data System (ADS)

Huang, Jia-Yen; Tsai, Ming-Yang; Chen, Jong-Sheng; Ong, Ching-Long

1995-05-01

A review of the program for the damage tolerance certification test of a composite horizontal stabilizer (HS) of a fighter is presented. The object of this program is to certify that the fatigue life and damage tolerance strength of a damaged composite horizontal stabilizer meets the design requirements. According to the specification for damage tolerance certification, a test article should be subjected to two design lifetimes of flight-by-flight load spectra simulating the in-service fatigue loading condition for the aircraft. However, considering the effect of environmental change on the composite structure, one additional lifetime test was performed. In addition, to evaluate the possibilities for extending the service life of the structure, one more lifetime test was carried out with the spectrum increased by a factor of 1.4. To assess the feasibility and reliability of repair technology on a composite structure, two damaged areas were repaired after two lifetimes of damage tolerance test. On completion of four lifetimes of the damage tolerance test, the static residual strength was measured to check whether structural strength after repair met the requirements. Stiffness and static strength of the composite HS with and without damage were evaluated and compared.

SU-E-T-249: Determining the Sensitivity of Beam Profile Parameters for Detecting Energy Changes in Flattening Filter-Free Beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mooney, K; Yaddanapudi, S; Mutic, S

2015-06-15

Purpose: To identify the beam profile parameters that can be used to detect energy changes in a flattening filter-free photon beams. Methods: Flattening filter-free beam profiles (inline, crossline, and diagonals) were measured for multiple field sizes (25×25cm and 10×10cm) at 6MV on a clinical system (Truebeam, Varian Medical Systems Palo Alto CA). Profiles were acquired for baseline energy and detuned beams by changing the bending magnet current (BMC), above and below baseline. The following profile parameters were measured: flatness (off-axis ratio at 80% of field size), symmetry, uniformity, slope, and the off-axis ratio (OAR) at several off-axis distances. Tolerance valuesmore » were determined from repeated measurements. Each parameter was evaluated for sensitivity to the induced beam changes, and the minimum detectable BMC change was calculated for each parameter by calculating the change in BMC that would Result in a change in the parameter above the measurement tolerance. Results: Tolerance values for the parameters were-Flatness≤0.1%; Symmetry≤0.4%; Uniformity≤0.01%; Slope≤ 0.001%/mm. The measurements made with a field size of 25cm and a depth of d=1.5cm showed the greatest sensitivity to bending magnet current variations. Uniformity had the highest sensitivity, able to detect a change in BMC of BMC=0.02A. The OARs and slope were sensitive to the magnitude and direction of BMC change. The sensitivity in the flatness parameter was BMC=0.04A; slope was sensitive to BMC=0.05A. The sensitivity decreased for OARs measured closer to central axis-BMC(8cm)=0.23A; BMC(5cm)=0.47A; BMC(2cm)=1.35A. Symmetry was not sensitive to changes in BMC. Conclusion: These tests allow for better QA of FFF beams by setting tolerance levels to beam parameter baseline values which reflect variations in machine calibration. Uniformity is most sensitive to BMC changes, while OARs provide information about magnitude and direction of miscalibration. Research funding provided by Varian Medical Systems. Dr. Sasa Mutic receives compensation for providing patient safety training services from Varian Medical Systems, the sponsor of this study.« less

Sliding mode based fault detection, reconstruction and fault tolerant control scheme for motor systems.

PubMed

Mekki, Hemza; Benzineb, Omar; Boukhetala, Djamel; Tadjine, Mohamed; Benbouzid, Mohamed

2015-07-01

The fault-tolerant control problem belongs to the domain of complex control systems in which inter-control-disciplinary information and expertise are required. This paper proposes an improved faults detection, reconstruction and fault-tolerant control (FTC) scheme for motor systems (MS) with typical faults. For this purpose, a sliding mode controller (SMC) with an integral sliding surface is adopted. This controller can make the output of system to track the desired position reference signal in finite-time and obtain a better dynamic response and anti-disturbance performance. But this controller cannot deal directly with total system failures. However an appropriate combination of the adopted SMC and sliding mode observer (SMO), later it is designed to on-line detect and reconstruct the faults and also to give a sensorless control strategy which can achieve tolerance to a wide class of total additive failures. The closed-loop stability is proved, using the Lyapunov stability theory. Simulation results in healthy and faulty conditions confirm the reliability of the suggested framework. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Monitoring system for testing the radiation hardness of a KINTEX-7 FPGA

NASA Astrophysics Data System (ADS)

Cojocariu, L. N.; Placinta, V. M.; Dumitru, L.

2016-03-01

A much more efficient Ring Imaging Cherenkov sub-detector system will be rebuilt in the second long shutdown of Large Hadron Collider for the LHCb experiment. Radiation-hard electronic components together with Commercial Off-The-Shelf ones will be used in the new Cherenkov photon detection system architecture. An irradiation program was foreseen to determine the radiation tolerance for the new electronic devices, including a Field Programmable Gate Array from KINTEX-7 family of XILINX. An automated test bench for online monitoring of the XC7K70T KINTEX-7 device operation in radiation conditions was designed and implemented by the LHCb Romanian group.

Defense Small Business Innovation Research Program (SBIR). Volume 3. Air Force Abstracts of Phase 1 Awards

DTIC Science & Technology

1990-01-01

THERE WILL BE A CONTINUING NEED FOR A SENSITIVE, RAPID, AND ECONOMICAL TESTING PROCEDURE CAPABLE OF DETECTING DEFECTS AND PROVIDING FEEDBACK FOR QUALITY...SOLUTIONS. THE DKF METHOD PROVIDES OPTIMAL OR NEAR-OPTIMAL ACCURACY, REDUCE PROCESSING BURDEN, AND IMPROVE FAULT TOLERANCE. THE DKF/MMAE ( DMAE ) TECHNIQUES...DEVICES FOR B-SiC IS TO BE ABLE TO CONSISTENTLY PRODUCE INTRINSIC FILMS WITH VERY LOW DEFECTS AND TO DEVELOP SCHOTTKY AND OHMIC CONTACT MATERIALS THAT WILL

Cancer prevention trial of a synergistic mixture of green tea concentrate plus Capsicum (CAPSOL-T) in a random population of subjects ages 40-84

PubMed Central

2014-01-01

Background Experts agree that one of the more promising strategies in cancer management is early detection coupled with early intervention. In this study, we evaluated an early cancer detection strategy of cancer presence based on serum levels of the cancer-specific transcript variants of ENOX2 in serum coupled with an ENOX2-targeted nutraceutical preparation of green tea concentrate plus Capsicum (Capsol-T®) as a strategy of Curative Prevention® involving early detection coupled with early intervention in early stage cancer when in its most susceptible and manageable stages. Experimental design One hundred ten (110) subjects were tested for cancer presence using the ONCOblot® Tissue of Origin 2-D gel/western blot protocol for detection of serum presence of transcript variants of the ENOX2 protein. Subjects testing positive for ENOX2 received 350 mg of Capsol-T® in capsule form every 4 h including during the night for periods of at least 3 to 6 months or longer after which they were again tested for ENOX2 presence using the ONCOblot® Tissue of Origin Cancer Test protocol. Results Of the 110 subjects, both male and female, ages 40 to 84, with no evidence of clinical symptoms of cancer, 40% were positive for ENOX2 presence in the ONCOblot® Tissue of Origin Cancer Test. After completion of 3 to 17 months of Capsol-T® use, 94% of subjects subsequently tested negative for ENOX2 presence. Conclusions Oral Capsol-T® is well tolerated and, for ENOX2 presence in serum in the absence of clinical cancer symptoms, is consistently effective in reducing the serum ENOX2 levels to below detectable limits. PMID:24393573

Mapping of a major QTL for salt tolerance of mature field-grown maize plants based on SNP markers.

PubMed

Luo, Meijie; Zhao, Yanxin; Zhang, Ruyang; Xing, Jinfeng; Duan, Minxiao; Li, Jingna; Wang, Naishun; Wang, Wenguang; Zhang, Shasha; Chen, Zhihui; Zhang, Huasheng; Shi, Zi; Song, Wei; Zhao, Jiuran

2017-08-15

Salt stress significantly restricts plant growth and production. Maize is an important food and economic crop but is also a salt sensitive crop. Identification of the genetic architecture controlling salt tolerance facilitates breeders to select salt tolerant lines. However, the critical quantitative trait loci (QTLs) responsible for the salt tolerance of field-grown maize plants are still unknown. To map the main genetic factors contributing to salt tolerance in mature maize, a double haploid population (240 individuals) and 1317 single nucleotide polymorphism (SNP) markers were employed to produce a genetic linkage map covering 1462.05 cM. Plant height of mature maize cultivated in the saline field (SPH) and plant height-based salt tolerance index (ratio of plant height between saline and control fields, PHI) were used to evaluate salt tolerance of mature maize plants. A major QTL for SPH was detected on Chromosome 1 with the LOD score of 22.4, which explained 31.2% of the phenotypic variation. In addition, the major QTL conditioning PHI was also mapped at the same position on Chromosome 1, and two candidate genes involving in ion homeostasis were identified within the confidence interval of this QTL. The detection of the major QTL in adult maize plant establishes the basis for the map-based cloning of genes associated with salt tolerance and provides a potential target for marker assisted selection in developing maize varieties with salt tolerance.

Performance monitor system functional simulator, environmental data, orbiter 101(HFT)

NASA Technical Reports Server (NTRS)

Parker, F. W.

1974-01-01

Information concerning the environment component of the space shuttle performance monitor system simulator (PMSS) and those subsystems operational on the shuttle orbiter 101 used for horizontal flight test (HFT) is provided, along with detailed data for the shuttle performance monitor system (PMS) whose software requirements evolve from three basic PMS functions: (1) fault detection and annunciation; (2) subsystem measurement management; and (3) subsystem configuration management. Information relative to the design and operation of Orbiter systems for HFT is also presented, and the functional paths are identified to the lowest level at which the crew can control the system functions. Measurement requirements are given which are necessary to adequately monitor the health status of the system. PMS process requirements, relative to the measurements which are necessary for fault detection and annunciation of a failed functional path, consist of measurement characteristics, tolerance limits, precondition tests, and correlation measurements.

Advanced Information Processing System - Fault detection and error handling

NASA Technical Reports Server (NTRS)

Lala, J. H.

1985-01-01

The Advanced Information Processing System (AIPS) is designed to provide a fault tolerant and damage tolerant data processing architecture for a broad range of aerospace vehicles, including tactical and transport aircraft, and manned and autonomous spacecraft. A proof-of-concept (POC) system is now in the detailed design and fabrication phase. This paper gives an overview of a preliminary fault detection and error handling philosophy in AIPS.

Chlorophyll fluorescence emission as a reporter on cold tolerance in Arabidopsis thaliana accessions

PubMed Central

Mishra, Anamika; Höermiller, Imke I; Heyer, Arnd G; Nedbal, Ladislav

2011-01-01

Non-invasive, high-throughput screening methods are valuable tools in breeding for abiotic stress tolerance in plants. Optical signals such as chlorophyll fluorescence emission can be instrumental in developing new screening techniques. In order to examine the potential of chlorophyll fluorescence to reveal plant tolerance to low temperatures, we used a collection of nine Arabidopsis thaliana accessions and compared their fluorescence features with cold tolerance quantified by the well established electrolyte leakage method on detached leaves. We found that, during progressive cooling, the minimal chlorophyll fluorescence emission rose strongly and that this rise was highly dependent on the cold tolerance of the accessions. Maximum quantum yield of PSII photochemistry and steady state fluorescence normalized to minimal fluorescence were also highly correlated to the cold tolerance measured by the electrolyte leakage method. In order to further increase the capacity of the fluorescence detection to reveal the low temperature tolerance, we applied combinatorial imaging that employs plant classification based on multiple fluorescence features. We found that this method, by including the resolving power of several fluorescence features, can be well employed to detect cold tolerance already at mild sub-zero temperatures. Therefore, there is no need to freeze the screened plants to the largely damaging temperatures of around −15°C. This, together with the method's easy applicability, represents a major advantage of the fluorescence technique over the conventional electrolyte leakage method. PMID:21427532

Quantitative analysis of antigen for the induction of tolerance in carcinoembryonic antigen transgenic mice.

PubMed Central

Hasegawa, T; Isobe, K; Nakashima, I; Shimokata, K

1992-01-01

In order to analyse the amounts of antigen in the thymus for the induction of tolerance, several carcinoembryonic antigen (CEA) transgenic lines were established which expressed human CEA antigen with different amounts. The chimeric KSN nude mice transplanted with the thymus of the B601 line (in which CEA mRNA and CEA protein could be detected in various tissues) to kidney capsule showed tolerance to human CEA. On the other hand, the chimeric KSN nude mice transplanted with the thymus of the B602 or BC60 line (in which neither CEA mRNA nor CEA protein could be detected by Northern blot analysis and flow cytometry analysis) or normal C57BL/6 (B6) did not develop the tolerance to human CEA. However, the chimeric KSN nude mice transplanted simultaneously with thymus of the B6 and spleen of the B601 line became tolerant to human CEA antigen. In the case of systemic immunization with cells which had CEA antigen, the B601 line was tolerant to human CEA. Surprisingly, the B602 and BC60 lines were also tolerant to CEA molecule. These results indicate that not only the antigen present in the thymus but also the antigen which flows from the peripheral organs to the thymus may be necessary for the induction of CEA tolerance. Images Figure 1 PMID:1493931

Alcohol-impaired speed and accuracy of cognitive functions: a review of acute tolerance and recovery of cognitive performance.

PubMed

Schweizer, Tom A; Vogel-Sprott, Muriel

2008-06-01

Much research on the effects of a dose of alcohol has shown that motor skills recover from impairment as blood alcohol concentrations (BACs) decline and that acute tolerance to alcohol impairment can develop during the course of the dose. Comparable alcohol research on cognitive performance is sparse but has increased with the development of computerized cognitive tasks. This article reviews the results of recent research using these tasks to test the development of acute tolerance in cognitive performance and recovery from impairment during declining BACs. Results show that speed and accuracy do not necessarily agree in detecting cognitive impairment, and this mismatch most frequently occurs during declining BACs. Speed of cognitive performance usually recovers from impairment to drug-free levels during declining BACs, whereas alcohol-increased errors fail to diminish. As a consequence, speed of cognitive processing tends to develop acute tolerance, but no such tendency is shown in accuracy. This "acute protracted error" phenomenon has not previously been documented. The findings pose a challenge to the theory of alcohol tolerance on the basis of physiological adaptation and raise new research questions concerning the independence of speed and accuracy of cognitive processes, as well as hemispheric lateralization of alcohol effects. The occurrence of alcohol-induced protracted cognitive errors long after speed returned to normal is identified as a potential threat to the safety of social drinkers that requires urgent investigation.

Heme oxygenase-1, carbon monoxide, and bilirubin induce tolerance in recipients toward islet allografts by modulating T regulatory cells.

PubMed

Lee, Soo Sun; Gao, Wenda; Mazzola, Silvia; Thomas, Michael N; Csizmadia, Eva; Otterbein, Leo E; Bach, Fritz H; Wang, Hongjun

2007-11-01

Heme oxygenase-1 (HO-1) induction in, or carbon monoxide (CO), or bilirubin administration to, donors and/or recipients frequently lead to long-term survival (>100 days) of DBA/2 islets into B6AF1 recipients. We tested here whether similar treatments show value in a stronger immunogenetic combination, i.e., BALB/c to C57BL/6, and attempted to elucidate the mechanism accounting for tolerance. Induction of HO-1, administering CO or bilirubin to the donor, the islets or the recipient, prolonged islet allograft survival to different extents. Combining all the above treatments (the "combined" protocol) led to survival for >100 days and antigen-specific tolerance to 60% of the transplanted grafts. A high level of forkhead box P3 (Foxp3) and transforming growth factor beta (TGF-beta) expression was detected in the long-term surviving grafts. With the combined protocol, significantly more T regulatory cells (Tregs) were observed surrounding islets 7 days following transplantation. No prolongation of graft survival was observed using the combined protocol when CD4+ CD25+ T cells were predepleted from the recipients before transplantation. In conclusion, our combined protocol led to long-term survival and tolerance to islets in the BALB/c to C57BL/6 combination by promoting Foxp3+ Tregs; these cells played a critical role in the induction and maintenance of tolerance in the recipient.

Genetic dissection of ethanol tolerance in the budding yeast Saccharomyces cerevisiae.

PubMed

Hu, X H; Wang, M H; Tan, T; Li, J R; Yang, H; Leach, L; Zhang, R M; Luo, Z W

2007-03-01

Uncovering genetic control of variation in ethanol tolerance in natural populations of yeast Saccharomyces cerevisiae is essential for understanding the evolution of fermentation, the dominant lifestyle of the species, and for improving efficiency of selection for strains with high ethanol tolerance, a character of great economic value for the brewing and biofuel industries. To date, as many as 251 genes have been predicted to be involved in influencing this character. Candidacy of these genes was determined from a tested phenotypic effect following gene knockout, from an induced change in gene function under an ethanol stress condition, or by mutagenesis. This article represents the first genomics approach for dissecting genetic variation in ethanol tolerance between two yeast strains with a highly divergent trait phenotype. We developed a simple but reliable experimental protocol for scoring the phenotype and a set of STR/SNP markers evenly covering the whole genome. We created a mapping population comprising 319 segregants from crossing the parental strains. On the basis of the data sets, we find that the tolerance trait has a high heritability and that additive genetic variance dominates genetic variation of the trait. Segregation at five QTL detected has explained approximately 50% of phenotypic variation; in particular, the major QTL mapped on yeast chromosome 9 has accounted for a quarter of the phenotypic variation. We integrated the QTL analysis with the predicted candidacy of ethanol resistance genes and found that only a few of these candidates fall in the QTL regions.

A Proactive Approach to Penicillin Allergy Testing in Hospitalized Patients.

PubMed

Chen, Justin R; Tarver, Scott A; Alvarez, Kristin S; Tran, Trang; Khan, David A

Penicillin allergy testing is underutilized in inpatients despite its potential to immediately impact antibiotic treatment. Although most tested patients are able to tolerate penicillin, limited availability and awareness of this tool leads to the use of costly and harmful substitutes. We established an inpatient service at a large academic hospital to identify and test patients with a history of penicillin allergy with the goals of removing inaccurate diagnoses, reducing the use of beta-lactam alternatives, and educating patients and clinicians about the procedure. Eligible inpatients were flagged daily through the electronic medical record and prioritized via a specialized algorithm. A trained clinical pharmacist performed penicillin skin tests and challenges preemptively or by provider request. Clinical characteristics and antibiotic use were analyzed in tested patients. A total of 1203 applicable charts were detected by our system leading to 252 direct evaluations over 18 months. Overall, 228 subjects (90.5%) had their penicillin allergy removed. Of these, 223 were cleared via testing and 5 by discovery of prior penicillin tolerance. Among patients testing negative, 85 (38%) subsequently received beta-lactams, preventing 504 inpatient days and 648 outpatient days on alternative agents. Penicillin allergy testing using a physician-pharmacist team model effectively removes reported allergies in hospitalized patients. The electronic medical record is a valuable asset for locating and stratifying individuals who benefit most from intervention. Proactive testing substantially reduces unnecessary inpatient and outpatient use of beta-lactam alternatives that may otherwise go unaddressed. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

A fast and reliable method for daily quality assurance in spot scanning proton therapy with a compact and inexpensive phantom.

PubMed

Bizzocchi, Nicola; Fracchiolla, Francesco; Schwarz, Marco; Algranati, Carlo

2017-01-01

In a radiotherapy center, daily quality assurance (QA) measurements are performed to ensure that the equipment can be safely used for patient treatment on that day. In a pencil beam scanning (PBS) proton therapy center, spot positioning, spot size, range, and dose output are usually verified every day before treatments. We designed, built, and tested a new, reliable, sensitive, and inexpensive phantom, coupled with an array of ionization chambers, for daily QA that reduces the execution times while preserving the reliability of the test. The phantom is provided with 2 pairs of wedges to sample the Bragg peak at different depths to have a transposition on the transverse plane of the depth dose. Three "boxes" are used to check spot positioning and delivered dose. The box thickness helps spread the single spot and to fit a Gaussian profile on a low resolution detector. We tested whether our new QA solution could detect errors larger than our action levels: 1 mm in spot positioning, 2 mm in range, and 10% in spot size. Execution time was also investigated. Our method is able to correctly detect 98% of spots that are actually in tolerance for spot positioning and 99% of spots out of 1 mm tolerance. All range variations greater than the threshold (2 mm) were correctly detected. The analysis performed over 1 month showed a very good repeatability of spot characteristics. The time taken to perform the daily quality assurance is 20 minutes, a half of the execution time of the former multidevice procedure. This "in-house build" phantom substitutes 2 very expensive detectors (a multilayer ionization chamber [MLIC] and a strip chamber, reducing by 5 times the cost of the equipment. We designed, built, and validated a phantom that allows for accurate, sensitive, fast, and inexpensive daily QA procedures in proton therapy with PBS. Copyright © 2017 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights reserved.

Oral glucose tolerance test significantly impacts the prevalence of abnormal glucose tolerance among Indian women with polycystic ovary syndrome: lessons from a large database of two tertiary care centers on the Indian subcontinent.

PubMed

Ganie, Mohd Ashraf; Dhingra, Atul; Nisar, Sobia; Sreenivas, Vishnubhatla; Shah, Zaffar Amin; Rashid, Aafia; Masoodi, Shariq; Gupta, Nandita

2016-01-01

To estimate the prevalence of abnormal glucose tolerance (AGT) among Indian women with polycystic ovary syndrome (PCOS) and analyze the role of oral glucose tolerance (OGTT) test on its estimation. Cross-sectional clinical study. Tertiary care center. A total of 2,014 women with PCOS diagnosed on the basis of the Rotterdam 2003 criteria were enrolled, and the data of 1,746 subjects were analyzed. In addition to recording clinical, biochemical, and hormone parameters, a 75 g OGTT was administered. Prevalence of AGT and impact of age, body mass index (BMI), family history, and OGTT on its prevalence. The mean age of subjects was 23.8 ± 5.3 years, with a mean BMI of 24.9 ± 4.4 kg/m(2). The overall prevalence of AGT was 36.3% (6.3% diabetes and 30% impaired fasting plasma glucose/impaired glucose tolerance) using American Diabetes Association criteria. The glucose intolerance showed a rising trend with advancing age (30.3%, 35.4%, 51%, and 58.8% in the second, third, fourth, and fifth decades, respectively) and increasing BMI. Family history of diabetes mellitus was present in 54.6% (953/1,746) subjects, and it did not correlate with any of the studied parameters except waist circumference and BMI. Sensitivity was better with 2-hour post-OGTT glucose values as compared with fasting plasma glucose, since using fasting plasma glucose alone would have missed the diagnosis in 107 (6.1%) subjects. We conclude that AGT is high among young Indian women with PCOS and that it is not predicted by family history of type 2 DM. OGTT significantly improves the detection rate of AGT among Indian women with PCOS. Copyright © 2016. Published by Elsevier Inc.

Biosentinel: Improving Desiccation Tolerance of Yeast Biosensors for Deep-Space Missions

NASA Technical Reports Server (NTRS)

Dalal, Sawan; Santa Maria, Sergio R.; Liddell, Lauren; Bhattacharya, Sharmila

2017-01-01

BioSentinel is one of 13 secondary payloads to be deployed on Exploration Mission 1 (EM-1) in 2019. We will use the budding yeast Saccharomyces cerevisiae as a biosensor to determine how deep-space radiation affects living organisms and to potentially quantify radiation levels through radiation damage analysis. Radiation can damage DNA through double strand breaks (DSBs), which can normally be repaired by homologous recombination. Two yeast strains will be air-dried and stored in microfluidic cards within the payload: a wild-type control strain and a radiation sensitive rad51 mutant that is deficient in DSB repairs. Throughout the mission, the microfluidic cards will be rehydrated with growth medium and an indicator dye. Growth rates of each strain will be measured through LED detection of the reduction of the indicator dye, which correlates with DNA repair and the amount of radiation damage accumulated. Results from BioSentinel will be compared to analog experiments on the ISS and on Earth. It is well known that desiccation can damage yeast cells and decrease viability over time. We performed a screen for desiccation-tolerant rad51 strains. We selected 20 re-isolates of rad51 and ran a weekly screen for desiccation-tolerant mutants for five weeks. Our data shows that viability decreases over time, confirming previous research findings. Isolates L2, L5 and L14 indicate desiccation tolerance and are candidates for whole-genome sequencing. More time is needed to determine whether a specific strain is truly desiccation tolerant. Furthermore, we conducted an intracellular trehalose assay to test how intracellular trehalose concentrations affect or protect the mutant strains against desiccation stress. S. cerevisiae cell and reagent concentrations from a previously established intracellular trehalose protocol did not yield significant absorbance measurements, so we tested varying cell and reagent concentrations and determined proper concentrations for successful protocol use.

Cyber situation awareness: modeling detection of cyber attacks with instance-based learning theory.

PubMed

Dutt, Varun; Ahn, Young-Suk; Gonzalez, Cleotilde

2013-06-01

To determine the effects of an adversary's behavior on the defender's accurate and timely detection of network threats. Cyber attacks cause major work disruption. It is important to understand how a defender's behavior (experience and tolerance to threats), as well as adversarial behavior (attack strategy), might impact the detection of threats. In this article, we use cognitive modeling to make predictions regarding these factors. Different model types representing a defender, based on Instance-Based Learning Theory (IBLT), faced different adversarial behaviors. A defender's model was defined by experience of threats: threat-prone (90% threats and 10% nonthreats) and nonthreat-prone (10% threats and 90% nonthreats); and different tolerance levels to threats: risk-averse (model declares a cyber attack after perceiving one threat out of eight total) and risk-seeking (model declares a cyber attack after perceiving seven threats out of eight total). Adversarial behavior is simulated by considering different attack strategies: patient (threats occur late) and impatient (threats occur early). For an impatient strategy, risk-averse models with threat-prone experiences show improved detection compared with risk-seeking models with nonthreat-prone experiences; however, the same is not true for a patient strategy. Based upon model predictions, a defender's prior threat experiences and his or her tolerance to threats are likely to predict detection accuracy; but considering the nature of adversarial behavior is also important. Decision-support tools that consider the role of a defender's experience and tolerance to threats along with the nature of adversarial behavior are likely to improve a defender's overall threat detection.

Automated video-based detection of nocturnal convulsive seizures in a residential care setting.

PubMed

Geertsema, Evelien E; Thijs, Roland D; Gutter, Therese; Vledder, Ben; Arends, Johan B; Leijten, Frans S; Visser, Gerhard H; Kalitzin, Stiliyan N

2018-06-01

People with epilepsy need assistance and are at risk of sudden death when having convulsive seizures (CS). Automated real-time seizure detection systems can help alert caregivers, but wearable sensors are not always tolerated. We determined algorithm settings and investigated detection performance of a video algorithm to detect CS in a residential care setting. The algorithm calculates power in the 2-6 Hz range relative to 0.5-12.5 Hz range in group velocity signals derived from video-sequence optical flow. A detection threshold was found using a training set consisting of video-electroencephalogaphy (EEG) recordings of 72 CS. A test set consisting of 24 full nights of 12 new subjects in residential care and additional recordings of 50 CS selected randomly was used to estimate performance. All data were analyzed retrospectively. The start and end of CS (generalized clonic and tonic-clonic seizures) and other seizures considered desirable to detect (long generalized tonic, hyperkinetic, and other major seizures) were annotated. The detection threshold was set to the value that obtained 97% sensitivity in the training set. Sensitivity, latency, and false detection rate (FDR) per night were calculated in the test set. A seizure was detected when the algorithm output exceeded the threshold continuously for 2 seconds. With the detection threshold determined in the training set, all CS were detected in the test set (100% sensitivity). Latency was ≤10 seconds in 78% of detections. Three/five hyperkinetic and 6/9 other major seizures were detected. Median FDR was 0.78 per night and no false detections occurred in 9/24 nights. Our algorithm could improve safety unobtrusively by automated real-time detection of CS in video registrations, with an acceptable latency and FDR. The algorithm can also detect some other motor seizures requiring assistance. © 2018 The Authors. Epilepsia published by Wiley Periodicals, Inc. on behalf of International League Against Epilepsy.

Progression from impaired glucose tolerance to type 2 diabetes in obese children and adolescents: a 3-6-year cohort study in southern Thailand.

PubMed

Jaruratanasirikul, Somchit; Thammaratchuchai, Sudarat; Puwanant, Maneerat; Mo-Suwan, Ladda; Sriplung, Hutcha

2016-11-01

Childhood obesity is associated with abnormal glucose metabolism and type 2 diabetes mellitus (T2DM). This study evaluated the prevalence of abnormal glucose metabolism in asymptomatic obese children and adolescents, and determined the percentage of T2DM development after 3-6 years of follow-up. During 2007-2013, 177 obese children and adolescents who had normal fasting plasma glucose (FPG<100 mg/dL) were given an oral glucose tolerance test (OGTT). The participants were classified into four groups: normal glucose tolerance (NGT), NGT-hyperinsulinemia (NGT-HI), impaired glucose tolerance (IGT), and diabetes mellitus (DM). Blood chemistries, including FPG, glycated hemoglobin, and lipid profiles, and liver function test were performed every 6-12 months or when the patient developed any symptom or sign indicative of diabetes. Glucose metabolism alterations were detected in 81.4% of the participants: 63.8% with NGT-HI, 15.3% with IGT, and 2.3% with T2DM. The median levels of homeostasis model assessment-insulin resistance (HOMA-IR) in patients with IGT (8.63) were significantly greater than those in the patients with NGT (4.04) (p<0.01). During the follow-up, 22 patients (14.4%) developed T2DM significantly more from the IGT group (nine of 33 cases, 27.3%) than the NGT-HI group (12 of 108 cases, 11.1%) (p=0.022). The predicting parameters for T2DM conversion were weight status, body mass index (BMI), FBG, fasting insulin, alanine transaminase (ALT) levels, and HOMA-IR. Glucose metabolism alteration was commonly found among obese adolescents. Factors associated with T2DM development were greater weight status and the severity of insulin resistance as shown by higher HOMA-IR levels.

Discrepancy between stimulus response and tolerance of pain in Alzheimer disease

PubMed Central

Werner, Mads U.; Jensen, Troels Staehelin; Ballegaard, Martin; Andersen, Birgitte Bo; Høgh, Peter; Waldemar, Gunhild

2015-01-01

Background: Affective-motivational and sensory-discriminative aspects of pain were investigated in patients with mild to moderate Alzheimer disease (AD) and healthy elderly controls using the cold pressor test tolerance and repetitive stimuli of warmth and heat stimuli, evaluating the stimulus-response function. Methods: A case-control design was applied examining 33 patients with mild to moderate AD dementia and 32 healthy controls with the cold pressor test (4°C). Warmth detection threshold (WDT) and heat pain threshold (HPT) were assessed using 5 stimulations. A stimulus-response function was estimated using 4 incrementally increasing suprathreshold heat stimuli. Results: Cold pressor tolerance was lower in patients with AD dementia than in controls (p = 0.027). There were no significant differences between groups regarding WDT and HPT. Significant successive increases in HPT assessments indicated habituation (p < 0.0001), which was similar in the 2 groups (p = 0.85). A mixed model for repeated measures demonstrated that pain rating of suprathreshold stimuli depended on HPT (p = 0.0004) and stimulus intensity (p < 0.0001). Patients with AD dementia had significantly lower increases in pain ratings than controls during suprathreshold stimulation (p = 0.0072). Conclusion: Our results indicate that AD dementia is not associated with a propensity toward development of sensitization or a lack of habituation, suggesting preservation of sensory-discriminative aspects of pain perception. The results further suggest that the attenuated cold pressor pain tolerance may relate to impairment of coping abilities. Paradoxically, we found an attenuated stimulus-response function, compared to controls, suggesting that AD dementia interferes with pain ratings over time, most likely due to memory impairment. PMID:25788560

Variation in Thermal Sensitivity and Thermal Tolerances in an Invasive Species across a Climatic Gradient: Lessons from the Land Snail Cornu aspersum

PubMed Central

Gaitán-Espitia, Juan Diego; Belén Arias, María; Lardies, Marco A.; Nespolo, Roberto F.

2013-01-01

The ability of organisms to perform at different temperatures could be described by a continuous nonlinear reaction norm (i.e., thermal performance curve, TPC), in which the phenotypic trait value varies as a function of temperature. Almost any shift in the parameters of this performance curve could highlight the direct effect of temperature on organism fitness, providing a powerful framework for testing thermal adaptation hypotheses. Inter-and intraspecific differences in this performance curve are also reflected in thermal tolerances limits (e.g., critical and lethal limits), influencing the biogeographic patterns of species’ distribution. Within this context, here we investigated the intraspecific variation in thermal sensitivities and thermal tolerances in three populations of the invasive snail Cornu aspersum across a geographical gradient, characterized by different climatic conditions. Thus, we examined population differentiation in the TPCs, thermal-coma recovery times, expression of heat-shock proteins and standard metabolic rate (i.e., energetic costs of physiological differentiation). We tested two competing hypotheses regarding thermal adaptation (the “hotter is better” and the generalist-specialist trade-offs). Our results show that the differences in thermal sensitivity among populations of C. aspersum follow a latitudinal pattern, which is likely the result of a combination of thermodynamic constraints (“hotter is better”) and thermal adaptations to their local environments (generalist-specialist trade-offs). This finding is also consistent with some thermal tolerance indices such as the Heat-Shock Protein Response and the recovery time from chill-coma. However, mixed responses in the evaluated traits suggest that thermal adaptation in this species is not complete, as we were not able to detect any differences in neither energetic costs of physiological differentiation among populations, nor in the heat-coma recovery. PMID:23940617

Variation in thermal sensitivity and thermal tolerances in an invasive species across a climatic gradient: lessons from the land snail Cornu aspersum.

PubMed

Gaitán-Espitia, Juan Diego; Belén Arias, María; Lardies, Marco A; Nespolo, Roberto F

2013-01-01

The ability of organisms to perform at different temperatures could be described by a continuous nonlinear reaction norm (i.e., thermal performance curve, TPC), in which the phenotypic trait value varies as a function of temperature. Almost any shift in the parameters of this performance curve could highlight the direct effect of temperature on organism fitness, providing a powerful framework for testing thermal adaptation hypotheses. Inter-and intraspecific differences in this performance curve are also reflected in thermal tolerances limits (e.g., critical and lethal limits), influencing the biogeographic patterns of species' distribution. Within this context, here we investigated the intraspecific variation in thermal sensitivities and thermal tolerances in three populations of the invasive snail Cornu aspersum across a geographical gradient, characterized by different climatic conditions. Thus, we examined population differentiation in the TPCs, thermal-coma recovery times, expression of heat-shock proteins and standard metabolic rate (i.e., energetic costs of physiological differentiation). We tested two competing hypotheses regarding thermal adaptation (the "hotter is better" and the generalist-specialist trade-offs). Our results show that the differences in thermal sensitivity among populations of C. aspersum follow a latitudinal pattern, which is likely the result of a combination of thermodynamic constraints ("hotter is better") and thermal adaptations to their local environments (generalist-specialist trade-offs). This finding is also consistent with some thermal tolerance indices such as the Heat-Shock Protein Response and the recovery time from chill-coma. However, mixed responses in the evaluated traits suggest that thermal adaptation in this species is not complete, as we were not able to detect any differences in neither energetic costs of physiological differentiation among populations, nor in the heat-coma recovery.

Assessing inspection sensitivity as it relates to damage tolerance in composite rotor hubs

NASA Astrophysics Data System (ADS)

Roach, Dennis P.; Rackow, Kirk

2001-08-01

Increasing niche applications, growing international markets, and the emergence of advanced rotorcraft technology are expected to greatly increase the population of helicopters over the next decade. In terms of fuselage fatigue, helicopters show similar trends as fixed-wing aircraft. The highly unsteady loads experienced by rotating wings not only directly affect components in the dynamic systems but are also transferred to the fixed airframe structure. Expanded use of rotorcraft has focused attention on the use of new materials and the optimization of maintenance practices. The FAA's Airworthiness Assurance Center (AANC) at Sandia National Labs has joined with Bell Helicopter andother agencies in the rotorcraft industry to evaluate nondestructive inspection (NDI) capabilities in light of the damage tolerance of assorted rotorcraft structure components. Currently, the program's emphasis is on composite rotor hubs. The rotorcraft industry is constantly evaluating new types of lightweight composite materials that not only enhance the safety and reliability of rotor components but also improve performance and extended operating life as well. Composite rotor hubs have led to the use of bearingless rotor systems that are less complex and require less maintenance than their predecessors. The test facility described in this paper allows the structural stability and damage tolerance of composite hubs to be evaluated using realistic flight load spectrums of centrifugal force and bending loads. NDI was integrated into the life-cycle fatigue tests in order to evaluate flaw detection sensitivity simultaneously wiht residual strength and general rotor hub peformance. This paper will describe the evolving use of damage tolerance analysis (DTA) to direct and improve rotorcraft maintenance along with the related use of nondestructive inspections to manage helicopter safety. OVeralll, the data from this project will provide information to improve the producibility, inspectability, serviceability, and cost effectively of rotorcraft components.

Identification of salt-tolerant QTLs with strong genetic background effect using two sets of reciprocal introgression lines in rice.

PubMed

Cheng, Lirui; Wang, Yun; Meng, Lijun; Hu, Xia; Cui, Yanru; Sun, Yong; Zhu, Linghua; Ali, Jauhar; Xu, Jianlong; Li, Zhikang

2012-01-01

Effect of genetic background on detection of quantitative trait locus (QTL) governing salinity tolerance (ST) was studied using two sets of reciprocal introgression lines (ILs) derived from a cross between a moderately salinity tolerant japonica variety, Xiushui09 from China, and a drought tolerant but salinity susceptible indica breeding line, IR2061-520-6-9 from the Philippines. Salt toxicity symptoms (SST) on leaves, days to seedling survival (DSS), and sodium and potassium uptake by shoots were measured under salinity stress of 140 mmol/L of NaCl. A total of 47 QTLs, including 26 main-effect QTLs (M-QTLs) and 21 epistatic QTLs (E-QTLs), were identified from the two sets of reciprocal ILs. Among the 26 M-QTLs, only four (15.4%) were shared in the reciprocal backgrounds while no shared E-QTLs were detected, indicating that ST QTLs, especially E-QTLs, were very specific to the genetic background. Further, 78.6% of the M-QTLs for SST and DSS identified in the reciprocal ILs were also detected in the recombinant inbred lines (RILs) from the same cross, which clearly brings out the background effect on ST QTL detection and its utilization in ST breeding. The detection of ILs with various levels of pyramiding of nonallelic M-QTL alleles for ST from Xiushui09 into IR2061-520-6-9 allowed us to further improve the ST in rice.

Development of a rapid screening test for veterinary sedatives and the beta-blocker carazolol in porcine kidney by ELISA.

PubMed

Cooper, John; Delahaut, Phillippe; Fodey, Terence L; Elliott, Christopher T

2004-02-01

Sedatives and tranquillisers are frequently used to reduce stress during the transportation of food producing animals. The most widely used classes of sedatives include the butyrophenone azaperone, the phenothiazines acepromazine, propionylpromazine, chlorpromazine and the [small beta]-blocker, carazolol. For regulatory control purposes, tolerances for azaperone and carazolol have been set by the European Union as 100 and 25 [micro sign]g kg(-1), respectively. Furthermore, the use of the phenothiazines is prohibited and therefore has a zero tolerance. A method for the detection of residues of five tranquillisers and one [small beta]-blocker using a single ELISA plate has been developed. Kidney samples (2.5 g) were extracted with dichloromethane and applied to a competitive enzyme immunoassay using three polyclonal antibodies raised in rabbits against azaperol, propionylpromazine and carazolol conjugates. In sample matrix, the azaperol antibody cross-reacted 28.0% with azaperone and the propionylpromazine antibody cross-reacted 24.9% with acepromazine and 11.7% with chlorpromazine. In the ELISA, the detection capabilities of the six sedatives, azaperol, azaperone, carazolol, acepromazine, chlorpromazine, and propionylpromazine are 5, 15, 5, 5, 20 and 5 [micro sign]g kg(-1), respectively. The proposed method is a sensitive and rapid multi-residue technique that offers a cost effective alternative to current published procedures, without any concession on the ability to detect sedative misuse.

Multiple Embedded Processors for Fault-Tolerant Computing

NASA Technical Reports Server (NTRS)

Bolotin, Gary; Watson, Robert; Katanyoutanant, Sunant; Burke, Gary; Wang, Mandy

2005-01-01

A fault-tolerant computer architecture has been conceived in an effort to reduce vulnerability to single-event upsets (spurious bit flips caused by impingement of energetic ionizing particles or photons). As in some prior fault-tolerant architectures, the redundancy needed for fault tolerance is obtained by use of multiple processors in one computer. Unlike prior architectures, the multiple processors are embedded in a single field-programmable gate array (FPGA). What makes this new approach practical is the recent commercial availability of FPGAs that are capable of having multiple embedded processors. A working prototype (see figure) consists of two embedded IBM PowerPC 405 processor cores and a comparator built on a Xilinx Virtex-II Pro FPGA. This relatively simple instantiation of the architecture implements an error-detection scheme. A planned future version, incorporating four processors and two comparators, would correct some errors in addition to detecting them.

Genome-Wide Association Study Reveals a New QTL for Salinity Tolerance in Barley (Hordeum vulgare L.)

PubMed Central

Fan, Yun; Zhou, Gaofeng; Shabala, Sergey; Chen, Zhong-Hua; Cai, Shengguan; Li, Chengdao; Zhou, Meixue

2016-01-01

Salinity stress is one of the most severe abiotic stresses that affect agricultural production. Genome wide association study (GWAS) has been widely used to detect genetic variations in extensive natural accessions with more recombination and higher resolution. In this study, 206 barley accessions collected worldwide were genotyped with 408 Diversity Arrays Technology (DArT) markers and evaluated for salinity stress tolerance using salinity tolerance score – a reliable trait developed in our previous work. GWAS for salinity tolerance had been conducted through a general linkage model and a mixed linkage model based on population structure and kinship. A total of 24 significant marker-trait associations were identified. A QTL on 4H with the nearest marker of bPb-9668 was consistently detected in all different methods. This QTL has not been reported before and is worth to be further confirmed with bi-parental populations. PMID:27446173

Population structure and genome-wide association analysis for frost tolerance in oat using continuous SNP array signal intensity ratios.

PubMed

Tumino, Giorgio; Voorrips, Roeland E; Rizza, Fulvia; Badeck, Franz W; Morcia, Caterina; Ghizzoni, Roberta; Germeier, Christoph U; Paulo, Maria-João; Terzi, Valeria; Smulders, Marinus J M

2016-09-01

Infinium SNP data analysed as continuous intensity ratios enabled associating genotypic and phenotypic data from heterogeneous oat samples, showing that association mapping for frost tolerance is a feasible option. Oat is sensitive to freezing temperatures, which restricts the cultivation of fall-sown or winter oats to regions with milder winters. Fall-sown oats have a longer growth cycle, mature earlier, and have a higher productivity than spring-sown oats, therefore improving frost tolerance is an important goal in oat breeding. Our aim was to test the effectiveness of a Genome-Wide Association Study (GWAS) for mapping QTLs related to frost tolerance, using an approach that tolerates continuously distributed signals from SNPs in bulked samples from heterogeneous accessions. A collection of 138 European oat accessions, including landraces, old and modern varieties from 27 countries was genotyped using the Infinium 6K SNP array. The SNP data were analyzed as continuous intensity ratios, rather than converting them into discrete values by genotype calling. PCA and Ward's clustering of genetic similarities revealed the presence of two main groups of accessions, which roughly corresponded to Continental Europe and Mediterranean/Atlantic Europe, although a total of eight subgroups can be distinguished. The accessions were phenotyped for frost tolerance under controlled conditions by measuring fluorescence quantum yield of photosystem II after a freezing stress. GWAS were performed by a linear mixed model approach, comparing different corrections for population structure. All models detected three robust QTLs, two of which co-mapped with QTLs identified earlier in bi-parental mapping populations. The approach used in the present work shows that SNP array data of heterogeneous hexaploid oat samples can be successfully used to determine genetic similarities and to map associations to quantitative phenotypic traits.

An optimized implementation of a fault-tolerant clock synchronization circuit

NASA Technical Reports Server (NTRS)

Torres-Pomales, Wilfredo

1995-01-01

A fault-tolerant clock synchronization circuit was designed and tested. A comparison to a previous design and the procedure followed to achieve the current optimization are included. The report also includes a description of the system and the results of tests performed to study the synchronization and fault-tolerant characteristics of the implementation.

Allergy to kiwi: is component-resolved diagnosis in routine clinical practice really impossible?

PubMed

Asero, R

2012-04-01

Kiwi allergy is frequent and can be the result of sensitization to a number of allergens showing different physicochemical characteristics. Component-resolved diagnosis of kiwi allergy is still unavailable in routine clinical practice. To investigate whether component resolved-diagnosis of kiwi allergy can be, at least in part, carried out by a proper combination of routinely available diagnostic tools. 63 adults with plant food allergy were studied 36 were kiwi-allergic while 27 were kiwi-tolerant and served as controls. Patients and controls underwent SPT with commercial peach and kiwi extracts, and with aprofilin-enriched date palm pollen extract (all by ALK-Abellò), and the measurement of IgE to birch, kiwi, and natural rubber latex. The in-vitro test showed poor sensitivity and specificity, as it scored positive in about 50% of patients and controls irrespective of clinical allergy to kiwi. The kiwi SPT showed overall poor sensitivity; however, it scored negative in all subjects with pollen food-allergy syndrome, was weakly positive in some lipid transfer protein-hypersensitive/kiwi tolerant subjects and in one latex-sensitized subject, and strongly positive in all subjects with primary kiwi sensitization. SPT with this commercial kiwi extract sensitively and specifically detects patients reacting to specific kiwi allergens. This can be useful to detect patients that are at risk of potentially severe reactions, particularly in case of co-sensitization to labile allergens, while we wait that the whole spectrum of kiwi allergens becomes available for routine in-vitro testing.

Role of glycemic elements of Cynodon dactylon and Musa paradisiaca in diabetes management.

PubMed

Rai, Prashant Kumar; Jaiswal, Dolly; Rai, Nilesh K; Pandhija, Shiwani; Rai, A K; Watal, Geeta

2009-09-01

The study defined the scientific evaluation of glycemic elements of extracts of Cynodon dactylon and Musa paradisiaca. A dose of 500 mg/kg body weight (bw) of C. dactylon produced maximum falls of 23.2% and 22.8% in blood glucose levels of normoglycemic rats during studies of fasting blood glucose and glucose tolerance, respectively, whereas the same dose of M. paradisiaca produced a rise of 34.9% and 18.4%. In diabetic rats during glucose tolerance tests, a fall of 27.8% and a rise of 17.5% were observed with the same dose of C. dactylon and M. paradisiaca, respectively. Laser-induced breakdown spectroscopy used for detection of glycemic elements present in both the extracts indicated that C. dactylon was rich in magnesium (Mg), whereas M. paradisiaca was rich in potassium (K) and sodium (Na), comparatively, suggesting thereby the defined roles of these elements in diabetes management.

Experiments in fault tolerant software reliability

NASA Technical Reports Server (NTRS)

Mcallister, David F.; Tai, K. C.; Vouk, Mladen A.

1987-01-01

The reliability of voting was evaluated in a fault-tolerant software system for small output spaces. The effectiveness of the back-to-back testing process was investigated. Version 3.0 of the RSDIMU-ATS, a semi-automated test bed for certification testing of RSDIMU software, was prepared and distributed. Software reliability estimation methods based on non-random sampling are being studied. The investigation of existing fault-tolerance models was continued and formulation of new models was initiated.

Pilot Study: Foam Wedge Chin Support Static Tolerance Testing

DTIC Science & Technology

2017-10-24

AFRL-SA-WP-SR-2017-0026 Pilot Study : Foam Wedge Chin Support Static Tolerance Testing Austin M. Fischer, BS1; William W...COVERED (From – To) April – October 2017 4. TITLE AND SUBTITLE Pilot Study : Foam Wedge Chin Support Static Tolerance Testing 5a. CONTRACT NUMBER...prototype to mitigate the increase in helmet weight and forward center of gravity. The purpose of this pilot study was to determine the feasibility and

Relationships of self-identified cold tolerance and cold-induced vasodilatation in the finger

NASA Astrophysics Data System (ADS)

Park, Joonhee; Lee, Joo-Young

2016-04-01

This study was conducted to investigate relationships of self-identified cold tolerance and cold-induced vasodilatation (CIVD) in the finger. Nine males and 34 females participated in the following 2 tests: a CIVD test and a self-reported survey. The CIVD test was conducted 30-min cold-water immersion (3.8 ± 0.3 °C) of the middle finger at an air temperature of 27.9 ± 0.1 °C. The self-reported questionnaire consisted of 28 questions about whole and local body cold and heat tolerances. By a cluster analysis on the survey results, the participants were divided into two groups: high self-identified cold tolerance (HSCT, n = 25) and low self-identified cold tolerance (LSCT, n = 18). LSCT had lower self-identified cold tolerance ( P < 0.001), preferred hot thermal stimulation ( P = 0.006), and wore heavier clothing during daily life ( P < 0.001) than HSCT. LSCT had significantly lower maximal finger temperatures ( T max) ( P = 0.040), smaller amplitude ( P = 0.029), and delayed onset time of CIVD ( P = 0.080) when compared to HSCT. Some questions examining the self-identified cold or heat tolerance had relationships with cold tolerance index, T max, and amplitude ( P < 0.1). These results indicate that self-identified cold tolerance classified through a standardized survey could be a good index to predict physiological cold tolerance.

Relationships of self-identified cold tolerance and cold-induced vasodilatation in the finger.

PubMed

Park, Joonhee; Lee, Joo-Young

2016-04-01

This study was conducted to investigate relationships of self-identified cold tolerance and cold-induced vasodilatation (CIVD) in the finger. Nine males and 34 females participated in the following 2 tests: a CIVD test and a self-reported survey. The CIVD test was conducted 30-min cold-water immersion (3.8 ± 0.3 °C) of the middle finger at an air temperature of 27.9 ± 0.1 °C. The self-reported questionnaire consisted of 28 questions about whole and local body cold and heat tolerances. By a cluster analysis on the survey results, the participants were divided into two groups: high self-identified cold tolerance (HSCT, n = 25) and low self-identified cold tolerance (LSCT, n = 18). LSCT had lower self-identified cold tolerance (P < 0.001), preferred hot thermal stimulation (P = 0.006), and wore heavier clothing during daily life (P < 0.001) than HSCT. LSCT had significantly lower maximal finger temperatures (T max) (P = 0.040), smaller amplitude (P = 0.029), and delayed onset time of CIVD (P = 0.080) when compared to HSCT. Some questions examining the self-identified cold or heat tolerance had relationships with cold tolerance index, T max, and amplitude (P < 0.1). These results indicate that self-identified cold tolerance classified through a standardized survey could be a good index to predict physiological cold tolerance.

Airborne Turbulence Detection and Warning ACLAIM Flight Test Results

NASA Technical Reports Server (NTRS)

Hannon, Stephen M.; Bagley, Hal R.; Soreide, Dave C.; Bowdle, David A.; Bogue, Rodney K.; Ehernberger, L. Jack

1999-01-01

The Airborne Coherent Lidar for Advanced Inflight Measurements (ACLAIM) is a NASA/Dryden-lead program to develop and demonstrate a 2 micrometers pulsed Doppler lidar for airborne look-ahead turbulence detection and warning. Advanced warning of approaching turbulence can significantly reduce injuries to passengers and crew aboard commercial airliners. The ACLAIM instrument is a key asset to the ongoing Turbulence component of NASA's Aviation Safety Program, aimed at reducing the accident rate aboard commercial airliners by a factor of five over the next ten years and by a factor of ten over the next twenty years. As well, the advanced turbulence warning capability can prevent "unstarts" in the inlet of supersonic aircraft engines by alerting the flight control computer which then adjusts the engine to operate in a less fuel efficient, and more turbulence tolerant, mode. Initial flight tests of the ACLAIM were completed in March and April of 1998. This paper and presentation gives results from these initial flights, with validated demonstration of Doppler lidar wind turbulence detection several kilometers ahead of the aircraft.

Tolerances of the human brain to concussion.

DOT National Transportation Integrated Search

1971-03-01

The report reviews the pertinent literature and adds additional evidence indicating that the human brain may be able to tolerate head impact forces in the range of 300 to 400 g's without evidence of concussion or other detectable neurologic sequelae,...

A Novel Approach to Rotorcraft Damage Tolerance

NASA Technical Reports Server (NTRS)

Forth, Scott C.; Everett, Richard A.; Newman, John A.

2002-01-01

Damage-tolerance methodology is positioned to replace safe-life methodologies for designing rotorcraft structures. The argument for implementing a damage-tolerance method comes from the fundamental fact that rotorcraft structures typically fail by fatigue cracking. Therefore, if technology permits prediction of fatigue-crack growth in structures, a damage-tolerance method should deliver the most accurate prediction of component life. Implementing damage-tolerance (DT) into high-cycle-fatigue (HCF) components will require a shift from traditional DT methods that rely on detecting an initial flaw with nondestructive inspection (NDI) methods. The rapid accumulation of cycles in a HCF component will result in a design based on a traditional DT method that is either impractical because of frequent inspections, or because the design will be too heavy to operate efficiently. Furthermore, once a HCF component develops a detectable propagating crack, the remaining fatigue life is short, sometimes less than one flight hour, which does not leave sufficient time for inspection. Therefore, designing a HCF component will require basing the life analysis on an initial flaw that is undetectable with current NDI technology.

Sliding Mode Fault Tolerant Control with Adaptive Diagnosis for Aircraft Engines

NASA Astrophysics Data System (ADS)

Xiao, Lingfei; Du, Yanbin; Hu, Jixiang; Jiang, Bin

2018-03-01

In this paper, a novel sliding mode fault tolerant control method is presented for aircraft engine systems with uncertainties and disturbances on the basis of adaptive diagnostic observer. By taking both sensors faults and actuators faults into account, the general model of aircraft engine control systems which is subjected to uncertainties and disturbances, is considered. Then, the corresponding augmented dynamic model is established in order to facilitate the fault diagnosis and fault tolerant controller design. Next, a suitable detection observer is designed to detect the faults effectively. Through creating an adaptive diagnostic observer and based on sliding mode strategy, the sliding mode fault tolerant controller is constructed. Robust stabilization is discussed and the closed-loop system can be stabilized robustly. It is also proven that the adaptive diagnostic observer output errors and the estimations of faults converge to a set exponentially, and the converge rate greater than some value which can be adjusted by choosing designable parameters properly. The simulation on a twin-shaft aircraft engine verifies the applicability of the proposed fault tolerant control method.

Detection and mapping of QTL for temperature tolerance and body size in Chinook salmon (Oncorhynchus tshawytscha) using genotyping by sequencing

PubMed Central

Everett, Meredith V; Seeb, James E

2014-01-01

Understanding how organisms interact with their environments is increasingly important for conservation efforts in many species, especially in light of highly anticipated climate changes. One method for understanding this relationship is to use genetic maps and QTL mapping to detect genomic regions linked to phenotypic traits of importance for adaptation. We used high-throughput genotyping by sequencing (GBS) to both detect and map thousands of SNPs in haploid Chinook salmon (Oncorhynchus tshawytscha). We next applied this map to detect QTL related to temperature tolerance and body size in families of diploid Chinook salmon. Using these techniques, we mapped 3534 SNPs in 34 linkage groups which is consistent with the haploid chromosome number for Chinook salmon. We successfully detected three QTL for temperature tolerance and one QTL for body size at the experiment-wide level, as well as additional QTL significant at the chromosome-wide level. The use of haploids coupled with GBS provides a robust pathway to rapidly develop genomic resources in nonmodel organisms; these QTL represent preliminary progress toward linking traits of conservation interest to regions in the Chinook salmon genome. PMID:24822082

Fault tolerant filtering and fault detection for quantum systems driven by fields in single photon states

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Qing, E-mail: qing.gao.chance@gmail.com; Dong, Daoyi, E-mail: daoyidong@gmail.com; Petersen, Ian R., E-mail: i.r.petersen@gmai.com

The purpose of this paper is to solve the fault tolerant filtering and fault detection problem for a class of open quantum systems driven by a continuous-mode bosonic input field in single photon states when the systems are subject to stochastic faults. Optimal estimates of both the system observables and the fault process are simultaneously calculated and characterized by a set of coupled recursive quantum stochastic differential equations.

Immunologic changes in children with egg allergy ingesting extensively heated egg.

PubMed

Lemon-Mulé, Heather; Sampson, Hugh A; Sicherer, Scott H; Shreffler, Wayne G; Noone, Sally; Nowak-Wegrzyn, Anna

2008-11-01

Prior studies have suggested that heated egg might be tolerated by some children with egg allergy. We sought to confirm tolerance of heated egg in a subset of children with egg allergy, to evaluate clinical and immunologic predictors of heated egg tolerance, to characterize immunologic changes associated with continued ingestion of heated egg, and to determine whether a diet incorporating heated egg is well tolerated. Subjects with documented IgE-mediated egg allergy underwent physician-supervised oral food challenges to extensively heated egg (in the form of a muffin and a waffle), with tolerant subjects also undergoing regular egg challenges (in a form of scrambled egg or French toast). Heated egg-tolerant subjects incorporated heated egg into their diets. Skin prick test wheal diameters and egg white, ovalbumin, and ovomucoid IgE levels, as well as ovalbumin and ovomucoid IgG4 levels, were measured at baseline for all subjects and at 3, 6, and 12 months for those tolerant of heated egg. Sixty-four of 117 subjects tolerated heated egg, 23 tolerated regular egg, and 27 reacted to heated egg. Heated egg-reactive subjects had larger skin test wheals and greater egg white-specific, ovalbumin-specific, and ovomucoid-specific IgE levels compared with heated egg- and egg-tolerant subjects. Continued ingestion of heated egg was associated with decreased skin test wheal diameters and ovalbumin-specific IgE levels and increased ovalbumin-specific and ovomucoid-specific IgG4 levels. The majority of subjects with egg allergy were tolerant of heated egg. Continued ingestion of heated egg was well tolerated and associated with immunologic changes that paralleled the changes observed with the development of clinical tolerance to regular egg.

Basal plasma insulin and homeostasis model assessment (HOMA) are indicators of insulin sensitivity in cats.

PubMed

Appleton, D J; Rand, J S; Sunvold, G D

2005-06-01

The objective of this study was to compare simpler indices of insulin sensitivity with the minimal model-derived insulin sensitivity index to identify a simple and reliable alternative method for assessing insulin sensitivity in cats. In addition, we aimed to determine whether this simpler measure or measures showed consistency of association across differing body weights and glucose tolerance levels. Data from glucose tolerance and insulin sensitivity tests performed in 32 cats with varying body weights (underweight to obese), including seven cats with impaired glucose tolerance, were used to assess the relationship between Bergman's minimal model-derived insulin sensitivity index (S(I)), and various simpler measures of insulin sensitivity. The most useful overall predictors of insulin sensitivity were basal plasma insulin concentrations and the homeostasis model assessment (HOMA), which is the product of basal glucose and insulin concentrations divided by 22.5. It is concluded that measurement of plasma insulin concentrations in cats with food withheld for 24 h, in conjunction with HOMA, could be used in clinical research projects and by practicing veterinarians to screen for reduced insulin sensitivity in cats. Such cats may be at increased risk of developing impaired glucose tolerance and type 2 diabetes mellitus. Early detection of these cats would enable preventative intervention programs such as weight reduction, increased physical activity and dietary modifications to be instigated.

Fault detection and fault tolerance in robotics

NASA Technical Reports Server (NTRS)

Visinsky, Monica; Walker, Ian D.; Cavallaro, Joseph R.

1992-01-01

Robots are used in inaccessible or hazardous environments in order to alleviate some of the time, cost and risk involved in preparing men to endure these conditions. In order to perform their expected tasks, the robots are often quite complex, thus increasing their potential for failures. If men must be sent into these environments to repair each component failure in the robot, the advantages of using the robot are quickly lost. Fault tolerant robots are needed which can effectively cope with failures and continue their tasks until repairs can be realistically scheduled. Before fault tolerant capabilities can be created, methods of detecting and pinpointing failures must be perfected. This paper develops a basic fault tree analysis of a robot in order to obtain a better understanding of where failures can occur and how they contribute to other failures in the robot. The resulting failure flow chart can also be used to analyze the resiliency of the robot in the presence of specific faults. By simulating robot failures and fault detection schemes, the problems involved in detecting failures for robots are explored in more depth.

An Ultrasonographic Periodontal Probe

NASA Astrophysics Data System (ADS)

Bertoncini, C. A.; Hinders, M. K.

2010-02-01

Periodontal disease, commonly known as gum disease, affects millions of people. The current method of detecting periodontal pocket depth is painful, invasive, and inaccurate. As an alternative to manual probing, an ultrasonographic periodontal probe is being developed to use ultrasound echo waveforms to measure periodontal pocket depth, which is the main measure of periodontal disease. Wavelet transforms and pattern classification techniques are implemented in artificial intelligence routines that can automatically detect pocket depth. The main pattern classification technique used here, called a binary classification algorithm, compares test objects with only two possible pocket depth measurements at a time and relies on dimensionality reduction for the final determination. This method correctly identifies up to 90% of the ultrasonographic probe measurements within the manual probe's tolerance.

Second generation experiments in fault tolerant software

NASA Technical Reports Server (NTRS)

Knight, J. C.

1987-01-01

The purpose of the Multi-Version Software (MVS) experiment is to obtain empirical measurements of the performance of multi-version systems. Twenty version of a program were prepared under reasonably realistic development conditions from the same specifications. The overall structure of the testing environment for the MVS experiment and its status are described. A preliminary version of the control system is described that was implemented for the MVS experiment to allow the experimenter to have control over the details of the testing. The results of an empirical study of error detection using self checks are also presented. The analysis of the checks revealed that there are great differences in the ability of individual programmers to design effective checks.

Nootropic Effects of Filipendula Vulgaris Moench Water Extract Fractions.

PubMed

Shilova, I V; Suslov, N I; Amelchenko, V P

2015-07-01

Nootropic activity of water extract fractions from aerial parts of Filipendula vulgaris Moench was demonstrated on the models of hermetic volume hypoxia, conditioned passive avoidance response, open field test, and forced swimming with a load. The fractions stimulated hypoxic resistance, normalized orientation and exploratory behavior, improved conditioned response reproduction during testing after hypoxic injury, and increased exercise tolerance. Fractionation of the extract led to dissociation of the effect components, which suggests that individual constituents have specific characteristics. Ethylacetate fraction exhibited most pronounced nootropic activity and was superior to plant extract by some characteristics. The detected effects seemed to be caused by modulation of the hippocampus activity the under the effects of phenol and triterpene compounds.

[Resistivity and hemodynamic reactions of essentially healthy pilots to the passive orthostatic test].

PubMed

Bondareva, S V; Vartbaronov, R A; Ponomarenko, K V; Bagaudinov, K G; Khomenko, M N

2009-01-01

The paper analyzes the data of expert tilt testing (-80 degrees, 20 min.) of 66 essentially healthy pilots. Hemodynamic reactions were characterized based on the standard concept of functional classes (FC). Good test tolerance was recorded in 86.4% of cases among which 36.4% were referred to FC-I and 50%--to FC-II. Adequate test tolerance (FC-II) was recorded in 10.6%; reduced and poor test tolerance (FC-IV and FC-V)--in 3%. According to ECG and computerized tachooscillography, the adaptive hemodynamic reactions were optimum in pilots of group FC-I as compared with group FC-II and all the more so when compared with FC-III. The last two groups showed some objective symptoms that had not been looked for in the past (a distinct lability of blood pressure, and incomplete hypertensive and hypotensive reactions) that differentiated these groups from FC-I. Results of the analysis made it possible to put forward additional clinical functional criteria to assess tilt tolerance of pilots with different levels of functional tolerance.

Periodontitis promotes the diabetic development of obese rat via miR-147 induced classical macrophage activation.

PubMed

Xu, Ran; Zeng, Guang; Wang, Shuyong; Tao, Hong; Ren, Le; Zhang, Zhe; Zhang, Qingna; Zhao, Jinxiu; Gao, Jing; Li, Daxu

2016-10-01

Emerging evidence has indicated the bad effect of periodontal inflammation on diabetes control. However, the exact regulatory mechanisms within the association between periodontitis and diabetic development remain unclear. This study aims to investigate the function of microRNAs in regulating periodontitis-induced inflammation in an obese rat model. Experimental periodontitis was introduced into OLETF and LETO rat. Intraperitoneal glucose tolerance test was performed to detect diabetic development. Serum cytokines levels and microRNAs expression were detected by ELISA and RT-PCR analysis respectively. And, macrophages were isolated for gain- and loss-of-function studies, to investigate the regulatory mechanism of miR-147 in periodontitis-induced inflammation. Periodontitis induced proinflammatory response with classical activated macrophages in both rats, but distinctively aggravated the impaired glucose tolerance of OLETF rat with spontaneous type 2 diabetes. Analysis for serum microRNAs expression showed the distinctive and synergistic upregulation of miR-147 with periodontitis-induced effects in rats, while further experiments demonstrated the positive regulatory mechanism of miR-147 on classical activated macrophages with overexpressed proinflammatory markers, showing M1 phenotype. This study provided new evidence for the positive effect of periodontal inflammation on diabetic development, while the regulatory mechanism of miR-147 on classical macrophage activation, was verified, and presumed to contribute to the impaired glucose tolerance aggravated by periodontitis in obese rats. Besides, this study indicated the application of miR-147 for therapeutic approach in the treatment of diabetes with periodontitis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Predeployment validation of fault-tolerant systems through software-implemented fault insertion

NASA Technical Reports Server (NTRS)

Czeck, Edward W.; Siewiorek, Daniel P.; Segall, Zary Z.

1989-01-01

Fault injection-based automated testing (FIAT) environment, which can be used to experimentally characterize and evaluate distributed realtime systems under fault-free and faulted conditions is described. A survey is presented of validation methodologies. The need for fault insertion based on validation methodologies is demonstrated. The origins and models of faults, and motivation for the FIAT concept are reviewed. FIAT employs a validation methodology which builds confidence in the system through first providing a baseline of fault-free performance data and then characterizing the behavior of the system with faults present. Fault insertion is accomplished through software and allows faults or the manifestation of faults to be inserted by either seeding faults into memory or triggering error detection mechanisms. FIAT is capable of emulating a variety of fault-tolerant strategies and architectures, can monitor system activity, and can automatically orchestrate experiments involving insertion of faults. There is a common system interface which allows ease of use to decrease experiment development and run time. Fault models chosen for experiments on FIAT have generated system responses which parallel those observed in real systems under faulty conditions. These capabilities are shown by two example experiments each using a different fault-tolerance strategy.

Spinal glucocorticoid receptor‑regulated chronic morphine tolerance may be through extracellular signal‑regulated kinase 1/2.

PubMed

Zhai, Mei-Li; Chen, Yi; Liu, Chong; Wang, Jian-Bo; Yu, Yong-Hao

2018-05-23

Opioid use has been limited in the treatment of chronic pain due to their side effects, including analgesic tolerance. Previous studies demonstrated that glucocorticoid receptors (GRs) may be involved in the development of chronic morphine tolerance; however, the mechanism remains unknown. It was hypothesized that the expression of spinal phosphorylated mitogen‑activated protein kinase [MAPK; phosphorylated extracellular signal‑regulated kinase (ERK)] is regulated through the spinal GRs, following chronic treatment with morphine. In the first experiment, the experimental rats were randomly divided into four groups: Control, morphine, morphine+GR antagonist mifepristone (RU38486) and morphine+GR agonist dexamethasone (Dex). Each group was treated with continuous intrathecal (IT) injection of the drugs for 6 days. The expression of GRs and MAPK 3/1 (p‑ERK 1/2) in the spinal dorsal horn was detected by western blot analysis and immunofluorescence staining. In the second experiment, the MAPK inhibitor PD98059 was added and the rats were randomly divided into four groups: Control, morphine, PD98059+morphine and PD98059+morphine+Dex. The continuous IT injection lasted for 7 days in each group. For all experiments, the tail flick test was conducted 30 min following administration every day to assess the thermal hyperalgesia of the rats. The experimental results demonstrated that there was a co‑existence of GRs and p‑ERK 1/2 in the spinal cord dorsal horn by double immunofluorescence staining. The GR antagonist RU38486 attenuated the morphine analgesia tolerance by inhibiting the expression of GR and increasing the expression of p‑ERK. The MAPK inhibitor PD98059 increased the effect of morphine tolerance and prolonged the duration of morphine tolerance. The present results suggest that spinal GRs may serve an important role in the development of morphine tolerance through the ERK signaling pathway.

Copy number variation of CBF-A14 at the Fr-A2 locus determines frost tolerance in winter durum wheat.

PubMed

Sieber, Alisa-Naomi; Longin, C Friedrich H; Leiser, Willmar L; Würschum, Tobias

2016-06-01

Frost tolerance in durum wheat is mainly controlled by copy number variation of CBF - A14 at the Fr - A2 locus. Frost tolerance is a key trait for successful breeding of winter durum wheat (Triticum durum) which can increase the yield performance in regions favoring autumn-sown winter cereals. The aim of this study was to investigate the genetic architecture of frost tolerance in order to provide molecular support for the breeding of winter durum wheat. To this end, a diverse panel of 170 winter and 14 spring durum wheat genotypes of worldwide origin was evaluated for frost tolerance in the field, as well as in a semi-controlled test. A total of 30,611 polymorphic genome-wide markers obtained by a genotyping-by-sequencing approach and markers for candidate loci were used to assess marker-trait associations. One major QTL was detected on chromosome 5A, likely corresponding to Frost Resistance-A2 (Fr-A2). Further analyses strongly support the conclusion that copy number variation of CBF-A14 at the Fr-A2 locus is the causal polymorphism underlying this major QTL. It explains 91.6 % of the genotypic variance and a haploblock of two strongly associated markers in the QTL region also allowed to capture the variance of this QTL. In addition to this major QTL, a much smaller contribution of 4.2 % was observed for Fr-B2. We further investigated this major QTL and found that the copy number of CBF-A14 and the frequency of the frost tolerant haplotype mirrored the climatic conditions in the genotypes' country of origin, suggesting selection through breeding. Two functional KASP markers were developed which facilitate a high-throughput screening of the haploblock and thus a marker-based breeding of frost tolerance in winter durum wheat.

Visual working memory is more tolerant than visual long-term memory.

PubMed

Schurgin, Mark W; Flombaum, Jonathan I

2018-05-07

Human visual memory is tolerant, meaning that it supports object recognition despite variability across encounters at the image level. Tolerant object recognition remains one capacity in which artificial intelligence trails humans. Typically, tolerance is described as a property of human visual long-term memory (VLTM). In contrast, visual working memory (VWM) is not usually ascribed a role in tolerant recognition, with tests of that system usually demanding discriminatory power-identifying changes, not sameness. There are good reasons to expect that VLTM is more tolerant; functionally, recognition over the long-term must accommodate the fact that objects will not be viewed under identical conditions; and practically, the passive and massive nature of VLTM may impose relatively permissive criteria for thinking that two inputs are the same. But empirically, tolerance has never been compared across working and long-term visual memory. We therefore developed a novel paradigm for equating encoding and test across different memory types. In each experiment trial, participants saw two objects, memory for one tested immediately (VWM) and later for the other (VLTM). VWM performance was better than VLTM and remained robust despite the introduction of image and object variability. In contrast, VLTM performance suffered linearly as more variability was introduced into test stimuli. Additional experiments excluded interference effects as causes for the observed differences. These results suggest the possibility of a previously unidentified role for VWM in the acquisition of tolerant representations for object recognition. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Detection of impaired glucose tolerance and undiagnosed type 2 diabetes in UK South Asians: an effective screening strategy.

PubMed

Hanif, M W; Valsamakis, G; Dixon, A; Boutsiadis, A; Jones, A F; Barnett, A H; Kumar, S

2008-09-01

We tested a stepwise, community-based screening strategy for glucose intolerance in South Asians using a health questionnaire in conjunction with body mass index (BMI). Anthropometric measurements (waist and hip circumference, sagittal diameter and percentage body fat) were then conducted in a hospital setting followed by an oral glucose tolerance test (OGTT) to identify subjects at the highest risk and analyse the factors predicting that risk. A health questionnaire was administered to 435 subjects in a community setting and BMI was measured. Subjects were graded by a risk score based on the health questionnaire as high, medium and low. Subjects with high and medium risk scores and a representative sample of those with low scores had anthropometric measurements in hospital followed by an OGTT. In total, 205 (47%) of the subjects had an OGTT performed. In total, 48.7% of the subjects tested with an OGTT had evidence of glucose dysregulation: 20% had diabetes and 28.7% had impaired glucose tolerance (IGT). Logistic regression model explained 49.1% of the total variability. The significant predictors of diabetes and IGT were Blood Glucose Monitoring Strips (BMI), random blood glucose (BM), sibling with diabetes and presence of diagnosed hypertension or ischaemic disease. Most of these predictors along with other heredity diabetes factors create a composite score, with high predictability, as the receiver operating curve analysis shows. We describe a simple, stepwise strategy in a community setting, based on a health questionnaire and anthropometric measurements, to explain about 50% of cases with IGT and diabetes and diagnose about 50% of cases from the population screened. We have also identified factors that predict the risk.

Tolerance to Non-Opioid Analgesics is Opioid Sensitive in the Nucleus Raphe Magnus.

PubMed

Tsagareli, Merab G; Nozadze, Ivliane; Tsiklauri, Nana; Gurtskaia, Gulnaz

2011-01-01

Repeated injection of opioid analgesics can lead to a progressive loss of effect. This phenomenon is known as tolerance. Several lines of investigations have shown that systemic, intraperitoneal administration or the microinjection of non-opioid analgesics, non-steroidal anti-inflammatory drugs (NSAIDs) into the midbrain periaqueductal gray matter induces antinociception with some effects of tolerance. Our recent study has revealed that microinjection of three drugs analgin, ketorolac, and xefocam into the central nucleus of amygdala produce tolerance to them and cross-tolerance to morphine. Here we report that repeated administrations of these NSAIDs into the nucleus raphe magnus (NRM) in the following 4 days result in progressively less antinociception compare to the saline control, i.e., tolerance develops to these drugs in male rats. Special control experiments showed that post-treatment with the μ-opioid antagonist naloxone into the NRM significantly decreased antinociceptive effects of NSAIDs on the first day of testing in the tail-flick (TF) reflex and hot plate (HP) latency tests. On the second day, naloxone generally had trend effects in both TF and HP tests and impeded the development of tolerance to the antinociceptive effect of non-opioid analgesics. These findings strongly support the suggestion of endogenous opioid involvement in NSAIDs antinociception and tolerance in the descending pain-control system. Moreover, repeated injections of NSAIDs progressively lead to tolerance to them, cross-tolerance to morphine, and the risk of a withdrawal syndrome. Therefore, these results are important for human medicine too.

Testing For EM Upsets In Aircraft Control Computers

NASA Technical Reports Server (NTRS)

Belcastro, Celeste M.

1994-01-01

Effects of transient electrical signals evaluated in laboratory tests. Method of evaluating nominally fault-tolerant, aircraft-type digital-computer-based control system devised. Provides for evaluation of susceptibility of system to upset and evaluation of integrity of control when system subjected to transient electrical signals like those induced by electromagnetic (EM) source, in this case lightning. Beyond aerospace applications, fault-tolerant control systems becoming more wide-spread in industry; such as in automobiles. Method supports practical, systematic tests for evaluation of designs of fault-tolerant control systems.

Test and analysis results for composite transport fuselage and wing structures

NASA Technical Reports Server (NTRS)

Deaton, Jerry W.; Kullerd, Susan M.; Madan, Ram C.; Chen, Victor L.

1992-01-01

Automated tow placement (ATP) and stitching of dry textile composite preforms followed by resin transfer molding (RTM) are being studied as cost effective manufacturing processes for obtaining damage tolerant fuselage and wing structures for transport aircraft. Data are presented to assess the damage tolerance of ATP and RTM fuselage elements with stitched-on stiffeners from compression tests of impacted three J-stiffened panels and from stiffener pull-off tests. Data are also presented to assess the damage tolerance of RTM wing elements which had stitched skin and stiffeners from impacted single stiffener and three blade stiffened compression tests and stiffener pull-off tests.

Comparison of liquid chromatographic and bioassay procedures for determining depletion of intramuscularly injected tylosin.

PubMed

Moats, W A; Harris, E W; Steele, N C

1985-01-01

Crossbred pigs weighing 80-110 kg were injected intramuscularly in the ham with 8.8 mg/kg tylosin. Animals were slaughtered in groups of 3 at intervals of 4 h, and 1, 2, 4, and 8 days after injection, and samples of blood, injected muscle, uninjected muscle, liver, and kidney were analyzed by liquid chromatography (LC) and by bioassay using Sarcina lutea as the test organism. The LC method was far more sensitive with a detection limit of less than 0.1 ppm, while the detection limit by bioassay was about 0.5 ppm in tissue. Results by bioassay and LC sometimes differed considerably for tissue samples. Residues in all tissues were below the tolerance limit of 0.2 ppm at 24 h, except in the injected muscle in one animal. Residues were not detected in any tissue of any animal at 48 h after treatment.

Aniracetam and DNQX affect the acquisition of rapid tolerance to ethanol in mice.

PubMed

Rial, Daniel; Takahashi, Reinaldo Naoto; Morato, Gina Struffaldi

2009-03-01

Several studies have emphasized the role of learning in the development of rapid tolerance and have shown that glutamate-mediated neurotransmission plays an important role in this phenomenon. Since the AMPA/kainate receptor system is directly involved in plasticity mechanisms, the influence of this receptor system on rapid tolerance induced by ethanol was studied using the rotarod. In the first experiment, mice were pretreated with aniracetam, an agonist of AMPA/kainate receptors, 30 min before ethanol (2.75 g/kg; IP) treatment, and tested on the rotarod. After 24 h, the groups were tested on the rotarod under ethanol treatment. Aniracetam facilitated the acquisition of rapid tolerance to ethanol. In the second experiment, mice received DNQX, a competitive antagonist of the AMPA receptor, 30 min before ethanol treatment (3 g/kg) and submitted to the rotarod. This dose of ethanol produced tolerance per se. Groups were tested under ethanol treatment (1.75 g/kg) after 24 h. DNQX blocked rapid tolerance to ethanol. Using a similar protocol, the third experiment showed that DNQX blocked the aniracetam-induced facilitation of rapid tolerance to ethanol. Our results show that aniracetam facilitates whereas DNQX blocks ethanol tolerance, suggesting that the non-NMDA receptors are involved in this phenomenon.

Habituation of enterotoxigenic Staphylococcus aureus to Origanum vulgare L. essential oil does not induce direct-tolerance and cross-tolerance to salts and organic acids

PubMed Central

Tavares, Adassa Gama; do Monte, Daniel Farias Marinho; Albuquerque, Allan dos Reis; Sampaio, Fábio Correia; Magnani, Marciane; de Siqueira, José Pinto; de Souza, Evandro Leite

2015-01-01

Enterotoxigenic Staphylococcus aureus strains that were isolated from foods were investigated for their ability to develop direct-tolerance and cross-tolerance to sodium chloride (NaCl), potassium chloride (KCl), lactic acid (LA) and acetic acid (AA) after habituation in sublethal amounts (1/2 of the minimum inhibitory concentration - 1/2 MIC and 1/4 of the minimum inhibitory concentration - 1/4 MIC) of Origanum vulgare L. essential oil (OVEO). The habituation of S. aureus to 1/2 MIC and 1/4 MIC of OVEO did not induce direct-tolerance or cross-tolerance in the tested strains, as assessed by modulation of MIC values. Otherwise, exposing the strains to OVEO at sublethal concentrations maintained or increased the sensitivity of the cells to the tested stressing agents because the MIC values of OVEO, NaCl, KCl, LA and AA against the cells that were previously habituated to OVEO remained the same or decreased when compared with non-habituated cells. These data indicate that OVEO does not have an inductive effect on the acquisition of direct-tolerance or cross-tolerance in the tested enterotoxigenic strains of S. aureus to antimicrobial agents that are typically used in food preservation. PMID:26413067

Evaluation of Drought Tolerance of the Vietnamese Soybean Cultivars Provides Potential Resources for Soybean Production and Genetic Engineering

PubMed Central

Nguyen, Quang Thien; Hoang, Xuan Lan Thi; Thao, Nguyen Phuong; Tran, Lam-Son Phan

2014-01-01

Drought is one of the greatest constraints to soybean production in many countries, including Vietnam. Although a wide variety of the newly produced cultivars have been produced recently in Vietnam through classical breeding to cope with water shortage, little knowledge of their molecular and physiological responses to drought has been discovered. This study was conducted to quickly evaluate drought tolerance of thirteen local soybean cultivars for selection of the best drought-tolerant cultivars for further field test. Differences in drought tolerance of cultivars were assessed by root and shoot lengths, relative water content, and drought-tolerant index under both normal and drought conditions. Our data demonstrated that DT51 is the strongest drought-tolerant genotype among all the tested cultivars, while the highest drought-sensitive phenotype was observed with MTD720. Thus, DT51 could be subjected to further yield tests in the field prior to suggesting it for use in production. Due to their contrasting drought-tolerant phenotypes, DT51 and MTD720 provide excellent genetic resources for further studies underlying mechanisms regulating drought responses and gene discovery. Our results provide vital information to support the effort of molecular breeding and genetic engineering to improve drought tolerance of soybean. PMID:24804248

Experiments in fault tolerant software reliability

NASA Technical Reports Server (NTRS)

Mcallister, David F.; Vouk, Mladen A.

1989-01-01

Twenty functionally equivalent programs were built and tested in a multiversion software experiment. Following unit testing, all programs were subjected to an extensive system test. In the process sixty-one distinct faults were identified among the versions. Less than 12 percent of the faults exhibited varying degrees of positive correlation. The common-cause (or similar) faults spanned as many as 14 components. However, a majority of these faults were trivial, and easily detected by proper unit and/or system testing. Only two of the seven similar faults were difficult faults, and both were caused by specification ambiguities. One of these faults exhibited variable identical-and-wrong response span, i.e. response span which varied with the testing conditions and input data. Techniques that could have been used to avoid the faults are discussed. For example, it was determined that back-to-back testing of 2-tuples could have been used to eliminate about 90 percent of the faults. In addition, four of the seven similar faults could have been detected by using back-to-back testing of 5-tuples. It is believed that most, if not all, similar faults could have been avoided had the specifications been written using more formal notation, the unit testing phase was subject to more stringent standards and controls, and better tools for measuring the quality and adequacy of the test data (e.g. coverage) were used.

Abnormal glucose tolerance post-gestational diabetes mellitus as defined by the International Association of Diabetes and Pregnancy Study Groups criteria.

PubMed

Noctor, Eoin; Crowe, Catherine; Carmody, Louise A; Saunders, Jean A; Kirwan, Breda; O'Dea, Angela; Gillespie, Paddy; Glynn, Liam G; McGuire, Brian E; O'Neill, Ciarán; O'Shea, P M; Dunne, F P

2016-10-01

An increase in gestational diabetes mellitus (GDM) prevalence has been demonstrated across many countries with adoption of the International Association of the Diabetes and Pregnancy Study Groups (IADPSG) diagnostic criteria. Here, we determine the cumulative incidence of abnormal glucose tolerance among women with previous GDM, and identify clinical risk factors predicting this. Two hundred and seventy women with previous IADPSG-defined GDM were prospectively followed up for 5years (mean 2.6) post-index pregnancy, and compared with 388 women with normal glucose tolerance (NGT) in pregnancy. Cumulative incidence of abnormal glucose tolerance (using American Diabetes Association criteria for impaired fasting glucose, impaired glucose tolerance and diabetes) was determined using the Kaplan-Meier method of survival analysis. Cox regression models were constructed to test for factors predicting abnormal glucose tolerance. Twenty-six percent of women with previous GDM had abnormal glucose tolerance vs 4% with NGT, with the log-rank test demonstrating significantly different survival curves (P<0.001). Women meeting IADPSG, but not the World Health Organization (WHO) 1999 criteria, had a lower cumulative incidence than women meeting both sets of criteria, both in the early post-partum period (4.2% vs 21.7%, P<0.001) and at longer-term follow-up (13.7% vs 32.6%, P<0.001). Predictive factors were glucose levels on the pregnancy oral glucose tolerance test, family history of diabetes, gestational week at testing, and BMI at follow-up. The proportion of women developing abnormal glucose tolerance remains high among those with IADPSG-defined GDM. This demonstrates the need for continued close follow-up, although the optimal frequency and method needs further study. © 2016 European Society of Endocrinology.

A Fault Tolerant System for an Integrated Avionics Sensor Configuration

NASA Technical Reports Server (NTRS)

Caglayan, A. K.; Lancraft, R. E.

1984-01-01

An aircraft sensor fault tolerant system methodology for the Transport Systems Research Vehicle in a Microwave Landing System (MLS) environment is described. The fault tolerant system provides reliable estimates in the presence of possible failures both in ground-based navigation aids, and in on-board flight control and inertial sensors. Sensor failures are identified by utilizing the analytic relationships between the various sensors arising from the aircraft point mass equations of motion. The estimation and failure detection performance of the software implementation (called FINDS) of the developed system was analyzed on a nonlinear digital simulation of the research aircraft. Simulation results showing the detection performance of FINDS, using a dual redundant sensor compliment, are presented for bias, hardover, null, ramp, increased noise and scale factor failures. In general, the results show that FINDS can distinguish between normal operating sensor errors and failures while providing an excellent detection speed for bias failures in the MLS, indicated airspeed, attitude and radar altimeter sensors.

Injury tolerance of tibia for the car-pedestrian impact.

PubMed

Mo, Fuhao; Arnoux, Pierre Jean; Jure, Jean Jaques; Masson, Catherine

2012-05-01

Lower limbs are normally the first contacted body region during car-pedestrian accidents, and easily suffer serious injuries. The previous tibia bending tolerances for pedestrian safety were mainly developed from three-point bending tests on tibia mid-shaft. The tibia tolerances of other locations are still not investigated enough. In addition, tibia loading condition under the car-pedestrian impact should be explored to compare with the three-point bending. This work aims to investigate the injury tolerance of tibia fracture with combined experimental data and numerical simulation. Eleven new reported quasi-static bending tests of tibia mid-shaft, and additional eleven dynamic mid-shaft bending test results in the previous literature were used to define injury risk functions. Furthermore, to investigate the influence of tibia locations on bending tolerance, finite element simulations with lower limb model were implemented according to three-point bending and pedestrian impact conditions. The regressive curve of tibia bending tolerance was obtained from the simulations on the different impact locations, and indicated that tibia fracture tolerance could vary largely due to the impact locations for the car-pedestrian crash. Copyright © 2011 Elsevier Ltd. All rights reserved.

Spinal interaction between the highly selective μ agonist DAMGO and several δ opioid receptor ligands in naive and morphine-tolerant mice.

PubMed

Szentirmay, A K; Király, K P; Lenkey, N; Lackó, E; Al-Khrasani, M; Friedmann, T; Timár, J; Gyarmati, S; Tóth, G; Fürst, S; Riba, P

2013-01-01

Since the discovery of opioid receptor dimers their possible roles in opioid actions were intensively investigated. Here we suggest a mechanism that may involve the μ-δ opioid heterodimers. The exact role of δ opioid receptors in antinociception and in the development of opioid tolerance is still unclear. While receptor up-regulation can be observed during the development of opioid tolerance no μ receptor down-regulation could be detected within five days. In our present work we investigated how the selective δ opioid receptor agonists and antagonists influence the antinociceptive effect of the selective μ receptor agonist DAMGO in naïve and morphine-tolerant mice. We treated male NMRI mice with 200 μmol/kg subcutaneous (s.c.) morphine twice daily for three days. On the fourth day we measured the antinociceptive effect of DAMGO alone and combined with delta ligands: DPDPE, deltorphin II (agonists), TIPP and TICPψ (antagonists), respectively, administered intrathecally (i.t.) in mouse tail-flick test. In naive control mice none of the δ ligands caused significant changes in the antinociceptive action of DAMGO. The treatment with s.c. morphine resulted in approximately four-fold tolerance to i.t. DAMGO, i.e. the ED₅₀ value of DAMGO was four times as high as in naive mice. 500 and 1000 pmol/mouse of the δ₁ selective agonist DPDPE enhanced the tolerance to DAMGO while 1000 pmol/mouse of the δ₂ selective agonist deltorphin II did not influence the degree of tolerance. However, both δ antagonists TIPP and TICPψ potentiated the antinociceptive effect of i.t. DAMGO, thus they restored the potency of DAMGO to the control level. The inhibitory action of DPDPE against the antinociceptive effect of DAMGO could be antagonized by TIPP and TICPψ. We hypothesize that during the development of morphine tolerance the formation of μδ heterodimers may contribute to the spinal opioid tolerance. δ ligands may affect the dimer formation differently. Those, like DPDPE may facilitate the dimer formation hence inhibit the antinociceptive effect of DAMGO by causing virtual μ receptor down-regulation. Ligands that do not affect the dimer formation do not influence antinociception either but ligands with the presumed capability of disconnecting the dimers may decrease the spinal tolerance to DAMGO. Copyright © 2012 Elsevier Inc. All rights reserved.

Quantitative fault tolerant control design for a hydraulic actuator with a leaking piston seal

NASA Astrophysics Data System (ADS)

Karpenko, Mark

Hydraulic actuators are complex fluid power devices whose performance can be degraded in the presence of system faults. In this thesis a linear, fixed-gain, fault tolerant controller is designed that can maintain the positioning performance of an electrohydraulic actuator operating under load with a leaking piston seal and in the presence of parametric uncertainties. Developing a control system tolerant to this class of internal leakage fault is important since a leaking piston seal can be difficult to detect, unless the actuator is disassembled. The designed fault tolerant control law is of low-order, uses only the actuator position as feedback, and can: (i) accommodate nonlinearities in the hydraulic functions, (ii) maintain robustness against typical uncertainties in the hydraulic system parameters, and (iii) keep the positioning performance of the actuator within prescribed tolerances despite an internal leakage fault that can bypass up to 40% of the rated servovalve flow across the actuator piston. Experimental tests verify the functionality of the fault tolerant control under normal and faulty operating conditions. The fault tolerant controller is synthesized based on linear time-invariant equivalent (LTIE) models of the hydraulic actuator using the quantitative feedback theory (QFT) design technique. A numerical approach for identifying LTIE frequency response functions of hydraulic actuators from acceptable input-output responses is developed so that linearizing the hydraulic functions can be avoided. The proposed approach can properly identify the features of the hydraulic actuator frequency response that are important for control system design and requires no prior knowledge about the asymptotic behavior or structure of the LTIE transfer functions. A distributed hardware-in-the-loop (HIL) simulation architecture is constructed that enables the performance of the proposed fault tolerant control law to be further substantiated, under realistic operating conditions. Using the HIL framework, the fault tolerant hydraulic actuator is operated as a flight control actuator against the real-time numerical simulation of a high-performance jet aircraft. A robust electrohydraulic loading system is also designed using QFT so that the in-flight aerodynamic load can be experimentally replicated. The results of the HIL experiments show that using the fault tolerant controller to compensate the internal leakage fault at the actuator level can benefit the flight performance of the airplane.

Calculation of Glucose Dose for Intraperitoneal Glucose Tolerance Tests in Lean and Obese Mice.

PubMed

Jørgensen, Mikkel S; Tornqvist, Kristina S; Hvid, Henning

2017-01-01

Glucose tolerance tests are used frequently in nonclinical research with laboratory animals, for example during characterization of obese phenotypes. Despite published standard operating procedures for glucose tolerance tests in rodents, how glucose doses should be calculated when obese and lean animals are compared is not well documented. Typically the glucose dose is calculated as 2 g/kg body weight, regardless of body composition. With this approach, obese mice receive larger glucose doses than do lean animals, potentially leading to overestimation of glucose intolerance in obese animals. In this study, we performed intraperitoneal glucose tolerance tests in mice with diet-induced obesity and their lean controls, with glucose doses based on either the total body weight or the lean body mass of the animals. To determine glucose tolerance, we determined the blood glucose AUC during the glucose tolerance test. We found that the blood glucose AUC was increased significantly in obese mice compared with lean mice by 75% on average when glucose was dosed according to the lean body mass and by 87% when the glucose dose was calculated according to total body weight. Therefore, mice with diet-induced obesity were approximately equally glucose intolerant between the 2 dose-calculation protocols. However, we recommend calculating the glucose dose according to the lean body mass of the mice, because doing so eliminates the concern regarding overdosing of obese animals.

Altitude deviations: Breakdowns of an error-tolerant system

NASA Technical Reports Server (NTRS)

Palmer, Everett A.; Hutchins, Edwin L.; Ritter, Richard D.; Vancleemput, Inge

1993-01-01

Pilot reports of aviation incidents to the Aviation Safety Reporting System (ASRS) provide a window on the problems occurring in today's airline cockpits. The narratives of 10 pilot reports of errors made in the automation-assisted altitude-change task are used to illustrate some of the issues of pilots interacting with automatic systems. These narratives are then used to construct a description of the cockpit as an information processing system. The analysis concentrates on the error-tolerant properties of the system and on how breakdowns can occasionally occur. An error-tolerant system can detect and correct its internal processing errors. The cockpit system consists of two or three pilots supported by autoflight, flight-management, and alerting systems. These humans and machines have distributed access to clearance information and perform redundant processing of information. Errors can be detected as deviations from either expected behavior or as deviations from expected information. Breakdowns in this system can occur when the checking and cross-checking tasks that give the system its error-tolerant properties are not performed because of distractions or other task demands. Recommendations based on the analysis for improving the error tolerance of the cockpit system are given.

Calf antibiotic and sulfonamide test (CAST) for screening antibiotic and sulfonamide residues in calf carcasses.

PubMed

Dey, Bhabani P; Reamer, Richard P; Thaker, Nitin H; Thaler, Alice M

2005-01-01

The Calf Antibiotic and Sulfonamide Test (CAST), a microbial inhibition screening test, was developed for detecting antibiotics and sulfonamides in bob veal calf carcasses. The test uses Bacillus megaterium ATCC 9885 as the indicator organism and Mueller Hinton agar as the growth medium. Compared to Swab Test on Premises (STOP), developed in 1970, this screening test has higher sensitivity and the ability to detect a wider range of veterinary antimicrobial residual drugs, particularly sulfonamides, at lower concentrations. Carcasses that are tested with CAST and suspected of containing chemical residue above tolerance level are retained for confirmation. Disposition of these carcasses are determined upon laboratory result. Routine testing of bob veal calves with CAST allowed the Food Safety and Inspection Service to release most calf carcasses within 24 h post-slaughter, thus conserving shipping and handling resources. However, changes in the regulation in 1990 dictate that disposition of carcasses found to contain violative levels of sulfonamide residues should be based on laboratory findings. The analysis of the data for the years 1990-1994 and 1998 indicate that the use of CAST over the years was significant, and had a direct impact on reduction of residue violations in veal carcasses. With the use of CAST, potentially harmful antimicrobial chemicals entering the human food chain through veal meat have been minimized.

Prevention, Detection, and Management of Diabetes in South Dakota.

PubMed

Hogue, Amy L; Huntington, Mark K

2017-01-01

Diabetes mellitus (DM) is increasing in prevalence nationwide and in South Dakota, with an especially high prevalence in its American Indian population. Screening is not recommended for type 1 DM, but is for type 2 DM and pre-diabetes in certain populations. Fasting glucose, two-hour glucose tolerance test, or hemoglobin A1c are appropriate screening options. Treatment can include diabetic self-management education programs and medications. In addition to glycemic control, other cardiovascular risk factors must be reduced in these patients and specific testing and consultations should be performed to detect complications such as nephropathy or retinopathy. Along with routine age-appropriate immunizations, most diabetic patients should receive the pneumococcal polysaccharide vaccine (PPSV-23), influenza, and the hepatitis B series. Progression from pre-diabetes to type 2 DM can be prevented or delayed in some patients through lifestyle interventions and/or metformin. The South Dakota Diabetes Coalition (www.sddiabetescoalition.org) is an excellent resource for clinicians and patients. Copyright© South Dakota State Medical Association.

Skin surface cooling improves orthostatic tolerance following prolonged head-down bed rest

PubMed Central

Keller, David M.; Low, David A.; Davis, Scott L.; Hastings, Jeff

2011-01-01

Prolonged exposure to microgravity, as well as its ground-based analog, head-down bed rest (HDBR), reduces orthostatic tolerance in humans. While skin surface cooling improves orthostatic tolerance, it remains unknown whether this could be an effective countermeasure to preserve orthostatic tolerance following HDBR. We therefore tested the hypothesis that skin surface cooling improves orthostatic tolerance after prolonged HDBR. Eight subjects (six men and two women) participated in the investigation. Orthostatic tolerance was determined using a progressive lower-body negative pressure (LBNP) tolerance test before HDBR during normothermic conditions and on day 16 or day 18 of 6° HDBR during normothermic and skin surface cooling conditions (randomized order post-HDBR). The thermal conditions were achieved by perfusing water (normothermia ∼34°C and skin surface cooling ∼12–15°C) through a tube-lined suit worn by each subject. Tolerance tests were performed after ∼30 min of the respective thermal stimulus. A cumulative stress index (CSI; mmHg LBNP·min) was determined for each LBNP protocol by summing the product of the applied negative pressure and the duration of LBNP at each stage. HDBR reduced normothermic orthostatic tolerance as indexed by a reduction in the CSI from 1,037 ± 96 mmHg·min to 574 ± 63 mmHg·min (P < 0.05). After HDBR, skin surface cooling increased orthostatic tolerance (797 ± 77 mmHg·min) compared with normothermia (P < 0.05). While the reduction in orthostatic tolerance following prolonged HDBR was not completely reversed by acute skin surface cooling, the identified improvements may serve as an important and effective countermeasure for individuals exposed to microgravity, as well as immobilized and bed-stricken individuals. PMID:21454746

Fault-tolerant onboard digital information switching and routing for communications satellites

NASA Technical Reports Server (NTRS)

Shalkhauser, Mary JO; Quintana, Jorge A.; Soni, Nitin J.; Kim, Heechul

1993-01-01

The NASA Lewis Research Center is developing an information-switching processor for future meshed very-small-aperture terminal (VSAT) communications satellites. The information-switching processor will switch and route baseband user data onboard the VSAT satellite to connect thousands of Earth terminals. Fault tolerance is a critical issue in developing information-switching processor circuitry that will provide and maintain reliable communications services. In parallel with the conceptual development of the meshed VSAT satellite network architecture, NASA designed and built a simple test bed for developing and demonstrating baseband switch architectures and fault-tolerance techniques. The meshed VSAT architecture and the switching demonstration test bed are described, and the initial switching architecture and the fault-tolerance techniques that were developed and tested are discussed.

Guest Editor's Introduction: Special section on dependable distributed systems

NASA Astrophysics Data System (ADS)

Fetzer, Christof

1999-09-01

We rely more and more on computers. For example, the Internet reshapes the way we do business. A `computer outage' can cost a company a substantial amount of money. Not only with respect to the business lost during an outage, but also with respect to the negative publicity the company receives. This is especially true for Internet companies. After recent computer outages of Internet companies, we have seen a drastic fall of the shares of the affected companies. There are multiple causes for computer outages. Although computer hardware becomes more reliable, hardware related outages remain an important issue. For example, some of the recent computer outages of companies were caused by failed memory and system boards, and even by crashed disks - a failure type which can easily be masked using disk mirroring. Transient hardware failures might also look like software failures and, hence, might be incorrectly classified as such. However, many outages are software related. Faulty system software, middleware, and application software can crash a system. Dependable computing systems are systems we can rely on. Dependable systems are, by definition, reliable, available, safe and secure [3]. This special section focuses on issues related to dependable distributed systems. Distributed systems have the potential to be more dependable than a single computer because the probability that all computers in a distributed system fail is smaller than the probability that a single computer fails. However, if a distributed system is not built well, it is potentially less dependable than a single computer since the probability that at least one computer in a distributed system fails is higher than the probability that one computer fails. For example, if the crash of any computer in a distributed system can bring the complete system to a halt, the system is less dependable than a single-computer system. Building dependable distributed systems is an extremely difficult task. There is no silver bullet solution. Instead one has to apply a variety of engineering techniques [2]: fault-avoidance (minimize the occurrence of faults, e.g. by using a proper design process), fault-removal (remove faults before they occur, e.g. by testing), fault-evasion (predict faults by monitoring and reconfigure the system before failures occur), and fault-tolerance (mask and/or contain failures). Building a system from scratch is an expensive and time consuming effort. To reduce the cost of building dependable distributed systems, one would choose to use commercial off-the-shelf (COTS) components whenever possible. The usage of COTS components has several potential advantages beyond minimizing costs. For example, through the widespread usage of a COTS component, design failures might be detected and fixed before the component is used in a dependable system. Custom-designed components have to mature without the widespread in-field testing of COTS components. COTS components have various potential disadvantages when used in dependable systems. For example, minimizing the time to market might lead to the release of components with inherent design faults (e.g. use of `shortcuts' that only work most of the time). In addition, the components might be more complex than needed and, hence, potentially have more design faults than simpler components. However, given economic constraints and the ability to cope with some of the problems using fault-evasion and fault-tolerance, only for a small percentage of systems can one justify not using COTS components. Distributed systems built from current COTS components are asynchronous systems in the sense that there exists no a priori known bound on the transmission delay of messages or the execution time of processes. When designing a distributed algorithm, one would like to make sure (e.g. by testing or verification) that it is correct, i.e. satisfies its specification. Many distributed algorithms make use of consensus (eventually all non-crashed processes have to agree on a value), leader election (a crashed leader is eventually replaced by a new leader, but at any time there is at most one leader) or a group membership detection service (a crashed process is eventually suspected to have crashed but only crashed processes are suspected). From a theoretical point of view, the service specifications given for such services are not implementable in asynchronous systems. In particular, for each implementation one can derive a counter example in which the service violates its specification. From a practical point of view, the consensus, the leader election, and the membership detection problem are solvable in asynchronous distributed systems. In this special section, Raynal and Tronel show how to bridge this difference by showing how to implement the group membership detection problem with a negligible probability [1] to fail in an asynchronous system. The group membership detection problem is specified by a liveness condition (L) and a safety property (S): (L) if a process p crashes, then eventually every non-crashed process q has to suspect that p has crashed; and (S) if a process q suspects p, then p has indeed crashed. One can show that either (L) or (S) is implementable, but one cannot implement both (L) and (S) at the same time in an asynchronous system. In practice, one only needs to implement (L) and (S) such that the probability that (L) or (S) is violated becomes negligible. Raynal and Tronel propose and analyse a protocol that implements (L) with certainty and that can be tuned such that the probability that (S) is violated becomes negligible. Designing and implementing distributed fault-tolerant protocols for asynchronous systems is a difficult but not an impossible task. A fault-tolerant protocol has to detect and mask certain failure classes, e.g. crash failures and message omission failures. There is a trade-off between the performance of a fault-tolerant protocol and the failure classes the protocol can tolerate. One wants to tolerate as many failure classes as needed to satisfy the stochastic requirements of the protocol [1] while still maintaining a sufficient performance. Since clients of a protocol have different requirements with respect to the performance/fault-tolerance trade-off, one would like to be able to customize protocols such that one can select an appropriate performance/fault-tolerance trade-off. In this special section Hiltunen et al describe how one can compose protocols from micro-protocols in their Cactus system. They show how a group RPC system can be tailored to the needs of a client. In particular, they show how considering additional failure classes affects the performance of a group RPC system. References [1] Cristian F 1991 Understanding fault-tolerant distributed systems Communications of ACM 34 (2) 56-78 [2] Heimerdinger W L and Weinstock C B 1992 A conceptual framework for system fault tolerance Technical Report 92-TR-33, CMU/SEI [3] Laprie J C (ed) 1992 Dependability: Basic Concepts and Terminology (Vienna: Springer)

Yeasts associated with an abandoned mining area in Pernek and their tolerance to different chemical elements.

PubMed

Vadkertiová, Renáta; Molnárová, Jana; Lux, Alexander; Vaculík, Marek; Lišková, Desana

2016-05-01

Four plants, Cirsium arvense (creeping thistle), Equisetum arvense (field horsetail), Oxalis acetosella (wood sorrel) and Phragmites australis (common reed), which grew in an abandoned Sb-mining area in Pernek (Malé Karpaty Mts., Slovakia), were investigated for the yeast species. Yeasts were isolated from both the leaves of the plants and the soil adjacent to the plants. In total, 65 yeast cultures, belonging to 11 ascomycetous and 5 basidiomycetous yeast species, were isolated. The species most frequently isolated from both the soil and leaf samples were Trichosporon porosum, Galactomyces candidus and Candida solani, whereas Aureobasidium pullulans, Candida tsuchiyae and Sporidiobolus metaroseus were isolated exclusively from the plant leaves. All the yeast species isolated were tested for their tolerance to two heavy metals (Cd, Zn) and three metalloids (As, Sb and Si). The yeasts isolated from both the leaves and soils exhibited a high tolerance level to both As and Sb, present in elevated concentrations at the locality. Among the yeast species tested, Cryptococcus musci, a close relative to Cryptococcus humicola, was the species most tolerant to all the chemical elements tested, with the exception of Si. It grew in the presence of 200 mmol/L Zn, 200 mmol/L Cd, 60 mmol/L As and 50 mmol/L Sb, and therefore, it can be considered as a multi-tolerant species. Some of the yeast species were tolerant to the individual chemical elements. The yeast-like species Trichosporon laibachii exhibited the highest tolerance to Si of all yeasts tested, and Cryptococcus flavescens and Lindnera saturnus showed the same tolerance as Cryptococcus musci to Zn and As, respectively. The majority of the yeasts showed a notably low tolerance to Cd (not exceeded 0.5 mmol/L), which was present in small amounts in the soil. However, Candida solani, isolated from the soil, exhibited a higher tolerance to Cd (20 mmol/L) than to As (2 mmol/L).

Evaluation of the NZ guidelines for screening for persistent postpartum hyperglycaemia following gestational diabetes.

PubMed

Hughes, Ruth C E; Florkowski, Chris; Gullam, Joanna E

2017-11-17

Recent New Zealand guidelines recommend annual glycated haemoglobin (HbA1c) measurements from three months postpartum, replacing the glucose tolerance test (GTT) at six weeks, to screen for persistent hyperglycaemia following gestational diabetes. Data suggest that this screening approach may miss cases of type 2 diabetes, but are they detected at subsequent screening and will screening rates improve? Our aim was to evaluate the effectiveness of HbA1c monitoring in improving screening rates following gestational diabetes and in detecting postpartum hyperglycaemia. During 2015 in Christchurch, all women with gestational diabetes were offered HbA1c and GTT measurements at three months postpartum and subsequent annual HbA1c measurements were recommended. Data from electronic hospital records were collected for a minimum 18 months postpartum. Of the cohort of 333 women, 218 (65%) completed both HbA1c and GTT at three months postpartum, 74 (22%) HbA1c only, 16 (5%) GTT only, 25 (8%) no screening; 184 (55%) had subsequent HbA1c tests. Diabetes was detected by GTT in five (2%) women and by HbA1c in only one out of five (20%); the disagreement between tests resolved in three out of four (75%) women with subsequent testing. Prediabetes was detected by GTT in 30 (14%) women; however, HbA1c only detected five out of 30 (17%) and subsequent HbA1c testing identified a further two out of 30 with prediabetes. HbA1c measurement at three months postpartum had a good uptake. However, most cases of diabetes were identified by subsequent HbA1c testing, the uptake of which was suboptimal. The importance of annual HbA1c monitoring following gestational diabetes needs greater emphasis. © 2017 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Early impaired β-cell function in chinese women with polycystic ovary syndrome.

PubMed

Tao, Tao; Li, Shengxian; Zhao, Aimin; Mao, Xiuyin; Liu, Wei

2012-01-01

The pathogenic factors that account for the development of diabetes condition in Chinese women with polycystic ovary syndrome (PCOS) remain elusive. To clarify the pathogenic features by evaluating the levels of insulin sensitivity and β cell function in these women with PCOS, either separately or by using of a disposition indexes (DIs). Cross-sectional study involving 137 Chinese women with PCOS and 123 normal women were examined by anthropometry, lipid profile, sex hormone, high-sensitivity C reactive protein, oral glucose tolerance tests and insulin tolerance tests. After controlling for BMI status, the Matsuda Index was significantly lower in women with PCOS in comparison to those of normal women (p<0.000). The early phase of insulin secretion (insulinogenic index) remained significantly lower in lean women with PCOS(LP) than those of both lean and obese women of control group (p=0.007, and p = 0.01, respectively). The mean HOMA-F values were significantly lower (p =0.045) in obese women with PCOS (OP) than those of BMI-matched women. Further, all DIs derived from non-fasting state indexes in women with PCOS were significantly lower than those of BMI-matched control women (p<0.001 for all). Lastly, DIs derived from fasting states indexes in OP were significantly lower than those of LP. Early impaired β cell function was detected in both LP and OP. However, more serious primary defect in insulin action was detected in LP compared to OP. These findings imply that early screening and intervention for PCOS would be therapeutic for Chinese women.

Age, BMI, and race are less important than random plasma glucose in identifying risk of glucose intolerance: the Screening for Impaired Glucose Tolerance Study (SIGT 5).

PubMed

Ziemer, David C; Kolm, Paul; Weintraub, William S; Vaccarino, Viola; Rhee, Mary K; Caudle, Jane M; Irving, Jade M; Koch, David D; Narayan, K M Venkat; Phillips, Lawrence S

2008-05-01

Age, BMI, and race/ethnicity are used in National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) and American Diabetes Association (ADA) guidelines to prompt screening for pre-diabetes and diabetes, but cutoffs have not been evaluated rigorously. Random plasma glucose (RPG) was measured and 75-g oral glucose tolerance tests were performed in 1,139 individuals without known diabetes. Screening performance was assessed by logistic regression and area under the receiver operating characteristic curve (AROC). NIDDK/ADA indicators age >45 years and BMI >25 kg/m(2) provided significant detection of both diabetes and dysglycemia (both AROCs 0.63), but screening was better with continuous-variable models of age, BMI, and race and better still with models of age, BMI, race, sex, and family history (AROC 0.78 and 0.72). However, screening was even better with RPG alone (AROCs 0.81 and 0.72). RPG >125 mg/dl could be used to prompt further evaluation with an OGTT. Use of age, BMI, and race/ethnicity in guidelines for screening to detect diabetes and pre-diabetes may be less important than evaluation of RPG. RPG should be investigated further as a convenient, inexpensive screen with good predictive utility.

Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome

PubMed Central

Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

2016-01-01

Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have. PMID:27570464

Pathophysiology, risk factors, and screening methods for prediabetes in women with polycystic ovary syndrome.

PubMed

Gourgari, Evgenia; Spanakis, Elias; Dobs, Adrian Sandra

2016-01-01

Polycystic ovary syndrome (PCOS) is a syndrome associated with insulin resistance (IR), obesity, infertility, and increased cardiometabolic risk. This is a descriptive review of several mechanisms that can explain the IR among women with PCOS, other risk factors for the development of diabetes, and the screening methods used for the detection of glucose intolerance in women with PCOS. Few mechanisms can explain IR in women with PCOS such as obesity, insulin receptor signaling defects, and inhibition of insulin-mediated glucose uptake in adipocytes. Women with PCOS have additional risk factors for the development of glucose intolerance such as family history of diabetes, use of oral contraceptives, anovulation, and age. The Androgen Society in 2007 and the Endocrine Society in 2013 recommended using oral glucose tolerance test as a screening tool for abnormal glucose tolerance in all women with PCOS. The approach to detection of glucose intolerance among women with PCOS varies among health care providers. Large prospective studies are still needed for the development of guidelines with strong evidence. When assessing risk of future diabetes in women with PCOS, it is important to take into account the method used for screening as well as other risk factors that these women might have.

Rifamycin action on RNA polymerase in antibiotic-tolerant Mycobacterium tuberculosis results in differentially detectable populations.

PubMed

Saito, Kohta; Warrier, Thulasi; Somersan-Karakaya, Selin; Kaminski, Lina; Mi, Jianjie; Jiang, Xiuju; Park, Suna; Shigyo, Kristi; Gold, Ben; Roberts, Julia; Weber, Elaina; Jacobs, William R; Nathan, Carl F

2017-06-13

Mycobacterium tuberculosis (Mtb) encounters stresses during the pathogenesis and treatment of tuberculosis (TB) that can suppress replication of the bacteria and render them phenotypically tolerant to most available drugs. Where studied, the majority of Mtb in the sputum of most untreated subjects with active TB have been found to be nonreplicating by the criterion that they do not grow as colony-forming units (cfus) when plated on agar. However, these cells are viable because they grow when diluted in liquid media. A method for generating such "differentially detectable" (DD) Mtb in vitro would aid studies of the biology and drug susceptibility of this population, but lack of independent confirmation of reported methods has contributed to skepticism about their existence. Here, we identified confounding artifacts that, when avoided, allowed development of a reliable method of producing cultures of ≥90% DD Mtb in starved cells. We then characterized several drugs according to whether they contribute to the generation of DD Mtb or kill them. Of the agents tested, rifamycins led to DD Mtb generation, an effect lacking in a rifampin-resistant strain with a mutation in rpoB , which encodes the canonical rifampin target, the β subunit of RNA polymerase. In contrast, thioridazine did not generate DD Mtb from starved cells but killed those generated by rifampin.

Inheritance of mercury tolerance in the aquatic oligochaete Tubifex tubifex.

PubMed

Vidal, Dora Elva; Horne, Alex John

2003-09-01

Resistance to contaminants is an important yet unmeasured factor in sediment toxicity tests. The rate at which mercury resistance develops and its genetic persistence in the oligochaete worm Tubifex tubifex were studied under laboratory conditions. Worms were raised for four generations under two different sediment treatments, one reference clean sediment, the other contaminated with mercury. Worms raised in mercury-contaminated sediment developed mercury tolerance that persisted even when the worms were raised for three subsequent generations in clean sediment. Mercury tolerance was determined by comparative water-only toxicity tests with mercury as the only stressor. Control worms had a mean lethal concentration (LC50) of 0.18 mg/L(-1). Worms exposed to high levels of mercury in sediment had high mercury tolerance with a mean LC50 of 1.40 mg/L(-1). When mercury-tolerant and control mercury-intolerant worms were crossed, their descendants also demonstrated mercury tolerance during lethal toxicity tests. The LC50 for worm descendants resulting from this cross was 1.39 mg/L(-1). Adaptation to mercury exposures occurred rapidly in this group of worms and appears to be due to both phenotypic and genotypic mechanisms. Development of contaminant resistance and adaptation may be common phenomena in aquatic benthic invertebrates, which should be considered during the design and interpretation of toxicity tests.

Fault-tolerant quantum error detection.

PubMed

Linke, Norbert M; Gutierrez, Mauricio; Landsman, Kevin A; Figgatt, Caroline; Debnath, Shantanu; Brown, Kenneth R; Monroe, Christopher

2017-10-01

Quantum computers will eventually reach a size at which quantum error correction becomes imperative. Quantum information can be protected from qubit imperfections and flawed control operations by encoding a single logical qubit in multiple physical qubits. This redundancy allows the extraction of error syndromes and the subsequent detection or correction of errors without destroying the logical state itself through direct measurement. We show the encoding and syndrome measurement of a fault-tolerantly prepared logical qubit via an error detection protocol on four physical qubits, represented by trapped atomic ions. This demonstrates the robustness of a logical qubit to imperfections in the very operations used to encode it. The advantage persists in the face of large added error rates and experimental calibration errors.

Handling Ibuprofen Increases Pain Tolerance and Decreases Perceived Pain Intensity in a Cold Pressor Test

PubMed Central

Rutchick, Abraham M.; Slepian, Michael L.

2013-01-01

Pain contributes to health care costs, missed work and school, and lower quality of life. Extant research on psychological interventions for pain has focused primarily on developing skills that individuals can apply to manage their pain. Rather than examining internal factors that influence pain tolerance (e.g., pain management skills), the current work examines factors external to an individual that can increase pain tolerance. Specifically, the current study examined the nonconscious influence of exposure to meaningful objects on the perception of pain. Participants (N = 54) completed a cold pressor test, examined either ibuprofen or a control object, then completed another cold pressor test. In the second test, participants who previously examined ibuprofen reported experiencing less intense pain and tolerated immersion longer (relative to baseline) than those who examined the control object. Theoretical and applied implications of these findings are discussed. PMID:23469170

Critical temperature: A quantitative method of assessing cold tolerance

Treesearch

D.H. DeHayes; M.W., Jr. Williams

1989-01-01

Critical temperature (Tc), defined as the highest temperature at which freezing injury to plant tissues can be detected, provides a biologically meaningful and statistically defined assessment of the relative cold tolerance of plant tissues. A method is described for calculating critical temperatures in laboratory freezing studies that use...

A fault-tolerant information processing concept for space vehicles.

NASA Technical Reports Server (NTRS)

Hopkins, A. L., Jr.

1971-01-01

A distributed fault-tolerant information processing system is proposed, comprising a central multiprocessor, dedicated local processors, and multiplexed input-output buses connecting them together. The processors in the multiprocessor are duplicated for error detection, which is felt to be less expensive than using coded redundancy of comparable effectiveness. Error recovery is made possible by a triplicated scratchpad memory in each processor. The main multiprocessor memory uses replicated memory for error detection and correction. Local processors use any of three conventional redundancy techniques: voting, duplex pairs with backup, and duplex pairs in independent subsystems.

Specialized physiological studies in support of manned space flight

NASA Technical Reports Server (NTRS)

Luft, U. C.

1976-01-01

Subjects were tested for tolerance to lower body negative pressure (LBNP) before and after acute dehydration by working intermittenly for two hours without fluid replacement. On the second day there-after the LBNP tests were repeated before and after acute dehydration. The LBNP test consisted of 5 min long consective stages at -20, -30, -40, -50 and -60 Torr. Tests were terminated when syncope was imminent or the full sequence was completed. Tolerance was expressed in terms of cumulative stress in Torr x min. Measurements of body mass, density, fat fraction and total body water (TBW) were made before and after acclimation. Blood volume and its constituents were determined before and after each of the four LBNP tests. During LBNP, heart rate, blood pressure, and changes in calf and forearm volume were recorded every minute. Results showed: acute dehydration caused a significant loss in average LBNP tolerance on all subjects. Acclimation to heat did not significantly affect LBNP tolerance in hydrated subjects but significantly improved it on dehydrated subjects.

De novo transcriptome sequencing of Acer palmatum and comprehensive analysis of differentially expressed genes under salt stress in two contrasting genotypes.

PubMed

Rong, Liping; Li, Qianzhong; Li, Shushun; Tang, Ling; Wen, Jing

2016-04-01

Maple (Acer palmatum) is an important species for landscape planting worldwide. Salt stress affects the normal growth of the Maple leaf directly, leading to loss of esthetic value. However, the limited availability of Maple genomic information has hindered research on the mechanisms underlying this tolerance. In this study, we performed comprehensive analyses of the salt tolerance in two genotypes of Maple using RNA-seq. Approximately 146.4 million paired-end reads, representing 181,769 unigenes, were obtained. The N50 length of the unigenes was 738 bp, and their total length over 102.66 Mb. 14,090 simple sequence repeats and over 500,000 single nucleotide polymorphisms were identified, which represent useful resources for marker development. Importantly, 181,769 genes were detected in at least one library, and 303 differentially expressed genes (DEGs) were identified between salt-sensitive and salt-tolerant genotypes. Among these DEGs, 125 were upregulated and 178 were downregulated genes. Two MYB-related proteins and one LEA protein were detected among the first 10 most downregulated genes. Moreover, a methyltransferase-related gene was detected among the first 10 most upregulated genes. The three most significantly enriched pathways were plant hormone signal transduction, arginine and proline metabolism, and photosynthesis. The transcriptome analysis provided a rich genetic resource for gene discovery related to salt tolerance in Maple, and in closely related species. The data will serve as an important public information platform to further our understanding of the molecular mechanisms involved in salt tolerance in Maple.

Mapping QTL for Sex and Growth Traits in Salt-Tolerant Tilapia (Oreochromis spp. X O. mossambicus).

PubMed

Lin, Grace; Chua, Elaine; Orban, Laszlo; Yue, Gen Hua

2016-01-01

In aquaculture, growth and sex are economically important traits. To accelerate genetic improvement in increasing growth in salt-tolerant tilapia, we conducted QTL mapping for growth traits and sex with an F2 family, including 522 offspring and two parents. We used 144 polymorphic microsatellites evenly covering the genome of tilapia to genotype the family. QTL analyses were carried out using interval mapping for all individuals, males and females in the family, respectively. Using all individuals, three suggestive QTL for body weight, body length and body thickness respectively were detected in LG20, LG22 and LG12 and explained 2.4% to 3.1% of phenotypic variance (PV). When considering only males, five QTL for body weight were detected on five LGs, and explained 4.1 to 6.3% of PV. Using only females from the F2 family, three QTL for body weight were detected on LG1, LG6 and LG8, and explained 7.9-14.3% of PV. The QTL for body weight in males and females were located in different LGs, suggesting that in salt-tolerant tilapia, different set of genes 'switches' control the growth in males and females. QTL for sex were mapped on LG1 and LG22, indicating multigene sex determination in the salt-tolerant tilapia. This study provides new insights on the locations and effects of QTL for growth traits and sex, and sets the foundation for fine mapping for future marker-assisted selection for growth and sex in salt-tolerant tilapia aquaculture.

Mapping QTL for Sex and Growth Traits in Salt-Tolerant Tilapia (Oreochromis spp. X O. mossambicus)

PubMed Central

Lin, Grace; Chua, Elaine; Orban, Laszlo; Yue, Gen Hua

2016-01-01

In aquaculture, growth and sex are economically important traits. To accelerate genetic improvement in increasing growth in salt-tolerant tilapia, we conducted QTL mapping for growth traits and sex with an F2 family, including 522 offspring and two parents. We used 144 polymorphic microsatellites evenly covering the genome of tilapia to genotype the family. QTL analyses were carried out using interval mapping for all individuals, males and females in the family, respectively. Using all individuals, three suggestive QTL for body weight, body length and body thickness respectively were detected in LG20, LG22 and LG12 and explained 2.4% to 3.1% of phenotypic variance (PV). When considering only males, five QTL for body weight were detected on five LGs, and explained 4.1 to 6.3% of PV. Using only females from the F2 family, three QTL for body weight were detected on LG1, LG6 and LG8, and explained 7.9–14.3% of PV. The QTL for body weight in males and females were located in different LGs, suggesting that in salt-tolerant tilapia, different set of genes ‘switches’ control the growth in males and females. QTL for sex were mapped on LG1 and LG22, indicating multigene sex determination in the salt-tolerant tilapia. This study provides new insights on the locations and effects of QTL for growth traits and sex, and sets the foundation for fine mapping for future marker-assisted selection for growth and sex in salt-tolerant tilapia aquaculture. PMID:27870905

Mid-Infrared Photoacoustic Detection of Glucose in Human Skin: Towards Non-Invasive Diagnostics

PubMed Central

Kottmann, Jonas; Rey, Julien M.; Sigrist, Markus W.

2016-01-01

Diabetes mellitus is a widespread metabolic disease without cure. Great efforts are being made to develop a non-invasive monitoring of the blood glucose level. Various attempts have been made, including a number of non-optical approaches as well as optical techniques involving visible, near- and mid-infrared light. However, no true breakthrough has been achieved so far, i.e., there is no fully non-invasive monitoring device available. Here we present a new study based on mid-infrared spectroscopy and photoacoustic detection. We employ two setups, one with a fiber-coupled photoacoustic (PA) cell and a tunable quantum cascade laser (QCL), and a second setup with two QCLs at different wavelengths combined with PA detection. In both cases, the PA cells are in direct skin contact. The performance is tested with an oral glucose tolerance test. While the first setup often gives reasonable qualitative agreement with ordinary invasive blood glucose measurements, the dual-wavelength approach yields a considerably improved stability and an uncertainty of only ±30 mg/dL of the blood glucose concentration level at a confidence level of 90%. This result is achieved without advanced data treatment such as principal component analysis involving extended wavelength ranges. PMID:27735878

Use of labelled triolein, vitamin A, and D-xylose in the diagnosis of malabsorption 1

PubMed Central

Wormsley, K. G.

1963-01-01

This paper discusses the type of results given by a group of test procedures used in the study of small intestinal dysfunction. While the chemical estimation of faecal fat remains the most valuable criterion for the laboratory detection of malabsorption, the occurrence of abnormal faecal or blood radioactivity also denotes the presence of malabsorption, although some patients with staetorrhoea appear to `absorb' labelled triolein normally. Analysis of data from the other tests shows that steatorrhoea is not necessarily present in patients who give abnormal results and that the presence of malabsorption does not preclude a normal capacity for handling the test substances. These reservations impair the value of the vitamin A and xylose `tolerance' tests and serum carotene levels as screening procedures for the determination of malabsorption states. On the other hand, these tests show patterns of results which are useful in differentiating idiopathic from secondary steatorrhoea, since patients with secondary malabsorption often handle one or more of these test substances normally. PMID:14058268

Medicinal Δ(9) -tetrahydrocannabinol (dronabinol) impairs on-the-road driving performance of occasional and heavy cannabis users but is not detected in Standard Field Sobriety Tests.

PubMed

Bosker, Wendy M; Kuypers, Kim P C; Theunissen, Eef L; Surinx, Anke; Blankespoor, Roos J; Skopp, Gisela; Jeffery, Wayne K; Walls, H Chip; van Leeuwen, Cees J; Ramaekers, Johannes G

2012-10-01

The acute and chronic effects of dronabinol [medicinal Δ(9) -tetrahydrocannabinol (THC)] on actual driving performance and the Standard Field Sobriety Test (SFST) were assessed. It was hypothesized that occasional users would be impaired on these tests and that heavy users would show less impairment due to tolerance. Double-blind, placebo-controlled, randomized, three-way cross-over study. Twelve occasional and 12 heavy cannabis users (14 males/10 females) received single doses of placebo, 10 and 20 mg dronabinol. Standard deviation of lateral position (SDLP; i.e. weaving) is the primary measure of road-tracking control. Time to speed adaptation (TSA) is the primary reaction-time measure in the car-following test. Percentage of impaired individuals on the SFST and subjective high on a visual analogue scale were secondary measures. Superiority tests showed that SDLP (P = 0.008) and TSA (P = 0.011) increased after dronabinol in occasional users. Equivalence tests demonstrated that dronabinol-induced increments in SDLP were bigger than impairment associated with BAC of 0.5 mg/ml in occasional and heavy users, although the magnitude of driving impairment was generally less in heavy users. The SFST did not discriminate between conditions. Levels of subjective high were comparable in occasional and heavy users. Dronabinol (medicinal tetrahydrocannabinol) impairs driving performance in occasional and heavy users in a dose-dependent way, but to a lesser degree in heavy users due possibly to tolerance. The Standard Field Sobriety Test is not sensitive to clinically relevant driving impairment caused by oral tetrahydrocannabinol. © 2012 The Authors. Addiction © 2012 Society for the Study of Addiction.

Safety studies on intravenous administration of oncolytic recombinant vesicular stomatitis virus in purpose-bred beagle dogs.

PubMed

LeBlanc, Amy K; Naik, Shruthi; Galyon, Gina D; Jenks, Nathan; Steele, Mike; Peng, Kah-Whye; Federspiel, Mark J; Donnell, Robert; Russell, Stephen J

2013-12-01

VSV-IFNβ-NIS is a novel recombinant oncolytic vesicular stomatitis virus (VSV) with documented efficacy and safety in preclinical murine models of cancer. To facilitate clinical translation of this promising oncolytic therapy in patients with disseminated cancer, we are utilizing a comparative oncology approach to gather data describing the safety and efficacy of systemic VSV-IFNβ-NIS administration in dogs with naturally occurring cancer. In support of this, we executed a dose-escalation study in purpose-bred dogs to determine the maximum tolerated dose (MTD) of systemic VSV-hIFNβ-NIS, characterize the adverse event profile, and describe routes and duration of viral shedding in healthy, immune-competent dogs. The data indicate that an intravenous dose of 10(10) TCID50 is well tolerated in dogs. Expected adverse events were mild to moderate fever, self-limiting nausea and vomiting, lymphopenia, and oral mucosal lesions. Unexpected adverse events included prolongation of partial thromboplastin time, development of bacterial urinary tract infection, and scrotal dermatitis, and in one dog receiving 10(11) TCID50 (10 × the MTD), the development of severe hepatotoxicity and symptoms of shock leading to euthanasia. Viral shedding data indicate that detectable viral genome in blood diminishes rapidly with anti-VSV neutralizing antibodies detectable in blood as early as day 5 postintravenous virus administration. While low levels of viral genome copies were detectable in plasma, urine, and buccal swabs of dogs treated at the MTD, no infectious virus was detectable in plasma, urine, or buccal swabs at any of the doses tested. These studies confirm that VSV can be safely administered systemically in dogs, justifying the use of oncolytic VSV as a novel therapy for the treatment of canine cancer.

Application of damage tolerance methodology in certification of the Piaggio P-180 Avanti

NASA Technical Reports Server (NTRS)

Johnson, Jerry

1992-01-01

The Piaggio P-180 Avanti, a twin pusher-prop engine nine-passenger business aircraft was certified in 1990, to the requirements of FAR Part 23 and Associated Special Conditions for Composite Structure. Certification included the application of a damage tolerant methodology to the design of the composite forward wing and empennage (vertical fin, horizontal stabilizer, tailcone, and rudder) structure. This methodology included an extensive analytical evaluation coupled with sub-component and full-scale testing of the structure. The work from the Damage Tolerance Analysis Assessment was incorporated into the full-scale testing. Damage representing hazards such as dropped tools, ground equipment, handling, and runway debris, was applied to the test articles. Additional substantiation included allowing manufacturing discrepancies to exist unrepaired on the full-scale articles and simulated bondline failures in critical elements. The importance of full-scale testing in the critical environmental conditions and the application of critical damage are addressed. The implication of damage tolerance on static and fatigue testing is discussed. Good correlation between finite element solutions and experimental test data was observed.

Differential expression of benzodiazepine anticonvulsant cross-tolerance according to time following flurazepam or diazepam treatment.

PubMed

Rosenberg, H C

1995-01-01

In previous studies in which the anti-pentylenetetrazol (PTZ) effect of benzodiazepines was used to measure tolerance, the results depended on the benzodiazepine used for chronic treatment as well as the benzodiazepine given acutely to test for tolerance. In this study, the time course of tolerance reversal was studied in rats given two treatments known to cause anticonvulsant tolerance, 1-week flurazepam (FZP), and 3-week diazepam (DZP). Neither treatment altered convulsive threshold for IV PTZ, but both treatments decreased the convulsive threshold for bicuculline. Withdrawing DZP, but not FZP, treatment resulted in a loss of body weight. Twelve hours after 1-week FZP treatment, all benzodiazepines were significantly less effective, showing tolerance. Forty-eight hours after the 1-week FZP treatment, tolerance was still observed with DZP, FZP, and zolpidem, but was no longer present with clonazepam or bretazenil. After the 3-week DZP treatment, rats were tolerant to all benzodiazepines tested at 12 h of withdrawal, but had lost tolerance to all the drugs except bretazenil by 48 h. The results suggest differences in the way these benzodiazepines interact with their receptors, allowing differential expression of tolerance, and that chronic DZP and FZP treatments affected interactions of the benzodiazepines with their receptors, but not in the same fashion.

Effect of Surgical Curve Correction on Exercise Tolerance and Physical Capacities in Patients of Severe Spinal Deformity.

PubMed

Patil, Prateek C; Rathod, Ashok K; Borde, Mandar; Singh, Vishwajeet; Singh, Hemant U

2016-12-01

Traditionally, surgical intervention for patients with a spinal deformity has been considered for cosmetic benefits, but surgical intervention can alter the lung physiology or volumes and in turn leads to increase in physical capacity and exercise tolerance. Therefore, we conducted this to determine whether a surgical correction would restore the lung physiology, physical capacity and exercise tolerance in patients with kyphoscoliosis. To evaluate the usage of six-minute walk test scores and modified Borg scores as tools/measures for exercise tolerance in patients with spinal deformity and to study the effects of surgical correction of spinal deformity on exercise tolerance with above parameters as the measures. Thirty patients with spinal deformity, who had undergone surgery for deformity correction, were evaluated. All patients were investigated pre-operatively with x-rays of the spine (anteroposterior and lateral views). Clinical tests like breath holding time (after full inspiration) in number of seconds, modified Borg scores, six-minute walk test scores (heart rate, respiratory rate, maximum distance walked); were recorded as measures of exercise tolerance. The patients were followed up on the first, third, sixth and twelfth month post-operatively and tested clinically for breath holding time, modified Borg scores, six-minute walk test scores (heart rate, respiratory rate, maximum distance walked) and x-rays of the spine (anteroposterior and lateral views). In our study, breath holding time (p-value = 0.001) and modified Borg scores (p-value = 0.012) showed a significant improvement at 12 months post-operatively. We noted similar findings with heart rate, respiratory rate and maximum distance walked after a six-minute walk test. Improvements were noted in all the parameters, especially in the group of patients with greater than 60 degrees of cobb angle. However, the differences between the two groups (pre-operative cobb angle less than 60 degrees and pre-operative cobb angle more than 60 degrees) were not significant. The results were analysed and tested for significance using Student's t-test (paired and unpaired as appropriate) and Wilcoxon signed rank test. Surgical correction in cases of spinal deformity improves the cosmetic appearance and balance in the patients. Favourable results of surgical intervention were found in exercise tolerance with improvements in modified Borg scores, six-minute walk test results and breath holding time. The above parameters appear to be good tools for the assessment of physical capacity and exercise tolerance in patients with spinal deformity.

40 CFR Table E-2 to Subpart E of... - Spectral Energy Distribution and Permitted Tolerance for Conducting Radiative Tests

Code of Federal Regulations, 2010 CFR

2010-07-01

... Permitted Tolerance for Conducting Radiative Tests E Table E-2 to Subpart E of Part 53 Protection of... Reference Methods and Class I and Class II Equivalent Methods for PM2.5 or PM10â2.5 Pt. 53, Subpt. E, Table E-2 Table E-2 to Subpart E of Part 53—Spectral Energy Distribution and Permitted Tolerance for...

Soils on exposed Sunda Shelf shaped biogeographic patterns in the equatorial forests of Southeast Asia

PubMed Central

Slik, J. W. Ferry; Aiba, Shin-Ichiro; Bastian, Meredith; Brearley, Francis Q.; Cannon, Charles H.; Eichhorn, Karl A. O.; Fredriksson, Gabriella; Kartawinata, Kuswata; Laumonier, Yves; Mansor, Asyraf; Marjokorpi, Antti; Meijaard, Erik; Morley, Robert J.; Nagamasu, Hidetoshi; Nilus, Reuben; Nurtjahya, Eddy; Payne, John; Permana, Andrea; Poulsen, Axel D.; Raes, Niels; Riswan, Soedarsono; van Schaik, Carel P.; Sheil, Douglas; Sidiyasa, Kade; Suzuki, Eizi; van Valkenburg, Johan L. C. H.; Webb, Campbell O.; Wich, Serge; Yoneda, Tsuyoshi; Zakaria, Rahmad; Zweifel, Nicole

2011-01-01

The marked biogeographic difference between western (Malay Peninsula and Sumatra) and eastern (Borneo) Sundaland is surprising given the long time that these areas have formed a single landmass. A dispersal barrier in the form of a dry savanna corridor during glacial maxima has been proposed to explain this disparity. However, the short duration of these dry savanna conditions make it an unlikely sole cause for the biogeographic pattern. An additional explanation might be related to the coarse sandy soils of central Sundaland. To test these two nonexclusive hypotheses, we performed a floristic cluster analysis based on 111 tree inventories from Peninsular Malaysia, Sumatra, and Borneo. We then identified the indicator genera for clusters that crossed the central Sundaland biogeographic boundary and those that did not cross and tested whether drought and coarse-soil tolerance of the indicator genera differed between them. We found 11 terminal floristic clusters, 10 occurring in Borneo, 5 in Sumatra, and 3 in Peninsular Malaysia. Indicator taxa of clusters that occurred across Sundaland had significantly higher coarse-soil tolerance than did those from clusters that occurred east or west of central Sundaland. For drought tolerance, no such pattern was detected. These results strongly suggest that exposed sandy sea-bed soils acted as a dispersal barrier in central Sundaland. However, we could not confirm the presence of a savanna corridor. This finding makes it clear that proposed biogeographic explanations for plant and animal distributions within Sundaland, including possible migration routes for early humans, need to be reevaluated. PMID:21746913

Cardiac autonomic neuropathy risk estimated by sudomotor function and arterial stiffness in Chinese subjects.

PubMed

Zeng, Q; Dong, S-Y; Wang, M-L; Wang, F; Li, J-M; Zhao, X-L

2016-11-01

The SUDOSCAN test was recently developed to detect diabetic autonomic neuropathy early and screen for cardiac autonomic neuropathy (CAN) through assessment of sudomotor function. The aim of this study was to investigate the relationship of cardiac autonomic dysfunction estimated by the SUDOSCAN test with arterial stiffness. A total of 4019 subjects without diabetes or established cardiovascular disease were tested with SUDOSCAN, central systolic blood pressure (cSBP) and brachial-ankle pulse wave velocity (baPWV). Hands mean electrochemical skin conductance (ESC) measured by SUDOSCAN was 70±17 μS, feet mean ESC was 71±16 μS and the CAN risk score was 21±10%. The levels of cSBP and baPWV increased across quartiles of CAN risk score (P for trend <0.001 for all). In spearman correlation analyses, the CAN risk score was positively correlated with cSBP (r=0.391, P<0.001) and baPWV (r=0.305, P<0.001). In multivariable analyses, the values of cSBP and baPWV increased 0.17 mm Hg (P=0.002) and 2.01 cm per second (P=0.010), respectively, when CAN risk score increased 1%. The results were unchanged when stratified by glucose tolerance status. In conclusion, cardiac autonomic dysfunction estimated by sudomotor function was correlated with arterial stiffness independent of conventional factors and glucose tolerance status.

Design of a Type-1 Diabetes Vaccine Candidate Using Edible Plants Expressing a Major Autoantigen

PubMed Central

Bertini, Edoardo; Merlin, Matilde; Gecchele, Elisa; Puggia, Andrea; Brozzetti, Annalisa; Commisso, Mauro; Falorni, Alberto; Bini, Vittorio; Klymyuk, Victor; Pezzotti, Mario; Avesani, Linda

2018-01-01

Type-1 diabetes (T1D) is a metabolic disease involving the autoimmune destruction of insulin-producing pancreatic beta cells. It is often diagnosed by the detection of autoantibodies, typically those recognizing insulin itself or the 65-kDa isoform of glutamic acid decarboxylase (GAD65). Oral insulin can be used to induce systemic immunological tolerance and thus prevent or delay the onset of T1D, suggesting that combination treatments with other autoantigens such as GAD65 could be even more successful. GAD65 has induced oral tolerance and prevented T1D in preclinical studies but it is difficult to produce in sufficient quantities for clinical testing. Here we combined edible plant systems, namely spinach (Spinacia oleracea cv Industra) and red beet (Beta vulgaris cv Moulin Rouge), with the magnICON® expression system to develop a safe, cost-effective and environmentally sustainable platform for the large-scale production of GAD65. The superior red beet platform was extensively characterized in terms of recombinant protein yields and bioequivalence to wild-type plants, and the product was tested for its ability to resist simulated gastric digestion. Our results indicate that red beet plants are suitable for the production of a candidate oral vaccine based on GAD65 for the future preclinical and clinical testing of T1D immunotherapy approaches. PMID:29765386

US women's attitudes to false positive mammography results and detection of ductal carcinoma in situ: cross sectional survey

PubMed Central

Schwartz, Lisa M; Woloshin, Steven; Sox, Harold C; Fischhoff, Baruch; Welch, H Gilbert

2000-01-01

Objective To determine women's attitudes to and knowledge of both false positive mammography results and the detection of ductal carcinoma in situ after screening mammography. Design Cross sectional survey. Setting United States. Participants 479 women aged 18-97 years who did not report a history of breast cancer. Main outcome measures Attitudes to and knowledge of false positive results and the detection of ductal carcinoma in situ after screening mammography. Results Women were aware that false positive results do occur. Their median estimate of the false positive rate for 10 years of annual screening was 20% (25th percentile estimate, 10%; 75th percentile estimate, 45%). The women were highly tolerant of false positives: 63% thought that 500 or more false positives per life saved was reasonable and 37% would tolerate 10 000 or more. Women who had had a false positive result (n=76) expressed the same high tolerance: 39% would tolerate 10 000 or more false positives. 62% of women did not want to take false positive results into account when deciding about screening. Only 8% of women thought that mammography could harm a woman without breast cancer, and 94% doubted the possibility of non-progressive breast cancers. Few had heard about ductal carcinoma in situ, a cancer that may not progress, but when informed, 60% of women wanted to take into account the possibility of it being detected when deciding about screening. Conclusions Women are aware of false positives and seem to view them as an acceptable consequence of screening mammography. In contrast, most women are unaware that screening can detect cancers that may never progress but feel that such information would be relevant. Education should perhaps focus less on false positives and more on the less familiar outcome of detection of ductal carcinoma in situ. PMID:10856064

Modeling the Fault Tolerant Capability of a Flight Control System: An Exercise in SCR Specification

NASA Technical Reports Server (NTRS)

Alexander, Chris; Cortellessa, Vittorio; DelGobbo, Diego; Mili, Ali; Napolitano, Marcello

2000-01-01

In life-critical and mission-critical applications, it is important to make provisions for a wide range of contingencies, by providing means for fault tolerance. In this paper, we discuss the specification of a flight control system that is fault tolerant with respect to sensor faults. Redundancy is provided by analytical relations that hold between sensor readings; depending on the conditions, this redundancy can be used to detect, identify and accommodate sensor faults.

Combined methods of tolerance increasing for embedded SRAM

NASA Astrophysics Data System (ADS)

Shchigorev, L. A.; Shagurin, I. I.

2016-10-01

The abilities of combined use of different methods of fault tolerance increasing for SRAM such as error detection and correction codes, parity bits, and redundant elements are considered. Area penalties due to using combinations of these methods are investigated. Estimation is made for different configurations of 4K x 128 RAM memory block for 28 nm manufacturing process. Evaluation of the effectiveness of the proposed combinations is also reported. The results of these investigations can be useful for designing fault-tolerant “system on chips”.

Development and evaluation of a fault-tolerant multiprocessor (FTMP) computer. Volume 1: FTMP principles of operation

NASA Technical Reports Server (NTRS)

Smith, T. B., Jr.; Lala, J. H.

1983-01-01

The basic organization of the fault tolerant multiprocessor, (FTMP) is that of a general purpose homogeneous multiprocessor. Three processors operate on a shared system (memory and I/O) bus. Replication and tight synchronization of all elements and hardware voting is employed to detect and correct any single fault. Reconfiguration is then employed to repair a fault. Multiple faults may be tolerated as a sequence of single faults with repair between fault occurrences.

A robust data fusion scheme for integrated navigation systems employing fault detection methodology augmented with fuzzy adaptive filtering

NASA Astrophysics Data System (ADS)

Ushaq, Muhammad; Fang, Jiancheng

2013-10-01

Integrated navigation systems for various applications, generally employs the centralized Kalman filter (CKF) wherein all measured sensor data are communicated to a single central Kalman filter. The advantage of CKF is that there is a minimal loss of information and high precision under benign conditions. But CKF may suffer computational overloading, and poor fault tolerance. The alternative is the federated Kalman filter (FKF) wherein the local estimates can deliver optimal or suboptimal state estimate as per certain information fusion criterion. FKF has enhanced throughput and multiple level fault detection capability. The Standard CKF or FKF require that the system noise and the measurement noise are zero-mean and Gaussian. Moreover it is assumed that covariance of system and measurement noises remain constant. But if the theoretical and actual statistical features employed in Kalman filter are not compatible, the Kalman filter does not render satisfactory solutions and divergence problems also occur. To resolve such problems, in this paper, an adaptive Kalman filter scheme strengthened with fuzzy inference system (FIS) is employed to adapt the statistical features of contributing sensors, online, in the light of real system dynamics and varying measurement noises. The excessive faults are detected and isolated by employing Chi Square test method. As a case study, the presented scheme has been implemented on Strapdown Inertial Navigation System (SINS) integrated with the Celestial Navigation System (CNS), GPS and Doppler radar using FKF. Collectively the overall system can be termed as SINS/CNS/GPS/Doppler integrated navigation system. The simulation results have validated the effectiveness of the presented scheme with significantly enhanced precision, reliability and fault tolerance. Effectiveness of the scheme has been tested against simulated abnormal errors/noises during different time segments of flight. It is believed that the presented scheme can be applied to the navigation system of aircraft or unmanned aerial vehicle (UAV).

Metabolic syndrome does not detect metabolic risk in African men living in the U.S.

PubMed

Ukegbu, Ugochi J; Castillo, Darleen C; Knight, Michael G; Ricks, Madia; Miller, Bernard V; Onumah, Barbara M; Sumner, Anne E

2011-10-01

Metabolic risk and metabolic syndrome (MetSyn) prevalence were compared in Africans who immigrated to the U.S. and African Americans. If MetSyn were an effective predictor of cardiometabolic risk, then the group with a worse metabolic risk profile would have a higher rate of MetSyn. Cross-sectional analyses were performed on 95 men (39 Africans, 56 African Americans, age 38 ± 6 years [mean ± SD]). Glucose tolerance was determined by oral glucose tolerance test, visceral adipose tissue (VAT) was determined by computerized tomography, and MetSyn was determined by the presence of three of five factors: central obesity, hypertriglyceridemia, low levels of HDL cholesterol, hypertension, and fasting hyperglycemia. MetSyn prevalence was similar in Africans and African Americans (10 vs. 13%, P = 0.74), but hypertension, glycemia (fasting and 2-h glucose), and VAT were higher in Africans. African immigrants have a worse metabolic profile than African Americans but a similar prevalence of MetSyn. Therefore, MetSyn may underpredict metabolic risk in Africans.

SGD1, a key enzyme in tocopherol biosynthesis, is essential for plant development and cold tolerance in rice.

PubMed

Wang, Di; Wang, Yunlong; Long, Wuhua; Niu, Mei; Zhao, Zhigang; Teng, Xuan; Zhu, Xiaopin; Zhu, Jianping; Hao, Yuanyuan; Wang, Yongfei; Liu, Yi; Jiang, Ling; Wang, Yihua; Wan, Jianmin

2017-07-01

Tocopherols, a group of Vitamin E compounds, are essential components of the human diet. In contrast to well documented roles in animals, the functions of tocopherols in plants are less understood. In this study, we characterized two allelic rice dwarf mutant lines designated sgd1-1 and sgd1-2 (small grain and dwarf1). Histological observations showed that the dwarf phenotypes were mainly due to cell elongation defects. A map-based cloning strategy and subsequent complementation test showed that SGD1 encodes homogentisate phytyltransferase (HPT), a key enzyme in tocopherol biosynthesis. Mutation of SGD1 resulted in tocopherol deficiency in both sgd1mutants. No oxidant damage was detected in the sgd1 mutants. Further analysis showed that sgd1-2 was hypersensitive to cold stress. Our results indicate that SGD1 is essential for plant development and cold tolerance in rice. Copyright © 2017 Elsevier B.V. All rights reserved.

Glucose metabolism in obese and lean adolescents with polycystic ovary syndrome.

PubMed

Poomthavorn, Preamrudee; Chaya, Weerapong; Mahachoklertwattana, Pat; Sukprasert, Matchuporn; Weerakiet, Sawaek

2013-01-01

Data on glucose metabolism in Asian adolescents with polycystic ovary syndrome (PCOS) are limited. Glucose metabolism assessment using an oral glucose tolerance test (OGTT) in obese and lean Thai adolescents with PCOS, and a comparison between the two groups were done. Thirty-one patients (19 obese, 12 lean) were enrolled. Their median (range) age was 14.9 (11.0-21.0) years. Eighteen patients had abnormal glucose metabolism (13 hyperinsulinemia, 4 impaired glucose tolerance, and 1 diabetes). Compared between obese [median (range) BMI Z-score, 1.6 (1.2-2.6)] and lean [median (range) BMI Z-score, 0.1 (-1.4 to 0.6)] patients, the frequencies of each abnormal OGTT category, areas under the curves of glucose and insulin levels, and insulinogenic index were not different; however, insulin resistance was greater in the obese group. In conclusion, a high proportion of our adolescents with PCOS had abnormal glucose metabolism. Therefore, OGTT should be performed in adolescents with PCOS for the early detection of abnormal glucose metabolism.

Amoxicillin rash in patients with infectious mononucleosis: evidence of true drug sensitization.

PubMed

Ónodi-Nagy, Katinka; Kinyó, Ágnes; Meszes, Angéla; Garaczi, Edina; Kemény, Lajos; Bata-Csörgő, Zsuzsanna

2015-01-01

It hasn't been clearly understood yet whether sensitization to antibiotics, the virus itself or transient loss of drug tolerance due to the virus, is responsible for the development of maculopapular exanthems following amoxicillin intake in patients with infectious mononucleosis. We aimed to examine whether sensitization to penicillin developed among patients with skin rash following amoxicillin treatment within infectious mononucleosis. Ten patients were investigated for drug sensitization by lymphocyte transformation test and six patients were further tested by prick-, intradermal and patch tests employing the penicillin's main antigens. Lymphocyte transformation test showed negative results with amoxicillin, while one patient had positive reaction to cefixime. Six patients with suspected sensitization to amoxicillin were then investigated by in vivo tests. Prick tests were negative in all six patients, but the intradermal tests showed positive reactions in four patients. Our data demonstrate that in vitro testing is not sensitive enough in determining drug sensitization to penicillin. In vivo tests should be performed to detect sensitization and indeed with skin tests our results confirmed that sensitization to aminopenicillin may develop within infectious mononucleosis.

The ColRS signal transduction system responds to the excess of external zinc, iron, manganese, and cadmium

PubMed Central

2014-01-01

Background The ColRS two-component system has been shown to contribute to the membrane functionality and stress tolerance of Pseudomonas putida as well as to the virulence of Pseudomonas aeruginosa and plant pathogenic Xanthomonas species. However, the conditions activating the ColRS pathway and the signal(s) sensed by ColS have remained unknown. Here we aimed to analyze the role of the ColRS system in metal tolerance of P. putida and to test whether ColS can respond to metal excess. Results We show that the ColRS system is necessary for P. putida to tolerate the excess of iron and zinc, and that it also contributes to manganese and cadmium tolerance. Excess of iron, zinc, manganese or cadmium activates ColRS signaling and as a result modifies the expression of ColR-regulated genes. Our data suggest that the genes in the ColR regulon are functionally redundant, as several loci have to be deleted to observe a significant decrease in metal tolerance. Site-directed mutagenesis of ColS revealed that excess of iron and, surprisingly, also zinc are sensed by a conserved ExxE motif in ColS’s periplasmic domain. While ColS is able to sense different metals, it still discriminates between the two oxidation states of iron, specifically responding to ferric and not ferrous iron. We propose a signal perception model involving a dimeric ColS, where each monomer donates one ExxE motif for metal binding. Conclusions Several transition metals are essential for living organisms in certain amounts, but toxic in excess. We show that ColRS is a sensor system which detects and responds to the excess of physiologically important metals such as zinc, iron and manganese. Thus, the ColRS system is an important factor for metal homeostasis and tolerance in P. putida. PMID:24946800

SU-E-T-484: In Vivo Dosimetry Tolerances in External Beam Fast Neutron Therapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Young, L; Gopan, O

Purpose: Optical stimulated luminescence (OSL) dosimetry with Landauer Al2O3:C nanodots was developed at our institution as a passive in vivo dosimetry (IVD) system for patients treated with fast neutron therapy. The purpose of this study was to establish clinically relevant tolerance limits for detecting treatment errors requiring further investigation. Methods: Tolerance levels were estimated by conducting a series of IVD expected dose calculations for square field sizes ranging between 2.8 and 28.8 cm. For each field size evaluated, doses were calculated for open and internal wedged fields with angles of 30°, 45°, or 60°. Theoretical errors were computed for variationsmore » of incorrect beam configurations. Dose errors, defined as the percent difference from the expected dose calculation, were measured with groups of three nanodots placed in a 30 x 30 cm solid water phantom, at beam isocenter (150 cm SAD, 1.7 cm Dmax). The tolerances were applied to IVD patient measurements. Results: The overall accuracy of the nanodot measurements is 2–3% for open fields. Measurement errors agreed with calculated errors to within 3%. Theoretical estimates of dosimetric errors showed that IVD measurements with OSL nanodots will detect the absence of an internal wedge or a wrong wedge angle. Incorrect nanodot placement on a wedged field is more likely to be caught if the offset is in the direction of the “toe” of the wedge where the dose difference in percentage is about 12%. Errors caused by an incorrect flattening filter size produced a 2% measurement error that is not detectable by IVD measurement alone. Conclusion: IVD with nanodots will detect treatment errors associated with the incorrect implementation of the internal wedge. The results of this study will streamline the physicists’ investigations in determining the root cause of an IVD reading that is out of normally accepted tolerances.« less

Development and inter-laboratory assessment of droplet digital PCR assays for multiplex quantification of 15 genetically modified soybean lines.

PubMed

Košir, Alexandra Bogožalec; Spilsberg, Bjørn; Holst-Jensen, Arne; Žel, Jana; Dobnik, David

2017-08-17

Quantification of genetically modified organisms (GMOs) in food and feed products is often required for their labelling or for tolerance thresholds. Standard-curve-based simplex quantitative polymerase chain reaction (qPCR) is the prevailing technology, which is often combined with screening analysis. With the rapidly growing number of GMOs on the world market, qPCR analysis becomes laborious and expensive. Innovative cost-effective approaches are therefore urgently needed. Here, we report the development and inter-laboratory assessment of multiplex assays to quantify GMO soybean using droplet digital PCR (ddPCR). The assays were developed to facilitate testing of foods and feed for compliance with current GMO regulations in the European Union (EU). Within the EU, the threshold for labelling is 0.9% for authorised GMOs per ingredient. Furthermore, the EU has set a technical zero tolerance limit of 0.1% for certain unauthorised GMOs. The novel multiplex ddPCR assays developed target 11 GMO soybean lines that are currently authorised, and four that are tolerated, pending authorisation in the EU. Potential significant improvements in cost efficiency are demonstrated. Performance was assessed for the critical parameters, including limits of detection and quantification, and trueness, repeatability, and robustness. Inter-laboratory performance was also determined on a number of proficiency programme and real-life samples.

Radiation tolerance of neutron-irradiated model Fe-Cr-Al alloys

DOE PAGES

Field, Kevin G.; Hu, Xunxiang; Littrell, Kenneth C.; ...

2015-07-14

The Fe Cr Al alloy system has the potential to form an important class of enhanced accident-tolerant cladding materials in the nuclear power industry owing to the alloy system's higher oxidation resistance in high-temperature steam environments compared with traditional zirconium-based alloys. However, radiation tolerance of Fe Cr Al alloys has not been fully established. In this study, a series of Fe Cr Al alloys with 10 18 wt % Cr and 2.9 4.9 wt % Al were neutron irradiated at 382 C to 1.8 dpa to investigate the irradiation-induced microstructural and mechanical property evolution as a function of alloy composition.more » Dislocation loops with Burgers vector of a/2 111 and a 100 were detected and quantified. Results indicate precipitation of Cr-rich is primarily dependent on the bulk chromium composition. Mechanical testing of sub-size-irradiated tensile specimens indicates the hardening response seen after irradiation is dependent on the bulk chromium composition. Furthermore, a structure property relationship was developed; it indicated that the change in yield strength after irradiation is caused by the formation of these radiation-induced defects and is dominated by the large number density of Cr-rich α' precipitates at sufficiently high chromium contents after irradiation.« less

Relationship between fish size and upper thermal tolerance

USGS Publications Warehouse

Recsetar, Matthew S.; Zeigler, Matthew P.; Ward, David L.; Bonar, Scott A.; Caldwell, Colleen A.

2012-01-01

Using critical thermal maximum (CTMax) tests, we examined the relationship between upper temperature tolerances and fish size (fry-adult or subadult lengths) of rainbow trout Oncorhynchus mykiss (41-200-mm TL), Apache trout O. gilae apache (40-220-mm TL), largemouth bass Micropterus salmoides (72-266-mm TL), Nile tilapia Oreochromis niloticus (35-206-mm TL), channel catfish Ictalurus punctatus (62-264 mm-TL), and Rio Grande cutthroat trout O. clarkii virginalis (36-181-mm TL). Rainbow trout and Apache trout were acclimated at 18°C, Rio Grande cutthroat trout were acclimated at 14°C, and Nile tilapia, largemouth bass, and channel catfish were acclimated at 25°C, all for 14 d. Critical thermal maximum temperatures were estimated and data were analyzed using simple linear regression. There was no significant relationship (P > 0.05) between thermal tolerance and length for Nile tilapia (P = 0.33), channel catfish (P = 0.55), rainbow trout (P = 0.76), or largemouth bass (P = 0.93) for the length ranges we tested. There was a significant negative relationship between thermal tolerance and length for Rio Grande cutthroat trout (R2 = 0.412, P 2 = 0.1374, P = 0.028); however, the difference was less than 1°C across all lengths of Apache trout tested and about 1.3°C across all lengths of Rio Grande cutthroat trout tested. Because there was either no or at most a slight relationship between upper thermal tolerance and size, management and research decisions based on upper thermal tolerance should be similar for the range of sizes within each species we tested. However, the different sizes we tested only encompassed life stages ranging from fry to adult/subadult, so thermal tolerance of eggs, alevins, and larger adults should also be considered before making management decisions affecting an entire species.

A whole-plant screening test to identify genotypes with superior freezing tolerance.

PubMed

Bertrand, Annick; Castonguay, Yves; Bourassa, Josée

2014-01-01

Freezing tolerance is a determinant factor of persistence of perennials grown in northern climate. Selection for winterhardiness in field nurseries is difficult because of the unpredictability of occurrence of test winters allowing the identification of hardy genotypes. Here we describe a whole-plant assay entirely performed indoor in growth chambers and walk-in freezers to identify genotypes with superior tolerance to freezing within populations of open pollinated species. Three successive freezing stresses are applied to progressively eliminate 90 % of the population and to retain only the 10 % best performing genotypes. This approach can be used to generate recurrently selected populations more tolerant to freezing in different species.

Reduced bleeding events with subcutaneous administration of recombinant human factor IX in immune-tolerant hemophilia B dogs.

PubMed

Russell, Karen E; Olsen, Eva H N; Raymer, Robin A; Merricks, Elizabeth P; Bellinger, Dwight A; Read, Marjorie S; Rup, Bonita J; Keith, James C; McCarthy, Kyle P; Schaub, Robert G; Nichols, Timothy C

2003-12-15

Intravenous administration of recombinant human factor IX (rhFIX) acutely corrects the coagulopathy in hemophilia B dogs. To date, 20 of 20 dogs developed inhibitory antibodies to the xenoprotein, making it impossible to determine if new human FIX products, formulations, or methods of chronic administration can reduce bleeding frequency. Our goal was to determine whether hemophilia B dogs rendered tolerant to rhFIX would have reduced bleeding episodes while on sustained prophylactic rhFIX administered subcutaneously. Reproducible methods were developed for inducing tolerance to rhFIX in this strain of hemophilia B dogs, resulting in a significant reduction in the development of inhibitors relative to historical controls (5 of 12 versus 20 or 20, P <.001). The 7 of 12 tolerized hemophilia B dogs exhibited shortened whole blood clotting times (WBCTs), sustained detectable FIX antigen, undetectable Bethesda inhibitors, transient or no detectable antihuman FIX antibody titers by enzyme-linked immunosorbent assay (ELISA), and normal clearance of infused rhFIX. Tolerized hemophilia B dogs had 69% reduction in bleeding frequency in year 1 compared with nontolerized hemophilia B dogs (P =.0007). If proven safe in human clinical trials, subcutaneous rhFIX may provide an alternate approach to prophylactic therapy in selected patients with hemophilia B.

Evaluation of the leucine incorporation technique for detection of pollution-induced community tolerance to copper in a long-term agricultural field trial with urban waste fertilizers.

PubMed

Lekfeldt, Jonas Duus Stevens; Magid, Jakob; Holm, Peter E; Nybroe, Ole; Brandt, Kristian Koefoed

2014-11-01

Copper (Cu) is known to accumulate in agricultural soils receiving urban waste products as fertilizers. We here report the use of the leucine incorporation technique to determine pollution-induced community tolerance (Leu-PICT) to Cu in a long-term agricultural field trial. A significantly increased bacterial community tolerance to Cu was observed for soils amended with organic waste fertilizers and was positively correlated with total soil Cu. However, metal speciation and whole-cell bacterial biosensor analysis demonstrated that the observed PICT responses could be explained entirely by Cu speciation and bioavailability artifacts during Leu-PICT detection. Hence, the agricultural application of urban wastes (sewage sludge or composted municipal waste) simulating more than 100 years of use did not result in sufficient accumulation of Cu to select for Cu resistance. Our findings also have implications for previously published PICT field studies and demonstrate that stringent PICT detection criteria are needed for field identification of specific toxicants. Copyright © 2014 Elsevier Ltd. All rights reserved.

Damage Tolerance of Composites

NASA Technical Reports Server (NTRS)

Hodge, Andy

2007-01-01

Fracture control requirements have been developed to address damage tolerance of composites for manned space flight hardware. The requirements provide the framework for critical and noncritical hardware assessment and testing. The need for damage threat assessments, impact damage protection plans, and nondestructive evaluation are also addressed. Hardware intended to be damage tolerant have extensive coupon, sub-element, and full-scale testing requirements in-line with the Building Block Approach concept from the MIL-HDBK-17, Department of Defense Composite Materials Handbook.

Effects of urbanization on benthic macroinvertebrate assemblages in contrasting environmental settings: Boston, Massachusetts; Birmingham, Alabama; and Salt Lake City, Utah

USGS Publications Warehouse

Cuffney, T.F.; Zappia, H.; Giddings, E.M.P.; Coles, J.F.

2005-01-01

Responses of invertebrate assemblages along gradients of urban intensity were examined in three metropolitan areas with contrasting climates and topography (Boston, Massachusetts; Birmingham, Alabama; Salt Lake City, Utah). Urban gradients were defined using an urban intensity index (UII) derived from basin-scale population, infrastructure, land-use, land-cover, and socioeconomic characteristics. Responses based on assemblage metrics, indices of biotic integrity (B-IBI), and ordinations were readily detected in all three urban areas and many responses could be accurately predicted simply using regional UIIs. Responses to UII were linear and did not indicate any initial resistance to urbanization. Richness metrics were better indicators of urbanization than were density metrics. Metrics that were good indicators were specific to each study except for a richness-based tolerance metric (TOLr) and one B-IBI. Tolerances to urbanization were derived for 205 taxa. These tolerances differed among studies and with published tolerance values, but provided similar characterizations of site conditions. Basin-scale land-use changes were the most important variables for explaining invertebrate responses to urbanization. Some chemical and instream physical habitat variables were important in individual studies, but not among studies. Optimizing the study design to detect basin-scale effects may have reduced the ability to detect local-scale effects. ?? 2005 by the American Fisheries Society.

Fault-tolerant quantum error detection

PubMed Central

Linke, Norbert M.; Gutierrez, Mauricio; Landsman, Kevin A.; Figgatt, Caroline; Debnath, Shantanu; Brown, Kenneth R.; Monroe, Christopher

2017-01-01

Quantum computers will eventually reach a size at which quantum error correction becomes imperative. Quantum information can be protected from qubit imperfections and flawed control operations by encoding a single logical qubit in multiple physical qubits. This redundancy allows the extraction of error syndromes and the subsequent detection or correction of errors without destroying the logical state itself through direct measurement. We show the encoding and syndrome measurement of a fault-tolerantly prepared logical qubit via an error detection protocol on four physical qubits, represented by trapped atomic ions. This demonstrates the robustness of a logical qubit to imperfections in the very operations used to encode it. The advantage persists in the face of large added error rates and experimental calibration errors. PMID:29062889

The Design of a Fault-Tolerant COTS-Based Bus Architecture for Space Applications

NASA Technical Reports Server (NTRS)

Chau, Savio N.; Alkalai, Leon; Tai, Ann T.

2000-01-01

The high-performance, scalability and miniaturization requirements together with the power, mass and cost constraints mandate the use of commercial-off-the-shelf (COTS) components and standards in the X2000 avionics system architecture for deep-space missions. In this paper, we report our experiences and findings on the design of an IEEE 1394 compliant fault-tolerant COTS-based bus architecture. While the COTS standard IEEE 1394 adequately supports power management, high performance and scalability, its topological criteria impose restrictions on fault tolerance realization. To circumvent the difficulties, we derive a "stack-tree" topology that not only complies with the IEEE 1394 standard but also facilitates fault tolerance realization in a spaceborne system with limited dedicated resource redundancies. Moreover, by exploiting pertinent standard features of the 1394 interface which are not purposely designed for fault tolerance, we devise a comprehensive set of fault detection mechanisms to support the fault-tolerant bus architecture.

SU-F-J-25: Position Monitoring for Intracranial SRS Using BrainLAB ExacTrac Snap Verification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jang, S; McCaw, T; Huq, M

2016-06-15

Purpose: To determine the accuracy of position monitoring with BrainLAB ExacTrac snap verification following couch rotations during intracranial SRS. Methods: A CT scan of an anthropomorphic head phantom was acquired using 1.25mm slices. The isocenter was positioned near the centroid of the frontal lobe. The head phantom was initially aligned on the treatment couch using cone-beam CT, then repositioned using ExacTrac x-ray verification with residual errors less than 0.2mm and 0.2°. Snap verification was performed over the full range of couch angles in 15° increments with known positioning offsets of 0–3mm applied to the phantom along each axis. At eachmore » couch angle, the smallest tolerance was determined for which no positioning deviation was detected. Results: For couch angles 30°–60° from the center position, where the longitudinal axis of the phantom is approximately aligned with the beam axis of one x-ray tube, snap verification consistently detected positioning errors exceeding the maximum 8mm tolerance. Defining localization error as the difference between the known offset and the minimum tolerance for which no deviation was detected, the RMS error is mostly less than 1mm outside of couch angles 30°–60° from the central couch position. Given separate measurements of patient position from the two imagers, whether to proceed with treatment can be determined by the criterion of a reading within tolerance from just one (OR criterion) or both (AND criterion) imagers. Using a positioning tolerance of 1.5mm, snap verification has sensitivity and specificity of 94% and 75%, respectively, with the AND criterion, and 67% and 93%, respectively, with the OR criterion. If readings exceeding maximum tolerance are excluded, the sensitivity and specificity are 88% and 86%, respectively, with the AND criterion. Conclusion: With a positioning tolerance of 1.5mm, ExacTrac snap verification can be used during intracranial SRS with sensitivity and specificity between 85% and 90%.« less

Genetic dissection of acetic acid tolerance in Saccharomyces cerevisiae.

PubMed

Geng, Peng; Xiao, Yin; Hu, Yun; Sun, Haiye; Xue, Wei; Zhang, Liang; Shi, Gui-Yang

2016-09-01

Dissection of the hereditary architecture underlying Saccharomyces cerevisiae tolerance to acetic acid is essential for ethanol fermentation. In this work, a genomics approach was used to dissect hereditary variations in acetic acid tolerance between two phenotypically different strains. A total of 160 segregants derived from these two strains were obtained. Phenotypic analysis indicated that the acetic acid tolerance displayed a normal distribution in these segregants, and suggested that the acetic acid tolerant traits were controlled by multiple quantitative trait loci (QTLs). Thus, 220 SSR markers covering the whole genome were used to detect QTLs of acetic acid tolerant traits. As a result, three QTLs were located on chromosomes 9, 12, and 16, respectively, which explained 38.8-65.9 % of the range of phenotypic variation. Furthermore, twelve genes of the candidates fell into the three QTL regions by integrating the QTL analysis with candidates of acetic acid tolerant genes. These results provided a novel avenue to obtain more robust strains.

Response of rice to Al stress and identification of quantitative trait Loci for Al tolerance.

PubMed

Ma, Jian Feng; Shen, Renfang; Zhao, Zhuqing; Wissuwa, Matthias; Takeuchi, Yoshinobu; Ebitani, Takeshi; Yano, Masahiro

2002-06-01

Rice (Oryza sativa L.) shows the highest tolerance to Al toxicity among small-grain cereal crops, however, the mechanisms and genetics responsible for its high Al tolerance are not yet well understood. We investigated the response of rice to Al stress using the japonica variety Koshihikari in comparison to the indica variety Kasalath. Koshihikari showed higher tolerance at various Al concentrations than Kasalath. The Al content in root apexes was less in Koshihikari than in Kasalath, suggesting that exclusion mechanisms rather than internal detoxification are acting in Koshihikari. Al-induced secretion of citrate was observed in both Koshihikari and Kasalath, however, it is unlikely to be the mechanism for Al tolerance because there was no significant difference in the amount of citrate secreted between Koshihikari and Kasalath. Quantitative trait loci (QTLs) for Al tolerance were mapped in a population of 183 backcross inbred lines (BILs) derived from a cross of Koshihikari and Kasalath. Three putative QTLs controlling Al tolerance were detected on chromosomes 1, 2 and 6. Kasalath QTL alleles on chromosome 1 and 2 reduced Al tolerance but increased tolerance on chromosome 6. The three QTLs explained about 27% of the phenotypic variation in Al tolerance. The existence of QTLs for Al tolerance was confirmed in substitution lines for corresponding chromosomal segments.

The Xenon Test Chamber Q-SUN® for testing realistic tolerances of fungi exposed to simulated full spectrum solar radiation.

PubMed

Dias, Luciana P; Araújo, Claudinéia A S; Pupin, Breno; Ferreira, Paulo C; Braga, Gilberto Ú L; Rangel, Drauzio E N

2018-06-01

The low survival of insect-pathogenic fungi when used for insect control in agriculture is mainly due to the deleterious effects of ultraviolet radiation and heat from solar irradiation. In this study, conidia of 15 species of entomopathogenic fungi were exposed to simulated full-spectrum solar radiation emitted by a Xenon Test Chamber Q-SUN XE-3-HC 340S (Q-LAB ® Corporation, Westlake, OH, USA), which very closely simulates full-spectrum solar radiation. A dendrogram obtained from cluster analyses, based on lethal time 50 % and 90 % calculated by Probit analyses, separated the fungi into three clusters: cluster 3 contains species with highest tolerance to simulated full-spectrum solar radiation, included Metarhizium acridum, Cladosporium herbarum, and Trichothecium roseum with LT 50  > 200 min irradiation. Cluster 2 contains eight species with moderate UV tolerance: Aschersonia aleyrodis, Isaria fumosorosea, Mariannaea pruinosa, Metarhizium anisopliae, Metarhizium brunneum, Metarhizium robertsii, Simplicillium lanosoniveum, and Torrubiella homopterorum with LT 50 between 120 and 150 min irradiation. The four species in cluster 1 had the lowest UV tolerance: Lecanicillium aphanocladii, Beauveria bassiana, Tolypocladium cylindrosporum, and Tolypocladium inflatum with LT 50  < 120 min irradiation. The QSUN Xenon Test Chamber XE3 is often used by the pharmaceutical and automotive industry to test light stability and weathering, respectively, but it was never used to evaluate fungal tolerance to full-spectrum solar radiation before. We conclude that the equipment provided an excellent tool for testing realistic tolerances of fungi to full-spectrum solar radiation of microbial agents for insect biological control in agriculture. Copyright © 2018 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Utility of antenatal clinical factors for prediction of postpartum outcomes in women with gestational diabetes mellitus (GDM).

PubMed

Ingram, Emily R; Robertson, Iain K; Ogden, Kathryn J; Dennis, Amanda E; Campbell, Joanne E; Corbould, Anne M

2017-06-01

Gestational diabetes mellitus (GDM) is associated with life-long increased risk of type 2 diabetes: affected women are advised to undergo oral glucose tolerance testing (OGTT) at 6-12 weeks postpartum, then glucose screening every 1-3 years. We investigated whether in women with GDM, antenatal clinical factors predicted postpartum abnormal glucose tolerance and compliance with screening. In women with GDM delivering 2007 to mid-2009 in a single hospital, antenatal/obstetric data and glucose tests at 6-12 weeks postpartum and during 5.5 years post-pregnancy were retrospectively collected. Predictors of return for testing and abnormal glucose tolerance were identified using multivariate analysis. Of 165 women, 117 (70.9%) returned for 6-12 week postpartum OGTT: 23 (19.6%) were abnormal. Smoking and parity, independent of socioeconomic status, were associated with non-return for testing. Fasting glucose ≥5.4 mmol/L on pregnancy OGTT predicted both non-return for testing and abnormal OGTT. During 5.5 years post-pregnancy, 148 (89.7%) women accessed glucose screening: nine (6.1%) developed diabetes, 33 (22.3%) had impaired fasting glucose / impaired glucose tolerance. Predictors of abnormal glucose tolerance were fasting glucose ≥5.4 mmol/L and 2-h glucose ≥9.3 mmol/L on pregnancy OGTT (~2.5-fold increased risk), and polycystic ovary syndrome (~3.4 fold increased risk). Risk score calculation, based on combined antenatal factors, did not improve predictions. Antenatal clinical factors were modestly predictive of return for testing and abnormal glucose tolerance post-pregnancy in women with GDM. Risk score calculations were ineffective in predicting outcomes: risk scores developed in other populations require validation. Ongoing glucose screening is indicated for all women with GDM. © 2016 The Royal Australian and New Zealand College of Obstetricians and Gynaecologists.

Materials and processes laboratory composite materials characterization task, part 1. Damage tolerance

NASA Technical Reports Server (NTRS)

Nettles, A. T.; Tucker, D. S.; Patterson, W. J.; Franklin, S. W.; Gordon, G. H.; Hart, L.; Hodge, A. J.; Lance, D. G.; Russel, S. S.

1991-01-01

A test run was performed on IM6/3501-6 carbon-epoxy in which the material was processed, machined into specimens, and tested for damage tolerance capabilities. Nondestructive test data played a major role in this element of composite characterization. A time chart was produced showing the time the composite material spent within each Branch or Division in order to identify those areas which produce a long turnaround time. Instrumented drop weight testing was performed on the specimens with nondestructive evaluation being performed before and after the impacts. Destructive testing in the form of cross-sectional photomicrography and compression-after-impact testing were used. Results show that the processing and machining steps needed to be performed more rapidly if data on composite material is to be collected within a reasonable timeframe. The results of the damage tolerance testing showed that IM6/3501-6 is a brittle material that is very susceptible to impact damage.

Identification of drought-responsive genes in roots of upland rice (Oryza sativa L)

PubMed Central

Rabello, Aline R; Guimarães, Cléber M; Rangel, Paulo HN; da Silva, Felipe R; Seixas, Daniela; de Souza, Emanuel; Brasileiro, Ana CM; Spehar, Carlos R; Ferreira, Márcio E; Mehta, Ângela

2008-01-01

Background Rice (Oryza sativa L.) germplasm represents an extraordinary source of genes that control traits of agronomic importance such as drought tolerance. This diversity is the basis for the development of new cultivars better adapted to water restriction conditions, in particular for upland rice, which is grown under rainfall. The analyses of subtractive cDNA libraries and differential protein expression of drought tolerant and susceptible genotypes can contribute to the understanding of the genetic control of water use efficiency in rice. Results Two subtractive libraries were constructed using cDNA of drought susceptible and tolerant genotypes submitted to stress against cDNA of well-watered plants. In silico analysis revealed 463 reads, which were grouped into 282 clusters. Several genes expressed exclusively in the tolerant or susceptible genotypes were identified. Additionally, proteome analysis of roots from stressed plants was performed and 22 proteins putatively associated to drought tolerance were identified by mass spectrometry. Conclusion Several genes and proteins involved in drought-response, as well as genes with no described homologs were identified. Genes exclusively expressed in the tolerant genotype were, in general, related to maintenance of turgor and cell integrity. In contrast, in the susceptible genotype, expression of genes involved in protection against cell damage was not detected. Several protein families identified in the proteomic analysis were not detected in the cDNA analysis. There is an indication that the mechanisms of susceptibility to drought in upland rice are similar to those of lowland varieties. PMID:18922162

Immune tolerance properties of the testicular tissue as a viral sanctuary site in ART-treated HIV-infected adults.

PubMed

Jenabian, Mohammad-Ali; Costiniuk, Cecilia T; Mehraj, Vikram; Ghazawi, Feras M; Fromentin, Rémi; Brousseau, Joëlle; Brassard, Pierre; Bélanger, Maud; Ancuta, Petronela; Bendayan, Reina; Chomont, Nicolas; Routy, Jean-Pierre

2016-11-28

HIV persistence in long-lived infected cells and in anatomical sanctuary sites are major hurdles to HIV eradication. Testicular tissue may represent a significant viral sanctuary site as it constitutes an immunologically privileged compartment. We assessed immunotolerance properties of the testicular tissue in individuals receiving suppressive antiretroviral therapy (ART). Testicular tissue and matched blood samples were collected from six virally suppressed adults and 10 HIV-uninfected controls prior to sex reassignment surgery. T cells were purified from freshly isolated testicular interstitial cell suspensions. T-cell subsets, expression of immune activation markers and HIV DNA were assessed in matched testicular cells and peripheral blood mononuclear cells (PBMCs). When compared with PBMCs, testes were characterized by a lower CD4 T-cell proportion among total T cells, a decrease in the frequency of naive cells, an increase in the frequency of effector-memory T cells and an increase in CCR5 expression in both the HIV+ and HIV- groups. In HIV-infected individuals on ART, testes displayed higher T-cell immune activation (Coexpression of CD38 and Human Leukocyte Antigen - antigen D Related) than PBMCs. In both groups, testes were characterized by higher frequencies of immunosuppressive CD39 regulatory T cells and a massive increase in CD73 expression on CD8 T cells. In addition, a remarkable increase in indoleamine-pyrrole 2,3-dioxygenase immunosuppressive enzyme involved in tryptophan/kynurenine catabolism was observed in testes versus blood. Rare cells harboring HIV DNA were detected in testes from five out six participants. These findings suggest that the adenosine and tryptophan/kynurenine immune-metabolic pathways contribute to immune tolerance in testicular tissue. Our results suggest that testes may represent a distinctive HIV sanctuary site during ART.

Prevalidation of a model for predicting acute neutropenia by colony forming unit granulocyte/macrophage (CFU-GM) assay.

PubMed

Pessina, A; Albella, B; Bueren, J; Brantom, P; Casati, S; Gribaldo, L; Croera, C; Gagliardi, G; Foti, P; Parchment, R; Parent-Massin, D; Sibiril, Y; Van Den Heuvel, R

2001-12-01

This report describes an international prevalidation study conducted to optimise the Standard Operating Procedure (SOP) for detecting myelosuppressive agents by CFU-GM assay and to study a model for predicting (by means of this in vitro hematopoietic assay) the acute xenobiotic exposure levels that cause maximum tolerated decreases in absolute neutrophil counts (ANC). In the first phase of the study (Protocol Refinement), two SOPs were assessed, by using two cell culture media (Test A, containing GM-CSF; and Test B, containing G-CSF, GM-CSF, IL-3, IL-6 and SCF), and the two tests were applied to cells from both human (bone marrow and umbilical cord blood) and mouse (bone marrow) CFU-GM. In the second phase (Protocol Transfer), the SOPs were transferred to four laboratories to verify the linearity of the assay response and its interlaboratory reproducibility. After a further phase (Protocol Performance), dedicated to a training set of six anticancer drugs (adriamycin, flavopindol, morpholino-doxorubicin, pyrazoloacridine, taxol and topotecan), a model for predicting neutropenia was verified. Results showed that the assay is linear under SOP conditions, and that the in vitro endpoints used by the clinical prediction model of neutropenia are highly reproducible within and between laboratories. Valid tests represented 95% of all tests attempted. The 90% inhibitory concentration values (IC(90)) from Test A and Test B accurately predicted the human maximum tolerated dose (MTD) for five of six and for four of six myelosuppressive anticancer drugs, respectively, that were selected as prototype xenobiotics. As expected, both tests failed to accurately predict the human MTD of a drug that is a likely protoxicant. It is concluded that Test A offers significant cost advantages compared to Test B, without any loss of performance or predictive accuracy. On the basis of these results, we proposed a formal Phase II validation study using the Test A SOP for 16-18 additional xenobiotics that represent the spectrum of haematotoxic potential.

Regulatory Focus Affects Physician Risk Tolerance

PubMed Central

Veazie, Peter J.; McIntosh, Scott; Chapman, Benjamin P.; Dolan, James G.

2014-01-01

Risk tolerance is a source of variation in physician decision-making. This variation, if independent of clinical concerns, can result in mistaken utilization of health services. To address such problems, it will be helpful to identify nonclinical factors of risk tolerance, particularly those amendable to intervention – regulatory focus theory suggests such a factor. This study tested whether regulatory focus affects risk tolerance among primary care physicians. Twenty-seven primary care physicians were assigned to promotion-focused or prevention-focused manipulations and compared on the Risk Taking Attitudes in Medical Decision Making scale using a randomization test. Results provide evidence that physicians assigned to the promotion-focus manipulation adopted an attitude of greater risk tolerance than the physicians assigned to the prevention-focused manipulation (P=0.01). The Cohen’s d statistic was conventionally large at 0.92. Results imply that situational regulatory focus in primary care physicians affects risk tolerance and may thereby be a nonclinical source of practice variation. Results also provide marginal evidence that chronic regulatory focus is associated with risk tolerance (P=0.05), but the mechanism remains unclear. Research and intervention targeting physician risk tolerance may benefit by considering situational regulatory focus as an explanatory factor. PMID:25431799

Awe, uncertainty, and agency detection.

PubMed

Valdesolo, Piercarlo; Graham, Jesse

2014-01-01

Across five studies, we found that awe increases both supernatural belief (Studies 1, 2, and 5) and intentional-pattern perception (Studies 3 and 4)-two phenomena that have been linked to agency detection, or the tendency to interpret events as the consequence of intentional and purpose-driven agents. Effects were both directly and conceptually replicated, and mediational analyses revealed that these effects were driven by the influence of awe on tolerance for uncertainty. Experiences of awe decreased tolerance for uncertainty, which, in turn, increased the tendency to believe in nonhuman agents and to perceive human agency in random events.

Multi-version software reliability through fault-avoidance and fault-tolerance

NASA Technical Reports Server (NTRS)

Vouk, Mladen A.; Mcallister, David F.

1989-01-01

A number of experimental and theoretical issues associated with the practical use of multi-version software to provide run-time tolerance to software faults were investigated. A specialized tool was developed and evaluated for measuring testing coverage for a variety of metrics. The tool was used to collect information on the relationships between software faults and coverage provided by the testing process as measured by different metrics (including data flow metrics). Considerable correlation was found between coverage provided by some higher metrics and the elimination of faults in the code. Back-to-back testing was continued as an efficient mechanism for removal of un-correlated faults, and common-cause faults of variable span. Software reliability estimation methods was also continued based on non-random sampling, and the relationship between software reliability and code coverage provided through testing. New fault tolerance models were formulated. Simulation studies of the Acceptance Voting and Multi-stage Voting algorithms were finished and it was found that these two schemes for software fault tolerance are superior in many respects to some commonly used schemes. Particularly encouraging are the safety properties of the Acceptance testing scheme.

Early genetic testing of coastal Douglas-fir for Swiss needle cast tolerance.

Treesearch

Fatih Temel; G.R. Johnson; W.T. Adams

2005-01-01

The possibility of early testing coastal Douglas-fir (Pseudotsuga menziesii var. menziesii (Mirb.) Franco) for Swiss needle cast (SNC; caused by Phaeocryptopus gaeumannii (Rohde) Petrak) tolerance was investigated using 55 Douglas-fir families from western Oregon. Seedlings were inoculated with P...

Factors predicting early postpartum glucose intolerance in Japanese women with gestational diabetes mellitus: decision-curve analysis.

PubMed

Kondo, M; Nagao, Y; Mahbub, M H; Tanabe, T; Tanizawa, Y

2018-04-29

To identify factors predicting early postpartum glucose intolerance in Japanese women with gestational diabetes mellitus, using decision-curve analysis. A retrospective cohort study was performed. The participants were 123 Japanese women with gestational diabetes who underwent 75-g oral glucose tolerance tests at 8-12 weeks after delivery. They were divided into a glucose intolerance and a normal glucose tolerance group based on postpartum oral glucose tolerance test results. Analysis of the pregnancy oral glucose tolerance test results showed predictive factors for postpartum glucose intolerance. We also evaluated the clinical usefulness of the prediction model based on decision-curve analysis. Of 123 women, 78 (63.4%) had normoglycaemia and 45 (36.6%) had glucose intolerance. Multivariable logistic regression analysis showed insulinogenic index/fasting immunoreactive insulin and summation of glucose levels, assessed during pregnancy oral glucose tolerance tests (total glucose), to be independent risk factors for postpartum glucose intolerance. Evaluating the regression models, the best discrimination (area under the curve 0.725) was obtained using the basic model (i.e. age, family history of diabetes, BMI ≥25 kg/m 2 and use of insulin during pregnancy) plus insulinogenic index/fasting immunoreactive insulin <1.1. Decision-curve analysis showed that combining insulinogenic index/fasting immunoreactive insulin <1.1 with basic clinical information resulted in superior net benefits for prediction of postpartum glucose intolerance. Insulinogenic index/fasting immunoreactive insulin calculated using oral glucose tolerance test results during pregnancy is potentially useful for predicting early postpartum glucose intolerance in Japanese women with gestational diabetes. © 2018 Diabetes UK.

Tolerance response of multidrug-resistant Salmonella enterica strains to habituation to Origanum vulgare L. essential oil

PubMed Central

Monte, Daniel F. M.; Tavares, Adassa G.; Albuquerque, Allan R.; Sampaio, Fábio C.; Oliveira, Tereza C. R. M.; Franco, Octavio L.; Souza, Evandro L.; Magnani, Marciane

2014-01-01

Multidrug-resistant Salmonella enterica isolates from human outbreaks or from poultry origin were investigated for their ability to develop direct-tolerance or cross-tolerance to sodium chloride, potassium chloride, lactic acid, acetic acid, and ciprofloxacin after habituation in subinhibitory amounts ( of the minimum inhibitory concentration – (MIC) and of the minimum inhibitory concentration – MIC) of Origanum vulgare L. essential oil (OVEO) at different time intervals. The habituation of S. enterica to OVEO did not induce direct-tolerance or cross-tolerance in the tested strains, as assessed by the modulation of MIC values. However, cells habituated to OVEO maintained or increased susceptibility to the tested antimicrobials agents, with up to fourfold double dilution decrease from previously determined MIC values. This study reports for the first time the non-inductive effect of OVEO on the acquisition of direct-tolerance or cross-tolerance in multidrug-resistant S. enterica strains to antimicrobial agents that are largely used in food preservation, as well as to CIP, the therapeutic drug of salmonellosis. PMID:25566231

[Renal glycosuria: dominant or recessive autosome anomaly? Mode of hereditary transmission based on the analysis of a 3-generation family tree].

PubMed

De Marchi, S; Proto, G; Jengo, A; Collinassi, P; Basile, A

1983-02-25

Assessment of the pedigree of 7 persons in 3 generations showed that interpretation of the transmission modality of renal glycosuria may be influenced by the diagnostic criteria employed. Analysis of renal glucose curves and evaluation of glycosuria after an oral glucose tolerance test made it clear that albeit slight detects could be detected in family members who would be regarded as healthy according to the criteria of Marble. Distribution of the character pointed to dominant transmission, as opposed to the recessive autosomal transmission favoured in the literature. Variations in the clinical gravity of the tubular defect may be ascribable to a difference in the expressiveness of the abnormal gene or to genetic heterogeneity. Persons homozygous and heterozygous for the gene were present in the pedigree concerned.

Using Ice Cream for Diagnosis of Diabetes Mellitus and Impaired Glucose Tolerance: An Alternative to the Oral Glucose Tolerance Test.

PubMed

Chanprasertpinyo, Wandee; Bhirommuang, Nattapimon; Surawattanawiset, Titiporn; Tangsermwong, Thanwarin; Phanachet, Pariya; Sriphrapradang, Chutintorn

2017-12-01

Oral glucose tolerance test (OGTT) is a sensitive and reliable test for diabetes mellitus and impaired glucose tolerance (IGT). However, poor patient tolerance of glucose solutions is common. We aim to compare the diagnostic value of an ice cream test with a standard OGTT. A total of 104 healthy adults were randomly assigned to either 75-g OGTT or ice cream, followed by a crossover to the other test. Most patients were females (71%). Mean age was 37 ± 12 years, and body mass index was 24.2 ± 3.9kg/m 2 . Diabetes mellitus and IGT, as diagnosed by 75-g OGTT, were 4.8% and 6.7%, respectively. The 2-hour plasma glucose levels were 110 ± 55.5mg/dL with 75-g glucose and 97.52 ± 40.7mg/dL with ice cream. The correlation coefficient of 2-hour plasma glucose for the 2 tests was 0.82 (95% CI: 0.75-0.87; P < 0.001). Discordant diagnostic results, based on 2-hour plasma glucose levels, were 9.61%. By using a combination of fasting plasma glucose and 2-hour plasma glucose values, the ice cream test would have missed 5.76% of those at high risk for diabetes mellitus (impaired fasting glucose and IGT) or diabetes. An ice cream test may serve as an alternative to a 75-g OGTT. Before applying this test in clinical practice, it needs to be validated in a larger population. Copyright © 2017 Southern Society for Clinical Investigation. Published by Elsevier Inc. All rights reserved.

Timing and Frequency of Sublethal Exposure Modifies the Induction and Retention of Increased Insecticide Tolerance in Wood Frogs (Lithobates sylvaticus).

PubMed

Jones, Devin K; Yates, Erika K; Mattes, Brian M; Hintz, William D; Schuler, Matthew S; Relyea, Rick A

2018-05-22

While the paradigm for increased tolerance to pesticides has been by selection on constitutive (naïve) traits, recent research has shown it can also occur through phenotypic plasticity. However, the time period in which induction can occur, the duration of induced tolerance, and the influence of multiple induction events remain unknown. We hypothesized that the induction of increased pesticide tolerance is limited to early sensitive periods, the magnitude of induced tolerance depends on the number of exposures, and the retention of induced tolerance depends on the time elapsed after an exposure and the number of exposures. To test these hypotheses, we exposed wood frog tadpoles to either a no-carbaryl control (water) or 0.5 mg/L carbaryl at four time periods, and later tested their tolerance to carbaryl using time-to-death assays. We discovered that tadpoles induced increased tolerance early and midway, but not late, in our experiment and their constitutive tolerance increased with age. We found no difference in the magnitude of induced tolerance following one or two exposures. Lastly, induced pesticide tolerance was reversed within 6 d, but was retained only when tadpoles experienced all four consecutive exposures. Phenotypic plasticity provides an immediate response for sensitive amphibian larvae to early pesticide exposures and reduces phenotypic mismatches in aquatic environments contaminated by agrochemicals. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Circulating progenitor cells during exercise, muscle electro-stimulation and intermittent hypobaric hypoxia in patients with traumatic brain injury: a pilot study.

PubMed

Corral, Luisa; Conde, Laura; Guillamó, Elisabet; Blasi, Juan; Juncadella, Montserrat; Javierre, Casimiro; Viscor, Ginés; Ventura, Josep L

2014-01-01

Circulating progenitor cells (CPC) treatments may have great potential for the recovery of neurons and brain function. To increase and maintain CPC with a program of exercise, muscle electro-stimulation (ME) and/or intermittent-hypobaric-hypoxia (IHH), and also to study the possible improvement in physical or psychological functioning of participants with Traumatic Brain Injury (TBI). Twenty-one participants. Four groups: exercise and ME group (EEG), cycling group (CyG), IHH and ME group (HEG) and control group (CG). Psychological and physical stress tests were carried out. CPC were measured in blood several times during the protocol. Psychological tests did not change. In the physical stress tests the VO2 uptake increased in the EEG and the CyG, and the maximal tolerated workload increased in the HEG. CPC levels increased in the last three weeks in EEG, but not in CyG, CG and HEG. CPC levels increased in the last three weeks of the EEG program, but not in the other groups and we did not detect performed psychological test changes in any group. The detected aerobic capacity or workload improvement must be beneficial for the patients who have suffered TBI, but exercise type and the mechanisms involved are not clear.

COLD-PCR enriches low-level variant DNA sequences and increases the sensitivity of genetic testing.

PubMed

Castellanos-Rizaldos, Elena; Milbury, Coren A; Guha, Minakshi; Makrigiorgos, G Mike

2014-01-01

Detection of low-level mutations is important for cancer biomarker and therapy targets discovery, but reliable detection remains a technical challenge. The newly developed method of CO-amplification at Lower Denaturation temperature PCR (COLD-PCR) helps to circumvent this issue. This PCR-based technology preferentially enriches minor known or unknown variants present in samples with a high background of wild type DNA which often hampers the accurate identification of these minority alleles. This is a simple process that consists of lowering the temperature at the denaturation step during the PCR-cycling protocol (critical denaturation temperature, T c) and inducing DNA heteroduplexing during an intermediate step. COLD-PCR in its simplest forms does not need additional reagents or specific instrumentation and thus, can easily replace conventional PCR and at the same time improve the mutation detection sensitivity limit of downstream technologies. COLD-PCR can be applied in two basic formats: fast-COLD-PCR that can enrich T m-reducing mutations and full-COLD-PCR that can enrich all mutations, though it requires an intermediate cross-hybridization step that lengthens the thermocycling program. An improved version of full-COLD-PCR (improved and complete enrichment, ice-COLD-PCR) has also been described. Finally, most recently, we developed yet another form of COLD-PCR, temperature-tolerant-COLD-PCR, which gradually increases the denaturation temperature during the COLD-PCR reaction, enriching diverse targets using a single cycling program. This report describes practical considerations for application of fast-, full-, ice-, and temperature-tolerant-COLD-PCR for enrichment of mutations prior to downstream screening.

Clinical implementation and error sensitivity of a 3D quality assurance protocol for prostate and thoracic IMRT

PubMed Central

Cotter, Christopher; Turcotte, Julie Catherine; Crawford, Bruce; Sharp, Gregory; Mah'D, Mufeed

2015-01-01

This work aims at three goals: first, to define a set of statistical parameters and plan structures for a 3D pretreatment thoracic and prostate intensity‐modulated radiation therapy (IMRT) quality assurance (QA) protocol; secondly, to test if the 3D QA protocol is able to detect certain clinical errors; and third, to compare the 3D QA method with QA performed with single ion chamber and 2D gamma test in detecting those errors. The 3D QA protocol measurements were performed on 13 prostate and 25 thoracic IMRT patients using IBA's COMPASS system. For each treatment planning structure included in the protocol, the following statistical parameters were evaluated: average absolute dose difference (AADD), percent structure volume with absolute dose difference greater than 6% (ADD6), and 3D gamma test. To test the 3D QA protocol error sensitivity, two prostate and two thoracic step‐and‐shoot IMRT patients were investigated. Errors introduced to each of the treatment plans included energy switched from 6 MV to 10 MV, multileaf collimator (MLC) leaf errors, linac jaws errors, monitor unit (MU) errors, MLC and gantry angle errors, and detector shift errors. QA was performed on each plan using a single ion chamber and 2D array of ion chambers for 2D and 3D QA. Based on the measurements performed, we established a uniform set of tolerance levels to determine if QA passes for each IMRT treatment plan structure: maximum allowed AADD is 6%; maximum 4% of any structure volume can be with ADD6 greater than 6%, and maximum 4% of any structure volume may fail 3D gamma test with test parameters 3%/3 mm DTA. Out of the three QA methods tested the single ion chamber performed the worst by detecting 4 out of 18 introduced errors, 2D QA detected 11 out of 18 errors, and 3D QA detected 14 out of 18 errors. PACS number: 87.56.Fc PMID:26699299

Comparison of 70 deg tilt, LBNP, and passive standing as measures of orthostatic tolerance

NASA Technical Reports Server (NTRS)

Hyatt, K. H.; Jacobson, L. B.; Schneider, V. S.

1975-01-01

The present study was performed to assess the reliability of lower body negative pressure (LBNP) as a test of orthostatic tolerance. The need for this assessment arose from the prior observation in this laboratory that some subjects show wide day-to-day variation in heart rate responses to LBNP. The extent of these variations was so great as to raise a serious question as to the value of LBNP as a measure of study-induced alterations (e.g., those produced by bedrest or weightlessness) in orthostatic tolerance. Five healthy volunteers were subjected to a series of tests, consisting of 70 deg tilt, LBNP, and passive standing, on three occasions preceding and three occasions following a 2-week period of bedrest. Study results show that it is possible to subdivide the volunteers into subgroups which show either great or little day-to-day variability in any of the three tests. All three tests revealed bedrest-induced alterations in orthostatic tolerance quite adequately. Of the three tests studied, LBNP most frequently resulted in the largest test-induced heart rate alterations, followed by quiet standing and, finally 70 deg tilt.

First-in-Human Phase I Study of PRS-050 (Angiocal), an Anticalin Targeting and Antagonizing VEGF-A, in Patients with Advanced Solid Tumors

PubMed Central

Fischer, Richard; Scharr, Dirk; Büchert, Martin; Stern, Angelika; Gille, Hendrik; Audoly, Laurent P.; Scheulen, Max E.

2013-01-01

Background To report the nonrandomized first-in-human phase I trial of PRS-050, a novel, rationally engineered Anticalin based on human tear lipocalin that targets and antagonizes vascular endothelial growth factor A (VEGF-A). Methods Patients with advanced solid tumors received PRS-050 at 0.1 mg/kg to 10 mg/kg by IV in successive dosing cohorts according to the 3+3 escalation scheme. The primary end point was safety. Results Twenty-six patients were enrolled; 25 were evaluable. Two patients experienced dose-limiting toxicity, comprising grade (G) 3 hypertension and G3 pyrexia, respectively. The maximum tolerated dose was not reached. Most commonly reported treatment-emergent adverse events (AEs) included chills (52%; G3, 4%), fatigue (52%; G3, 4%), hypertension (44%; G3, 16%), and nausea (40%, all G1/2). No anti–PRS-050 antibodies following multiple administration of the drug were detected. PRS-050 showed dose-proportional pharmacokinetics (PK), with a terminal half-life of approximately 6 days. Free VEGF-A was detectable at baseline in 9/25 patients, becoming rapidly undetectable after PRS-050 infusion for up to 3 weeks. VEGF-A/PRS-050 complex was detectable for up to 3 weeks at all dose levels, including in patients without detectable baseline-free VEGF-A. We also detected a significant reduction in circulating matrix metalloproteinase 2, suggesting this end point could be a pharmacodynamic (PD) marker of the drug’s activity. Conclusions PRS-050, a novel Anticalin with high affinity for VEGF-A, was well-tolerated when administered at the highest dose tested, 10 mg/kg. Based on target engagement and PK/PD data, the recommended phase II dose is 5 mg/kg every 2 weeks administered as a 120-minute infusion. Trial Registration ClinicalTrials.gov NCT01141257 http://clinicaltrials.gov/ct2/show/NCT01141257 PMID:24349470

Tolerance limit value of brightness and contrast adjustment on digitized radiographs

NASA Astrophysics Data System (ADS)

Utami, S. N.; Kiswanjaya, B.; Syahraini, S. I.; Ustriyana, P.

2017-08-01

The aim of this study was to measure the tolerance limit value of brightness and contrast adjustment on digitized radiograph with apical periodontitis and early apical abscess. Brightness and contrast adjustment on 60 periapical radiograph with apical periodontitis and early apical abscess made by 2 observers. Reliabilities tested by Cohen’s Kappa Coefficient and significance tested by wilcoxon test. Tolerance limit value of brightness and contrast adjustment for apical periodontitis is -5 and +5, early apical abscess is -10 and +10, and both is -5 and +5. Brightness and contrast adjustment which not appropriate can alter the evaluation and differential diagnosis of periapical lesion.

Epidemic failure detection and consensus for extreme parallelism

DOE PAGES

Katti, Amogh; Di Fatta, Giuseppe; Naughton, Thomas; ...

2017-02-01

Future extreme-scale high-performance computing systems will be required to work under frequent component failures. The MPI Forum s User Level Failure Mitigation proposal has introduced an operation, MPI Comm shrink, to synchronize the alive processes on the list of failed processes, so that applications can continue to execute even in the presence of failures by adopting algorithm-based fault tolerance techniques. This MPI Comm shrink operation requires a failure detection and consensus algorithm. This paper presents three novel failure detection and consensus algorithms using Gossiping. The proposed algorithms were implemented and tested using the Extreme-scale Simulator. The results show that inmore » all algorithms the number of Gossip cycles to achieve global consensus scales logarithmically with system size. The second algorithm also shows better scalability in terms of memory and network bandwidth usage and a perfect synchronization in achieving global consensus. The third approach is a three-phase distributed failure detection and consensus algorithm and provides consistency guarantees even in very large and extreme-scale systems while at the same time being memory and bandwidth efficient.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Katti, Amogh; Di Fatta, Giuseppe; Naughton, Thomas

Future extreme-scale high-performance computing systems will be required to work under frequent component failures. The MPI Forum s User Level Failure Mitigation proposal has introduced an operation, MPI Comm shrink, to synchronize the alive processes on the list of failed processes, so that applications can continue to execute even in the presence of failures by adopting algorithm-based fault tolerance techniques. This MPI Comm shrink operation requires a failure detection and consensus algorithm. This paper presents three novel failure detection and consensus algorithms using Gossiping. The proposed algorithms were implemented and tested using the Extreme-scale Simulator. The results show that inmore » all algorithms the number of Gossip cycles to achieve global consensus scales logarithmically with system size. The second algorithm also shows better scalability in terms of memory and network bandwidth usage and a perfect synchronization in achieving global consensus. The third approach is a three-phase distributed failure detection and consensus algorithm and provides consistency guarantees even in very large and extreme-scale systems while at the same time being memory and bandwidth efficient.« less

Tolerant industrial yeast Saccharomyces cerevisiae posses a more robust cell wall integrity signaling pathway against 2-furaldehyde and 5-(hydroxymethyl)-2-furaldehyde

USDA-ARS?s Scientific Manuscript database

Cell wall integrity signaling pathway in Saccharomyces cerevisiae is a conserved function for detecting and responding to cell stress conditions but less understood for industrial yeast. We dissected gene expression dynamics for a tolerant industrial yeast strain NRRL Y-50049 in response to challeng...

Monitoring pyrethroid insecticide resistance in major malaria vector Anopheles culicifacies: comparison of molecular tools and conventional susceptibility test.

PubMed

Djadid, Navid Dinparast; Forouzesh, Flora; Karimi, Mohsen; Raeisi, Ahmad; Hassan-Zehi, Abdoulghaffar; Zakeri, Sedigheh

2007-07-01

Anopheles culicifacies is a main malaria vector in southeastern part of Iran, bordring Afghanistan and Pakistan. So far, resistance to DDT, dieldrin, malathion and partial tolerance to pyrethroids has been reported in An. stephensi, but nothing confirmed on resistance status of An. culicifacies in Iran. In current study, along with WHO routine susceptibility test with DDT (4%), dieldrin (0.4%), malathion (5%), permethrin (0.25%), lambadacyhalothrin (0.1%), and deltamethrin 0.025, we cloned and sequenced segment VI of domain II (SII6) in voltage-gated sodium channel (vgsc) gene of An. culicifacies specimens collected in Sistan and Baluchistan province (Iran). A 221-bp amplified fragment showed 91% and 93% similarity with exon I and exon II of An. gambiae. The size of intron II in An. culicifacies is 62 bp, while in An. gambiae is 57 bp. The major difference within An. culicifacies specimens and also with An. gambiae is in position 29 of exon I, which led to substitution of Leu to His amino acid. This data will act as first report on partial sequence of vgsc gene and its polymorphism in An. culicifacies. A Leu to His amino acid substitution detected upstream the formerly known knockdown resistance (kdr) mutation site could be an indication for other possible mutations related to insecticide resistance. However, the result of WHO susceptibility test carried out in Baluchistan of Iran revealed a level of tolerance to DDT and dieldrin, but almost complete susceptibility to pyrethroids in An. culicifacies. We postulate that the molecular diagnostic tool developed for detection and identification of kdr-related mutations in An. culicifacies, could be useful in monitoring insecticide resistance in Iran and neighbouring countries such as Pakistan and Afghanistan. A phylogenetic tree also constructed based on the sequence of exon I and II, which readily separated An. culicifacies populations from An. stephensi, An. fluviatilis and An. gambiae.

A real-time, practical sensor fault-tolerant module for robust EMG pattern recognition.

PubMed

Zhang, Xiaorong; Huang, He

2015-02-19

Unreliability of surface EMG recordings over time is a challenge for applying the EMG pattern recognition (PR)-controlled prostheses in clinical practice. Our previous study proposed a sensor fault-tolerant module (SFTM) by utilizing redundant information in multiple EMG signals. The SFTM consists of multiple sensor fault detectors and a self-recovery mechanism that can identify anomaly in EMG signals and remove the recordings of the disturbed signals from the input of the pattern classifier to recover the PR performance. While the proposed SFTM has shown great promise, the previous design is impractical. A practical SFTM has to be fast enough, lightweight, automatic, and robust under different conditions with or without disturbances. This paper presented a real-time, practical SFTM towards robust EMG PR. A novel fast LDA retraining algorithm and a fully automatic sensor fault detector based on outlier detection were developed, which allowed the SFTM to promptly detect disturbances and recover the PR performance immediately. These components of SFTM were then integrated with the EMG PR module and tested on five able-bodied subjects and a transradial amputee in real-time for classifying multiple hand and wrist motions under different conditions with different disturbance types and levels. The proposed fast LDA retraining algorithm significantly shortened the retraining time from nearly 1 s to less than 4 ms when tested on the embedded system prototype, which demonstrated the feasibility of a nearly "zero-delay" SFTM that is imperceptible to the users. The results of the real-time tests suggested that the SFTM was able to handle different types of disturbances investigated in this study and significantly improve the classification performance when one or multiple EMG signals were disturbed. In addition, the SFTM could also maintain the system's classification performance when there was no disturbance. This paper presented a real-time, lightweight, and automatic SFTM, which paved the way for reliable and robust EMG PR for prosthesis control.

Cardiorespiratory assessment of 24-hour crash-diet effects on altitude, +Gz, and fatigue tolerances.

DOT National Transportation Integrated Search

1981-02-01

Eleven male surrogates of general aviation pilots, 25-40 years old, were tested for altitude, +Gz, and fatigue tolerances with and without previous fasting for 24 h. Testing included 2 min of lower body negative pressure (LBNP) at -40 torr (equivalen...

77 FR 56782 - Bifenthrin; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-14

..., hay. Interregional Research Project Number 4 (IR-4) requested these tolerances under the Federal Food... OCSPP test guidelines referenced in this document electronically, please go to http://www.epa.gov/ocspp and select ``Test Methods and Guidelines.'' C. How can I file an objection or hearing request? Under...

78 FR 55635 - Prometryn; Pesticide Tolerances

Federal Register 2010, 2011, 2012, 2013, 2014

2013-09-11

.... Interregional Research Project Number 4 (IR-4) requested these tolerances under the Federal Food, Drug, and... test guidelines referenced in this document electronically, please go to http://www.epa.gov/ocspp and select ``Test Methods and Guidelines. C. How can I file an objection or hearing request? Under FFDCA...

Histological findings in two renal transplants accomplishing operational tolerance criteria

PubMed Central

Azancot, M.A.; Cantarell, C.; Torres, I.B.; Serón, D.R.

2011-01-01

Operational tolerance is defined as stable renal function in transplants without immunosuppression for at least 1 year. We present histological assessments of two patients with operational tolerance. The first withdrew immunosuppression in 2005 and presents stable renal function (creatinine 1.5 mg/dL) without proteinuria. The biopsy showed mild chronic tubulointerstitial changes without inflammation. The second withdrew immunosuppression in 2009 and maintains stable renal function (creatinine 1.6 mg/dL) with mild proteinuria. Histology showed chronic humoural rejection and Class II anti-human leukocyte antigen antibodies were detected. These cases suggest that a renal biopsy may be useful to rule out subclinical pathology in patients with operational tolerance. PMID:25984157

Histological findings in two renal transplants accomplishing operational tolerance criteria.

PubMed

Azancot, M A; Moreso, F; Cantarell, C; Torres, I B; Serón, D R

2011-06-01

Operational tolerance is defined as stable renal function in transplants without immunosuppression for at least 1 year. We present histological assessments of two patients with operational tolerance. The first withdrew immunosuppression in 2005 and presents stable renal function (creatinine 1.5 mg/dL) without proteinuria. The biopsy showed mild chronic tubulointerstitial changes without inflammation. The second withdrew immunosuppression in 2009 and maintains stable renal function (creatinine 1.6 mg/dL) with mild proteinuria. Histology showed chronic humoural rejection and Class II anti-human leukocyte antigen antibodies were detected. These cases suggest that a renal biopsy may be useful to rule out subclinical pathology in patients with operational tolerance.

Fructose intake exacerbates the contractile response elicited by norepinephrine in mesenteric vascular bed of rats via increased endothelial prostanoids.

PubMed

Sousa, Glauciene J; Oliveira, Phablo Wendell C; Nogueira, Breno V; Melo, Antônio F; Faria, Thaís de Oliveira; Meira, Eduardo Frizera; Mill, José G; Bissoli, Nazaré S; Baldo, Marcelo P

2017-10-01

Chronic fructose intake induces major cardiovascular and metabolic disturbances and is associated with the development of hypertension due to changes in vascular function. We hypothesized that high fructose intake for 6 weeks would cause metabolic syndrome and lead to initial vascular dysfunction. Male Wistar rats were assigned to receive fructose (FRU, 10%) or drinking water (CON) for 6 weeks. Systolic blood pressure was evaluated by tail plethysmography. Fasting glucose, insulin and glucose tolerance were measured at the end of the follow-up. Mesenteric vascular bed reactivity was tested before and after pharmacological blockade. Western blot analysis was performed for iNOS, eNOS, Nox2 and COX-2. DHE staining was used for vascular superoxide anion detection. Vessel structure was evaluated by optical and electronic microscopy. Fructose intake did not alter blood pressure, but did increase visceral fat deposition and fasting glucose as well as impair insulin and glucose tolerance. Fructose increased NE-induced vasoconstriction compared with CON, and this difference was abrogated by indomethacin perfusion as well as endothelium removal. ACh-induced relaxation was preserved, and the NO modulation tested after L-NAME perfusion was similar between groups. SNP-induced relaxation was not altered. Inducible NOS was increased; however, there were no changes in eNOS, Nox2 or COX-2 protein expression. Basal or stimulated superoxide anion production was not changed by fructose intake. In conclusion, high fructose intake increased NE-induced vasoconstriction through the endothelial prostanoids even in the presence of a preserved endothelium-mediated relaxation. No major changes in vessel structure were detected. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of a minimally invasive system for measuring glucose area under the curve during oral glucose tolerance tests: usefulness of sweat monitoring for precise measurement.

PubMed

Sakaguchi, Kazuhiko; Hirota, Yushi; Hashimoto, Naoko; Ogawa, Wataru; Hamaguchi, Tomoya; Matsuo, Toshihiro; Miyagawa, Jun-ichiro; Namba, Mitsuyoshi; Sato, Toshiyuki; Okada, Seiki; Tomita, Koji; Matsuhisa, Munehide; Kaneto, Hideaki; Kosugi, Keisuke; Maegawa, Hiroshi; Nakajima, Hiromu; Kashiwagi, Atsunori

2013-05-01

We developed a system for measuring glucose area under the curve (AUC) using minimally invasive interstitial fluid extraction technology (MIET). Sweat contamination during interstitial fluid glucose (IG) extraction affects the accuracy of glucose AUC measurement, because this technology uses extracted sodium ion levels as an internal standard. Therefore, we developed a sweat monitoring patch to reduce this effect and investigated its efficacy in volunteers undergoing oral glucose tolerance tests (OGTTs). Fifty diabetes mellitus inpatients and 10 healthy subjects undergoing the 75 g OGTT were included. Two sites on the forearm were pretreated with microneedle arrays, then hydrogels for interstitial fluid extraction were placed on the treated sites. Simultaneously, hydrogels for sweat monitoring were placed on untreated sites near the treated sites. Plasma glucose (PG) levels were measured every 30 min for 2 h to calculate reference AUC values. Using MIET, IG AUC was calculated from extracted glucose and sodium ion levels after attachment of the hydrogel for 2 h. Good correlation between IG AUC measurements using MIET and reference AUCs measured using PG levels was confirmed over a wide AUC range (202-610 mg/h/dl) after correction for the sweat-induced error detected by the hydrogel patches on the nonpretreated skin. Strong correlation between IG AUC and peak glucose levels indicates that glucose spikes can be easily detected by this system. We confirmed the effectiveness of a sweat monitoring patch for precise AUC measurement using MIET. This novel, easy-to-use system has potential for glucose excursion evaluation in daily clinical practice. © 2013 Diabetes Technology Society.

Evaluation of a Minimally Invasive System for Measuring Glucose Area under the Curve during Oral Glucose Tolerance Tests: Usefulness of Sweat Monitoring for Precise Measurement

PubMed Central

Sakaguchi, Kazuhiko; Hirota, Yushi; Hashimoto, Naoko; Ogawa, Wataru; Hamaguchi, Tomoya; Toshihiro, Matsuo; Miyagawa, Jun-ichiro; Namba, Mitsuyoshi; Sato, Toshiyuki; Okada, Seiki; Tomita, Koji; Matsuhisa, Munehide; Kaneto, Hideaki; Kosugi, Keisuke; Maegawa, Hiroshi; Nakajima, Hiromu; Kashiwagi, Atsunori

2013-01-01

Aims: We developed a system for measuring glucose area under the curve (AUC) using minimally invasive interstitial fluid extraction technology (MIET). Sweat contamination during interstitial fluid glucose (IG) extraction affects the accuracy of glucose AUC measurement, because this technology uses extracted sodium ion levels as an internal standard. Therefore, we developed a sweat monitoring patch to reduce this effect and investigated its efficacy in volunteers undergoing oral glucose tolerance tests (OGTTs). Materials and Methods: Fifty diabetes mellitus inpatients and 10 healthy subjects undergoing the 75 g OGTT were included. Two sites on the forearm were pretreated with microneedle arrays, then hydrogels for interstitial fluid extraction were placed on the treated sites. Simultaneously, hydrogels for sweat monitoring were placed on untreated sites near the treated sites. Plasma glucose (PG) levels were measured every 30 min for 2 h to calculate reference AUC values. Using MIET, IG AUC was calculated from extracted glucose and sodium ion levels after attachment of the hydrogel for 2 h. Results: Good correlation between IG AUC measurements using MIET and reference AUCs measured using PG levels was confirmed over a wide AUC range (202–610 mg/h/dl) after correction for the sweat-induced error detected by the hydrogel patches on the nonpretreated skin. Strong correlation between IG AUC and peak glucose levels indicates that glucose spikes can be easily detected by this system. Conclusion: We confirmed the effectiveness of a sweat monitoring patch for precise AUC measurement using MIET. This novel, easy-to-use system has potential for glucose excursion evaluation in daily clinical practice. PMID:23759401

Mechanical response of dental cements as determined by nanoindentation and scanning electron microscopy.

PubMed

Saghiri, Mohammad Ali; Nazari, Amir; Garcia-Godoy, Franklin; Asatourian, Armen; Malekzadeh, Mansour; Elyasi, Maryam

2013-12-01

This study evaluated the effects of nanoindentation on the surface of white mineral trioxide aggregate (WMTA), Bioaggregate and Nano WMTA cements. Cements were mixed according to the manufacturer directions, condensed inside glass tubes, and randomly divided into three groups (n = 8). Specimens were soaked in synthetic tissue fluid (pH = 7.4) and incubated for 3 days. Cement pellets were subjected to nanoindentation tests and observed by scanning electron microscopy. Then, the images were processed and the number of cracks and total surface area of defects on the surface were calculated and analyzed using ImageJ. Data were submitted to one-way analysis of variance and a post hoc Tukey's test. The lowest number of cracks and total surface of defects were detected in Nano WMTA samples; however, it was not significantly different from WMTA samples (p = 0.588), while the highest values were noticed in Bioaggregate specimens that were significantly different from Nano WMTA and WMTA (p = 0.0001). The surface of WMTA and Nano WMTA showed more resistance after exposure to nano-compressive forces which indicated a better surface tolerance against these forces and crack formation. This suggests these substances are more tolerant cement materials which can predictably withstand loaded situations in a clinical scenario.

Survey of Verification and Validation Techniques for Small Satellite Software Development

NASA Technical Reports Server (NTRS)

Jacklin, Stephen A.

2015-01-01

The purpose of this paper is to provide an overview of the current trends and practices in small-satellite software verification and validation. This document is not intended to promote a specific software assurance method. Rather, it seeks to present an unbiased survey of software assurance methods used to verify and validate small satellite software and to make mention of the benefits and value of each approach. These methods include simulation and testing, verification and validation with model-based design, formal methods, and fault-tolerant software design with run-time monitoring. Although the literature reveals that simulation and testing has by far the longest legacy, model-based design methods are proving to be useful for software verification and validation. Some work in formal methods, though not widely used for any satellites, may offer new ways to improve small satellite software verification and validation. These methods need to be further advanced to deal with the state explosion problem and to make them more usable by small-satellite software engineers to be regularly applied to software verification. Last, it is explained how run-time monitoring, combined with fault-tolerant software design methods, provides an important means to detect and correct software errors that escape the verification process or those errors that are produced after launch through the effects of ionizing radiation.

Effect of resin on impact damage tolerance of graphite/epoxy laminates

NASA Technical Reports Server (NTRS)

Williams, J. G.; Rhodes, M. D.

1982-01-01

Twenty-four different epoxy resin systems were evaluated by a variety of test techniques to identify materials that exhibited improved impact damage tolerance in graphite/epoxy composite laminates. Forty-eight-ply composite panels of five of the material systems were able to sustain 100 m/s impact by a 1.27-cm-diameter aluminum projectile while statically loaded to strains of 0.005. Of the five materials with the highest tolerance to impact, two had elastomeric additives, two had thermoplastic additives, and one had a vinyl modifier; all the five systems used bisphenol A as the base resin. An evaluation of test results shows that the laminate damage tolerance is largely determined by the resin tensile properties, and that improvements in laminate damage tolerance are not necessarily made at the expense of room-temperature mechanical properties. The results also suggest that a resin volume fraction of 40 percent or greater may be required to permit the plastic flow between fibers necessary for improved damage tolerance.

Tolerance of image enhancement brightness and contrast in lateral cephalometric digital radiography for Steiner analysis

NASA Astrophysics Data System (ADS)

Rianti, R. A.; Priaminiarti, M.; Syahraini, S. I.

2017-08-01

Image enhancement brightness and contrast can be adjusted on lateral cephalometric digital radiographs to improve image quality and anatomic landmarks for measurement by Steiner analysis. To determine the limit value for adjustments of image enhancement brightness and contrast in lateral cephalometric digital radiography for Steiner analysis. Image enhancement brightness and contrast were adjusted on 100 lateral cephalometric radiography in 10-point increments (-30, -20, -10, 0, +10, +20, +30). Steiner analysis measurements were then performed by two observers. Reliabilities were tested by the Interclass Correlation Coefficient (ICC) and significance tested by ANOVA or the Kruskal Wallis test. No significant differences were detected in lateral cephalometric analysis measurements following adjustment of the image enhancement brightness and contrast. The limit value of adjustments of the image enhancement brightness and contrast associated with incremental 10-point changes (-30, -20, -10, 0, +10, +20, +30) does not affect the results of Steiner analysis.

Tolerability of 2.5% Lidocaine/Prilocaine Hydrogel in Children Undergoing Cryotherapy for Molluscum Contagiosum.

PubMed

Gobbato, André A M; Babadópulos, Tainah; Gobbato, Cintia A R S; Moreno, Ronilson A; Gagliano-Jucá, Thiago; De Nucci, Gilberto

2016-05-01

The tolerability of a 2.5% lidocaine/prilocaine hydrogel (Nanorap, Biolab Indústria Farmacêutica Ltd., Sao Paulo, Brazil) was evaluated in 20 children ages 2 to 11 years undergoing cryotherapy for molluscum contagiosum (MC). The product was well tolerated, with only two children presenting with eczema at the application site. These adverse reactions were considered unlikely to be related to the test product, because a patch test was negative in one of the individuals and the other event occurred in only one of the two treated areas. Nanorap is an efficacious and well-tolerated option for topical anesthesia in children undergoing cryotherapy for MC. © 2016 Wiley Periodicals, Inc.

Reveal Listeria 2.0 test for detection of Listeria spp. in foods and environmental samples.

PubMed

Alles, Susan; Curry, Stephanie; Almy, David; Jagadeesan, Balamurugan; Rice, Jennifer; Mozola, Mark

2012-01-01

A Performance Tested Method validation study was conducted for a new lateral flow immunoassay (Reveal Listeria 2.0) for detection of Listeria spp. in foods and environmental samples. Results of inclusivity testing showed that the test detects all species of Listeria, with the exception of L. grayi. In exclusivity testing conducted under nonselective growth conditions, all non-listeriae tested produced negative Reveal assay results, except for three strains of Lactobacillus spp. However, these lactobacilli are inhibited by the selective Listeria Enrichment Single Step broth enrichment medium used with the Reveal method. Six foods were tested in parallel by the Reveal method and the U.S. Food and Drug Administration/Bacteriological Analytical Manual (FDA/BAM) reference culture procedure. Considering data from both internal and independent laboratory trials, overall sensitivity of the Reveal method relative to that of the FDA/BAM procedure was 101%. Four foods were tested in parallel by the Reveal method and the U.S. Department of Agriculture-Food Safety and Inspection Service (USDA-FSIS) reference culture procedure. Overall sensitivity of the Reveal method relative to that of the USDA-FSIS procedure was 98.2%. There were no statistically significant differences in the number of positives obtained by the Reveal and reference culture procedures in any food trials. In testing of swab or sponge samples from four types of environmental surfaces, sensitivity of Reveal relative to that of the USDA-FSIS reference culture procedure was 127%. For two surface types, differences in the number of positives obtained by the Reveal and reference methods were statistically significant, with more positives by the Reveal method in both cases. Specificity of the Reveal assay was 100%, as there were no unconfirmed positive results obtained in any phase of the testing. Results of ruggedness experiments showed that the Reveal assay is tolerant of modest deviations in test sample volume and device incubation time.

Is the OJIP Test a Reliable Indicator of Winter Hardiness and Freezing Tolerance of Common Wheat and Triticale under Variable Winter Environments?

PubMed Central

Rapacz, Marcin; Sasal, Monika; Kalaji, Hazem M.; Kościelniak, Janusz

2015-01-01

OJIP analysis, which explores changes in photosystem II (PSII) photochemical performance, has been used as a measure of plant susceptibility to stress. However, in the case of freezing tolerance and winter hardiness, which are highly environmentally variable, the use of this method can give ambiguous results depending on the species as well as the sampling year and time. To clarify this issue, we performed chlorophyll fluorescence measurements over three subsequent winters (2010/11, 2011/12 and 2012/13) on 220 accessions of common winter wheat and 139 accessions of winter triticale. After freezing, leaves were collected from cold-acclimated plants in the laboratory and field-grown plants. Observations of field survival in seven locations across Poland and measurements of freezing tolerance of the studied plants were also recorded. Our results confirm that the OJIP test is a reliable indicator of winter hardiness and freezing tolerance of common wheat and triticale under unstable winter environments. Regardless of species, the testing conditions giving the most reliable results were identical, and the reliability of the test could be easily checked by analysis of some relationships between OJIP-test parameters. We also found that triticale is more winter hardy and freezing tolerant than wheat. In addition, the two species were characterized by different patterns of photosynthetic apparatus acclimation to cold. PMID:26230839

Is the OJIP Test a Reliable Indicator of Winter Hardiness and Freezing Tolerance of Common Wheat and Triticale under Variable Winter Environments?

PubMed

Rapacz, Marcin; Sasal, Monika; Kalaji, Hazem M; Kościelniak, Janusz

2015-01-01

OJIP analysis, which explores changes in photosystem II (PSII) photochemical performance, has been used as a measure of plant susceptibility to stress. However, in the case of freezing tolerance and winter hardiness, which are highly environmentally variable, the use of this method can give ambiguous results depending on the species as well as the sampling year and time. To clarify this issue, we performed chlorophyll fluorescence measurements over three subsequent winters (2010/11, 2011/12 and 2012/13) on 220 accessions of common winter wheat and 139 accessions of winter triticale. After freezing, leaves were collected from cold-acclimated plants in the laboratory and field-grown plants. Observations of field survival in seven locations across Poland and measurements of freezing tolerance of the studied plants were also recorded. Our results confirm that the OJIP test is a reliable indicator of winter hardiness and freezing tolerance of common wheat and triticale under unstable winter environments. Regardless of species, the testing conditions giving the most reliable results were identical, and the reliability of the test could be easily checked by analysis of some relationships between OJIP-test parameters. We also found that triticale is more winter hardy and freezing tolerant than wheat. In addition, the two species were characterized by different patterns of photosynthetic apparatus acclimation to cold.

Design of an optical PPM communication link in the presence of component tolerances

NASA Technical Reports Server (NTRS)

Chen, C.-C.

1988-01-01

A systematic approach is described for estimating the performance of an optical direct detection pulse position modulation (PPM) communication link in the presence of parameter tolerances. This approach was incorporated into the JPL optical link analysis program to provide a useful tool for optical link design. Given a set of system parameters and their tolerance specifications, the program will calculate the nominal performance margin and its standard deviation. Through use of these values, the optical link can be designed to perform adequately even under adverse operating conditions.

Assessment of biochemical mechanisms of tolerance to chlorpyrifos in ancient and contemporary Daphnia pulicaria genotypes.

PubMed

Simpson, Adam M; Jeyasingh, Punidan D; Belden, Jason B

2017-12-01

The evolution of tolerance to environmental contaminants in non-target taxa has been largely studied by comparing extant populations experiencing contrasting exposure. Previous research has demonstrated that "resurrected" genotypes from a population of Daphnia pulicaria express temporal variation in sensitivity to the insecticide chlorpyrifos. Ancient genotypes (1301-1646AD.) were on average more sensitive to this chemical compared to the contemporary genotypes (1967-1977AD.). To determine the physiological mechanisms of tolerance, a series of biochemical assays was performed on three ancient and three contemporary genotypes; these six genotypes exhibited the most sensitive and most tolerant phenotypes within the population, respectively. Metabolic tolerance mechanisms were evaluated using acute toxicity testing, while target-site tolerance was assessed via in vitro acetylcholinesterase (AChE) assays. Acute toxicity tests were conducted using i) the toxic metabolite chlorpyrifos-oxon (CPF-oxon) and ii) CPF-oxon co-applied with piperonyl butoxide (PBO), a known Phase-I metabolic inhibitor. Both series of toxicity tests reduced the mean variation in sensitivity between tolerant and sensitive genotypes. Exposure to CPF-O reduced the disparity from a 4.7-fold to 1.6-fold difference in sensitivity. The addition of PBO further reduced the variation to a 1.2-fold difference in sensitivity. In vitro acetylcholinesterase assays yielded no significant differences in constitutive activity or target-site sensitivity. These findings suggest that pathways involving Phase-I detoxification and/or bioactivation of chlorpyrifos play a significant role in dictating the microevolutionary trajectories of tolerance in this population. Copyright © 2017 Elsevier B.V. All rights reserved.

Does smoking abstinence influence distress tolerance? An experimental study comparing the response to a breath-holding test of smokers under tobacco withdrawal and under nicotine replacement therapy.

PubMed

Cosci, Fiammetta; Anna Aldi, Giulia; Nardi, Antonio Egidio

2015-09-30

Distress tolerance has been operationalized as task persistence in stressful behavioral laboratory tasks. According to the distress tolerance perspective, how an individual responds to discomfort/distress predicts early smoking lapses. This theory seems weakly supported by experimental studies since they are limited in number, show inconsistent results, do not include control conditions. We tested the response to a stressful task in smokers under abstinence and under no abstinence to verify if tobacco abstinence reduces task persistence, thus distress tolerance. A placebo-controlled, double-blind, randomized, cross-over design was used. Twenty smokers underwent a breath holding test after the administration of nicotine on one test day and a placebo on another test day. Physiological and psychological variables were assessed at baseline and directly before and after each challenge. Abstinence induced a statistically significant shorter breath holding duration relative to the nicotine condition. No different response to the breath holding test was observed when nicotine and placebo conditions were compared. No response to the breath holding test was found when pre- and post-test values of heart rate, blood pressure, Visual Analogue Scale for fear or discomfort were compared. In brief, tobacco abstinence reduces breath holding duration but breath holding test does not influence discomfort. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The conditional indirect effect model of women's union participation: the moderating effect of perceived union tolerance for sexual harassment.

PubMed

Mellor, Steven; Golay, Leslie M

2014-01-01

We tested a theoretically trimmed model of union participation presented by Tetrick, Shore, McClurg, and Vandenberg (2007), in which perceived union instrumentality is expected to influence participation through perceived union support. This testing was accomplished as a precursor to testing a conditional indirect effect model of women's participation--in which perceived union tolerance for sexual harassment was expected to moderate the influence of perceived support on willingness to participate in union activities. In a sample of 326 women from multiple unions, we found support for the conditional model; the influence of perceived instrumentality on willingness to participate through perceived support was moderated by perceived tolerance for harassment; specifically, the influence through perceived support was weak when perceived tolerance was high. The implications of our results are discussed in reference to need support and women's participation.

Transcriptome responses in alfalfa associated with tolerance to intensive animal grazing

PubMed Central

Wang, Junjie; Zhao, Yan; Ray, Ian; Song, Mingzhou

2016-01-01

Tolerance of alfalfa (Medicago sativa L.) to animal grazing varies widely within the species. However, the molecular mechanisms influencing the grazing tolerant phenotype remain uncharacterized. The objective of this study was to identify genes and pathways that control grazing response in alfalfa. We analyzed whole-plant de novo transcriptomes from grazing tolerant and intolerant populations of M. sativa ssp. falcata subjected to grazing by sheep. Among the Gene Ontology terms which were identified as grazing responsive in the tolerant plants and differentially enriched between the tolerant and intolerant populations (both grazed), most were associated with the ribosome and translation-related activities, cell wall processes, and response to oxygen levels. Twenty-one grazing responsive pathways were identified that also exhibited differential expression between the tolerant and intolerant populations. These pathways were associated with secondary metabolite production, primary carbohydrate metabolic pathways, shikimate derivative dependent pathways, ribosomal subunit composition, hormone signaling, wound response, cell wall formation, and anti-oxidant defense. Sequence polymorphisms were detected among several differentially expressed homologous transcripts between the tolerant and intolerant populations. These differentially responsive genes and pathways constitute potential response mechanisms for grazing tolerance in alfalfa. They also provide potential targets for molecular breeding efforts to develop grazing-tolerant cultivars of alfalfa. PMID:26763747

Hemocytes Are Sites of Enteric Virus Persistence within Oysters ▿

PubMed Central

Provost, Keleigh; Dancho, Brooke A.; Ozbay, Gulnihal; Anderson, Robert S.; Richards, Gary P.; Kingsley, David H.

2011-01-01

The goal of this study was to determine how enteric viruses persist within shellfish tissues. Several lines of novel evidence show that phagocytic blood cells (hemocytes) of Eastern oysters (Crassostrea virginica) play an important role in the retention of virus particles. Our results demonstrated an association of virus contamination with hemocytes but not with hemolymph. Live oysters contaminated overnight with hepatitis A virus (HAV) and murine norovirus (MNV) had 56% and 80% of extractable virus associated with hemocytes, respectively. Transfer of HAV-contaminated hemocytes to naïve (virus-free) oysters resulted in naïve oyster meat testing HAV positive for up to 3 weeks. Acid tolerance of HAV, MNV, poliovirus (PV), and feline calicivirus (FCV) correlated with the ability of each virus to persist within oysters. Using reverse transcription-PCR (RT-PCR) to evaluate persistence of these viruses in oysters, we showed that HAV persisted the longest (>21 days) and was most acid resistant, MNV and PV were less tolerant of acidic pH, persisting for up to 12 days and 1 day, respectively, and FCV did not persist (<1 day) within oysters and was not acid tolerant. This suggests that the ability of a virus to tolerate the acidic conditions typical of phagolysosomal vesicles within hemocytes plays a role in determining virus persistence in shellfish. Evaluating oyster and hemocyte homogenates and live contaminated oysters as a prelude to developing improved viral RNA extraction methods, we found that viruses were extracted more expediently from hemocytes than from whole shellfish tissues and gave similar RT-PCR detection sensitivities. PMID:21948840

Gestational diabetes mellitus screening, management and outcomes in the Cook Islands.

PubMed

Aung, Yin Yin May; Sowter, Martin; Kenealy, Timothy; Herman, Josephine; Ekeroma, Alec

2015-04-17

To describe current practices for screening for gestational diabetes mellitus in the Cook Islands and consider the implications of alternative screening strategies. Eligible women had antenatal care from January 2009 to December 2012. A non-fasting 50 g glucose challenge between 24 and 28 weeks gestation (positive if 1-hour glucose greater than or equal to 7.8 mmol/L) was followed by a 75 g oral glucose tolerance test (gestational diabetes mellitus diagnosed if fasting glucose greater than or equal to 5.2 mmol/L or 2-hour glucose greater than or equal to 8.0 mmol/L; pregnancy impaired glucose tolerance if positive screen and negative diagnostic test). Uptake of the screening programme rose from 49.0% to 99.6% by the end of the study period. 646 women had a glucose challenge; for 186/646 (28.8%) the challenge was positive; 183 had an oral glucose tolerance test; 89/646 (13.8%) had pregnancy impaired glucose tolerance; 94/646 (13.9%) had gestational diabetes mellitus. Median maternal weight gain was 6 kg (gestational diabetes mellitus) and 10 kg (normal glucose tolerance); caesarean section rates were 25% and 11% respectively; baby birthweights were not significantly different. 59 women with gestational diabetes mellitus had a post-natal glucose tolerance test at their 6-week check and 21 (35.6%) had diabetes confirmed. The gestational diabetes mellitus screening programme has a high uptake and current management appears effective in reducing maternal and fetal weight gain. A proposed new screening programme is outlined.

Test and analysis results for composite transport fuselage and wing structures

NASA Technical Reports Server (NTRS)

Deaton, Jerry W.; Kullerd, Susan M.; Madan, Ram C.; Chen, Victor L.

1992-01-01

Automated tow placement (ATP) and stitching of dry textile composite preforms followed by resin transfer molding (RTM) are being investigated by researchers at NASA LaRC and Douglas Aircraft Company as cost-effective manufacturing processes for obtaining damage tolerant fuselage and wing structures for transport aircraft. The Douglas work is being performed under a NASA contract entitled 'Innovative Composites Aircraft Primary Structures (ICAPS)'. Data are presented in this paper to assess the damage tolerance of ATP and RTM fuselage elements with stitched-on stiffeners from compression tests of impacted three-J-stiffened panels and from stiffener pull-off tests. Data are also presented to assess the damage tolerance of RTM wing elements which had stitched skin and stiffeners from impacted single stiffener and three blade-stiffened compression tests and stiffener pull-off tests.

Low velocity instrumented impact testing of four new damage tolerant carbon/epoxy composite systems

NASA Technical Reports Server (NTRS)

Lance, D. G.; Nettles, A. T.

1990-01-01

Low velocity drop weight instrumented impact testing was utilized to examine the damage resistance of four recently developed carbon fiber/epoxy resin systems. A fifth material, T300/934, for which a large data base exists, was also tested for comparison purposes. A 16-ply quasi-isotropic lay-up configuration was used for all the specimens. Force/absorbed energy-time plots were generated for each impact test. The specimens were cross-sectionally analyzed to record the damage corresponding to each impact energy level. Maximum force of impact versus impact energy plots were constructed to compare the various systems for impact damage resistance. Results show that the four new damage tolerant fiber/resin systems far outclassed the T300/934 material. The most damage tolerant material tested was the IM7/1962 fiber/resin system.

Opioid tolerance and urine drug testing among initiates of extended-release or long-acting opioids in Food and Drug Administration's Sentinel System.

PubMed

Larochelle, Marc R; Cocoros, Noelle M; Popovic, Jennifer; Dee, Elizabeth C; Kornegay, Cynthia; Ju, Jing; Racoosin, Judith A

A risk evaluation and mitigation strategy for extended-release and long-acting (ER/LA) opioid analgesics was approved by the Food and Drug Administration in 2012. Our objective was to assess frequency of opioid tolerance and urine drug testing for individuals initiating ER/LA opioid analgesics. Retrospective cohort study. Sentinel, a distributed database with electronic healthcare data on >190 million predominantly commercially insured members. Members under age 65 initiating ER/LA opioid analgesics between January 2009 and December 2013. We examined the proportion of opioid-tolerant-only ER/LA opioid analgesic initiates meeting tolerance criteria: receipt of ≥30 mg oxycodone equivalents per day in 7 days prior to the first opioid-tolerant-only dispensing. We separately examined the proportion of new users of extended-release oxycodone (ERO) and other ER/LA opioid analgesics with a claim for a urine drug test in the 30 days prior to, and separately for the 183 days after, dispensing. We identified 79,824 ERO, 7,343 extended-release hydromorphone, and 91,778 transdermal fentanyl opi-oid-tolerant-only episodes. Tolerance criteria were met in 64 percent of ERO, 64 percent of extended-release hydromorphone and 40 percent of transdermal fentanyl episodes. We identified 210,581 incident ERO and 311,660 other ER/LA opioid analgesic episodes. Use of urine drug testing for ERO compared with other ER/LA opioid analgesics was: 4 percent vs 14 percent respectively in the 30 days prior to initiation and 9 percent vs 23 percent respectively in the 183 days following initiation. These results suggest potential areas for improving appropriate ER/LA opioid analgesic prescribing practices.

CD20-specific adoptive immunotherapy for lymphoma using a chimeric antigen receptor with both CD28 and 4-1BB domains: pilot clinical trial results.

PubMed

Till, Brian G; Jensen, Michael C; Wang, Jinjuan; Qian, Xiaojun; Gopal, Ajay K; Maloney, David G; Lindgren, Catherine G; Lin, Yukang; Pagel, John M; Budde, Lihua E; Raubitschek, Andrew; Forman, Stephen J; Greenberg, Philip D; Riddell, Stanley R; Press, Oliver W

2012-04-26

Cellular immune responses have the potential to elicit dramatic and sustained clinical remissions in lymphoma patients. Recent clinical trial data demonstrate that modification of T cells with chimeric antigen receptors (CARs) is a promising strategy. T cells containing CARs with costimulatory domains exhibit improved activity against tumors. We conducted a pilot clinical trial testing a "third-generation" CD20-specific CAR with CD28 and 4-1BB costimulatory domains in patients with relapsed indolent B-cell and mantle cell lymphomas. Four patients were enrolled, and 3 received T-cell infusions after cyclophosphamide lymphodepletion. Treatment was well tolerated, although one patient developed transient infusional symptoms. Two patients without evaluable disease remained progression-free for 12 and 24 months. The third patient had an objective partial remission and relapsed at 12 months after infusions. Modified T cells were detected by quantitative PCR at tumor sites and up to 1 year in peripheral blood, albeit at low levels. No evidence of host immune responses against infused cells was detected. In conclusion, adoptive immunotherapy with CD20-specific T cells was well tolerated and was associated with antitumor activity. We will pursue alternative gene transfer technologies and culture conditions in future studies to improve CAR expression and cell production efficiency.

Impaired glucose tolerance in patients with amyotrophic lateral sclerosis.

PubMed

Pradat, Pierre-Francois; Bruneteau, Gaelle; Gordon, Paul H; Dupuis, Luc; Bonnefont-Rousselot, Dominique; Simon, Dominique; Salachas, Francois; Corcia, Philippe; Frochot, Vincent; Lacorte, Jean-Marc; Jardel, Claude; Coussieu, Christiane; Le Forestier, Nadine; Lacomblez, Lucette; Loeffler, Jean-Philippe; Meininger, Vincent

2010-01-01

Our objectives were to analyse carbohydrate metabolism in a series of ALS patients and to examine potential association with parameters of lipid metabolism and clinical features. Glucose tolerance was assessed by the oral glucose tolerance test in 21 non-diabetic ALS patients and compared with 21 age- and sex-matched normal subjects. Lipids and lactate/pyruvate ratio, levels of pro-inflammatory cytokines (tumour necrosis factor-alpha and interleukin-6) and adipocytokines (leptin and adiponectin) were also measured in ALS patients. Mann-Whitney U-tests analysed continuous data and Fisher's exact tests assessed categorical data. Blood glucose determined 120 min after the glucose bolus was significantly higher in patients with ALS (7.41 mmol/l+/-1.68) compared to controls (6.05+/-1.44, p=0.006). ALS patients with impaired glucose tolerance (IGT) according to WHO criteria (n=7, 33%) were more likely to have elevated free fatty acids (FFA) levels compared to patients with normal glucose tolerance (0.77 nmol/l+/-0.30 vs. 0.57+/-0.19, p=0.04). IGT was not associated with disease duration or severity. In conclusion, patients with ALS show abnormal glucose tolerance that could be associated with increased FFA levels, a key determinant of insulin resistance. The origin of glucose homeostasis abnormalities in ALS may be multifactorial and deserves further investigation.

40 CFR 172.3 - Scope of requirement.

Code of Federal Regulations, 2010 CFR

2010-07-01

... experimental use permit (EUP) is generally required for testing of any unregistered pesticide or any registered... testing for more than one target pest occurs at the same time and in the same locality, the 10 acre... experimental animals unless an appropriate tolerance or exemption from a tolerance has been established under...

40 CFR 172.3 - Scope of requirement.

Code of Federal Regulations, 2012 CFR

2012-07-01

... experimental use permit (EUP) is generally required for testing of any unregistered pesticide or any registered... testing for more than one target pest occurs at the same time and in the same locality, the 10 acre... experimental animals unless an appropriate tolerance or exemption from a tolerance has been established under...

Advanced information processing system - Status report. [for fault tolerant and damage tolerant data processing for aerospace vehicles

NASA Technical Reports Server (NTRS)

Brock, L. D.; Lala, J.

1986-01-01

The Advanced Information Processing System (AIPS) is designed to provide a fault tolerant and damage tolerant data processing architecture for a broad range of aerospace vehicles. The AIPS architecture also has attributes to enhance system effectiveness such as graceful degradation, growth and change tolerance, integrability, etc. Two key building blocks being developed by the AIPS program are a fault and damage tolerant processor and communication network. A proof-of-concept system is now being built and will be tested to demonstrate the validity and performance of the AIPS concepts.

A novel system for in situ determination of heat tolerance of plants: first results on alpine dwarf shrubs

PubMed Central

2013-01-01

Background Heat stress and heat damage to plants gain globally increasing importance for crop production and plant survival in endangered habitats. Therefore the knowledge of heat tolerance of plants is of great interest. As many heat tolerance measurement procedures require detachment of plants and protocols expose samples to various heat temperatures in darkness, the ecological relevance of such results may be doubted. To overcome these constraints we designed a novel field compatible Heat Tolerance Testing System (HTTS) that opens the opportunity to induce controlled heat stress on plants in situ under full natural solar irradiation. Subsequently, heat tolerance can be evaluated by a variety of standard viability assays like the electrolyte leakage test, chlorophyll fluorescence measurements and visual assessment methods. Furthermore, recuperation can be studied under natural environmental conditions which is impossible when detached plant material is used. First results obtained on three alpine dwarf - shrubs are presented. Results When heat tolerance of Vaccinium gaultherioides Bigelow was tested with the HTTS in situ, the visual assessment of leaves showed 50% heat injury (LT50) at 48.3°C, while on detached leaves where heat exposure took place in small heat chambers this already happened at 45.8°C. Natural solar irradiation being applied during heat exposure in the HTTS had significantly protective effects: In Loiseleuria procumbens L. (Desv.), if heat exposure (in situ) took place in darkness, leaf heat tolerance was 50.6°C. In contrast, when heat exposure was conducted under full natural solar irradiation heat tolerance was increased to 53.1°C. In Rhododendron ferrugineum L. heat tolerance of leaves was 42.5°C if the exposure took place ex situ and in darkness, while it was significantly increased to 45.8°C when this happened in situ under natural solar irradiation. Conclusions The results obtained with the HTTS tested in the field indicate a mitigating effect of natural solar irradiation during heat exposure. Commonly used laboratory based measurement procedures expose samples in darkness and seem to underestimate leaf heat tolerance. Avoidance of detachment by the use of the HTTS allows studying heat tolerance and recuperation processes in the presence of interacting external abiotic, biotic and genetic factors under field conditions. The investigation of combined effects of heat exposure under full solar irradiation, of recuperation and repair processes but also of possible damage amplification into the results with the HTTS appears to be particularly useful as it allows determining heat tolerance of plants with a considerably high ecological significance. PMID:23497517

An Integrated Fault Tolerant Robotic Controller System for High Reliability and Safety

NASA Technical Reports Server (NTRS)

Marzwell, Neville I.; Tso, Kam S.; Hecht, Myron

1994-01-01

This paper describes the concepts and features of a fault-tolerant intelligent robotic control system being developed for applications that require high dependability (reliability, availability, and safety). The system consists of two major elements: a fault-tolerant controller and an operator workstation. The fault-tolerant controller uses a strategy which allows for detection and recovery of hardware, operating system, and application software failures.The fault-tolerant controller can be used by itself in a wide variety of applications in industry, process control, and communications. The controller in combination with the operator workstation can be applied to robotic applications such as spaceborne extravehicular activities, hazardous materials handling, inspection and maintenance of high value items (e.g., space vehicles, reactor internals, or aircraft), medicine, and other tasks where a robot system failure poses a significant risk to life or property.

Gyro and accelerometer failure detection and identification in redundant sensor systems

NASA Technical Reports Server (NTRS)

Potter, J. E.; Deckert, J. C.

1972-01-01

Algorithms for failure detection and identification for redundant noncolinear arrays of single degree of freedom gyros and accelerometers are described. These algorithms are optimum in the sense that detection occurs as soon as it is no longer possible to account for the instrument outputs as the outputs of good instruments operating within their noise tolerances, and identification occurs as soon as it is true that only a particular instrument failure could account for the actual instrument outputs within the noise tolerance of good instruments. An estimation algorithm is described which minimizes the maximum possible estimation error magnitude for the given set of instrument outputs. Monte Carlo simulation results are presented for the application of the algorithms to an inertial reference unit consisting of six gyros and six accelerometers in two alternate configurations.

Metabolic responses in a model of insulin resistance: comparison between oral glucose and meal tolerance tests.

PubMed

Berthiaume, Nathalie; Zinker, Bradley A

2002-05-01

The purpose of this investigation was to compare the benefits of a meal tolerance test (MTT) against those of an oral glucose tolerance test (OGTT) in one of the most commonly used models of insulin resistance, the Zucker fatty rat. Comparison of these two oral challenges will facilitate determination of the most effective means of inducing both glucose and insulin responses in this particular model and allow for possible therapeutic benefits to be examined more effectively. Eight-week-old Zucker fatty rats (n = 7 or 8) were used to perform either an OGTT or a MTT following an overnight fast. The OGTT contained a final amount of carbohydrate (CHO) of 1.2 g/kg body weight (BW). The MTT (commercially available liquid meal), in addition to having fat and protein, included a final amount of available CHO and volume to match the OGTT. A saline-treated group served as control. A greater glucose excursion was observed following the OGTT compared to the MTT. The maximal change in glucose from baseline was 140 +/- 10 mg/dL (a 2.1-fold rise) for the OGTT compared to 86.3 +/- 6.1 mg/dL (a 1.7-fold rise) for the MTT (P <.05). The MTT induced a greater change from baseline in insulin response compared to the OGTT (7.5 +/- 1.1 v 3.9 +/- 0.5 ng/mL, MTT v OGTT, respectively; P <.05). The saline challenge induced only minimal glucose and insulin responses in comparison to the other treatments. These results suggest that, in a model of insulin resistance, the MTT is a more potent insulin stimulator than glucose alone. A mixed meal, such as a MTT, provides a complete nutrient challenge (CHO, fat, and protein) that will induce both glucose and insulin responses, enabling a better capacity to detect differences in one of the most often used models of insulin resistance, the Zucker fatty rat. Copyright 2002, Elsevier Science (USA). All rights reserved.

[Indicators of dynamic work tolerability in healthy subjects].

PubMed

Capodaglio, E M; Capodaglio, P

1997-01-01

This paper reports a study on the dynamics of tolerability in performing dynamic cycling in healthy subjects. Data on individually tolerable levels (power x duration) was obtained from 9 subjects by means of three submaximal tests on an ergometric bicycle lasting < or = 40 minutes, with constant load (50%, 65% and 80% of maximum VO2 reached during a previous test of increasing difficulty within the limits of the symptoms). During performance of the test we monitored heart rate and subjective perception of fatigue (Borg's 10-point scale). We then defined the individual functions of "isoperception", which expressed the individual trend of the product "power x duration" at identical subjective perception score. On the basis of the metabolic parameters monitored, the individual isoperceptive functions at a "moderate" level of fatigue (3 on the Borg scale) were defined as "tolerability) threshold" for prolonged dynamic cycling. The product "power x duration" defined by the isoperceptive curves at a "moderate" level of fatigue does in fact reflect the individual aerobic capacity that can be sustained for prolonged dynamic activity (under 60 minutes). In order to validate the hypothesis of tolerability of the functions identified, three further short tests were performed (duration < or = 8.5 minutes) on an ergometric bicycle, with measurement of ventilatory and metabolic parameters.

Modeling and Simulation Reliable Spacecraft On-Board Computing

NASA Technical Reports Server (NTRS)

Park, Nohpill

1999-01-01

The proposed project will investigate modeling and simulation-driven testing and fault tolerance schemes for Spacecraft On-Board Computing, thereby achieving reliable spacecraft telecommunication. A spacecraft communication system has inherent capabilities of providing multipoint and broadcast transmission, connectivity between any two distant nodes within a wide-area coverage, quick network configuration /reconfiguration, rapid allocation of space segment capacity, and distance-insensitive cost. To realize the capabilities above mentioned, both the size and cost of the ground-station terminals have to be reduced by using reliable, high-throughput, fast and cost-effective on-board computing system which has been known to be a critical contributor to the overall performance of space mission deployment. Controlled vulnerability of mission data (measured in sensitivity), improved performance (measured in throughput and delay) and fault tolerance (measured in reliability) are some of the most important features of these systems. The system should be thoroughly tested and diagnosed before employing a fault tolerance into the system. Testing and fault tolerance strategies should be driven by accurate performance models (i.e. throughput, delay, reliability and sensitivity) to find an optimal solution in terms of reliability and cost. The modeling and simulation tools will be integrated with a system architecture module, a testing module and a module for fault tolerance all of which interacting through a centered graphical user interface.

Tolerability of aztreonam and carbapenems in patients with IgE-mediated hypersensitivity to penicillins.

PubMed

Gaeta, Francesco; Valluzzi, Rocco Luigi; Alonzi, Cristiana; Maggioletti, Michela; Caruso, Cristiano; Romano, Antonino

2015-04-01

Studies performed on samples larger than 100 subjects with a documented IgE-mediated hypersensitivity to penicillins have demonstrated a cross-reactivity rate of approximately 1% between penicillins and both imipenem and meropenem, whereas a single study found a cross-reactivity rate of 6.2% with aztreonam in 16 such subjects. To assess the cross-reactivity and tolerability of aztreonam and 3 carbapenems (imipenem-cilastatin, meropenem, and ertapenem) in patients with documented IgE-mediated hypersensitivity to penicillins. A total of 212 consecutive subjects with immediate reactions to penicillins and positive results on skin tests to at least 1 penicillin reagent underwent skin tests with aztreonam and carbapenems; subjects with negative results were challenged with escalating doses of aztreonam and carbapenems. All subjects displayed negative skin test results to both aztreonam and carbapenems; 211 accepted challenges and tolerated them. Challenges were not followed by full therapeutic courses. These data indicate the tolerability of both aztreonam and carbapenems in penicillin-allergic subjects. In those who especially require these alternative β-lactams, however, we recommend pretreatment skin tests, both because rare cases of cross-reactivity have been reported and because negative results indicate tolerability. Copyright © 2014 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

Chronic voluntary alcohol consumption results in tolerance to sedative/hypnotic and hypothermic effects of alcohol in hybrid mice

PubMed Central

Ozburn, Angela Renee; Harris, R. Adron; Blednov, Yuri A.

2013-01-01

The continuous two bottle choice test is the most common measure of alcohol consumption but there is remarkably little information about the development of tolerance or dependence with this procedure. We showed that C57BL/6JxFVB/NJ and FVB/NJxC57BL/6J F1 hybrid mice demonstrate greater preference for and consumption of alcohol than either parental strain. In order to test the ability of this genetic model of high alcohol consumption to produce neuroadaptation, we examined development of alcohol tolerance and dependence after chronic self-administration using a continuous access two-bottle choice paradigm. Ethanol-experienced mice stably consumed about 16–18 g/kg/day of ethanol. Ethanol-induced withdrawal severity was assessed (after 59 days of drinking) by scoring handling-induced convulsions; withdrawal severity was minimal and did not differ between ethanol-experienced and -naïve mice. After 71 days of drinking, the rate of ethanol clearance was similar for ethanol-experienced and -naïve mice. After 77 days of drinking, ethanol-induced loss of righting reflex (LORR) was tested daily for 5 days. Ethanol-experienced mice had a shorter duration of LORR. For both ethanol-experienced and -naïve mice, blood ethanol concentrations taken at gain of righting reflex were greater on day 5 than on day 1, indicative of tolerance. After 98 days of drinking, ethanol-induced hypothermia was assessed daily for 3 days. Both ethanol-experienced and –naïve mice developed rapid and chronic tolerance to ethanol-induced hypothermia, with significant group differences on the first day of testing. In summary, chronic, high levels of alcohol consumption in F1 hybrid mice produced rapid and chronic tolerance to both the sedative/hypnotic and hypothermic effects of ethanol; additionally, a small degree of metabolic tolerance developed. The development of tolerance supports the validity of using this model of high alcohol consumption in genetic studies of alcoholism. PMID:23313769

VALIDATION OF ANSI N42.34 AMERICAN NATIONAL STANDARD PERFORMANCE CRITERIA FOR HAND-HELD INSTRUMENTS FOR THE DETECTION AND IDENTIFICATION OF RADIONUCLIDES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lorier, T.

2014-09-03

SRNL’s validation of ANSI N42.34-D6 for the Domestic Nuclear Detection Office (DNDO) was performed utilizing one hand-held instrument (or RID) – the FLIR identiFINDER 2. Each section of the standard was evaluated via a walk-through or test. NOTE: In Table 1, W = walk-through and T = test, as directed by the Domestic Nuclear Detection Office (DNDO). For a walk-through, the experiment was either setup or reviewed for setup; for a test, the N42.34-D6 procedures were followed with some exceptions and comments noted. SRNL is not fully able to evaluate a RID against Sections 7 (Environmental), 8 (Electromagnetic), and 9more » (Mechanical) of N42.34, so those portions of this validation were done in collaboration with Qualtest, Inc. in Orlando, Florida. The walk-throughs and tests of Sections 7, 8, and 9 were performed in Qualtest, Inc. facilities with SRNL providing radiological sources as necessary. Where applicable, assessment results and findings of the walk-throughs and tests were recorded on datasheets and a validation summary is provided. A general comment pertained to test requirements found in another standard and referenced in N42.34-D6. For example, step 1 of the test method in section 8.1.2 states “RF test set up information can be found in IEC 61000-4-3.” It is recommended that any information from other standards necessary for conducting the tests within N42.34 should be posted in N42.34 for simplicity and to prevent the user from having to peruse other documents. Another general comment, as noted by Qualtest, is that a tolerance reference is not listed for each test in sections 7-9. Overall, the N42.34-D6 was proven to be practicable, but areas for improvement and recommendations were identified for consideration prior to final ballot submittal.« less

Occurrence of specific humoral non-responsiveness to swine antigens following administration of GalT-KO bone marrow to baboons

PubMed Central

Griesemer, Adam; Liang, Fan; Hirakata, Atsushi; Hirsh, Erica; Lo, Diana; Okumi, Masayoshi; Sykes, Megan; Yamada, Kazuhiko; Huang, Christene A.; Sachs, David H.

2010-01-01

Background Hematopoietic chimerism induces transplantation tolerance across allogeneic and xenogeneic barriers, but has been difficult to achieve in the pig-to-primate model. We have now utilized swine with knockout of the gene coding for α-1,3-galactosyltransferase (GalT-KO pigs) as bone marrow donors in an attempt to achieve chimerism and tolerance by avoiding the effects of natural antibodies to Gal determinants on pig hematopoietic cells. Methods Baboons (n = 4; Baboons 1 to 4 = B156, B158, B167, and B175, respectively) were splenectomized and conditioned with TBI (150 cGy), thymic irradiation (700 cGy), T cell depletion with rabbit anti-thymocyte globulin (rATG) and rat anti-primate CD2 (LoCD2b), and received FK506 and supportive therapy for 28 days. All animals received GalT-KO bone marrow (1 to 2 × 109 cells/kg) in two fractions on days 0 and 2, and were thereafter monitored for the presence of pig cells by flow cytometry, for porcine progenitor cells by PCR of BM colony-forming units, and for cellular reactivity to pig cells by mixed lymphocyte reaction (MLR). In vitro antibody formation to LoCD2b and rATG was tested by ELISA; antibody reactivity to GalT-KO pig cells was tested by flow cytometry and cytotoxicity assays. Additionally, Baboons 3 and 4 received orthotopic kidney transplants on days 17 and 2, respectively, to test the potential impact of the protocol on renal transplantation. Results None of the animals showed detectable pig cells by flow cytometry for more than 12 h post-BM infusion. However, porcine progenitor cell engraftment, as evidenced by pig-derived colony forming units in the BM, as well as peripheral microchimerism in the thymus, lymph node, and peripheral blood was detected by PCR in baboons 1 and 2 for at least 28 days post-transplant. ELISA results confirmed humoral immunocompetence at time of transplantation as antibody titers to rat (LoCD2b) and rabbit (ATG) increased within 2 weeks. However, no induced antibodies to GalT-KO pig cells or increased donor specific cytotoxicity was detectable by flow cytometry. In contrast, baboons 3 and 4 developed serum antibodies to pig cells as well as to rat and rabbit immunoglobulin by day 14. Retrospective analysis revealed that although all four baboons possessed low levels of antibody-mediated cytotoxicity to GalT-KO cells prior to transplantation, the two baboons (3 and 4) that became sensitized to pig cells (and rejected pig kidneys) had relatively high pre-transplantation titers of anti–non-Gal IgG detectable by flow cytometry, whereas baboons 1 and 2 had undetectable titers. Conclusions Engraftment and specific non-responsiveness to pig cells has been achieved in two of four baboons following GalT-KO pig-to-baboon BMT. Engraftment correlated with absence of preformed anti–non-Gal IgG serum antibodies. These results are encouraging with regard to the possibility of achieving transplantation tolerance across this xenogeneic barrier. PMID:20723202

Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil.

PubMed

Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; Prata, Mara de Moura Gondim; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

2016-02-01

This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL.

Profilin desensitization: A case series

PubMed Central

Nucera, Eleonora; Aruanno, Arianna; Rizzi, Angela; Pecora, Valentina; Patriarca, Giampiero; Buonomo, Alessandro; Mezzacappa, Simona; Schiavino, Domenico

2016-01-01

The role of profilin as an allergen has long been questioned. The capacity of profilin to induce respiratory symptoms has recently been demonstrated; moreover, over 50% of patients sensitized to profilin experienced symptoms after the ingestion of plant-derived foods, suggesting that profilin should be considered as a clinically relevant food allergen. We describe the cases of seven allergic patients with oral allergy syndrome and other adverse reactions after eating plant-derived food, that have been undergone to profilin desensitization treatment. The protocol started with a drop of profilin solution (50 µg/mL) diluted 1:1018 in water until the highest dose of 10 drops of undiluted solution three times a week. At the end of the treatment we observed a decreased mean diameter of profilin wheal in skin prick test (SPT) in five of the seven participants and in profilin specific IgE values in six patients that repeated the test. Regarding basophil activation test (BAT) and the detection of IgG4, we do not have significant results because the tests have to be repeated in some patients. Regarding the double-blind placebo-controlled challenges, after about 10 months of induction phase all the patients showed tolerance to several foods that they previously did not tolerate. Moreover, the immunotherapy with profilin has proved to be safe because no serious adverse events have been reported in our patients. In summary, the results of this exploratory study of sublingual immunotherapy (SLIT) for profilin allergy show that it can be a promising therapeutic option that could modify the clinical reactivity of the patients to the intake of plant-derived food. PMID:26684620

Subclinical Cushing's syndrome: current concepts and trends.

PubMed

Zografos, George N; Perysinakis, Iraklis; Vassilatou, Evangeline

2014-01-01

Clinically inapparent adrenal masses which are incidentally detected have become a common problem in everyday practice. Approximately 5-20% of adrenal incidentalomas present subclinical cortisol hypersecretion which is characterized by subtle alterations of the hypothalamic-pituitary-adrenal axis due to adrenal autonomy. This disorder has been described as subclinical Cushing's syndrome, since there is no typical clinical phenotype. The diagnosis of subclinical Cushing's syndrome is based on biochemical evaluation; however, there is still no consensus for the biochemical diagnostic criteria. An abnormal 1mg dexamethasone suppression test (DST) as initial screening test in combination with at least one other abnormal test of the hypothalamic-pituitary-adrenal axis has been advocated by most experts for the diagnosis of subclinical Cushing's syndrome. DST is the main method of establishing the diagnosis, while there is inhomogeneity of the information that other tests provide. Arterial hypertension, diabetes mellitus type 2 or impaired glucose tolerance, central obesity, osteoporosis/vertebral fractures and dyslipidemia are considered as detrimental effects of chronic subtle cortisol excess, although there is no proven causal relationship between subclinical cortisol hypersecretion and these morbidities. Therapeutic strategies include careful observation along with medical treatment of morbidities potentially related to subtle cortisol hypersecretion versus laparoscopic adrenalectomy. The optimal management of patients with subclinical Cushing's syndrome is not yet defined. The conservative approach is appropriate for the majority of these patients; however, the duration of follow-up and the frequency of periodical evaluation still remain open issues. Surgical resection may be beneficial for patients with hypertension, diabetes mellitus type 2 or abnormal glucose tolerance and obesity.

Clinical evaluation, biochemistry and genetic polymorphism analysis for the diagnosis of lactose intolerance in a population from northeastern Brazil

PubMed Central

Ponte, Paulo Roberto Lins; de Medeiros, Pedro Henrique Quintela Soares; Havt, Alexandre; Caetano, Joselany Afio; Cid, David A C; de Moura Gondim Prata, Mara; Soares, Alberto Melo; Guerrant, Richard L; Mychaleckyj, Josyf; Lima, Aldo Ângelo Moreira

2016-01-01

OBJECTIVE: This work aimed to evaluate and correlate symptoms, biochemical blood test results and single nucleotide polymorphisms for lactose intolerance diagnosis. METHOD: A cross-sectional study was conducted in Fortaleza, Ceará, Brazil, with a total of 119 patients, 54 of whom were lactose intolerant. Clinical evaluation and biochemical blood tests were conducted after lactose ingestion and blood samples were collected for genotyping evaluation. In particular, the single nucleotide polymorphisms C>T-13910 and G>A-22018 were analyzed by restriction fragment length polymorphism/polymerase chain reaction and validated by DNA sequencing. RESULTS: Lactose-intolerant patients presented with more symptoms of flatulence (81.4%), bloating (68.5%), borborygmus (59.3%) and diarrhea (46.3%) compared with non-lactose-intolerant patients (p<0.05). We observed a significant association between the presence of the alleles T-13910 and A-22018 and the lactose-tolerant phenotype (p<0.05). After evaluation of the biochemical blood test results for lactose, we found that the most effective cutoff for glucose levels obtained for lactose malabsorbers was <15 mg/dL, presenting an area under the receiver operating characteristic curve greater than 80.3%, with satisfactory values for sensitivity and specificity. CONCLUSIONS: These data corroborate the association of these single nucleotide polymorphisms (C>T-13910 and G>A-22018) with lactose tolerance in this population and suggest clinical management for patients with lactose intolerance that considers single nucleotide polymorphism detection and a change in the biochemical blood test cutoff from <25 mg/dL to <15 mg/dL. PMID:26934237

The interactive effects of essential ions and salinity on the survival of Mysidopsis bahia in 96-H acute toxicity tests of effluents discharged to marine and estuarine receiving waters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Douglas, W.S.; Horne, M.T.

1997-10-01

The importance of salinity in whole effluent toxicity tests using marine organisms has been acknowledged in most testing protocols. However, little if any attention has been given to the specific effects of alteration of the ionic composition of seawater solutions to the test organism. The presence of persistent toxicity in effluents with no apparent toxic agents prompted examination of the potential influence of essential ions on the survival of the opossum shrimp, Mysidopsis bahia, a common effluent toxicity indicator organism. Through stepwise additions of ionic salts to deionized water, the minimum complement of salts to maintain survival of M. bahiamore » during 96-h exposures was determined to be Ca, Mg, K, Br, Na, and Cl. The toxicity curves for Ca, Mg, K, and Br were then determined across test salinity ranging from 10 to 35 parts per thousand. These curves for Ca, Mg, and K revealed that there are significant negative effects on survival when the essential ions are present in either low or high concentrations relative to the levels in natural seawater. Although there were no statistically detectable effects of Br on organism survival over the concentration range tested (5--480 mg/L). Br toxicity at concentrations less than 5 mg/L and greater than 700 mg/L have been shown in other studies. In addition, the tolerance ranges for K, Ca, and Mg were shown to shift significantly with changes in salinity, with lower salinity causing an apparent decrease in tolerance to an excess of essential ions. Tests with toxic effluents from five industrial and municipal sources revealed that adjustment of the ionic balance prior to testing reduced or eliminated toxicity in four of the five whole effluents tested. Suggestions for integrating this information into biomonitoring programs and toxicity identification evaluations are presented.« less

Hyperspectral imaging to identify salt-tolerant wheat lines

NASA Astrophysics Data System (ADS)

Moghimi, Ali; Yang, Ce; Miller, Marisa E.; Kianian, Shahryar; Marchetto, Peter

2017-05-01

In order to address the worldwide growing demand for food, agriculture is facing certain challenges and limitations. One of the important threats limiting crop productivity is salinity. Identifying salt tolerate varieties is crucial to mitigate the negative effects of this abiotic stress in agricultural production systems. Traditional measurement methods of this stress, such as biomass retention, are labor intensive, environmentally influenced, and often poorly correlated to salinity stress alone. In this study, hyperspectral imaging, as a non-destructive and rapid method, was utilized to expedite the process of identifying relatively the most salt tolerant line among four wheat lines including Triticum aestivum var. Kharchia, T. aestivum var. Chinese Spring, (Ae. columnaris) T. aestivum var. Chinese Spring, and (Ae. speltoides) T. aestivum var. Chinese Spring. To examine the possibility of early detection of a salt tolerant line, image acquisition was started one day after stress induction and continued on three, seven, and 12 days after adding salt. Simplex volume maximization (SiVM) method was deployed to detect superior wheat lines in response to salt stress. The results of analyzing images taken as soon as one day after salt induction revealed that Kharchia and (columnaris)Chinese Spring are the most tolerant wheat lines, while (speltoides) Chinese Spring was a moderately susceptible, and Chinese Spring was a relatively susceptible line to salt stress. These results were confirmed with the measuring biomass performed several weeks later.

Serum glycerophosphate levels are increased in Japanese men with type 2 diabetes.

PubMed

Daimon, Makoto; Soga, Tomoyoshi; Hozawa, Atsushi; Oizumi, Toshihide; Kaino, Wataru; Takase, Kaoru; Karasawa, Shigeru; Jimbu, Yumi; Wada, Kiriko; Kameda, Wataru; Susa, Shinji; Kayama, Takamasa; Saito, Kaori; Tomita, Masaru; Kato, Takeo

2012-01-01

To identify metabolites showing changes in serum levels among Japanese male with diabetes. We performed metabolite profiling by coupling capillary electrophoresis with electrospray ionization time-of-flight mass spectrometry using fasting serum samples from Japanese male subjects with diabetes (n=17), impaired glucose tolerance (IGT; n=5) and normal glucose tolerance (NGT; n=14). Other than the expected differences in characteristics related to abnormal glucose metabolism, the percent body fat was significantly different among subjects with diabetes, IGT and NGT (27.3±6.2, 22.2±4.5 and 19.2±6.0%, respectively, p=0.0022). Therefore, percent body fat was considered as a possible confounding factor in subsequent analyses. Of 560 metabolites detected using our platform, the levels of 74 metabolites were quantified in all of the serum samples. Significant differences between diabetes and NGT were observed for 24 metabolites. The top-ranked metabolite was glycerol-3-phophate (glycerophosphate), which was significantly higher in subjects with diabetes than in those with NGT, even after Bonferroni correction for multiple testing (11.7±3.6 vs. 6.4±1.9 µM, respectively; corrected p=0.0222). Stepwise multiple regression analyses revealed that serum glycerophosphate levels were significantly correlated with 2-h plasma glucose after a 75-g oral glucose tolerance test (r=0.553, p=0.0005), independently of other characteristics, including FPG and HbA1c. Serum glycerophosphate levels were found to be elevated in Japanese men with diabetes, and correlated with 2-h PG, independent of FPG and HbA1c. Namely, serum glycerophosphate level at fasting condition can be a marker for predicting glucose intolerance. These results warrant further studies to evaluate the relevance of glycerophosphate in the pathophysiology of diabetes.

Basal measures of insulin sensitivity and insulin secretion and simplified glucose tolerance tests in dogs.

PubMed

Verkest, K R; Fleeman, L M; Rand, J S; Morton, J M

2010-10-01

There is need for simple, inexpensive measures of glucose tolerance, insulin sensitivity, and insulin secretion in dogs. The aim of this study was to estimate the closeness of correlation between fasting and dynamic measures of insulin sensitivity and insulin secretion, the precision of fasting measures, and the agreement between results of standard and simplified glucose tolerance tests in dogs. A retrospective descriptive study using 6 naturally occurring obese and 6 lean dogs was conducted. Data from frequently sampled intravenous glucose tolerance tests (FSIGTTs) in 6 obese and 6 lean client-owned dogs were used to calculate HOMA, QUICKI, fasting glucose and insulin concentrations. Fasting measures of insulin sensitivity and secretion were compared with MINMOD analysis of FSIGTTs using Pearson correlation coefficients, and they were evaluated for precision by the discriminant ratio. Simplified sampling protocols were compared with standard FSIGTTs using Lin's concordance correlation coefficients, limits of agreement, and Pearson correlation coefficients. All fasting measures except fasting plasma glucose concentration were moderately correlated with MINMOD-estimated insulin sensitivity (|r| = 0.62-0.80; P < 0.03), and those that combined fasting insulin and glucose were moderately closely correlated with MINMOD-estimated insulin secretion (r = 0.60-0.79; P < 0.04). HOMA calculated using the nonlinear formulae had the closest estimated correlation (r = 0.77 and 0.74) and the best discrimination for insulin sensitivity and insulin secretion (discriminant ratio 4.4 and 3.4, respectively). Simplified sampling protocols with half as many samples collected over 3 h had close agreement with the full sampling protocol. Fasting measures and simplified intravenous glucose tolerance tests reflect insulin sensitivity and insulin secretion derived from frequently sampled glucose tolerance tests with MINMOD analysis in dogs. Copyright 2010 Elsevier Inc. All rights reserved.

7 CFR 801.12 - Design requirements incorporated by reference.

Code of Federal Regulations, 2010 CFR

2010-01-01

... reference: General Code (1.10.) G-S.5.5. Money Values, Mathematical Agreement G-T.1. Acceptance Tolerances G.... Tolerance Values T.3. For Test Weight Per Bushel Indications or Recorded Representations UR.3.2. Other... Standards and Technology's (NIST) Handbook 44, “Specifications, Tolerances, and Other Technical Requirements...

Fuel Cycle Research and Development Accident Tolerant Fuels Series 1 (ATF-1) Irradiation Testing FY 2016 Status Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Core, Gregory Matthew

This report contains a summary of irradiation testing of Fuel Cycle Research and Development (FCRD) Accident Tolerant Fuels Series 1 (ATF 1) experiments performed at Idaho National Laboratory (INL) in FY 2016. ATF 1 irradiation testing work performed in FY 2016 included design, analysis, and fabrication of ATF-1B drop in capsule ATF 1 series experiments and irradiation testing of ATF-1 capsules in the ATR.

Experimental demonstration of radiation effects on the performance of a stirling-alternator convertor and candidate materials evaluation

NASA Astrophysics Data System (ADS)

Mireles, Omar R.

Free-piston Stirling power convertors are under consideration by NASA for service in the Advanced Stirling Radioisotope Generator (ASRG) and Fission Surface Power (FSP) systems to enable aggressive exploration missions by providing a reliable and constant power supply. The ASRG must withstand environmental radiation conditions, while the FSP system must tolerate a mixed neutron and gamma-ray environment resulting from self-irradiation. Stirling-alternators utilize rare earth magnets and a variety of organic materials whose radiation limits dominate service life estimates and shielding requirements. The project objective was to demonstrate the performance of the alternator, identify materials that exhibit excessive radiation sensitivity, identify radiation tolerant substitutes, establish empirical dose limits, and demonstrate the feasibility of cost effective nuclear and radiation tests by selection of the appropriate personnel and test facilities as a function of hardware maturity. The Stirling Alternator Radiation Test Article (SARTA) was constructed from linear alternator components of a Stirling convertor and underwent significant pre-exposure characterization. The SARTA was operated at the Sandia National Laboratories Gamma Irradiation Facility to a dose of over 40 Mrad. Operating performance was within nominal variation, although modestly decreasing trends occurred in later runs as well as the detection of an electrical fault after the final exposure. Post-irradiation disassembly and internal inspection revealed minimal degradation of the majority of the organic components. Radiation testing of organic material coupons was conducted since the majority of the literature was inconsistent. These inconsistencies can be attributed to testing at environmental conditions vastly different than those Stirling-alternator organics will experience during operation. Samples were irradiated at the Texas A&M TRIGA reactor to above expected FSP neutron fluence. A thorough materials evaluation followed and results indicate that the majority of material properties experienced minimal statistically significant change.

Fault Tolerance for VLSI Multicomputers

DTIC Science & Technology

1985-08-01

that consists of hundreds or thousands of VLSI computation nodes interconnected by dedicated links. Some important applications of high-end computers...technology, and intended applications . A proposed fault tolerance scheme combines hardware that performs error detection and system-level protocols for...order to recover from the error and resume correct operation, a valid system state must be restored. A low-overhead, application -transparent error

Anti-nociceptive interactions between opioids and a cannabinoid receptor 2 agonist in inflammatory pain

PubMed Central

Hale, David E; Guindon, Josée; Morgan, Daniel J

2017-01-01

The cannabinoid 1 receptor and cannabinoid 2 receptor can both be targeted in the treatment of pain; yet, they have some important differences. Cannabinoid 1 receptor is expressed at high levels in the central nervous system, whereas cannabinoid 2 receptor is found predominantly, although not exclusively, outside the central nervous system. The objective of this study was to investigate potential interactions between cannabinoid 2 receptor and the mu-opioid receptor in pathological pain. The low level of adverse side effects and lack of tolerance for cannabinoid 2 receptor agonists are attractive pharmacotherapeutic traits. This study assessed the anti-nociceptive effects of a selective cannabinoid 2 receptor agonist (JWH-133) in pathological pain using mice subjected to inflammatory pain using the formalin test. Furthermore, we examined several ways in which JWH-133 may interact with morphine. JWH-133 produces dose-dependent anti-nociception during both the acute and inflammatory phases of the formalin test. This was observed in both male and female mice. However, a maximally efficacious dose of JWH-133 (1 mg/kg) was not associated with somatic withdrawal symptoms, motor impairment, or hypothermia. After eleven once-daily injections of 1 mg/JWH-133, no tolerance was observed in the formalin test. Cross-tolerance for the anti-nociceptive effects of JWH-133 and morphine were assessed to gain insight into physiologically relevant cannabinoid 2 receptor and mu-opioid receptor interaction. Mice made tolerant to the effects of morphine exhibited a lower JWH-133 response in both phases of the formalin test compared to vehicle-treated morphine-naïve animals. However, repeated daily JWH-133 administration did not cause cross-tolerance for morphine, suggesting opioid and cannabinoid 2 receptor cross-tolerance is unidirectional. However, preliminary data suggest co-administration of JWH-133 with morphine modestly attenuates morphine tolerance. Isobolographic analysis revealed that co-administration of JWH-133 and morphine has an additive effect on anti-nociception in the formalin test. Overall these findings show that cannabinoid 2 receptor may functionally interact with mu-opioid receptor to modulate anti-nociception in the formalin test. PMID:28879802

Radiation-Tolerant Intelligent Memory Stack - RTIMS

NASA Technical Reports Server (NTRS)

Ng, Tak-kwong; Herath, Jeffrey A.

2011-01-01

This innovation provides reconfigurable circuitry and 2-Gb of error-corrected or 1-Gb of triple-redundant digital memory in a small package. RTIMS uses circuit stacking of heterogeneous components and radiation shielding technologies. A reprogrammable field-programmable gate array (FPGA), six synchronous dynamic random access memories, linear regulator, and the radiation mitigation circuits are stacked into a module of 42.7 42.7 13 mm. Triple module redundancy, current limiting, configuration scrubbing, and single- event function interrupt detection are employed to mitigate radiation effects. The novel self-scrubbing and single event functional interrupt (SEFI) detection allows a relatively soft FPGA to become radiation tolerant without external scrubbing and monitoring hardware

Linewidth-tolerant real-time 40-Gbit/s 16-QAM self-homodyne detection using a pilot carrier and ISI suppression based on electronic digital processing.

PubMed

Nakamura, Moriya; Kamio, Yukiyoshi; Miyazaki, Tetsuya

2010-01-01

We experimentally demonstrate linewidth-tolerant real-time 40-Gbit/s(10-Gsymbol/s) 16-quadrature amplitude modulation. We achieved bit-error rates of <10(-9) using an external-cavity laser diode with a linewidth of 200 kHz and <10(-7) using a distributed-feedback laser diode with a linewidth of 30 MHz, thanks to the phase-noise canceling capability provided by self-homodyne detection using a pilot carrier. Pre-equalization based on digital signal processing was employed to suppress intersymbol interference caused by the limited-frequency bandwidth of electrical components.

Curcumin reverses the depressive-like behavior and insulin resistance induced by chronic mild stress.

PubMed

Shen, Ji-Duo; Wei, Yu; Li, Yu-Jie; Qiao, Jing-Yi; Li, Yu-Cheng

2017-08-01

Increasing evidence has demonstrated that patients with depression have a higher risk of developing type 2 diabetes. Insulin resistance has been identified as the key mechanism linking depression and diabetes. The present study established a rat model of depression complicated by insulin resistance using a 12-week exposure to chronic mild stress (CMS) and investigated the therapeutic effects of curcumin. Sucrose intake tests were used to evaluate depressive-like behaviors, and oral glucose tolerance tests (OGTT) and intraperitoneal insulin tolerance tests (IPITT) were performed to evaluate insulin sensitivity. Serum parameters were detected using commercial kits. Real-time quantitative PCR was used to examine mRNA expression. CMS rats exhibited reduced sucrose consumption, increased serum glucose, insulin, triglyceride (TG), low density lipoprotein-cholesterol (LDL-C), non-esterified fatty acid (NEFA), glucagon, leptin, and corticosterone levels, as well as impaired insulin sensitivity. Curcumin upregulated the phosphorylation of insulin receptor substrate (IRS)-1 and protein kinase B (Akt) in the liver, enhanced insulin sensitivity, and reversed the metabolic abnormalities and depressive-like behaviors mentioned above. Moreover, curcumin increased the hepatic glycogen content by inhibiting glycogen synthase kinase (GSK)-3β and prevented gluconeogenesis by inhibiting phosphoenolpyruvate carboxykinase (PEPCK) and glucose 6-phosphatase (G6Pase). These results suggest that curcumin not only exerted antidepressant-like effects, but also reversed the insulin resistance and metabolic abnormalities induced by CMS. These data may provide evidence to support the potential use of curcumin against depression and/or metabolic disorders.

Paired methods to measure biofilm killing and removal: a case study with Penicillin G treatment of Staphylococcus aureus biofilm.

PubMed

Ausbacher, D; Lorenz, L; Pitts, B; Stewart, P S; Goeres, D M

2018-03-01

Biofilms are microbial aggregates that show high tolerance to antibiotic treatments in vitro and in vivo. Killing and removal are both important in biofilm control, therefore methods that measure these two mechanisms were evaluated in a parallel experimental design. Kill was measured using the single tube method (ASTM method E2871) and removal was determined by video microscopy and image analysis using a new treatment flow cell. The advantage of the parallel test design is that both methods used biofilm covered coupons harvested from a CDC biofilm reactor, a well-established and standardized biofilm growth method. The control Staphylococcus aureus biofilms treated with growth medium increased by 0·6 logs during a 3-h contact time. Efficacy testing showed biofilms exposed to 400 μmol l -1 penicillin G decreased by only 0·3 logs. Interestingly, time-lapse confocal scanning laser microscopy revealed that penicillin G treatment dispersed the biofilm despite being an ineffective killing agent. In addition, no biofilm removal was detected when assays were performed in 96-well plates. These results illustrate that biofilm behaviour and impact of treatments can vary substantially when assayed by different methods. Measuring both killing and removal with well-characterized methods will be crucial for the discovery of new anti-biofilm strategies. Biofilms are tolerant to antimicrobial treatments and can lead to persistent infections. Finding new anti-biofilm strategies and understanding their mode-of-action is therefore of high importance. Historically, antimicrobial testing has focused on measuring the decrease in viability. While kill data are undeniably important, measuring biofilm disruption provides equally useful information. Starting with biofilm grown in the same reactor, we paired assessment of biofilm removal using a new treatment-flow-cell and real-time microscopy with kill data collected using the single tube method (ASTM E2871). Pairing these two methods revealed efficient biofilm removal properties of Penicillin G which were not detected during efficacy testing. © 2017 The Society for Applied Microbiology.

Design and testing of integrated Bragg grating sensor systems for advanced grid structure

NASA Astrophysics Data System (ADS)

Amano, Masataro; Mizutani, Tadahito; Okabe, Yoji; Takeda, Nobuo; Ozaki, Tsuyoshi

2006-03-01

In this research, the authors target on the construction of structural health monitoring system of Advanced Grid Structure (AGS) made of Carbon fiber reinforced plastic (CFRP). AGS has often been applied to aerospace structures because of the following advantages: (1) Since ribs carry only axial forces, the weakness in the transverse direction of the CFRP unidirectional laminates is negligible. (2) AGS has damage tolerance because the fracture of a rib hardly affects other ribs, namely AGS is a fail-safe structure. In this research, in order to detect existence and regions of rib fractures in AGS, we embedded multiplexed fiber Bragg grating (FBG) sensors into AGS in rib longitudinal directions for measurement of strains. Monitoring of the change in rib longitudinal strains is the most effective SHM system for AGS. In order to confirm our proposal, we carried out following discussions. First, we analytically revealed that the change in rib longitudinal strains was the most sensitive signal for damage detection because of AGS's structural redundancy. Then, we introduced a statistical outlier analysis technique into the SHM system for damage recognition. Finally, we established AGS with the SHM system and verified experimentally. The result of the test showed that damage existence and regions in AGS could be detected with the proposed SHM system.

The Role of the Environment in the Evolution of Tolerance and Resistance to a Pathogen.

PubMed

Zeller, Michael; Koella, Jacob C

2017-09-01

Defense against parasites can be divided into resistance, which limits parasite burden, and tolerance, which reduces pathogenesis at a given parasite burden. Distinguishing between the two and understanding which defense is favored by evolution in different ecological settings are important, as they lead to fundamentally different evolutionary trajectories of host-parasite interactions. We let the mosquito Aedes aegypti evolve under different food levels and with either no parasite, a constant parasite, or a coevolving parasite (the microsporidian Vavraia culicis). We then tested tolerance and resistance of the evolved lines on a population level at the two food levels. Exposure to parasites during evolution increased resistance and tolerance, but there were no differences between the lines evolved with coevolving or constant parasites. Mosquitoes that had evolved with food restriction had higher resistance than those evolved with high food but similar tolerance. The mosquitoes that had restricted food when being tested had lower tolerance than those with normal food, but there was no difference in resistance. Our results emphasize the complexity and dependence on environmental conditions of the evolution and expression of resistance and tolerance and help to evaluate some of the predictions about the evolution of host defense against parasites.

Tolerance to the antinociceptive effects of chronic morphine requires c-Jun N-terminal kinase.

PubMed

Marcus, David J; Zee, Michael; Hughes, Alex; Yuill, Matthew B; Hohmann, Andrea G; Mackie, Ken; Guindon, Josée; Morgan, Daniel J

2015-06-12

Morphine and fentanyl are opioid analgesics in wide clinical use that act through the μ-opioid receptor (MOR). However, one limitation of their long-term effectiveness is the development of tolerance. Receptor desensitization has been proposed as a putative mechanism driving tolerance to G protein-coupled receptor (GPCR) agonists. Recent studies have found that tolerance to morphine is mediated by the c-Jun N-terminal Kinase (JNK) signaling pathway. The goal of the present study was to test the hypotheses that: 1) JNK inhibition will be antinociceptive on its own; 2) JNK inhibition will augment morphine antinociception and; 3) JNK mediates chronic tolerance for the antinociceptive effects of morphine using acute (hotplate and tail-flick), inflammatory (10 μl of formalin 2.5%) and chemotherapy (cisplatin 5 mg/kg ip once weekly)-induced neuropathic pain assays. We found that JNK inhibition by SP600125 (3 mg/kg) produces a greater antinociceptive effect than morphine (6 mg/kg) alone in the formalin test. Moreover, co-administration of morphine (6 mg/kg) with SP600125 (3 mg/kg) produced a sub-additive antinociceptive effect in the formalin test. We also show that pre-treatment with SP600125 (3 or 10 mg/kg), attenuates tolerance to the antinociceptive effects of morphine (10 mg/kg), but not fentanyl (0.3 mg/kg), in the tail-flick and hotplate tests. Pre-treatment with SP600125 also attenuates tolerance to the hypothermic effects of both morphine and fentanyl. We also examined the role of JNK in morphine tolerance in a cisplatin-induced model of neuropathic pain. Interestingly, treatment with SP600125 (3 mg/kg) alone attenuated mechanical and cold allodynia in a chemotherapy-induced pain model using cisplatin. Strikingly, SP600125 (3 mg/kg) pre-treatment prolonged the anti-allodynic effect of morphine by several days (5 and 7 days for mechanical and cold, respectively). These results demonstrate that JNK signaling plays a crucial role in mediating antinociception as well as chronic tolerance to the antinociceptive effects of morphine in acute, inflammatory, and neuropathic pain states. Thus, inhibition of JNK signaling pathway, via SP600125, represents an efficacious pharmacological approach to delay tolerance to the antinociceptive effects of chronic morphine in diverse pain models.

Recombinase Polymerase Amplification Assay-A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1.

PubMed

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1 infection.

Recombinase Polymerase Amplification Assay—A Simple, Fast and Cost-Effective Alternative to Real Time PCR for Specific Detection of Feline Herpesvirus-1

PubMed Central

Wang, Jianchang; Liu, Libing; Wang, Jinfeng; Sun, Xiaoxia; Yuan, Wanzhe

2017-01-01

Feline herpesvirus 1 (FHV-1), an enveloped dsDNA virus, is one of the major pathogens of feline upper respiratory tract disease (URTD) and ocular disease. Currently, polymerase chain reaction (PCR) remains the gold standard diagnostic tool for FHV-1 infection but is relatively expensive, requires well-equipped laboratories and is not suitable for field tests. Recombinase polymerase amplification (RPA), an isothermal gene amplification technology, has been explored for the molecular diagnosis of infectious diseases. In this study, an exo-RPA assay for FHV-1 detection was developed and validated. Primers targeting specifically the thymidine kinase (TK) gene of FHV-1 were designed. The RPA reaction was performed successfully at 39°C and the results were obtained within 20 min. Using different copy numbers of recombinant plasmid DNA that contains the TK gene as template, we showed the detection limit of exo-RPA was 102 copies DNA/reaction, the same as that of real time PCR. The exo-RPA assay did not cross-detect feline panleukopenia virus, feline calicivirus, bovine herpesvirus-1, pseudorabies virus or chlamydia psittaci, a panel of pathogens important in feline URTD or other viruses in Alphaherpesvirinae, demonstrating high specificity. The assay was validated by testing 120 nasal and ocular conjunctival swabs of cats, and the results were compared with those obtained with real-time PCR. Both assays provided the same testing results in the clinical samples. Compared with real time PCR, the exo-RPA assay uses less-complex equipment that is portable and the reaction is completed much faster. Additionally, commercial RPA reagents in vacuum-sealed pouches can tolerate temperatures up to room temperature for days without loss of activity, suitable for shipment and storage for field tests. Taken together, the exo-RPA assay is a simple, fast and cost-effective alternative to real time PCR, suitable for use in less advanced laboratories and for field detection of FHV-1 infection. PMID:28045956

In polycystic ovary syndrome, adrenal steroids are regulated differently in the morning versus in response to nutrient intake

USDA-ARS?s Scientific Manuscript database

The objective of this study was to investigate adrenal steroid regulation in Polycystic Ovary Syndrome (PCOS). A 5-h oral glucose tolerance test (OGTT) and a 3-h frequently sampled-intravenous glucose tolerance test (FSIVGTT) were administered to 30 patients with PCOS. Anthropometric parameters (hei...

PRN 2007-2: Guidance on Small-Scale Field Testing and Low-level Presence in Food of Plant-Incorporated Protectants (PIPs)

EPA Pesticide Factsheets

This notice clarifies how EPA ensures the safety of residues of PIPs possibly present in food or feed and when a tolerance or tolerance exemption would be required for field tests for biotechnology-derived food and feed crop plants containing PIPs.

Intelligent fault-tolerant controllers

NASA Technical Reports Server (NTRS)

Huang, Chien Y.

1987-01-01

A system with fault tolerant controls is one that can detect, isolate, and estimate failures and perform necessary control reconfiguration based on this new information. Artificial intelligence (AI) is concerned with semantic processing, and it has evolved to include the topics of expert systems and machine learning. This research represents an attempt to apply AI to fault tolerant controls, hence, the name intelligent fault tolerant control (IFTC). A generic solution to the problem is sought, providing a system based on logic in addition to analytical tools, and offering machine learning capabilities. The advantages are that redundant system specific algorithms are no longer needed, that reasonableness is used to quickly choose the correct control strategy, and that the system can adapt to new situations by learning about its effects on system dynamics.

Ketamine coadministration attenuates morphine tolerance and leads to increased brain concentrations of both drugs in the rat

PubMed Central

Lilius, T O; Jokinen, V; Neuvonen, M S; Niemi, M; Kalso, E A; Rauhala, P V

2015-01-01

Background and Purpose The effects of ketamine in attenuating morphine tolerance have been suggested to result from a pharmacodynamic interaction. We studied whether ketamine might increase brain morphine concentrations in acute coadministration, in morphine tolerance and morphine withdrawal. Experimental Approach Morphine minipumps (6 mg·day–1) induced tolerance during 5 days in Sprague–Dawley rats, after which s.c. ketamine (10 mg·kg–1) was administered. Tail flick, hot plate and rotarod tests were used for behavioural testing. Serum levels and whole tissue brain and liver concentrations of morphine, morphine-3-glucuronide, ketamine and norketamine were measured using HPLC-tandem mass spectrometry. Key Results In morphine-naïve rats, ketamine caused no antinociception whereas in morphine-tolerant rats there was significant antinociception (57% maximum possible effect in the tail flick test 90 min after administration) lasting up to 150 min. In the brain of morphine-tolerant ketamine-treated rats, the morphine, ketamine and norketamine concentrations were 2.1-, 1.4- and 3.4-fold, respectively, compared with the rats treated with morphine or ketamine only. In the liver of morphine-tolerant ketamine-treated rats, ketamine concentration was sixfold compared with morphine-naïve rats. After a 2 day morphine withdrawal period, smaller but parallel concentration changes were observed. In acute coadministration, ketamine increased the brain morphine concentration by 20%, but no increase in ketamine concentrations or increased antinociception was observed. Conclusions and Implications The ability of ketamine to induce antinociception in rats made tolerant to morphine may also be due to increased brain concentrations of morphine, ketamine and norketamine. The relevance of these findings needs to be assessed in humans. PMID:25297798

Likelihood of myocardial infarction during stroke rehabilitation preceded by cardiovascular screening and an exercise tolerance test: the Locomotor Experience Applied Post-Stroke (LEAPS) trial.

PubMed

Nadeau, Stephen E; Rose, Dorian Kay; Dobkin, Bruce; Wu, Samuel S; Dai, Yufeng E; Schofield, Richard; Duncan, Pamela W

2014-12-01

Coronary artery disease is highly prevalent in patients with stroke, but because revascularization does not improve major clinical outcomes in patients with stable coronary artery disease relative to intensive medical therapy, routine evaluation for this disease is not warranted in stroke patients. However, it might be warranted in patients destined to undergo vigorous physical therapy. The Locomotor Experience Applied Post-Stroke study, a randomized controlled trial of 408 participants that tested the relative efficacy of two rehabilitation techniques on functional walking level, provided the opportunity to address this question. The study aims to test the efficacy of screening for cardiovascular disease and an exercise tolerance test in assuring safety among patients undergoing vigorous rehabilitation for gait impairment. All participants were screened for serious cardiovascular and pulmonary conditions. At six-weeks poststroke, they also completed a cardiovascular screening inventory and underwent an exercise tolerance test involving bicycle ergometry. Participants received 36, 90-min sessions of a prescribed physical therapy (three per week), initiated at either two-months or six-months poststroke. Twenty-nine participants were excluded on the basis of the cardiac screening questionnaire, and 15 failed the exercise tolerance test for cardiovascular reasons. No participant experienced a cardiac event during a treatment session. Two participants experienced myocardial infarctions, but continued in the trial. In three additional participants, myocardial infarctions caused or contributed to death. The combination of a negative cardiac screen and the absence of exercise tolerance test failure appeared to have a high negative predictive value for cardiac events during treatment, despite the likelihood of a high prevalence of coronary artery disease in our population. © 2014 World Stroke Organization.

Eigenstructure Assignment for Fault Tolerant Flight Control Design

NASA Technical Reports Server (NTRS)

Sobel, Kenneth; Joshi, Suresh (Technical Monitor)

2002-01-01

In recent years, fault tolerant flight control systems have gained an increased interest for high performance military aircraft as well as civil aircraft. Fault tolerant control systems can be described as either active or passive. An active fault tolerant control system has to either reconfigure or adapt the controller in response to a failure. One approach is to reconfigure the controller based upon detection and identification of the failure. Another approach is to use direct adaptive control to adjust the controller without explicitly identifying the failure. In contrast, a passive fault tolerant control system uses a fixed controller which achieves acceptable performance for a presumed set of failures. We have obtained a passive fault tolerant flight control law for the F/A-18 aircraft which achieves acceptable handling qualities for a class of control surface failures. The class of failures includes the symmetric failure of any one control surface being stuck at its trim value. A comparison was made of an eigenstructure assignment gain designed for the unfailed aircraft with a fault tolerant multiobjective optimization gain. We have shown that time responses for the unfailed aircraft using the eigenstructure assignment gain and the fault tolerant gain are identical. Furthermore, the fault tolerant gain achieves MIL-F-8785C specifications for all failure conditions.

Constraints on the evolution of tolerance to herbicide in the common morning glory: resistance and tolerance are mutually exclusive.

PubMed

Baucom, Regina S; Mauricio, Rodney

2008-11-01

Evolutionary biologists explain the maintenance of intermediate levels of defense in plant populations as being due to trade-offs, or negative genetic covariances among ecologically important traits. Attempts at detecting trade-offs as constraints on the evolution of defense have not always been successful, leading some to conclude that such trade-offs rarely explain current levels of defense in the population. Using the agricultural pest Ipomoea purpurea, we measured correlations between traits involved in defense to glyphosate, the active ingredient in Roundup, a widely used herbicide. We found significant allocation costs of tolerance, as well as trade-offs between resistance and two measures of tolerance to glyphosate. Selection on resistance and tolerance exhibited differing patterns: tolerance to leaf damage was under negative directional selection, whereas resistance was under positive directional selection. The joint pattern of selection on resistance and tolerance to leaf damage indicated the presence of alternate peaks in the fitness landscape such that a combination of either high tolerance and low resistance, or high resistance and low tolerance was favored. The widespread use of this herbicide suggests that it is likely an important selective agent on weed populations. Understanding the evolutionary dynamics of herbicide defense traits is thus of increasing importance in the context of human-mediated evolution.

Life-cycle changes and zinc shortage in cadmium-tolerant midges, Chironomus riparius (Diptera), reared in the absence of cadmium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Postma, J.F.; Mol, S.; Larsen, H.

1995-01-01

Adaptation to selected metals is known to modify life-cycle characteristics of some invertebrates and can modify the response to other metals. The reverse process, i.e., adaptation to nonpolluted conditions in a metal-tolerant strain, was studied here for a cadmium-tolerant population of the midge Chironomus riparius to detect whether this backward adaptation followed the same lines. It appeared that cadmium-tolerant populations, reared in the absence of cadmium, continued to suffer from high mortality rates and lowered larval growth rates and reproductive success. Also, some cadmium-tolerant populations accumulated more zinc than did nontolerant populations. Successive experiments in which both cadmium-tolerant and nontolerantmore » populations were exposed to zinc indicated that the reduced growth rate and reproduction were a direct consequence of zinc shortage in tolerant midges reared in the absence of cadmium. Mortality among cadmium-tolerant midges was, however, not lowered by zinc exposure and, judged by their high mortality rates, these midges were even more sensitive to zinc than were nontolerant chironomids. It was concluded that cadmium-tolerant chironomid populations recovering from prolonged exposure are affected by an increased need for zinc as well as by an increased mortality rate as a direct consequence of their earlier adaptation process.« less

Genetic diversity, breed composition and admixture of Kenyan domestic pigs.

PubMed

Mujibi, Fidalis Denis; Okoth, Edward; Cheruiyot, Evans K; Onzere, Cynthia; Bishop, Richard P; Fèvre, Eric M; Thomas, Lian; Masembe, Charles; Plastow, Graham; Rothschild, Max

2018-01-01

The genetic diversity of African pigs, whether domestic or wild has not been widely studied and there is very limited published information available. Available data suggests that African domestic pigs originate from different domestication centers as opposed to international commercial breeds. We evaluated two domestic pig populations in Western Kenya, in order to characterize the genetic diversity, breed composition and admixture of the pigs in an area known to be endemic for African swine fever (ASF). One of the reasons for characterizing these specific populations is the fact that a proportion of indigenous pigs have tested ASF virus (ASFv) positive but do not present with clinical symptoms of disease indicating some form of tolerance to infection. Pigs were genotyped using either the porcine SNP60 or SNP80 chip. Village pigs were sourced from Busia and Homabay counties in Kenya. Because bush pigs (Potamochoerus larvatus) and warthogs (Phacochoerus spp.) are known to be tolerant to ASFv infection (exhibiting no clinical symptoms despite infection), they were included in the study to assess whether domestic pigs have similar genomic signatures. Additionally, samples representing European wild boar and international commercial breeds were included as references, given their potential contribution to the genetic make-up of the target domestic populations. The data indicate that village pigs in Busia are a non-homogenous admixed population with significant introgression of genes from international commercial breeds. Pigs from Homabay by contrast, represent a homogenous population with a "local indigenous' composition that is distinct from the international breeds, and clusters more closely with the European wild boar than African wild pigs. Interestingly, village pigs from Busia that tested negative by PCR for ASFv genotype IX, had significantly higher local ancestry (>54%) compared to those testing positive, which contained more commercial breed gene introgression. This may have implication for breed selection and utilization in ASF endemic areas. A genome wide scan detected several regions under preferential selection with signatures for pigs from Busia and Homabay being very distinct. Additionally, there was no similarity in specific genes under selection between the wild pigs and domestic pigs despite having some broad areas under similar selection signatures. These results provide a basis to explore possible genetic determinants underlying tolerance to infection by ASFv genotypes and suggests multiple pathways for genetically mediated ASFv tolerance given the diversity of selection signatures observed among the populations studied.

The DIAMIND study: postpartum SMS reminders to women who have had gestational diabetes mellitus to test for type 2 diabetes: a randomised controlled trial - study protocol.

PubMed

Heatley, Emer; Middleton, Philippa; Hague, William; Crowther, Caroline

2013-04-12

Postpartum follow up of women who have been found to have gestational diabetes during pregnancy is essential because of the strong association of gestational diabetes with subsequent type 2 diabetes. Postal reminders have been shown to increase significantly attendance for oral glucose tolerance testing postpartum. It is possible that a short message service (text) reminder system may also be effective. This trial aims to assess whether a text message reminder system for women who have experienced gestational diabetes in their index pregnancy will increase attendance for oral glucose tolerance testing within six months after birth. Single centre (Women's and Children's Hospital, South Australia), parallel group randomised controlled trial. Women diagnosed with gestational diabetes in their index pregnancy (oral glucose tolerance test with fasting glucose ≥ 5.5 mmol/L and/or two hour glucose ≥ 7.8 mmol/L), with access to a mobile phone, whose capillary blood glucose profile measurements prior to postnatal discharge are all normal (fasting glucose < 6.0 mmol/L, postprandial glucoses < 8.0 mmol/L). Pregestational diabetes mellitus, triplet/higher order multiple birth or stillbirth in the index pregnancy, requirement for interpreter.Trial entry and randomisation: Allocation to intervention will be undertaken using a telephone randomisation service (computer-generated random number sequence generation, with balanced variable blocks, and stratification by insulin requirement).Study groups: Women in the intervention group will receive a text reminder to attend for an oral glucose tolerance test at 6 weeks postpartum, with further reminders at 3 months and 6 months if they do not respond to indicate test completion. Women in the control group will receive a single text message reminder at 6 months postpartum.Blinding: Baseline data collection will be undertaken blinded. Blinding of participants and blinded collection of primary outcome data will not be possible for this study.Primary study outcome: Attendance for the oral glucose tolerance test within 6 months postpartum. 276 subjects will be required to show an 18% absolute increase in the rate of attendance (α=0.05 two tailed, β=80%, 5% loss to follow up) from 37% to 55% in the intervention group. Given the heightened risk of impaired glucose tolerance and type 2 diabetes in women who have had gestational diabetes, ensuring the highest possible rate of attendance for postpartum glucose tolerance testing, so that early diagnosis and intervention can occur, is important. A text message reminder system may prove to be an effective method for achieving improved attendance for such testing. This randomised controlled trial will assess whether such a system will increase rates of attendance for postpartum oral glucose tolerance testing in women who have experienced gestational diabetes. Australian New Zealand Clinical Trials Registry - ACTRN12612000621819.

Ectomycorrhizal inoculation with Pisolithus tinctorius reduces stress induced by drought in cork oak.

PubMed

Sebastiana, Mónica; da Silva, Anabela Bernardes; Matos, Ana Rita; Alcântara, André; Silvestre, Susana; Malhó, Rui

2018-04-01

We investigated whether the performance of cork oak under drought could be improved by colonization with the ectomycorrhizal fungus Pisolithus tinctorius. Results show that inoculation alone had a positive effect on plant height, shoot biomass, shoot basal diameter, and root growth. Under drought, root growth of mycorrhizal plants was significantly increased showing that inoculation was effective in increasing tolerance to drought. In accordance, mycorrhizal plants subjected to drought showed less symptoms of stress when compared to non-mycorrhizal plants, such as lower concentration of soluble sugars and starch, increased ability to maintain fatty acid content and composition, and increased unsaturation level of membrane lipids. After testing some of the mechanisms suggested to contribute to the enhanced tolerance of mycorrhizal plants to drought, we could not find any by which Pisolithus tinctorius could benefit cork oak, at least under the drought conditions imposed in our experiment. Inoculation did not increase photosynthesis under drought, suggesting no effect in sustaining stomatal opening at low soil water content. Similarly, plant water status was not affected by inoculation suggesting that P. tinctorius does not contribute to an increased plant water uptake during drought. Inoculation did increase nitrogen concentration in plants but it was independent of the water status. Furthermore, no significant mycorrhizal effect on drought-induced ROS production or osmotic adjustment was detected, suggesting that these factors are not important for the improved drought tolerance triggered by P. tinctorius.

Inefficient skeletal muscle oxidative function flanks impaired motor neuron recruitment in Amyotrophic Lateral Sclerosis during exercise.

PubMed

Lanfranconi, F; Ferri, A; Corna, G; Bonazzi, R; Lunetta, C; Silani, V; Riva, N; Rigamonti, A; Maggiani, A; Ferrarese, C; Tremolizzo, L

2017-06-07

This study aimed to evaluate muscle oxidative function during exercise in amyotrophic lateral sclerosis patients (pALS) with non-invasive methods in order to assess if determinants of reduced exercise tolerance might match ALS clinical heterogeneity. 17 pALS, who were followed for 4 months, were compared with 13 healthy controls (CTRL). Exercise tolerance was assessed by an incremental exercise test on cycle ergometer measuring peak O 2 uptake ([Formula: see text]O 2peak ), vastus lateralis oxidative function by near infrared spectroscopy (NIRS) and breathing pattern ([Formula: see text]E peak ). pALS displayed: (1) 44% lower [Formula: see text]O 2peak vs. CTRL (p < 0.0001), paralleled by a 43% decreased peak skeletal muscle oxidative function (p < 0.01), with a linear regression between these two variables (r 2  = 0.64, p < 0.0001); (2) 46% reduced [Formula: see text]E peak vs. CTRL (p < 0.0001), achieved by using an inefficient breathing pattern (increasing respiratory frequency) from the onset until the end of exercise. Inefficient skeletal muscle O 2 function, when flanking the impaired motor units recruitment, is a major determinant of pALS clinical heterogeneity and working capacity exercise tolerance. CPET and NIRS are useful tools for detecting early stages of oxidative deficiency in skeletal muscles, disclosing individual impairments in the O 2 transport and utilization chain.

Shuttle filter study. Volume 3: Appendix

NASA Technical Reports Server (NTRS)

1974-01-01

Test data obtained from flow resistance and contaminant tolerance tests on the various porous media evaluated in the different fluids are presented in both graphical and tabular forms. Test procedures for both flow resistance and contaminant tolerance testing are presented, and the development of a system for continuously adding contaminant at a predetermined rate to a flowing fluid stream is described. Also included is a section describing the development effort of the self-indexing filter. This concept was adapted during this program for various shuttle applications.

Computing in the presence of soft bit errors. [caused by single event upset on spacecraft

NASA Technical Reports Server (NTRS)

Rasmussen, R. D.

1984-01-01

It is shown that single-event-upsets (SEUs) due to cosmic rays are a significant source of single bit error in spacecraft computers. The physical mechanism of SEU, electron hole generation by means of Linear Energy Transfer (LET), it discussed with reference made to the results of a study of the environmental effects on computer systems of the Galileo spacecraft. Techniques for making software more tolerant of cosmic ray effects are considered, including: reducing the number of registers used by the software; continuity testing of variables; redundant execution of major procedures for error detection; and encoding state variables to detect single-bit changes. Attention is also given to design modifications which may reduce the cosmic ray exposure of on-board hardware. These modifications include: shielding components operating in LEO; removing low-power Schottky parts; and the use of CMOS diodes. The SEU parameters of different electronic components are listed in a table.

Ethnic differences in cross-sectional associations between impaired glucose regulation, identified by oral glucose tolerance test or HbA1c values, and cardiovascular disease in a cohort of European and South Asian origin.

PubMed

Eastwood, S V; Tillin, T; Mayet, J; Shibata, D K; Wright, A; Heasman, J; Beauchamp, N; Forouhi, N G; Hughes, A D; Chaturvedi, N

2016-03-01

We contrasted impaired glucose regulation (prediabetes) prevalence, defined according to oral glucose tolerance test or HbA1c values, and studied cross-sectional associations between prediabetes and subclinical/clinical cardiovascular disease (CVD) in a cohort of European and South Asian origin. For 682 European and 520 South Asian men and women, aged 58-85 years, glycaemic status was determined by oral glucose tolerance test or HbA1c thresholds. Questionnaires, record review, coronary artery calcification scores and cerebral magnetic resonance imaging established clinical plus subclinical coronary heart and cerebrovascular disease. Prediabetes was more prevalent in South Asian participants when defined by HbA1c rather than by oral glucose tolerance test criteria. Accounting for age, sex, smoking, systolic blood pressure, triglycerides and waist-hip ratio, prediabetes was associated with coronary heart disease and cerebrovascular disease in European participants, most obviously when defined by HbA1c rather than by oral glucose tolerance test [odds ratios for HbA1c -defined prediabetes 1.60 (95% CI 1.07, 2.39) for coronary heart disease and 1.57 (95% CI 1.00, 2.51) for cerebrovascular disease]. By contrast, non-significant associations were present between oral glucose tolerance test-defined prediabetes only and coronary heart disease [odds ratio 1.41 (95% CI 0.84, 2.36)] and HbA1c -defined prediabetes only and cerebrovascular disease [odds ratio 1.39 (95% CI 0.69, 2.78)] in South Asian participants. Prediabetes defined by HbA1c or oral glucose tolerance test criteria was associated with cardiovascular disease (defined as coronary heart and/or cerebrovascular disease) in Europeans [odds ratio 1.95 (95% CI 1.31, 2.91) for HbA1c prediabetes criteria] but not in South Asian participants [odds ratio 1.00 (95% CI 0.62, 2.66); ethnicity interaction P = 0.04]. Prediabetes appeared to be less associated with cardiovascular disease in the South Asian than in the European group. These findings have implications for screening, and early cardiovascular prevention strategies in South Asian populations. © 2015 The Authors. Diabetic Medicine published by John Wiley & Sons Ltd on behalf of Diabetes UK.

Zero Tolerance: Don't Be a Square!

ERIC Educational Resources Information Center

Warren, Thomas P.; Rich, Wesley D.; Townsend, Megan; Mohrbutter, Trent L.; Brinson, Kenneth H.

2010-01-01

At Wentworth, rule violations are normally minor in nature and handled at the private school administration's discretion. A recent event involving the possession and use of alcohol during an off-campus school overnight activity leads to the development of a zero tolerance substance abuse policy. The zero tolerance policy is tested by one of the…

Directionality between Tolerance of Deviance and Deviant Behavior Is Age-Moderated in Chronically Stressed Youth

ERIC Educational Resources Information Center

Ridenour, Ty A.; Caldwell, Linda L.; Coatsworth, J. Douglas; Gold, Melanie A.

2011-01-01

Problem behavior theory posits that tolerance of deviance is an antecedent to antisocial behavior and substance use. In contrast, cognitive dissonance theory implies that acceptability of a behavior may increase after experiencing the behavior. Using structural equation modeling, this investigation tested whether changes in tolerance of deviance…

Using transcriptional profiling to develop a diagnostic test of operational tolerance in liver transplant recipients.

PubMed

Martínez-Llordella, Marc; Lozano, Juan José; Puig-Pey, Isabel; Orlando, Giuseppe; Tisone, Giuseppe; Lerut, Jan; Benítez, Carlos; Pons, Jose Antonio; Parrilla, Pascual; Ramírez, Pablo; Bruguera, Miquel; Rimola, Antoni; Sánchez-Fueyo, Alberto

2008-08-01

A fraction of liver transplant recipients are able to discontinue all immunosuppressive therapies without rejecting their grafts and are said to be operationally tolerant to the transplant. However, accurate identification of these recipients remains a challenge. To design a clinically applicable molecular test of operational tolerance in liver transplantation, we studied transcriptional patterns in the peripheral blood of 80 liver transplant recipients and 16 nontransplanted healthy individuals by employing oligonucleotide microarrays and quantitative real-time PCR. This resulted in the discovery and validation of several gene signatures comprising a modest number of genes capable of identifying tolerant and nontolerant recipients with high accuracy. Multiple peripheral blood lymphocyte subsets contributed to the tolerance-associated transcriptional patterns, although NK and gammadeltaTCR+ T cells exerted the predominant influence. These data suggest that transcriptional profiling of peripheral blood can be employed to identify liver transplant recipients who can discontinue immunosuppressive therapy and that innate immune cells are likely to play a major role in the maintenance of operational tolerance in liver transplantation.

Identification of Rhizobium phaseoli Strains That Are Tolerant or Sensitive to Soil Acidity

PubMed Central

Lowendorf, Henry S.; Alexander, Martin

1983-01-01

A study was conducted to determine whether the survival of Rhizobium phaseoli in acid soils could be predicted on the basis of the tolerance of the organism to acidity in culture. Of 16 strains tested, all grew in culture at pH 4.6, but only those that grew at pH 3.8 survived in soils having pH values of 4.1 to 4.6. Strains that tolerated the lowest pH values in culture were tolerant of the highest aluminum concentrations. In one acid soil, an acid-tolerant strain was unable to survive in numbers greater than 100/g, but the poor survival was not related to the level of extractable aluminum or manganese in the soil. Reproduction of an acid-tolerant strain of R. phaseoli was enhanced in the rhizosphere of Phaseolus vulgaris in both acid and limed soils, but stimulation of an acid-sensitive strain by the plant occurred only in the limed soil. These results indicate that cultural tests can be used to predict the ability of R. phaseoli to survive in acid soil. PMID:16346239

Algorithm-Based Fault Tolerance Integrated with Replication

NASA Technical Reports Server (NTRS)

Some, Raphael; Rennels, David

2008-01-01

In a proposed approach to programming and utilization of commercial off-the-shelf computing equipment, a combination of algorithm-based fault tolerance (ABFT) and replication would be utilized to obtain high degrees of fault tolerance without incurring excessive costs. The basic idea of the proposed approach is to integrate ABFT with replication such that the algorithmic portions of computations would be protected by ABFT, and the logical portions by replication. ABFT is an extremely efficient, inexpensive, high-coverage technique for detecting and mitigating faults in computer systems used for algorithmic computations, but does not protect against errors in logical operations surrounding algorithms.

Enhanced fault-tolerant quantum computing in d-level systems.

PubMed

Campbell, Earl T

2014-12-05

Error-correcting codes protect quantum information and form the basis of fault-tolerant quantum computing. Leading proposals for fault-tolerant quantum computation require codes with an exceedingly rare property, a transversal non-Clifford gate. Codes with the desired property are presented for d-level qudit systems with prime d. The codes use n=d-1 qudits and can detect up to ∼d/3 errors. We quantify the performance of these codes for one approach to quantum computation known as magic-state distillation. Unlike prior work, we find performance is always enhanced by increasing d.

The WOMEN study: what is the optimal method for ischemia evaluation in women? A multi-center, prospective, randomized study to establish the optimal method for detection of coronary artery disease (CAD) risk in women at an intermediate-high pretest likelihood of CAD: study design.

PubMed

Mieres, Jennifer H; Shaw, Leslee J; Hendel, Robert C; Heller, Gary V

2009-01-01

Coronary artery disease remains the leading cause of morbidity and mortality in women. The optimal non-invasive test for evaluation of ischemic heart disease in women is unknown. Although current guidelines support the choice of the exercise tolerance test (ETT) as a first line test for women with a normal baseline ECG and adequate exercise capabilities, supportive data for this recommendation are controversial. The what is the optimal method for ischemia evaluation in women? (WOMEN) study was designed to determine the optimal non-invasive strategy for CAD risk detection of intermediate and high risk women presenting with chest pain or equivalent symptoms suggestive of ischemic heart disease. The study will prospectively compare the 2-year event rates in women capable of performing exercise treadmill testing or Tc-99 m tetrofosmin SPECT myocardial perfusion imaging (MPI). The study will enroll women presenting for the evaluation of chest pain or anginal equivalent symptoms who are capable of performing >5 METs of exercise while at intermediate-high pretest risk for ischemic heart disease who will be randomized to either ETT testing alone or with Tc-99 m tetrofosmin SPECT MPI. The null hypothesis for this project is that the exercise ECG has the same negative predictive value for risk detection as gated myocardial perfusion SPECT in women. The primary aim is to compare 2-year cardiac event rates in women randomized to SPECT MPI to those randomized to ETT. The WOMEN study seeks to provide objective information for guidelines for the evaluation of symptomatic women with an intermediate-high likelihood for CAD.

Processing of silicon solar cells by ion implantation and laser annealing

NASA Technical Reports Server (NTRS)

Minnucci, J. A.; Matthei, K. W.; Greenwald, A. C.

1981-01-01

Methods to improve the radiation tolerance of silicon cells for spacecraft use are described. The major emphasis of the program was to reduce the process-induced carbon and oxygen impurities in the junction and base regions of the solar cell, and to measure the effect of reduced impurity levels on the radiation tolerance of cells. Substrates of 0.1, 1.0 and 10.0 ohm-cm float-zone material were used as starting material in the process sequence. High-dose, low-energy ion implantation was used to form the junction in n+p structures. Implant annealing was performed by conventional furnace techniques and by pulsed laser and pulsed electron beam annealing. Cells were tested for radiation tolerance at Spire and NASA-LeRC. After irradiation by 1 MeV electrons to a fluence of 10 to the 16th power per sq cm, the cells tested at Spire showed no significant process induced variations in radiation tolerance. However, for cells tested at Lewis to a fluence of 10 to the 15th power per sq cm, ion-implanted cells annealed in vacuum by pulsed electron beam consistently showed the best radiation tolerance for all cell resistivities.

Prenatal tolerance induction: relationship between cell dose, marrow T-cells, chimerism, and tolerance.

PubMed

Chen, Jeng-Chang; Chang, Ming-Ling; Huang, Shiu-Feng; Chang, Pei-Yeh; Muench, Marcus O; Fu, Ren-Huei; Ou, Liang-Shiou; Kuo, Ming-Ling

2008-01-01

It was reported that the dose of self-antigens can determine the consequence of deletional tolerance and donor T cells are critical for tolerance induction in mixed chimeras. This study aimed at assessing the effect of cell doses and marrow T cells on engraftment and tolerance induction after prenatal bone marrow transplantation. Intraperitoneal cell transplantation was performed in FVB/N (H-2K(q)) mice at gestational day 14 with escalating doses of adult C57BL/6 (H-2K(b)) marrows. Peripheral chimerism was examined postnatally by flow cytometry and tolerance was tested by skin transplantation. Transplantation of light-density marrow cells showed a dose response. High-level chimerism emerged with a threshold dose of 5.0 x 10(6) and host leukocytes could be nearly replaced at a dose of 7.5-10.0 x 10(6). High-dose transplants conferred a steady long-lasting donor-specific tolerance but were accompanied by >50% incidence of graft-versus-host disease. Depletion of marrow T cells lessened graft-versus-host disease to the detriment of engraftment. With low-level chimerism, tolerance was a graded phenomenon dependent upon the level of chimerism. Durable chimerism within 6 months required a threshold of > or = 2% chimerism at 1 month of age and predicted a 50% chance of long-term tolerance, whereas transient chimerism (<2%) only caused hyporesponsiveness to the donor. Tolerance induction did not succeed without peripheral chimerism even if a large amount of injected donor cells persisted in the peritoneum. Neither did an increase in cell doses or donor T-cell contents benefit skin graft survivals unless it had substantially improved peripheral chimerism. Thus, peripheral chimerism level can be a simple and straightforward test to predict the degree of prenatal immune tolerance.

Fuel containment, lightning protection and damage tolerance in large composite primary aircraft structures

NASA Technical Reports Server (NTRS)

Griffin, Charles F.; James, Arthur M.

1985-01-01

The damage-tolerance characteristics of high strain-to-failure graphite fibers and toughened resins were evaluated. Test results show that conventional fuel tank sealing techniques are applicable to composite structures. Techniques were developed to prevent fuel leaks due to low-energy impact damage. For wing panels subjected to swept stroke lightning strikes, a surface protection of graphite/aluminum wire fabric and a fastener treatment proved effective in eliminating internal sparking and reducing structural damage. The technology features developed were incorporated and demonstrated in a test panel designed to meet the strength, stiffness, and damage tolerance requirements of a large commercial transport aircraft. The panel test results exceeded design requirements for all test conditions. Wing surfaces constructed with composites offer large weight savings if design allowable strains for compression can be increased from current levels.

A Primer on Architectural Level Fault Tolerance

NASA Technical Reports Server (NTRS)

Butler, Ricky W.

2008-01-01

This paper introduces the fundamental concepts of fault tolerant computing. Key topics covered are voting, fault detection, clock synchronization, Byzantine Agreement, diagnosis, and reliability analysis. Low level mechanisms such as Hamming codes or low level communications protocols are not covered. The paper is tutorial in nature and does not cover any topic in detail. The focus is on rationale and approach rather than detailed exposition.

A fault injection experiment using the AIRLAB Diagnostic Emulation Facility

NASA Technical Reports Server (NTRS)

Baker, Robert; Mangum, Scott; Scheper, Charlotte

1988-01-01

The preparation for, conduct of, and results of a simulation based fault injection experiment conducted using the AIRLAB Diagnostic Emulation facilities is described. An objective of this experiment was to determine the effectiveness of the diagnostic self-test sequences used to uncover latent faults in a logic network providing the key fault tolerance features for a flight control computer. Another objective was to develop methods, tools, and techniques for conducting the experiment. More than 1600 faults were injected into a logic gate level model of the Data Communicator/Interstage (C/I). For each fault injected, diagnostic self-test sequences consisting of over 300 test vectors were supplied to the C/I model as inputs. For each test vector within a test sequence, the outputs from the C/I model were compared to the outputs of a fault free C/I. If the outputs differed, the fault was considered detectable for the given test vector. These results were then analyzed to determine the effectiveness of some test sequences. The results established coverage of selt-test diagnostics, identified areas in the C/I logic where the tests did not locate faults, and suggest fault latency reduction opportunities.

SU-E-T-468: Implementation of the TG-142 QA Process for Seven Linacs with Enhanced Beam Conformance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woollard, J; Ayan, A; DiCostanzo, D

2015-06-15

Purpose: To develop a TG-142 compliant QA process for 7 Varian TrueBeam linear accelerators (linacs) with enhanced beam conformance and dosimetrically matched beam models. To ensure consistent performance of all 7 linacs, the QA process should include a common set of baseline values for use in routine QA on all linacs. Methods: The TG 142 report provides recommended tests, tolerances and frequencies for quality assurance of medical accelerators. Based on the guidance provided in the report, measurement tests were developed to evaluate each of the applicable parameters listed for daily, monthly and annual QA. These tests were then performed onmore » each of our 7 new linacs as they came on line at our institution. Results: The tolerance values specified in TG-142 for each QA test are either absolute tolerances (i.e. ±2mm) or require a comparison to a baseline value. The results of our QA tests were first used to ensure that all 7 linacs were operating within the suggested tolerance values provided in TG −142 for those tests with absolute tolerances and that the performance of the linacs was adequately matched. The QA test results were then used to develop a set of common baseline values for those QA tests that require comparison to a baseline value at routine monthly and annual QA. The procedures and baseline values were incorporated into a spreadsheets for use in monthly and annual QA. Conclusion: We have developed a set of procedures for daily, monthly and annual QA of our linacs that are consistent with the TG-142 report. A common set of baseline values was developed for routine QA tests. The use of this common set of baseline values for comparison at monthly and annual QA will ensure consistent performance of all 7 linacs.« less

Metabolic Syndrome Does Not Detect Metabolic Risk in African Men Living in the U.S.

PubMed Central

Ukegbu, Ugochi J.; Castillo, Darleen C.; Knight, Michael G.; Ricks, Madia; Miller, Bernard V.; Onumah, Barbara M.; Sumner, Anne E.

2011-01-01

OBJECTIVE Metabolic risk and metabolic syndrome (MetSyn) prevalence were compared in Africans who immigrated to the U.S. and African Americans. If MetSyn were an effective predictor of cardiometabolic risk, then the group with a worse metabolic risk profile would have a higher rate of MetSyn. RESEARCH DESIGN AND METHODS Cross-sectional analyses were performed on 95 men (39 Africans, 56 African Americans, age 38 ± 6 years [mean ± SD]). Glucose tolerance was determined by oral glucose tolerance test, visceral adipose tissue (VAT) was determined by computerized tomography, and MetSyn was determined by the presence of three of five factors: central obesity, hypertriglyceridemia, low levels of HDL cholesterol, hypertension, and fasting hyperglycemia. RESULTS MetSyn prevalence was similar in Africans and African Americans (10 vs. 13%, P = 0.74), but hypertension, glycemia (fasting and 2-h glucose), and VAT were higher in Africans. CONCLUSIONS African immigrants have a worse metabolic profile than African Americans but a similar prevalence of MetSyn. Therefore, MetSyn may underpredict metabolic risk in Africans. PMID:21873563

Application of Bacillus sp. TAT105 to reduce ammonia emissions during pilot-scale composting of swine manure.

PubMed

Kuroda, Kazutaka; Tanaka, Akihiro; Furuhashi, Kenich; Nakasaki, Kiyohiko

2017-12-01

Thermophilic ammonium-tolerant bacterium Bacillus sp. TAT105 grows and reduces ammonia (NH 3 ) emissions by assimilating ammonium nitrogen during composting of swine feces. To evaluate the efficacy of a biological additive containing TAT105 at reducing NH 3 emissions, composting tests of swine manure on a pilot scale (1.8 m 3 ) were conducted. In the TAT105-added treatment, NH 3 emissions and nitrogen loss were lower than those in the control treatment without TAT105. No significant difference was detected in losses in the weight and volatile solids between the treatments. Concentration of thermophilic ammonium-tolerant bacteria in the compost increased in both treatments at the initial stage of composting. In the TAT105-added treatment, bacterial concentration reached ~10 9 colony-forming units per gram of dry matter, several-fold higher than that in the control and stayed at the same level until the end. These results suggest that TAT105 grows during composting and reduces NH 3 emissions in TAT105-added treatment.

Effect of polymer viscosity on physicochemical properties and ocular tolerance of FB-loaded PLGA nanospheres.

PubMed

Araújo, J; Vega, E; Lopes, C; Egea, M A; Garcia, M L; Souto, E B

2009-08-01

Poly(lactide-co-glycolide) acid (PLGA) nanospheres incorporating flurbiprofen (FB) were produced by the solvent displacement technique, for ocular applications aiming to avoid/minimize inflammation induced by surgical trauma. In this work, a PLGA of low viscosity has been tested and the results obtained were compared with those previously reported by Vega et al. The physicochemical properties of the developed formulations were evaluated by measuring particle size, zeta potential and FB entrapment efficiency, showing no significant differences. Release studies demonstrated that the formulation produced with PLGA of higher viscosity revealed a slower drug release rate. Stability analysis, for a period of 75 days, was performed using three complementary methods: (i) turbidity experiments using a Turbiscan optical analyzer, (ii) particle size measurements, and (iii) zeta potential analysis. The results revealed long-term physicochemical stability suitability for ophthalmic use, being independent from the polymer viscosity. The ocular tolerance was assessed by an alternative in vitro method to animal experimentation, the HET-CAM. For all developed formulations no ocular irritancy has been detected.

Mechanical performance of pyrolytic carbon in prosthetic heart valve applications.

PubMed

Cao, H

1996-06-01

An experimental procedure has been developed for rigorous characterization of the fracture resistance and fatigue crack extension in pyrolytic carbon for prosthetic heart valve application. Experiments were conducted under sustained and cyclic loading in a simulated biological environment using Carbomedics Pyrolite carbon. While the material was shown to have modest fracture toughness, it exhibited excellent resistance to subcritical crack growth. The crack growth kinetics in pyrolytic carbon were formulated using a phenomenological description. A fatigue threshold was observed below which the crack growth rate diminishes. A damage tolerance concept based on fracture mechanics was used to develop an engineering design approach for mechanical heart valve prostheses. In particular, a new quantity, referred to as the safe-life index, was introduced to assess the design adequacy against subcritical crack growth in brittle materials. In addition, a weakest-link statistical description of the fracture strength is provided and used in the design of component proof-tests. It is shown that the structural reliability of mechanical heart valves can be assured by combining effective flaw detection and manufacturing quality control with adequate damage tolerance design.

Mechanisms underlying sodium nitroprusside-induced tolerance in the mouse aorta: Role of ROS and cyclooxygenase-derived prostanoids.

PubMed

Diniz, Mariana C; Olivon, Vania C; Tavares, Lívia D; Simplicio, Janaina A; Gonzaga, Natália A; de Souza, Daniele G; Bendhack, Lusiane M; Tirapelli, Carlos R; Bonaventura, Daniella

2017-05-01

To determine the role of reactive oxygen species (ROS) on sodium nitroprusside (SNP)-induced tolerance. Additionally, we evaluated the role of ROS on NF-κB activation and pro-inflammatory cytokines production during SNP-induced tolerance. To induce in vitro tolerance, endothelium-intact or -denuded aortic rings isolated from male Balb-c mice were incubated for 15, 30, 45 or 60min with SNP (10nmol/L). Tolerance to SNP was observed after incubation of endothelium-denuded, but not endothelium-intact aortas for 60min with this inorganic nitrate. Pre-incubation of denuded rings with tiron (superoxide anion (O 2 - ) scavenger), and the NADPH oxidase inhibitors apocynin and atorvastatin reversed SNP-induced tolerance. l-NAME (non-selective NOS inhibitor) and l-arginine (NOS substrate) also prevented SNP-induced tolerance. Similarly, ibuprofen (non-selective cyclooxygenase (COX) inhibitor), nimesulide (selective COX-2 inhibitor), AH6809 (prostaglandin PGF 2 α receptor antagonist) or SQ29584 [PGH 2 /thromboxane TXA 2 receptor antagonist] reversed SNP-induced tolerance. Increased ROS generation was detected in tolerant arteries and both tiron and atorvastatin reversed this response. Tiron prevented tolerance-induced increase on O 2 - and hydrogen peroxide (H 2 O 2 ) levels. The increase onp65/NF-κB expression and TNF-α production in tolerant arteries was prevented by tiron. The major new finding of our study is that SNP-induced tolerance is mediated by NADPH-oxidase derived ROS and vasoconstrictor prostanoids derived from COX-2, which are capable of reducing the vasorelaxation induced by SNP. Additionally, we found that ROS mediate the activation of NF-κB and the production of TNF-α in tolerant arteries. These findings identify putative molecular mechanisms whereby SNP induces tolerance in the vasculature. Copyright © 2017 Elsevier Inc. All rights reserved.

Differential pain modulation in patients with peripheral neuropathic pain and fibromyalgia.

PubMed

Gormsen, Lise; Bach, Flemming W; Rosenberg, Raben; Jensen, Troels S

2017-12-29

Background The definition of neuropathic pain has recently been changed by the International Association for the Study of Pain. This means that conditions such as fibromyalgia cannot, as sometimes discussed, be included in the neuropathic pain conditions. However, fibromyalgia and peripheral neuropathic pain share common clinical features such as spontaneous pain and hypersensitivity to external stimuli. Therefore, it is of interest to directly compare the conditions. Material and methods In this study we directly compared the pain modulation in neuropathic pain versus fibromyalgia by recording responses to a cold pressor test in 30 patients with peripheral neuropathic pain, 28 patients with fibromyalgia, and 26 pain-free age-and gender-matched healthy controls. Patients were asked to rate their spontaneous pain on a visual analog scale (VAS (0-100 mm) immediately before and immediately after the cold pressor test. Furthermore the duration (s) of extremity immersion in cold water was used as a measure of the pain tolerance threshold, and the perceived pain intensity at pain tolerance on the VAS was recorded on the extremity in the water after the cold pressor test. In addition, thermal (thermo tester) and mechanical stimuli (pressure algometer) were used to determine sensory detection, pain detection, and pain tolerance thresholds in different body parts. All sensory tests were done by the same examiner, in the same room, and with each subject in a supine position. The sequence of examinations was the following: (1) reaction time, (2) pressure thresholds, (3) thermal thresholds, and (4) cold pressor test. Reaction time was measured to ensure that psychomotoric inhibitions did not influence pain thresholds. Results Pain modulation induced by a cold pressor test reduced spontaneous pain by 40% on average in neuropathic pain patients, but increased spontaneous pain by 2.6% in fibromyalgia patients. This difference between fibromyalgia and neuropathic pain patients was significant (P < 0.002). Fibromyalgia patients withdrew their extremity from the cold water significantly earlier than neuropathic pain patients and healthy controls; however, they had a higher perceived pain intensity on the VAS than neuropathic pain patients and control subjects. Furthermore, neuropathic pain patients had a localized hypersensitivity to mechanical and thermal stimuli in the affected area of the body. In contrast, fibromyalgia patients displayed a general hypersensitivity to mechanical and thermal stimuli when the stimuli were rated by the VAS, and hypersensitivity to some of the sensory stimuli. Conclusions These findings are the first to suggest that a conditioning stimulus evoked by a cold pressor test reduced spontaneous ongoing pain in patients with peripheral neuropathic pain, but not in fibromyalgia patients when directly compared. The current study supports the notion that fibromyalgia and neuropathic pain are distinct pain conditions with separate sensory patterns and dysfunctions in pain-modulating networks. Fibromyalgia should therefore not, as sometimes discussed, be included in NP conditions. Implications On the basis of the findings, it is of interest to speculate on the underlying mechanisms. The results are consistent with the idea that peripheral neuropathic pain is primarily driven from damaged nerve endings in the periphery, while chronic fibromyalgia pain may be a central disorder with increased activity in pain-facilitating systems.

Efficacy and local tolerability of povidone iodine and octenidine hydrochloride solution for the antiseptic preparation of the orificium urethrae.

PubMed

Rudolph, P; Fritze, F; Reimer, K; Klebingat, K J; Kramer, A

1999-01-01

In a randomized clinical study, 61 hospitalized men were examined to test the local tolerability and antimicrobial efficacy of antiseptic treatment of the genitals with povidone iodine versus octenidine hydrochloride solution. Antibacterial efficacy was established by comparing the total aerobic bacterial colony count from standardized swabs from the orificium urethrae externum before, immediately after, and 30 and 60 min after antisepsis. Tolerability was assessed by dermatoscopy, applying a scale to rate the criteria of reddening, erosions and microbleeding. pH-value was taken and the nitracin yellow test carried out at several intervals. Patients assessed sensations (itching, burning, warmth, cold tension) in visual analogue scales. The test for equivalence in efficacy of both antiseptic agents produced no significant result (P = 0.3). The sum score of tolerability produced a better result for povidone iodine. In addition, the drop in the pH value after observed antisepsis with povidone iodine provides an additional protective mechanism against bacterial colonization.

Useful method to monitor the physiological effects of alcohol ingestion by combination of micro-integrated laser Doppler blood flow meter and arm-raising test.

PubMed

Iwasaki, Wataru; Nogami, Hirofumi; Ito, Hiroki; Gotanda, Takeshi; Peng, Yao; Takeuchi, Satoshi; Furue, Masutaka; Higurashi, Eiji; Sawada, Renshi

2012-10-01

Alcohol has a variety of effects on the human body, affecting both the sympathetic and parasympathetic nervous system. We examined the peripheral blood flow of alcohol drinkers using a micro-integrated laser Doppler blood flow meter (micro-electromechanical system blood flow sensor). An increased heart rate and blood flow was recorded at the earlobe after alcohol ingestion, and we observed strong correlation between blood flow, heart rate, and breath alcohol content in light drinkers; but not heavy drinkers. We also found that the amplitude of pulse waves measured at the fingertip during an arm-raising test significantly decreased on alcohol consumption, regardless of the individual's alcohol tolerance. Our micro-electromechanical system blood flow sensor successfully detected various physiological changes in peripheral blood circulation induced by alcohol consumption.

Fracture strength of flawed cylindrical pressure vessels under cryogenic temperatures

NASA Astrophysics Data System (ADS)

Christopher, T.; Sankarnarayanasamy, K.; Nageswara Rao, B.

2002-11-01

Damage tolerant and fail-safe approaches have been employed increasingly in the design of critical engineering components. In these approaches, one has to assess the residual strength of a component with an assumed pre-existing crack. In other cases, cracks may be detected during service. Then, there is a need to evaluate the residual strength of the cracked components in order to decide whether they can be continued safely or repair and replacement are imperative. A three-parameter fracture criterion is applied to correlate the fracture data on aluminium, titanium and steel materials from test results on cylindrical tanks/pressure vessels at cryogenic temperatures. Fracture parameters to generate the failure assessment diagram are determined for the materials considered in the present study. Failure pressure estimates were found to be in good agreement with test results.

Analytical validation of a novel multiplex test for detection of advanced adenoma and colorectal cancer in symptomatic patients.

PubMed

Dillon, Roslyn; Croner, Lisa J; Bucci, John; Kairs, Stefanie N; You, Jia; Beasley, Sharon; Blimline, Mark; Carino, Rochele B; Chan, Vicky C; Cuevas, Danissa; Diggs, Jeff; Jennings, Megan; Levy, Jacob; Mina, Ginger; Yee, Alvin; Wilcox, Bruce

2018-05-30

Early detection of colorectal cancer (CRC) is key to reducing associated mortality. Despite the importance of early detection, approximately 40% of individuals in the United States between the ages of 50-75 have never been screened for CRC. The low compliance with colonoscopy and fecal-based screening may be addressed with a non-invasive alternative such as a blood-based test. We describe here the analytical validation of a multiplexed blood-based assay that measures the plasma concentrations of 15 proteins to assess advanced adenoma (AA) and CRC risk in symptomatic patients. The test was developed on an electrochemiluminescent immunoassay platform employing four multi-marker panels, to be implemented in the clinic as a laboratory developed test (LDT). Under the Clinical Laboratory Improvement Amendments (CLIA) and College of American Pathologists (CAP) regulations, a United States-based clinical laboratory utilizing an LDT must establish performance characteristics relating to analytical validity prior to releasing patient test results. This report describes a series of studies demonstrating the precision, accuracy, analytical sensitivity, and analytical specificity for each of the 15 assays, as required by CLIA/CAP. In addition, the report describes studies characterizing each of the assays' dynamic range, parallelism, tolerance to common interfering substances, spike recovery, and stability to sample freeze-thaw cycles. Upon completion of the analytical characterization, a clinical accuracy study was performed to evaluate concordance of AA and CRC classifier model calls using the analytical method intended for use in the clinic. Of 434 symptomatic patient samples tested, the percent agreement with original CRC and AA calls was 87% and 92% respectively. All studies followed CLSI guidelines and met the regulatory requirements for implementation of a new LDT. The results provide the analytical evidence to support the implementation of the novel multi-marker test as a clinical test for evaluating CRC and AA risk in symptomatic individuals. Copyright © 2018 Elsevier B.V. All rights reserved.

Plant Distribution Data Show Broader Climatic Limits than Expert-Based Climatic Tolerance Estimates

PubMed Central

Curtis, Caroline A.; Bradley, Bethany A.

2016-01-01

Background Although increasingly sophisticated environmental measures are being applied to species distributions models, the focus remains on using climatic data to provide estimates of habitat suitability. Climatic tolerance estimates based on expert knowledge are available for a wide range of plants via the USDA PLANTS database. We aim to test how climatic tolerance inferred from plant distribution records relates to tolerance estimated by experts. Further, we use this information to identify circumstances when species distributions are more likely to approximate climatic tolerance. Methods We compiled expert knowledge estimates of minimum and maximum precipitation and minimum temperature tolerance for over 1800 conservation plant species from the ‘plant characteristics’ information in the USDA PLANTS database. We derived climatic tolerance from distribution data downloaded from the Global Biodiversity and Information Facility (GBIF) and corresponding climate from WorldClim. We compared expert-derived climatic tolerance to empirical estimates to find the difference between their inferred climate niches (ΔCN), and tested whether ΔCN was influenced by growth form or range size. Results Climate niches calculated from distribution data were significantly broader than expert-based tolerance estimates (Mann-Whitney p values << 0.001). The average plant could tolerate 24 mm lower minimum precipitation, 14 mm higher maximum precipitation, and 7° C lower minimum temperatures based on distribution data relative to expert-based tolerance estimates. Species with larger ranges had greater ΔCN for minimum precipitation and minimum temperature. For maximum precipitation and minimum temperature, forbs and grasses tended to have larger ΔCN while grasses and trees had larger ΔCN for minimum precipitation. Conclusion Our results show that distribution data are consistently broader than USDA PLANTS experts’ knowledge and likely provide more robust estimates of climatic tolerance, especially for widespread forbs and grasses. These findings suggest that widely available expert-based climatic tolerance estimates underrepresent species’ fundamental niche and likely fail to capture the realized niche. PMID:27870859

Determination of Tolerance to Internal Shorts and Its Screening in Lithium-ion Cells NASA - JSC Method

NASA Technical Reports Server (NTRS)

Jeevarajan, Judith

2009-01-01

This slide presentation reviews the method developed by the NASA Johnson Space Center (JSC) to determine tolerances to internal shorts and screening for problems in commercial off the shelf (COTS) Lithium-ion batteries. The test apparatus is shown and several examples of the usage and results of the test are discussed.

The shape of the glucose response curve during an oral glucose tolerance test heralds biomarkers of type 2 diabetes risk in obese youth

USDA-ARS?s Scientific Manuscript database

The shape of the glucose response curve during an oral glucose tolerance test (OGTT), monophasic versus biphasic, identifies physiologically distinct groups of individuals with differences in insulin secretion and sensitivity. We aimed to verify the value of the OGTT-glucose response curve against m...

Reduced circulating stem cells associate with excess fasting and post-load NEFA exposure in healthy adults with normal glucose tolerance.

PubMed

Fadini, Gian Paolo; Tura, Andrea; Pacini, Giovanni; Avogaro, Angelo; Vigili de Kreutzenberg, Saula

2017-06-01

Reduced levels of circulating stem cells (CSCs) predict cardiovascular events and death, but the factors underlying variability of CSCs in healthy adults are mostly unknown. Previous studies detected associations of CSCs with glucose tolerance or insulin resistance, while the role of fatty acids has been overlooked. We herein aimed to describe in better detail the metabolic abnormalities associated with a reduced CSC level. This was a cross-sectional study on 94 healthy male and female individuals with normal glucose tolerance, aged 18-65 years. All participants underwent an oral glucose tolerance test (OGTT) with blood samples collected at 0, 10, 20, 30, 60, 90 and 120 min. Mathematical models were applied to plasma glucose, insulin, C-peptide and non-esterified fatty acids (NEFA) concentrations. CSCs were defined as CD34 + or CD133 + . Participants (mean ± SEM age 43.8 ± 0.7; 41% males) were divided according to CSC levels below (low) or above (high) the median value and metabolic parameters were compared. There was no significant baseline difference between groups except for higher concentrations of fasting NEFA in subjects with low CSCs. Upon OGTT, individuals with low CSCs had higher area under curve (AUC) of NEFA (p < 0.001) and no significant differences in glucose, insulin and C-peptide. Several insulin sensitivity and beta cell function indexes were not significantly different, except for a decrease in the disposition index (DI) in subjects with low CSCs. CSCs were associated with excess NEFA levels independently from age and DI. We show for the first time that, in healthy adults with normal glucose tolerance, low CSCs are strongly associated with excess NEFA exposure. The pathophysiological consequence of this association needs to be interpreted in view of the prognostic role of CSCs. Future studies should explore whether excess NEFA and low CSCs and are causally interconnected. Copyright © 2017 Elsevier B.V. All rights reserved.

Tolerance limits and methodologies for IMRT measurement-based verification QA: Recommendations of AAPM Task Group No. 218.

PubMed

Miften, Moyed; Olch, Arthur; Mihailidis, Dimitris; Moran, Jean; Pawlicki, Todd; Molineu, Andrea; Li, Harold; Wijesooriya, Krishni; Shi, Jie; Xia, Ping; Papanikolaou, Nikos; Low, Daniel A

2018-04-01

Patient-specific IMRT QA measurements are important components of processes designed to identify discrepancies between calculated and delivered radiation doses. Discrepancy tolerance limits are neither well defined nor consistently applied across centers. The AAPM TG-218 report provides a comprehensive review aimed at improving the understanding and consistency of these processes as well as recommendations for methodologies and tolerance limits in patient-specific IMRT QA. The performance of the dose difference/distance-to-agreement (DTA) and γ dose distribution comparison metrics are investigated. Measurement methods are reviewed and followed by a discussion of the pros and cons of each. Methodologies for absolute dose verification are discussed and new IMRT QA verification tools are presented. Literature on the expected or achievable agreement between measurements and calculations for different types of planning and delivery systems are reviewed and analyzed. Tests of vendor implementations of the γ verification algorithm employing benchmark cases are presented. Operational shortcomings that can reduce the γ tool accuracy and subsequent effectiveness for IMRT QA are described. Practical considerations including spatial resolution, normalization, dose threshold, and data interpretation are discussed. Published data on IMRT QA and the clinical experience of the group members are used to develop guidelines and recommendations on tolerance and action limits for IMRT QA. Steps to check failed IMRT QA plans are outlined. Recommendations on delivery methods, data interpretation, dose normalization, the use of γ analysis routines and choice of tolerance limits for IMRT QA are made with focus on detecting differences between calculated and measured doses via the use of robust analysis methods and an in-depth understanding of IMRT verification metrics. The recommendations are intended to improve the IMRT QA process and establish consistent, and comparable IMRT QA criteria among institutions. © 2018 American Association of Physicists in Medicine.

The other white-nose syndrome transcriptome: Tolerant and susceptible hosts respond differently to the pathogen Pseudogymnoascus destructans.

PubMed

Davy, Christina M; Donaldson, Michael E; Willis, Craig K R; Saville, Barry J; McGuire, Liam P; Mayberry, Heather; Wilcox, Alana; Wibbelt, Gudrun; Misra, Vikram; Bollinger, Trent; Kyle, Christopher J

2017-09-01

Mitigation of emerging infectious diseases that threaten global biodiversity requires an understanding of critical host and pathogen responses to infection. For multihost pathogens where pathogen virulence or host susceptibility is variable, host-pathogen interactions in tolerant species may identify potential avenues for adaptive evolution in recently exposed, susceptible hosts. For example, the fungus Pseudogymnoascus destructans causes white-nose syndrome (WNS) in hibernating bats and is responsible for catastrophic declines in some species in North America, where it was recently introduced. Bats in Europe and Asia, where the pathogen is endemic, are only mildly affected. Different environmental conditions among Nearctic and Palearctic hibernacula have been proposed as an explanation for variable disease outcomes, but this hypothesis has not been experimentally tested. We report the first controlled, experimental investigation of response to P. destructans in a tolerant, European species of bat (the greater mouse-eared bat, Myotis myotis ). We compared body condition, disease outcomes and gene expression in control (sham-exposed) and exposed M. myotis that hibernated under controlled environmental conditions following treatment. Tolerant M. myotis experienced extremely limited fungal growth and did not exhibit symptoms of WNS. However, we detected no differential expression of genes associated with immune response in exposed bats, indicating that immune response does not drive tolerance of P. destructans in late hibernation. Variable responses to P. destructans among bat species cannot be attributed solely to environmental or ecological factors. Instead, our results implicate coevolution with the pathogen, and highlight the dynamic nature of the "white-nose syndrome transcriptome." Interspecific variation in response to exposure by the host (and possibly pathogen) emphasizes the importance of context in studies of the bat-WNS system, and robust characterization of genetic responses to exposure in various hosts and the pathogen should precede any attempts to use particular bat species as generalizable "model hosts."

Efficient acquisition of iron confers greater tolerance to saline-alkaline stress in rice (Oryza sativa L.).

PubMed

Li, Qian; Yang, An; Zhang, Wen-Hao

2016-12-01

To elucidate the mechanisms underlying tolerance to saline-alkaline stress in two rice genotypes, Dongdao-4 and Jigeng-88, we exposed them to medium supplemented with 10 mM Na 2 CO 3 and 40 mM NaCl (pH 8.5). Dongdao-4 plants displayed higher biomass, chlorophyll content, and photosynthetic rates, and a larger root system than Jigeng-88 under saline-alkaline conditions. Dongdao-4 had a higher shoot Na + /K + ratio than Jigeng-88 under both control and saline-alkaline conditions. Dongdao-4 exhibited stronger rhizospheric acidification than Jigeng-88 under saline-alkaline conditions, resulting from greater up-regulation of H + -ATPases at the transcriptional level. Moreover, Fe concentrations in shoots and roots of Dongdao-4 were higher than those in Jigeng-88, and a higher rate of phytosiderophore exudation was detected in Dongdao-4 versus Jigeng-88 under saline-alkaline conditions. The Fe-deficiency-responsive genes OsIRO2, OsIRT1, OsNAS1, OsNAS2, OsYSL2, and OsYSL15 were more strongly up-regulated in Dongdao-4 than Jigeng-88 plants in saline-alkaline medium, implying greater tolerance of Dongdao-4 plants to Fe deficiency. To test this hypothesis, we compared the effects of Fe deficiency on the two genotypes, and found that Dongdao-4 was more tolerant to Fe deficiency. Exposure to Fe-deficient medium led to greater rhizospheric acidification and phytosiderophore exudation in Dongdao-4 than Jigeng-88 plants. Expression levels of OsIRO2, OsIRT1, OsNAS1, OsNAS2, OsYSL2, and OsYSL15 were higher in Dongdao-4 than Jigeng-88 plants under Fe-deficient conditions. These results demonstrate that a highly efficient Fe acquisition system together with a large root system may underpin the greater tolerance of Dongdao-4 plants to saline-alkaline stress. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Efficient acquisition of iron confers greater tolerance to saline-alkaline stress in rice (Oryza sativa L.)

PubMed Central

Li, Qian; Yang, An; Zhang, Wen-Hao

2016-01-01

To elucidate the mechanisms underlying tolerance to saline-alkaline stress in two rice genotypes, Dongdao-4 and Jigeng-88, we exposed them to medium supplemented with 10 mM Na2CO3 and 40 mM NaCl (pH 8.5). Dongdao-4 plants displayed higher biomass, chlorophyll content, and photosynthetic rates, and a larger root system than Jigeng-88 under saline-alkaline conditions. Dongdao-4 had a higher shoot Na+/K+ ratio than Jigeng-88 under both control and saline-alkaline conditions. Dongdao-4 exhibited stronger rhizospheric acidification than Jigeng-88 under saline-alkaline conditions, resulting from greater up-regulation of H+-ATPases at the transcriptional level. Moreover, Fe concentrations in shoots and roots of Dongdao-4 were higher than those in Jigeng-88, and a higher rate of phytosiderophore exudation was detected in Dongdao-4 versus Jigeng-88 under saline-alkaline conditions. The Fe-deficiency-responsive genes OsIRO2, OsIRT1, OsNAS1, OsNAS2, OsYSL2, and OsYSL15 were more strongly up-regulated in Dongdao-4 than Jigeng-88 plants in saline-alkaline medium, implying greater tolerance of Dongdao-4 plants to Fe deficiency. To test this hypothesis, we compared the effects of Fe deficiency on the two genotypes, and found that Dongdao-4 was more tolerant to Fe deficiency. Exposure to Fe-deficient medium led to greater rhizospheric acidification and phytosiderophore exudation in Dongdao-4 than Jigeng-88 plants. Expression levels of OsIRO2, OsIRT1, OsNAS1, OsNAS2, OsYSL2, and OsYSL15 were higher in Dongdao-4 than Jigeng-88 plants under Fe-deficient conditions. These results demonstrate that a highly efficient Fe acquisition system together with a large root system may underpin the greater tolerance of Dongdao-4 plants to saline-alkaline stress. PMID:27811002

Diagnosing ozone stress and differential tolerance in rice (Oryza sativa L.) with ethylenediurea (EDU).

PubMed

Ashrafuzzaman, Md; Lubna, Farzana Afrose; Holtkamp, Felix; Manning, William J; Kraska, Thorsten; Frei, Michael

2017-11-01

Rising tropospheric ozone concentrations in Asia necessitate the breeding of adapted rice varieties to ensure food security. However, breeding requires field-based evaluation of ample plant material, which can be technically challenging or very costly when using ozone fumigation facilities. The chemical ethylenediurea (EDU) has been proposed for estimating the effects of ozone in large-scale field applications, but controlled experiments investigating constitutive effects on rice or its suitability to detect genotypic differences in ozone tolerance are missing. This study comprised a controlled open top chamber experiment with four treatments (i) control (average ozone concentration 16 ppb), (ii) control with EDU application, (iii) ozone stress (average 77 ppb for 7 h daily throughout the season), and (iv) ozone stress with EDU application. Three contrasting rice genotypes were tested, i.e. the tolerant line L81 and the sensitive Nipponbare and BR28. The ozone treatment had significant negative effects on plant growth (height and tillering), stomatal conductance, SPAD value, spectral reflectance indices such as the normalized difference vegetation index (NDVI), lipid peroxidation, as well as biomass and grain yields. These negative effects were more pronounced in the a priori sensitive varieties, especially the widely grown Bangladeshi variety BR28, which showed grain yield reductions by 37 percent. EDU application had almost no effects on plants in the absence of ozone, but partly mitigated ozone effects on foliar symptoms, lipid peroxidation, SPAD value, stomatal conductance, several spectral reflectance parameters, panicle number, grain yield, and spikelet sterility. EDU responses were more pronounced in sensitive genotypes than in the tolerant L81. In conclusion, EDU had no constitutive effects on rice and partly offset negative ozone effects, especially in sensitive varieties. It can thus be used to diagnose ozone damage in field grown rice and for distinguishing tolerant (less EDU-responsive) and sensitive (more EDU-responsive) genotypes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification and Verification of QTL Associated with Frost Tolerance Using Linkage Mapping and GWAS in Winter Faba Bean.

PubMed

Sallam, Ahmed; Arbaoui, Mustapha; El-Esawi, Mohamed; Abshire, Nathan; Martsch, Regina

2016-01-01

Frost stress is one of the abiotic stresses that causes a significant reduction in winter faba bean yield in Europe. The main objective of this work is to genetically improve frost tolerance in winter faba bean by identifying and validating QTL associated with frost tolerance to be used in marker-assisted selection (MAS). Two different genetic backgrounds were used: a biparental population (BPP) consisting of 101 inbred lines, and 189 genotypes from single seed descent (SSD) from the Gottingen Winter bean Population (GWBP). All experiments were conducted in a frost growth chamber under controlled conditions. Both populations were genotyped using the same set of 189 SNP markers. Visual scoring for frost stress symptoms was used to define frost tolerance in both populations. In addition, leaf fatty acid composition (FAC) and proline content were analyzed in BPP as physiological traits. QTL mapping (for BPP) and genome wide association studies (for GWBP) were performed to detect QTL associated with frost tolerance. High genetic variation between genotypes, and repeatability estimates, were found for all traits. QTL mapping and GWAS identified new putative QTL associated with promising frost tolerance and related traits. A set of 54 SNP markers common in both genetic backgrounds showed a high genetic diversity with polymorphic information content (PIC) ranging from 0.31 to 0.37 and gene diversity ranging from 0.39 to 0.50. This indicates that these markers may be polymorphic for many faba bean populations. Five SNP markers showed a significant marker-trait association with frost tolerance and related traits in both populations. Moreover, synteny analysis between Medicago truncatula (a model legume) and faba bean genomes was performed to identify candidate genes for these markers. Collinearity was evaluated between the faba bean genetic map constructed in this study and the faba bean consensus map, resulting in identifying possible genomic regions in faba bean which may control frost tolerance genes. The two genetic backgrounds were useful in detecting new variation for improving frost tolerance in winter faba bean. Of the five validated SNP markers, one (VF_Mt3g086600) was found to be associated with frost tolerance and FAC in both populations. This marker was also associated with winter hardiness and high yield in earlier studies. This marker is located in a gene of unknown function.

Identification and Verification of QTL Associated with Frost Tolerance Using Linkage Mapping and GWAS in Winter Faba Bean

PubMed Central

Sallam, Ahmed; Arbaoui, Mustapha; El-Esawi, Mohamed; Abshire, Nathan; Martsch, Regina

2016-01-01

Frost stress is one of the abiotic stresses that causes a significant reduction in winter faba bean yield in Europe. The main objective of this work is to genetically improve frost tolerance in winter faba bean by identifying and validating QTL associated with frost tolerance to be used in marker-assisted selection (MAS). Two different genetic backgrounds were used: a biparental population (BPP) consisting of 101 inbred lines, and 189 genotypes from single seed descent (SSD) from the Gottingen Winter bean Population (GWBP). All experiments were conducted in a frost growth chamber under controlled conditions. Both populations were genotyped using the same set of 189 SNP markers. Visual scoring for frost stress symptoms was used to define frost tolerance in both populations. In addition, leaf fatty acid composition (FAC) and proline content were analyzed in BPP as physiological traits. QTL mapping (for BPP) and genome wide association studies (for GWBP) were performed to detect QTL associated with frost tolerance. High genetic variation between genotypes, and repeatability estimates, were found for all traits. QTL mapping and GWAS identified new putative QTL associated with promising frost tolerance and related traits. A set of 54 SNP markers common in both genetic backgrounds showed a high genetic diversity with polymorphic information content (PIC) ranging from 0.31 to 0.37 and gene diversity ranging from 0.39 to 0.50. This indicates that these markers may be polymorphic for many faba bean populations. Five SNP markers showed a significant marker-trait association with frost tolerance and related traits in both populations. Moreover, synteny analysis between Medicago truncatula (a model legume) and faba bean genomes was performed to identify candidate genes for these markers. Collinearity was evaluated between the faba bean genetic map constructed in this study and the faba bean consensus map, resulting in identifying possible genomic regions in faba bean which may control frost tolerance genes. The two genetic backgrounds were useful in detecting new variation for improving frost tolerance in winter faba bean. Of the five validated SNP markers, one (VF_Mt3g086600) was found to be associated with frost tolerance and FAC in both populations. This marker was also associated with winter hardiness and high yield in earlier studies. This marker is located in a gene of unknown function. PMID:27540381

Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis

PubMed Central

Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

2018-01-01

Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7–3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through prompt on-site detection of Fno. PMID:29444148

Development of a recombinase polymerase amplification assay for rapid detection of Francisella noatunensis subsp. orientalis.

PubMed

Shahin, Khalid; Gustavo Ramirez-Paredes, Jose; Harold, Graham; Lopez-Jimena, Benjamin; Adams, Alexandra; Weidmann, Manfred

2018-01-01

Francisella noatunensis subsp. orientalis (Fno) is the causative agent of piscine francisellosis in warm water fish including tilapia. The disease induces chronic granulomatous inflammation with high morbidity and can result in high mortality. Early and accurate detection of Fno is crucial to set appropriate outbreak control measures in tilapia farms. Laboratory detection of Fno mainly depends on bacterial culture and molecular techniques. Recombinase polymerase amplification (RPA) is a novel isothermal technology that has been widely used for the molecular diagnosis of various infectious diseases. In this study, a recombinase polymerase amplification (RPA) assay for rapid detection of Fno was developed and validated. The RPA reaction was performed at a constant temperature of 42°C for 20 min. The RPA assay was performed using a quantitative plasmid standard containing a unique Fno gene sequence. Validation of the assay was performed not only by using DNA from Fno, closely related Francisella species and other common bacterial pathogens in tilapia farms, but also by screening 78 Nile tilapia and 5 water samples. All results were compared with those obtained by previously established real-time qPCR. The developed RPA showed high specificity in detection of Fno with no cross-detection of either the closely related Francisella spp. or the other tested bacteria. The Fno-RPA performance was highly comparable to the published qPCR with detection limits at 15 and 11 DNA molecules detected, respectively. The RPA gave quicker results in approximately 6 min in contrast to the qPCR that needed about 90 min to reach the same detection limit, taking only 2.7-3 min to determine Fno in clinical samples. Moreover, RPA was more tolerant to reaction inhibitors than qPCR when tested with field samples. The fast reaction, simplicity, cost-effectiveness, sensitivity and specificity make the RPA an attractive diagnostic tool that will contribute to controlling the infection through prompt on-site detection of Fno.

Deletion and anergy of polyclonal B cells specific for ubiquitous membrane-bound self-antigen

PubMed Central

Taylor, Justin J.; Martinez, Ryan J.; Titcombe, Philip J.; Barsness, Laura O.; Thomas, Stephanie R.; Zhang, Na; Katzman, Shoshana D.; Jenkins, Marc K.

2012-01-01

B cell tolerance to self-antigen is critical to preventing antibody-mediated autoimmunity. Previous work using B cell antigen receptor transgenic animals suggested that self-antigen–specific B cells are either deleted from the repertoire, enter a state of diminished function termed anergy, or are ignorant to the presence of self-antigen. These mechanisms have not been assessed in a normal polyclonal repertoire because of an inability to detect rare antigen-specific B cells. Using a novel detection and enrichment strategy to assess polyclonal self-antigen–specific B cells, we find no evidence of deletion or anergy of cells specific for antigen not bound to membrane, and tolerance to these types of antigens appears to be largely maintained by the absence of T cell help. In contrast, a combination of deleting cells expressing receptors with high affinity for antigen with anergy of the undeleted lower affinity cells maintains tolerance to ubiquitous membrane-bound self-antigens. PMID:23071255

Factors driving public tolerance levels and information‐seeking behaviour concerning insects in the household environment

PubMed Central

Poortvliet, P Marijn; Takken, Willem

2018-01-01

Abstract BACKGROUND The public's negative attitudes towards household insects drive tolerance for these insects and their control. Tolerance levels are important in integrated pest management (IPM), as are pest knowledge and information. The risk information seeking and processing (RISP) model describes the relationships between personal factors and information‐seeking behaviour. We combined IPM and RISP to determine important relationships between factors driving insect tolerance levels and information‐seeking behaviour through an online survey and tested whether this model is valid and generally applicable. RESULTS Relationships between variables from both IPM and RISP models were tested for seven insect species. Tolerance levels were measured with two factors: willingness to pay for pest control and whether insects are tolerated. Willingness to pay for control was positively affected by age, experience, risk perception, insect characteristics, and negative emotions and affected behavioural intention, by influencing information sufficiency and information‐seeking behaviour. Tolerability was influenced by perception of insect characteristics and determines whether control measures are taken. CONCLUSION It was possible to combine the RISP and IPM models. Relevant driving factors were a person's age, experience, risk perception, negative affective responses, tolerance levels, relevant channel beliefs about online forums, information sufficiency and information‐seeking behaviour. There was, however, variation in important factors between different insects. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:29274106

Hormonal indices of tolerance to +Gz acceleration in female subjects. [personnel selection in Shuttle program

NASA Technical Reports Server (NTRS)

Vernikos-Danellis, J.; Dallman, M. F.; Forsham, P.; Goodwin, A. L.; Leach, C. S.

1978-01-01

As a possible predictive test for screening Space Shuttle passengers, the secretions of the pituitary adrenal system and the adrenal medulla have been studied in conjunction with exposure to gravitational acceleration three times the normal level. The 12 female subjects in the test were divided into ambulatory and bedrest groups. Before bedrest, a high tolerance to centrifugation appeared to be linked to increases in plasma ACTH and cortisol. This relationship did not hold after bedrest. The correlation between tolerance to centrifugation and 24-hour urinary epinephrine-to-norepinephrine ratios was not significant.

[Insulin, glucagon and growth hormone responses during glucose, arginine and insulin tolerance tests in children with hyperthyroidism].

PubMed

Kato, T; Matsuura, N; Fujita, H; Fujieda, K; Nohara, Y; Mikami, Y; Abe, K; Fukushima, N

1985-06-20

There are many reports of glucose intolerance in adult patients with hyperthyroidism but few reports of glucose intolerance in hyperthyroid children. In this study, we measured plasma levels of glucose, insulin, glucagon and growth hormone in hyperthyroid children and control subjects by the use of three kinds of tolerance tests: an oral glucose tolerance test, an arginine tolerance test and an insulin tolerance test. In the oral glucose tolerance test, mean fasting glucose levels (79.6 +/- 1.4 mg/dl) rose to maximum levels (157.3 +/- 4.3 mg/dl) at 30 min in hyperthyroid children which were significantly higher than the levels in control subjects (p less than 0.01). The maximum levels of glucose fell slowly and returned to fasting levels at 180 min. In this test, plasma insulin levels increased from basal levels (12.7 +/- 1.9 microU/ml) to maximum levels (120.8 +/- 22.1 microU/ml) at 30 min in the prepubertal age group of hyperthyroidism. On the other hand, in the pubertal age group of hyperthyroidism, maximum levels of insulin were observed at 60 min, but not at 30 min. These maximum levels of insulin of both hyperthyroid age groups were significantly higher than those in the control subjects (p less than 0.05, p less than 0.01 respectively). There was no difference in insulin-glucose ratio at 30 min (delta IRI/delta BG) and insulinogenic index (I.I.) at 0 to 60 min between these two groups of hyperthyroid children and control subjects. However, I.I. at 0 to 120 min and 0 to 180 min decreased significantly in the pubertal age group of hyperthyroidism as compared with those in the control group (p less than 0.05, p less than 0.02 respectively). In the oral glucose tolerance test, plasma glucagon levels decreased from basal levels (74.1 +/- 4.3 pg/ml) to minimum levels (36.4 +/- 4.7 pg/ml) at 90 min in hyperthyroidism, which were significantly lower than those in the controls (p less than 0.05). However, there was no difference in -epsilon delta IRG/epsilon delta BG (cumulative glucagon response/cumulative glucose response) between the subjects with hyperthyroidism and the controls. On the other hand, lower responses of blood glucose, insulin, glucagon and growth hormone to arginine were observed in subjects with hyperthyroidism than in the controls. Moreover in the insulin tolerance test, there was no difference in glucagon and growth hormone response between the subjects with hyperthyroidism and the controls. Thus our conclusions are as follows: A marked increase in blood glucose after oral glucose load was observed in spite of normal insulin-glucose ratio in hyperthyroid children, suggesting the existence of peripheral insulin resistance.(ABSTRACT TRUNCATED AT 400 WORDS)

Children's and Parents' Ability to Tolerate Child Distress: Impact on Cognitive Behavioral Therapy for Pediatric Obsessive Compulsive Disorder.

PubMed

Selles, Robert R; Franklin, Martin; Sapyta, Jeffrey; Compton, Scott N; Tommet, Doug; Jones, Richard N; Garcia, Abbe; Freeman, Jennifer

2018-04-01

The present study explored the concept of tolerance for child distress in 46 children (ages 5-8), along with their mothers and fathers, who received family-based CBT for OCD. The study sought to describe baseline tolerance, changes in tolerance with treatment, and the predictive impact of tolerance on symptom improvement. Tolerance was rated by clinicians on a single item and the CY-BOCS was used to measure OCD severity. Descriptive results suggested that all participants had some difficulty tolerating the child's distress at baseline while paired t tests indicated large improvements were made over treatment (d = 1.2-2.0). Fathers' initial tolerance was significantly related to symptom improvement in a multivariate regression as were fathers' and children's changes in distress tolerance over the course of treatment. Overall, results provide support for examining tolerance of child distress including its predictive impact and potential as a supplemental intervention target.

COGNITIVE FUNCTIONING AND TOLERANCE FOR DELAY OF GRATIFICATION.

ERIC Educational Resources Information Center

ZIMILES, HERBERT

TWO EXPERIMENTS WERE CONDUCTED TO STUDY THE RELATIONSHIP BETWEEN A CHILD'S TOLERANCE FOR DELAY OF GRATIFICATION AND HIS ABILITY TO CONSERVE NUMBER AND PICTURES. OTHER MEASURES OF COGNITION ALSO WERE USED. TOLERANCE FOR DELAY OF GRATIFICATION WAS MEASURED BY THE CHILD'S DECISION TO RECEIVE A PACK OF CANDY AND A TOY ON THE DAY OF TESTING OR TO…

The desert moss Pterygoneurum lamellatum (Pottiaceae) exhibits an inducible ecological strategy of desiccation tolerance: effects of rate of drying on shoot damage and regeneration

USDA-ARS?s Scientific Manuscript database

Premise of the study: Bryophytes are regarded as a clade incorporating constitutive desiccation tolerance, especially terrestrial species. Here we test the hypothesis that the opposing ecological strategy of desiccation tolerance, inducibility, is present in a desert moss, and addressed by varying r...

A Novel Testing Model for Opportunistic Screening of Pre-Diabetes and Diabetes among U.S. Adults

PubMed Central

Zhang, Yurong; Hu, Gang; Zhang, Lu; Mayo, Rachel; Chen, Liwei

2015-01-01

Objective The study aim was to evaluate the performance of a novel simultaneous testing model, based on the Finnish Diabetes Risk Score (FINDRISC) and HbA1c, in detecting undiagnosed diabetes and pre-diabetes in Americans. Research Design and Methods This cross-sectional analysis included 3,886 men and women (≥ 20 years) without known diabetes from the U.S. National Health and Nutrition Examination Survey (NHANES) 2005-2010. The FINDRISC was developed based on eight variables (age, BMI, waist circumference, use of antihypertensive drug, history of high blood glucose, family history of diabetes, daily physical activity and fruit & vegetable intake). The sensitivity, specificity, and the receiver operating characteristic (ROC) curve of the testing model were calculated for undiagnosed diabetes and pre-diabetes, determined by oral glucose tolerance test (OGTT). Results The prevalence of undiagnosed diabetes was 7.0% and 43.1% for pre-diabetes (27.7% for isolated impaired fasting glucose (IFG), 5.1% for impaired glucose tolerance (IGT), and 10.3% for having both IFG and IGT). The sensitivity and specificity of using the HbA1c alone was 24.2% and 99.6% for diabetes (cutoff of ≥6.5%), and 35.2% and 86.4% for pre-diabetes (cutoff of ≥5.7%). The sensitivity and specificity of using the FINDRISC alone (cutoff of ≥9) was 79.1% and 48.6% for diabetes and 60.2% and 61.4% for pre-diabetes. Using the simultaneous testing model with a combination of FINDRISC and HbA1c improved the sensitivity to 84.2% for diabetes and 74.2% for pre-diabetes. The specificity for the simultaneous testing model was 48.4% of diabetes and 53.0% for pre-diabetes. Conclusions This simultaneous testing model is a practical and valid tool in diabetes screening in the general U.S. population. PMID:25790106

Genome-Wide Association Mapping Reveals Multiple QTLs Governing Tolerance Response for Seedling Stage Chilling Stress in Indica Rice.

PubMed

Pandit, Elssa; Tasleem, Swaleha; Barik, Saumya R; Mohanty, Durga P; Nayak, Deepak K; Mohanty, Shakti P; Das, Sujata; Pradhan, Sharat K

2017-01-01

Rice crop is sensitive to cold stress at seedling stage. A panel of population representing 304 shortlisted germplasm lines was studied for seedling stage chilling tolerance in indica rice. Six phenotypic classes were exposed to six low temperature stress regimes under control phenotyping facility to investigate response pattern. A panel of 66 genotypes representing all phenotypic classes was used for ensuring genetic diversity, population structure and association mapping for the trait using 58 simple sequence repeat (SSR) and 2 direct trait linked markers. A moderate level of genetic diversity was detected in the panel population for the trait. Deviation of Hardy-Weinberg's expectation was detected in the studied population using Wright's F statistic. The panel showed 30% variation among population and 70% among individuals. The entire population was categorized into three sub-populations through STRUCTURE analysis. This revealed tolerance for the trait had a common primary ancestor for each sub-population with few admix individuals. The panel population showed the presence of many QTLs for cold stress tolerance in the individuals representing like genome-wide expression of the trait. Nineteen SSR markers were significantly associated at chilling stress of 8°C to 4°C for 7-21 days duration. Thus, the primers linked to the seedling stage cold tolerance QTLs namely qCTS9, qCTS-2, qCTS6.1, qSCT2, qSCT11, qSCT1a, qCTS-3.1, qCTS11.1, qCTS12.1, qCTS-1b, and CTB2 need to be pyramided for development of strongly chilling tolerant variety.

Genome-Wide Association Mapping Reveals Multiple QTLs Governing Tolerance Response for Seedling Stage Chilling Stress in Indica Rice

PubMed Central

Pandit, Elssa; Tasleem, Swaleha; Barik, Saumya R.; Mohanty, Durga P.; Nayak, Deepak K.; Mohanty, Shakti P.; Das, Sujata; Pradhan, Sharat K.

2017-01-01

Rice crop is sensitive to cold stress at seedling stage. A panel of population representing 304 shortlisted germplasm lines was studied for seedling stage chilling tolerance in indica rice. Six phenotypic classes were exposed to six low temperature stress regimes under control phenotyping facility to investigate response pattern. A panel of 66 genotypes representing all phenotypic classes was used for ensuring genetic diversity, population structure and association mapping for the trait using 58 simple sequence repeat (SSR) and 2 direct trait linked markers. A moderate level of genetic diversity was detected in the panel population for the trait. Deviation of Hardy-Weinberg's expectation was detected in the studied population using Wright's F statistic. The panel showed 30% variation among population and 70% among individuals. The entire population was categorized into three sub-populations through STRUCTURE analysis. This revealed tolerance for the trait had a common primary ancestor for each sub-population with few admix individuals. The panel population showed the presence of many QTLs for cold stress tolerance in the individuals representing like genome-wide expression of the trait. Nineteen SSR markers were significantly associated at chilling stress of 8°C to 4°C for 7–21 days duration. Thus, the primers linked to the seedling stage cold tolerance QTLs namely qCTS9, qCTS-2, qCTS6.1, qSCT2, qSCT11, qSCT1a, qCTS-3.1, qCTS11.1, qCTS12.1, qCTS-1b, and CTB2 need to be pyramided for development of strongly chilling tolerant variety. PMID:28487705

Genetic linkage map construction and QTL mapping of salt tolerance traits in Zoysiagrass (Zoysia japonica).

PubMed

Guo, Hailin; Ding, Wanwen; Chen, Jingbo; Chen, Xuan; Zheng, Yiqi; Wang, Zhiyong; Liu, Jianxiu

2014-01-01

Zoysiagrass (Zoysia Willd.) is an important warm season turfgrass that is grown in many parts of the world. Salt tolerance is an important trait in zoysiagrass breeding programs. In this study, a genetic linkage map was constructed using sequence-related amplified polymorphism markers and random amplified polymorphic DNA markers based on an F1 population comprising 120 progeny derived from a cross between Zoysia japonica Z105 (salt-tolerant accession) and Z061 (salt-sensitive accession). The linkage map covered 1211 cM with an average marker distance of 5.0 cM and contained 24 linkage groups with 242 marker loci (217 sequence-related amplified polymorphism markers and 25 random amplified polymorphic DNA markers). Quantitative trait loci affecting the salt tolerance of zoysiagrass were identified using the constructed genetic linkage map. Two significant quantitative trait loci (qLF-1 and qLF-2) for leaf firing percentage were detected; qLF-1 at 36.3 cM on linkage group LG4 with a logarithm of odds value of 3.27, which explained 13.1% of the total variation of leaf firing and qLF-2 at 42.3 cM on LG5 with a logarithm of odds value of 2.88, which explained 29.7% of the total variation of leaf firing. A significant quantitative trait locus (qSCW-1) for reduced percentage of dry shoot clipping weight was detected at 44.1 cM on LG5 with a logarithm of odds value of 4.0, which explained 65.6% of the total variation. This study provides important information for further functional analysis of salt-tolerance genes in zoysiagrass. Molecular markers linked with quantitative trait loci for salt tolerance will be useful in zoysiagrass breeding programs using marker-assisted selection.

RNAi-directed downregulation of betaine aldehyde dehydrogenase 1 (OsBADH1) results in decreased stress tolerance and increased oxidative markers without affecting glycine betaine biosynthesis in rice (Oryza sativa).

PubMed

Tang, Wei; Sun, Jiaqi; Liu, Jia; Liu, Fangfang; Yan, Jun; Gou, Xiaojun; Lu, Bao-Rong; Liu, Yongsheng

2014-11-01

As an important osmoprotectant, glycine betaine (GB) plays an essential role in resistance to abiotic stress in a variety of organisms, including rice (Oryza sativa L.). However, GB content is too low to be detectable in rice, although rice genome possesses several orthologs coding for betaine aldehyde dehydrogenase (BADH) involved in plant GB biosynthesis. Rice BADH1 (OsBADH1) has been shown to be targeted to peroxisome and its overexpression resulted in increased GB biosynthesis and tolerance to abiotic stress. In this study, we demonstrated a pivotal role of OsBADH1 in stress tolerance without altering GB biosynthesis capacity, using the RNA interference (RNAi) technique. OsBADH1 was ubiquitously expressed in different organs, including roots, stems, leaves and flowers. Transgenic rice lines downregulating OsBADH1 exhibited remarkably reduced tolerance to NaCl, drought and cold stresses. The decrease of stress tolerance occurring in the OsBADH1-RNAi repression lines was associated with an elevated level of malondialdehyde content and hydrogen peroxidation. No GB accumulation was detected in transgene-positive and transgene-negative lines derived from heterozygous transgenic T0 plants. Moreover, transgenic OsBADH1-RNAi repression lines showed significantly reduced seed set and yield. In conclusion, the downregulation of OsBADH1, even though not causing any change of GB content, was accounted for the reduction of ability to dehydrogenate the accumulating metabolism-derived aldehydes and subsequently resulted in decreased stress tolerance and crop productivity. These results suggest that OsBADH1 possesses an enzyme activity to catalyze other aldehydes in addition to betaine aldehyde (the precursor of GB) and thus alleviate their toxic effects under abiotic stresses.

Neuromotor tolerability and behavioural characterisation of cannabidiolic acid, a phytocannabinoid with therapeutic potential for anticipatory nausea.

PubMed

Brierley, Daniel I; Samuels, James; Duncan, Marnie; Whalley, Benjamin J; Williams, Claire M

2016-01-01

Anticipatory nausea (AN) is a poorly controlled side effect experienced by chemotherapy patients. Currently, pharmacotherapy is restricted to benzodiazepine anxiolytics, which have limited efficacy, have significant sedative effects and induce dependency. The non-psychoactive phytocannabinoid, cannabidiolic acid (CBDA), has shown considerable efficacy in pre-clinical AN models, however determination of its neuromotor tolerability profile is crucial to justify clinical investigation. Provisional evidence for appetite-stimulating properties also requires detailed investigation. This study aims to assess the tolerability of CBDA in locomotor activity, motor coordination and muscular strength tests, and additionally for ability to modulate feeding behaviours. Male Lister Hooded rats administered CBDA (0.05-5 mg/kg; p.o.) were assessed in habituated open field (for locomotor activity), static beam and grip strength tests. A further study investigated whether these CBDA doses modulated normal feeding behaviour. Finally, evidence of anxiolytic-like effects in the habituated open field prompted testing of 5 mg/kg CBDA for anxiolytic-like activity in unhabituated open field, light/dark box and novelty-suppressed feeding (NSF) tests. CBDA had no adverse effects upon performance in any neuromotor tolerability test, however anxiolytic-like behaviour was observed in the habituated open field. Normal feeding behaviours were unaffected by any dose. CBDA (5 mg/kg) abolished the increased feeding latency in the NSF test induced by the 5-HT1AR antagonist, WAY-100,635, indicative of anxiolytic-like effects, but had no effect on anxiety-like behaviour in the novel open field or light/dark box. CBDA is very well tolerated and devoid of the sedative side effect profile of benzodiazepines, justifying its clinical investigation as a novel AN treatment.

Increased expression of native cytosolic Cu/Zn superoxide dismutase and ascorbate peroxidase improves tolerance to oxidative and chilling stresses in cassava (Manihot esculenta Crantz)

PubMed Central

2014-01-01

Background Cassava (Manihot esculenta Crantz) is a tropical root crop, and is therefore, extremely sensitive to low temperature; its antioxidative response is pivotal for its survival under stress. Timely turnover of reactive oxygen species (ROS) in plant cells generated by chilling-induced oxidative damages, and scavenging can be achieved by non-enzymatic and enzymatic reactions in order to maintain ROS homeostasis. Results Transgenic cassava plants that co-express cytosolic superoxide dismutase (SOD), MeCu/ZnSOD, and ascorbate peroxidase (APX), MeAPX2, were produced and tested for tolerance against oxidative and chilling stresses. The up-regulation of MeCu/ZnSOD and MeAPX2 expression was confirmed by the quantitative reverse transcriptase-polymerase chain reaction, and enzymatic activity analyses in the leaves of transgenic cassava plant lines with a single-transgene integration site. Upon exposure to ROS-generating agents, 100 μM ROS-generating reagent methyl viologen and 0.5 M H2O2, higher levels of enzymatic activities of SOD and APX were detected in transgenic plants than the wild type. Consequently, the oxidative stress parameters, such as lipid peroxidation, chlorophyll degradation and H2O2 synthesis, were lower in the transgenic lines than the wild type. Tolerance to chilling stress at 4°C for 2 d was greater in transgenic cassava, as observed by the higher levels of SOD, catalase, and ascorbate-glutathione cycle enzymes (e.g., APX, monodehydroascorbate reductase, dehydroascorbate reducatase and glutathione reductase) and lower levels of malondialdehyde content. Conclusions These results suggest that the expression of native cytosolic SOD and APX simultaneously activated the antioxidative defense mechanisms via cyclic ROS scavenging, thereby improving its tolerance to cold stress. PMID:25091029

Increased expression of native cytosolic Cu/Zn superoxide dismutase and ascorbate peroxidase improves tolerance to oxidative and chilling stresses in cassava (Manihot esculenta Crantz).

PubMed

Xu, Jia; Yang, Jun; Duan, Xiaoguang; Jiang, Yueming; Zhang, Peng

2014-08-05

Cassava (Manihot esculenta Crantz) is a tropical root crop, and is therefore, extremely sensitive to low temperature; its antioxidative response is pivotal for its survival under stress. Timely turnover of reactive oxygen species (ROS) in plant cells generated by chilling-induced oxidative damages, and scavenging can be achieved by non-enzymatic and enzymatic reactions in order to maintain ROS homeostasis. Transgenic cassava plants that co-express cytosolic superoxide dismutase (SOD), MeCu/ZnSOD, and ascorbate peroxidase (APX), MeAPX2, were produced and tested for tolerance against oxidative and chilling stresses. The up-regulation of MeCu/ZnSOD and MeAPX2 expression was confirmed by the quantitative reverse transcriptase-polymerase chain reaction, and enzymatic activity analyses in the leaves of transgenic cassava plant lines with a single-transgene integration site. Upon exposure to ROS-generating agents, 100 μM ROS-generating reagent methyl viologen and 0.5 M H₂O₂, higher levels of enzymatic activities of SOD and APX were detected in transgenic plants than the wild type. Consequently, the oxidative stress parameters, such as lipid peroxidation, chlorophyll degradation and H₂O₂ synthesis, were lower in the transgenic lines than the wild type. Tolerance to chilling stress at 4°C for 2 d was greater in transgenic cassava, as observed by the higher levels of SOD, catalase, and ascorbate-glutathione cycle enzymes (e.g., APX, monodehydroascorbate reductase, dehydroascorbate reducatase and glutathione reductase) and lower levels of malondialdehyde content. These results suggest that the expression of native cytosolic SOD and APX simultaneously activated the antioxidative defense mechanisms via cyclic ROS scavenging, thereby improving its tolerance to cold stress.

Glucose tolerance status in 510 children and adolescents attending an obesity clinic in Central Italy.

PubMed

Brufani, Claudia; Ciampalini, Paolo; Grossi, Armando; Fiori, Rossana; Fintini, Danilo; Tozzi, Alberto; Cappa, Marco; Barbetti, Fabrizio

2010-02-01

Childhood obesity is epidemic in developed countries and is accompanied by an increase in the prevalence of type 2 diabetes (T2DM). Establish prevalence of glucose metabolism alterations in a large sample of overweight/obese children and adolescents from Central Italy. The study group included 510 overweight/obese subjects (3-18 yr). Oral glucose tolerance test (OGTT) was performed with glucose and insulin determination. Homeostatic model assessment of insulin resistance (HOMA-IR) and insulin sensitivity index (ISI) were derived from fasting and OGTT measurements. Beta-cell function was estimated by insulinogenic index. Fat mass was measured by dual-energy x-ray absorptiometry. Glucose metabolism alterations were detected in 12.4% of patients. Impaired glucose tolerance (IGT) was the most frequent alteration (11.2%), with a higher prevalence in adolescents than in children (14.8 vs. 4.1%, p < 0.001); silent T2DM was identified in two adolescents (0.4%). HOMA-IR and glucose-stimulated insulin levels were higher in patients with IGT than individuals with normal glucose tolerance (HOMA-IR = 4.4 +/- 2.5 vs. 3.4 +/- 2.3, p = 0.001). Fat mass percentage and insulinogenic index were not different between the two groups. In multivariate analysis, age, fasting glucose, and insulin resistance influenced independently plasma glucose at 120 min of OGTT. Individuals with combined impaired fasting glucose/IGT (IFG/IGT) and T2DM were older and had reduced plasma insulin values at OGTT when compared to patients with simple IGT. Glucose metabolism alterations are frequently found among children and adolescents with overweight/obesity from Central Italy. Age, fasting glucose, and insulin resistance are main predictors of IGT. We suggest the use of OGTT as a screening tool in obese European adolescents.

Deletion of interleukin 1 receptor-associated kinase 1 (Irak1) improves glucose tolerance primarily by increasing insulin sensitivity in skeletal muscle.

PubMed

Sun, Xiao-Jian; Kim, Soohyun Park; Zhang, Dongming; Sun, Helen; Cao, Qi; Lu, Xin; Ying, Zhekang; Li, Liwu; Henry, Robert R; Ciaraldi, Theodore P; Taylor, Simeon I; Quon, Michael J

2017-07-21

Chronic inflammation may contribute to insulin resistance via molecular cross-talk between pathways for pro-inflammatory and insulin signaling. Interleukin 1 receptor-associated kinase 1 (IRAK-1) mediates pro-inflammatory signaling via IL-1 receptor/Toll-like receptors, which may contribute to insulin resistance, but this hypothesis is untested. Here, we used male Irak1 null (k/o) mice to investigate the metabolic role of IRAK-1. C57BL/6 wild-type (WT) and k/o mice had comparable body weights on low-fat and high-fat diets (LFD and HFD, respectively). After 12 weeks on LFD (but not HFD), k/o mice ( versus WT) had substantially improved glucose tolerance (assessed by the intraperitoneal glucose tolerance test (IPGTT)). As assessed with the hyperinsulinemic euglycemic glucose clamp technique, insulin sensitivity was 30% higher in the Irak1 k/o mice on chow diet, but the Irak1 deletion did not affect IPGTT outcomes in mice on HFD, suggesting that the deletion did not overcome the impact of obesity on glucose tolerance. Moreover, insulin-stimulated glucose-disposal rates were higher in the k/o mice, but we detected no significant difference in hepatic glucose production rates (± insulin infusion). Positron emission/computed tomography scans indicated higher insulin-stimulated glucose uptake in muscle, but not liver, in Irak1 k/o mice in vivo Moreover, insulin-stimulated phosphorylation of Akt was higher in muscle, but not in liver, from Irak1 k/o mice ex vivo In conclusion, Irak1 deletion improved muscle insulin sensitivity, with the effect being most apparent in LFD mice. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

An ultrasensitive bio-surrogate for nanoporous filter membrane performance metrology directed towards contamination control in microlithography applications

NASA Astrophysics Data System (ADS)

Ahmad, Farhan; Mish, Barbara; Qiu, Jian; Singh, Amarnauth; Varanasi, Rao; Bedford, Eilidh; Smith, Martin

2016-03-01

Contamination tolerances in semiconductor manufacturing processes have changed dramatically in the past two decades, reaching below 20 nm according to the guidelines of the International Technology Roadmap for Semiconductors. The move to narrower line widths drives the need for innovative filtration technologies that can achieve higher particle/contaminant removal performance resulting in cleaner process fluids. Nanoporous filter membrane metrology tools that have been the workhorse over the past decade are also now reaching limits. For example, nanoparticle (NP) challenge testing is commonly applied for assessing particle retention performance of filter membranes. Factors such as high NP size dispersity, low NP detection sensitivity, and high NP particle-filter affinity impose challenges in characterizing the next generation of nanoporous filter membranes. We report a novel bio-surrogate, 5 nm DNA-dendrimer conjugate for evaluating particle retention performance of nanoporous filter membranes. A technique capable of single molecule detection is employed to detect sparse concentration of conjugate in filter permeate, providing >1000- fold higher detection sensitivity than any existing 5 nm-sized particle enumeration technique. This bio-surrogate also offers narrow size distribution, high stability and chemical tunability. This bio-surrogate can discriminate various sub-15 nm pore-rated nanoporous filter membranes based on their particle retention performance. Due to high bio-surrogate detection sensitivity, a lower challenge concentration of bio-surrogate (as compared to other NPs of this size) can be used for filter testing, providing a better representation of customer applications. This new method should provide better understanding of the next generation filter membranes for removing defect-causing contaminants from lithography processes.

A Voyager attitude control perspective on fault tolerant systems

NASA Technical Reports Server (NTRS)

Rasmussen, R. D.; Litty, E. C.

1981-01-01

In current spacecraft design, a trend can be observed to achieve greater fault tolerance through the application of on-board software dedicated to detecting and isolating failures. Whether fault tolerance through software can meet the desired objectives depends on very careful consideration and control of the system in which the software is imbedded. The considered investigation has the objective to provide some of the insight needed for the required analysis of the system. A description is given of the techniques which have been developed in this connection during the development of the Voyager spacecraft. The Voyager Galileo Attitude and Articulation Control Subsystem (AACS) fault tolerant design is discussed to emphasize basic lessons learned from this experience. The central driver of hardware redundancy implementation on Voyager was known as the 'single point failure criterion'.

Effect of Different Insulin Response Patterns During Oral Glucose Tolerance Test on Glycemia in Individuals with Normal Glucose Tolerance.

PubMed

Praveen, Edavan Pulikkanath; Chouhan, Sunil; Sahoo, Jayaprakash; Goel, Sudhir K; Dwivedi, Sada Nand; Khurana, Madan Lal; Kulshreshtha, Bindu; Ammini, Ariachery C

2016-05-01

Research is still going on for detecting the earliest glucose homeostasis derangements in individuals, which is crucial for the prevention of glucose intolerance. This cross-sectional study analyzes different insulin response patterns during the oral glucose tolerance test (OGTT) and their implications on glycemia in normoglycemic individuals. The sample frame was the "Offspring of Individuals with Diabetes Study" database. All participants underwent OGTT. Blood samples were collected at 0, 30, 60, and 120 min for measurement of insulin, C-peptide, and proinsulin levels. Normal glucose tolerant individuals were selected for analysis. Four hundred fifty subjects (mean age, 25 years) were included and divided into two groups according to timing of plasma insulin peaking during OGTT: Group 1, peaking at 30 min; and Group 2, peaking at 60 or 120 min. Body mass index (BMI) and insulin resistance were comparable between the groups; however, Group 2 showed a significantly higher 60- and 120-min glucose level and lower disposition index. Based on the magnitude of the insulin levels, Group 1 was subdivided into Group N (normal pattern) and Group E (exaggerated pattern) with a 30-min insulin cutoff of 74 μU/mL (Group E, ≥74 μU/mL). Group 2 was subdivided into Group DL (delayed and limited pattern; 60-min insulin <73.0 μU/mL and 120-min insulin <80.0 μU/mL) and Group DE (delayed and exaggerated pattern; 60-min insulin ≥73.0 μU/mL or 120-min insulin ≥80.0 μU/mL). Group DE showed a significantly higher area under the curve (AUC) of glucose compared with the other groups and had a lower disposition index and high-density lipoprotein levels. Group DL had significantly lower insulin resistance and BMI compared with Group E but showed a similar AUC of glucose. A delayed insulin pattern was associated with higher postprandial glucose levels. Individuals with delayed and exaggerated insulin secretion may have a higher risk for glucose intolerance.

Exercise Self-Efficacy Moderates the Relation between Anxiety Sensitivity and Body Mass Index and Exercise Tolerance in Treatment-Seeking Smokers

PubMed Central

Farris, Samantha G.; Davis, Michelle L.; Rosenfield, David; Kauffman, Brooke Y.; Baird, Scarlett O.; Powers, Mark B.; Otto, Michael W.; Marcus, Bess H.; Church, Timothy S.; Smits, Jasper A. J.; Zvolensky, Michael J.

2016-01-01

There is little known about factors that contribute to the comorbidity of cigarette smoking and obesity. The current study sought to test whether exercise self-efficacy moderated the relation between anxiety sensitivity (fear of internal sensations) and BMI and exercise tolerance among cigarette smokers. Smokers (n = 72; 50% female; Mcpd = 19.3, SD = 10.65) were recruited to participate in a smoking cessation treatment trial. During medical screen, we measured weight, height, and exercise tolerance (functional capacity) employing a standardized maximal exercise testing protocol. After adjusting for participant sex and cigarettes per day, exercise self-efficacy moderated the association between anxiety sensitivity and BMI, such that the positive association between anxiety sensitivity and BMI was significantly stronger when exercise self-efficacy was low. The same pattern of results emerged for exercise tolerance. Exercise self-efficacy moderated the association between anxiety sensitivity and exercise tolerance, such that the negative association between anxiety sensitivity and exercise tolerance was significantly stronger when exercise self-efficacy was low. Among smokers, anxiety sensitivity may be a risk variable that, directly and indirectly in the context of low self-efficacy for exercise, causes or maintains higher body weight and lower exercise tolerance. PMID:27725844

Exercise Self-Efficacy Moderates the Relation between Anxiety Sensitivity and Body Mass Index and Exercise Tolerance in Treatment-Seeking Smokers.

PubMed

Farris, Samantha G; Davis, Michelle L; Rosenfield, David; Kauffman, Brooke Y; Baird, Scarlett O; Powers, Mark B; Otto, Michael W; Marcus, Bess H; Church, Timothy S; Smits, Jasper A J; Zvolensky, Michael J

2016-03-01

There is little known about factors that contribute to the comorbidity of cigarette smoking and obesity. The current study sought to test whether exercise self-efficacy moderated the relation between anxiety sensitivity (fear of internal sensations) and BMI and exercise tolerance among cigarette smokers. Smokers ( n = 72; 50% female; M cpd = 19.3, SD = 10.65) were recruited to participate in a smoking cessation treatment trial. During medical screen, we measured weight, height, and exercise tolerance (functional capacity) employing a standardized maximal exercise testing protocol. After adjusting for participant sex and cigarettes per day, exercise self-efficacy moderated the association between anxiety sensitivity and BMI, such that the positive association between anxiety sensitivity and BMI was significantly stronger when exercise self-efficacy was low. The same pattern of results emerged for exercise tolerance. Exercise self-efficacy moderated the association between anxiety sensitivity and exercise tolerance, such that the negative association between anxiety sensitivity and exercise tolerance was significantly stronger when exercise self-efficacy was low. Among smokers, anxiety sensitivity may be a risk variable that, directly and indirectly in the context of low self-efficacy for exercise, causes or maintains higher body weight and lower exercise tolerance.

Use of a New Portable Instrumented Impactor on the NASA Composite Crew Module Damage Tolerance Program

NASA Technical Reports Server (NTRS)

Jackson, Wade C.; Polis, Daniel L.

2014-01-01

Damage tolerance performance is critical to composite structures because surface impacts at relatively low energies may result in a significant strength loss. For certification, damage tolerance criteria require aerospace vehicles to meet design loads while containing damage at critical locations. Data from standard small coupon testing are difficult to apply to larger more complex structures. Due to the complexity of predicting both the impact damage and the residual properties, damage tolerance is demonstrated primarily by testing. A portable, spring-propelled, impact device was developed which allows the impact damage response to be investigated on large specimens, full-scale components, or entire vehicles. During impact, both the force history and projectile velocity are captured. The device was successfully used to demonstrate the damage tolerance performance of the NASA Composite Crew Module. The impactor was used to impact 18 different design features at impact energies up to 35 J. Detailed examples of these results are presented, showing impact force histories, damage inspection results, and response to loading.

Interspecies and Intraspecies Analysis of Trehalose Contents and the Biosynthesis Pathway Gene Family Reveals Crucial Roles of Trehalose in Osmotic-Stress Tolerance in Cassava

PubMed Central

Han, Bingying; Fu, Lili; Zhang, Dan; He, Xiuquan; Chen, Qiang; Peng, Ming; Zhang, Jiaming

2016-01-01

Trehalose is a nonreducing α,α-1,1-disaccharide in a wide range of organisms, and has diverse biological functions that range from serving as an energy source to acting as a protective/signal sugar. However, significant amounts of trehalose have rarely been detected in higher plants, and the function of trehalose in the drought-tolerant crop cassava (Manihot esculenta Crantz) is unclear. We measured soluble sugar concentrations of nine plant species with differing levels of drought tolerance and 41 cassava varieties using high-performance liquid chromatography with evaporative light-scattering detector (HPLC-ELSD). Significantly high amounts of trehalose were identified in drought-tolerant crops cassava, Jatropha curcas, and castor bean (Ricinus communis). All cassava varieties tested contained high amounts of trehalose, although their concentrations varied from 0.23 to 1.29 mg·g−1 fresh weight (FW), and the trehalose level was highly correlated with dehydration stress tolerance of detached leaves of the varieties. Moreover, the trehalose concentrations in cassava leaves increased 2.3–5.5 folds in response to osmotic stress simulated by 20% PEG 6000. Through database mining, 24 trehalose pathway genes, including 12 trehalose-6-phosphate synthases (TPS), 10 trehalose-6-phosphate phosphatases (TPP), and two trehalases were identified in cassava. Phylogenetic analysis indicated that there were four cassava TPS genes (MeTPS1–4) that were orthologous to the solely active TPS gene (AtTPS1 and OsTPS1) in Arabidopsis and rice, and a new TPP subfamily was identified in cassava, suggesting that the trehalose biosynthesis activities in cassava had potentially been enhanced in evolutionary history. RNA-seq analysis indicated that MeTPS1 was expressed at constitutionally high level before and after osmotic stress, while other trehalose pathway genes were either up-regulated or down-regulated, which may explain why cassava accumulated high level of trehalose under normal conditions. MeTPS1 was then transformed into tobacco (Nicotiana benthamiana). Results indicated that transgenic tobacco lines accumulated significant level of trehalose and possessed improved drought stress tolerance. In conclusion, cassava accumulated significantly high amount of trehalose under normal conditions due to multiplied trehalose biosynthesis gene families and constant expression of the active MeTPS1 gene. High levels of trehalose subsequently contributed to high drought stress tolerance. PMID:27420056

Isolation, characterization, and evaluation of wild isolates of Lactobacillus reuteri from pig feces.

PubMed

Lee, Deog Yong; Seo, Yeon-Soo; Rayamajhi, Nabin; Kang, Mi Lan; Lee, Su In; Yoo, Han Sang

2009-12-01

Lactic acid bacteria (LAB) are a well-used probiotics for health improvements in both humans and animals. Despite of several benefits, non-host-specific LAB showed poor probiotics effects due to difficulty in colonization and competition with normal flora. Therefore, the feasibility of porcine LAB isolates was evaluated as a probiotics. Ten of 49 Lactobacillus spp. isolates harbored 2 approximately 10 kb plasmid DNA. Seven strains were selected based on the safety test, such as hemolytic activity, ammonia, indole, and phenylalanine production. After safety test, five strains were selected again by several tests, such as epithelial adherence, antimicrobial activity, tolerance against acid, bile, heat, and cold-drying, and production of acid and hydrogen peroxide. Then, enzyme profiles (ZYM test) and antibiotics resistance were analyzed for further characterization. Five Lactobacillus reuteri isolates from pig feces were selected by safety and functional tests. The plasmid DNA which was able to develop vector system was detected in the isolates. Together with these approaches, pig-specific Lactobacillus spp. originated from pigs were selected. These strains may be useful tools to develop oral delivery system.

Acquired intolerance to organic solvents and results of vestibular testing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gyntelberg, F.; Vesterhauge, S.; Fog, P.

1986-01-01

Among 160 consecutive patients referred to the Clinic of Occupational Medicine, Rigshospitalet, for symptoms connected with exposure to organic solvents, 20 exhibited symptoms of acquired intolerance to minor amounts of organic solvents. Later, an additional 30 consecutive patients with symptoms of acquired intolerance were included, yielding a total of 43 men and 7 women. The characteristics of the clinical syndrome described are complaints of dizziness, nausea, and weakness after exposure to minimal solvent vapor concentrations. After having tolerated long-term occupational exposure to moderate or high air concentrations of various organic solvents, the patients became intolerant within a short period ofmore » time. Since dizziness was a frequent complaint, we tried to obtain a measure of the patients' complaints using vestibular tests. As a diagnostic test the combined vestibular tests had a sensitivity of 0.55 and a specificity of 0.87. No differences between patients with and without intolerance could be detected by the vestibular tests used. We conclude that acquired intolerance to organic solvents is a new but characteristic and easily recognizable syndrome, often with severe consequences for the patient's working ability.« less

Interspecific variation in hypoxia tolerance, swimming performance and plasticity in cyprinids that prefer different habitats.

PubMed

Fu, Shi-Jian; Fu, Cheng; Yan, Guan-Jie; Cao, Zhen-Dong; Zhang, An-Jie; Pang, Xu

2014-02-15

This study quantified and compared hypoxia tolerance and swim performance among cyprinid fish species from rapid-, slow- and intermediate-flow habitats (four species per habitat) in China. In addition, we explored the effects of short-term acclimation on swim performance, maximum metabolic rate (M(O2,max)) and gill remodelling to detect habitat-associated patterns of plastic response to hypoxia. Indices of hypoxia tolerance included oxygen threshold for loss of equilibrium (LOE50) and aquatic surface respiration (ASR50), and critical oxygen tension for routine metabolic rate (Pcrit). Critical swimming speed (Ucrit) and M(O2,max) were measured under normoxic and hypoxic conditions after 48 h acclimation to normoxia and hypoxia, and gill remodelling was estimated after 48 h of hypoxia exposure. Both traditional ANCOVA and phylogenetically independent contrast (PDANOVA) analyses showed that fish species from rapid-flow habitats exhibited lower LOE50 compared with fish from intermediate- and slow-flow habitats. Habitat-specific differences in Pcrit and Ucrit were detected using PDANOVA but not traditional ANCOVA analyses, with fish species from rapid-flow habitats exhibiting lower Pcrit but higher Ucrit values compared with fish from intermediate- and slow-flow habitats. Fish species from rapid-flow habitats were also characterized by less plasticity in swim performance and gill morphology in response to hypoxia acclimation compared with species from slow-flow habitats, but a greater drop in swim performance in response to acute hypoxia exposure. The study detected a habitat-specific difference in hypoxia tolerance, swimming performance and its plasticity among fish from habitats with different flow conditions, possibly because of the long-term adaptation to the habitat caused by selection stress. The PDANOVA analyses were more powerful than traditional statistical analyses according to the habitat effects in both hypoxia tolerance and swimming performance in this study.

Upper thermal tolerances of early life stages of freshwater mussels

USGS Publications Warehouse

Pandolfo, Tamara J.; Cope, W. Gregory; Arellano, Consuelo; Bringolf, Robert B.; Barnhart, M. Christopher; Hammer, E

2010-01-01

Freshwater mussels (order Unioniformes) fulfill an essential role in benthic aquatic communities, but also are among the most sensitive and rapidly declining faunal groups in North America. Rising water temperatures, caused by global climate change, industrial discharges, drought, or land development, could further challenge imperiled unionid communities. The aim of our study was to determine the upper thermal tolerances of the larval (glochidia) and juvenile life stages of freshwater mussels. Glochidia of 8 species of mussels were tested: Lampsilis siliquoidea, Potamilus alatus, Ligumia recta, Ellipsaria lineolata,Lasmigona complanata, Megalonaias nervosa, Alasmidonta varicosa, and Villosa delumbis. Seven of these species also were tested as juveniles. Survival trends were monitored while mussels held at 3 acclimation temperatures (17, 22, and 27°C) were exposed to a range of common and extreme water temperatures (20–42°C) in standard acute laboratory tests. The average median lethal temperature (LT50) among species in 24-h tests with glochidia was 31.6°C and ranged from 21.4 to 42.7°C. The mean LT50 in 96-h juvenile tests was 34.7°C and ranged from 32.5 to 38.8°C. Based on comparisons of LT50s, thermal tolerances differed among species for glochidia, but not for juveniles. Acclimation temperature did not affect thermal tolerance for either life stage. Our results indicate that freshwater mussels already might be living close to their upper thermal tolerances in some systems and, thus, might be at risk from rising environmental temperatures.

Impact testing of textile composite materials

NASA Technical Reports Server (NTRS)

Portanova, Marc

1995-01-01

The objectives of this report were to evaluate the impact damage resistance and damage tolerance of a variety of textile composite materials. Static indentation and impact tests were performed on the stitched and unstitched uniweave composites constructed from AS4/3501-6 Carbon/Epoxy with a fiberglass yarn woven in to hold the fibers together while being stitched. Compression and tension were measured after the tests to determine the damage resistance, residual strength and the damage tolerance of the specimens.

A Novel 5-Enolpyruvylshikimate-3-Phosphate Synthase Shows High Glyphosate Tolerance in Escherichia coli and Tobacco Plants

PubMed Central

Zhang, Shengxue; Yang, Xuewen; Chen, Rongrong; Zhang, Yuwen; Lu, Wei; Liu, Yan; Wang, Jianhua; Lin, Min; Wang, Guoying

2012-01-01

A key enzyme in the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the primary target of the broad-spectrum herbicide glyphosate. Identification of new aroA genes coding for EPSPS with a high level of glyphosate tolerance is essential for the development of glyphosate-tolerant crops. In the present study, the glyphosate tolerance of five bacterial aroA genes was evaluated in the E. coli aroA-defective strain ER2799 and in transgenic tobacco plants. All five aroA genes could complement the aroA-defective strain ER2799, and AM79 aroA showed the highest glyphosate tolerance. Although glyphosate treatment inhibited the growth of both WT and transgenic tobacco plants, transgenic plants expressing AM79 aroA tolerated higher concentration of glyphosate and had a higher fresh weight and survival rate than plants expressing other aroA genes. When treated with high concentration of glyphosate, lower shikimate content was detected in the leaves of transgenic plants expressing AM79 aroA than transgenic plants expressing other aroA genes. These results suggest that AM79 aroA could be a good candidate for the development of transgenic glyphosate-tolerant crops. PMID:22715408

EGFR mutation detection in ctDNA from NSCLC patient plasma: A cross-platform comparison of leading technologies to support the clinical development of AZD9291.

PubMed

Thress, Kenneth S; Brant, Roz; Carr, T Hedley; Dearden, Simon; Jenkins, Suzanne; Brown, Helen; Hammett, Tracey; Cantarini, Mireille; Barrett, J Carl

2015-12-01

To assess the ability of different technology platforms to detect epidermal growth factor receptor (EGFR) mutations, including T790M, from circulating tumor DNA (ctDNA) in advanced non-small cell lung cancer (NSCLC) patients. A comparison of multiple platforms for detecting EGFR mutations in plasma ctDNA was undertaken. Plasma samples were collected from patients entering the ongoing AURA trial (NCT01802632), investigating the safety, tolerability, and efficacy of AZD9291 in patients with EGFR-sensitizing mutation-positive NSCLC. Plasma was collected prior to AZD9291 dosing but following clinical progression on a previous EGFR-tyrosine kinase inhibitor (TKI). Extracted ctDNA was analyzed using two non-digital platforms (cobas(®) EGFR Mutation Test and therascreen™ EGFR amplification refractory mutation system assay) and two digital platforms (Droplet Digital™ PCR and BEAMing digital PCR [dPCR]). Preliminary assessment (38 samples) was conducted using all four platforms. For EGFR-TKI-sensitizing mutations, high sensitivity (78-100%) and specificity (93-100%) were observed using tissue as a non-reference standard. For the T790M mutation, the digital platforms outperformed the non-digital platforms. Subsequent assessment using 72 additional baseline plasma samples was conducted using the cobas(®) EGFR Mutation Test and BEAMing dPCR. The two platforms demonstrated high sensitivity (82-87%) and specificity (97%) for EGFR-sensitizing mutations. For the T790M mutation, the sensitivity and specificity were 73% and 67%, respectively, with the cobas(®) EGFR Mutation Test, and 81% and 58%, respectively, with BEAMing dPCR. Concordance between the platforms was >90%, showing that multiple platforms are capable of sensitive and specific detection of EGFR-TKI-sensitizing mutations from NSCLC patient plasma. The cobas(®) EGFR Mutation Test and BEAMing dPCR demonstrate a high sensitivity for T790M mutation detection. Genomic heterogeneity of T790M-mediated resistance may explain the reduced specificity observed with plasma-based detection of T790M mutations versus tissue. These data support the use of both platforms in the AZD9291 clinical development program. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

The effects of heat stress in Italian Holstein dairy cattle.

PubMed

Bernabucci, U; Biffani, S; Buggiotti, L; Vitali, A; Lacetera, N; Nardone, A

2014-01-01

The data set for this study comprised 1,488,474 test-day records for milk, fat, and protein yields and fat and protein percentages from 191,012 first-, second-, and third-parity Holstein cows from 484 farms. Data were collected from 2001 through 2007 and merged with meteorological data from 35 weather stations. A linear model (M1) was used to estimate the effects of the temperature-humidity index (THI) on production traits. Least squares means from M1 were used to detect the THI thresholds for milk production in all parities by using a 2-phase linear regression procedure (M2). A multiple-trait repeatability test-model (M3) was used to estimate variance components for all traits and a dummy regression variable (t) was defined to estimate the production decline caused by heat stress. Additionally, the estimated variance components and M3 were used to estimate traditional and heat-tolerance breeding values (estimated breeding values, EBV) for milk yield and protein percentages at parity 1. An analysis of data (M2) indicated that the daily THI at which milk production started to decline for the 3 parities and traits ranged from 65 to 76. These THI values can be achieved with different temperature/humidity combinations with a range of temperatures from 21 to 36°C and relative humidity values from 5 to 95%. The highest negative effect of THI was observed 4 d before test day over the 3 parities for all traits. The negative effect of THI on production traits indicates that first-parity cows are less sensitive to heat stress than multiparous cows. Over the parities, the general additive genetic variance decreased for protein content and increased for milk yield and fat and protein yield. Additive genetic variance for heat tolerance showed an increase from the first to third parity for milk, protein, and fat yield, and for protein percentage. Genetic correlations between general and heat stress effects were all unfavorable (from -0.24 to -0.56). Three EBV per trait were calculated for each cow and bull (traditional EBV, traditional EBV estimated with the inclusion of THI covariate effect, and heat tolerance EBV) and the rankings of EBV for 283 bulls born after 1985 with at least 50 daughters were compared. When THI was included in the model, the ranking for 17 and 32 bulls changed for milk yield and protein percentage, respectively. The heat tolerance genetic component is not negligible, suggesting that heat tolerance selection should be included in the selection objectives. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Metabolic Capacity of Sinorhizobium (Ensifer) meliloti Strains as Determined by Phenotype MicroArray Analysis▿ †

PubMed Central

Biondi, Emanuele G.; Tatti, Enrico; Comparini, Diego; Giuntini, Elisa; Mocali, Stefano; Giovannetti, Luciana; Bazzicalupo, Marco; Mengoni, Alessio; Viti, Carlo

2009-01-01

Sinorhizobium meliloti is a soil bacterium that fixes atmospheric nitrogen in plant roots. The high genetic diversity of its natural populations has been the subject of extensive analysis. Recent genomic studies of several isolates revealed a high content of variable genes, suggesting a correspondingly large phenotypic differentiation among strains of S. meliloti. Here, using the Phenotype MicroArray (PM) system, hundreds of different growth conditions were tested in order to compare the metabolic capabilities of the laboratory reference strain Rm1021 with those of four natural S. meliloti isolates previously analyzed by comparative genomic hybridization (CGH). The results of PM analysis showed that most phenotypic differences involved carbon source utilization and tolerance to osmolytes and pH, while fewer differences were scored for nitrogen, phosphorus, and sulfur source utilization. Only the variability of the tested strain in tolerance to sodium nitrite and ammonium sulfate of pH 8 was hypothesized to be associated with the genetic polymorphisms detected by CGH analysis. Colony and cell morphologies and the ability to nodulate Medicago truncatula plants were also compared, revealing further phenotypic diversity. Overall, our results suggest that the study of functional (phenotypic) variability of S. meliloti populations is an important and complementary step in the investigation of genetic polymorphism of rhizobia and may help to elucidate rhizobial evolutionary dynamics, including adaptation to diverse environments. PMID:19561177

Dietary chromium tripicolinate supplementation reduces glucose concentrations and improves glucose tolerance in normal-weight cats.

PubMed

Appleton, D J; Rand, J S; Sunvold, G D; Priest, J

2002-03-01

The effect of dietary chromium supplementation on glucose and insulin metabolism in healthy, non-obese cats was evaluated. Thirty-two cats were randomly divided into four groups and fed experimental diets consisting of a standard diet with 0 ppb (control), 150 ppb, 300 ppb, or 600 ppb added chromium as chromium tripicolinate. Intravenous glucose tolerance, insulin tolerance and insulin sensitivity tests with minimal model analysis were performed before and after 6 weeks of feeding the test diets. During the glucose tolerance test, glucose concentrations, area under the glucose concentration-time curve, and glucose half-life (300 ppb only), were significantly lower after the trial in cats supplemented with 300 ppb and 600 ppb chromium, compared with values before the trial. Fasting glucose concentrations measured on a different day in the biochemistry profile were also significantly lower after supplementation with 600 ppb chromium. There were no significant differences in insulin concentrations or indices in either the glucose or insulin tolerance tests following chromium supplementation, nor were there any differences between groups before or after the dietary trial.Importantly, this study has shown a small but significant, dose-dependent improvement in glucose tolerance in healthy, non-obese cats supplemented with dietary chromium. Further long-term studies are warranted to determine if the addition of chromium to feline diets is advantageous. Cats most likely to benefit are those with glucose intolerance and insulin resistance from lack of exercise, obesity and old age. Healthy cats at risk of glucose intolerance and diabetes from underlying low insulin sensitivity or genetic factors may also benefit from long-term chromium supplementation. Copyright 2002 ESFM and AAFP.