DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

Annotated definition of BCL11A and HMIP-2 haplotypes through the analysis of sicilian β-thalassemia patients with high levels of fetal hemoglobin.

PubMed

Buccheri, Maria A; Spina, Sonia; Ruberto, Concetta; Lombardo, Turi; Labie, Dominique; Ragusa, And Angela

2013-01-01

Fetal hemoglobin (Hb F) is the principal ameliorating factor of β-thalassemia (β-thal) and sickle cell disease. Persistent production in adult life is a quantitative trait regulated by loci inside or outside the β-globin gene cluster. From genome-wide association studies, principal quantitative trait loci (QTL) (accounting for 50.0% of Hb F variability in different populations) have been identified in the BCL11A gene, HBS1L-MYB intergenic polymorphism and the β-globin gene cluster itself. In this study, we analyzed quantitative trait haplotypes in two Sicilian families with extremely mild β-thal and unusually high Hb F expression, in order to examine possible genetic background variations in a similar β-thalassemic phenotype. This study redefines the linkage disequilibrium blocks at these loci, but also shows slight differences between probands in haplotype combinations which could reflect different mechanisms of high Hb F production in patients with β-thal. We proposed a haplotype-based approach as a useful tool for the understanding of β-thal phenotype variation in patients with similar β-thalassemic backgrounds in an attempt to answer the recurring question of why patients with the same β-thalassemic genotype show different phenotypes.

Framing the research agenda for sickle cell trait: building on the current understanding of clinical events and their potential implications

PubMed Central

Goldsmith, Jonathan C.; Bonham, Vence L.; Joiner, Clinton H.; Kato, Gregory J.; Noonan, Allan S.; Steinberg, Martin H.

2012-01-01

Sickle Cell Trait (HbAS), the heterozygous state for the sickle hemoglobin beta globin gene is carried by as many as 100 million individuals including up to 25% of the population in some regions of the world (World Health Organization, Provisional agenda item 4.8, EB117/34 (22 December 2005) or World Health Organization, Provisional agenda item 11.4 (24 April 2006)). Persons with HbAS have some resistance to falciparum malaria infection in early childhood (Piel FB, Patil AP, Howes RE, et al., Nat Commun 2010;1104:1–7 and Aidoo M, Terlouw DJ, Kolczak M, et al., Lancet 2002;359:1311–1312) and as a result individuals with HbAS living in malarial endemic regions of Africa have a survival advantage over individuals with HbAA. Reports from the US emphasize possible health risks for individuals with HbAS including increased incidence of renal failure and malignancy, thromboembolic disorders, splenic infarction as a high altitude complication, and exercise-related sudden death. The National Heart, Lung, and Blood Institute, National Institutes of Health convened a workshop in Bethesda, Maryland on June 3–4, 2010, Framing the Research Agenda for Sickle Cell Trait, to review the clinical manifestations of HbAS, discuss the exercise-related sudden death reports in HbAS, and examine the public health, societal, and ethical implications of policies regarding HbAS. The goal of the workshop was to identify potential research questions to address knowledge gaps. PMID:22307997

Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia.

PubMed

Lee, T Y; Lai, M I; Ismail, P; Ramachandran, V; Tan, J A M A; Teh, L K; Othman, R; Hussein, N H; George, E

2016-04-07

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Frequency of haemoglobinopathies and glucose-6-phosphate dehydrogenase deficiency in Basra.

PubMed

Hassan, M K; Taha, J Y; Al-Naama, L M; Widad, N M; Jasim, S N

2003-01-01

Basra, southern Iraq, was mapped for haemoglobinopathies and glucose-6-phosphate dehydrogenase (G6PD) deficiency. Of 1064 couples aged 14-60 years recruited from the Public Health Laboratory, 49 had beta-thalassaemia trait, 69 had sickle-cell trait, 2 had haemoglobin D trait, 2 had haemoglobin C trait and 1 had high persistent fetal haemoglobin. Carriers of major beta-globin disorders comprised 11.48%. G6PD deficiency was detected in 133 individuals (12.5%). Only 10 couples (0.94%) were at risk of having children affected with either sickle-cell disease or beta-thalassaemia major. These defects constitute a real health problem and necessitate a management plan and public health education for early diagnosis and therapy.

IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.

PubMed

Azimi, Azam; Alibakhshi, Reza; Hayati, Hasibeh; Tahmasebi, Soosan; Alimoradi, Sasan

2017-01-01

Thalassemia is the most common inherited disorder in Iran. There are approximately 800 different genomic alterations of the β-globin gene described in the HbVar database. In this study, we identified a novel mutation in a 21-year-old woman [IVS-II-648/649 (-T); HBB: c.316-202del)] and describe its clinical implications. Two other members of this family, all with hematological and clinical features associated with β-thalassemia (β-thal), also carried this mutation. The molecular diagnosis of the β-globin gene mutation was performed by direct sequencing. Based on the observed β-thal phenotype and in silico analysis results, we concluded that this novel β-globin gene mutation was associated with the mild phenotype of β-thal.

Erythro-megakaryocytic transcription factors associated with hereditary anemia

PubMed Central

Weiss, Mitchell J.

2014-01-01

Most heritable anemias are caused by mutations in genes encoding globins, red blood cell (RBC) membrane proteins, or enzymes in the glycolytic and hexose monophosphate shunt pathways. A less common class of genetic anemia is caused by mutations that alter the functions of erythroid transcription factors (TFs). Many TF mutations associated with heritable anemia cause truncations or amino acid substitutions, resulting in the production of functionally altered proteins. Characterization of these mutant proteins has provided insights into mechanisms of gene expression, hematopoietic development, and human disease. Mutations within promoter or enhancer regions that disrupt TF binding to essential erythroid genes also cause anemia and heritable variations in RBC traits, such as fetal hemoglobin content. Defining the latter may have important clinical implications for de-repressing fetal hemoglobin synthesis to treat sickle cell anemia and β thalassemia. Functionally important alterations in genes encoding TFs or their cognate cis elements are likely to occur more frequently than currently appreciated, a hypothesis that will soon be tested through ongoing genome-wide association studies and the rapidly expanding use of global genome sequencing for human diagnostics. Findings obtained through such studies of RBCs and associated diseases are likely generalizable to many human diseases and quantitative traits. PMID:24652993

Plasmodium falciparum malaria skews globin gene expression balance in in-vitro haematopoietic stem cell culture system: Its implications in malaria associated anemia.

PubMed

Pathak, Vrushali; Colah, Roshan; Ghosh, Kanjaksha

2018-02-01

Understanding the pathophysiology and associated host parasite interactions of the malaria infection is the prerequisite for developing effective prevention and treatment strategies. The exact mechanism underlying malaria associated ineffective and dyserythropoiesis is not yet fully understood. Being an important protein, haemoglobin serves as the main amino acid reservoir available to the intra-erythrocytic plasmodium. It is important to check the expression profiling of globin genes which may help us to understand host parasite interactions and its potential contribution to both infection and disease. Here, an in-vitro culture system was used to study the effect of different doses of Plasmodium falciparum on haematopoietic stem cell expansion, differentiation and expression of globin genes. Upon exposure to the different doses of P. falciparum parasites of strains 3D7, Dd2 and RKL9 (intact and lysed form) at different stages of erythroid development, cells demonstrated suppression in growth and differentiation. At almost all stages of erythroid development upon parasite exposure, the γ globin gene was found to be downregulated and the α/β as well as α/non- α globin mRNA ratios in late stage erythroid cells were found to be reduced (p < .01) compared to the untreated controls. The imbalance in globin chain expression might be considered as one of the factors involved in malaria associated inappropriate erythropoietic responses. Copyright © 2018 Elsevier Inc. All rights reserved.

Two genetic markers closely linked to adult polycystic kidney disease on chromosome 16.

PubMed Central

Reeders, S T; Breuning, M H; Corney, G; Jeremiah, S J; Meera Khan, P; Davies, K E; Hopkinson, D A; Pearson, P L; Weatherall, D J

1986-01-01

The genetic locus for autosomal dominant adult polycystic kidney disease was recently assigned to chromosome 16 by the finding of genetic linkage to the alpha globin gene cluster. Further study showed that the phosphoglycolate phosphatase locus is also closely linked to both the locus for adult polycystic kidney disease and the alpha globin gene cluster. These findings have important implications for the prenatal and presymptomatic diagnosis of adult polycystic kidney disease and for a better understanding of its pathogenesis. Images FIG 1 PMID:3008903

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thein, S.L.; Weatherall, D.J.; Sampietro, M.

[open quotes]Heterocellular hereditary persistence of fetal hemoglobin[close quotes] (HPFH) is the term used to describe the genetically determined persistence of fetal hemoglobin (Hb F) production into adult life, in the absence of any related hematological disorder. Whereas some forms are caused by mutations in the [beta]-globin gene cluster on chromosome 11, others segregate independently. While the latter are of particular interest with respect to the regulation of globin gene switching, it has not been possible to determine their chromosomal location, mainly because their mode of inheritance is not clear, but also because several other factors are known to modify Hbmore » F production. The authors have examined a large Asian Indian pedigree which includes individuals with heterocellular HPFH associated with [beta]-thalassemia and/or [alpha]-thalassemia. Segregation analysis was conducted on the HPFH trait FC, defined to be the percentage of Hb F-containing cells (F-cells), using the class D regressive model. The results provide evidence for the presence of a major gene, dominant or codominant, which controls the FC values with residual familial correlations. The major gene was detected when the effects of genetic modifiers, notably [beta]-thalassemia and the XmnI-[sup G][gamma] polymorphism, are accounted for in this analysis. Linkage with the [beta]-globin gene cluster is excluded. The transmission of the FC values in this pedigree is informative enough to allow detection of linkage with an appropriate marker(s). The analytical approach outlined in this study, using simple regression to allow for genetic modifiers and thus allowing the mode of inheritance of a trait to be dissected out, may be useful as a model for segregation and linkage analyses of other complex phenotypes. 39 refs., 4 figs., 6 tabs.« less

Genetic modulation of sickle cell anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Steinberg, M.H.

1995-05-01

Sickle cell anemia, a common disorder associated with reduced life span of the red blood cell and vasoocclusive events, is caused by a mutation in the {Beta}-hemoglobin gene. Yet, despite this genetic homogeneity, the phenotype of the disease is heterogeneous. This suggests the modulating influence of associated inherited traits. Some of these may influence the accumulation of fetal hemoglobin, a hemoglobin type that interferes with the polymerization of sickle hemoglobin. Another inherited trait determines the accumulation of {alpha}-globin chains. This review focuses on potential genetic regulators of the phenotype of sickle cell anemia. 125 refs., 6 figs., 3 tabs.

Synergistic and additive properties of the beta-globin locus control region (LCR) revealed by 5'HS3 deletion mutations: implication for LCR chromatin architecture.

PubMed

Fang, Xiangdong; Sun, Jin; Xiang, Ping; Yu, Man; Navas, Patrick A; Peterson, Kenneth R; Stamatoyannopoulos, George; Li, Qiliang

2005-08-01

Deletion of the 234-bp core element of the DNase I hypersensitive site 3 (5'HS3) of the locus control region (LCR) in the context of a human beta-globin locus yeast artificial chromosome (beta-YAC) results in profound effects on globin gene expression in transgenic mice. In contrast, deletion of a 2.3-kb 5'HS3 region, which includes the 234-bp core sequence, has a much milder phenotype. Here we report the effects of these deletions on chromatin structure in the beta-globin locus of adult erythroblasts. The 234-bp 5'HS3 deletion abolished histone acetylation throughout the beta-globin locus; recruitment of RNA polymerase II (pol II) to the LCR and beta-globin gene promoter was reduced to a basal level; and formation of all the 5' DNase I hypersensitive sites of the LCR was disrupted. The 2.3-kb 5'HS3 deletion mildly reduced the level of histone acetylation but did not change the profile across the whole locus; the 5' DNase I hypersensitive sites of the LCR were formed, but to a lesser extent; and recruitment of pol II was reduced, but only marginally. These data support the hypothesis that the LCR forms a specific chromatin structure and acts as a single entity. Based on these results we elaborate on a model of LCR chromatin architecture which accommodates the distinct phenotypes of the 5'HS3 and HS3 core deletions.

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

PubMed

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Acute chest syndrome is associated with single nucleotide polymorphism-defined beta globin cluster haplotype in children with sickle cell anaemia

PubMed Central

Bean, Christopher J.; Boulet, Sheree L.; Yang, Genyan; Payne, Amanda B.; Ghaji, Nafisa; Pyle, Meredith E.; Hooper, W. Craig; Bhatnagar, Pallav; Keefer, Jeffrey; Barron-Casella, Emily A.; Casella, James F.; DeBaun, Michael R.

2013-01-01

Summary Genetic diversity at the human β-globin locus has been implicated as a modifier of sickle cell anaemia (SCA) severity. However, haplotypes defined by restriction fragment length polymorphism sites across the β-globin locus have not been consistently associated with clinical phenotypes. To define the genetic structure at the β-globin locus more thoroughly, we performed high-density single nucleotide polymorphism (SNP) mapping in 820 children who were homozygous for the sickle cell mutation (HbSS). Genotyping results revealed very high linkage disequilibrium across a large region spanning the locus control region and the HBB (β-globin gene) cluster. We identified three predominant haplotypes accounting for 96% of the βS-carrying chromosomes in this population that could be distinguished using a minimal set of common SNPs. Consistent with previous studies, fetal haemoglobin level was significantly associated with βS-haplotypes. After controlling for covariates, an association was detected between haplotype and rate of hospitalization for acute chest syndrome (ACS) (incidence rate ratio 0.51, 95% confidence interval 0.29–0.89) but not incidence rate of vaso-occlusive pain or presence of silent cerebral infarct (SCI). Our results suggest that these SNP-defined βS-haplotypes may be associated with ACS, but not pain or SCI in a study population of children with SCA. PMID:23952145

Genome-wide association analysis of red blood cell traits in African Americans: the COGENT Network

PubMed Central

Chen, Zhao; Tang, Hua; Qayyum, Rehan; Schick, Ursula M.; Nalls, Michael A.; Handsaker, Robert; Li, Jin; Lu, Yingchang; Yanek, Lisa R.; Keating, Brendan; Meng, Yan; van Rooij, Frank J.A.; Okada, Yukinori; Kubo, Michiaki; Rasmussen-Torvik, Laura; Keller, Margaux F.; Lange, Leslie; Evans, Michele; Bottinger, Erwin P.; Linderman, Michael D.; Ruderfer, Douglas M.; Hakonarson, Hakon; Papanicolaou, George; Zonderman, Alan B.; Gottesman, Omri; Thomson, Cynthia; Ziv, Elad; Singleton, Andrew B.; Loos, Ruth J.F.; Sleiman, Patrick M.A.; Ganesh, Santhi; McCarroll, Steven; Becker, Diane M.; Wilson, James G.; Lettre, Guillaume; Reiner, Alexander P.

2013-01-01

Laboratory red blood cell (RBC) measurements are clinically important, heritable and differ among ethnic groups. To identify genetic variants that contribute to RBC phenotypes in African Americans (AAs), we conducted a genome-wide association study in up to ∼16 500 AAs. The alpha-globin locus on chromosome 16pter [lead SNP rs13335629 in ITFG3 gene; P < 1E−13 for hemoglobin (Hgb), RBC count, mean corpuscular volume (MCV), MCH and MCHC] and the G6PD locus on Xq28 [lead SNP rs1050828; P < 1E − 13 for Hgb, hematocrit (Hct), MCV, RBC count and red cell distribution width (RDW)] were each associated with multiple RBC traits. At the alpha-globin region, both the common African 3.7 kb deletion and common single nucleotide polymorphisms (SNPs) appear to contribute independently to RBC phenotypes among AAs. In the 2p21 region, we identified a novel variant of PRKCE distinctly associated with Hct in AAs. In a genome-wide admixture mapping scan, local European ancestry at the 6p22 region containing HFE and LRRC16A was associated with higher Hgb. LRRC16A has been previously associated with the platelet count and mean platelet volume in AAs, but not with Hgb. Finally, we extended to AAs the findings of association of erythrocyte traits with several loci previously reported in Europeans and/or Asians, including CD164 and HBS1L-MYB. In summary, this large-scale genome-wide analysis in AAs has extended the importance of several RBC-associated genetic loci to AAs and identified allelic heterogeneity and pleiotropy at several previously known genetic loci associated with blood cell traits in AAs. PMID:23446634

The Full Globin Repertoire of Turtles Provides Insights into Vertebrate Globin Evolution and Functions.

PubMed

Schwarze, Kim; Singh, Abhilasha; Burmester, Thorsten

2015-06-15

Globins are small heme proteins that play an important role in oxygen supply, but may also have other functions. Globins offer a unique opportunity to study the functional evolution of genes and proteins. We have characterized the globin repertoire of two different turtle species: the Chinese softshell turtle (Pelodiscus sinensis) and the western painted turtle (Chrysemys picta bellii). In the genomes of both species, we have identified eight distinct globin types: hemoglobin (Hb), myoglobin, neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Therefore, along with the coelacanth, turtles are so far the only known vertebrates with a full globin repertoire. This fact allows for the first time a comparative analysis of the expression of all eight globins in a single species. Phylogenetic analysis showed an early divergence of neuroglobin and globin X before the radiation of vertebrates. Among the other globins, cytoglobin diverged first, and there is a close relationship between myoglobin and globin E; the position of globin Y is not resolved. The globin E gene was selectively lost in the green anole, and the genes coding for globin X and globin Y were deleted in chicken. Quantitative real-time reverse transcription polymerase chain reaction experiments revealed that myoglobin, neuroglobin, and globin E are highly expressed with tissue-specific patterns, which are in line with their roles in the oxidative metabolism of the striated muscles, the brain, and the retina, respectively. Histochemical analyses showed high levels of globin E in the pigment epithelium of the eye. Globin E probably has a myoglobin-like role in transporting O2 across the pigment epithelium to supply in the metabolically highly active retina. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Axolotl hemoglobin: cDNA-derived amino acid sequences of two alpha globins and a beta globin from an adult Ambystoma mexicanum.

PubMed

Shishikura, Fumio; Takeuchi, Hiro-aki; Nagai, Takatoshi

2005-11-01

Erythrocytes of the adult axolotl, Ambystoma mexicanum, have multiple hemoglobins. We separated and purified two kinds of hemoglobin, termed major hemoglobin (Hb M) and minor hemoglobin (Hb m), from a five-year-old male by hydrophobic interaction column chromatography on Alkyl Superose. The hemoglobins have two distinct alpha type globin polypeptides (alphaM and alpham) and a common beta globin polypeptide, all of which were purified in FPLC on a reversed-phase column after S-pyridylethylation. The complete amino acid sequences of the three globin chains were determined separately using nucleotide sequencing with the assistance of protein sequencing. The mature globin molecules were composed of 141 amino acid residues for alphaM globin, 143 for alpham globin and 146 for beta globin. Comparing primary structures of the five kinds of axolotl globins, including two previously established alpha type globins from the same species, with other known globins of amphibians and representatives of other vertebrates, we constructed phylogenetic trees for amphibian hemoglobins and tetrapod hemoglobins. The molecular trees indicated that alphaM, alpham, beta and the previously known alpha major globin were adult types of globins and the other known alpha globin was a larval type. The existence of two to four more globins in the axolotl erythrocyte is predicted.

Molecular Characterization and Expression of α-Globin and β-Globin Genes in the Euryhaline Flounder (Platichthys flesus)

PubMed Central

Lu, Weiqun; Mayolle, Aurelie; Cui, Guoqiang; Luo, Lei; Balment, Richard J.

2011-01-01

In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW. PMID:21969841

Three mouse models of human thalassemia.

PubMed Central

Martinell, J; Whitney, J B; Popp, R A; Russell, L B; Anderson, W F

1981-01-01

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hbath-J, appear to be true animal models of human thalassemia. Expression of the alpha-globin genes in three stocks of mice, each one heterozygous for one of the alpha-globin mutations, was examined at the polypeptide, RNA, and DNA levels. alpha-Globin polypeptide chains, relative to beta-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of alpha-globin to beta-globin RNA sequences are also 75-80% of normal, exactly reflecting the alpha-globin to beta-globin chain ratios. In the case of mutant 352HB, at least one alpha-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their alpha-globin genes. Images PMID:6946454

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals.

PubMed

Patel, Vidushi S; Cooper, Steven J B; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer A M

2008-07-25

Vertebrate alpha (alpha)- and beta (beta)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the alpha- and beta-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil beta-globin gene (omega) in the marsupial alpha-cluster, however, suggested that duplication of the alpha-beta cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous alpha- and beta-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. The platypus alpha-globin cluster (chromosome 21) contains embryonic and adult alpha- globin genes, a beta-like omega-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-zeta-zeta'-alphaD-alpha3-alpha2-alpha1-omega-GBY-3'. The platypus beta-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-epsilon-beta-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate alpha-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal beta-globin clusters are embedded in olfactory genes. Thus, the mammalian alpha- and beta-globin clusters are orthologous to the bird alpha- and beta-globin clusters respectively. We propose that alpha- and beta-globin clusters evolved from an ancient MPG-C16orf35-alpha-beta-GBY-LUC7L arrangement 410 million years ago. A copy of the original beta (represented by omega in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of beta-globin genes with different expression profiles in different lineages.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinell, J.; Whitney, J.B.; Popp, R.A.

Three types of mice with globin gene mutations, called 352HB, 27HB, and Hba/sup th-J/, appear to be true animal models of human thalassemia. Expression of the ..cap alpha..-globin genes in three stocks of mice, each one heterozygous for one of the ..cap alpha..-globin mutations, was examined at the polypeptide, RNA, and DNA levels. ..cap alpha..-globin polypeptide chains, relative to ..gamma..-globin chains in heterozygous thalassemic mice, are present at approximately 80% of normal. The ratios of ..cap alpha..-globin to ..gamma..-globin RNA sequences are also 75 to 80% normal, exactly reflecting the ..cap alpha..-globin to ..gamma..-globin chain ratios. In the case ofmore » mutant 352HB, at least one ..cap alpha..-globin gene is deleted. Thalassemic mouse erythroid cells appear to compensate partially for the loss of half of their ..cap alpha..-globin genes.« less

All of the human beta-type globin genes compete for LCR enhancer activity in embryonic erythroid cells of yeast artificial chromosome transgenic mice.

PubMed

Okamura, Eiichi; Matsuzaki, Hitomi; Campbell, Andrew D; Engel, James Douglas; Fukamizu, Akiyoshi; Tanimoto, Keiji

2009-12-01

In primitive erythroid cells of human beta-globin locus transgenic mice (TgM), the locus control region (LCR)-proximal epsilon- and gamma-globin genes are transcribed, whereas the distal delta- and beta-globin genes are silent. It is generally accepted that the beta-globin gene is competitively suppressed by gamma-globin gene expression at this developmental stage. Previously, however, we observed that epsilon-globin gene expression was severely attenuated when its distance from the LCR was extended, implying that beta-globin gene might also be silenced because of its great distance from the LCR. Here, to clarify the beta-globin gene silencing mechanism, we established TgM lines carrying either gamma- or epsilon- plus gamma-globin promoter deletions, without significantly altering the distance between the beta-globin gene and the LCR. Precocious expression of delta- and beta-globin genes was observed in primitive erythroid cells of mutant, but not wild-type TgM, which was most evident when both the epsilon and gamma promoters were deleted. Thus, we clearly demonstrated that the repression of the delta- and beta-globin genes in primitive erythroid cells is dominated by competitive silencing by the epsilon- and gamma-globin gene promoters, and that epsilon- and the other beta-like globin genes might be activated by two distinct mechanisms by the LCR.

Combination of a triple alpha-globin gene with beta-thalassemia in a gypsy family: importance of the genetic testing in the diagnosis and search for a donor for bone marrow transplantation for one of their children.

PubMed

Yus Cebrian, Flor; Recasens Flores, María del Valle; Izquierdo Álvarez, Silvia; Parra Salinas, Ingrid; Rodriguez-Vigil Iturrate, Carmen

2016-04-14

The simultaneous presence of a heterozygous β-thalassemia with α-gene triplication may cause anything from a thalassemia trait to thalassemia intermedia of mild to moderate severity. An 8-month-old ethnic Gypsy male infant with failure to thrive from birth, mild jaundice and splenomegaly. Clinical signs were compatible with severe microcytic anemia requiring bi-monthly blood transfusions. The β-thalassemia gene analysis found homozygous mutation IVS-I-110 (G>A) (c.93-21G>A) in intron 1 of the hemoglobin beta globin gene and a non-pathogenic sequence variant (single nucleotide polimorfism (SNP) Rs1609812). In addition, the patient had α gene triplication (ααα(anti 3.7)/αα) caused by double heterozygosity for a 3.7 kb fragment that contained only the hemoglobin alpha globin gene-2 gene. This finding led to screening and follow up in first-degree relatives, twin brothers and a sister and parents to provide them with appropriate genetic counseling. Nowadays, new horizons could open a new therapeutic management until definitive cure of these diseases through gene therapy or mutation-specific genome editing. Genetic testing can provide an early diagnosis and facilitates the search for a suitable donor for transplantation.

Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

PubMed Central

Patel, Vidushi S; Cooper, Steven JB; Deakin, Janine E; Fulton, Bob; Graves, Tina; Warren, Wesley C; Wilson, Richard K; Graves, Jennifer AM

2008-01-01

Background Vertebrate alpha (α)- and beta (β)-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω) in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus), to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21) contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2) contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes) was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago), then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages. PMID:18657265

Rapid determination of human globin chains using reversed-phase high-performance liquid chromatography.

PubMed

Wan, Jun-Hui; Tian, Pei-Ling; Luo, Wei-Hao; Wu, Bing-Yi; Xiong, Fu; Zhou, Wan-Jun; Wei, Xiang-Cai; Xu, Xiang-Min

2012-07-15

Reversed-phase high-performance liquid chromatography (RP-HPLC) of human globin chains is an important tool for detecting thalassemias and hemoglobin variants. The challenges of this method that limit its clinical application are a long analytical time and complex sample preparation. The aim of this study was to establish a simple, rapid and high-resolution RP-HPLC method for the separation of globin chains in human blood. Red blood cells from newborns and adults were diluted in deionized water and injected directly onto a micro-jupiter C18 reversed-phase column (250 mm × 4.6 mm) with UV detection at 280 nm. Under the conditions of varying pH or the HPLC gradient, the globin chains (pre-β, β, δ, α, (G)γ and (A)γ) were denatured and separated from the heme groups in 12 min with a retention time coefficient of variation (CV) ranging from 0.11 to 1.29% and a peak area CV between 0.32% and 4.86%. Significant differences (P<0.05) among three groups (normal, Hb H and β thalassemia) were found in the area ratio of α/pre-β+β applying the rapid elution procedure, while P≥0.05 was obtained between the normal and α thalassemia silent/trait group. Based on the ANOVA results, receiver operating characteristic (ROC) curve analysis of the δ/β and α/pre-β+β area ratios showed a sensitivity of 100.0%, and a specificity of 100.0% for indicating β thalassemia carriers, and a sensitivity of 96.6% and a specificity of 89.6% for the prediction of hemoglobin H (Hb H) disease. The proposed cut-off was 0.026 of δ/β for β thalassemia carriers and 0.626 of α/pre-β+β for Hb H disease. In addition, abnormal hemoglobin hemoglobin E (Hb E) and Hb Westmead (Hb WS) were successfully identified using this RP-HPLC method. Our experience in developing this RP-HPLC method for the rapid separation of human globin chains could be of use for similar work. Copyright © 2012 Elsevier B.V. All rights reserved.

LCR 5' hypersensitive site specificity for globin gene activation within the active chromatin hub.

PubMed

Peterson, Kenneth R; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-12-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (β(m)), coupled to an intact LCR, a 5'HS3 complete deletion (5'ΔHS3) or a 5'HS3 core deletion (5'ΔHS3c). The 5'ΔHS3c mice expressed β(m)-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5'HS3 core was not required for β(m)-globin expression, previous work showed that the 5'HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5'HS complete deletion mice, except β(m)-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction.

Context-dependent EKLF responsiveness defines the developmental specificity of the human ɛ-globin gene in erythroid cells of YAC transgenic mice

PubMed Central

Tanimoto, Keiji; Liu, Qinghui; Grosveld, Frank; Bungert, Jörg; Engel, James Douglas

2000-01-01

We explored the mechanism of definitive-stage ɛ-globin transcriptional inactivity within a human β-globin YAC expressed in transgenic mice. We focused on the globin CAC and CAAT promoter motifs, as previous laboratory and clinical studies indicated a pivotal role for these elements in globin gene activation. A high-affinity CAC-binding site for the erythroid krüppel-like factor (EKLF) was placed in the ɛ-globin promoter at a position corresponding to that in the adult β-globin promoter, thereby simultaneously ablating a direct repeat (DR) element. This mutation led to EKLF-independent ɛ-globin transcription during definitive erythropoiesis. A second 4-bp substitution in the ɛ-globin CAAT sequence, which simultaneously disrupts a second DR element, further enhanced ectopic definitive erythroid activation of ɛ-globin transcription, which surprisingly became EKLF dependent. We finally examined factors in nuclear extracts prepared from embryonic or adult erythroid cells that bound these elements in vitro, and we identified a novel DR-binding protein (DRED) whose properties are consistent with those expected for a definitive-stage ɛ-globin repressor. We conclude that the suppression of ɛ-globin transcription during definitive erythropoiesis is mediated by the binding of a repressor that prevents EKLF from activating the ɛ-globin gene. PMID:11069894

Silencing of Aγ-Globin Gene Expression during Adult Definitive Erythropoiesis Mediated by GATA-1-FOG-1-Mi2 Complex Binding at the −566 GATA Site▿ †

PubMed Central

Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.

2008-01-01

Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053

Silencing of Agamma-globin gene expression during adult definitive erythropoiesis mediated by GATA-1-FOG-1-Mi2 complex binding at the -566 GATA site.

PubMed

Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R

2008-05-01

Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.

LCR 5′ hypersensitive site specificity for globin gene activation within the active chromatin hub

PubMed Central

Peterson, Kenneth R.; Fedosyuk, Halyna; Harju-Baker, Susanna

2012-01-01

The DNaseI hypersensitive sites (HSs) of the human β-globin locus control region (LCR) may function as part of an LCR holocomplex within a larger active chromatin hub (ACH). Differential activation of the globin genes during development may be controlled in part by preferential interaction of each gene with specific individual HSs during globin gene switching, a change in conformation of the LCR holocomplex, or both. To distinguish between these possibilities, human β-globin locus yeast artificial chromosome (β-YAC) lines were produced in which the ε-globin gene was replaced with a second marked β-globin gene (βm), coupled to an intact LCR, a 5′HS3 complete deletion (5′ΔHS3) or a 5′HS3 core deletion (5′ΔHS3c). The 5′ΔHS3c mice expressed βm-globin throughout development; γ-globin was co-expressed in the embryonic yolk sac, but not in the fetal liver; and wild-type β-globin was co-expressed in adult mice. Although the 5′HS3 core was not required for βm-globin expression, previous work showed that the 5′HS3 core is necessary for ε-globin expression during embryonic erythropoiesis. A similar phenotype was observed in 5′HS complete deletion mice, except βm-globin expression was higher during primitive erythropoiesis and γ-globin expression continued into fetal definitive erythropoiesis. These data support a site specificity model of LCR HS-globin gene interaction. PMID:23042246

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

THE ANTIGENIC PROPERTIES OF GLOBIN CASEINATE

PubMed Central

Gay, Frederick P.; Robertson, T. Brailsford

1913-01-01

This study of globin and its compound with casein (globin caseinate) shows that globin fails to produce fixation antibodies in rabbits after repeated injections, thus agreeing with our own work and with that of others with similar histon bodies which are primarily toxic. When globin is combined with casein, however, it gives rise to antibodies that react not only with globin caseinate and casein but also with globin. The antibodies in antiglobin casein serum are apparently separate, one for globin and one for casein. In other words, the change in globin undergone on combination with casein has apparently rendered it antigenic. We did not succeed in demonstrating the genesis of this new antigenic property by anaphylaxis experiments. A further investigation of similar and more complex combined proteins is indicated and gives promise of more light on the nature of biological specificity. PMID:19867665

Molecular analysis of globin gene expression in different thalassaemia disorders: individual variation of β(E) pre-mRNA splicing determine disease severity.

PubMed

Tubsuwan, Alisa; Munkongdee, Thongperm; Jearawiriyapaisarn, Natee; Boonchoy, Chanikarn; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2011-09-01

Thalassaemia is characterized by the reduced or absent production of globins in the haemoglobin molecule leading to imbalanced α-globin/non α-globin chains. HbE, the result of a G to A mutation in codon 26 of the HBB (β-globin) gene, activates a cryptic 5' splice site in codon 25 leading to a reduction of correctly spliced β(E) -globin (HBB:c.79G>A) mRNA and consequently β(+) -thalassaemia. A wide range of clinical severities in bothα- and β-thalassaemia syndromes, from nearly asymptomatic to transfusion-dependent, has been observed. The correlation between clinical heterogeneity in various genotypes of thalassaemia and the levels of globin gene expression and β(E) -globin pre-mRNA splicing were examined using multiplex quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) and allele-specific RT-qPCR. The α-globin/non α-globin mRNA ratio was demonstrated to be a good indicator for disease severity among different thalassaemia disorders. However, the α-globin/non α-globin mRNA ratio ranged widely in β-thalassaemia/HbE patients, with no significant difference between mild and severe phenotypes. Interestingly, the correctly to aberrantly spliced β(E) -globin mRNA ratio in 30% of mild β-thalassaemia/HbE patients was higher than that of the severe patients. The splicing process of β(E) -globin pre-mRNA differs among β-thalassaemia/HbE patients and serves as one of the modifying factors for disease severity. © 2011 Blackwell Publishing Ltd.

Evidence for a large expansion and subfunctionalisation of globin genes in sea anemones.

PubMed

Smith, Hayden L; Pavasovic, Ana; Surm, Joachim M; Phillips, Matthew J; Prentis, Peter J

2018-06-27

The globin gene superfamily has been well-characterised in vertebrates, however, there has been limited research in early-diverging lineages, such as phylum Cnidaria. This study aimed to identify globin genes in multiple cnidarian lineages, and use bioinformatic approaches to characterise the evolution, structure and expression of these genes. Phylogenetic analyses and in silico protein predictions showed that all cnidarians have undergone an expansion of globin genes, which likely have a hexacoordinate protein structure. Our protein modelling has also revealed the possibility of a single pentacoordinate globin lineage in anthozoan species. Some cnidarian globin genes displayed tissue and development specific expression with very few orthologous genes similarly expressed across species. Our phylogenetic analyses also revealed that eumetazoan globin genes form a polyphyletic relationship with vertebrate globin genes. Overall, our analyses suggest that a Ngb-like and GbX-like gene were most likely present in the globin gene repertoire for the last common ancestor of eumetazoans. The identification of a large-scale expansion and subfunctionalisation of globin genes in actiniarians provides an excellent starting point to further our understanding of the evolution and function of the globin gene superfamily in early-diverging lineages.

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription

PubMed Central

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-01-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the Gγ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the Gγ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes. PMID:24470145

The hematopoietic regulator TAL1 is required for chromatin looping between the β-globin LCR and human γ-globin genes to activate transcription.

PubMed

Yun, Won Ju; Kim, Yea Woon; Kang, Yujin; Lee, Jungbae; Dean, Ann; Kim, AeRi

2014-04-01

TAL1 is a key hematopoietic transcription factor that binds to regulatory regions of a large cohort of erythroid genes as part of a complex with GATA-1, LMO2 and Ldb1. The complex mediates long-range interaction between the β-globin locus control region (LCR) and active globin genes, and although TAL1 is one of the two DNA-binding complex members, its role is unclear. To explore the role of TAL1 in transcription activation of the human γ-globin genes, we reduced the expression of TAL1 in erythroid K562 cells using lentiviral short hairpin RNA, compromising its association in the β-globin locus. In the TAL1 knockdown cells, the γ-globin transcription was reduced to 35% and chromatin looping of the (G)γ-globin gene with the LCR was disrupted with decreased occupancy of the complex member Ldb1 and LMO2 in the locus. However, GATA-1 binding, DNase I hypersensitive site formation and several histone modifications were largely maintained across the β-globin locus. In addition, overexpression of TAL1 increased the γ-globin transcription and increased interaction frequency between the (G)γ-globin gene and LCR. These results indicate that TAL1 plays a critical role in chromatin loop formation between the γ-globin genes and LCR, which is a critical step for the transcription of the γ-globin genes.

Conservation of globin genes in the "living fossil" Latimeria chalumnae and reconstruction of the evolution of the vertebrate globin family.

PubMed

Schwarze, Kim; Burmester, Thorsten

2013-09-01

The (hemo-)globins are among the best-investigated proteins in biomedical sciences. These small heme-proteins play an important role in oxygen supply, but may also have other functions. In addition to well known hemoglobin and myoglobin, six other vertebrate globin types have been identified in recent years: neuroglobin, cytoglobin, globin E, globin X, globin Y, and androglobin. Analyses of the genome of the "living fossil" Latimeria chalumnae show that the coelacanth is the only known vertebrate that includes all eight globin types. Thus, Latimeria can also be considered as a "globin fossil". Analyses of gene synteny and phylogenetic reconstructions allow us to trace the evolution and the functional changes of the vertebrate globin family. Neuroglobin and globin X diverged from the other globin types before the separation of Protostomia and Deuterostomia. The cytoglobins, which are unlikely to be involved in O2 supply, form the earliest globin branch within the jawed vertebrates (Gnathostomata), but do not group with the agnathan hemoglobins, as it has been proposed before. There is strong evidence from phylogenetic reconstructions and gene synteny that the eye-specific globin E and muscle-specific myoglobin constitute a common clade, suggesting a similar role in intracellular O2 supply. Latimeria possesses two α- and two β-hemoglobin chains, of which one α-chain emerged prior to the divergence of Actinopterygii and Sarcopterygii, but has been retained only in the coelacanth. Notably, the embryonic hemoglobin α-chains of Gnathostomata derive from a common ancestor, while the embryonic β-chains - with the exception of a more complex pattern in the coelacanth and amphibians - display a clade-specific evolution. Globin Y is associated with the hemoglobin gene cluster, but its phylogenetic position is not resolved. Our data show an early divergence of distinct globin types in the vertebrate evolution before the emergence of tetrapods. The subsequent loss of globins in certain taxa may be associated with changes in the oxygen-dependent metabolism. This article is part of a Special Issue entitled: Oxygen Binding and Sensing Proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome

PubMed Central

Opazo, Juan C.; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F.

2015-01-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. PMID:25743544

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liebhaber, S.A.; Weiss, I.; Cash, F.E.

Synthesis of normal human hemoglobin A, {alpha}{sub 2}{beta}{sub 2}, is based upon balanced expression of genes in the {alpha}-globin gene cluster on chromosome 15 and the {beta}-globin gene cluster on chromosome 11. Full levels of erythroid-specific activation of the {beta}-globin cluster depend on sequences located at a considerable distance 5{prime} to the {beta}-globin gene, referred to as the locus-activating or dominant control region. The existence of an analogous element(s) upstream of the {alpha}-globin cluster has been suggested from observations on naturally occurring deletions and experimental studies. The authors have identified an individual with {alpha}-thalassemia in whom structurally normal {alpha}-globin genesmore » have been inactivated in cis by a discrete de novo 35-kilobase deletion located {approximately}30 kilobases 5{prime} from the {alpha}-globin gene cluster. They conclude that this deletion inactivates expression of the {alpha}-globin genes by removing one or more of the previously identified upstream regulatory sequences that are critical to expression of the {alpha}-globin genes.« less

β-Globin locus control region HS2 and HS3 interact structurally and functionally

PubMed Central

Jackson, David A.; McDowell, Jennifer C.; Dean, Ann

2003-01-01

The overall structure of the DNase I hypersensitive sites (HSs) that comprise the β-globin locus control region (LCR) is highly conserved among mammals, implying that the HSs have conserved functions. However, it is not well understood how the LCR HSs, either individually or collectively, activate transcription. We analyzed the interactions of HS2, HS3 and HS4 with the human ε- and β-globin genes in chromatinized episomes in fetal/embryonic K562 cells. Only HS2 activates transcription of the ε-globin gene, while all three HSs activate the β-globin gene. HS3 stimulates the β-globin gene constitutively, but HS2 and HS4 transactivation requires expression of the transcription factor EKLF, which is not present in K562 cells but is required for β-globin expression in vivo. To begin addressing how the individual HSs may interact with one another in a complex, we linked the β-globin gene to both the HS2 and HS3. HS2 and HS3 together resulted in synergistic stimulation of β-globin transcription. Unexpectedly, mutated, inactive forms of HS2 impeded the activation of the β-globin gene by HS3. Thus, there appear to be distinct interactions among the HSs and between the HSs and the globin genes. These preferential, non-exclusive interactions may underlie an important structural and functional cooperativity among the regulatory sequences of the β-globin locus in vivo. PMID:12582237

Erythroid Kruppel-like factor (EKLF) is recruited to the γ-globin gene promoter as a co-activator and is required for γ-globin gene induction by short-chain fatty acid derivatives

PubMed Central

Perrine, Susan P.; Mankidy, Rishikesh; Boosalis, Michael S.; Bieker, James J.; Faller, Douglas V.

2011-01-01

Objectives The erythroid Kruppel-like factor (EKLF) is an essential transcription factor for β-type globin gene switching, and specifically activates transcription of the adult β-globin gene promoter. We sought to determine if EKLF is also required for activation of the γ-globin gene by short-chain fatty acid (SCFA) derivatives, which are now entering clinical trials. Methods The functional and physical interaction of EKLF and co-regulatory molecules with the endogenous human globin gene promoters was studied in primary human erythroid progenitors and cell lines, using chromatin immunoprecipitation (ChIP) assays and genetic manipulation of the levels of EKLF and co-regulators. Results and conclusions Knockdown of EKLF prevents SCFA-induced expression of the γ-globin promoter in a stably expressed μLCRβprRlucAγprFluc cassette, and prevents induction of the endogenous γ-globin gene in primary human erythroid progenitors. EKLF is actively recruited to endogenous γ-globin gene promoters after exposure of primary human erythroid progenitors, and murine hematopoietic cell lines, to SCFA derivatives. The core ATPase BRG1 subunit of the human SWI/WNF complex, a ubiquitous multimeric complex that regulates gene expression by remodeling nucleosomal structure, is also required for γ-globin gene induction by SCFA derivatives. BRG1 is actively recruited to the endogenous γ-globin promoter of primary human erythroid progenitors by exposure to SCFA derivatives, and this recruitment is dependent upon the presence of EKLF. These findings demonstrate that EKLF, and the co-activator BRG1, previously demonstrated to be required for definitive or adult erythropoietic patterns of globin gene expression, are co-opted by SCFA derivatives to activate the fetal globin genes. PMID:19220418

A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF-related complexes in β-globin expression and erythroid development

PubMed Central

Bultman, Scott J.; Gebuhr, Thomas C.; Magnuson, Terry

2005-01-01

The Brg1 catalytic subunit of SWI/SNF-related complexes has been implicated in many developmental and physiological processes, but null homozygotes die as blastocysts prior to implantation. To circumvent this early embryonic lethality, we performed an ENU mutagenesis screen and generated a Brg1 hypomorph mutation in the ATPase domain. The mutant Brg1 protein is stable, assembles into SWI/SNF-related complexes, and exhibits normal ATPase activity but is unable to establish DNase I hypersensitivity sites characteristic of open chromatin. Mutant embryos develop normally until midgestation but then exhibit a distinct block in the development of the erythroid lineage, leading to anemia and death. The mutant Brg1 protein is recruited to the β-globin locus, but chromatin remodeling and transcription are perturbed. Histone acetylation and DNA methylation are also affected. To our knowledge, Brg1 is the first chromatin-modifying factor shown to be required for β-globin regulation and erythropoiesis in vivo. Not only does this mutation establish a role for Brg1 during organogenesis, it also demonstrates that ATPase activity can be uncoupled from chromatin remodeling. PMID:16287714

Globin gene structure in a reptile supports the transpositional model for amniote α- and β-globin gene evolution.

PubMed

Patel, Vidushi S; Ezaz, Tariq; Deakin, Janine E; Graves, Jennifer A Marshall

2010-12-01

The haemoglobin protein, required for oxygen transportation in the body, is encoded by α- and β-globin genes that are arranged in clusters. The transpositional model for the evolution of distinct α-globin and β-globin clusters in amniotes is much simpler than the previously proposed whole genome duplication model. According to this model, all jawed vertebrates share one ancient region containing α- and β-globin genes and several flanking genes in the order MPG-C16orf35-(α-β)-GBY-LUC7L that has been conserved for more than 410 million years, whereas amniotes evolved a distinct β-globin cluster by insertion of a transposed β-globin gene from this ancient region into a cluster of olfactory receptors flanked by CCKBR and RRM1. It could not be determined whether this organisation is conserved in all amniotes because of the paucity of information from non-avian reptiles. To fill in this gap, we examined globin gene organisation in a squamate reptile, the Australian bearded dragon lizard, Pogona vitticeps (Agamidae). We report here that the α-globin cluster (HBK, HBA) is flanked by C16orf35 and GBY and is located on a pair of microchromosomes, whereas the β-globin cluster is flanked by RRM1 on the 3' end and is located on the long arm of chromosome 3. However, the CCKBR gene that flanks the β-globin cluster on the 5' end in other amniotes is located on the short arm of chromosome 5 in P. vitticeps, indicating that a chromosomal break between the β-globin cluster and CCKBR occurred at least in the agamid lineage. Our data from a reptile species provide further evidence to support the transpositional model for the evolution of β-globin gene cluster in amniotes.

Sequence Divergence in the 3′ Untranslated Regions of Human ζ- and α-Globin mRNAs Mediates a Difference in Their Stabilities and Contributes to Efficient α-to-ζ Gene Developmental Switching

PubMed Central

Russell, J. Eric; Morales, Julia; Makeyev, Aleksandr V.; Liebhaber, Stephen A.

1998-01-01

The developmental stage-specific expression of human globin proteins is characterized by a switch from the coexpression of ζ- and α-globin in the embryonic yolk sac to exclusive expression of α-globin during fetal and adult life. Recent studies with transgenic mice demonstrate that in addition to transcriptional control elements, full developmental silencing of the human ζ-globin gene requires elements encoded within the transcribed region. In the current work, we establish that these latter elements operate posttranscriptionally by reducing the relative stability of ζ-globin mRNA. Using a transgenic mouse model system, we demonstrate that human ζ-globin mRNA is unstable in adult erythroid cells relative to the highly stable human α-globin mRNA. A critical determinant of the difference between α- and ζ-globin mRNA stability is mapped by in vivo expression studies to their respective 3′ untranslated regions (3′UTRs). In vitro messenger ribonucleoprotein (mRNP) assembly assays demonstrate that the α- and ζ-globin 3′UTRs assemble a previously described mRNP stability-determining complex, the α-complex, with distinctly different affinities. The diminished efficiency of α-complex assembly on the ζ 3′UTR results from a single C→G nucleotide substitution in a crucial polypyrimidine tract contained by both the human α- and ζ-globin mRNA 3′UTRs. A potential pathway for accelerated ζ-globin mRNA decay is suggested by the observation that its 3′UTR encodes a shortened poly(A) tail. Based upon these data, we propose a model for ζ-globin gene silencing in fetal and adult erythroid cells in which posttranscriptional controls play a central role by providing for accelerated clearance of ζ-globin transcripts. PMID:9528789

Ancient Duplications and Expression Divergence in the Globin Gene Superfamily of Vertebrates: Insights from the Elephant Shark Genome and Transcriptome.

PubMed

Opazo, Juan C; Lee, Alison P; Hoffmann, Federico G; Toloza-Villalobos, Jessica; Burmester, Thorsten; Venkatesh, Byrappa; Storz, Jay F

2015-07-01

Comparative analyses of vertebrate genomes continue to uncover a surprising diversity of genes in the globin gene superfamily, some of which have very restricted phyletic distributions despite their antiquity. Genomic analysis of the globin gene repertoire of cartilaginous fish (Chondrichthyes) should be especially informative about the duplicative origins and ancestral functions of vertebrate globins, as divergence between Chondrichthyes and bony vertebrates represents the most basal split within the jawed vertebrates. Here, we report a comparative genomic analysis of the vertebrate globin gene family that includes the complete globin gene repertoire of the elephant shark (Callorhinchus milii). Using genomic sequence data from representatives of all major vertebrate classes, integrated analyses of conserved synteny and phylogenetic relationships revealed that the last common ancestor of vertebrates possessed a repertoire of at least seven globin genes: single copies of androglobin and neuroglobin, four paralogous copies of globin X, and the single-copy progenitor of the entire set of vertebrate-specific globins. Combined with expression data, the genomic inventory of elephant shark globins yielded four especially surprising findings: 1) there is no trace of the neuroglobin gene (a highly conserved gene that is present in all other jawed vertebrates that have been examined to date), 2) myoglobin is highly expressed in heart, but not in skeletal muscle (reflecting a possible ancestral condition in vertebrates with single-circuit circulatory systems), 3) elephant shark possesses two highly divergent globin X paralogs, one of which is preferentially expressed in gonads, and 4) elephant shark possesses two structurally distinct α-globin paralogs, one of which is preferentially expressed in the brain. Expression profiles of elephant shark globin genes reveal distinct specializations of function relative to orthologs in bony vertebrates and suggest hypotheses about ancestral functions of vertebrate globins. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A Phylogenetic Analysis of the Globins in Fungi

PubMed Central

Hoogewijs, David; Dewilde, Sylvia; Vierstraete, Andy; Moens, Luc; Vinogradov, Serge N.

2012-01-01

Background All globins belong to one of three families: the F (flavohemoglobin) and S (sensor) families that exhibit the canonical 3/3 α-helical fold, and the T (truncated 3/3 fold) globins characterized by a shortened 2/2 α-helical fold. All eukaryote 3/3 hemoglobins are related to the bacterial single domain F globins. It is known that Fungi contain flavohemoglobins and single domain S globins. Our aims are to provide a census of fungal globins and to examine their relationships to bacterial globins. Results Examination of 165 genomes revealed that globins are present in >90% of Ascomycota and ∼60% of Basidiomycota genomes. The S globins occur in Blastocladiomycota and Chytridiomycota in addition to the phyla that have FHbs. Unexpectedly, group 1 T globins were found in one Blastocladiomycota and one Chytridiomycota genome. Phylogenetic analyses were carried out on the fungal globins, alone and aligned with representative bacterial globins. The Saccharomycetes and Sordariomycetes with two FHbs form two widely divergent clusters separated by the remaining fungal sequences. One of the Saccharomycete groups represents a new subfamily of FHbs, comprising a previously unknown N-terminal and a FHb missing the C-terminal moiety of its reductase domain. The two Saccharomycete groups also form two clusters in the presence of bacterial FHbs; the surrounding bacterial sequences are dominated by Proteobacteria and Bacilli (Firmicutes). The remaining fungal FHbs cluster with Proteobacteria and Actinobacteria. The Sgbs cluster separately from their bacterial counterparts, except for the intercalation of two Planctomycetes and a Proteobacterium between the Fungi incertae sedis and the Blastocladiomycota and Chytridiomycota. Conclusion Our results are compatible with a model of globin evolution put forward earlier, which proposed that eukaryote F, S and T globins originated via horizontal gene transfer of their bacterial counterparts to the eukaryote ancestor, resulting from the endosymbiotic events responsible for the origin of mitochondria and chloroplasts. PMID:22384087

Evolution and Expression of Tissue Globins in Ray-Finned Fishes.

PubMed

Gallagher, Michael D; Macqueen, Daniel J

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution.

Chromatin structure of the LCR in the human β-globin locus transcribing the adult δ- and β-globin genes.

PubMed

Kim, Seoyeon; Kim, Yea Woon; Shim, Sung Han; Kim, Chul Geun; Kim, Aeri

2012-03-01

The β-like globin genes are transcribed in a developmental stage specific fashion in erythroid cells. The specific transcription of globin genes is conferred by the locus control region (LCR), but the chromatin structure of the LCR in the human adult β-globin locus transcribing the δ- and β-globin genes is not clear. Here, we employed hybrid MEL cells that contain a human chromosome 11. The δ- and β-globin genes were highly transcribed in hybrid MEL/ch11 cells after transcriptional induction. LCR HS3 and HS2 were strongly occupied by erythroid specific transcriptional activators and co-factors in the induced locus. These HSs, but not HS4 and HS1, were in close proximity with the active globin genes as revealed by high resolution 3C experiments. The active features at HS3 were markedly established after transcriptional induction, while HS2 was in a relatively active conformation before the induction. Unexpectedly, HS1 did not show notable active features except histone hyperacetylation. Taken together, the LCR of the human β-globin locus transcribing the adult δ- and β-globin genes has HS specific chromatin structure. The structure at each HS, which is different from the locus transcribing the fetal globin genes, might relate to its role in transcribing the adult genes. Copyright © 2011 Elsevier Ltd. All rights reserved.

Zebrafish globin switching occurs in two developmental stages and is controlled by the LCR.

PubMed

Ganis, Jared J; Hsia, Nelson; Trompouki, Eirini; de Jong, Jill L O; DiBiase, Anthony; Lambert, Janelle S; Jia, Zhiying; Sabo, Peter J; Weaver, Molly; Sandstrom, Richard; Stamatoyannopoulos, John A; Zhou, Yi; Zon, Leonard I

2012-06-15

Globin gene switching is a complex, highly regulated process allowing expression of distinct globin genes at specific developmental stages. Here, for the first time, we have characterized all of the zebrafish globins based on the completed genomic sequence. Two distinct chromosomal loci, termed major (chromosome 3) and minor (chromosome 12), harbor the globin genes containing α/β pairs in a 5'-3' to 3'-5' orientation. Both these loci share synteny with the mammalian α-globin locus. Zebrafish globin expression was assayed during development and demonstrated two globin switches, similar to human development. A conserved regulatory element, the locus control region (LCR), was revealed by analyzing DNase I hypersensitive sites, H3K4 trimethylation marks and GATA1 binding sites. Surprisingly, the position of these sites with relation to the globin genes is evolutionarily conserved, despite a lack of overall sequence conservation. Motifs within the zebrafish LCR include CACCC, GATA, and NFE2 sites, suggesting functional interactions with known transcription factors but not the same LCR architecture. Functional homology to the mammalian α-LCR MCS-R2 region was confirmed by robust and specific reporter expression in erythrocytes of transgenic zebrafish. Our studies provide a comprehensive characterization of the zebrafish globin loci and clarify the regulation of globin switching. Copyright © 2012 Elsevier Inc. All rights reserved.

Electron paramagnetic resonance of globin proteins - a successful match between spectroscopic development and protein research

NASA Astrophysics Data System (ADS)

Van Doorslaer, Sabine; Cuypers, Bert

2018-02-01

At the start of the twenty-first century, the research into the haem-containing globins got a considerable impetus with the discovery of three new mammalian globins: neuroglobin, cytoglobin and androglobin. Globins are by now found in all kingdoms of life and, in many cases, their functions are still under debate. This revival in globin research increased the demand for adequate physico-chemical research tools to determine the structure-function relationships of these proteins. From early days onwards, electron paramagnetic resonance (EPR) has been used in globin research. In recent decades, the field of EPR has been revolutionised with the introduction of many new pulsed and high-field EPR techniques. In this review, we highlight how EPR has become an essential tool in globin research, and how globins equally provide ideal model systems to push technical developments in EPR.

Rapid and Sensitive Assessment of Globin Chains for Gene and Cell Therapy of Hemoglobinopathies

PubMed Central

Loucari, Constantinos C.; Patsali, Petros; van Dijk, Thamar B.; Stephanou, Coralea; Papasavva, Panayiota; Zanti, Maria; Kurita, Ryo; Nakamura, Yukio; Christou, Soteroulla; Sitarou, Maria; Philipsen, Sjaak; Lederer, Carsten W.; Kleanthous, Marina

2018-01-01

The β-hemoglobinopathies sickle cell anemia and β-thalassemia are the focus of many gene-therapy studies. A key disease parameter is the abundance of globin chains because it indicates the level of anemia, likely toxicity of excess or aberrant globins, and therapeutic potential of induced or exogenous β-like globins. Reversed-phase high-performance liquid chromatography (HPLC) allows versatile and inexpensive globin quantification, but commonly applied protocols suffer from long run times, high sample requirements, or inability to separate murine from human β-globin chains. The latter point is problematic for in vivo studies with gene-addition vectors in murine disease models and mouse/human chimeras. This study demonstrates HPLC-based measurements of globin expression (1) after differentiation of the commonly applied human umbilical cord blood–derived erythroid progenitor-2 cell line, (2) in erythroid progeny of CD34+ cells for the analysis of clustered regularly interspaced short palindromic repeats/Cas9-mediated disruption of the globin regulator BCL11A, and (3) of transgenic mice holding the human β-globin locus. At run times of 8 min for separation of murine and human β-globin chains as well as of human γ-globin chains, and with routine measurement of globin-chain ratios for 12 nL of blood (tested for down to 0.75 nL) or of 300,000 in vitro differentiated cells, the methods presented here and any variant-specific adaptations thereof will greatly facilitate evaluation of novel therapy applications for β-hemoglobinopathies. PMID:29325430

Copy number variations of six and seven α-globin genes in a family with intermedia and major thalassemia phenotypes.

PubMed

Farashi, Samaneh; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-10-01

Copy number variations in α-globin genes are results of unequal crossover between homologous segments in the α-globin gene cluster that misalign during the meiosis phase of the gametogenesis process. Reduction or augmentation of α-globin genes leads to imbalance of α/β chains in hemoglobin tetramer and consequently attenuate or worsen the β-thal clinical symptoms, respectively. Multiplications in α-globin genes have been found in some populations, justifying unexpected severe phenotype of β-thal carriers. Unexpected severe phenotype in the family members may result from coexistence of extra α-globin genes, which is an important factor in the causation of thalassemia intermedia and major in heterozygous β-thalassemia. We described different multiplications in α-globin locus in an Iranian family with one, two or three extra α-globin genes (ααα/αα, αααα/αα and αααα/ααα). The excess α-globin gene/genes cause increment in β/α chain imbalance and leads to worsening pathophysiology and clinical severity of β-thalassemia carriers.

Beta-globin LCR and intron elements cooperate and direct spatial reorganization for gene therapy.

PubMed

Buzina, Alla; Lo, Mandy Y M; Moffett, Angela; Hotta, Akitsu; Fussner, Eden; Bharadwaj, Rikki R; Pasceri, Peter; Garcia-Martinez, J Victor; Bazett-Jones, David P; Ellis, James

2008-04-11

The Locus Control Region (LCR) requires intronic elements within beta-globin transgenes to direct high level expression at all ectopic integration sites. However, these essential intronic elements cannot be transmitted through retrovirus vectors and their deletion may compromise the therapeutic potential for gene therapy. Here, we systematically regenerate functional beta-globin intron 2 elements that rescue LCR activity directed by 5'HS3. Evaluation in transgenic mice demonstrates that an Oct-1 binding site and an enhancer in the intron cooperate to increase expression levels from LCR globin transgenes. Replacement of the intronic AT-rich region with the Igmu 3'MAR rescues LCR activity in single copy transgenic mice. Importantly, a combination of the Oct-1 site, Igmu 3'MAR and intronic enhancer in the BGT158 cassette directs more consistent levels of expression in transgenic mice. By introducing intron-modified transgenes into the same genomic integration site in erythroid cells, we show that BGT158 has the greatest transcriptional induction. 3D DNA FISH establishes that induction stimulates this small 5'HS3 containing transgene and the endogenous locus to spatially reorganize towards more central locations in erythroid nuclei. Electron Spectroscopic Imaging (ESI) of chromatin fibers demonstrates that ultrastructural heterochromatin is primarily perinuclear and does not reorganize. Finally, we transmit intron-modified globin transgenes through insulated self-inactivating (SIN) lentivirus vectors into erythroid cells. We show efficient transfer and robust mRNA and protein expression by the BGT158 vector, and virus titer improvements mediated by the modified intron 2 in the presence of an LCR cassette composed of 5'HS2-4. Our results have important implications for the mechanism of LCR activity at ectopic integration sites. The modified transgenes are the first to transfer intronic elements that potentiate LCR activity and are designed to facilitate correction of hemoglobinopathies using single copy vectors.

Design of retrovirus vectors for transfer and expression of the human. beta. -globin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, A.D.; Bender, M.A.; Harris, E.A.S.

1988-11-01

Regulated expression of the human ..beta..-globin gene has been demonstrated in cultured murine erythroleukemia cells and in mice after retrovirus-mediated gene transfer. However, the low titer of recombinant viruses described to date results in relatively inefficient gene transfer, which limits their usefulness for animal studies and for potential gene therapy in humans for diseases involving defective ..beta..-globin genes. The authors found regions that interfered with virus production within intron 2 of the ..beta..-globin gene and on both sides of the gene. The flanking regions could be removed, but intron 2 was required for ..beta..-globin expression. Inclusion of ..beta..-globin introns necessitatesmore » an antisense orientation of the gene within the retrovirus vector. However, they found no effect of the antisense ..beta..-globin transcription on virus production. A region downstream of the ..beta..-globin gene that stimulates expression of the gene in transgenic mice was included in the viruses without detrimental effects on virus titer. Virus titers of over 10/sup 6/ CFU/ml were obtained with the final vector design, which retained the ability to direct regulated expression of human ..beta..-globin in murine erythroleukemia cells. The vector also allowed transfer and expression of the human ..beta..-globin gene in hematopoietic cells (CFU-S cells) in mice.« less

Evolution and Expression of Tissue Globins in Ray-Finned Fishes

PubMed Central

Gallagher, Michael D.

2017-01-01

The globin gene family encodes oxygen-binding hemeproteins conserved across the major branches of multicellular life. The origins and evolutionary histories of complete globin repertoires have been established for many vertebrates, but there remain major knowledge gaps for ray-finned fish. Therefore, we used phylogenetic, comparative genomic and gene expression analyses to discover and characterize canonical “non-blood” globin family members (i.e., myoglobin, cytoglobin, neuroglobin, globin-X, and globin-Y) across multiple ray-finned fish lineages, revealing novel gene duplicates (paralogs) conserved from whole genome duplication (WGD) and small-scale duplication events. Our key findings were that: (1) globin-X paralogs in teleosts have been retained from the teleost-specific WGD, (2) functional paralogs of cytoglobin, neuroglobin, and globin-X, but not myoglobin, have been conserved from the salmonid-specific WGD, (3) triplicate lineage-specific myoglobin paralogs are conserved in arowanas (Osteoglossiformes), which arose by tandem duplication and diverged under positive selection, (4) globin-Y is retained in multiple early branching fish lineages that diverged before teleosts, and (5) marked variation in tissue-specific expression of globin gene repertoires exists across ray-finned fish evolution, including several previously uncharacterized sites of expression. In this respect, our data provide an interesting link between myoglobin expression and the evolution of air breathing in teleosts. Together, our findings demonstrate great-unrecognized diversity in the repertoire and expression of nonblood globins that has arisen during ray-finned fish evolution. PMID:28173090

Deletion of the human beta-globin LCR 5'HS4 or 5'HS1 differentially affects beta-like globin gene expression in beta-YAC transgenic mice.

PubMed

Fedosyuk, Halyna; Peterson, Kenneth R

2007-01-01

A 213 kb human beta-globin locus yeast artificial chromosome (beta-YAC) was modified by homologous recombination to delete 2.9 kb of cross-species conserved sequence similarity encompassing the LCR 5' hypersensitive site (HS) 4 (Delta5'HS4 beta-YAC). In three transgenic mouse lines, completion of the gamma- to beta-globin switch during definitive erythropoiesis was delayed relative to wild-type beta-YAC mice. In addition, quantitative per-copy human beta-like globin mRNA levels were similar to wild-type beta-YAC transgenic lines, although beta-globin gene expression was slightly decreased in the day 12 fetal liver of Delta5'HS4 beta-YAC mice. A 0.8 kb 5'HS1 fragment was similarly deleted in the YAC. Three Delta5'HS1 beta-YAC transgenic lines were established. epsilon-globin gene expression was markedly reduced, approximately 16 fold, during primitive erythropoiesis compared to wild-type beta-YAC mice, but gamma-globin expression levels were unaffected. However, during the fetal stage of definitive erythropoiesis, gamma-globin gene expression was decreased approximately 4 fold at day 12 and approximately 5 fold at day 14. Temporal developmental expression profiles of the beta-like globin genes were unaffected by deletion of 5'HS1. Decreased expression of the epsilon- and gamma-globin genes is the first phenotype ascribed to a 5'HS1 mutation in the human beta-globin locus, suggesting that this HS does indeed have a role in LCR function beyond simply a combined synergism with the other LCR HSs.

Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.

PubMed

Nava, María Paulina; Ibarra, Bertha; Magaña, María Teresa; de la Luz Chávez, María; Perea, F Javier

2006-01-01

The aim of this study was to determine the frequency of alpha-globin gene mutations in three groups of Mexican unrelated individuals. The first two groups were normal and sickle cell trait individuals from the Costa Chica region, a place with a 12.8% frequency of HbS carriers, and the third group comprised of Mexican mestizo patients with beta-thalassemia. We searched for -alpha(3.7) and -alpha(4.2) alpha(+)-thalassemia deletion alleles, as well as the alpha alpha alpha(anti3.7) triplication through long-gap PCR. The alleles -alpha(3.7) and alpha alpha alpha(anti3.7) were found in the heterozygote state only; 19% of the normal subjects had the -alpha(3.7) allele, and 2% showed the alpha alpha alpha(anti3.7) allele. In individuals with the sickle cell trait, 17% had the -alpha(3.7) deletion, and the alpha alpha alpha(anti3.7) triplication was observed in 3% of these individuals. We revealed that 16% of the subjects with beta-thalassemia showed the -alpha(3.7) deletion and 28% the alpha alpha alpha(anti3.7) triplication. The -alpha(4.2) deletion was not detected in any individual. The frequency of the -alpha(3.7) allele was roughly the same in the three groups studied; this can be explained by the fact that the three groups have common genes from Africa and the Mediterranean, where a high prevalence of alpha(+)-thalassemia has been observed. To our knowledge, the frequency of alpha alpha alpha(anti3.7) triplication observed in the Mexican beta-thalassemia patients is the highest reported. As the -alpha(3.7) and alpha alpha alpha(anti3.7) alleles are very common in our selected populations, we believe that there is a need to investigate systematically the alpha-globin gene mutations in all hemoglobinopathies in the Mexican population.

[Main regulatory element (MRE) of the Danio rerio α/β-globin gene domain exerts enhancer activity toward the promoters of the embryonic-larval and adult globin genes].

PubMed

Kovina, A P; Petrova, N V; Razin, S V; Yarovaia, O V

2016-01-01

In warm-blooded vertebrates, the α- and β-globin genes are organized in domains of different types and are regulated in different fashion. In cold-blooded vertebrates and, in particular, the tropical fish Danio rerio, the α- and β-globin genes form two gene clusters. A major D. rerio globin gene cluster is in chromosome 3 and includes the α- and β-globin genes of embryonic-larval and adult types. The region upstream of the cluster contains c16orf35, harbors the main regulatory element (MRE) of the α-globin gene domain in warm-blooded vertebrates. In this study, transient transfection of erythroid cells with genetic constructs containing a reporter gene under the control of potential regulatory elements of the domain was performed to characterize the promoters of the embryonic-larval and adult α- and β-globin genes of the major cluster. Also, in the 5th intron of c16orf35 in Danio reriowas detected a functional analog of the warm-blooded vertebrate MRE. This enhancer stimulated activity of the promoters of both adult and embryonic-larval α- and β-globin genes.

Fever of unclear origin and cytopenia because of acute splenic sequestration in a young immunocompetent carrier of beta-globin mutation for Hb Valletta.

PubMed

Parrinello, Gaspare; Torres, Daniele; Paterna, Salvatore; Di Pasquale, Pietro; Licata, Giuseppe

2008-12-01

Fever of unclear origin is a clinical challenge in medical practice. Infectious diseases, neoplasms, and collagen vascular illnesses are its main causes in adults and children. Acute splenic sequestration crises, a known potentially fatal complication of sickle cell disease and sickle beta-thalassemia, are uncommon in beta-heterozygosis. We describe a case of prolonged recurrent episodes of fever with spontaneous resolution, commencing at age 10 in a 15-year-old boy with a history of hypochromic microcytic anemia attributed to a thalassemic trait. He was admitted twice to our university hospital for continuous-remittent fever with a pruritic, macular evanescent Still's skin rash, severe splenomegaly, leucopenia, thrombocytopenia, and sudden aggravation of anemia. Infectious, rheumatologic, autoimmune, and hematologic illnesses were excluded. A genetic-based study revealed heterozygosis of the beta-globin gene for a A>C (Thr>Pro) substitution at position 87 called Hemoglobin Valletta (alpha 2 beta 2 87 PRO) with a C>G transition in homozygosis in beta-globin intronic polymorphism intervening sequence 2 at nucleotide 745. After a follow-up period of 1 year without treatment, the young patient remains apyretic and in good general clinical health with persistent microcythemia and hepatosplenomegaly. Acute splenic sequestration crisis and related cytopenia may be an unusual complication of fever of unclear origin in a beta-thalassemic carrier of a Hemoglobin Valletta mutation and polymorphism in homozygosis of intervening sequence 2 at nucleotide 745. This hemoglobinopathy may predispose to a clinical phenotype of minor or intermediate thalassemia and, during a febrile illness, to hemoglobin instability and splenic sequestration.

Removing peroxide impurities from ether improves the quality of globin chains for biosynthetic studies.

PubMed

Mirzazadeh, Roghieh; Khatami, Shohreh; Bayat, Parastoo; Zamani, Zahra; Sadeghi, Sedigheh; Roohi, Soghra; Saidi, Parinaz

2005-01-01

The diagnosis of the different forms of thalassemia is one of the important applications of analysis of globin chains. These analyses are done by high performance liquid chromatography (HPLC) using a MONO-S cation exchange column and ether is used for washing the globin powder in the final step. The presence of peroxide impurities in ether could change the structure of the globin chains. In the chromatograms, these modified globins appear as separated peaks next to the unmodified globin peaks. In these cases, the alpha/beta ratio exceed by artifact the correct value. Our study demonstrates that diagnostic centers should ensure that the ether they use is pure.

Butyrate Infusions in the Ovine Fetus Delay the Biologic Clock for Globin Gene Switching

NASA Astrophysics Data System (ADS)

Perrine, Susan P.; Rudolph, Abraham; Faller, Douglas V.; Roman, Christine; Cohen, Ruth A.; Chen, Shao-Jing; Kan, Yuet Wai

1988-11-01

The switch from fetal to adult hemoglobin expression is regulated in many mammalian species by a developmental clock-like mechanism and determined by the gestational age of the fetus. Prolonging fetal globin gene expression is of considerable interest for therapeutic potential in diseases caused by abnormal β -globin genes. Butyric acid, which is found in increased plasma concentrations in infants of diabetic mothers who have delayed globin gene switching, was infused into catheterized fetal lambs in utero during the time of the normal globin gene switch period. The globin gene switch was significantly delayed in three of four butyrate-treated fetuses compared with controls and was entirely prevented in one fetus in whom the infusion was begun before the globin switch was under way. These data provide a model for investigating and arresting the biologic clock of hemoglobin switching.

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice.

PubMed

Boosalis, Michael S; Sangerman, Jose I; White, Gary L; Wolf, Roman F; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H; Li, Biaoru; Pace, Betty S; Nouraie, Mehdi; Faller, Douglas V; Perrine, Susan P

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies.

Editing an α-globin enhancer in primary human hematopoietic stem cells as a treatment for β-thalassemia.

PubMed

Mettananda, Sachith; Fisher, Chris A; Hay, Deborah; Badat, Mohsin; Quek, Lynn; Clark, Kevin; Hublitz, Philip; Downes, Damien; Kerry, Jon; Gosden, Matthew; Telenius, Jelena; Sloane-Stanley, Jackie A; Faustino, Paula; Coelho, Andreia; Doondeea, Jessica; Usukhbayar, Batchimeg; Sopp, Paul; Sharpe, Jacqueline A; Hughes, Jim R; Vyas, Paresh; Gibbons, Richard J; Higgs, Douglas R

2017-09-04

β-Thalassemia is one of the most common inherited anemias, with no effective cure for most patients. The pathophysiology reflects an imbalance between α- and β-globin chains with an excess of free α-globin chains causing ineffective erythropoiesis and hemolysis. When α-thalassemia is co-inherited with β-thalassemia, excess free α-globin chains are reduced significantly ameliorating the clinical severity. Here we demonstrate the use of CRISPR/Cas9 genome editing of primary human hematopoietic stem/progenitor (CD34+) cells to emulate a natural mutation, which deletes the MCS-R2 α-globin enhancer and causes α-thalassemia. When edited CD34+ cells are differentiated into erythroid cells, we observe the expected reduction in α-globin expression and a correction of the pathologic globin chain imbalance in cells from patients with β-thalassemia. Xenograft assays show that a proportion of the edited CD34+ cells are long-term repopulating hematopoietic stem cells, demonstrating the potential of this approach for translation into a therapy for β-thalassemia.β-thalassemia is characterised by the presence of an excess of α-globin chains, which contribute to erythrocyte pathology. Here the authors use CRISP/Cas9 to reduce α-globin expression in hematopoietic precursors, and show effectiveness in xenograft assays in mice.

Eos Negatively Regulates Human γ-globin Gene Transcription during Erythroid Differentiation

PubMed Central

Yu, Hai-Chuan; Zhao, Hua-Lu; Wu, Zhi-Kui; Zhang, Jun-Wu

2011-01-01

Background Human globin gene expression is precisely regulated by a complicated network of transcription factors and chromatin modifying activities during development and erythropoiesis. Eos (Ikaros family zinc finger 4, IKZF4), a member of the zinc finger transcription factor Ikaros family, plays a pivotal role as a repressor of gene expression. The aim of this study was to examine the role of Eos in globin gene regulation. Methodology/Principal Findings Western blot and quantitative real-time PCR detected a gradual decrease in Eos expression during erythroid differentiation of hemin-induced K562 cells and Epo-induced CD34+ hematopoietic stem/progenitor cells (HPCs). DNA transfection and lentivirus-mediated gene transfer demonstrated that the enforced expression of Eos significantly represses the expression of γ-globin, but not other globin genes, in K562 cells and CD34+ HPCs. Consistent with a direct role of Eos in globin gene regulation, chromatin immunoprecipitaion and dual-luciferase reporter assays identified three discrete sites located in the DNase I hypersensitivity site 3 (HS3) of the β-globin locus control region (LCR), the promoter regions of the Gγ- and Aγ- globin genes, as functional binding sites of Eos protein. A chromosome conformation capture (3C) assay indicated that Eos may repress the interaction between the LCR and the γ-globin gene promoter. In addition, erythroid differentiation was inhibited by enforced expression of Eos in K562 cells and CD34+ HPCs. Conclusions/Significance Our results demonstrate that Eos plays an important role in the transcriptional regulation of the γ-globin gene during erythroid differentiation. PMID:21829552

[The effect of DNA hydroxymethylase Tet2 on γ globin activation in the treatment of β-thalassemia].

PubMed

Li, W X; Ma, Q W; Zeng, F Y

2018-03-01

Objective: To study the function of ten-eleven translocation 2 (Tet2) in γ globin gene expression in patients with β- thalassemia. Methods: Gamma globin expression was induced by 5-azacytidine and Tet2 gene expression was knocked down by short hairpin RNA (shRNA) in a human immortalized myelogenous leukemia K562 cell line. The global 5-hydroxymethylcytosine (5hmC) level was measured by an ELISA kit. 5hmC level of γ globin gene was quantified by sulfite sequencing. The mRNA level of Tet2, γ globin, and related transcription factors Nfe4 and Klf1 were quantified by real-time PCR. Results: Tet2 knockdown resulted in a decreased global 5hmC level from 0.14% to 0.03% as of the control group in K562 cells. The expression of γ globin was enhanced after 5-azacytidine treatment in vitro. However, γ globin mRNA level in Tet2 knockdown cells was only 55% as that in control group. The CG sites on γ globin gene were unmethylated. As Tet2 was down-regulated, the expression levels of Nfe4 and Klf1 decreased by about 80% and increased to 3.5 folds, respectively. Conclusions: Tet2 appears to maintain 5hmC level and facilitates γ globin gene activation. Moreover, Tet2 more likely regulates γ globin expression via affecting transcription factors rather than the gene itself. Thus, Tet2 could be a potential therapeutic target for β thalassemias.

Generation and Characterization of a Transgenic Mouse Carrying a Functional Human β-Globin Gene with the IVSI-6 Thalassemia Mutation

PubMed Central

Mancini, Irene; Lampronti, Ilaria; Salvatori, Francesca; Fabbri, Enrica; Zuccato, Cristina; Cosenza, Lucia C.; Montagner, Giulia; Borgatti, Monica; Altruda, Fiorella; Fagoonee, Sharmila; Carandina, Gianni; Aiello, Vincenzo; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2015-01-01

Mouse models that carry mutations causing thalassemia represent a suitable tool to test in vivo new mutation-specific therapeutic approaches. Transgenic mice carrying the β-globin IVSI-6 mutation (the most frequent in Middle-Eastern regions and recurrent in Italy and Greece) are, at present, not available. We report the production and characterization of a transgenic mouse line (TG-β-IVSI-6) carrying the IVSI-6 thalassemia point mutation within the human β-globin gene. In the TG-β-IVSI-6 mouse (a) the transgenic integration region is located in mouse chromosome 7; (b) the expression of the transgene is tissue specific; (c) as expected, normally spliced human β-globin mRNA is produced, giving rise to β-globin production and formation of a human-mouse tetrameric chimeric hemoglobin mu α-globin2/hu β-globin2 and, more importantly, (d) the aberrant β-globin-IVSI-6 RNAs are present in blood cells. The TG-β-IVSI-6 mouse reproduces the molecular features of IVSI-6 β-thalassemia and might be used as an in vivo model to characterize the effects of antisense oligodeoxynucleotides targeting the cryptic sites responsible for the generation of aberrantly spliced β-globin RNA sequences, caused by the IVSI-6 mutation. These experiments are expected to be crucial for the development of a personalized therapy for β-thalassemia. PMID:26097845

Novel Inducers of Fetal Globin Identified through High Throughput Screening (HTS) Are Active In Vivo in Anemic Baboons and Transgenic Mice

PubMed Central

Boosalis, Michael S.; Sangerman, Jose I.; White, Gary L.; Wolf, Roman F.; Shen, Ling; Dai, Yan; White, Emily; Makala, Levi H.; Li, Biaoru; Pace, Betty S.; Nouraie, Mehdi; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

High-level fetal (γ) globin expression ameliorates clinical severity of the beta (β) hemoglobinopathies, and safe, orally-bioavailable γ-globin inducing agents would benefit many patients. We adapted a LCR-γ-globin promoter-GFP reporter assay to a high-throughput robotic system to evaluate five diverse chemical libraries for this activity. Multiple structurally- and functionally-diverse compounds were identified which activate the γ-globin gene promoter at nanomolar concentrations, including some therapeutics approved for other conditions. Three candidates with established safety profiles were further evaluated in erythroid progenitors, anemic baboons and transgenic mice, with significant induction of γ-globin expression observed in vivo. A lead candidate, Benserazide, emerged which demonstrated > 20-fold induction of γ-globin mRNA expression in anemic baboons and increased F-cell proportions by 3.5-fold in transgenic mice. Benserazide has been used chronically to inhibit amino acid decarboxylase to enhance plasma levels of L-dopa. These studies confirm the utility of high-throughput screening and identify previously unrecognized fetal globin inducing candidates which can be developed expediently for treatment of hemoglobinopathies. PMID:26713848

Whole-Genome Duplication and the Functional Diversification of Teleost Fish Hemoglobins

PubMed Central

Opazo, Juan C.; Butts, G. Tyler; Nery, Mariana F.; Storz, Jay F.; Hoffmann, Federico G.

2013-01-01

Subsequent to the two rounds of whole-genome duplication that occurred in the common ancestor of vertebrates, a third genome duplication occurred in the stem lineage of teleost fishes. This teleost-specific genome duplication (TGD) is thought to have provided genetic raw materials for the physiological, morphological, and behavioral diversification of this highly speciose group. The extreme physiological versatility of teleost fish is manifest in their diversity of blood–gas transport traits, which reflects the myriad solutions that have evolved to maintain tissue O2 delivery in the face of changing metabolic demands and environmental O2 availability during different ontogenetic stages. During the course of development, regulatory changes in blood–O2 transport are mediated by the expression of multiple, functionally distinct hemoglobin (Hb) isoforms that meet the particular O2-transport challenges encountered by the developing embryo or fetus (in viviparous or oviparous species) and in free-swimming larvae and adults. The main objective of the present study was to assess the relative contributions of whole-genome duplication, large-scale segmental duplication, and small-scale gene duplication in producing the extraordinary functional diversity of teleost Hbs. To accomplish this, we integrated phylogenetic reconstructions with analyses of conserved synteny to characterize the genomic organization and evolutionary history of the globin gene clusters of teleosts. These results were then integrated with available experimental data on functional properties and developmental patterns of stage-specific gene expression. Our results indicate that multiple α- and β-globin genes were present in the common ancestor of gars (order Lepisoteiformes) and teleosts. The comparative genomic analysis revealed that teleosts possess a dual set of TGD-derived globin gene clusters, each of which has undergone lineage-specific changes in gene content via repeated duplication and deletion events. Phylogenetic reconstructions revealed that paralogous genes convergently evolved similar functional properties in different teleost lineages. Consistent with other recent studies of globin gene family evolution in vertebrates, our results revealed evidence for repeated evolutionary transitions in the developmental regulation of Hb synthesis. PMID:22949522

Beta-globin locus activation regions: conservation of organization, structure, and function.

PubMed Central

Li, Q L; Zhou, B; Powers, P; Enver, T; Stamatoyannopoulos, G

1990-01-01

The human beta-globin locus activation region (LAR) comprises four erythroid-specific DNase I hypersensitive sites (I-IV) thought to be largely responsible for activating the beta-globin domain and facilitating high-level erythroid-specific globin gene expression. We identified the goat beta-globin LAR, determined 10.2 kilobases of its sequence, and demonstrated its function in transgenic mice. The human and goat LARs share 6.5 kilobases of homologous sequences that are as highly conserved as the epsilon-globin gene promoters. Furthermore, the overall spatial organization of the two LARs has been conserved. These results suggest that the functionally relevant regions of the LAR are large and that in addition to their primary structure, the spatial relationship of the conserved elements is important for LAR function. Images PMID:2236034

High resolution melting curve analysis targeting the HBB gene mutational hot-spot offers a reliable screening approach for all common as well as most of the rare beta-globin gene mutations in Bangladesh.

PubMed

Islam, Md Tarikul; Sarkar, Suprovath Kumar; Sultana, Nusrat; Begum, Mst Noorjahan; Bhuyan, Golam Sarower; Talukder, Shezote; Muraduzzaman, A K M; Alauddin, Md; Islam, Mohammad Sazzadul; Biswas, Pritha Promita; Biswas, Aparna; Qadri, Syeda Kashfi; Shirin, Tahmina; Banu, Bilquis; Sadya, Salma; Hussain, Manzoor; Sarwardi, Golam; Khan, Waqar Ahmed; Mannan, Mohammad Abdul; Shekhar, Hossain Uddin; Chowdhury, Emran Kabir; Sajib, Abu Ashfaqur; Akhteruzzaman, Sharif; Qadri, Syed Saleheen; Qadri, Firdausi; Mannoor, Kaiissar

2018-01-02

Bangladesh lies in the global thalassemia belt, which has a defined mutational hot-spot in the beta-globin gene. The high carrier frequencies of beta-thalassemia trait and hemoglobin E-trait in Bangladesh necessitate a reliable DNA-based carrier screening approach that could supplement the use of hematological and electrophoretic indices to overcome the barriers of carrier screening. With this view in mind, the study aimed to establish a high resolution melting (HRM) curve-based rapid and reliable mutation screening method targeting the mutational hot-spot of South Asian and Southeast Asian countries that encompasses exon-1 (c.1 - c.92), intron-1 (c.92 + 1 - c.92 + 130) and a portion of exon-2 (c.93 - c.217) of the HBB gene which harbors more than 95% of mutant alleles responsible for beta-thalassemia in Bangladesh. Our HRM approach could successfully differentiate ten beta-globin gene mutations, namely c.79G > A, c.92 + 5G > C, c.126_129delCTTT, c.27_28insG, c.46delT, c.47G > A, c.92G > C, c.92 + 130G > C, c.126delC and c.135delC in heterozygous states from the wild type alleles, implying the significance of the approach for carrier screening as the first three of these mutations account for ~85% of total mutant alleles in Bangladesh. Moreover, different combinations of compound heterozygous mutations were found to generate melt curves that were distinct from the wild type alleles and from one another. Based on the findings, sixteen reference samples were run in parallel to 41 unknown specimens to perform direct genotyping of the beta-thalassemia specimens using HRM. The HRM-based genotyping of the unknown specimens showed 100% consistency with the sequencing result. Targeting the mutational hot-spot, the HRM approach could be successfully applied for screening of beta-thalassemia carriers in Bangladesh as well as in other countries of South Asia and Southeast Asia. The approach could be a useful supplement of hematological and electrophortic indices in order to avoid false positive and false negative results.

Relative deformability of red blood cells in sickle cell trait and sickle cell anemia by trapping and dragging

NASA Astrophysics Data System (ADS)

Solomon, Rance; Cooper, James; Welker, Gabriel; Aguilar, Elaura; Flanagan, Brooke; Pennycuff, Chelsey; Scott, David; Farone, Anthony; Farone, Mary; Erenso, Daniel; Mushi, Robert; del Pilar Aguinaga, Maria

2013-06-01

Genetic mutation of the β-globin gene or inheritance of this mutated gene changes the chemical composition of the oxygen-carrying hemoglobin molecule that could lead to either the heterozygote genotype, resulting in sickle cell trait (SCT), or the homozygote genotype, resulting in sickle cell anemia (SCA). These mutations could affect the reversible elastic deformations of the red blood cells (RBCs) which are vital for biological functions. We have investigated this effect by studying the differences in the deformability of RBCs from blood samples of an individual with SCT and an untreated patient with SCA along with hemoglobin quantitation of each blood sample. Infrared 1064 nm laser trap force along with drag shear force are used to induce deformation in the RBCs. Ultra2-High Performance Liquid Chromatography (UHPLC) is used for the hemoglobin quantitation.

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Assessment of virally vectored autoimmunity as a biocontrol strategy for cane toads.

PubMed

Pallister, Jackie A; Halliday, Damien C T; Robinson, Anthony J; Venables, Daryl; Voysey, Rhonda D; Boyle, Donna G; Shanmuganathan, Thayalini; Hardy, Christopher M; Siddon, Nicole A; Hyatt, Alex D

2011-01-25

The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach.

Inhibition of G9a methyltransferase stimulates fetal hemoglobin production by facilitating LCR/γ-globin looping.

PubMed

Krivega, Ivan; Byrnes, Colleen; de Vasconcellos, Jaira F; Lee, Y Terry; Kaushal, Megha; Dean, Ann; Miller, Jeffery L

2015-07-30

Induction of fetal hemoglobin (HbF) production in adult erythrocytes can reduce the severity of sickle cell disease and β-thalassemia. Transcription of β-globin genes is regulated by the distant locus control region (LCR), which is brought into direct gene contact by the LDB1/GATA-1/TAL1/LMO2-containing complex. Inhibition of G9a H3K9 methyltransferase by the chemical compound UNC0638 activates fetal and represses adult β-globin gene expression in adult human hematopoietic precursor cells, but the underlying mechanisms are unclear. Here we studied UNC0638 effects on β-globin gene expression using ex vivo differentiation of CD34(+) erythroid progenitor cells from peripheral blood of healthy adult donors. UNC0638 inhibition of G9a caused dosed accumulation of HbF up to 30% of total hemoglobin in differentiated cells. Elevation of HbF was associated with significant activation of fetal γ-globin and repression of adult β-globin transcription. Changes in gene expression were associated with widespread loss of H3K9me2 in the locus and gain of LDB1 complex occupancy at the γ-globin promoters as well as de novo formation of LCR/γ-globin contacts. Our findings demonstrate that G9a establishes epigenetic conditions preventing activation of γ-globin genes during differentiation of adult erythroid progenitor cells. In this view, manipulation of G9a represents a promising epigenetic approach for treatment of β-hemoglobinopathies.

MafK/NF-E2 p18 is required for beta-globin genes activation by mediating the proximity of LCR and active beta-globin genes in MEL cell line.

PubMed

Du, Mei-Jun; Lv, Xiang; Hao, De-Long; Zhao, Guo-Wei; Wu, Xue-Song; Wu, Feng; Liu, De-Pei; Liang, Chih-Chuan

2008-01-01

Evidences indicate that locus control region (LCR) of beta-globin spatially closes to the downstream active gene promoter to mediate the transcriptional activation by looping. DNA binding proteins may play an important role in the looping formation. NF-E2 is one of the key transcription factors in beta-globin gene transcriptional activation. To shed light on whether NF-E2 is involved in this process, DS19MafKsiRNA cell pools were established by specifically knocked down the expression of MafK/NF-E2 p18, one subunit of NF-E2 heterodimer. In the above cell pools, it was observed that the occupancy efficiency of NF-E2 on beta-globin gene locus and the expression level of beta-globin genes were decreased. H3 acetylation, H3-K4 methylation and the deposition of RNA polymerase II, but not the recruitment of GATA-1, were also found reduced at the beta-globin gene cluster. Chromosome Conformation Capture (3C) assay showed that the cross-linking frequency between the main NF-E2 binding site HS2 and downstream structural genes was reduced compared to the normal cell. This result demonstrated that MafK/NF-E2 p18 recruitment was involved in the physical proximity of LCR and active beta-globin genes upon beta-globin gene transcriptional activation.

Open and Lys–His Hexacoordinated Closed Structures of a Globin with Swapped Proximal and Distal Sites

PubMed Central

Teh, Aik-Hong; Saito, Jennifer A.; Najimudin, Nazalan; Alam, Maqsudul

2015-01-01

Globins are haem-binding proteins with a conserved fold made up of α-helices and can possess diverse properties. A putative globin-coupled sensor from Methylacidiphilum infernorum, HGbRL, contains an N-terminal globin domain whose open and closed structures reveal an untypical dimeric architecture. Helices E and F fuse into an elongated helix, resulting in a novel site-swapped globin fold made up of helices A–E, hence the distal site, from one subunit and helices F–H, the proximal site, from another. The open structure possesses a large cavity binding an imidazole molecule, while the closed structure forms a unique Lys–His hexacoordinated species, with the first turn of helix E unravelling to allow Lys52(E10) to bind to the haem. Ligand binding induces reorganization of loop CE, which is stabilized in the closed form, and helix E, triggering a large conformational movement in the open form. These provide a mechanical insight into how a signal may be relayed between the globin domain and the C-terminal domain of HGbRL, a Roadblock/LC7 domain. Comparison with HGbI, a closely related globin, further underlines the high degree of structural versatility that the globin fold is capable of, enabling it to perform a diversity of functions. PMID:26094577

Towards β-globin gene-targeting with integrase-defective lentiviral vectors.

PubMed

Inanlou, Davoud Nouri; Yakhchali, Bagher; Khanahmad, Hossein; Gardaneh, Mossa; Movassagh, Hesam; Cohan, Reza Ahangari; Ardestani, Mehdi Shafiee; Mahdian, Reza; Zeinali, Sirous

2010-11-01

We have developed an integrase-defective lentiviral (LV) vector in combination with a gene-targeting approach for gene therapy of β-thalassemia. The β-globin gene-targeting construct has two homologous stems including sequence upstream and downstream of the β-globin gene, a β-globin gene positioned between hygromycin and neomycin resistant genes and a herpes simplex virus type 1 thymidine kinase (HSVtk) suicide gene. Utilization of integrase-defective LV as a vector for the β-globin gene increased the number of selected clones relative to non-viral methods. This method represents an important step toward the ultimate goal of a clinical gene therapy for β-thalassemia.

Mutations on the α2-Globin Gene That May Trigger α(+)-Thalassemia.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

In the present study, a total of 11 individuals with hypochromic microcytic anemia who did not reveal the most common α-thalassemia (α-thal) deletions or mutations, were subjected to more investigations by DNA sequencing of the α-globin genes. Seven novel nondeletional α-thal mutations localized on the α2-globin gene in the heterozygous state were identified. These mutations either corrupted regulatory splice sites and consequently affected RNA processing or created unstable hemoglobin (Hb) variants. The mutations described here produced globin gene variants that lead to amino acid changes in critical regions of the globin chain. The clinical presentation of most patients was a persistent mild microcytic anemia similar to an α(+)-thal. In the last decade, numerous α-globin mutations have been observed leading to an α-thal phenotype and these studies have been considered to be important as discussed here.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Activation of beta-major globin gene transcription is associated with recruitment of NF-E2 to the beta-globin LCR and gene promoter.

PubMed

Sawado, T; Igarashi, K; Groudine, M

2001-08-28

The mouse beta-globin gene locus control region (LCR), located upstream of the beta-globin gene cluster, is essential for the activated transcription of genes in the cluster. The LCR contains multiple binding sites for transactivators, including Maf-recognition elements (MAREs). However, little is known about the specific proteins that bind to these sites or the time at which they bind during erythroid differentiation. We have performed chromatin immunoprecipitation experiments to determine the recruitment of the erythroid-specific transactivator p45 NF-E2/MafK (p18 NF-E2) heterodimer and small Maf proteins to various regions in the globin gene locus before and after the induction of murine erythroleukemia (MEL) cell differentiation. We report that, before induction, the LCR is occupied by small Maf proteins, and, on erythroid maturation, the NF-E2 complex is recruited to the LCR and the active globin promoters, even though the promoters do not contain MAREs. This differentiation-coupled recruitment of NF-E2 complex correlates with a greater than 100-fold increase in beta-major globin transcription, but is not associated with a significant change in locus-wide histone H3 acetylation. These findings suggest that the beta-globin gene locus exists in a constitutively open chromatin conformation before terminal differentiation, and we speculate that recruitment of NF-E2 complex to the LCR and active promoters may be a rate-limiting step in the activation of beta-globin gene expression.

Erythroid activator NF-E2, TAL1 and KLF1 play roles in forming the LCR HSs in the human adult β-globin locus.

PubMed

Kim, Yea Woon; Yun, Won Ju; Kim, AeRi

2016-06-01

The β-like globin genes are developmental stage specifically transcribed in erythroid cells. The transcription of the β-like globin genes requires erythroid specific activators such as GATA-1, NF-E2, TAL1 and KLF1. However, the roles of these activators have not fully elucidated in transcription of the human adult β-globin gene. Here we employed hybrid MEL cells (MEL/ch11) where a human chromosome containing the β-globin locus is present and the adult β-globin gene is highly transcribed by induction. The roles of erythroid specific activators were analyzed by inhibiting the expression of NF-E2, TAL1 or KLF1 in MEL/ch11 cells. The loss of each activator decreased the transcription of human β-globin gene, locus wide histone hyperacetylation and the binding of other erythroid specific activators including GATA-1, even though not affecting the expression of other activators. Notably, sensitivity to DNase I was reduced in the locus control region (LCR) hypersensitive sites (HSs) with the depletion of activators. These results indicate that NF-E2, TAL1 and KLF1, all activators play a primary role in HSs formation in the LCR. It might contribute to the transcription of human adult β-globin gene by allowing the access of activators and cofactors. The roles of activators in the adult β-globin locus appear to be different from the roles in the early fetal locus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Structural analysis of an oxygen-regulated diguanylate cyclase.

PubMed

Tarnawski, Miroslaw; Barends, Thomas R M; Schlichting, Ilme

2015-11-01

Cyclic di-GMP is a bacterial second messenger that is involved in switching between motile and sessile lifestyles. Given the medical importance of biofilm formation, there has been increasing interest in understanding the synthesis and degradation of cyclic di-GMPs and their regulation in various bacterial pathogens. Environmental cues are detected by sensing domains coupled to GGDEF and EAL or HD-GYP domains that have diguanylate cyclase and phosphodiesterase activities, respectively, producing and degrading cyclic di-GMP. The Escherichia coli protein DosC (also known as YddV) consists of an oxygen-sensing domain belonging to the class of globin sensors that is coupled to a C-terminal GGDEF domain via a previously uncharacterized middle domain. DosC is one of the most strongly expressed GGDEF proteins in E. coli, but to date structural information on this and related proteins is scarce. Here, the high-resolution structural characterization of the oxygen-sensing globin domain, the middle domain and the catalytic GGDEF domain in apo and substrate-bound forms is described. The structural changes between the iron(III) and iron(II) forms of the sensor globin domain suggest a mechanism for oxygen-dependent regulation. The structural information on the individual domains is combined into a model of the dimeric DosC holoprotein. These findings have direct implications for the oxygen-dependent regulation of the activity of the cyclase domain.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Lalley, P.A.; Whitney, J.B.

A genetic polymorphism for a Bgl I endonuclease site near the ..cap alpha..-globin-like pseudogene ..cap alpha..-4 of C57BL/6 and C3H/HeN mice was used to show that ..cap alpha..-4 was not affected by three independent mutations in which the adult globin genes ..cap alpha..-1 and ..cap alpha..-2 were deleted. These results indicated that ..cap alpha..-4 might not be located adjacent to the adult ..cap alpha..-globin genes on chromosome 11. Restriction endonuclease analysis of DNA of a primary clone of a Chinese hamster-mouse somatic cell hybrid that had lost mouse chromosomes 11 and 18 showed that this clone lacked the adult murinemore » globin genes ..cap alpha..-1 and ..cap alpha..-2 but it did contain the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4. These results indicated that the adult ..cap alpha..-globin genes and ..cap alpha..-globin-like pseudogenes are not located on the same chromosome. Similar analyses of several other Chinese hamster-mouse somatic cell hybrids that had segregated other mouse chromosomes indicated that the ..cap alpha..-globin-like pseudogenes ..cap alpha..-3 and ..cap alpha..-4 are located on mouse chromosomes 15 and 17, respectively. These data explain why ..cap alpha..-3 and ..cap alpha..-4 were not affected by the three independently induced deletion-type mutations that cause ..cap alpha..-thalassemia in the mouse.« less

Amelioration of murine beta-thalassemia through drug selection of hematopoietic stem cells transduced with a lentiviral vector encoding both gamma-globin and the MGMT drug-resistance gene.

PubMed

Zhao, Huifen; Pestina, Tamara I; Nasimuzzaman, Md; Mehta, Perdeep; Hargrove, Phillip W; Persons, Derek A

2009-06-04

Correction of murine models of beta-thalassemia has been achieved through high-level globin lentiviral vector gene transfer into mouse hematopoietic stem cells (HSCs). However, transduction of human HSCs is less robust and may be inadequate to achieve therapeutic levels of genetically modified erythroid cells. We therefore developed a double gene lentiviral vector encoding both human gamma-globin under the transcriptional control of erythroid regulatory elements and methylguanine methyltransferase (MGMT), driven by a constitutive cellular promoter. MGMT expression provides cellular resistance to alkylator drugs, which can be administered to kill residual untransduced, diseased HSCs, whereas transduced cells are protected. Mice transplanted with beta-thalassemic HSCs transduced with a gamma-globin/MGMT vector initially had subtherapeutic levels of red cells expressing gamma-globin. To enrich gamma-globin-expressing cells, transplanted mice were treated with the alkylator agent 1,3-bis-chloroethyl-1-nitrosourea. This resulted in significant increases in the number of gamma-globin-expressing red cells and the amount of fetal hemoglobin, leading to resolution of anemia. Selection of transduced HSCs was also obtained when cells were drug-treated before transplantation. Mice that received these cells demonstrated reconstitution with therapeutic levels of gamma-globin-expressing cells. These data suggest that MGMT-based drug selection holds promise as a modality to improve gene therapy for beta-thalassemia.

DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

PubMed

Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

2010-05-07

Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

Assessment of Virally Vectored Autoimmunity as a Biocontrol Strategy for Cane Toads

PubMed Central

Robinson, Anthony J.; Venables, Daryl; Voysey, Rhonda D.; Boyle, Donna G.; Shanmuganathan, Thayalini; Hardy, Christopher M.; Siddon, Nicole A.; Hyatt, Alex D.

2011-01-01

Background The cane toad, Bufo (Chaunus) marinus, is one of the most notorious vertebrate pests introduced into Australia over the last 200 years and, so far, efforts to identify a naturally occurring B. marinus-specific pathogen for use as a biological control agent have been unsuccessful. We explored an alternative approach that entailed genetically modifying a pathogen with broad host specificity so that it no longer caused disease, but carried a gene to disrupt the cane toad life cycle in a species specific manner. Methodology/Principal Findings The adult beta globin gene was selected as the model gene for proof of concept of autoimmunity as a biocontrol method for cane toads. A previous report showed injection of bullfrog tadpoles with adult beta globin resulted in an alteration in the form of beta globin expressed in metamorphs as well as reduced survival. In B. marinus we established for the first time that the switch from tadpole to adult globin exists. The effect of injecting B. marinus tadpoles with purified recombinant adult globin protein was then assessed using behavioural (swim speed in tadpoles and jump length in metamorphs), developmental (time to metamorphosis, weight and length at various developmental stages, protein profile of adult globin) and genetic (adult globin mRNA levels) measures. However, we were unable to detect any differences between treated and control animals. Further, globin delivery using Bohle iridovirus, an Australian ranavirus isolate belonging to the Iridovirus family, did not reduce the survival of metamorphs or alter the form of beta globin expressed in metamorphs. Conclusions/Significance While we were able to show for the first time that the switch from tadpole to adult globin does occur in B. marinus, we were not able to induce autoimmunity and disrupt metamorphosis. The short development time of B. marinus tadpoles may preclude this approach. PMID:21283623

The effect of globin scaffold on osteoblast adhesion and phenotype expression in vitro.

PubMed

Hamdan, Ahmad A; Loty, Sabine; Isaac, Juliane; Tayot, Jean-Louis; Bouchard, Philippe; Khraisat, Ameen; Bedral, Ariane; Sautier, Jean-Michel

2012-01-01

Different synthetic and natural biomaterials have been used in bone tissue regeneration. However, several limitations are associated with the use of synthetic as well as allogenous or xenogenous natural materials. This study evaluated, in an in vitro model, the behavior of rat osteoblastic cells cultured on a human globin scaffold. Rat osteoblastic cells were isolated from the calvaria of 21-day-old fetal Sprague-Dawley rats. They were then grown in the presence of globin. Real-time polymerase chain reaction (RT-PCR) was performed to study the expression of cyclin D1, integrin Β1, Msx2, Dlx5, Runx2, and osteocalcin on days 1, 5, and 9. Moreover, alkaline phosphatase activity was measured on days 1, 3, 5, and 7. Alizarin red staining was performed on day 9 to observe calcium deposition. Cells were able to adhere, proliferate, and differentiate on globin scaffolds. Moreover, RT-PCR showed that globin may stimulate some key genes of osteoblastic differentiation (Runx2, osteocalcin, Dlx5). Globin had an inhibitory effect on alkaline phosphatase activity. Calcium deposits were seen after 9 days of culture. These results indicate that purified human globin might be a suitable scaffold for bone tissue regeneration.

Characterization of the transcriptome profiles related to globin gene switching during in vitro erythroid maturation

PubMed Central

2012-01-01

Background The fetal and adult globin genes in the human β-globin cluster on chromosome 11 are sequentially expressed to achieve normal hemoglobin switching during human development. The pharmacological induction of fetal γ-globin (HBG) to replace abnormal adult sickle βS-globin is a successful strategy to treat sickle cell disease; however the molecular mechanism of γ-gene silencing after birth is not fully understood. Therefore, we performed global gene expression profiling using primary erythroid progenitors grown from human peripheral blood mononuclear cells to characterize gene expression patterns during the γ-globin to β-globin (γ/β) switch observed throughout in vitro erythroid differentiation. Results We confirmed erythroid maturation in our culture system using cell morphologic features defined by Giemsa staining and the γ/β-globin switch by reverse transcription-quantitative PCR (RT-qPCR) analysis. We observed maximal γ-globin expression at day 7 with a switch to a predominance of β-globin expression by day 28 and the γ/β-globin switch occurred around day 21. Expression patterns for transcription factors including GATA1, GATA2, KLF1 and NFE2 confirmed our system produced the expected pattern of expression based on the known function of these factors in globin gene regulation. Subsequent gene expression profiling was performed with RNA isolated from progenitors harvested at day 7, 14, 21, and 28 in culture. Three major gene profiles were generated by Principal Component Analysis (PCA). For profile-1 genes, where expression decreased from day 7 to day 28, we identified 2,102 genes down-regulated > 1.5-fold. Ingenuity pathway analysis (IPA) for profile-1 genes demonstrated involvement of the Cdc42, phospholipase C, NF-Kβ, Interleukin-4, and p38 mitogen activated protein kinase (MAPK) signaling pathways. Transcription factors known to be involved in γ-and β-globin regulation were identified. The same approach was used to generate profile-2 genes where expression was up-regulated over 28 days in culture. IPA for the 2,437 genes with > 1.5-fold induction identified the mitotic roles of polo-like kinase, aryl hydrocarbon receptor, cell cycle control, and ATM (Ataxia Telangiectasia Mutated Protein) signaling pathways; transcription factors identified included KLF1, GATA1 and NFE2 among others. Finally, profile-3 was generated from 1,579 genes with maximal expression at day 21, around the time of the γ/β-globin switch. IPA identified associations with cell cycle control, ATM, and aryl hydrocarbon receptor signaling pathways. Conclusions The transcriptome analysis completed with erythroid progenitors grown in vitro identified groups of genes with distinct expression profiles, which function in metabolic pathways associated with cell survival, hematopoiesis, blood cells activation, and inflammatory responses. This study represents the first report of a transcriptome analysis in human primary erythroid progenitors to identify transcription factors involved in hemoglobin switching. Our results also demonstrate that the in vitro liquid culture system is an excellent model to define mechanisms of global gene expression and the DNA-binding protein and signaling pathways involved in globin gene regulation. PMID:22537182

A 21 Nucleotide Duplication on the α1- and α2-Globin Genes Involves a Variety of Hypochromic Microcytic Anemias, From Mild to Hb H Disease.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Zeinali, Fatemeh; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita; Tamaddoni, Ahmad

2015-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects in the α-globin gene cluster can result in α-thal that may develop into a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. Loss of one functional α gene, indicated as heterozygous α(+)-thal, shows minor hematological abnormalities. Homozygosity for α(+)- or heterozygosity for α(0)-thal have more severe hematological abnormalities due to a markedly reduced α chain output. At the molecular level, the absence of three α-globin genes resulting from the compound heterozygous state for α(0)- and α(+)-thal, lead to Hb H disease. Here we present a 21 nucleotide (nt) duplication consisting of six amino acids and 3 bp of intronic sequence at the exon-intron boundary, in both the α-globin genes, detected by direct DNA sequencing. This duplication was identified in three patients originating from two different Iranian ethnic groups and one Arab during more than 12 years. The clinical presentation of these individuals varies widely from a mild asymptomatic anemia (heterozygote in α1-globin gene) to a severely anemic state, diagnosed as an Hb H individual requiring blood transfusion (duplication on the α2-globin gene in combination with the - -(MED) double α-globin gene deletion). The third individual, who was homozygous for this nt duplication on the α1-globin gene, showed severe hypochromic microcytic anemia and splenomegaly. In the last decade, numerous α-globin mutations have demonstrated the necessity of prenatal diagnosis (PND) for α-thal, and this study has contributed another mutation as important enough that needs to be considered.

A Practical Platform for Blood Biomarker Study by Using Global Gene Expression Profiling of Peripheral Whole Blood

PubMed Central

Schmid, Patrick; Yao, Hui; Galdzicki, Michal; Berger, Bonnie; Wu, Erxi; Kohane, Isaac S.

2009-01-01

Background Although microarray technology has become the most common method for studying global gene expression, a plethora of technical factors across the experiment contribute to the variable of genome gene expression profiling using peripheral whole blood. A practical platform needs to be established in order to obtain reliable and reproducible data to meet clinical requirements for biomarker study. Methods and Findings We applied peripheral whole blood samples with globin reduction and performed genome-wide transcriptome analysis using Illumina BeadChips. Real-time PCR was subsequently used to evaluate the quality of array data and elucidate the mode in which hemoglobin interferes in gene expression profiling. We demonstrated that, when applied in the context of standard microarray processing procedures, globin reduction results in a consistent and significant increase in the quality of beadarray data. When compared to their pre-globin reduction counterparts, post-globin reduction samples show improved detection statistics, lowered variance and increased sensitivity. More importantly, gender gene separation is remarkably clearer in post-globin reduction samples than in pre-globin reduction samples. Our study suggests that the poor data obtained from pre-globin reduction samples is the result of the high concentration of hemoglobin derived from red blood cells either interfering with target mRNA binding or giving the pseudo binding background signal. Conclusion We therefore recommend the combination of performing globin mRNA reduction in peripheral whole blood samples and hybridizing on Illumina BeadChips as the practical approach for biomarker study. PMID:19381341

The role of fetal adrenal hormones in the switch from fetal to adult globin synthesis in the sheep.

PubMed

Wintour, E M; Smith, M B; Bell, R J; McDougall, J G; Cauchi, M N

1985-01-01

The switch from gamma (fetal) to beta (adult) globin production was studied by the analysis of globin synthesis in chronically cannulated ovine fetuses and newborn lambs. The gamma/alpha globin synthesis ratio decreased from 0.98 +/- 0.11 (S.D.) (n = 4 samples) at 100-120 days of gestation to 0.15 +/- 0.07 (n = 4) in lambs of 150-156 days post-conception, and the beta/alpha synthesis ratio increased from 0.04 +/- 0.06 (n = 4) to 1.13 +/- 0.21 (n = 4) over the same period. In bilaterally adrenalectomized fetuses, which survived in utero until 151-156 days, the gamma/alpha and beta/alpha synthesis ratios were 0.64 +/- 0.14 (n = 3) and 0.25 +/- 0.07 (n = 3) respectively in the 150- to 156-day period. Bilateral adrenalectomy did not affect the time of onset of beta globin synthesis, but significantly decreased the rate. In one bilaterally adrenalectomized fetus the infusion of increasing concentrations of cortisol restored the rate of beta globin synthesis to normal. Treatment of three intact fetuses with 100 micrograms cortisol/h for 3 weeks, from 100 to 121 days, did not affect the timing or rate of switch from gamma to beta globin synthesis. Thus fetal adrenal secretions, probably cortisol, affected the rate of change of gamma to beta globin synthesis but other factors must have been involved in the initiation of the switch.

A molecular study of a family with Greek hereditary persistence of fetal hemoglobin and beta-thalassemia.

PubMed Central

Giglioni, B; Casini, C; Mantovani, R; Merli, S; Comi, P; Ottolenghi, S; Saglio, G; Camaschella, C; Mazza, U

1984-01-01

A family was studied in which two inherited defects of the non-alpha-globin cluster segregate: Greek hereditary persistence of fetal hemoglobin (HPFH) and beta-thalassemia. Fragments of the non-alpha-globin cluster from two patients were cloned in cosmid and phage lambda vectors, and assigned to either the HPFH or beta-thalassemic chromosome on the basis of the demonstration of a polymorphic BglII site in the HPFH gamma-globin cluster. The thalassemic beta-globin gene carries a mutation at nucleotide 1 of the intervening sequence I, known to cause beta zero-thalassemia; the beta-globin gene from the HPFH chromosome is entirely normal, both in the intron-exon sequence and in 5' flanking regions required for transcription. As the compound HPFH/beta-thalassemia heterozygote synthesizes HbA, these data prove that the HPFH beta-globin gene is functional, although at a decreased rate; its lower activity is likely to be due to a distant mutation. The HPFH A gamma-globin gene shows only two mutations: a T----C substitution in the large intervening sequence (responsible for the BglII polymorphic site) and a C----T substitution 196 nucleotides 5' to the cap site; the 5' flanking sequence is normal up to -1350 nucleotides upstream from the gene. Circumstantial evidence suggests that the mutation at -196 may be responsible for the abnormally high expression of the A gamma-globin gene. Images Fig. 1. Fig. 3. Fig. 4. Fig. 5. PMID:6210198

Alpha-globin gene haplotypes in South American Indians.

PubMed

Zago, M A; Melo Santos, E J; Clegg, J B; Guerreiro, J F; Martinson, J J; Norwich, J; Figueiredo, M S

1995-08-01

The haplotypes of the alpha-globin gene cluster were determined for 99 Indians from the Brazilian Amazon region who belong to 5 tribes: Wayampí, Wayana-Apalaí, Kayapó, Arára, and Yanomámi. Three predominant haplotypes were identified: Ia (present in 38.9% of chromosomes), IIIa (25.8%), and IIe (22.1%). The only alpha-globin gene rearrangement detected was alpha alpha alpha 3.7 I gene triplication associated with haplotype IIIa, found in high frequencies (5.6% and 10.6%) in two tribes and absent in the others. alpha-Globin gene deletions that cause alpha-thalassemia were not seen, supporting the argument that malaria was absent in these populations until recently. The heterogeneous distribution of alpha-globin gene haplotypes and rearrangements among the different tribes differs markedly from the homogeneous distribution of beta-globin gene cluster haplotypes and reflects the action of various genetic mechanisms (genetic drift, founder effect, consanguinity) on small isolated population groups with a complicated history of divergence-fusion events. The alpha-globin gene haplotype distribution has some similarities to distributions observed in Southeast Asian and Pacific Island populations, indicating that these populations have considerable genetic affinities. However, the absence of several features of the alpha-globin gene cluster that are consistently present among the Pacific Islanders suggests that the similarity of haplotypes between Brazilian Indians and people from Polynesia, Micronesia, and Melanesia is more likely to result of ancient common ancestry rather than the consequence of recent direct genetic contribution through immigration.

β-Globin-Expressing Definitive Erythroid Progenitor Cells Generated from Embryonic and Induced Pluripotent Stem Cell-Derived Sacs.

PubMed

Fujita, Atsushi; Uchida, Naoya; Haro-Mora, Juan J; Winkler, Thomas; Tisdale, John

2016-06-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent a potential alternative source for red blood cell transfusion. However, when using traditional methods with embryoid bodies, ES cell-derived erythroid cells predominantly express embryonic type ɛ-globin, with lesser fetal type γ-globin and very little adult type β-globin. Furthermore, no β-globin expression is detected in iPS cell-derived erythroid cells. ES cell-derived sacs (ES sacs) have been recently used to generate functional platelets. Due to its unique structure, we hypothesized that ES sacs serve as hemangioblast-like progenitors capable to generate definitive erythroid cells that express β-globin. With our ES sac-derived erythroid differentiation protocol, we obtained ∼120 erythroid cells per single ES cell. Both primitive (ɛ-globin expressing) and definitive (γ- and β-globin expressing) erythroid cells were generated from not only ES cells but also iPS cells. Primitive erythropoiesis is gradually switched to definitive erythropoiesis during prolonged ES sac maturation, concurrent with the emergence of hematopoietic progenitor cells. Primitive and definitive erythroid progenitor cells were selected on the basis of glycophorin A or CD34 expression from cells within the ES sacs before erythroid differentiation. This selection and differentiation strategy represents an important step toward the development of in vitro erythroid cell production systems from pluripotent stem cells. Further optimization to improve expansion should be required for clinical application. Stem Cells 2016;34:1541-1552. © 2016 AlphaMed Press.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

[Regulation of the β-globin gene family expression, useful in the search for new therapeutic targets for hemoglobinopathies].

PubMed

Scheps, Karen G; Varela, Viviana

Different hemoglobin isoforms are expressed during the embryonic, fetal and postnatal stages. They are formed by combination of polypeptide chains synthesized from the α- and β-globin gene clusters. Based on the fact that the presence of high hemoglobin F levels is beneficial in both sickle cell disease and severe thalassemic syndromes, a revision of the regulation of the β-globin cluster expression is proposed, especially regarding the genes encoding the y-globin chains (HBG1 and HBG2). In this review we describe the current knowledge about transcription factors and epigenetic regulators involved in the switches of the β-globin cluster. It is expected that the consolidation of knowledge in this field will allow finding new therapeutic targets for the treatment of hemoglobinopathies.

β-globin gene cluster haplotypes in ethnic minority populations of southwest China

PubMed Central

Sun, Hao; Liu, Hongxian; Huang, Kai; Lin, Keqin; Huang, Xiaoqin; Chu, Jiayou; Ma, Shaohui; Yang, Zhaoqing

2017-01-01

The genetic diversity and relationships among ethnic minority populations of southwest China were investigated using seven polymorphic restriction enzyme sites in the β-globin gene cluster. The haplotypes of 1392 chromosomes from ten ethnic populations living in southwest China were determined. Linkage equilibrium and recombination hotspot were found between the 5′ sites and 3′ sites of the β-globin gene cluster. 5′ haplotypes 2 (+−−−), 6 (−++−+), 9 (−++++) and 3′ haplotype FW3 (−+) were the predominant haplotypes. Notably, haplotype 9 frequency was significantly high in the southwest populations, indicating their difference with other Chinese. The interpopulation differentiation of southwest Chinese minority populations is less than those in populations of northern China and other continents. Phylogenetic analysis shows that populations sharing same ethnic origin or language clustered to each other, indicating current β-globin cluster diversity in the Chinese populations reflects their ethnic origin and linguistic affiliations to a great extent. This study characterizes β-globin gene cluster haplotypes in southwest Chinese minorities for the first time, and reveals the genetic variability and affinity of these populations using β-globin cluster haplotype frequencies. The results suggest that ethnic origin plays an important role in shaping variations of the β-globin gene cluster in the southwestern ethnic populations of China. PMID:28205625

The locus control region is required for association of the murine β-globin locus with engaged transcription factories during erythroid maturation

PubMed Central

Ragoczy, Tobias; Bender, M.A.; Telling, Agnes; Byron, Rachel; Groudine, Mark

2006-01-01

We have examined the relationship between nuclear localization and transcriptional activity of the endogenous murine β-globin locus during erythroid differentiation. Murine fetal liver cells were separated into distinct erythroid maturation stages by fluorescence-activated cell sorting, and the nuclear position of the locus was determined at each stage. We find that the β-globin locus progressively moves away from the nuclear periphery with increasing maturation. Contrary to the prevailing notion that the nuclear periphery is a repressive compartment in mammalian cells, βmajor-globin expression begins at the nuclear periphery prior to relocalization. However, relocation of the locus to the nuclear interior with maturation is accompanied by an increase in βmajor-globin transcription. The distribution of nuclear polymerase II (Pol II) foci also changes with erythroid differentiation: Transcription factories decrease in number and contract toward the nuclear interior. Moreover, both efficient relocalization of the β-globin locus from the periphery and its association with hyperphosphorylated Pol II transcription factories require the locus control region (LCR). These results suggest that the LCR-dependent association of the β-globin locus with transcriptionally engaged Pol II foci provides the driving force for relocalization of the locus toward the nuclear interior during erythroid maturation. PMID:16705039

Production of β-globin and adult hemoglobin following G418 treatment of erythroid precursor cells from homozygous β039 thalassemia patients

PubMed Central

Salvatori, Francesca; Breveglieri, Giulia; Zuccato, Cristina; Finotti, Alessia; Bianchi, Nicoletta; Borgatti, Monica; Feriotto, Giordana; Destro, Federica; Canella, Alessandro; Brognara, Eleonora; Lampronti, Ilaria; Breda, Laura; Rivella, Stefano; Gambari, Roberto

2013-01-01

In several types of thalassemia (including β039-thalassemia), stop codon mutations lead to premature translation termination and to mRNA destabilization through nonsense-mediated decay. Drugs (for instance aminoglycosides) can be designed to suppress premature termination, inducing a ribosomal readthrough. These findings have introduced new hopes for the development of a pharmacologic approach to the cure of this disease. However, the effects of aminoglycosides on globin mRNA carrying β-thalassemia stop mutations have not yet been investigated. In this study, we have used a lentiviral construct containing the β039- thalassemia globin gene under control of the β-globin promoter and a LCR cassette. We demonstrated by fluorescence-activated cell sorting (FACS) analysis the production of β-globin by K562 cell clones expressing the β039-thalassemia globin gene and treated with G418. More importantly, after FACS and high-performance liquid chromatography (HPLC) analyses, erythroid precursor cells from β039-thalassemia patients were demonstrated to be able to produce β-globin and adult hemoglobin after treatment with G418. This study strongly suggests that ribosomal readthrough should be considered a strategy for developing experimental strategies for the treatment of β0-thalassemia caused by stop codon mutations. PMID:19810011

Splice-Site Mutations Cause Rrp6-Mediated Nuclear Retention of the Unspliced RNAs and Transcriptional Down-Regulation of the Splicing-Defective Genes

PubMed Central

Eberle, Andrea B.; Hessle, Viktoria; Helbig, Roger; Dantoft, Widad; Gimber, Niclas; Visa, Neus

2010-01-01

Background Eukaryotic cells have developed surveillance mechanisms to prevent the expression of aberrant transcripts. An early surveillance checkpoint acts at the transcription site and prevents the release of mRNAs that carry processing defects. The exosome subunit Rrp6 is required for this checkpoint in Saccharomyces cerevisiae, but it is not known whether Rrp6 also plays a role in mRNA surveillance in higher eukaryotes. Methodology/Principal Findings We have developed an in vivo system to study nuclear mRNA surveillance in Drosophila melanogaster. We have produced S2 cells that express a human β-globin gene with mutated splice sites in intron 2 (mut β-globin). The transcripts encoded by the mut β-globin gene are normally spliced at intron 1 but retain intron 2. The levels of the mut β-globin transcripts are much lower than those of wild type (wt) ß-globin mRNAs transcribed from the same promoter. We have compared the expression of the mut and wt β-globin genes to investigate the mechanisms that down-regulate the production of defective mRNAs. Both wt and mut β-globin transcripts are processed at the 3′, but the mut β-globin transcripts are less efficiently cleaved than the wt transcripts. Moreover, the mut β-globin transcripts are less efficiently released from the transcription site, as shown by FISH, and this defect is restored by depletion of Rrp6 by RNAi. Furthermore, transcription of the mut β-globin gene is significantly impaired as revealed by ChIP experiments that measure the association of the RNA polymerase II with the transcribed genes. We have also shown that the mut β-globin gene shows reduced levels of H3K4me3. Conclusions/Significance Our results show that there are at least two surveillance responses that operate cotranscriptionally in insect cells and probably in all metazoans. One response requires Rrp6 and results in the inefficient release of defective mRNAs from the transcription site. The other response acts at the transcription level and reduces the synthesis of the defective transcripts through a mechanism that involves histone modifications. PMID:20634951

Hemoglobins, Hemorphins, and 11p15.5 Chromosomal Region in Cancer Biology and İmmunity with Special Emphasis for Brain Tumors.

PubMed

Altinoz, Meric Adil; Elmaci, Ilhan; Ince, Bahri; Ozpinar, Aysel; Sav, Aydin Murat

2016-05-01

In systemic cancers, increased hemolysis leads to extracellular hemoglobin (HB), and experimental studies have shown its provoking role on tumor growth and metastasis. However, investigations have shown that HB chains presented by tumor vascular pericytes or serum protein complexes of HB could also induce antitumor immunity, which may be harnessed to treat refractory cancers and brain tumors. Mounting recent evidence shows that expression of HBs is not restricted to erythrocytes and that HBs exist in the cells of lung and kidney, in macrophages, and in neurons and glia of the central nervous system (CNS). HBs mediate coping with hypoxia and free radical stress in normal and tumor cells, and they are increased in certain tumors including breast, lung, colon, and squamous cell cancers. Recent studies showed HBs in meningioma, in the cyst fluid of craniopharyngioma, in the cerebrospinal fluid (CSF) of pediatric patients with posterior fossa tumors, and in glioblastoma cell lines. Hemorphins, abundant brain peptides formed via HB-chain cleavage, exert opioid activity and antiproliferative and immunomodifier effects. Hence mutations in HBs may modify brain tumorigenesis via influencing hemorphins and perturbing regulations of immune surveillance and cell growth in the neuroectodermal tissues. The β-globin gene cluster resides in the chromosome region 11p15.5, harboring important immunity genes and IGF2, H19, PHLDA2/TSSC3, TRIM3, and SLC22A18 genes associated with cancers and gliomas. 11p15.5 is a prominent region subject to epigenetic regulation. Thus the β-globin loci may exert haplotypal interactions with these. Some clues support this theory. It is well established that iron load induces liver cancer in thalassemia major; however iron load-independent associations also exist. Enhanced rates of hematologic malignancies are associated with HB Lepore, association of hemoglobin E with cholangiocarcinoma, and enhanced gastric cancer rates in the thalassemia trait. In the African Herero population, a mutant form of δ-globin is very prevalent, and this population has higher rates of pediatric brain tumors. Globins are also expressed in healthy endothelia and in tumoral vessels, indicating potential involvement in angiogenesis. Studies on HBs and their cleavage peptides in cancers and brain tumors may lead to innovative treatment strategies. Georg Thieme Verlag KG Stuttgart · New York.

The 87-kD A gamma-globin enhancer-binding protein is a product of the HOXB2(HOX2H) locus.

PubMed

Sengupta, P K; Lavelle, D E; DeSimone, J

1994-03-01

Developmental regulation of globin gene expression may be controlled by developmental stage-specific nuclear proteins that influence interactions between the locus control region and local regulatory sequences near individual globin genes. We previously isolated an 87-kD nuclear protein from K562 cells that bound to DNA sequences in the beta-globin locus control region, gamma-globin promoter, and A gamma-globin enhancer. The presence of this protein in fetal globin-expressing cells and its absence in adult globin-expressing cells suggested that it may be a developmental stage-specific factor. A lambda gt11 K562 cDNA clone encoding a portion of the HOXB2 (formerly HOX2H) homeobox gene was isolated on the basis of the ability of its beta-galactosidase fusion protein to bind to the same DNA sequences as the 87-kD K562 protein. Because no other relationship had been established between the 87-kD K562 protein and the HOXB2 protein other than their ability to bind ot the same DNA sequences, we have investigated whether the two proteins are related antigenically. Our data show that antisera produced against the HOXB2-beta-gal fusion protein and a synthetic HOXB2 decapeptide react specifically with an 87-kD protein from K562 nuclear extract, showing that the 87-kD K562 nuclear protein is a product of the HOXB2 locus, and is the first demonstration of cellular HOXB2 protein.

Mi2β Is Required for γ-Globin Gene Silencing: Temporal Assembly of a GATA-1-FOG-1-Mi2 Repressor Complex in β-YAC Transgenic Mice

PubMed Central

Costa, Flávia C.; Fedosyuk, Halyna; Chazelle, Allen M.; Neades, Renee Y.; Peterson, Kenneth R.

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the −566 GATA motif of the Aγ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of Aγ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the −566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1–mediated repressor complex was disrupted by the −566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting −566 Aγ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis. PMID:23284307

Mi2β is required for γ-globin gene silencing: temporal assembly of a GATA-1-FOG-1-Mi2 repressor complex in β-YAC transgenic mice.

PubMed

Costa, Flávia C; Fedosyuk, Halyna; Chazelle, Allen M; Neades, Renee Y; Peterson, Kenneth R

2012-01-01

Activation of γ-globin gene expression in adults is known to be therapeutic for sickle cell disease. Thus, it follows that the converse, alleviation of repression, would be equally effective, since the net result would be the same: an increase in fetal hemoglobin. A GATA-1-FOG-1-Mi2 repressor complex was recently demonstrated to be recruited to the -566 GATA motif of the (A)γ-globin gene. We show that Mi2β is essential for γ-globin gene silencing using Mi2β conditional knockout β-YAC transgenic mice. In addition, increased expression of (A)γ-globin was detected in adult blood from β-YAC transgenic mice containing a T>G HPFH point mutation at the -566 GATA silencer site. ChIP experiments demonstrated that GATA-1 is recruited to this silencer at day E16, followed by recruitment of FOG-1 and Mi2 at day E17 in wild-type β-YAC transgenic mice. Recruitment of the GATA-1-mediated repressor complex was disrupted by the -566 HPFH mutation at developmental stages when it normally binds. Our data suggest that a temporal repression mechanism is operative in the silencing of γ-globin gene expression and that either a trans-acting Mi2β knockout deletion mutation or the cis-acting -566 (A)γ-globin HPFH point mutation disrupts establishment of repression, resulting in continued γ-globin gene transcription during adult definitive erythropoiesis.

CD34+ cells from dental pulp stem cells with a ZFN-mediated and homology-driven repair-mediated locus-specific knock-in of an artificial β-globin gene.

PubMed

Chattong, S; Ruangwattanasuk, O; Yindeedej, W; Setpakdee, A; Manotham, K

2017-07-01

In humans, mutations in the β-globin gene (HBB) have two important clinical manifestations: β-thalassemia and sickle cell disease. The progress in genome editing and stem cell research may be relevant to the treatment of β-globin-related diseases. In this work, we employed zinc-finger nuclease (ZFN)-mediated gene integration of synthetic β-globin cDNA into HBB loci, thus correcting almost all β-globin mutations. The integration was achieved in both HEK 293 cells and isolated dental pulp stem cell (DPSCs). We also showed that DPSCs with an artificial gene knock-in were capable of generating stable six-cell clones and were expandable at least 10 8 -fold; therefore, they may serve as a personalized stem cell factory. In addition, transfection with non-integrated pCAG-hOct4 and culturing in a conditioned medium converted the genome-edited DPSCs to CD34 + HSC-like cells. We believe that this approach may be useful for the treatment of β-globin-related diseases, especially the severe form of β-thalassemia.

Amoebozoa Possess Lineage-Specific Globin Gene Repertoires Gained by Individual Horizontal Gene Transfers

PubMed Central

Dröge, Jasmin; Buczek, Dorota; Suzuki, Yutaka; Makałowski, Wojciech

2014-01-01

The Amoebozoa represent a clade of unicellular amoeboid organisms that display a wide variety of lifestyles, including free-living and parasitic species. For example, the social amoeba Dictyostelium discoideum has the ability to aggregate into a multicellular fruiting body upon starvation, while the pathogenic amoeba Entamoeba histolytica is a parasite of humans. Globins are small heme proteins that are present in almost all extant organisms. Although several genomes of amoebozoan species have been sequenced, little is known about the phyletic distribution of globin genes within this phylum. Only two flavohemoglobins (FHbs) of D. discoideum have been reported and characterized previously while the genomes of Entamoeba species are apparently devoid of globin genes. We investigated eleven amoebozoan species for the presence of globin genes by genomic and phylogenetic in silico analyses. Additional FHb genes were identified in the genomes of four social amoebas and the true slime mold Physarum polycephalum. Moreover, a single-domain globin (SDFgb) of Hartmannella vermiformis, as well as two truncated hemoglobins (trHbs) of Acanthamoeba castellanii were identified. Phylogenetic evidence suggests that these globin genes were independently acquired via horizontal gene transfer from some ancestral bacteria. Furthermore, the phylogenetic tree of amoebozoan FHbs indicates that they do not share a common ancestry and that a transfer of FHbs from bacteria to amoeba occurred multiple times. PMID:25013378

A Functional Element Necessary for Fetal Hemoglobin Silencing

PubMed Central

Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

2011-01-01

BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.

PubMed

Neishabury, Maryam; Azarkeivan, Azita; Oberkanins, Christian; Abedini, Seyedeh Sedigheh; Zamani, Shahbaz; Najmabadi, Hossein

2011-03-15

Our data on 114 Iranian individuals with thalassemia intermedia phenotype revealed homozygous or compound heterozygous beta-globin mutations to be the predominant disease factor in 86.2% of cases. However, 8.2% of these individuals were found to be heterozygous or wild type for beta-globin mutations. In search for determinants outside of the beta-globin gene, which could be responsible for the unexpected thalassemia intermedia phenotype in these subjects, we screened the alpha-globin genes, the 5'HS3 and 5'HS4 regions of the beta-globin LCR, and the NF-E2 transcription factor for sequence variations in selected individuals. The -3.7 deletion was the only alpha-globin mutation detected, and no alterations were found in 5'HS3 and NF-E2. Sequence analysis of the 5'HS4 LCR core region identified three known SNPs in a single patient, who required irregular blood transfusions. The A/G polymorphism in the 5'HS4 palindromic region was also observed to be variable. Family studies were carried out on a female G/G homozygous patient, who received irregular blood transfusions. Her father, who had the same heterozygous IVSII-1 beta-globin mutation but the A/G genotype at the 5'HS4 palindromic site, presented with mild anemia and no requirement for blood transfusions. This suggests an impact of SNPs in the 5'HS4 LCR core region on the thalassemia phenotype and offers an interesting subject for further investigations in the Iranian population. Copyright © 2010 Elsevier Inc. All rights reserved.

Hemoglobins emerging roles in mental disorders. Metabolical, genetical and immunological aspects.

PubMed

Altinoz, Meric A; Ince, Bahri

2017-10-01

Hemoglobin (Hb) expression in the central nervous system is recently shown. Cooccurences of mental disorders (mainly bipolar disorder (BD) and tic disorders) with β- or α-thalassemia trait or erythrocytosis were witnessed, which may be due to peripheral or central hypoxia/hyperoxia or haplotypal gene interactions. β-Globin genes reside at 11p15.5 close to tyrosine hydroxylase, dopamine receptor DRD4 and Brain Derived Neurotrophic Factor, which involve in psychiatric diseases. α-Globin genes reside at 16p13.3 which associates with BD, tic disorders, ATR-16 Syndrome and Rubinstein Taybi Syndrome (RTS). CREB-Binding Protein (CEBBP)-gene is mutated in RTS, which commonly associates with mood disorders. 16p13.3 region also contains GRIN2A gene encoding N-methyl-d-aspartate receptor-2A and SSTR5 (Somatostatin Receptor-5), again involving in mental disorders. We demonstrated a protective role of minor HbA2 against post-partum episodes in BD and association of higher minor HbF (fetal hemoglobin) levels with family history of psychosis in a BD-patient cohort. HbA2 increases in cardiac ischemia and in mountain dwellers indicating its likely protection against ischemia/hypoxia. HMGIY, a repressive transcription factor of δ-globin chain of HbA2 is increased in lymphocytes of schizophrenics. In autism, deletional mutations were found in BCL11A gene, which cause persistence of HbF at high levels in adulthood. Also, certain polymorphisms in BCL11A strongly associate with schizophrenia. Further, many drugs from anabolic steroids to antimalarial agents elevate HbF and may cause mania. We ascribe a protective role to HbA2 and a maladaptive detrimental role to HbF in psychopathology. We believe that future studies on hemoglobins may pave to discover novel pathogenesis mechanisms in mental disorders. Copyright © 2017 ISDN. Published by Elsevier Ltd. All rights reserved.

Molecular Basis and Genetic Modifiers of Thalassemia.

PubMed

Mettananda, Sachith; Higgs, Douglas R

2018-04-01

Thalassemia is a disorder of hemoglobin characterized by reduced or absent production of one of the globin chains in human red blood cells with relative excess of the other. Impaired synthesis of β-globin results in β-thalassemia, whereas defective synthesis of α-globin leads to α-thalassemia. Despite being a monogenic disorder, thalassemia exhibits remarkable clinical heterogeneity that is directly related to the intracellular imbalance between α- and β-like globin chains. Novel insights into the genetic modifiers have contributed to the understanding of the correlation between genotype and phenotype and are being explored as therapeutic pathways to cure this life-limiting disease. Copyright © 2017 Elsevier Inc. All rights reserved.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Disorders of Human Hemoglobin

NASA Astrophysics Data System (ADS)

Bank, Arthur; Mears, J. Gregory; Ramirez, Francesco

1980-02-01

Studies of the human hemoglobin system have provided new insights into the regulation of expression of a group of linked human genes, the γ -δ -β globin gene complex in man. In particular, the thalassemia syndromes and related disorders of man are inherited anemias that provide mutations for the study of the regulation of globin gene expression. New methods, including restriction enzyme analysis and cloning of cellular DNA, have made it feasible to define more precisely the structure and organization of the globin genes in cellular DNA. Deletions of specific globin gene fragments have already been found in certain of these disorders and have been applied in prenatal diagnosis.

Glucocorticoids inhibit coordinated translation of. cap alpha. - and. beta. -globin mRNAs in Friend erythroleukemia cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, J.; Stewart, J.A.; Rabek, J.P.

The dimethylsulfoxide (Me/sub 2/SO)-mediated induction of hemoglobin synthesis in Friend erythroleukemia cells is inhibited by the glucocorticoids hydrocortisone, dexamethasone, and fluocinolone acetonide; hydrocortisone, at concentrations of 10/sup -5/ to 10/sup -8/ M inhibits by 90-30% and fluocinolone acetonide at concentrations of 10/sup -8/ to 10/sup -11/ M shows a greater than 90% inhibition. At these concentrations the hormones have no effect on cell growth or viability. In this study it has been shown that there is a group of proteins, including the ..cap alpha..- and ..beta..-globins, whose regulation is associated with the induction of Friend erythroleukemia cell differentiation, and thatmore » the expression of these, in addition to ..cap alpha..- and ..beta..-globin, is affected by glucocorticoids. It is concluded that, although the translation of ..cap alpha..- and ..beta..-globin mRNA is a major site of inhibition by glucocorticoids, there is a detectable amount of ..cap alpha..- and ..beta..-globin mRNA translation which results in unequal amounts of globin synthesis and an overall more potent inhibition of hemoglobin formation.« less

A majority of mice show long-term expression of a human. beta. -globin gene after retrovirus transfer into hematopoietic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bender, M.A.; Gelinas, R.E.; Miller

1989-04-01

Murine bone marrow was infected with a high-titer retrovirus vector containing the human {beta}-globin and neomycin phosphotransferase genes. Anemic W/W/sup v/ mice were transplanted with infected marrow which in some cases had been exposed to the selective agent G418. Human {beta}-globin expression was monitored in transplanted animals by using a monoclonal antibody specific for human {beta}-globin polypeptide, and hematopoietic reconstitution was monitored by using donor and recipient mice which differed in hemoglobin type. In some experiments all transplanted mice expressed the human {beta}-globin polypeptide for over 4 months, and up to 50% of peripheral erythrocytes contained detectable levels of polypeptide.more » DNA analysis of transplanted animals revealed that virtually every myeloid cell contained a provirus. Integration site analysis and reconstitution of secondary marrow recipients suggested that every mouse was reconstituted with at least one infected stem cell which had extensive repopulation capability. The ability to consistently transfer an active {beta}-globin gene into mouse hematopoietic cells improves the feasibility of using these techniques for somatic cell gene therapy in humans.« less

Assessing the relative stabilities of engineered hemoglobins using electrospray mass spectrometry.

PubMed

Apostol, I

1999-07-15

An ion trap mass spectrometer equipped with an electrospray source was used to examine the relative thermodynamic stabilities of various hemoglobins with respect to both tetramer dissociation and hemin dissociation. The results demonstrated that the stability of hemoglobin molecules can be differentiated by the amount of applied collision-induced dissociation (CID) energy necessary to break up the intact tetramer into its constituent globins. The stability of the intact tetramer was affected by single mutations in the beta-globins. The stabilities of the constituent hologlobins were assessed via trap CID of selected ions. The results demonstrated the importance of the contributions of the hologlobin components to the stability of the intact tetramer. Genetic fusion of two alpha-globins, through the introduction of a single glycine residue between the C-terminus of one alpha-chain and the N-terminus of the second, significantly increased the stability of the hemoglobin pseudo-tetramer. Chemical crosslinking of the beta-globins in addition to genetic fusion of alpha-globins further stabilized the hemoglobin molecule. A dihemoglobin molecule produced by the genetic fusion of two di-alpha-globins with a flexible linker demonstrated a decreased stability relative to the corresponding monohemoglobin. Copyright 1999 Academic Press.

Alternative options for DNA-based experimental therapy of β-thalassemia.

PubMed

Gambari, Roberto

2012-04-01

Beta-thalassemias are caused by more than 200 mutations of the β-globin gene, leading to low or absent production of adult hemoglobin. Achievements have been made with innovative therapeutic strategies for β-thalassemias, based on research conducted at the levels of gene structure, transcription, mRNA processing and protein synthesis. The objective of this review is to describe the development of therapeutic strategies employing viral and non-viral DNA-based approaches for treatment of β-thalassemia. Modification of β-globin gene expression in β-thalassemia cells has been achieved by gene therapy, correction of the mutated β-globin gene and RNA repair. In addition, cellular therapy has been proposed for β-thalassemia, including reprogramming of somatic cells to generate induced pluripotent stem cells to be genetically corrected. Based on the concept that increased production of fetal hemoglobin (HbF) is beneficial in β-thalassemia, DNA-based approaches to increase HbF production have been optimized, including treatment of target cells with lentiviral vectors carrying γ-globin genes. Finally, DNA-based targeting of α-globin gene expression has been applied to reduce the excess of α-globin production by β-thalassemia cells, one of the major causes of the clinical phenotype.

Target-based drug discovery for [Formula: see text]-globin disorders: drug target prediction using quantitative modeling with hybrid functional Petri nets.

PubMed

Mehraei, Mani; Bashirov, Rza; Tüzmen, Şükrü

2016-10-01

Recent molecular studies provide important clues into treatment of [Formula: see text]-thalassemia, sickle-cell anaemia and other [Formula: see text]-globin disorders revealing that increased production of fetal hemoglobin, that is normally suppressed in adulthood, can ameliorate the severity of these diseases. In this paper, we present a novel approach for drug prediction for [Formula: see text]-globin disorders. Our approach is centered upon quantitative modeling of interactions in human fetal-to-adult hemoglobin switch network using hybrid functional Petri nets. In accordance with the reverse pharmacology approach, we pose a hypothesis regarding modulation of specific protein targets that induce [Formula: see text]-globin and consequently fetal hemoglobin. Comparison of simulation results for the proposed strategy with the ones obtained for already existing drugs shows that our strategy is the optimal as it leads to highest level of [Formula: see text]-globin induction and thereby has potential beneficial therapeutic effects on [Formula: see text]-globin disorders. Simulation results enable verification of model coherence demonstrating that it is consistent with qPCR data available for known strategies and/or drugs.

Replication of the Chicken β-Globin Locus: Early-Firing Origins at the 5′ HS4 Insulator and the ρ- and βA-Globin Genes Show Opposite Epigenetic Modifications

PubMed Central

Prioleau, Marie-Noëlle; Gendron, Marie-Claude; Hyrien, Olivier

2003-01-01

Chromatin structure is believed to exert a strong effect on replication origin function. We have studied the replication of the chicken β-globin locus, whose chromatin structure has been extensively characterized. This locus is delimited by hypersensitive sites (HSs) that mark the position of insulator elements. A stretch of condensed chromatin and another HS separate the β-globin domain from an adjacent folate receptor (FR) gene. We demonstrate here that in erythroid cells that express the FR but not the globin genes, replication initiates at four sites within the β-globin domain, one at the 5′ HS4 insulator and the other three near the ρ- and βA-globin genes. Three origins consist of G+C-rich sequences enriched in CpG dinucleotides. The fourth origin is A+T rich. Together with previous work, these data reveal that the insulator origin has unmethylated CpGs, hyperacetylated histones H3 and H4, and lysine 4-methylated histone H3. In contrast, opposite modifications are observed at the other G+C-rich origins. We also show that the whole region, including the stretch of condensed chromatin, replicates early in S phase in these cells. Therefore, different early-firing origins within the same locus may have opposite patterns of epigenetic modifications. The role of insulator elements in DNA replication is discussed. PMID:12724412

Therapeutic fetal-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms.

PubMed

Dai, Yan; Sangerman, Jose; Luo, Hong Yuan; Fucharoen, Suthat; Chui, David H K; Faller, Douglas V; Perrine, Susan P

2016-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. Copyright © 2015 Elsevier Inc. All rights reserved.

Therapeutic γ-globin inducers reduce transcriptional repression in hemoglobinopathy erythroid progenitors through distinct mechanisms

PubMed Central

Dai, Yan; Sangerman, Jose; Hong, Yuan Luo; Fuchareon, Suthat; Chui, David H.K.; Faller, Douglas V.; Perrine, Susan P.

2015-01-01

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy. PMID:26603726

Diverse hematological phenotypes of β-thalassemia carriers.

PubMed

Luo, Hong-Yuan; Chui, David H K

2016-03-01

Most β-thalassemia carriers have mild anemia, low mean corpuscular volume and mean corpuscular hemoglobin, and elevated hemoglobin α2 (HbA2 ). However, there is considerable variability resulting from coinheritance with α- and/or δ-globin gene mutations, dominant inheritance of β-thalassemia mutations, highly unstable variant globin chains, large deletions removing part or all of the β-globin gene cluster, loss of heterozygosity of the β-globin gene cluster during development, or concomitant erythroid enzyme or membrane protein abnormalities. Recognition of the specific abnormality and correct diagnosis can allay anxiety and unnecessary investigation, help formulate treatment programs, and deliver appropriate genetic and family counseling. © 2016 New York Academy of Sciences.

The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran

PubMed Central

Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye

2017-01-01

Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378

Analysis of alpha hemoglobin stabilizing protein overexpression in murine β-thalassemia

PubMed Central

Nasimuzzaman, Md; Khandros, Eugene; Wang, Xiaomei; Kong, Yi; Zhao, Huifen; Weiss, David; Rivella, Stefano; Weiss, Mitchell J.; Persons, Derek A.

2013-01-01

Excess free α-globin is cytotoxic and contributes to the pathophysiology of β-thalassemia. Alpha hemoglobin stabilizing protein (AHSP) is a molecular chaperone that binds free α-globin to promote its folding and inhibit its ability to produce damaging reactive oxygen species. Reduced AHSP levels correlate with increased severity of β-thalassemia in some human cohorts, but causal mechanistic relationships are not established for these associations. We used transgenic and lentiviral gene transfer methods to investigate whether supraphysiologic AHSP levels could mitigate the severity of β-thalassemia intermedia by providing an increased sink for the excess pool of α-globin chains. We tested wild-type AHSP and two mutant versions with amino acid substitutions that confer 3- or 13-fold higher affinity for α-globin. Erythroid overexpression of these AHSP proteins up to 11-fold beyond endogenous levels had no major effects on hematologic parameters in β-thalassemic animals. Our results demonstrate that endogenous AHSP is not limiting for α-globin detoxification in a murine model of β-thalassemia. PMID:20815047

β-Thalassemia.

PubMed

Origa, Raffaella

2017-06-01

β-Thalassemia is caused by reduced (β + ) or absent (β 0 ) synthesis of the β-globin chains of hemoglobin. Three clinical and hematological conditions of increasing severity are recognized: the β-thalassemia carrier state, thalassemia intermedia, and thalassemia major, a severe transfusion-dependent anemia. The severity of disease expression is related mainly to the degree of α-globin chain excess, which precipitates in the red blood cell precursors, causing both mechanic and oxidative damage (ineffective erythropoiesis). Any mechanism that reduces the number of unbound α-globin chains in the red cells may ameliorate the detrimental effects of excess α-globin chains. Factors include the inheritance of mild/silent β-thalassemia mutations, the coinheritance of α-thalassemia alleles, and increased γ-globin chain production. The clinical severity of β-thalassemia syndromes is also influenced by genetic factors unlinked to globin genes as well as environmental conditions and management. Transfusions and oral iron chelation therapy have dramatically improved the quality of life for patients with thalassemia major. Previously a rapidly fatal disease in early childhood, β-thalassemia is now a chronic disease with a greater life expectancy. At present, the only definitive cure is bone marrow transplantation. Therapies undergoing investigation are modulators of erythropoiesis and stem cell gene therapy.Genet Med advance online publication 03 November 2016.

Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

PubMed

Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

2011-01-01

Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

High Fractional Occupancy of a Tandem Maf Recognition Element and Its Role in Long-Range β-Globin Gene Regulation

PubMed Central

Stees, Jared R.; Hossain, Mir A.; Sunose, Tomoki; Kudo, Yasushi; Pardo, Carolina E.; Nabilsi, Nancy H.; Darst, Russell P.; Poudyal, Rosha; Igarashi, Kazuhiko; Kladde, Michael P.

2015-01-01

Enhancers and promoters assemble protein complexes that ultimately regulate the recruitment and activity of RNA polymerases. Previous work has shown that at least some enhancers form stable protein complexes, leading to the formation of enhanceosomes. We analyzed protein-DNA interactions in the murine β-globin gene locus using the methyltransferase accessibility protocol for individual templates (MAPit). The data show that a tandem Maf recognition element (MARE) in locus control region (LCR) hypersensitive site 2 (HS2) reveals a remarkably high degree of occupancy during differentiation of mouse erythroleukemia cells. Most of the other transcription factor binding sites in LCR HS2 or in the adult β-globin gene promoter regions exhibit low fractional occupancy, suggesting highly dynamic protein-DNA interactions. Targeting of an artificial zinc finger DNA-binding domain (ZF-DBD) to the HS2 tandem MARE caused a reduction in the association of MARE-binding proteins and transcription complexes at LCR HS2 and the adult βmajor-globin gene promoter but did not affect expression of the βminor-globin gene. The data demonstrate that a stable MARE-associated footprint in LCR HS2 is important for the recruitment of transcription complexes to the adult βmajor-globin gene promoter during erythroid cell differentiation. PMID:26503787

Efficient Generation of β-Globin-Expressing Erythroid Cells Using Stromal Cell-Derived Induced Pluripotent Stem Cells from Patients with Sickle Cell Disease.

PubMed

Uchida, Naoya; Haro-Mora, Juan J; Fujita, Atsushi; Lee, Duck-Yeon; Winkler, Thomas; Hsieh, Matthew M; Tisdale, John F

2017-03-01

Human embryonic stem (ES) cells and induced pluripotent stem (iPS) cells represent an ideal source for in vitro modeling of erythropoiesis and a potential alternative source for red blood cell transfusions. However, iPS cell-derived erythroid cells predominantly produce ε- and γ-globin without β-globin production. We recently demonstrated that ES cell-derived sacs (ES sacs), known to express hemangioblast markers, allow for efficient erythroid cell generation with β-globin production. In this study, we generated several iPS cell lines derived from bone marrow stromal cells (MSCs) and peripheral blood erythroid progenitors (EPs) from sickle cell disease patients, and evaluated hematopoietic stem/progenitor cell (HSPC) generation after iPS sac induction as well as subsequent erythroid differentiation. MSC-derived iPS sacs yielded greater amounts of immature hematopoietic progenitors (VEGFR2 + GPA-), definitive HSPCs (CD34 + CD45+), and megakaryoerythroid progenitors (GPA + CD41a+), as compared to EP-derived iPS sacs. Erythroid differentiation from MSC-derived iPS sacs resulted in greater amounts of erythroid cells (GPA+) and higher β-globin (and βS-globin) expression, comparable to ES sac-derived cells. These data demonstrate that human MSC-derived iPS sacs allow for more efficient erythroid cell generation with higher β-globin production, likely due to heightened emergence of immature progenitors. Our findings should be important for iPS cell-derived erythroid cell generation. Stem Cells 2017;35:586-596. © 2016 AlphaMed Press.

Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.

PubMed

Tan, Jin Ai Mary Anne; Chin, Pui See; Wong, Yean Ching; Tan, Kim Lian; Chan, Lee Lee; George, Elizabeth

2006-10-01

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations. DNA from 173 beta-thalassaemia carriers and five beta-thalassaemia major patients from the Malay, Chinese and Indian ethnic groups were first analysed by ARMS and gap-PCR. Ninety-five per cent (174/183) of the 183 beta-globin genes studied were characterised using these two techiques. The remaining nine uncharacterised beta-globin genes (4.9%) were analysed using genomic sequencing of a 904 bp amplified PCR product consisting of the promoter region, exon 1, intervening sequence (IVS) 1, exon 2 and the 5' IVS2 regions of the beta-globin gene. The rare beta-globin mutations detected in the Chinese patients were CD27/28 (+C) and CD43 (GAG-TAG), and -88 (C-T) in an Indian patient. Beta-globin mutations at CD16 (-C), IVS1-1 (G-A), IVS2-1 (G-A), -86 (C-G) and Haemoglobin South Florida (CD1, GTG-ATG) were confirmed in the Malay patients. The seven rare beta-globin mutations and a rare haemoglobin variant confirmed in this study have been described in other populations but have not been previously described in Malaysian beta-thalassemia patients.

Genetic disruption of the KLF1 gene to overexpress the γ-globin gene using the CRISPR/Cas9 system.

PubMed

Shariati, Laleh; Khanahmad, Hossein; Salehi, Mansoor; Hejazi, Zahra; Rahimmanesh, Ilnaz; Tabatabaiefar, Mohammad Amin; Modarressi, Mohammad Hossein

2016-10-01

β-thalassemia comprises a major group of human genetic disorders involving a decrease in or an end to the normal synthesis of the β-globin chains of hemoglobin. KLF1 is a key regulatory molecule involved in the γ- to β-globin gene switching process directly inducing the expression of the β-globin gene and indirectly repressing γ-globin. The present study aimed to investigate the ability of an engineered CRISPR/Cas9 system with respect to disrupting the KLF1 gene to inhibit the γ- to β-hemoglobin switching process in K562 cells. We targeted three sites on the KLF1 gene, two of which are upstream of codon 288 in exon 2 and the other site being in exon 3. The average indel percentage in the cells transfected with CRISPR a, b and c was approximately 24%. Relative quantification was performed for the assessment of γ-globin expression. The levels of γ-globin mRNA on day 5 of differentiation were 8.1-, 7.7- and 1.8-fold in the cells treated with CRISPR/Cas9 a, b and c, respectively,compared to untreated cells. The measurement of HbF expression levels confirmed the same results. The findings obtained in the present study support the induction of an indel mutation in the KLF1 gene leading to a null allele. As a result, the effect of KLF1 on the expression of BCL11A is decreased and its inhibitory effect on γ-globin gene expression is removed. Application of CRISPR technology to induce an indel in the KLF1 gene in adult erythroid progenitors may provide a method for activating fetal hemoglobin expression in individuals with β-thalassemia or sickle cell disease. Copyright © 2016 John Wiley & Sons, Ltd.

Interaction of an α-Globin Gene Triplication with β-Globin Gene Mutations in Iranian Patients with β-Thalassemia Intermedia.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Faramarzi Garous, Negin; Ashki, Mehri; Montajabi Niat, Mona; Vakili, Shadi; Imanian, Hashem; Zeinali, Sirous; Najmabadi, Hossein; Azarkeivan, Azita

2015-01-01

The 3.7 kb triplicated α-globin gene (ααα(anti 3.7)) mutation has been found in most populations. It results from an unequal crossover between misaligned homologous segments in the α-globin gene cluster during meiosis. The pathophysiology and clinical severity of β-thalassemia (β-thal) are associated with the degree of α chain imbalance. The excess of α-globin chains plays an important role in the pathophysiology of β-thal. When heterozygous/homozygous β-thal coexists with an α gene numerical alteration, the clinical and hematological phenotype of thalassemia could change to mild anemia in case of an α deletion (-α/αα) or severe anemia in the case of an α triplication (αα/ααα). The coexistence of an ααα(anti 3.7) triplication is considered an important factor in the severity of β-thal, exacerbating the phenotypic severity of β-thal by causing more globin chain imbalance. This study shows that the ααα(anti 3.7) triplication is an important factor in the causation of β-thal intermedia (β-TI) in heterozygous β-thal. This type of phenotype modification has rarely been observed and reported in the Iranian population. Here we report the coinheritance of a triplicated α-globin gene arrangement and heterozygous/homozygous β-thal in 23 cases, presenting with a β-TI or β-thal major (β-TM) phenotype. Some of these patients were considered to have a mild β-TI phenotype as they needed no blood transfusions; some occasionally received blood transfusions in their lifetime (for example on delivery) but some are dependent on regular blood transfusions (every 20 to 40 days). Our study was focused on the importance of detecting the α-globin gene triplication in genotype/phenotype prediction in Iranian thalassemia patients.

Dexamethasone facilitates erythropoiesis in murine embryonic stem cells differentiating into hematopoietic cells in vitro

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Anand S.; Kaushal, Sharmeela; Mishra, Rangnath

2006-07-28

Differentiating embryonic stem (ES) cells are increasingly emerging as an important source of hematopoietic progenitors with a potential to be useful for both basic and clinical research applications. It has been suggested that dexamethasone facilitates differentiation of ES cells towards erythrocytes but the mechanism responsible for sequential expression of genes regulating this process are not well-understood. Therefore, we in vitro induced differentiation of murine ES cells towards erythropoiesis and studied the sequential expression of a set of genes during the process. We hypothesized that dexamethasone-activates its cognate nuclear receptors inducing up-regulation of erythropoietic genes such as GATA-1, Flk-1, Epo-R, andmore » direct ES cells towards erythropoietic differentiation. ES cells were cultured in primary hematopoietic differentiation media containing methyl-cellulose, IMDM, IL-3, IL-6, and SCF to promote embryoid body (EB) formation. Total RNA of day 3, 5, and 9-old EBs was isolated for gene expression studies using RT-PCR. Cells from day 9 EBs were subjected to secondary differentiation using three different cytokines and growth factors combinations: (1) SCF, EPO, dexamethasone, and IGF; (2) SCF, IL-3, IL-6, and TPO; and (3) SCF IL-3, IL-6, TPO, and EPO. Total RNA from day 12 of secondary differentiated ES cells was isolated to study the gene expression pattern during this process. Our results demonstrate an up-regulation of GATA-1, Flk-1, HoxB-4, Epo-R, and globin genes ({alpha}-globin, {beta}H-1 globin, {beta}-major globin, {epsilon} -globin, and {zeta}-globin) in the 9-day-old EBs, whereas, RNA from 5-day-old EBs showed expression of HoxB-4, {epsilon}-globin, {gamma}-globin, {beta}H1-globin, and Flk-1. Three-day-old EBs showed only HoxB-4 and Flk-1 gene expression and lacked expression of all globin genes. These findings indicate that erythropoiesis-specific genes are activated later in the course of differentiation. Gene expression studies on the ES cells of secondary EB origin cultured in media containing dexamethasone showed a down-regulation of GATA-3 and an up-regulation of GATA-1, Flk-1, and Epo-R in comparison to the two other cytokines and growth factor combinations containing media. The secondary differentiation also showed an enhanced production of erythrocytic precursors in dexamethasone containing media in comparison to that in the control media. Our results indicate that dexamethasone can prove to be an effective agent which can be employed to enhance differentiation towards erythrocytic progenitors from ES cells.« less

Gene Therapy in a Patient with Sickle Cell Disease.

PubMed

Ribeil, Jean-Antoine; Hacein-Bey-Abina, Salima; Payen, Emmanuel; Magnani, Alessandra; Semeraro, Michaela; Magrin, Elisa; Caccavelli, Laure; Neven, Benedicte; Bourget, Philippe; El Nemer, Wassim; Bartolucci, Pablo; Weber, Leslie; Puy, Hervé; Meritet, Jean-François; Grevent, David; Beuzard, Yves; Chrétien, Stany; Lefebvre, Thibaud; Ross, Robert W; Negre, Olivier; Veres, Gabor; Sandler, Laura; Soni, Sandeep; de Montalembert, Mariane; Blanche, Stéphane; Leboulch, Philippe; Cavazzana, Marina

2017-03-02

Sickle cell disease results from a homozygous missense mutation in the β-globin gene that causes polymerization of hemoglobin S. Gene therapy for patients with this disorder is complicated by the complex cellular abnormalities and challenges in achieving effective, persistent inhibition of polymerization of hemoglobin S. We describe our first patient treated with lentiviral vector-mediated addition of an antisickling β-globin gene into autologous hematopoietic stem cells. Adverse events were consistent with busulfan conditioning. Fifteen months after treatment, the level of therapeutic antisickling β-globin remained high (approximately 50% of β-like-globin chains) without recurrence of sickle crises and with correction of the biologic hallmarks of the disease. (Funded by Bluebird Bio and others; HGB-205 ClinicalTrials.gov number, NCT02151526 .).

Gene expression profiling of whole blood: Comparison of target preparation methods for accurate and reproducible microarray analysis

PubMed Central

Vartanian, Kristina; Slottke, Rachel; Johnstone, Timothy; Casale, Amanda; Planck, Stephen R; Choi, Dongseok; Smith, Justine R; Rosenbaum, James T; Harrington, Christina A

2009-01-01

Background Peripheral blood is an accessible and informative source of transcriptomal information for many human disease and pharmacogenomic studies. While there can be significant advantages to analyzing RNA isolated from whole blood, particularly in clinical studies, the preparation of samples for microarray analysis is complicated by the need to minimize artifacts associated with highly abundant globin RNA transcripts. The impact of globin RNA transcripts on expression profiling data can potentially be reduced by using RNA preparation and labeling methods that remove or block globin RNA during the microarray assay. We compared four different methods for preparing microarray hybridization targets from human whole blood collected in PAXGene tubes. Three of the methods utilized the Affymetrix one-cycle cDNA synthesis/in vitro transcription protocol but varied treatment of input RNA as follows: i. no treatment; ii. treatment with GLOBINclear; or iii. treatment with globin PNA oligos. In the fourth method cDNA targets were prepared with the Ovation amplification and labeling system. Results We find that microarray targets generated with labeling methods that reduce globin mRNA levels or minimize the impact of globin transcripts during hybridization detect more transcripts in the microarray assay compared with the standard Affymetrix method. Comparison of microarray results with quantitative PCR analysis of a panel of genes from the NF-kappa B pathway shows good correlation of transcript measurements produced with all four target preparation methods, although method-specific differences in overall correlation were observed. The impact of freezing blood collected in PAXGene tubes on data reproducibility was also examined. Expression profiles show little or no difference when RNA is extracted from either fresh or frozen blood samples. Conclusion RNA preparation and labeling methods designed to reduce the impact of globin mRNA transcripts can significantly improve the sensitivity of the DNA microarray expression profiling assay for whole blood samples. While blockage of globin transcripts during first strand cDNA synthesis with globin PNAs resulted in the best overall performance in this study, we conclude that selection of a protocol for expression profiling studies in blood should depend on several factors, including implementation requirements of the method and study design. RNA isolated from either freshly collected or frozen blood samples stored in PAXGene tubes can be used without altering gene expression profiles. PMID:19123946

Coexistence of multiple globin genes conferring protection against nitrosative stress to the Antarctic bacterium Pseudoalteromonas haloplanktis TAC125.

PubMed

Coppola, Daniela; Giordano, Daniela; Milazzo, Lisa; Howes, Barry D; Ascenzi, Paolo; di Prisco, Guido; Smulevich, Giulietta; Poole, Robert K; Verde, Cinzia

2018-02-28

Despite the large number of globins recently discovered in bacteria, our knowledge of their physiological functions is restricted to only a few examples. In the microbial world, globins appear to perform multiple roles in addition to the reversible binding of oxygen; all these functions are attributable to the heme pocket that dominates functional properties. Resistance to nitrosative stress and involvement in oxygen chemistry seem to be the most prevalent functions for bacterial globins, although the number of globins for which functional roles have been studied via mutation and genetic complementation is very limited. The acquisition of structural information has considerably outpaced the physiological and molecular characterisation of these proteins. The genome of the Antarctic cold-adapted bacterium Pseudoalteromonas haloplanktis TAC125 (PhTAC125) contains genes encoding three distinct single-chain 2/2 globins, supporting the hypothesis of their crucial involvement in a number of functions, including protection against oxidative and nitrosative stress in the cold and O 2 -rich environment. In the genome of PhTAC125, the genes encoding 2/2 globins are constitutively transcribed, thus suggesting that these globins are not functionally redundant in their physiological function in PhTAC125. In the present study, the physiological role of one of the 2/2 globins, Ph-2/2HbO-2217, was investigated by integrating in vivo and in vitro results. This role includes the involvement in the detoxification of reactive nitrogen and O 2 species including NO by developing two in vivo and in vitro models to highlight the protective role of Ph-2/2HbO-2217 against reactive nitrogen species. The PSHAa2217 gene was cloned and over-expressed in the flavohemoglobin-deficient mutant of Escherichia coli and the growth properties and O 2 uptake in the presence of NO of the mutant carrying the PSHAa2217 gene were analysed. The ferric form of Ph-2/2HbO-2217 is able to catalyse peroxynitrite isomerisation in vitro, indicating its potential role in the scavenging of reactive nitrogen species. Here we present in vitro evidence for the detoxification of NO by Ph-2/2HbO-2217. Copyright © 2017. Published by Elsevier Inc.

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Specific repression of β-globin promoter activity by nuclear ferritin

PubMed Central

Broyles, Robert H.; Belegu, Visar; DeWitt, Christina R.; Shah, Sandeep N.; Stewart, Charles A.; Pye, Quentin N.; Floyd, Robert A.

2001-01-01

Developmental hemoglobin switching involves sequential globin gene activations and repressions that are incompletely understood. Earlier observations, described herein, led us to hypothesize that nuclear ferritin is a repressor of the adult β-globin gene in embryonic erythroid cells. Our data show that a ferritin-family protein in K562 cell nuclear extracts binds specifically to a highly conserved CAGTGC motif in the β-globin promoter at −153 to −148 bp from the cap site, and mutation of the CAGTGC motif reduces binding 20-fold in competition gel-shift assays. Purified human ferritin that is enriched in ferritin-H chains also binds the CAGTGC promoter segment. Expression clones of ferritin-H markedly repress β-globin promoter-driven reporter gene expression in cotransfected CV-1 cells in which the β-promoter has been stimulated with the transcription activator erythroid Krüppel-like factor (EKLF). We have constructed chloramphenicol acetyltransferase reporter plasmids containing either a wild-type or mutant β-globin promoter for the −150 CAGTGC motif and have compared the constructs for susceptibility to repression by ferritin-H in cotransfection assays. We find that stimulation by cotransfected EKLF is retained with the mutant promoter, whereas repression by ferritin-H is lost. Thus, mutation of the −150 CAGTGC motif not only markedly reduces in vitro binding of nuclear ferritin but also abrogates the ability of expressed ferritin-H to repress this promoter in our cell transfection assay, providing a strong link between DNA binding and function, and strong support for our proposal that nuclear ferritin-H is a repressor of the human β-globin gene. Such a repressor could be helpful in treating sickle cell and other genetic diseases. PMID:11481480

A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition.

PubMed

Traxler, Elizabeth A; Yao, Yu; Wang, Yong-Dong; Woodard, Kaitly J; Kurita, Ryo; Nakamura, Yukio; Hughes, Jim R; Hardison, Ross C; Blobel, Gerd A; Li, Chunliang; Weiss, Mitchell J

2016-09-01

Disorders resulting from mutations in the hemoglobin subunit beta gene (HBB; which encodes β-globin), mainly sickle cell disease (SCD) and β-thalassemia, become symptomatic postnatally as fetal γ-globin expression from two paralogous genes, hemoglobin subunit gamma 1 (HBG1) and HBG2, decreases and adult β-globin expression increases, thereby shifting red blood cell (RBC) hemoglobin from the fetal (referred to as HbF or α2γ2) to adult (referred to as HbA or α2β2) form. These disorders are alleviated when postnatal expression of fetal γ-globin is maintained. For example, in hereditary persistence of fetal hemoglobin (HPFH), a benign genetic condition, mutations attenuate γ-globin-to-β-globin switching, causing high-level HbF expression throughout life. Co-inheritance of HPFH with β-thalassemia- or SCD-associated gene mutations alleviates their clinical manifestations. Here we performed CRISPR-Cas9-mediated genome editing of human blood progenitors to mutate a 13-nt sequence that is present in the promoters of the HBG1 and HBG2 genes, thereby recapitulating a naturally occurring HPFH-associated mutation. Edited progenitors produced RBCs with increased HbF levels that were sufficient to inhibit the pathological hypoxia-induced RBC morphology found in SCD. Our findings identify a potential DNA target for genome-editing-mediated therapy of β-hemoglobinopathies.

Structural polymorphism at LCR and its role in beta-globin gene regulation.

PubMed

Kukreti, Shrikant; Kaur, Harpreet; Kaushik, Mahima; Bansal, Aparna; Saxena, Sarika; Kaushik, Shikha; Kukreti, Ritushree

2010-09-01

Information on the secondary structures and conformational manifestations of eukaryotic DNA and their biological significance with reference to gene regulation and expression is limited. The human beta-globin gene Locus Control Region (LCR), a dominant regulator of globin gene expression, is a contiguous piece of DNA with five tissue-specific DNase I-hypersensitive sites (HSs). Since these HSs have a high density of transcription factor binding sites, structural interdependencies between HSs and different promoters may directly or indirectly regulate LCR functions. Mutations and SNPs may stabilize or destabilize the local secondary structures, affecting the gene expression by changes in the protein-DNA recognition patterns. Various palindromic or quasi-palindromic segments within LCR, could cause structural polymorphism and geometrical switching of DNA. This emphasizes the importance of understanding of the sequence-dependent variations of the DNA structure. Such structural motifs might act as regulatory elements. The local conformational variability of a DNA segment or action of a DNA specific protein is key to create and maintain active chromatin domains and affect transcription of various tissue specific beta-globin genes. We, summarize here the current status of beta-globin LCR structure and function. Further structural studies at molecular level and functional genomics might solve the regulatory puzzles that control the beta-globin gene locus. Copyright (c) 2010 Elsevier Masson SAS. All rights reserved.

Thalassemia

MedlinePlus

... disorder that affects the way the body makes hemoglobin. Hemoglobin is the part of red blood cells that ... alpha globin and beta globin; these proteins make hemoglobin. In thalassemia, a gene that makes these proteins ...

β-thalassemias: paradigmatic diseases for scientific discoveries and development of innovative therapies.

PubMed

Rivella, Stefano

2015-04-01

β-thalassemias are monogenic disorders characterized by defective synthesis of the β-globin chain, one of the major components of adult hemoglobin. A large number of mutations in the β-globin gene or its regulatory elements have been associated with β-thalassemias. Due to the complexity of the regulation of the β-globin gene and the role of red cells in many physiological processes, patients can manifest a large spectrum of phenotypes, and clinical requirements vary from patient to patient. It is important to consider the major differences in the light of potential novel therapeutics. This review summarizes the main discoveries and mechanisms associated with the synthesis of β-globin and abnormal erythropoiesis, as well as current and novel therapies. Copyright© Ferrata Storti Foundation.

Developmental regulation of DNA replication timing at the human beta globin locus.

PubMed

Simon, I; Tenzen, T; Mostoslavsky, R; Fibach, E; Lande, L; Milot, E; Gribnau, J; Grosveld, F; Fraser, P; Cedar, H

2001-11-01

The human beta globin locus replicates late in most cell types, but becomes early replicating in erythroid cells. Using FISH to map DNA replication timing around the endogenous beta globin locus and by applying a genetic approach in transgenic mice, we have demonstrated that both the late and early replication states are controlled by regulatory elements within the locus control region. These results also show that the pattern of replication timing is set up by mechanisms that work independently of gene transcription.

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: implications for the enzyme mechanism.

PubMed

Ogura, Hiroshi; Evans, John P; Peng, Dungeng; Satterlee, James D; Ortiz de Montellano, Paul R; La Mar, Gerd N

2009-04-14

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase 1 (hHO) has been investigated by (1)H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. Two-dimensional (1)H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts that places the lone iron pi-spin in the d(xz) orbital, rather than the d(yz) orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy, and magnetic susceptibilities argues for a low-spin, (d(xy))(2)(d(yz),d(xz))(3), ground state in both azide and cyanide complexes. The switch from singly occupied d(yz) for the cyanide to d(xz) for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide pi-plane in the latter complex, which is approximately 90 degrees in-plane rotated from that of the imidazole pi-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicates that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 --> Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed.

The orbital ground state of the azide-substrate complex of human heme oxygenase is an indicator of distal H-bonding: Implications for the enzyme mechanism‡

PubMed Central

Ogura, Hiroshi; Evans, John P.; Peng, Dungeng; Satterlee, James D.; de Montellano, Paul R. Ortiz; Mar, Gerd N. La

2009-01-01

The active site electronic structure of the azide complex of substrate-bound human heme oxygenase-1, (hHO) has been investigated by 1H NMR spectroscopy to shed light on the orbital/spin ground state as an indicator of the unique distal pocket environment of the enzyme. 2D 1H NMR assignments of the substrate and substrate-contact residue signals reveal a pattern of substrate methyl contact shifts, that places the lone iron π-spin in the dxz orbital, rather than the dyz orbital found in the cyanide complex. Comparison of iron spin relaxivity, magnetic anisotropy and magnetic susceptibilities argues for a low-spin, (dxy)2(dyz,dxz)3, ground state in both azide and cyanide complexes. The switch from singly-occupied dyz for the cyanide to dxz for the azide complex of hHO is shown to be consistent with the orbital hole determined by the azide π-plane in the latter complex, which is ∼90° in-plane rotated from that of the imidazole π-plane. The induction of the altered orbital ground state in the azide relative to the cyanide hHO complex, as well as the mean low-field bias of methyl hyperfine shifts and their paramagnetic relaxivity relative to those in globins, indicate that azide exerts a stronger ligand field in hHO than in the globins, or that the distal H-bonding to azide is weaker in hHO than in globins. The Asp140 → Ala hHO mutant that abolishes activity retains the unusual WT azide complex spin/orbital ground state. The relevance of our findings for other HO complexes and the HO mechanism is discussed. PMID:19243105

Human beta-globin gene polymorphisms characterized in DNA extracted from ancient bones 12,000 years old.

PubMed

Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M

1995-12-01

Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.

Structural characterization of hemoglobins from Monilifera and Frenulata tubeworms (Siboglinids): first discovery of giant hexagonal-bilayer hemoglobin in the former "Pogonophora" group.

PubMed

Meunier, Cédric; Andersen, Ann C; Bruneaux, Matthieu; Le Guen, Dominique; Terrier, Peran; Leize-Wagner, Emmanuelle; Zal, Franck

2010-01-01

Siboglinids are symbiotic polychete annelids having hemoglobins as essential oxygen- and sulfide-carriers for their endosymbiotic bacteria. We analyzed the structure of the hemoglobins from two species of siboglinids: the monilifera Sclerolinum contortum and the frenulata Oligobrachia webbi (i.e. haakonmosbiensis) from Norwegian cold seeps. Measured by Multi-Angle Laser Light Scattering (MALLS), Sclerolinum shows a 3190+/-50 kDa hexagonal bilayer hemoglobin (HBL-Hb) and a 461+/-46 kDa ring-Hb, just as vestimentifera, whereas Oligobrachia has a 409+/-3.7 kDa ring-Hb only. Electrospray Ionization-Mass Spectrometry (ESI-MS) showed Sclerolinum HBL-Hb composed of seven monomeric globins (15-16 kDa), three disulfide-bonded globin heterodimers and three linkers. The heterodimers always contain globin-b (15814.4+/-1.5 Da). Sclerolinum ring-Hb is composed of globins and dimers with identical masses as its HBL-Hb, but lacks linkers. Oligobrachia ring-Hb has three globin monomers (14-15 kDa) only, with no disulfide-bonded dimers. Comparison of Sclerolinum hemoglobins between Storegga and Haakon Mosby Mud Volcano, using the normalized height of deconvoluted ESI-MS peaks, shows differences in globin monomers abundances that could reflect genetic differences or differential gene expression between distinct seep populations. The discovery of HBL-Hb in Sclerolinum is a new element supporting the hypothesis of monilifera being phylogenetically more closely related to vestimentifera, than to frenulata.

Therapeutic levels of fetal hemoglobin in erythroid progeny of β-thalassemic CD34+ cells after lentiviral vector-mediated gene transfer

PubMed Central

Wilber, Andrew; Hargrove, Phillip W.; Kim, Yoon-Sang; Riberdy, Janice M.; Sankaran, Vijay G.; Papanikolaou, Eleni; Georgomanoli, Maria; Anagnou, Nicholas P.; Orkin, Stuart H.; Nienhuis, Arthur W.

2011-01-01

β-Thalassemia major results from severely reduced or absent expression of the β-chain of adult hemoglobin (α2β2;HbA). Increased levels of fetal hemoglobin (α2γ2;HbF), such as occurs with hereditary persistence of HbF, ameliorate the severity of β-thalassemia, raising the potential for genetic therapy directed at enhancing HbF. We used an in vitro model of human erythropoiesis to assay for enhanced production of HbF after gene delivery into CD34+ cells obtained from mobilized peripheral blood of normal adults or steady-state bone marrow from patients with β-thalassemia major. Lentiviral vectors encoding (1) a human γ-globin gene with or without an insulator, (2) a synthetic zinc-finger transcription factor designed to interact with the γ-globin gene promoters, or (3) a short-hairpin RNA targeting the γ-globin gene repressor, BCL11A, were tested. Erythroid progeny of normal CD34+ cells demonstrated levels of HbF up to 21% per vector copy. For β-thalassemic CD34+ cells, similar gene transfer efficiencies achieved HbF production ranging from 45% to 60%, resulting in up to a 3-fold increase in the total cellular Hb content. These observations suggest that both lentiviral-mediated γ-globin gene addition and genetic reactivation of endogenous γ-globin genes have potential to provide therapeutic HbF levels to patients with β-globin deficiency. PMID:21156846

A randomized Phase I/II Trial of HQK-1001, an oral fetal globin gene inducer, in β–thalassaemia intermedia and HbE/β–thalassaemia

PubMed Central

Fucharoen, Suthat; Inati, Adlette; Siritanaratku, Noppadol; Thein, Swee Lay; Wargin, William C.; Koussa, Suzanne; Taher, Ali; Chaneim, Nattawara; Boosalis, Michael; Berenson, Ronald; Perrine, Susan P.

2014-01-01

β–thalassemia intermedia syndromes (BTI) cause hemolytic anemia, ineffective erythropoiesis, and widespread complications. Higher fetal globin expression within genotypes reduces globin imbalance and ameliorates anemia. Sodium 2,2 dimethylbutyrate (HQK-1001), an orally bioavailable short-chain fatty acid derivative, induces γ-globin expression experimentally and is well-tolerated in normal subjects. Accordingly, a randomized, blinded, placebo-controlled, Phase I/II trial was performed in 21 adult BTI patients (14 with HbE/β0 thalassemia and 7 with β+/β0 thalassemia intermedia, to determine effective doses for fetal globin induction, safety, and tolerability. HQK-1001 or placebo were administered once daily for 8 weeks at four dose levels (10, 20, 30, or 40 mg/kg/day), and subjects were monitored for laboratory and clinical events. Pharmacokinetic profiles demonstrated a t1/2 of 10–12 hours. Adverse events with HQK-1001 treatment were not significantly different from placebo treatment. Median HbF increased with the 20 mg/kg treatment doses above baseline levels by 6.6% and 0.44 g/dL (p <0.01) in 8/9 subjects; total hemoglobin (Hgb) increased by a mean of 1.1 gm/dL in 4/9 subjects. These findings identify a safe oral therapeutic which induces fetal globin in BTI. Further investigation of HQK-1001 with longer dosing to definitively evaluate its hematologic potential appears warranted. PMID:23530969

The beta -globin locus control region (LCR) functions primarily by enhancing the transition from transcription initiation to elongation.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Bender, M A; Groudine, Mark

2003-04-15

To investigate the molecular basis of beta-globin gene activation, we analyzed factor recruitment and histone modification at the adult beta-globin gene in wild-type (WT)/locus control region knockout (DeltaLCR) heterozygous mice and in murine erythroleukemia (MEL) cells. Although histone acetylation and methylation (Lys 4) are high before and after MEL differentiation, recruitment of the erythroid-specific activator NF-E2 to the promoter and preinitiation complex (PIC) assembly occur only after differentiation. We reported previously that targeted deletion of the LCR reduces beta-globin gene expression to 1%-4% of WT without affecting promoter histone acetylation. Here, we report that NF-E2 is recruited equally efficiently to the adult beta-globin promoters of the DeltaLCR and WT alleles. Moreover, the LCR deletion reduces PIC assembly only twofold, but has a dramatic effect on Ser 5 phosphorylation of RNA polymerase II and transcriptional elongation. Our results suggest at least three distinct stages in beta-globin gene activation: (1) an LCR-independent chromatin opening stage prior to NF-E2 recruitment to the promoter and PIC assembly; (2) an intermediate stage in which NF-E2 binding (LCR-independent) and PIC assembly (partially LCR-dependent) occur; and (3) an LCR-dependent fully active stage characterized by efficient pol II elongation. Thus, in its native location the LCR functions primarily downstream of activator recruitment and PIC assembly.

HbVar: A relational database of human hemoglobin variants and thalassemia mutations at the globin gene server.

PubMed

Hardison, Ross C; Chui, David H K; Giardine, Belinda; Riemer, Cathy; Patrinos, George P; Anagnou, Nicholas; Miller, Webb; Wajcman, Henri

2002-03-01

We have constructed a relational database of hemoglobin variants and thalassemia mutations, called HbVar, which can be accessed on the web at http://globin.cse.psu.edu. Extensive information is recorded for each variant and mutation, including a description of the variant and associated pathology, hematology, electrophoretic mobility, methods of isolation, stability information, ethnic occurrence, structure studies, functional studies, and references. The initial information was derived from books by Dr. Titus Huisman and colleagues [Huisman et al., 1996, 1997, 1998]. The current database is updated regularly with the addition of new data and corrections to previous data. Queries can be formulated based on fields in the database. Tables of common categories of variants, such as all those involving the alpha1-globin gene (HBA1) or all those that result in high oxygen affinity, are maintained by automated queries on the database. Users can formulate more precise queries, such as identifying "all beta-globin variants associated with instability and found in Scottish populations." This new database should be useful for clinical diagnosis as well as in fundamental studies of hemoglobin biochemistry, globin gene regulation, and human sequence variation at these loci. Copyright 2002 Wiley-Liss, Inc.

Modulating Vascular Hemodynamics With an Alpha Globin Mimetic Peptide (HbαX).

PubMed

Keller, T C Stevenson; Butcher, Joshua T; Broseghini-Filho, Gilson Brás; Marziano, Corina; DeLalio, Leon J; Rogers, Stephen; Ning, Bo; Martin, Jennifer N; Chechova, Sylvia; Cabot, Maya; Shu, Xiahong; Best, Angela K; Good, Miranda E; Simão Padilha, Alessandra; Purdy, Michael; Yeager, Mark; Peirce, Shayn M; Hu, Song; Doctor, Allan; Barrett, Eugene; Le, Thu H; Columbus, Linda; Isakson, Brant E

2016-12-01

The ability of hemoglobin to scavenge the potent vasodilator nitric oxide (NO) in the blood has been well established as a mechanism of vascular tone homeostasis. In endothelial cells, the alpha chain of hemoglobin (hereafter, alpha globin) and endothelial NO synthase form a macromolecular complex, providing a sink for NO directly adjacent to the production source. We have developed an alpha globin mimetic peptide (named HbαX) that displaces endogenous alpha globin and increases bioavailable NO for vasodilation. Here we show that, in vivo, HbαX administration increases capillary oxygenation and blood flow in arterioles acutely and produces a sustained decrease in systolic blood pressure in normal and angiotensin II-induced hypertensive states. HbαX acts with high specificity and affinity to endothelial NO synthase, without toxicity to liver and kidney and no effect on p50 of O 2 binding in red blood cells. In human vasculature, HbαX blunts vasoconstrictive response to cumulative doses of phenylephrine, a potent constricting agent. By binding to endothelial NO synthase and displacing endogenous alpha globin, HbαX modulates important metrics of vascular function, increasing vasodilation and flow in the resistance vasculature. © 2016 American Heart Association, Inc.

Imputation of Exome Sequence Variants into Population- Based Samples and Blood-Cell-Trait-Associated Loci in African Americans: NHLBI GO Exome Sequencing Project

PubMed Central

Auer, Paul L.; Johnsen, Jill M.; Johnson, Andrew D.; Logsdon, Benjamin A.; Lange, Leslie A.; Nalls, Michael A.; Zhang, Guosheng; Franceschini, Nora; Fox, Keolu; Lange, Ethan M.; Rich, Stephen S.; O’Donnell, Christopher J.; Jackson, Rebecca D.; Wallace, Robert B.; Chen, Zhao; Graubert, Timothy A.; Wilson, James G.; Tang, Hua; Lettre, Guillaume; Reiner, Alex P.; Ganesh, Santhi K.; Li, Yun

2012-01-01

Researchers have successfully applied exome sequencing to discover causal variants in selected individuals with familial, highly penetrant disorders. We demonstrate the utility of exome sequencing followed by imputation for discovering low-frequency variants associated with complex quantitative traits. We performed exome sequencing in a reference panel of 761 African Americans and then imputed newly discovered variants into a larger sample of more than 13,000 African Americans for association testing with the blood cell traits hemoglobin, hematocrit, white blood count, and platelet count. First, we illustrate the feasibility of our approach by demonstrating genome-wide-significant associations for variants that are not covered by conventional genotyping arrays; for example, one such association is that between higher platelet count and an MPL c.117G>T (p.Lys39Asn) variant encoding a p.Lys39Asn amino acid substitution of the thrombpoietin receptor gene (p = 1.5 × 10−11). Second, we identified an association between missense variants of LCT and higher white blood count (p = 4 × 10−13). Third, we identified low-frequency coding variants that might account for allelic heterogeneity at several known blood cell-associated loci: MPL c.754T>C (p.Tyr252His) was associated with higher platelet count; CD36 c.975T>G (p.Tyr325∗) was associated with lower platelet count; and several missense variants at the α-globin gene locus were associated with lower hemoglobin. By identifying low-frequency missense variants associated with blood cell traits not previously reported by genome-wide association studies, we establish that exome sequencing followed by imputation is a powerful approach to dissecting complex, genetically heterogeneous traits in large population-based studies. PMID:23103231

Biomonitoring of carcinogenic substances: enzymatic digestion of globin for detecting alkylated amino acids

NASA Astrophysics Data System (ADS)

Bader, Michael; Rauscher, Dankwart; Geibel, Kurt; Angerer, Juergen

1993-03-01

We report the application of proteases for the total hydrolysis of globin with subsequent determination of amino acids. Optimization of the proteolysis was made with respect to enzyme concentration, time of incubation and type of protease. Ethylene oxide modified globin was used to compare the results of the analysis of the N-terminal amino acid valine after enzymatic cleavage to those obtained from the widely used modified Edman procedure. It is shown that the cleavage is of good reproducibility and yields more alkylated amino acid than the Edman procedure.

AHSP: a novel hemoglobin helper

PubMed Central

Bank, Arthur

2007-01-01

Recently, the small protein α hemoglobin–stabilizing protein (AHSP) was identified and found to specifically bind α-globin, stabilize its structure, and limit the toxic effects of excess α-globin, which are manifest in the inherited blood disorder β thalassemia. In this issue of the JCI, Yu, Weiss, and colleagues show that AHSP is also critical to the formation and stabilization of normal amounts of hemoglobin, even when α-globin is deficient, indicating unique and previously unidentified roles for this molecule (see the related article beginning on page 1856). PMID:17607349

DOE Office of Scientific and Technical Information (OSTI.GOV)

Louie, E.; Dietz, L.; Shafer, F.

A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, whichmore » would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.« less

Genetics Home Reference: sickle cell disease

MedlinePlus

... of beta-globin; this abnormality is called beta thalassemia . In people with sickle cell disease , at least ... globin. If mutations that produce hemoglobin S and beta thalassemia occur together, individuals have hemoglobin S- beta thalassemia (HbSBetaThal) ...

Three 3D graphical representations of DNA primary sequences based on the classifications of DNA bases and their applications.

PubMed

Xie, Guosen; Mo, Zhongxi

2011-01-21

In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.

Chromatin looping and eRNA transcription precede the transcriptional activation of gene in the β-globin locus

PubMed Central

Kim, Yea Woon; Lee, Sungkung; Yun, Jangmi; Kim, AeRi

2015-01-01

Enhancers are closely positioned with actively transcribed target genes by chromatin looping. Non-coding RNAs are often transcribed on active enhancers, referred to as eRNAs (enhancer RNAs). To explore the kinetics of enhancer–promoter looping and eRNA transcription during transcriptional activation, we induced the β-globin locus by chemical treatment and analysed cross-linking frequency between the β-globin gene and locus control region (LCR) and the amount of eRNAs transcribed on the LCR in a time course manner. The cross-linking frequency was increased after chemical induction but before the transcriptional activation of gene in the β-globin locus. Transcription of eRNAs was increased in concomitant with the increase in cross-linking frequency. These results show that chromatin looping and eRNA transcription precedes the transcriptional activation of gene. Concomitant occurrence of the two events suggests functional relationship between them. PMID:25588787

Gene cooption and convergent evolution of oxygen transport hemoglobins in jawed and jawless vertebrates

PubMed Central

Hoffmann, Federico G.; Opazo, Juan C.; Storz, Jay F.

2010-01-01

Natural selection often promotes evolutionary innovation by coopting preexisting genes for new functions, and this process may be greatly facilitated by gene duplication. Here we report an example of cooptive convergence where paralogous members of the globin gene superfamily independently evolved a specialized O2 transport function in the two deepest branches of the vertebrate family tree. Specifically, phylogenetic evidence demonstrates that erythroid-specific O2 transport hemoglobins evolved independently from different ancestral precursor proteins in jawed vertebrates (gnathostomes) and jawless fish (cyclostomes, represented by lamprey and hagfish). A comprehensive phylogenetic analysis of the vertebrate globin gene superfamily revealed that the erythroid hemoglobins of cyclostomes are orthologous to the cytoglobin protein of gnathostome vertebrates, a hexacoordinate globin that has no O2 transport function and that is predominantly expressed in fibroblasts and related cell types. The phylogeny reconstruction also revealed that vertebrate-specific globins are grouped into four main clades: (i) cyclostome hemoglobin + cytoglobin, (ii) myoglobin + globin E, (iii) globin Y, and (iv) the α- and β-chain hemoglobins of gnathostomes. In the hemoglobins of gnathostomes and cyclostomes, multisubunit quaternary structures provide the basis for cooperative O2 binding and allosteric regulation by coupling the effects of ligand binding at individual subunits with interactions between subunits. However, differences in numerous structural details belie their independent origins. This example of convergent evolution of protein function provides an impressive demonstration of the ability of natural selection to cobble together complex design solutions by tinkering with different variations of the same basic protein scaffold. PMID:20660759

Genetic therapy for beta-thalassemia: from the bench to the bedside.

PubMed

Arumugam, Paritha; Malik, Punam

2010-01-01

Beta-thalassemia is a genetic disorder with mutations in the β-globin gene that reduce or abolish β-globin protein production. Patients with β-thalassemia major (Cooley's anemia) become severely anemic by 6 to 18 months of age, and are transfusion dependent for life, while those with thalassemia intermedia, a less-severe form of thalassemia, are intermittently or rarely transfused. An allogeneically matched bone marrow transplant is curative, although it is restricted to those with matched donors. Gene therapy holds the promise of "fixing" one's own bone marrow cells by transferring the normal β-globin or γ-globin gene into hematopoietic stem cells (HSCs) to permanently produce normal red blood cells. Requirements for effective gene transfer for the treatment of β-thalassemia are regulated, erythroid-specific, consistent, and high-level β-globin or γ-globin expression. Gamma retroviral vectors have had great success with immune-deficiency disorders, but due to vector-associated limitations, they have limited utility in hemoglobinopathies. Lentivirus vectors, on the other hand, have now been shown in several studies to correct mouse and animal models of thalassemia. The immediate challenges of the field as it moves toward clinical trials are to optimize gene transfer and engraftment of a high proportion of genetically modified HSCs and to minimize the adverse consequences that can result from random integration of vectors into the genome by improving current vector design or developing novel vectors. This article discusses the current state of the art in gene therapy for β-thalassemia and some of the challenges it faces in human trials.

Understanding the kinetics of ligand binding to globins with molecular dynamics simulations: the necessity of multiple state models.

PubMed

Estarellas Martin, Carolina; Seira Castan, Constantí; Luque Garriga, F Javier; Bidon-Chanal Badia, Axel

2015-10-01

Residue conformational changes and internal cavity migration processes play a key role in regulating the kinetics of ligand migration and binding events in globins. Molecular dynamics simulations have demonstrated their value in the study of these processes in different haemoglobins, but derivation of kinetic data demands the use of more complex techniques like enhanced sampling molecular dynamics methods. This review discusses the different methodologies that are currently applied to study the ligand migration process in globins and highlight those specially developed to derive kinetic data. Copyright © 2015 Elsevier Ltd. All rights reserved.

Bergamot (Citrus bergamia Risso) fruit extracts as γ-globin gene expression inducers: phytochemical and functional perspectives.

PubMed

Guerrini, Alessandra; Lampronti, Ilaria; Bianchi, Nicoletta; Zuccato, Cristina; Breveglieri, Giulia; Salvatori, Francesca; Mancini, Irene; Rossi, Damiano; Potenza, Rocco; Chiavilli, Francesco; Sacchetti, Gianni; Gambari, Roberto; Borgatti, Monica

2009-05-27

Epicarps of Citrus bergamia fruits from organic farming were extracted with the objective of obtaining derived products differently rich in coumarins and psoralens. The extracts were chemically characterized by (1)H nuclear magnetic resonance (NMR), gas chromatography-flame ionization detection (GC-FID), gas chromatography-mass spectrometry (GC-MS), and high-pressure liquid chromatography (HPLC) for detecting and quantifying the main constituents. Both bergamot extracts and chemical standards corresponding to the main constituents detected were then assayed for their capacity to increase erythroid differentiation of K562 cells and expression of γ-globin genes in human erythroid precursor cells. Three experimental cell systems were employed: (a) the human leukemic K562 cell line, (b) K562 cell clones stably transfected with a pCCL construct carrying green-enhanced green fluorescence protein (EGFP) under the γ-globin gene promoter, and (c) the two-phase liquid culture of human erythroid progenitors isolated from healthy donors. The results suggest that citropten and bergapten are powerful inducers of differentiation and γ-globin gene expression in human erythroid cells. These data could have practical relevance, because pharmacologically mediated regulation of human γ-globin gene expression, with the consequent induction of fetal hemoglobin, is considered to be a potential therapeutic approach in hematological disorders, including β-thalassemia and sickle cell anemia.

Running, swimming and diving modifies neuroprotecting globins in the mammalian brain

PubMed Central

Williams, Terrie M; Zavanelli, Mary; Miller, Melissa A; Goldbeck, Robert A; Morledge, Michael; Casper, Dave; Pabst, D. Ann; McLellan, William; Cantin, Lucas P; Kliger, David S

2007-01-01

The vulnerability of the human brain to injury following just a few minutes of oxygen deprivation with submergence contrasts markedly with diving mammals, such as Weddell seals (Leptonychotes weddellii), which can remain underwater for more than 90 min while exhibiting no neurological or behavioural impairment. This response occurs despite exposure to blood oxygen levels concomitant with human unconsciousness. To determine whether such aquatic lifestyles result in unique adaptations for avoiding ischaemic–hypoxic neural damage, we measured the presence of circulating (haemoglobin) and resident (neuroglobin and cytoglobin) oxygen-carrying globins in the cerebral cortex of 16 mammalian species considered terrestrial, swimming or diving specialists. Here we report a striking difference in globin levels depending on activity lifestyle. A nearly 9.5-fold range in haemoglobin concentration (0.17–1.62 g Hb 100 g brain wet wt−1) occurred between terrestrial and deep-diving mammals; a threefold range in resident globins was evident between terrestrial and swimming specialists. Together, these two globin groups provide complementary mechanisms for facilitating oxygen transfer into neural tissues and the potential for protection against reactive oxygen and nitrogen groups. This enables marine mammals to maintain sensory and locomotor neural functions during prolonged submergence, and suggests new avenues for averting oxygen-mediated neural injury in the mammalian brain. PMID:18089537

Hemoglobin genetics: recent contributions of GWAS and gene editing

PubMed Central

Smith, Elenoe C.; Orkin, Stuart H.

2016-01-01

The β-hemoglobinopathies are inherited disorders resulting from altered coding potential or expression of the adult β-globin gene. Impaired expression of β-globin reduces adult hemoglobin (α2β2) production, the hallmark of β-thalassemia. A single-base mutation at codon 6 leads to formation of HbS (α2βS2) and sickle cell disease. While the basis of these diseases is known, therapy remains largely supportive. Bone marrow transplantation is the only curative therapy. Patients with elevated levels of fetal hemoglobin (HbF, α2γ2) as adults exhibit reduced symptoms and enhanced survival. The β-globin gene locus is a paradigm of cell- and developmental stage-specific regulation. Although the principal erythroid cell transcription factors are known, mechanisms responsible for silencing of the γ-globin gene were obscure until application of genome-wide association studies (GWAS). Here, we review findings in the field. GWAS identified BCL11A as a candidate negative regulator of γ-globin expression. Subsequent studies have established BCL11A as a quantitative repressor. GWAS-related single-nucleotide polymorphisms lie within an essential erythroid enhancer of the BCL11A gene. Disruption of a discrete region within the enhancer reduces BCL11A expression and induces HbF expression, providing the basis for gene therapy using gene editing tools. A recently identified, second silencing factor, leukemia/lymphoma-related factor/Pokemon, shares features with BCL11A, including interaction with the nucleosome remodeling deacetylase repressive complex. These findings suggest involvement of a common pathway for HbF silencing. In addition, we discuss other factors that may be involved in γ-globin gene silencing and their potential manipulation for therapeutic benefit in treating the β-hemoglobinopathies. PMID:27340226

Altitudinal Variation at Duplicated β-Globin Genes in Deer Mice: Effects of Selection, Recombination, and Gene Conversion

PubMed Central

Storz, Jay F.; Natarajan, Chandrasekhar; Cheviron, Zachary A.; Hoffmann, Federico G.; Kelly, John K.

2012-01-01

Spatially varying selection on a given polymorphism is expected to produce a localized peak in the between-population component of nucleotide diversity, and theory suggests that the chromosomal extent of elevated differentiation may be enhanced in cases where tandemly linked genes contribute to fitness variation. An intriguing example is provided by the tandemly duplicated β-globin genes of deer mice (Peromyscus maniculatus), which contribute to adaptive differentiation in blood–oxygen affinity between high- and low-altitude populations. Remarkably, the two β-globin genes segregate the same pair of functionally distinct alleles due to a history of interparalog gene conversion and alleles of the same functional type are in perfect coupling-phase linkage disequilibrium (LD). Here we report a multilocus analysis of nucleotide polymorphism and LD in highland and lowland mice with different genetic backgrounds at the β-globin genes. The analysis of haplotype structure revealed a paradoxical pattern whereby perfect LD between the two β-globin paralogs (which are separated by 16.2 kb) is maintained in spite of the fact that LD within both paralogs decays to background levels over physical distances of less than 1 kb. The survey of nucleotide polymorphism revealed that elevated levels of altitudinal differentiation at each of the β-globin genes drop away quite rapidly in the external flanking regions (upstream of the 5′ paralog and downstream of the 3′ paralog), but the level of differentiation remains unexpectedly high across the intergenic region. Observed patterns of diversity and haplotype structure are difficult to reconcile with expectations of a two-locus selection model with multiplicative fitness. PMID:22042573

Protein adducts as biomarkers of exposure to aromatic diisocyanates in workers manufacturing polyurethane (PUR) foam.

PubMed

Säkkinen, Kirsi; Tornaeus, Jarkko; Hesso, Antti; Hirvonen, Ari; Vainio, Harri; Norppa, Hannu; Rosenberg, Christina

2011-04-01

This work was undertaken to investigate the usefulness of diisocyanate-related protein adducts in blood samples as biomarkers of occupational exposure to toluene diisocyanate (TDI; 2,4- and 2,6-isomers) and 4,4'-methylenediphenyl diisocyanate (MDI). Quantification of adducts as toluene diamines (TDAs) and methylenedianiline (MDA) was performed on perfluoroacylated derivatives by gas chromatography-mass spectrometry (GC-MS/MS) in negative chemical ionisation mode. TDI-derived adducts were found in 77% of plasma and in 59% of globin samples from exposed workers manufacturing flexible polyurethane foam. The plasma levels ranged from 0.003 to 0.58 nmol mL(-1) and those in globin from 0.012 to 0.33 nmol g(-1). The 2,6-isomer amounted to about two-thirds of the sum concentration of TDA isomers. MDI-derived adducts were detected in 3.5% of plasma and in 7% of globin samples from exposed workers manufacturing rigid polyurethane foam. A good correlation was found between the sum of TDA isomers in urine and that in plasma. The relationship between globin adducts and urinary metabolites was ambiguous. Monitoring TDI-derived TDA in plasma thus appears to be an appropriate method for assessing occupational exposure. Contrary to TDI exposure, adducts in plasma or globin were not useful in assessing workers' exposure to MDI. An important outcome of the study was that no amine-related adducts were detected in globin samples from TDI- or MDI-exposed workers, alleviating concerns that TDI or MDI might pose a carcinogenic hazard. Further studies are nevertheless required to judge whether diisocyanates per se could be such a hazard.

Gamma reactivation using the spongy effect of KLF1-binding site sequence: an approach in gene therapy for beta-thalassemia

PubMed Central

Heydari, Nasrin; Shariati, Laleh; Khanahmad, Hossein; Hejazi, Zahra; Shahbazi, Mansoureh; Salehi, Mansoor

2016-01-01

Objective(s): β-thalassemia is one of the most common genetic disorders in the world. As one of the promising treatment strategies, fetal hemoglobin (Hb F) can be induced. The present study was an attempt to reactivate the γ-globin gene by introducing a gene construct containing KLF1 binding sites to the K562 cell line. Materials and Methods: A plasmid containing a 192 bp sequence with two repeats of KLF1 binding sites on β-globin and BCL11A promoters was constructed and used to transfect the K562 cell line. Positive selection was performed under treatment with 150 μg/ml hygromycin B. The remaining cells were expanded and harvested on day 28, and genomic DNA was extracted. The PCR was carried out to verify insertion of DNA fragment to the genome of K562 cells. The cells were differentiated with 15 μg/ml cisplatin. Flowcytometry was performed to identify erythroid differentiation by detection of CD235a+ cells. Real-time RT-PCR was performed to evaluate γ-globin expression in the transfected cells. Results: A 1700 bp fragment was observed on agarose gel as expected and insertion of DNA fragment to the genome of K562 cells was verified. Totally, 84% of cells were differentiated. The transfected cells significantly increased γ-globin expression after differentiation compared to untransfected ones. Conclusion: The findings demonstrate that the spongy effect of KLF1-binding site on BCL11A and β-globin promoters can induce γ-globin expression in K562 cells. This novel strategy can be promising for the treatment of β-thalassemia and sickle cell disease. PMID:27872702

Screening of (-SEA) α-thalassaemia using an immunochromatographic strip assay for the ζ-globin chain in a population with a high prevalence and heterogeneity of haemoglobinopathies.

PubMed

Jomoui, Wittaya; Fucharoen, Goonnapa; Sanchaisuriya, Kanokwan; Fucharoen, Supan

2017-01-01

The presence of the ζ-globin chain is a good marker of (-- SEA ) α 0 -thalassaemia. We evaluated an immunochromatographic (IC) strip assay for ζ-globin in screening for (-- SEA ) α 0 -thalassaemia in a population with a high prevalence and heterogeneity of haemoglobinopathies. The study was carried out on 300 screen positive blood samples of Thai individuals. The IC strip assay for the ζ-globin chain was performed on all samples. The results were interpreted with thalassaemia genotyping using standard haemoglobin and DNA analyses. Several thalassaemia genotypes were noted. Among the 300 subjects investigated, 79 had a positive IC strip assay for ζ-globin and (-- SEA ) α 0 -thalassaemia was identified in 40 of them. No (-- SEA ) α 0 -thalassaemia was detected in the remaining 39 samples with a positive IC strip test result or in the 221 samples with a negative IC strip test result. Further DNA analysis identified α + -thalassaemia in 25 of the 39 (-- SEA ) α 0 -thalassaemia negative samples. Using this IC strip assay in combination with a conventional screening protocol for (-- SEA ) α 0 -thalassaemia could provide sensitivity and specificity of 100% and 90.4%, respectively. IC strip assay for ζ-globin is simple, rapid and does not require sophisticated equipment. Use of this test in addition to the existing screening protocol could detect potential (-- SEA ) α 0 -thalassaemia leading to a significant reduction in the workload of DNA analysis. This could be used in areas where haemoglobinopathies are prevalent and heterogeneous but molecular testing is not available. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

High-Density SNP Genotyping to Define β-Globin Locus Haplotypes

PubMed Central

Liu, Li; Muralidhar, Shalini; Singh, Manisha; Sylvan, Caprice; Kalra, Inderdeep S.; Quinn, Charles T.; Onyekwere, Onyinye C.; Pace, Betty S.

2014-01-01

Five major β-globin locus haplotypes have been established in individuals with sickle cell disease (SCD) from the Benin, Bantu, Senegal, Cameroon, and Arab-Indian populations. Historically, β-haplotypes were established using restriction fragment length polymorphism (RFLP) analysis across the β-locus, which consists of five functional β-like globin genes located on chromosome 11. Previous attempts to correlate these haplotypes as robust predictors of clinical phenotypes observed in SCD have not been successful. We speculate that the coverage and distribution of the RFLP sites located proximal to or within the globin genes are not sufficiently dense to accurately reflect the complexity of this region. To test our hypothesis, we performed RFLP analysis and high-density single nucleotide polymorphism (SNP) genotyping across the β-locus using DNA samples from either healthy African Americans with normal hemoglobin A (HbAA) or individuals with homozygous SS (HbSS) disease. Using the genotyping data from 88 SNPs and Haploview analysis, we generated a greater number of haplotypes than that observed with RFLP analysis alone. Furthermore, a unique pattern of long-range linkage disequilibrium between the locus control region and the β-like globin genes was observed in the HbSS group. Interestingly, we observed multiple SNPs within the HindIII restriction site located in the Gγ-globin intervening sequence II which produced the same RFLP pattern. These findings illustrated the inability of RFLP analysis to decipher the complexity of sequence variations that impacts genomic structure in this region. Our data suggest that high density SNP mapping may be required to accurately define β-haplotypes that correlate with the different clinical phenotypes observed in SCD. PMID:18829352

Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds*

PubMed Central

Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.

2012-01-01

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

Gene duplication and the evolution of hemoglobin isoform differentiation in birds.

PubMed

Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F

2012-11-02

The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

The population genetics of the alpha-2 globin locus of orangutans (Pongo pygmaeus).

PubMed

Steiper, Michael E; Wolfe, Nathan D; Karesh, William B; Kilbourn, Annelisa M; Bosi, Edwin J; Ruvolo, Maryellen

2005-03-01

In this study, the molecular population genetics of the orangutan's alpha-2 globin (HBA2) gene were investigated in order to test for the action of natural selection. Haplotypes from 28 orangutan chromosomes were collected from a 1.46-kilobase region of the alpha-2 globin locus. While many aspects of the data were consistent with neutrality, the observed heterogeneous distribution of polymorphisms was inconsistent with neutral expectations. Furthermore, a single amino acid variant, found in both the Bornean and the Sumatran orangutan subspecies, was associated with different alternative synonymous variants in each subspecies, suggesting that the allele may have spread separately through the two subspecies after two distinct origination events. This variant is not in Hardy-Weinberg equilibrium (HWE). These observations are consistent with neutral models that incorporate population structure and models that invoke selection. The orangutan Plasmodium parasite is a plausible selective agent that may underlie the variation at alpha-2 globin in orangutans.

Hemoglobin Wayne Trait with Incidental Polycythemia.

PubMed

Ambelil, Manju; Nguyen, Nghia; Dasgupta, Amitava; Risin, Semyon; Wahed, Amer

2017-01-01

Hemoglobinopathies, caused by mutations in the globin genes, are one of the most common inherited disorders. Many of the hemoglobin variants can be identified by hemoglobin analysis using conventional electrophoresis and high performance liquid chromatography; however hemoglobin DNA analysis may be necessary in other cases for confirmation. Here, we report a case of a rare alpha chain hemoglobin variant, hemoglobin Wayne, in a 47-year-old man who presented with secondary polycythemia. Capillary zone electrophoresis and high performance liquid chromatography revealed a significant amount of a hemoglobin variant, which was further confirmed by hemoglobin DNA sequencing as hemoglobin Wayne. Since the patient was not homozygous for hemoglobin Wayne, which is associated with secondary polycythemia, the laboratory diagnosis in this case was critical in ruling out hemoglobinopathy as the etiology of his polycythemia. © 2017 by the Association of Clinical Scientists, Inc.

HPLC-ESI-MS/MS analysis of hemoglobin peptides in tryptic digests of dried-blood spot extracts detects HbS, HbC, HbD, HbE, HbO-Arab, and HbG-Philadelphia mutations.

PubMed

Haynes, Christopher A; Guerra, Stephanie L; Fontana, Jessalyn C; DeJesús, Víctor R

2013-09-23

Hemoglobinopathies are mutations resulting in abnormal globin chain structure; some have clinically significant outcomes such as anemia or reduced lifespan. Five β-globin mutations are (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), and (c.364G>A, p.E121K), resulting in HbS (sickle-cell hemoglobin), HbC, HbE, HbD-Los Angeles, and HbO-Arab, respectively. One α-globin mutation is (c.[207C>G or 207C>A], p.N68K), resulting in HbG-Philadelphia. HPLC-ESI-MS/MS analysis of dried-blood spot (DBS) punches from newborns extracted with a trypsin-containing solution provides greater than 90% coverage of α-, β-, and γ-globin amino acid sequences. Because the (c.20A>T, p.E6V), (c.19G>A, p. E6K), (c.79G>A, p.E26K), (c.364G>C, p.E121Q), (c.364G>A, p.E121K), and (c.[207C>G or 207C>A], p.N68K) mutations generate globin peptides with novel amino acid sequences, detecting one of these peptides in DBS extracts is indicative of the presence of a hemoglobinopathy in the newborn. The method described here can distinguish normal β-globin peptides from the mutant HbS, HbC, HbE, HbD-Los Angeles and HbO-Arab peptides, as well as normal α-globin peptide from the mutant HbG-Philadelphia peptide, allowing the identification of unaffected heterozygotes such as HbAS, and of compound heterozygotes such as HbASG-Philadelphia. This HPLC-ESI-MS/MS analytical approach provides information that is not available from traditional hemoglobin analyses such as isoelectric focusing and HPLC-UV. It is also capable of determining the amino acid sequence of hemoglobin peptides, potentially allowing the detection of numerous hemoglobinopathies resulting from point mutations. Published by Elsevier B.V.

Role of α-globin H helix in the building of tetrameric human hemoglobin: interaction with α-hemoglobin stabilizing protein (AHSP) and heme molecule.

PubMed

Domingues-Hamdi, Elisa; Vasseur, Corinne; Fournier, Jean-Baptiste; Marden, Michael C; Wajcman, Henri; Baudin-Creuza, Véronique

2014-01-01

Alpha-Hemoglobin Stabilizing Protein (AHSP) binds to α-hemoglobin (α-Hb) or α-globin and maintains it in a soluble state until its association with the β-Hb chain partner to form Hb tetramers. AHSP specifically recognizes the G and H helices of α-Hb. To investigate the degree of interaction of the various regions of the α-globin H helix with AHSP, this interface was studied by stepwise elimination of regions of the α-globin H helix: five truncated α-Hbs α-Hb1-138, α-Hb1-134, α-Hb1-126, α-Hb1-123, α-Hb1-117 were co-expressed with AHSP as two glutathione-S-transferase (GST) fusion proteins. SDS-PAGE and Western Blot analysis revealed that the level of expression of each truncated α-Hb was similar to that of the wild type α-Hb except the shortest protein α-Hb1-117 which displayed a decreased expression. While truncated GST-α-Hb1-138 and GST-α-Hb1-134 were normally soluble; the shorter globins GST-α-Hb1-126 and GST-α-Hb1-117 were obtained in very low quantities, and the truncated GST-α-Hb1-123 provided the least material. Absorbance and fluorescence studies of complexes showed that the truncated α-Hb1-134 and shorter forms led to modified absorption spectra together with an increased fluorescence emission. This attests that shortening the H helix leads to a lower affinity of the α-globin for the heme. Upon addition of β-Hb, the increase in fluorescence indicates the replacement of AHSP by β-Hb. The CO binding kinetics of different truncated AHSPWT/α-Hb complexes showed that these Hbs were not functionally normal in terms of the allosteric transition. The N-terminal part of the H helix is primordial for interaction with AHSP and C-terminal part for interaction with heme, both features being required for stability of α-globin chain.

Characterization of Homozygous Hb Setif (HBA2: c.283G>T) in the Iranian Population.

PubMed

Farashi, Samaneh; Garous, Negin F; Vakili, Shadi; Ashki, Mehri; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

Hemoglobin (Hb) variants are abnormalities resulting from point mutations in either of the two α-globin genes (HBA2 or HBA1) or the β-globin gene (HBB). Various reports of Hb variants have been described in Iran and other countries around the world. Hb Setif (or HBA2: c.283G>T) is one of these variants with a mutation at codon 94 of of the α2-globin gene that is characterized in clinically normal heterozygous individuals. We here report clinical and hematological findings in two homozygous cases of Iranian origin for this unstable Hb variant.

EXPERIMENTAL STUDIES IN ACUTE RENAL FAILURE

PubMed Central

Menefee, Max G.; Mueller, C. Barber; Miller, Tracy B.; Myers, Joseph K.; Bell, Allen L.

1964-01-01

When purified human globin is injected intravenously into rats it produces acute renal failure characterized by tubular casts and oliguria. The globin is identifiable within vesicles and channels in the cytoplasm of the proximal tubules, through which it passes from lumen to basal side with no apparent serious effect on the cells. When a very minimal amount of globin is taken up by cells of the distal limb of Henle's loop or distal tubules (lower nephron), a markedly deleterious effect is apparent and the cells die within a short time. The mixture of cell debris and precipitated globin forms plugs within the confines of the basement membranes of the former distal limbs and distal tubules. After a number of lower nephrons are plugged a disruption of proximal tubules is found, which apparently results from the effect of back pressure in the obstructed nephrons. We suggest that any amount in excess of a low threshold of globin, either alone or combined with heme or related material, has a toxic effect on lower nephron cells. Once initiated, the toxic effect is not reversible and the resulting plug of debris and precipitate will occlude the lumen. If a sufficient number of nephrons are made non-functional the animal becomes anuric; otherwise it is oliguric. A high rate of urine flow will protect against the excess absorption of material and thus against acute renal failure. PMID:14238931

MBD2 is a critical component of a methyl cytosine-binding protein complex isolated from primary erythroid cells

PubMed Central

Kransdorf, Evan P.; Wang, Shou Zhen; Zhu, Sheng Zu; Langston, Timothy B.; Rupon, Jeremy W.; Ginder, Gordon D.

2006-01-01

The chicken embryonic β-type globin gene, ρ, is a member of a small group of vertebrate genes whose developmentally regulated expression is mediated by DNA methylation. Previously, we have shown that a methyl cytosine-binding complex binds to the methylated ρ-globin gene in vitro. We have now chromatographically purified and characterized this complex from adult chicken primary erythroid cells. Four components of the MeCP1 transcriptional repression complex were identified: MBD2, RBAP48, HDAC2, and MTA1. These 4 proteins, as well as the zinc-finger protein p66 and the chromatin remodeling factor Mi2, were found to coelute by gel-filtration analysis and pull-down assays. We conclude that these 6 proteins are components of the MeCPC. In adult erythrocytes, significant enrichment for MBD2 is seen at the inactive ρ-globin gene by chromatin immunoprecipitation assay, whereas no enrichment is observed at the active βA-globin gene, demonstrating MBD2 binds to the methylated and transcriptionally silent ρ-globin gene in vivo. Knock-down of MBD2 resulted in up-regulation of a methylated ρ-gene construct in mouse erythroleukemic (MEL)-ρ cells. These results represent the first purification of a MeCP1-like complex from a primary cell source and provide support for a role for MBD2 in developmental gene regulation. PMID:16778143

Cooperativeness of the higher chromatin structure of the beta-globin locus revealed by the deletion mutations of DNase I hypersensitive site 3 of the LCR.

PubMed

Fang, Xiangdong; Xiang, Ping; Yin, Wenxuan; Stamatoyannopoulos, George; Li, Qiliang

2007-01-05

High-level transcription of the globin genes requires the enhancement by a distant element, the locus control region (LCR). Such long-range regulation in vivo involves spatial interaction between transcriptional elements, with intervening chromatin looping out. It has been proposed that the clustering of the HS sites of the LCR, the active globin genes, as well as the remote 5' hypersensitive sites (HSs) (HS-60/-62 in mouse, HS-110 in human) and 3'HS1 forms a specific spatial chromatin structure, termed active chromatin hub (ACH). Here we report the effects of the HS3 deletions of the LCR on the spatial chromatin structure of the beta-globin locus as revealed by the chromatin conformation capture (3C) technology. The small HS3 core deletion (0.23 kb), but not the large HS3 deletion (2.3 kb), disrupted the spatial interactions among all the HS sites of the LCR, the beta-globin gene and 3'HS1. We have previously demonstrated that the large HS3 deletion barely impairs the structure of the LCR holocomplex, while the structure is significantly disrupted by the HS3 core deletion. Taken together, these results suggest that the formation of the ACH is dependent on a largely intact LCR structure. We propose that the ACH indeed is an extension of the LCR holocomplex.

H3 K79 dimethylation marks developmental activation of the beta-globin gene but is reduced upon LCR-mediated high-level transcription.

PubMed

Sawado, Tomoyuki; Halow, Jessica; Im, Hogune; Ragoczy, Tobias; Bresnick, Emery H; Bender, M A; Groudine, Mark

2008-07-15

Genome-wide analyses of the relationship between H3 K79 dimethylation and transcription have revealed contradictory results. To clarify this relationship at a single locus, we analyzed expression and H3 K79 modification levels of wild-type (WT) and transcriptionally impaired beta-globin mutant genes during erythroid differentiation. Analysis of fractionated erythroid cells derived from WT/Delta locus control region (LCR) heterozygous mice reveals no significant H3 K79 dimethylation of the beta-globin gene on either allele prior to activation of transcription. Upon transcriptional activation, H3 K79 di-methylation is observed along both WT and DeltaLCR alleles, and both alleles are located in proximity to H3 K79 dimethylation nuclear foci. However, H3 K79 di-methylation is significantly increased along the DeltaLCR allele compared with the WT allele. In addition, analysis of a partial LCR deletion mutant reveals that H3 K79 dimethylation is inversely correlated with beta-globin gene expression levels. Thus, while our results support a link between H3 K79 dimethylation and gene expression, high levels of this mark are not essential for high level beta-globin gene transcription. We propose that H3 K79 dimethylation is destabilized on a highly transcribed template.

Leader Behavior of Head Nurses through the Perceptions of Self and Others.

DTIC Science & Technology

1984-01-01

studies ......... 17 III. Methodology .. ....... ...... ......................... 25 Population and sample ........ .*... ............ . 25 Procedures...60....*.* Implications for future rsearch ............. 62 Implications for nursing comaunity...*................. 63 *.......****.*** 75 Vi List...able to distinguish the personality traits of leaders from the personality traits of non -leaders. The traits of leaders, she contends, are communication

Correlations between oxygen affinity and sequence classifications of plant hemoglobins

USDA-ARS?s Scientific Manuscript database

Plants express three phylogenetic classes of hemoglobins (Hb) based on sequence analyses. Class 1 and 2 Hbs are full length globins with the classical 8 helix Mb-like fold, whereas Class 3 plant Hbs resemble the truncated globins found in bacteria. With the exception of the specialized leghemoglobin...

A novel mutation of the beta-globin gene promoter (-102 C>A) and pitfalls in family screening.

PubMed

Aguilar-Martinez, Patricia; Jourdan, Eric; Brun, Sophie; Cunat, Séverine; Giansily-Blaizot, Muriel; Pissard, Serge; Schved, Jean-François

2007-12-01

We describe a family with beta-thalassemia in which several pitfalls of genetic diagnoses were present. These include coherent family phenotypes with discrepancies in molecular findings because of nonpaternity, and a false beta-globin gene homozygous genotype due to a large deletion in the second locus. These findings underline the difficulties of family genetic studies and the need for tight relationship between professionals involved in laboratory studies and those in-charge of the clinical follow-up and genetic counselling. In this family, we also report a new silent beta-thalassemia mutation, -102 (C>A), in the distal CACCC box of the beta-globin gene promoter.

Pathophysiology and Clinical Manifestations of the β-Thalassemias

PubMed Central

Nienhuis, Arthur W.; Nathan, David G.

2012-01-01

The β-thalassemia syndromes reflect deficient or absent β-globin synthesis usually owing to a mutation in the β-globin locus. The relative excess of α-globin results in the formation of insoluble aggregates leading to ineffective erythropoiesis and shortened red cell survival. A relatively high capacity for fetal hemoglobin synthesis is a major genetic modifier of disease severity, with polymorphisms in other genes also having a significant role. Iron overload secondary to enhanced absorption and red cell transfusions causes an increase in liver iron and in various other tissues, leading to endocrine and cardiac dysfunction. Modern chelation regimens are effective in removing iron and preserving or restoring organ function. PMID:23209183

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations

PubMed Central

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-01-01

Background The sickle (βs) mutation in the beta-globin gene (HBB) occurs on five "classical" βs haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the βs allele – a consequence of protection from severe malarial infection afforded by heterozygotes – has been associated with a high degree of extended haplotype similarity. The relationship between classical βs haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical βs haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). Results The most common βs sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the βs mutation. Conclusion Two different classical βs haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of βs haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from β-globin. PMID:17688704

Classical sickle beta-globin haplotypes exhibit a high degree of long-range haplotype similarity in African and Afro-Caribbean populations.

PubMed

Hanchard, Neil; Elzein, Abier; Trafford, Clare; Rockett, Kirk; Pinder, Margaret; Jallow, Muminatou; Harding, Rosalind; Kwiatkowski, Dominic; McKenzie, Colin

2007-08-10

The sickle (betas) mutation in the beta-globin gene (HBB) occurs on five "classical" betas haplotype backgrounds in ethnic groups of African ancestry. Strong selection in favour of the betas allele - a consequence of protection from severe malarial infection afforded by heterozygotes - has been associated with a high degree of extended haplotype similarity. The relationship between classical betas haplotypes and long-range haplotype similarity may have both anthropological and clinical implications, but to date has not been explored. Here we evaluate the haplotype similarity of classical betas haplotypes over 400 kb in population samples from Jamaica, The Gambia, and among the Yoruba of Nigeria (Hapmap YRI). The most common betas sub-haplotype among Jamaicans and the Yoruba was the Benin haplotype, while in The Gambia the Senegal haplotype was observed most commonly. Both subtypes exhibited a high degree of long-range haplotype similarity extending across approximately 400 kb in all three populations. This long-range similarity was significantly greater than that seen for other haplotypes sampled in these populations (P < 0.001), and was independent of marker choice and marker density. Among the Yoruba, Benin haplotypes were highly conserved, with very strong linkage disequilibrium (LD) extending a megabase across the betas mutation. Two different classical betas haplotypes, sampled from different populations, exhibit comparable and extensive long-range haplotype similarity and strong LD. This LD extends across the adjacent recombination hotspot, and is discernable at distances in excess of 400 kb. Although the multi-centric geographic distribution of betas haplotypes indicates strong subdivision among early Holocene sub-Saharan populations, we find no evidence that selective pressures imposed by falciparum malaria varied in intensity or timing between these subpopulations. Our observations also suggest that cis-acting loci, which may influence outcomes in sickle cell disease, could lie considerable distances away from beta-globin.

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

α-Globin as a molecular target in the treatment of β-thalassemia

PubMed Central

Mettananda, Sachith; Gibbons, Richard J.

2015-01-01

The thalassemias, together with sickle cell anemia and its variants, are the world’s most common form of inherited anemia, and in economically undeveloped countries, they still account for tens of thousands of premature deaths every year. In developed countries, treatment of thalassemia is also still far from ideal, requiring lifelong transfusion or allogeneic bone marrow transplantation. Clinical and molecular genetic studies over the course of the last 50 years have demonstrated how coinheritance of modifier genes, which alter the balance of α-like and β-like globin gene expression, may transform severe, transfusion-dependent thalassemia into relatively mild forms of anemia. Most attention has been paid to pathways that increase γ-globin expression, and hence the production of fetal hemoglobin. Here we review the evidence that reduction of α-globin expression may provide an equally plausible approach to ameliorating clinically severe forms of β-thalassemia, and in particular, the very common subgroup of patients with hemoglobin E β-thalassemia that makes up approximately half of all patients born each year with severe β-thalassemia. PMID:25869286

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Popp, D.M.; Johnson, F.M.

Mice homozygous for a spontaneous mutation, in which the ..beta..-major globin gene is deleted, have clinical symptoms of ..beta..-thalassemia. These mice have a hypocellular, hypochromic, microcytic anemia that becomes more severe with increasing age. The defective red cell morphology, decreased osmotic fragility of erythrocytes and shortened red cell life span found in ..beta..-thalassemic mice are similar to those observed in human ..beta..-thalassemia. Synthesis of ..beta..-globin is depressed but not as much as might be expected because the expression of the..beta..-minor globin gene is enhanced to encode two to three times more globin than in normal mice. Splenomegaly, an enlarged poolmore » of stem cells for erythropoiesis, and iron overloading occur in older mice. The fact that these mice remain moderately healthy makes them a very suitable animal model in which to develop and test alternative techniques of gene therapy that could be successfully applied to the treatment of human thalassemia. Homozygous ..beta..-thalassemic mice have large deposits of iron in their tissues, which might make these mice also useful for in vivo tests of the effectiveness and possible long-term side effects for newly developed iron chelators.« less

The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

PubMed

Case, S S; Huber, P; Lloyd, J A

1999-11-01

A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

LDB1-mediated enhancer looping can be established independent of mediator and cohesin.

PubMed

Krivega, Ivan; Dean, Ann

2017-08-21

Mechanistic studies in erythroid cells indicate that LDB1, as part of a GATA1/TAL1/LMO2 complex, brings erythroid-expressed genes into proximity with enhancers for transcription activation. The role of co-activators in establishing this long-range interaction is poorly understood. Here we tested the contributions of the RNA Pol II pre-initiation complex (PIC), mediator and cohesin to establishment of locus control region (LCR)/β-globin proximity. CRISPR/Cas9 editing of the β-globin promoter to eliminate the RNA Pol II PIC by deleting the TATA-box resulted in loss of transcription, but enhancer-promoter interaction was unaffected. Additional deletion of the promoter GATA1 site eliminated LDB1 complex and mediator occupancy and resulted in loss of LCR/β-globin proximity. To separate the roles of LDB1 and mediator in LCR looping, we expressed a looping-competent but transcription-activation deficient form of LDB1 in LDB1 knock down cells: LCR/β-globin proximity was restored without mediator core occupancy. Further, Cas9-directed tethering of mutant LDB1 to the β-globin promoter forced LCR loop formation in the absence of mediator or cohesin occupancy. Moreover, ENCODE data and our chromatin immunoprecipitation results indicate that cohesin is almost completely absent from validated and predicted LDB1-regulated erythroid enhancer-gene pairs. Thus, lineage specific factors largely mediate enhancer-promoter looping in erythroid cells independent of mediator and cohesin. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Real-time PCR assays using internal controls for quantitation of HPV-16 and beta-globin DNA in cervicovaginal lavages.

PubMed

Lefevre, Jonas; Hankins, Catherine; Pourreaux, Karina; Voyer, Hélène; Coutlée, François

2003-12-01

High-risk human papillomavirus 16 (HPV-16) DNA viral load has been measured with real-time PCR assays by amplifying HPV-16 and a human gene. However, these assays have not used internal controls (ICs) to screen for the presence of inhibitors contained in samples. To quantitate HPV-16 DNA and cell content with real-time PCR, ICs for HPV-16 DNA and beta-globin were synthesised and used to control for inhibition. The assays were sensitive and linear over 5 logs. Good reproducibility was achieved with inter-run coefficients of variation of 23% (10(2) HPV-16 copies), 12% (10(4) HPV-16 copies), 17% (274 beta-globin DNA copies) and 7% (27,400 beta-globin DNA copies). Samples containing 56,800,000, 306,000, 18,000, and 4,070 HPV-16 copies/microg of cellular DNA were tested blindly and estimated to contain 48,800,000, 479,000, 20,300, and 6,620 HPV-16 copies/microg of DNA (mean ratio of measured to expected viral load of 1.27+/-0.32). Inhibition of amplification of HPV-16 and beta-globin ICs by six samples known to contain PCR inhibitors was variable: four inhibited both ICs while two inhibited only the HPV-16 IC. The use of internal controls with real-time PCR for HPV-16 quantitation allows to screen for the presence of inhibitors that do not affect equally primer-driven genomic amplification.

Monomethylfumarate Induces γ-Globin Expression and Fetal Hemoglobin Production in Cultured Human Retinal Pigment Epithelial (RPE) and Erythroid Cells, and in Intact Retina

PubMed Central

Promsote, Wanwisa; Makala, Levi; Li, Biaoru; Smith, Sylvia B.; Singh, Nagendra; Ganapathy, Vadivel; Pace, Betty S.; Martin, Pamela M.

2014-01-01

Purpose. Sickle retinopathy (SR) is a major cause of vision loss in sickle cell disease (SCD). There are no strategies to prevent SR and treatments are extremely limited. The present study evaluated (1) the retinal pigment epithelial (RPE) cell as a hemoglobin producer and novel cellular target for fetal hemoglobin (HbF) induction, and (2) monomethylfumarate (MMF) as an HbF-inducing therapy and abrogator of oxidative stress and inflammation in SCD retina. Methods. Human globin gene expression was evaluated by RT–quantitative (q)PCR in the human RPE cell line ARPE-19 and in primary RPE cells isolated from Townes humanized SCD mice. γ-Globin promoter activity was monitored in KU812 stable dual luciferase reporter expressing cells treated with 0 to 1000 μM dimethylfumarate, MMF, or hydroxyurea (HU; positive control) by dual luciferase assay. Reverse transcriptase–qPCR, fluorescence-activated cell sorting (FACS), immunofluorescence, and Western blot techniques were used to evaluate γ-globin expression and HbF production in primary human erythroid progenitors, ARPE-19, and normal hemoglobin producing (HbAA) and homozygous βs mutation (HbSS) RPE that were treated similarly, and in MMF-injected (1000 μM) HbAA and HbSS retinas. Dihydroethidium labeling and nuclear factor (erythroid-derived 2)-like 2 (Nrf2), IL-1β, and VEGF expression were also analyzed. Results. Retinal pigment epithelial cells express globin genes and synthesize adult and fetal hemoglobin MMF stimulated γ-globin expression and HbF production in cultured RPE and erythroid cells, and in HbSS mouse retina where it also reduced oxidative stress and inflammation. Conclusions. The production of hemoglobin by RPE suggests the potential involvement of this cell type in the etiology of SR. Monomethylfumarate influences multiple parameters consistent with improved retinal health in SCD and may therefore be of therapeutic potential in SR treatment. PMID:24825111

Molecular evolution of globin genes in Gymnotiform electric fishes: relation to hypoxia tolerance.

PubMed

Tian, Ran; Losilla, Mauricio; Lu, Ying; Yang, Guang; Zakon, Harold

2017-02-13

Nocturnally active gymnotiform weakly electric fish generate electric signals for communication and navigation, which can be energetically taxing. These fish mainly inhabit the Amazon basin, where some species prefer well-oxygenated waters and others live in oxygen-poor, stagnant habitats. The latter species show morphological, physiological, and behavioral adaptations for hypoxia-tolerance. However, there have been no studies of hypoxia tolerance on the molecular level. Globins are classic respiratory proteins. They function principally in oxygen-binding and -delivery in various tissues and organs. Here, we investigate the molecular evolution of alpha and beta hemoglobins, myoglobin, and neuroglobin in 12 gymnotiforms compared with other teleost fish. The present study identified positively selected sites (PSS) on hemoglobin (Hb) and myoglobin (Mb) genes using different maximum likelihood (ML) methods; some PSS fall in structurally important protein regions. This evidence for the positive selection of globin genes suggests that the adaptive evolution of these genes has helped to enhance the capacity for oxygen storage and transport. Interestingly, a substitution of a Cys at a key site in the obligate air-breathing electric eel (Electrophorus electricus) is predicted to enhance oxygen storage of Mb and contribute to NO delivery during hypoxia. A parallel Cys substitution was also noted in an air-breathing African electric fish (Gymnarchus niloticus). Moreover, the expected pattern under normoxic conditions of high expression of myoglobin in heart and neuroglobin in the brain in two hypoxia-tolerant species suggests that the main effect of selection on these globin genes is on their sequence rather than their basal expression patterns. Results indicate a clear signature of positive selection in the globin genes of most hypoxia-tolerant gymnotiform fishes, which are obligate or facultative air breathers. These findings highlight the critical role of globin genes in hypoxia tolerance evolution of Gymnotiform electric fishes.

Coordination and redox state-dependent structural changes of the heme-based oxygen sensor AfGcHK associated with intraprotein signal transduction.

PubMed

Stranava, Martin; Man, Petr; Skálová, Tereza; Kolenko, Petr; Blaha, Jan; Fojtikova, Veronika; Martínek, Václav; Dohnálek, Jan; Lengalova, Alzbeta; Rosůlek, Michal; Shimizu, Toru; Martínková, Markéta

2017-12-22

The heme-based oxygen sensor histidine kinase Af GcHK is part of a two-component signal transduction system in bacteria. O 2 binding to the Fe(II) heme complex of its N-terminal globin domain strongly stimulates autophosphorylation at His 183 in its C-terminal kinase domain. The 6-coordinate heme Fe(III)-OH - and -CN - complexes of Af GcHK are also active, but the 5-coordinate heme Fe(II) complex and the heme-free apo-form are inactive. Here, we determined the crystal structures of the isolated dimeric globin domains of the active Fe(III)-CN - and inactive 5-coordinate Fe(II) forms, revealing striking structural differences on the heme-proximal side of the globin domain. Using hydrogen/deuterium exchange coupled with mass spectrometry to characterize the conformations of the active and inactive forms of full-length Af GcHK in solution, we investigated the intramolecular signal transduction mechanisms. Major differences between the active and inactive forms were observed on the heme-proximal side (helix H5), at the dimerization interface (helices H6 and H7 and loop L7) of the globin domain and in the ATP-binding site (helices H9 and H11) of the kinase domain. Moreover, separation of the sensor and kinase domains, which deactivates catalysis, increased the solvent exposure of the globin domain-dimerization interface (helix H6) as well as the flexibility and solvent exposure of helix H11. Together, these results suggest that structural changes at the heme-proximal side, the globin domain-dimerization interface, and the ATP-binding site are important in the signal transduction mechanism of Af GcHK. We conclude that Af GcHK functions as an ensemble of molecules sampling at least two conformational states. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

A novel tandem mass spectrometry method for first-line screening of mainly beta-thalassemia from dried blood spots.

PubMed

Yu, Chaowen; Huang, Shuodan; Wang, Ming; Zhang, Juan; Liu, Hao; Yuan, Zhaojian; Wang, Xingbin; He, Xiaoyan; Wang, Jie; Zou, Lin

2017-02-10

Traditional methods for thalassemia screening are time-consuming and easily affected by cell hemolysis or hemoglobin degradation in stored blood samples. Tandem mass spectrometry (MS/MS) proved to be an effective technology for sickle cell disorders (SCD) screening. Here, we developed a novel MS/MS method for β-thalassemia screening from dried blood spots (DBS). Stable isotopic-labeled peptides were used as internal standards for quantification and calculation of the α:β-globin ratios. We used the α:β-globin ratio cutoffs to differentiate between normal individuals and patients with thalassemia. About 781 patients and 300 normal individuals were analyzed. The α:β-globin ratios showed significant difference between normal and β-thalassemia patients (P<0.01), particularly when the disease was homozygous or double heterozygous with another α- or β-thalassemia mutation. In the parallel study, all cases screened for suspected thalassemia from six hundred DBS samples by using this MS/MS method were successfully confirmed by genotyping. The intra-assay and inter-assay CVs of the ratios ranged from 2.4% to 3.9% and 4.7% to 7.1%, and there was no significant sample carryover or matrix effect for this MS/MS method. Combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Traditional methods for thalassemia screening were depending on the structural integrity of tetramers and could be affected by hemolysis and degradation of whole blood samples, especially when stored. We used proteospecific peptides produced by the tryptic digestion of each globin to evaluate the production ratio between α- and β-globin chains, which turned out to be quite stable even when stored for more than two months. Though most of the peptides were specific to α-globin or β-globin, we only chose four most informative peptides and its stable isotopic-labeled peptides as internal standards for analysis, which could obtain a high accuracy. Currently, we are the first to address the application of MS/MS for thalassemia screening, when combined with SCD screening, this MS/MS method could be used as a first-line screening assay for both structural and expression abnormalities of human hemoglobin. Copyright © 2016. Published by Elsevier B.V.

Hemolysis area: A new parameter of erythrocyte osmotic fragility for screening of thalassemia trait

PubMed Central

Tatu, Thanusak; Sweatman, Denis

2018-01-01

BACKGROUND: One-tube osmotic fragility test (OFT) is widely used for screening thalassemia traits. Interobserver variation may occur with 0.36% NaCl-based OFT due to the naked eye result reading style. PURPOSE: The purpose of this study was to establish and evaluate the novel numerical OFT-based parameter, so-called hemolysis area (HA), in screening thalassemia traits. MATERIALS AND METHODS: The portable spectrophotometer was invented capable of calculating the HA values. The HA values were then compared among 69, 156, and 19 blood samples having positive, negative, and suspicious 0.36% NaCl-based OFT results, respectively; 109 and 135 blood samples having mean corpuscular volume (MCV) ≤80 fL and >80 fL, respectively; and 138 and 106 blood samples having mean corpuscular hemoglobin (MCH) ≤27 pg and >27 pg, respectively. In addition, the HA values were compared in 166 blood samples having different globin gene genotypes. Finally, the HA cutoff value was determined by receiver operation curve (ROC) analysis. RESULTS: The HA values in samples having positive, suspicious, and negative 0.36% NaCl-based OFT were 33.3 ± 14.4, 42.9 ± 10.5, and 65.3 ± 13.4, respectively; in sample having MCV ≤80 fL and >80 fL were 43.1 ± 19.6 and 63.8 ± 14.5, respectively; and in samples having MCH ≤27 pg and >27 pg were 46.7 ± 20.1 and 64.8 ± 14.2, respectively. The HA values in normal, hemoglobin E, SEA-α thalassemia 1, and β-thalassemia traits were 67.1 ± 12.6, 36.4 ± 13.9, 20.2 ± 4.8, and 18.6 ± 1.1, respectively. All were significantly different. ROC analysis established 52.4 as the HA cutoff that had comparable effectiveness to the conventional screening tests. CONCLUSION: The new HA value was effective and could be an alternative choice for screening thalassemia traits. PMID:29692590

Coexistence of Southeast Asian ovalocytosis and beta-thalassemia: a molecular and hematological analysis.

PubMed

Fucharoen, Goonnapa; Fucharoen, Supan; Singsanan, Sanita; Sanchaisuriya, Kanokwan

2007-05-01

We describe hematological and molecular characterization of a Thai female who had Southeast Asian ovalocytosis (SAO) associated with beta+-thalassemia trait. The proband had mild microcytosis with Hb 12.9 g/dl, Hct 35.8%, MCV 74.4 fl, MCH 26.8 pg, MCHC 36.0 g/dl, and elevated Hb A2 (5.6%), characteristics of beta-thalassemia trait. Peripheral blood film examination revealed prominent ovalocytosis. However, a one-tube osmotic fragility (OF) test commonly used for thalassemia screening was negative and a normal OF curve was observed. Further polymerase chain reaction (PCR) analyses identified the beta(-28A-G) mutation in the beta-globin gene and a 27 bp deletion in erythrocyte band 3 protein gene, indicating a genetically compound heterozygote. Hematological data of the proband was comparatively presented with those of eight female and 15 male carriers of pure beta-thalassemia with the same mutation. The finding demonstrates that although the association of the SAO and beta-thalassemia does not produce a more severe clinical picture, this could lead to a mis-screening of beta-thalassemia using an OF test as a primary screening test. Additional blood film examination followed by PCR could help in the detection of this unusual genetic interaction in the region. (c) 2006 Wiley-Liss, Inc.

Significant prevalence of sickle cell disease in Southwest Germany: results from a birth cohort study indicate the necessity for newborn screening.

PubMed

Kunz, Joachim B; Awad, Saida; Happich, Margit; Muckenthaler, Lena; Lindner, Martin; Gramer, Gwendolyn; Okun, Jürgen G; Hoffmann, Georg F; Bruckner, Thomas; Muckenthaler, Martina U; Kulozik, Andreas E

2016-02-01

Children with sickle cell disease (SCD) benefit from newborn screening, because life-threatening complications can be prevented by pre-symptomatic diagnosis. In Germany, the immigration of people from endemic countries is steadily growing. Comprehensive data about the epidemiology and prevalence of SCD in Germany are however lacking, and SCD is not included in the national newborn screening program. We provide data on the prevalence of SCD in a population from both urban and rural areas in Southwest Germany. Anonymized dried blood spots from 37,838 unselected newborns were analyzed by allele-specific PCR for the HbS mutation. Samples tested positive were subjected to Sanger sequencing of the entire β-globin coding sequence firstly to validate the screening and secondly to identify compound heterozygous SCD patients with other mutations of the β-globin gene. We identified 83 carriers of the sickle cell trait, three compound heterozygous SCD patients (two with sickle cell-β-thalassemia, one with sickle cell-Hb Tianshui) but no homozygous SCD patients. The novel molecular method and strategy for newborn screening for SCD presented here compares favorably in terms of sensitivity (1.0 for homozygous HbS, 0.996 for heterozygous HbS), specificity (0.996), practicability, and costs with conventional biochemical screening. Our results demonstrate a significant prevalence of SCD of approximately 1:12,000 in an unselected urban and rural population in Southwest Germany. Together with previously published even higher results from exclusively urban populations in Berlin and Hamburg, our data provide the basis for the decision on a newborn screening program for SCD in Germany.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngo, K.Y.; Liu, D.; Lee, J.

During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

PubMed

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Investigating alpha-globin structural variants: a retrospective review of 135,000 Brazilian individuals

PubMed Central

Kimura, Elza Miyuki; Oliveira, Denise Madureira; Jorge, Susan Elisabeth; Ribeiro, Daniela Maria; Zaccariotto, Tânia Regina; Santos, Magnun Nueldo Nunes; Almeida, Vanessa; Albuquerque, Dulcinéia Martins; Costa, Fernando Ferreira; Sonati, Maria de Fátima

2015-01-01

Background Brazil has a multiethnic population with a high diversity of hemoglobinopathies. While screenings for beta-globin mutations are far more common, alterations affecting alpha-globin genes are usually more silent and less well known. The aim of this study was to describe the results of a screening program for alpha-globin gene mutations in a representative sample of the Southeastern Brazilian population. Methods A total of 135,000 individuals, including patients with clinical suspicion of hemoglobinopathies and their family members, randomly chosen individuals submitted to blood tests and blood donors who were abnormal hemoglobin carriers were analyzed. The variants were screened by alkaline and acid electrophoreses, isoelectric focusing and cation-exchange high performance liquid chromatography (HPLC) and the abnormal chains were investigated by reverse-phase high performance liquid chromatography (RP-HPLC). Mutations were identified by molecular analyses, and the oxygen affinity, heme–heme cooperativity and Bohr effect of the variants were evaluated by functional tests. Results Four new and 22 rare variants were detected in 98 families. Some of these variants were found in co-inheritance with other hemoglobinopathies. Of the rare hemoglobins, Hasharon, Stanleyville II and J-Rovigo were the most common, the first two being S-like and associated with alpha-thalassemia. Conclusion The variability of alpha-globin alterations reflects the high degree of racial miscegenation and an intense internal migratory flow between different Brazilian regions. This diversity highlights the importance of programs for diagnosing hemoglobinopathies and preventing combinations that may lead to important clinical manifestations in multiethnic populations. PMID:25818820

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popp, R.A.; Marsh, C.L.; Skow, L.C.

Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous ..cap alpha..-thalassemic embryos, expression of EI (x/sub 2/y/sub 2/) and EII (..cap alpha../sub 2/y/sub 2/) is deficient because the x- and ..cap alpha..-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- andmore » ..cap alpha..-globin genes indicates that these genes must be closely linked. Reduced x- and ..cap alpha..-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y/sub 4/ hemoglobin also appears in ..beta..-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and ..beta..-globin genes. In double heterozygotes, which have a single functional allele of x- and ..cap alpha..-globin genes and three functional alleles of y- and ..beta..-globin genes, synthesis of ..cap alpha.. and non-..cap alpha.. chains is severely imbalanced and half of the total hemoglobin is y/sub 4/. Mouse y/sub 4/ has a high affinity for oxygen, P/sub 50/ of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues.« less

Haemoglobin Fontainebleau (HBA2: c. 64G>C) in Oman: molecular and haematological characteristics and interaction with various haemoglobinopathies.

PubMed

Daar, Shahina; Al Zadjali, Shoaib; Alkindi, Salam; Wali, Yasser; Al-Rawas, Abdulhakeem; Al-Haddabi, Humood; Al-Riyami, Arwa Z

2018-04-01

To describe the laboratory features of haemoglobin Fontainebleau (Hb FB) and its interactions with various α and β globin gene mutations in the Omani population. Over a period of 10 years, a total of 94 blood samples were suspected to have an α variant on HPLC at the Sultan Qaboos University Hospital, Muscat, Oman. Molecular testing was performed using PCR based techniques to define the variant and to analyse other interacting mutations in either α or β globin genes. Of 94 subjects, molecular analysis confirmed the Hb FB variant in 55 samples (38 non-cord and 17 cord blood). A total of 36/38 non-cord samples were heterozygous for the variant, while all 17 cord blood samples were heterozygotes. A total of 43/55 individuals had a concomitant α and/or β globin gene mutation. Hb FB is the the most common α variant in the Omani population. We report the different HPLC profiles of this variant that we observed, with and without other haemoglobinopathies in non-cord and cord blood samples. This is the first report describing the HPLC profiles of this α globin chain variant on 1 year follow-up testing of cord blood samples. With careful analysis by HPLC, it is possible not only to identify Hb FB but also to predict any concomitant α and/or β globin gene mutations. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Translational recognition of the 5'-terminal 7-methylguanosine of globin messenger RNA as a function of ionic strength.

PubMed

Chu, L Y; Rhoads, R E

1978-06-13

The translation of rabbit globin mRNA in cell-free systems derived from either wheat germ or rabbit reticulocyte was studied in the presence of various analogues of the methylated 5' terminus (cap) as a function of ionic strength. Inhibition by these analogues was strongly enhanced by increasing concentrations of KCl, K(OAc), Na(OAc), or NH4(OAc). At appropriate concentrations of K(OAc), both cell-free systems were equally sensitive to inhibition by m7GTP. At 50 mM K(OAc), the reticulocyte system was not sensitive to m7GMP or m7GTP, but at higher concentrations up to 200 mM K(OAc), both nucleotides caused strong inhibition. The compound in m7G5'ppp5'Am was inhibitory at all concentrations of K(OAc) ranging from 50 to 200 mM, although more strongly so at the higher concentrations. Over the same range of nucleotide concentrations, the compounds GMP, GTP, and G5'ppp5'Am were not inhibitors. The mobility on sodium dodecyl sulfate-polyacrylamide electrophoresis of the translation product was that of globin at all K(OAc) concentrations in the presence of m7GTP. Globin mRNA from which the terminal m7GTP group had been removed by chemical treatment (periodate-cyclohexylamine-alkaline phosphatase) or enzymatic treatment (tobacco acid pyrophosphatase-alkaline phosphatase) was translated less efficiently than untreated globin mRNA at higher K(OAc) concentrations, but retained appreciable activity at low K(OAc) concentrations.

Hb L'Aquila [beta106(G8)Leu-->Val, CTG-->GTG]: a novel thalassemic hemoglobin variant.

PubMed

Amato, Antonio; Cappabianca, Maria Pia; Ponzini, Donatella; Rinaldi, Silvana; Biagio, Paola Di; Foglietta, Enrica; Grisanti, Paola; Mastropietro, Fabrizio

2007-01-01

A new beta-globin variant at codon 106 (CTG-->GTG), and which we named Hb L'Aquila [beta106(G8)Leu-->Val], was detected by DNA analysis. The proband and her father presented with the features of a mild beta(+)-thalassemia (thal), confirmed by their alpha/beta-globin chain biosynthesis ratios.

Evaluation of microbial globin promoters for oxygen-limited processes using Escherichia coli.

PubMed

Lara, Alvaro R; Jaén, Karim E; Sigala, Juan-Carlos; Regestein, Lars; Büchs, Jochen

2017-01-01

Oxygen-responsive promoters can be useful for synthetic biology applications, however, information on their characteristics is still limited. Here, we characterized a group of heterologous microaerobic globin promoters in Escherichia coli . Globin promoters from Bacillus subtilis , Campylobacter jejuni , Deinococcus radiodurans , Streptomyces coelicolor , Salmonella typhi and Vitreoscilla stercoraria were used to express the FMN-binding fluorescent protein (FbFP), which is a non-oxygen dependent marker. FbFP fluorescence was monitored online in cultures at maximum oxygen transfer capacities (OTR max ) of 7 and 11 mmol L -1  h -1 . Different FbFP fluorescence intensities were observed and the OTR max affected the induction level and specific fluorescence emission rate (the product of the specific fluorescence intensity multiplied by the specific growth rate) of all promoters. The promoter from S. typhi displayed the highest fluorescence emission yields (the quotient of the fluorescence intensity divided by the scattered light intensity at every time-point) and rate, and together with the promoters from D. radiodurans and S. coelicolor , the highest induction ratios. These results show the potential of diverse heterologous globin promoters for oxygen-limited processes using E. coli .

Two new γ chain variants: Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

PubMed

Kutlar, Ferdane; Ameri, Afshin; Patel, Niren H; Zhuang, Lina; Johnson, Lee E; Cheng, Michael L; Kutlar, Abdullah

2014-01-01

The total number of hemoglobin (Hb) variants so far reported to the HbVar database is 1598 (April 9 2014) and 130 of them are fetal Hb variants. Fetal Hb are categorized as two different subunits, (G)γ- and (A)γ-globin chains, and γ chain variants can be observed in both subunits. There are 72 (G)γ- and 58 (A)γ-globin chain variants. Most of them are clinically silent and detected during newborn screening programs in the USA and outside the USA. In this report, we discuss the molecular characteristics and diagnostic difficulties of two new γ-globin chain variants found in an African American baby with no clinical symptoms. One is a new (G)γ-globin chain variant, Hb F-Augusta GA [(G)γ59(E3)Lys → Arg; HBG2: c.179A > G] and the other one is Hb F-Port Royal-II [(A)γ125(H3)Glu → Ala; HBG1: c.377A > C].

The higher structure of chromatin in the LCR of the beta-globin locus changes during development.

PubMed

Fang, Xiangdong; Yin, Wenxuan; Xiang, Ping; Han, Hemei; Stamatoyannopoulos, George; Li, Qiliang

2009-11-27

The beta-globin locus control region (LCR) is able to enhance the expression of all globin genes throughout the course of development. However, the chromatin structure of the LCR at the different developmental stages is not well defined. We report DNase I and micrococcal nuclease hypersensitivity, chromatin immunoprecipitation analyses for histones H2A, H2B, H3, and H4, and 3C (chromatin conformation capture) assays of the normal and mutant beta-globin loci, which demonstrate that nucleosomes at the DNase I hypersensitive sites of the LCR could be either depleted or retained depending on the stages of development. Furthermore, MNase sensitivity and 3C assays suggest that the LCR chromatin is more open in embryonic erythroblasts than in definitive erythroblasts at the primary- and secondary-structure levels; however, the LCR chromatin is packaged more tightly in embryonic erythroblasts than in definitive erythroblasts at the tertiary chromatin level. Our study provides the first evidence that the occupancy of nucleosomes at a DNase I hypersensitive site is a developmental stage-related event and that embryonic and adult cells possess distinct chromatin structures of the LCR.

Sequence change in the HS2-LCR and Ggamma-globin gene promoter region of sickle cell anemia patients.

PubMed

Adorno, E V; Moura-Neto, J P; Lyra, I; Zanette, A; Santos, L F O; Seixas, M O; Reis, M G; Goncalves, M S

2008-02-01

The fetal hemoglobin (HbF) levels and betaS-globin gene haplotypes of 125 sickle cell anemia patients from Brazil were investigated. We sequenced the Ggamma- and Agamma-globin gene promoters and the DNase I-2 hypersensitive sites in the locus control regions (HS2-LCR) of patients with HbF level disparities as compared to their betaS haplotypes. Sixty-four (51.2%) patients had CAR/Ben genotype; 36 (28.8%) Ben/Ben; 18 (14.4%) CAR/CAR; 2 (1.6%) CAR/Atypical; 2 (1.6%) Ben/Cam; 1 (0.8%) CAR/Cam; 1 (0.8%) CAR/Arab-Indian, and 1 (0.8%) Sen/Atypical. The HS2-LCR sequence analyses demonstrated a c.-10.677G>A change in patients with the Ben haplotype and high HbF levels. The Gg gene promoter sequence analyses showed a c.-157T>C substitution shared by all patients, and a c.-222_-225del related to the Cam haplotype. These results identify new polymorphisms in the HS2-LCR and Gg-globin gene promoter. Further studies are required to determine the correlation between HbF synthesis and the clinical profile of sickle cell anemia patients.

Comparison of ligand migration and binding in heme proteins of the globin family

NASA Astrophysics Data System (ADS)

Karin, Nienhaus; Ulrich Nienhaus, G.

2015-12-01

The binding of small diatomic ligands such as carbon monoxide or dioxygen to heme proteins is among the simplest biological processes known. Still, it has taken many decades to understand the mechanistic aspects of this process in full detail. Here, we compare ligand binding in three heme proteins of the globin family, myoglobin, a dimeric hemoglobin, and neuroglobin. The combination of structural, spectroscopic, and kinetic experiments over many years by many laboratories has revealed common properties of globins and a clear mechanistic picture of ligand binding at the molecular level. In addition to the ligand binding site at the heme iron, a primary ligand docking site exists that ensures efficient ligand binding to and release from the heme iron. Additional, secondary docking sites can greatly facilitate ligand escape after its dissociation from the heme. Although there is only indirect evidence at present, a preformed histidine gate appears to exist that allows ligand entry to and exit from the active site. The importance of these features can be assessed by studies involving modified proteins (via site-directed mutagenesis) and comparison with heme proteins not belonging to the globin family.

A Mouse β-Globin Mutant That Is an Exact Model of Hemoglobin Rainier in Man

PubMed Central

Peters, J.; Andrews, S. J.; Loutit, J. F.; Clegg, J. B.

1985-01-01

A mutation induced by ethylnitrosourea in a spermatogonial stem cell of a 101/H mouse has resulted in a structurally altered β-diffuse major globin in one of his offspring. The mutant hemoglobin is associated with polycythemia, rubor, increased oxygen affinity and decreased hem-hem interaction. The mutant haplotype has been designated Hbb d4, polycythemia. Amino acid analysis of the mutant globin has shown that a single substitution β145 Tyr → Cys has occurred, and it is proposed that ethylnitrosourea induced an A → G transition in the tyrosine codon (TAC → TGC). This murine polycythemia is homologous with hemoglobin Rainier in man, in which the amino acid substitution is also β145 Tyr → Cys and which is associated with similar physiological consequences. PMID:3839762

Annual Research Progress Report.

DTIC Science & Technology

1979-09-30

will be trained in SLRL test procedures and the methodology will be developed for the incorporation of test materials into the standard rearing diet ...requirements exist for system software maintenance and development of software to report dosing data, to calculate diet preparation data, to manage collected...influence of diet and exercise on myo- globin and metmyoglobin reductase were evaluated in the rat. The activity of inetmyo- globin reductase was

Spontaneous trait inference and spontaneous trait transference are both unaffected by prior evaluations of informants.

PubMed

Zengel, Bettina; Ambler, James K; McCarthy, Randy J; Skowronski, John J

2017-01-01

This article reports results from a study in which participants encountered either (a) previously known informants who were positive (e.g. Abraham Lincoln), neutral (e.g., Jay Leno), or negative (e.g., Adolf Hitler), or (b) previously unknown informants. The informants ostensibly described either a trait-implicative positive behavior, a trait-implicative negative behavior, or a neutral behavior. These descriptions were framed as either the behavior of the informant or the behavior of another person. Results yielded evidence of informant-trait linkages for both self-informants and for informants who described another person. These effects were not moderated by informant type, behavior valence, or the congruency or incongruency between the prior knowledge of the informant and the behavior valence. Results are discussed in terms of theories of Spontaneous Trait Inference and Spontaneous Trait Transference.

Mutation spectrum of β-globin gene in thalassemia patients at Hasan Sadikin Hospital - West Java Indonesia.

PubMed

Maskoen, Ani Melani; Rahayu, Nurul S; Reniarti, Lelani; Susanah, Susi; Laksono, Bremmy; Fauziah, Prima Nanda; Zada, Almira; Hidayat, Dadang S

2017-12-30

Thalassemia is the most common hereditary haemolytic anemia in Southeast Asia, in which Indonesia is among countries that are at a high risk for thalassemia. It has been reported that mutation in the beta-globin gene is responsible in severe Thalassemia. However, the spectrum of beta-globin gene mutations in Indonesian population varies in different regions . Thus, this study aimed to identify the most prevalent mutation of Thalassemia patients from the Hasan Sadikin Hospital, Bandung, using this as a reference hospital for Thalassemia in West Java. The three most prevalent mutations of beta globin (IVS1nt5, Cd26 (HbE), and IVS1nt1), were conducted in the beginning of this study. Mutations of 291 samples were detected by PCR-RFLP in the Molecular Genetic Laboratory, Faculty of Medicine Universitas Padjadjaran, Bandung. The prevalence of the beta globin gene mutation types were 47.4% IVS1nt5 homozygote, 9.9% compound heterozygote IVS1nt5/HbE, 5.4% compound heterozygote IVS1nt5/IVS1nt1, 1.4% compound heterozygote HbE/IVS1nt1, 1% HbE homozygote, 14.4% Compound heterzygote IVS1nt5/… (no paired mutation), 2.06% compound heterozygote HbE/… (no paired mutation), 1.3% compound heterozygote IVS1nt1/… (no paired mutation), and 7 samples were unidentified. The thalassemia mutation IVS1nt5 homozygote is the most common mutation found in Thalassemia patients at Hasan Sadikin Hospital, Bandung. The samples with unidentified results might carry mutations other than the three that are observed in the present study.

Mathematical modeling of erythrocyte chimerism informs genetic intervention strategies for sickle cell disease.

PubMed

Altrock, Philipp M; Brendel, Christian; Renella, Raffaele; Orkin, Stuart H; Williams, David A; Michor, Franziska

2016-09-01

Recent advances in gene therapy and genome-engineering technologies offer the opportunity to correct sickle cell disease (SCD), a heritable disorder caused by a point mutation in the β-globin gene. The developmental switch from fetal γ-globin to adult β-globin is governed in part by the transcription factor (TF) BCL11A. This TF has been proposed as a therapeutic target for reactivation of γ-globin and concomitant reduction of β-sickle globin. In this and other approaches, genetic alteration of a portion of the hematopoietic stem cell (HSC) compartment leads to a mixture of sickling and corrected red blood cells (RBCs) in periphery. To reverse the sickling phenotype, a certain proportion of corrected RBCs is necessary; the degree of HSC alteration required to achieve a desired fraction of corrected RBCs remains unknown. To address this issue, we developed a mathematical model describing aging and survival of sickle-susceptible and normal RBCs; the former can have a selective survival advantage leading to their overrepresentation. We identified the level of bone marrow chimerism required for successful stem cell-based gene therapies in SCD. Our findings were further informed using an experimental mouse model, where we transplanted mixtures of Berkeley SCD and normal murine bone marrow cells to establish chimeric grafts in murine hosts. Our integrative theoretical and experimental approach identifies the target frequency of HSC alterations required for effective treatment of sickling syndromes in humans. Our work replaces episodic observations of such target frequencies with a mathematical modeling framework that covers a large and continuous spectrum of chimerism conditions. Am. J. Hematol. 91:931-937, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

An intriguing high performance liquid chromatogram of a double heterozygosity for Hb Q-India/Hb D-Punjab.

PubMed

Badyal, Rama Kumari; Chhabra, Sanjeev; Sharma, Prashant; Das, Reena

2014-01-01

Cation exchange high performance liquid chromatography (HPLC) is commonly utilized as the first method of screening for thalassemias and hemoglobinopathies worldwide. This method of diagnosis requires knowledge of the clinical background and complete blood counts as well as skill and experience in interpreting the sometimes complex results produced. An asymptomatic 27-year-old pregnant North Indian woman was found to have a highly unusual chromatographic pattern with multiple unexpected peaks during routine antenatal screening. Most concerning was a C-window peak as Hb C (HBB: c.19G>A) is rare in ethnic Asian Indian populations. Cellulose acetate electrophoresis at alkaline pH (8.6) and parental screening were performed. These revealed the correct diagnosis to be a double heterozygosity for Hb Q-India (HBA1: c.193G>C) (an uncommon asymptomatic α-globin chain variant) plus Hb D-Punjab (HBB: c.364G>C) (a β-globin chain variant that is common in this region and is asymptomatic in the heterozygous state). The unexpected C-window peak was the hybrid of the abnormal α-Q-India and β-D-Punjab globin chains. Another small peak was explained as a variant Hb A2 formed by the combination of α-Q-India and δ-globin chains. Hematopathologists should be cognizant of the complex pattern resulting from coinheritance of both α- and β-globin structural variants. Second-line testing and parental testing are invaluable in resolving unknown peaks, especially if rare or unexpected variants are being considered. Although both Hb Q-India and Hb D-Punjab are relatively common in northwestern India, to the best of our knowledge, only two recent reports describe a total of three cases of such diagnostically puzzling coinheritance.

Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.

PubMed

Shamoon, Rawand P; Al-Allawi, Nasir A S; Cappellini, Maria D; Di Pierro, Elena; Brancaleoni, Valentina; Granata, Francesca

2015-01-01

β-Thalassemia intermedia (β-TI) is a clinical term describing a range of clinical phenotypes that are intermediate in severity between the carrier state and β-thalassemia major (β-TM). To characterize the molecular basis of β-TI in Erbil Province, Northern Iraq, 83 unrelated patients were investigated. Detection of β-globin gene mutations was carried out by reverse hybridization assay and direct gene sequencing. All patients were screened for the XmnI polymorphism by direct sequencing of HBG2 ((G)γ promoter gene). Detection of α-globin gene deletions and triplication was carried out using the reverse hybridization assay. Four main molecular patterns were identified in association with the β-TI phenotype, namely: β(+)/β(+) (38.5%), β(+)/β(0) (21.6%), β(0)/β(0) (31.3%), and β(0)/wild type (8.4%). IVS-I-6 (T > C) was the most frequently encountered mutation (55 alleles, 34.6%), followed by IVS-II-1 (G > A) and codon 8 (-AA); furthermore, we report for the first time from Iraq two β(+) mutations, -87 (C > G) and 5' untranslated region (5'UTR) +22 (G > A). The XmnI polymorphism was detected in 47.0% of patients, mainly in association with the β(0)/β(0) genotype. The α-globin gene deletions were encountered in four cases, including one case with (- -(FIL)) double gene deletion, a report that is the first from our country. The α-globin gene triplication was detected in five of the seven heterozygous β-thalassemia (β-thal) patients. Similar to other Mediterranean countries, inheritance of mild β-globin mutations was the main molecular pattern underlying β-TI in our patients followed by the ameliorating effect of the XmnI polymorphism.

High Frequency of Hb E-Saskatoon (HBB: c.67G > A) in Brazilians: A New Genetic Origin?

PubMed

Wagner, Sandrine C; Lindenau, Juliana D; Castro, Simone M de; Santin, Ana Paula; Zaleski, Carina F; Azevedo, Laura A; Ribeiro Dos Santos, Ândrea K C; Dos Santos, Sidney E B; Hutz, Mara H

2016-08-01

Hb E-Saskatoon [β22(B4)Glu→Lys, HBB: c.67G > A] is a rare, nonpathological β-globin variant that was first described in a Canadian woman of Scottish and Dutch ancestry and has since then been detected in several populations. The aim of the present study was to identify the origin of Hb E-Saskatoon in Brazil using β-globin haplotypes and genetic ancestry in carriers of this hemoglobin (Hb) variant. Blood samples were investigated by isoelectric focusing (IEF) and high performance liquid chromatography (HPLC) using commercial kits. Hb E-Saskatoon was confirmed by amplification of the HBB gene, followed by sequence analysis. Haplotypes of the β-globin gene were determined by polymerase chain reaction (PCR), followed by digestion with specific restriction enzymes. Individual ancestry was estimated with 48 biallelic insertion/deletions using three 16-plex PCR amplifications. The IEF pattern was similar to Hbs C (HBB: c.19G > A) and Hb E (HBB: c.79G > A) [isoelectric point (pI): 7.59-7.65], and HPLC results showed an elution in the Hb S (HBB: c.20A > T) window [retention time (RT): 4.26-4.38]. DNA sequencing of the amplified β-globin gene showed a mutation at codon 22 (GAA>AAA) corresponding to Hb E-Saskatoon. A total of 11 cases of this variant were identified. In nine unrelated individuals, Hb E-Saskatoon was in linkage disequilibrium with haplotype 2 [+ - - - -]. All subjects showed a high degree of European contribution (mean = 0.85). Hb E-Saskatoon occurred on the β-globin gene of haplotype 2 in all Brazilian carriers. These findings suggest a different genetic origin for this Hb variant from that previously described.

Laboratory investigation of hemoglobinopathies and thalassemias: review and update.

PubMed

Clarke, G M; Higgins, T N

2000-08-01

Structural hemoglobin (Hb) variants typically are based on a point mutation in a globin gene that produce a single amino acid substitution in a globin chain. Although most are of limited clinical significance, a few important subtypes have been identified with some frequency. Homozygous Hb C and Hb S (sickle cell disease) produce significant clinical manifestations, whereas Hb E and Hb D homozygotes may be mildly symptomatic. Although heterozygotes for these variants are typically asymptomatic, diagnosis may be important for genetic counseling. Thalassemia, in contrast, results from quantitative reductions in globin chain synthesis. Those with diminished beta-globin chains are termed beta-thalassemias, whereas those with decreased alpha-chain production are called alpha-thalassemias. Severity of clinical manifestations in these disorders relates to the amount of globin chain produced and the stability of residual chains present in excess. The thalassemia minor syndromes are characterized clinically by mild anemia with persistent microcytosis. Thalassemia intermedia (i.e., Hb H disease) is typified by a moderate, variably compensated hemolytic anemia that may present with clinical symptoms during a period of physiologic stress such as infection, pregnancy, or surgery. The thalassemia major syndromes produce severe, life-threatening anemia. alpha-Thalassemia major usually is incompatible with extrauterine life; beta-thalassemia major presents in infancy and requires life-long transfusion therapy and/or bone marrow transplantation for successful control of the disease. Double heterozygosity for certain structural variants and/or thalassemia syndromes may also lead to severe clinical disease. Several guidelines have been published that outline the required steps for hemoglobinopathy and thalassemia investigation. The availability of HPLC has streamlined many of these requirements, allowing an efficient stepwise diagnostic strategy for these complex disorders.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catecholmore » enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.« less

Extending the construct of psychopathy to youth: implications for understanding, diagnosing, and treating antisocial children and adolescents.

PubMed

Frick, Paul J

2009-12-01

This paper reviews several attempts to extend the construct of psychopathy to children and adolescents. The research suggests that the presence of callous-unemotional (CU) traits may be particularly important. Specifically, the presence of these traits designates a clinically important subgroup of youth with childhood-onset conduct problems who show a particularly severe, aggressive, and stable pattern of antisocial behaviour. Also, children with CU traits show numerous emotional, cognitive, and personality features that are distinct from other antisocial youth that are similar to features found in adults with psychopathy. The research on CU traits has important implications for understanding the different causal pathways through which children develop severe antisocial and aggressive behaviour, as well as implications for diagnosing and intervening with antisocial youth.

Molecular basis of length polymorphism in the human zeta-globin gene complex.

PubMed Central

Goodbourn, S E; Higgs, D R; Clegg, J B; Weatherall, D J

1983-01-01

The length polymorphism between the human zeta-globin gene and its pseudogene is caused by an allele-specific variation in the copy number of a tandemly repeating 36-base-pair sequence. This sequence is related to a tandemly repeated 14-base-pair sequence in the 5' flanking region of the human insulin gene, which is known to cause length polymorphism, and to a repetitive sequence in intervening sequence (IVS) 1 of the pseudo-zeta-globin gene. Evidence is presented that the latter is also of variable length, probably because of differences in the copy number of the tandem repeat. The homology between the three length polymorphisms may be an indication of the presence of a more widespread group of related sequences in the human genome, which might be useful for generalized linkage studies. PMID:6308667

High Risk Behaviors in Marine Mammals: Linking Behavioral Responses to Anthropogenic Disturbance to Biological Consequences

DTIC Science & Technology

2014-09-30

98) Prescribed by ANSI Std Z39-18 2 injury via cardiovascular performance during submergence. Neuro -protection through globin deposition and...relationships for stroking costs, aerobic dive limits, types of neuro -protection (globin deposition, capillarity), and cardiac risk factors that will be mapped...Greenland. A custom built ECG recorder with 3- axis accelerometer recorder and pressure transducer was combined with retrieval transmitters (Argos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baserga, S.J.; Benz, E.J. Jr.

A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

PubMed

Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

2014-06-01

Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

GlobAl Distribution of GEnetic Traits (GADGET) web server: polygenic trait scores worldwide.

PubMed

Chande, Aroon T; Wang, Lu; Rishishwar, Lavanya; Conley, Andrew B; Norris, Emily T; Valderrama-Aguirre, Augusto; Jordan, I King

2018-05-18

Human populations from around the world show striking phenotypic variation across a wide variety of traits. Genome-wide association studies (GWAS) are used to uncover genetic variants that influence the expression of heritable human traits; accordingly, population-specific distributions of GWAS-implicated variants may shed light on the genetic basis of human phenotypic diversity. With this in mind, we developed the GlobAl Distribution of GEnetic Traits web server (GADGET http://gadget.biosci.gatech.edu). The GADGET web server provides users with a dynamic visual platform for exploring the relationship between worldwide genetic diversity and the genetic architecture underlying numerous human phenotypes. GADGET integrates trait-implicated single nucleotide polymorphisms (SNPs) from GWAS, with population genetic data from the 1000 Genomes Project, to calculate genome-wide polygenic trait scores (PTS) for 818 phenotypes in 2504 individual genomes. Population-specific distributions of PTS are shown for 26 human populations across 5 continental population groups, with traits ordered based on the extent of variation observed among populations. Users of GADGET can also upload custom trait SNP sets to visualize global PTS distributions for their own traits of interest.

Homozygosity for the AATAAA > AATA- - Polyadenylation Site Mutation on the α2-Globin Gene Causing Transfusion-Dependent Hb H Disease in an Iranian Patient: A Case Report.

PubMed

Farashi, Samaneh; Garous, Negin F; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemeh; Imanian, Hashem; Azarkeivan, Azita; Giordano, Piero C; Najmabadi, Hossein

2015-01-01

We describe a case of Hb H disease associated with homozygosity for a two nucleotide deletion in the polyadenylation signal of the α2-globin gene (HBA2: c.*93_*94delAA). The patient, a 27-year-old son of a consanguineous couple, needs regular blood transfusions every 6 months.

Light-induced protoporphyrin release from erythrocytes in erythropoietic protoporphyria.

PubMed Central

Sandberg, S; Brun, A

1982-01-01

The photohemolysis of normal erythrocytes incubated with protoporphyrin is reduced in the presence of albumin. When globin is added to normal erythrocytes loaded with protoporphyrin, protoporphyrin is bound to globin. During irradiation protoporphyrin moves from globin to the erythrocyte membrane and photohemolysis is initiated. Erythrocytes in patients with erythropoietic protoporphyria contain large amounts of protoporphyrin bound to hemoglobin. Upon irradiation of these cells in the absence of albumin, 40% of protoporphyrin and 80% of hemoglobin is released after 240 kJ/m2. The released protoporphyrin is hemoglobin bound. In contrast, when albumin is present only 8% of hemoglobin is released whereas protoporphyrin is released to 76%. The released protoporphyrin is albumin bound. A hypothesis for the release of erythrocyte protoporphyrin in erythropoietic protoporphyria without simultaneous hemolysis is proposed. Upon irradiation protoporphyrin photodamages its binding sites on hemoglobin, moves through the plasma membrane, and is bound to albumin in plasma. PMID:7107898

Pathophysiologically based drug treatment of sickle cell disease.

PubMed

Steinberg, Martin H

2006-04-01

Sickle cell disease is a systemic disorder that is caused by a mutation (Glu6Val) in the gene that encodes beta globin. The sickle hemoglobin molecule (HbS) is a tetramer of two alpha-globin chains and two sickle beta-globin chains, and has the tendency to polymerize when deoxygenated. HbS facilitates abnormal interactions between the sickle erythrocyte and leukocytes and endothelial cells, which trigger a complex pathobiology. This multifaceted pathophysiology provides the opportunity to interrupt the disease at multiple sites, including polymerization of HbS, erythrocyte density and cell-cell interactions. For example, it is possible to induce higher concentrations of fetal hemoglobin, which disrupts the pathology-initiating step of HbS polymerization. Furthermore, it is possible to improve the hydration of sickle erythrocytes and it might be feasible to counteract the endothelial, inflammatory and oxidative abnormalities of sickle cell disease. A therapeutic approach that targets several sites of pathobiology might be most promising.

Neuroglobin and cytoglobin: two new members of globin family

PubMed Central

Tosqui, Priscilla; Colombo, Marcio Francisco

2011-01-01

The globin family has long been defined by myoglobin and hemoglobin, proteins with the functions of oxygen storage and transportation, respectively. Recently, two new members of this family were discovered: neuroglobin present in neurons and retinal cells and cytoglobin found in various types of tissue. The increased expression of these proteins in hypoxic conditions first suggested a role in oxygen supply. However structural and functional differences, such as the hexacoordinated heme, a high autoxidation rate and different concentrations between different cellular types, have dismissed this hypothesis. The protective role of these globins has already been established. In vitro and in vivo studies have demonstrated increased survival of neurons under stress in the presence of neuroglobin and increased resistance to neurodegenerative diseases. However the mechanism remains unknown. Functions, including detoxification of nitric oxide, free radical scavenging and as an antioxidant and signaling of apoptosis, have also been suggested for neuroglobin and an antifibrotic function for cytoglobin. PMID:23049323

Comparison of different methods for erythroid differentiation in the K562 cell line.

PubMed

Shariati, Laleh; Modaress, Mehran; Khanahmad, Hossein; Hejazi, Zahra; Tabatabaiefar, Mohammad Amin; Salehi, Mansoor; Modarressi, Mohammad Hossein

2016-08-01

To compare methods for erythroid differentiation of K562 cells that will be promising in the treatment of beta-thalassemia by inducing γ-globin synthesis. Cells were treated separately with: RPMI 1640 medium without glutamine, RPMI 1640 medium without glutamine supplemented with 1 mM sodium butyrate, RPMI 1640 medium supplemented with 1 mM sodium butyrate, 25 µg cisplatin/ml, 0.1 µg cytosine arabinoside/ml. The highest differentiation (84 %) with minimum toxicity was obtained with cisplatin at 15 µg /ml. Real-time RT-PCR showed that expression of the γ-globin gene was significantly higher in the cells differentiated with cisplatin compared to undifferentiated cells (P < 0.001). Cisplatin is useful in the experimental therapy of ß-globin gene defects and can be considered for examining the basic mechanism of γ-reactivation.

Erythroid differentiation ability of butyric acid analogues: identification of basal chemical structures of new inducers of foetal haemoglobin.

PubMed

Bianchi, Nicoletta; Chiarabelli, Cristiano; Zuccato, Cristina; Lampronti, Ilaria; Borgatti, Monica; Amari, Gabriele; Delcanale, Maurizio; Chiavilli, Francesco; Prus, Eugenia; Fibach, Eitan; Gambari, Roberto

2015-04-05

Several investigations have demonstrated a mild clinical status in patients with β-globin disorders and congenital high persistence of foetal haemoglobin. This can be mimicked by a pharmacological increase of foetal γ-globin genes expression and foetal haemoglobin production. Our goal was to apply a multistep assay including few screening methods (benzidine staining, RT-PCR and HPLC analyses) and erythroid cellular model systems (the K562 cell line and erythroid precursors collected from peripheral blood) to select erythroid differentiation agents with foetal haemoglobin inducing potential. With this methodology, we have identified a butyric acid derivative, namely the 4174 cyclopropanecarboxylic acid compound, able to induce erythroid differentiation without antiproliferative effect in K562 cells and increase of γ-globin gene expression in erythroid precursor cells. The results are relevant for pharmacological treatments of haemoglobinopathies, including β-thalassaemia and sickle cell anaemia. Copyright © 2015 Elsevier B.V. All rights reserved.

[Acute abdominal pain due to splenic infarction in a patient with heterozygous sickle cell disease exposed to high altitude].

PubMed

Ruiz Semba, Edgar; Garavito Rentería, Jorge; Jiménez Bustamante, Jorge; Arteaga Caro, Ronal; García Del Aguila, José Luis; Chávez Gil, Vannya

2006-01-01

Hemoglobinopathy S, Depranocytosis or Sickle Cell Disease is the most common hemoglobinopathy in the world. In its heterozygous form (Sickle Cell Trait), it affects 8% of the black population in the U.S. and 25% of the black population in Africa, and is found less frequently in the Mediterranean area, India, Middle East and Latin America. The basic alteration is a substitution of glutamic acid by valin in the sixth position of the beta globin chain, which causes polymerization at low oxygen tension thereby distorting the structure of erythrocytes and increasing blood viscosity, which, in turn, generates obstructions of the capillary arterial blood flow to different areas of the body thus causing microinfarctions. Although Splenic Infarction is rare, it is recognized as a serious complication of Heterozygous Sickle Cell Disease (Sickle Cell Trait). We present the case of a 21 year-old mestizo male patient who came in with an acute case of abdominal pain after arriving to work in the Casapalca mining city (located in the Peruvian Andes at 4200 m.a.s.l.) and was referred to our Hospital in Lima for exams. We present the case because it is an unusual cause of acute abdominal pain, and because this condition is rare in Peru and there are few publications about it.

Do key dimensions of seed and seedling functional trait variation capture variation in recruitment probability?

USDA-ARS?s Scientific Manuscript database

1. Plant functional traits provide a mechanistic basis for understanding ecological variation among plant species and the implications of this variation for species distribution, community assembly and restoration. 2. The bulk of our functional trait understanding, however, is centered on traits rel...

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin

PubMed Central

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-01-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

Convergent evolution of hemoglobin switching in jawed and jawless vertebrates.

PubMed

Rohlfing, Kim; Stuhlmann, Friederike; Docker, Margaret F; Burmester, Thorsten

2016-02-01

During development, humans and other jawed vertebrates (Gnathostomata) express distinct hemoglobin genes, resulting in different hemoglobin tetramers. Embryonic and fetal hemoglobin have higher oxygen affinities than the adult hemoglobin, sustaining the oxygen demand of the developing organism. Little is known about the expression of hemoglobins during development of jawless vertebrates (Agnatha). We identified three hemoglobin switches in the life cycle of the sea lamprey. Three hemoglobin genes are specifically expressed in the embryo, four genes in the filter feeding larva (ammocoete), and nine genes correspond to the adult hemoglobin chains. During the development from the parasitic to the reproductive adult, the composition of hemoglobin changes again, with a massive increase of chain aHb1. A single hemoglobin chain is expressed constitutively in all stages. We further showed the differential expression of other globin genes: Myoglobin 1 is most highly expressed in the reproductive adult, myoglobin 2 expression peaks in the larva. Globin X1 is restricted to the embryo; globin X2 was only found in the reproductive adult. Cytoglobin is expressed at low levels throughout the life cycle. Because the hemoglobins of jawed and jawless vertebrates evolved independently from a common globin ancestor, hemoglobin switching must also have evolved convergently in these taxa. Notably, the ontogeny of sea lamprey hemoglobins essentially recapitulates their phylogeny, with the embryonic hemoglobins emerging first, followed by the evolution of larval and adult hemoglobins.

Recent trends in the gene therapy of β-thalassemia

PubMed Central

Finotti, Alessia; Breda, Laura; Lederer, Carsten W; Bianchi, Nicoletta; Zuccato, Cristina; Kleanthous, Marina; Rivella, Stefano; Gambari, Roberto

2015-01-01

The β-thalassemias are a group of hereditary hematological diseases caused by over 300 mutations of the adult β-globin gene. Together with sickle cell anemia, thalassemia syndromes are among the most impactful diseases in developing countries, in which the lack of genetic counseling and prenatal diagnosis have contributed to the maintenance of a very high frequency of these genetic diseases in the population. Gene therapy for β-thalassemia has recently seen steadily accelerating progress and has reached a crossroads in its development. Presently, data from past and ongoing clinical trials guide the design of further clinical and preclinical studies based on gene augmentation, while fundamental insights into globin switching and new technology developments have inspired the investigation of novel gene-therapy approaches. Moreover, human erythropoietic stem cells from β-thalassemia patients have been the cellular targets of choice to date whereas future gene-therapy studies might increasingly draw on induced pluripotent stem cells. Herein, we summarize the most significant developments in β-thalassemia gene therapy over the last decade, with a strong emphasis on the most recent findings, for β-thalassemia model systems; for β-, γ-, and anti-sickling β-globin gene addition and combinatorial approaches including the latest results of clinical trials; and for novel approaches, such as transgene-mediated activation of γ-globin and genome editing using designer nucleases. PMID:25737641

Relaxed functional constraints on triplicate α-globin gene in the bank vole suggest a different evolutionary history from other rodents

PubMed Central

Marková, S; Searle, J B; Kotlík, P

2014-01-01

Gene duplication plays an important role in the origin of evolutionary novelties, but the mechanisms responsible for the retention and functional divergence of the duplicated copy are not fully understood. The α-globin genes provide an example of a gene family with different numbers of gene duplicates among rodents. Whereas Rattus and Peromyscus each have three adult α-globin genes (HBA-T1, HBA-T2 and HBA-T3), Mus has only two copies. High rates of amino acid evolution in the independently derived HBA-T3 genes of Peromyscus and Rattus have been attributed to positive selection. Using RACE PCR, reverse transcription-PCR (RT–PCR) and RNA-seq, we show that another rodent, the bank vole Clethrionomys glareolus, possesses three transcriptionally active α-globin genes. The bank vole HBA-T3 gene is distinguished from each HBA-T1 and HBA-T2 by 20 amino acids and is transcribed 23- and 4-fold lower than HBA-T1 and HBA-T2, respectively. Polypeptides corresponding to all three genes are detected by electrophoresis, demonstrating that the translated products of HBA-T3 are present in adult erythrocytes. Patterns of codon substitution and the presence of low-frequency null alleles suggest a postduplication relaxation of purifying selection on bank vole HBA-T3. PMID:24595364

Spontaneous evaluative inferences and their relationship to spontaneous trait inferences.

PubMed

Schneid, Erica D; Carlston, Donal E; Skowronski, John J

2015-05-01

Three experiments are reported that explore affectively based spontaneous evaluative impressions (SEIs) of stimulus persons. Experiments 1 and 2 used modified versions of the savings in relearning paradigm (Carlston & Skowronski, 1994) to confirm the occurrence of SEIs, indicating that they are equivalent whether participants are instructed to form trait impressions, evaluative impressions, or neither. These experiments also show that SEIs occur independently of explicit recall for the trait implications of the stimuli. Experiment 3 provides a single dissociation test to distinguish SEIs from spontaneous trait inferences (STIs), showing that disrupting cognitive processing interferes with a trait-based prediction task that presumably reflects STIs, but not with an affectively based social approach task that presumably reflects SEIs. Implications of these findings for the potential independence of spontaneous trait and evaluative inferences, as well as limitations and important steps for future study are discussed. (c) 2015 APA, all rights reserved).

Maternal Exposure to Childhood Abuse is Associated with Mate Selection: Implications for Autism in Offspring.

PubMed

Roberts, Andrea L; Lyall, Kristen; Weisskopf, Marc G

2017-07-01

Maternal experience of childhood abuse has been associated with offspring autism. To explore whether familial tendency towards autistic traits-presumably related to genetic predisposition-accounts for this association, we examined whether women who experienced childhood abuse were more likely to select mates with high levels of autistic traits, and whether parental autistic traits accounted for the association of maternal abuse and offspring autism in 209 autism cases and 833 controls. Maternal childhood abuse was strongly associated with high paternal autistic traits (severe abuse, OR = 3.98, 95% CI = 1.26, 8.31). Maternal and paternal autistic traits accounted for 21% of the association between maternal abuse and offspring autism. These results provide evidence that childhood abuse affects mate selection, with implications for offspring health.

Engineered U7 snRNA mediates sustained splicing correction in erythroid cells from β-thalassemia/HbE patients.

PubMed

Preedagasamzin, Sarinthip; Nualkaew, Tiwaporn; Pongrujikorn, Tanjitti; Jinawath, Natini; Kole, Ryszard; Fucharoen, Suthat; Jearawiriyapaisarn, Natee; Svasti, Saovaros

2018-04-30

Repair of a splicing defect of β-globin pre-mRNA harboring hemoglobin E (HbE) mutation was successfully accomplished in erythroid cells from patients with β-thalassemia/HbE disorder by a synthetic splice-switching oligonucleotide (SSO). However, its application is limited by short-term effectiveness and requirement of lifelong periodic administration of SSO, especially for chronic diseases like thalassemias. Here, we engineered lentiviral vectors that stably express U7 small nuclear RNA (U7 snRNA) carrying the splice-switching sequence of the SSO that restores correct splicing of β E -globin pre-mRNA and achieves a long-term therapeutic effect. Using a two-step tiling approach, we systematically screened U7 snRNAs carrying splice-switching SSO sequences targeted to the cryptic 5' splice site created by HbE mutation. We tested this approach and identified the most responsive element for mediating splicing correction in engineered U7 snRNAs in HeLa-β E cell model cell line. Remarkably, the U7 snRNA lentiviral vector (U7 βE4+1) targeted to this region effectively restored the correctly-spliced β E -globin mRNA for at least 5 months. Moreover, the effects of the U7 βE4+1 snRNA lentiviral vector were also evident as upregulation of the correctly-spliced β E -globin mRNA in erythroid progenitor cells from β-thalassemia/HbE patients treated with the vector, which led to improvements of pathologies in erythroid progenitor cells from thalassemia patients. These results suggest that the splicing correction of β E -globin pre-mRNA by the engineered U7 snRNA lentiviral vector provides a promising, long-term treatment for β-thalassemia/HbE. Copyright © 2018 Elsevier Inc. All rights reserved.

Transfusion independence and HMGA2 activation after gene therapy of human β-thalassaemia.

PubMed

Cavazzana-Calvo, Marina; Payen, Emmanuel; Negre, Olivier; Wang, Gary; Hehir, Kathleen; Fusil, Floriane; Down, Julian; Denaro, Maria; Brady, Troy; Westerman, Karen; Cavallesco, Resy; Gillet-Legrand, Beatrix; Caccavelli, Laure; Sgarra, Riccardo; Maouche-Chrétien, Leila; Bernaudin, Françoise; Girot, Robert; Dorazio, Ronald; Mulder, Geert-Jan; Polack, Axel; Bank, Arthur; Soulier, Jean; Larghero, Jérôme; Kabbara, Nabil; Dalle, Bruno; Gourmel, Bernard; Socie, Gérard; Chrétien, Stany; Cartier, Nathalie; Aubourg, Patrick; Fischer, Alain; Cornetta, Kenneth; Galacteros, Frédéric; Beuzard, Yves; Gluckman, Eliane; Bushman, Frederick; Hacein-Bey-Abina, Salima; Leboulch, Philippe

2010-09-16

The β-haemoglobinopathies are the most prevalent inherited disorders worldwide. Gene therapy of β-thalassaemia is particularly challenging given the requirement for massive haemoglobin production in a lineage-specific manner and the lack of selective advantage for corrected haematopoietic stem cells. Compound β(E)/β(0)-thalassaemia is the most common form of severe thalassaemia in southeast Asian countries and their diasporas. The β(E)-globin allele bears a point mutation that causes alternative splicing. The abnormally spliced form is non-coding, whereas the correctly spliced messenger RNA expresses a mutated β(E)-globin with partial instability. When this is compounded with a non-functional β(0) allele, a profound decrease in β-globin synthesis results, and approximately half of β(E)/β(0)-thalassaemia patients are transfusion-dependent. The only available curative therapy is allogeneic haematopoietic stem cell transplantation, although most patients do not have a human-leukocyte-antigen-matched, geno-identical donor, and those who do still risk rejection or graft-versus-host disease. Here we show that, 33 months after lentiviral β-globin gene transfer, an adult patient with severe β(E)/β(0)-thalassaemia dependent on monthly transfusions since early childhood has become transfusion independent for the past 21 months. Blood haemoglobin is maintained between 9 and 10 g dl(-1), of which one-third contains vector-encoded β-globin. Most of the therapeutic benefit results from a dominant, myeloid-biased cell clone, in which the integrated vector causes transcriptional activation of HMGA2 in erythroid cells with further increased expression of a truncated HMGA2 mRNA insensitive to degradation by let-7 microRNAs. The clonal dominance that accompanies therapeutic efficacy may be coincidental and stochastic or result from a hitherto benign cell expansion caused by dysregulation of the HMGA2 gene in stem/progenitor cells.

mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin.

PubMed

Henning, Konstanze; Schroeder, Timm; Schwanbeck, Ralf; Rieber, Nikolaus; Bresnick, Emery H; Just, Ursula

2007-09-01

In many developing tissues, signaling mediated by activation of the transmembrane receptor Notch influences cell-fate decisions, differentiation, proliferation, and cell survival. Notch receptors are expressed on hematopoietic cells and cognate ligands on bone marrow stromal cells. Here, we investigate the role of mNotch1 signaling in the control of erythroid differentiation of multipotent progenitor cells. Multipotent FDCP-mix cell lines engineered to permit the conditional induction of the constitutively active intracellular domain of mNotch1 (mN1(IC)) by the 4-hydroxytamoxifen (OHT)-inducible system were used to analyze the effects of activated mNotch1 on erythroid differentiation and on expression of Gata1, Fog1, Eklf, NF-E2, and beta-globin. Expression was analyzed by Northern blotting and real-time polymerase chain reaction. Enhancer activity of reporter constructs was determined with the dual luciferase system in transient transfection assays. Induction of mN1(IC) by OHT resulted in increased and accelerated differentiation of FDCP-mix cells along the erythroid lineage. Erythroid maturation was induced by activated Notch1 also under conditions that normally promote self-renewal, but required the presence of erythropoietin for differentiation to proceed. While induction of Notch signaling rapidly upregulated Hes1 and Hey1 expression, the expression of Gata1, Fog1, Eklf, and NF-E2 remained unchanged. Concomitantly with erythroid differentiation, activated mNotch1 upregulated beta-globin RNA. Notch signaling transactivated a reporter construct harboring a conserved RBP-J (CBF1) binding site in the hypersensitive site 2 (HS2) of human beta-globin. Transactivation by activated Notch was completely abolished when this RBP-J site was mutated to prevent RBP-J binding. Our results show that activation of mNotch1 induces erythroid differentiation in cooperation with erythropoietin and upregulates beta-globin expression.

The effect of histone deacetylase inhibitors on AHSP expression

PubMed Central

Ziari, Katayoun; Ranjbaran, Reza; Nikouyan, Negin

2018-01-01

Alpha-hemoglobin stabilizing protein (AHSP) is a molecular chaperone that can reduce the damage caused by excess free α-globin to erythroid cells in patients with impaired β-globin chain synthesis. We assessed the effect of sodium phenylbutyrate and sodium valproate, two histone deacetylase inhibitors (HDIs) that are being studied for the treatment of hemoglobinopathies, on the expression of AHSP, BCL11A (all isoforms), γ-globin genes (HBG1/2), and some related transcription factors including GATA1, NFE2, EKLF, KLF4, and STAT3. For this purpose, the K562 cell line was cultured for 2, 4, and 6 days in the presence and absence of sodium phenylbutyrate and sodium valproate. Relative real-time qRT-PCR analysis of mRNA levels was performed to determine the effects of the two compounds on gene expression. Expression of all target mRNAs increased significantly (p < 0.05), except for the expression of BCL11A, which was down-regulated (p < 0.05) in the cells treated with both compounds relative to the levels measured for untreated cells. The findings indicated that sodium valproate had a more considerable effect than sodium phenylbutyrate (p < 0.0005) on BCL11A repression and the up-regulation of other studied genes. γ-Globin and AHSP gene expression continuously increased during the culture period in the treated cells, with the highest gene expression observed for 1 mM sodium valproate after 6 days. Both compounds repressed the expression of BCL11A (-XL, -L, -S) and up-regulated GATA1, NFE2, EKLF, KLF4, STAT3, AHSP, and γ-globin genes expression. Moreover, sodium valproate showed a stronger effect on repressing BCL11A and escalating the expression of other target genes. The findings of this in vitro experiment could be considered in selecting drugs for clinical use in patients with β-hemoglobinopathies. PMID:29389946

VNTR internal structure mapping at the {alpha}-globin 3{prime}HVR locus reveals a hierachy of related lineages in oceania

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinson, J.J.; Clegg, J.B.; Boyce, A.J.

1994-09-01

Analysis of the {alpha}-globin gene complex in Oceania has revealed many different rearrangements which remove one of the adult globin genes. Frequencies of these deletion chromosomes are elevated by malarial resistance conferred by the resulting {alpha}-thalassaemia. One particular deletion chromosome, designated -{alpha}{sup 3.7}III, is found at high levels in Melanesia and Polynesia: RFLP haplotype analysis shows that this deletion is always found on chromosomes bearing the IIIa haplotype and is likely to be the product of one single rearrangement event. A subset of the -{alpha}{sup 3.7}III chromosomes carries a more recent mutation which generates the haemoglobin variant HbJ{sup Tongariki}. Wemore » have characterized the allelic variation at the 3{prime}HVR VNTR locus located 6 kb from the globin genes in each of these groups of chromosomes. We have determined the internal structure of these alleles by RFLP mapping of PCR-amplified DNA: within each group, the allelic diversity results from the insertion and/or deletion of small {open_quotes}motifs{close_quotes} of up to 6 adjacent repeats. Mapping of 3{prime}HVR alleles associated with other haplotypes reveals that these are composed of repeat arrays that are substantially different to those derived from IIIa chromosomes, indicating that interchromosomal recombination between heterologous haplotypes does not account for any of the diversity seen to date. We have recently shown that allelic size variation at the two VNTR loci flanking the {alpha}-globin complex is very closely linked to the haplotypes known to be present at this locus. Here we show that, within a haplotype, VNTR alleles are very closely related to each other on the basis of internal structure and demonstrate that intrachromosomal mutation processes involving small numbers of tandem repeats are the main cause of variation at this locus.« less

The "common good" phenomenon: Why similarities are positive and differences are negative.

PubMed

Alves, Hans; Koch, Alex; Unkelbach, Christian

2017-04-01

Positive attributes are more prevalent than negative attributes in the social environment. From this basic assumption, 2 implications that have been overlooked thus far: Positive compared with negative attributes are more likely to be shared by individuals, and people's shared attributes (similarities) are more positive than their unshared attributes (differences). Consequently, similarity-based comparisons should lead to more positive evaluations than difference-based comparisons. We formalized our probabilistic reasoning in a model and tested its predictions in a simulation and 8 experiments (N = 1,181). When participants generated traits about 2 target persons, positive compared with negative traits were more likely to be shared by the targets (Experiment 1a) and by other participants' targets (Experiment 1b). Conversely, searching for targets' shared traits resulted in more positive traits than searching for unshared traits (Experiments 2, 4a, and 4b). In addition, positive traits were more accessible than negative traits among shared traits but not among unshared traits (Experiment 3). Finally, shared traits were only more positive when positive traits were indeed prevalent (Experiments 5 and 6). The current framework has a number of implications for comparison processes and provides a new interpretation of well-known evaluative asymmetries such as intergroup bias and self-superiority effects. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Familial congenital cyanosis caused by Hb-MYantai(α-76 GAC → TAC, Asp → Tyr)

PubMed Central

2010-01-01

Methemoglobin (Hb-M) is a rare hemoglobinopathy in China. We hereby report on a family living in Yantai, East China, with congenital cyanosis due to Hb-M mutation. The proband, a 65-year-old female, presented 63% oxygen saturation. Both Hb-M concentration and arterial oxygen saturation remained unchanged, even following intravenous treatment with methylene blue. There was also no change in blood-color (chocolate-brown) after adding 0.1% KCN. A fast-moving band (Hb-X) in hemolysates was found by cellulose acetate electrophoresis, the Hb-X/Hb-A ratio exceeding 10%. GT transition at 131nt of exon 2, although present in one of the α2 -globin alleles, was not found in α1 -globin alleles as a whole. This mutation leads to the aspartic acid to tyrosine substitution (Asp76Tyr). In this family, the novel mutation in the α2 -globin gene resulted in a rare form of congenital cyanosis due to Hb-M. This hemoglobin was named Hb-M Yantai . PMID:21637412

Genetic Basis and Genetic Modifiers of β-Thalassemia and Sickle Cell Disease.

PubMed

Thein, Swee Lay

2017-01-01

β-thalassemia and sickle cell disease (SCD) are prototypical Mendelian single gene disorders, both caused by mutations affecting the adult β-globin gene. Despite the apparent genetic simplicity, both disorders display a remarkable spectrum of phenotypic severity and share two major genetic modifiers-α-globin genotype and innate ability to produce fetal hemoglobin (HbF, α 2 γ 2 ).This article provides an overview of the genetic basis for SCD and β-thalassemia, and genetic modifiers identified through phenotype correlation studies. Identification of the genetic variants modifying HbF production in combination with α-globin genotype provide some prediction of disease severity for β-thalassemia and SCD but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered.Nonetheless, genetic studies have been successful in characterizing some of the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation.

Hb Mozhaisk [β92(F8)His→Arg; HBB: c.278A>G] as a De Novo Mutation in a Child of Mixed Ethnic Origins.

PubMed

Benzoni, Elena; Giannone, Valentina; Michetti, Laura; Seia, Manuela; Cavalleri, Laura; Curcio, Cristina

Approximately 150 variants described in the HbVar database have been found to be unstable and about 80.0% of these are on the β-globin gene. We describe the case of a 3-year-old child who presented at the emergency room with fever and asthenia. Hematological data suggested severe hemolytic anemia. Sequencing of the β-globin gene revealed the mutation HBB: c.278A>G at codon 92 in a heterozygous state, reported as Hb Mozhaisk in the HbVar database. Other family members did not have Hb Mozhaisk, thus, this variant is due to a de novo mutation. Because of the rarity of this globin variant, we believe it is important to report similar cases, to have a more complete phenotype description of the pathology and define an adequate reproductive risk for couples, considering the dominant inheritance pattern (hence an inheritance risk of 50.0%).

Patterns in root traits of woody species hosting arbuscular and ectomycorrhizas: implications for the evolution of belowground strategies

USDA-ARS?s Scientific Manuscript database

Despite large variation in root traits among species, we have limited understanding of how traits are related to diverse soil resource acquisition strategies. We examined root trait variation among 33 species co-existing in Northeastern US forests that form the two most common mutualisms with mycorr...

Children's Thinking about Traits: Implications for Judgments of the Self and Others.

ERIC Educational Resources Information Center

Heyman, Gail D.; Dweck, Carol S.

1998-01-01

Investigated the relation between 7- and 8-year-olds' interpretations of human behavior and children's beliefs about the stability of human traits. Found that the belief that traits are stable predicted a greater tendency to make trait judgments in the academic and sociomoral domains, and an increased focus on outcomes such as performance and…

Development and characterization of K562 cell clones expressing BCL11A-XL: Decreased hemoglobin production with fetal hemoglobin inducers and its rescue with mithramycin.

PubMed

Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto

2015-12-01

Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

Improving enrichment of circulating fetal DNA for genetic testing: size fractionation followed by whole gene amplification.

PubMed

Jorgez, Carolina J; Bischoff, Farideh Z

2009-01-01

Among the pitfalls of using cell-free fetal DNA in plasma for prenatal diagnosis is quality of the recovered DNA fragments and concomitant presence of maternal DNA (>95%). Our objective is to provide alternative methods for achieving enrichment and high-quality fetal DNA from plasma. Cell-free DNA from 31 pregnant women and 18 controls (10 males and 8 females) were size separated using agarose gel electrophoresis. DNA fragments of 100-300, 500-700 and 1,500-2,000 bp were excised and extracted, followed by whole genome amplification (WGA) of recovered fragments. Levels of beta-globin and DYS1 were measured. Distribution of beta-globin size fragments was similar among pregnant women and controls. Among control male cases, distribution of size fragments was the same for both beta-globin and DYS1. Among maternal cases confirmed to be male, the smallest size fragment (100-300 bp) accounted for nearly 50% (39.76 +/- 17.55%) of the recovered DYS1-DNA (fetal) and only 10% (10.40 +/- 6.49%) of beta-globin (total) DNA. After WGA of plasma fragments from pregnant women, DYS1 sequence amplification was best observed when using the 100-300 bp fragments as template. Combination of electrophoresis for size separation and WGA led to enriched fetal DNA from plasma. This novel combination of strategies is more likely to permit universal clinical applications of cell-free fetal DNA. Copyright 2009 S. Karger AG, Basel.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Prevalence of βS-globin gene haplotypes, α-thalassemia (3.7 kb deletion) and redox status in patients with sickle cell anemia in the state of Paraná, Brazil

PubMed Central

Shimauti, Eliana LitsukoTomimatsu; Silva, Danilo Grunig Humberto; de Souza, Eniuce Menezes; de Almeida, Eduardo Alves; Leal, Francismar Prestes; Bonini-Domingos, Claudia Regina

2015-01-01

The aim of this study was to determine the frequency of beta S-globin gene (βS globin) haplotypes and alpha thalassemia with 3.7 kb deletion (−α3.7kb thalassemia) in the northwest region of Paraná state, and to investigate the oxidative and clinical-hematological profile of βS globin carriers in this population. Of the 77 samples analyzed, 17 were Hb SS, 30 were Hb AS and 30 were Hb AA. The βSglobin haplotypes and −α3.7kb thalassemia were identified using polymerase chain reaction.Trolox equivalent antioxidant capacity (TEAC) and lipid peroxidation (LPO) were assessed spectophotometrically. Serum melatonin levels were determined using high-performance liquid chromatography coupled to coulometric electrochemical detection. The haplotype frequencies in the SS individuals were as follows: Bantu- 21 (62%), Benin - 11 (32%) and Atypical- 2 (6%). Bantu/Benin was the most frequent genotype. Of the 47 SS and AS individuals assessed, 17% (n = 8) had the −α3.7kb mutation. Clinical manifestations, as well as serum melatonin, TEAC and LPO levels did not differ between Bantu/Bantu and Bantu/Benin individuals (p > 0.05). Both genotypes were associated with high LPO and TEAC levels and decreased melatonin concentration. These data suggest that the level of oxidative stress in patients with Bantu/Bantu and Bantu/Benin genotypes may overload the antioxidant capacity. PMID:26500435

The New Self-Inactivating Lentiviral Vector for Thalassemia Gene Therapy Combining Two HPFH Activating Elements Corrects Human Thalassemic Hematopoietic Stem Cells

PubMed Central

Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios

2012-01-01

Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313

Distinct modes of gene regulation by a cell-specific transcriptional activator.

PubMed

Sengupta, Tanushri; Cohet, Nathalie; Morlé, François; Bieker, James J

2009-03-17

The architectural layout of a eukaryotic RNA polymerase II core promoter plays a role in general transcriptional activation. However, its role in tissue-specific expression is not known. For example, differing modes of its recognition by general transcription machinery can provide an additional layer of control within which a single tissue-restricted transcription factor may operate. Erythroid Kruppel-like factor (EKLF) is a hematopoietic-specific transcription factor that is critical for the activation of subset of erythroid genes. We find that EKLF interacts with TATA binding protein-associated factor 9 (TAF9), which leads to important consequences for expression of adult beta-globin. First, TAF9 functionally supports EKLF activity by enhancing its ability to activate the beta-globin gene. Second, TAF9 interacts with a conserved beta-globin downstream promoter element, and ablation of this interaction by beta-thalassemia-causing mutations decreases its promoter activity and disables superactivation. Third, depletion of EKLF prevents recruitment of TAF9 to the beta-globin promoter, whereas depletion of TAF9 drastically impairs beta-promoter activity. However, a TAF9-independent mode of EKLF transcriptional activation is exhibited by the alpha-hemoglobin-stabilizing protein (AHSP) gene, which does not contain a discernable downstream promoter element. In this case, TAF9 does not enhance EKLF activity and depletion of TAF9 has no effect on AHSP promoter activation. These studies demonstrate that EKLF directs different modes of tissue-specific transcriptional activation depending on the architecture of its target core promoter.

Histone- and protamine-DNA association: conservation of different patterns within the beta-globin domain in human sperm.

PubMed

Gardiner-Garden, M; Ballesteros, M; Gordon, M; Tam, P P

1998-06-01

Most DNA in human sperm is bound to highly basic proteins called protamines, but a small proportion is complexed with histones similar to those found in active chromatin. This raises the intriguing possibility that histones in sperm are marking sets of genes that will be preferentially activated during early development. We have examined the chromatin structure of members of the beta-globin gene family, which are expressed at different times in development, and the protamine 2 gene, which is expressed in spermatids prior to the widespread displacement of histones by transition proteins. The genes coding for epsilon and gamma globin, which are active in the embryonic yolk sac, contain regions which are histone associated in the sperm. No histone-associated regions are present at the sites tested within the beta- and delta-globin genes which are silent in the embryonic yolk sac. The trends of histone or protamine association are consistent for samples from the same person, and no significant between-subject variations in these trends are found for 13 of the 15 fragments analyzed in the two donors. The results suggest that sperm chromatin structures are generally similar in different men but that the length of the histone-associated regions can vary. The association of sperm DNA with histones or protamines sometimes changes within as little as 400 bp of DNA, suggesting that there is fine control over the retention of histones.

Intelligence: shared genetic basis between Mendelian disorders and a polygenic trait.

PubMed

Franić, Sanja; Groen-Blokhuis, Maria M; Dolan, Conor V; Kattenberg, Mathijs V; Pool, René; Xiao, Xiangjun; Scheet, Paul A; Ehli, Erik A; Davies, Gareth E; van der Sluis, Sophie; Abdellaoui, Abdel; Hansell, Narelle K; Martin, Nicholas G; Hudziak, James J; van Beijsterveldt, Catherina E M; Swagerman, Suzanne C; Hulshoff Pol, Hilleke E; de Geus, Eco J C; Bartels, Meike; Ropers, H Hilger; Hottenga, Jouke-Jan; Boomsma, Dorret I

2015-10-01

Multiple inquiries into the genetic etiology of human traits indicated an overlap between genes underlying monogenic disorders (eg, skeletal growth defects) and those affecting continuous variability of related quantitative traits (eg, height). Extending the idea of a shared genetic basis between a Mendelian disorder and a classic polygenic trait, we performed an association study to examine the effect of 43 genes implicated in autosomal recessive cognitive disorders on intelligence in an unselected Dutch population (N=1316). Using both single-nucleotide polymorphism (SNP)- and gene-based association testing, we detected an association between intelligence and the genes of interest, with genes ELP2, TMEM135, PRMT10, and RGS7 showing the strongest associations. This is a demonstration of the relevance of genes implicated in monogenic disorders of intelligence to normal-range intelligence, and a corroboration of the utility of employing knowledge on monogenic disorders in identifying the genetic variability underlying complex traits.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pirastu, M.; Galanello, R.; Doherty, M.A.

The predominant ..beta..-thalassemia in Sardinia is the ..beta../sup 0/ type in which no ..beta..-globin chains are synthesized in the homozygous state. The authors determined the ..beta..-thalassemia mutations in this population by the oligonucleotide-probe method and defined the chromosome haplotypes on which the mutation resides. The same ..beta../sup 39(CAG..-->..TAG)/ nonsense mutation was found on nine different chromosome haplotypes. Although this mutation may have arisen more than once, the multiple haplotypes could also be generated by crossing over and gene conversion events. These findings underscore the frequency of mutational events in the ..beta..-globin gene region.

Individual specific DNA fingerprints from a hypervariable region probe: alpha-globin 3'HVR.

PubMed

Fowler, S J; Gill, P; Werrett, D J; Higgs, D R

1988-06-01

A probe detecting a hypervariable region (HVR) 3' to the alpha globin locus on chromosome 16 has been used to produce DNA fingerprints. Segregation analysis has revealed multiple, randomly dispersed DNA fragments inherited in a Mendelian fashion with minimal allelism and linkage. The fingerprints are highly polymorphic (probability of chance association between random individuals much less than 10(-14]. The probe is, therefore, a powerful discriminating tool: it is envisaged that this probe will have forensic applications, including paternity cases, and will be informative in linkage analysis.

Evidence for adaptive radiation from a phylogenetic study of plant defenses

PubMed Central

Agrawal, Anurag A.; Fishbein, Mark; Halitschke, Rayko; Hastings, Amy P.; Rabosky, Daniel L.; Rasmann, Sergio

2009-01-01

One signature of adaptive radiation is a high level of trait change early during the diversification process and a plateau toward the end of the radiation. Although the study of the tempo of evolution has historically been the domain of paleontologists, recently developed phylogenetic tools allow for the rigorous examination of trait evolution in a tremendous diversity of organisms. Enemy-driven adaptive radiation was a key prediction of Ehrlich and Raven's coevolutionary hypothesis [Ehrlich PR, Raven PH (1964) Evolution 18:586–608], yet has remained largely untested. Here we examine patterns of trait evolution in 51 North American milkweed species (Asclepias), using maximum likelihood methods. We study 7 traits of the milkweeds, ranging from seed size and foliar physiological traits to defense traits (cardenolides, latex, and trichomes) previously shown to impact herbivores, including the monarch butterfly. We compare the fit of simple random-walk models of trait evolution to models that incorporate stabilizing selection (Ornstein-Ulenbeck process), as well as time-varying rates of trait evolution. Early bursts of trait evolution were implicated for 2 traits, while stabilizing selection was implicated for several others. We further modeled the relationship between trait change and species diversification while allowing rates of trait evolution to vary during the radiation. Species-rich lineages underwent a proportionately greater decline in latex and cardenolides relative to species-poor lineages, and the rate of trait change was most rapid early in the radiation. An interpretation of this result is that reduced investment in defensive traits accelerated diversification, and disproportionately so, early in the adaptive radiation of milkweeds. PMID:19805160

β-Thalassemia and Polycythemia vera: targeting chronic stress erythropoiesis.

PubMed

Crielaard, Bart J; Rivella, Stefano

2014-06-01

β-Thalassemia and Polycythemia vera are genetic disorders which affect the synthesis of red blood cells, also referred to as erythropoiesis. Although essentially different in clinical presentation - patients with β-thalassemia have an impairment in β-globin synthesis leading to defective erythrocytes and anemia, while patients with Polycythemia vera present with high hemoglobin levels because of excessive red blood cell synthesis - both pathologies may characterized by lasting high erythropoietic activity, i.e. chronic stress erythropoiesis. In both diseases, therapeutic strategies targeting chronic stress erythropoiesis may improve the address phenotype and prevent secondary pathology, such as iron overload. The current review will address the basic concepts of these strategies to reduce chronic stress erythropoiesis, which may have significant clinical implications in the near future. Copyright © 2014 Elsevier Ltd. All rights reserved.

How Do Trait Dimensions Map onto ADHD Symptom Domains?

ERIC Educational Resources Information Center

Martel, Michelle M.; Nigg, Joel T.; von Eye, Alexander

2009-01-01

Theories of Attention-Deficit/Hyperactivity Disorder (ADHD) implicate dysfunctional regulation mechanisms that have been conceptually grouped into "top-down" control and "bottom-up" affective/reactive processes. This dual-process account can be invoked in relation to temperament or personality traits and may clarify how traits relate to ADHD. Two…

A State-trait Analysis of Alpha Density and Personality Variables in a Normal Population

ERIC Educational Resources Information Center

Degood, Douglas E.; Valle, Ronald S.

1975-01-01

This paper examined the relationship of some selected trait measures of personality with resting samples of alpha density in a normal population and the implications of such data for a state-trait approach to alpha and the experiential states associated with alpha. (Author/RK)

Motivational Traits of Elite Young Soccer Players

ERIC Educational Resources Information Center

Stewart, Craig; Meyers, Michael C.

2004-01-01

Among the most overlooked aspects in the development of elite young soccer players is that of specific psychological traits. Of those traits, motivation has important implications for programs whose objectives are identification and cultivation of young, skilled performers. The growth in popularity of soccer by youth and the successes experienced…

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2016-11-30

Thalassemia is an inherited autosomal recessive blood disorder, caused by mutations in globin genes or their regulatory regions. This results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains precipitate in red blood cells, leading to their destruction (haemolysis) and ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the curative potential. This is an update of a previously published Cochrane Review. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 18 August 2016. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

Monitoring exposure to acrylonitrile using adducts with N-terminal valine in hemoglobin.

PubMed

Osterman-Golkar, S M; MacNeela, J P; Turner, M J; Walker, V E; Swenberg, J A; Sumner, S J; Youtsey, N; Fennell, T R

1994-12-01

Human exposure to acrylonitrile (ACN), a carcinogen in rats, may occur in industrial settings, through waste water and tobacco smoke. ACN is an electrophilic compound and binds covalently to nucleophilic sites in macromolecules. Measurements of adducts with hemoglobin could be utilized for improved exposure assessments. In this study, a method for quantification of N-(2-cyanoethyl)valine (CEVal), the product of reaction of ACN with N-terminal valine in hemoglobin has been developed. The method is based on the N-alkyl Edman procedure, which involves derivatization of the globin with pentafluorophenyl isothiocyanate and gas chromatographic-mass spectrometric analysis of the resulting thiohydantoin. An internal standard was prepared by reacting valylglycylglycine with [2H3]ACN, spiked with [14C]ACN to a known sp. act. Levels of CEVal were measured in globin from rats exposed to 3-300 p.p.m. ACN in drinking water for 105 days and from humans (four smokers and four non-smokers). CEVal was detected at all exposure levels in the drinking water study. The relationship between adduct level and water concentration was linear at concentrations of 10 p.p.m. (corresponding to an average daily uptake of c. 0.74 mg ACN/kg body wt during the 65 days prior to sacrifice) and below, with a slope of 37.7 pmol CEVal/g globin/p.p.m. At higher concentrations, adduct levels increased sublinearly, indicating saturation of a metabolic process for elimination of ACN. Comparison of adduct formation with the estimated dose (mg/kg/day) of ACN indicated that at low dose (0-10 p.p.m.) CEVal = 0.508 x ACN dose + 0.048 and at high dose (35-300 p.p.m.) CEVal = 1.142 x ACN dose - 1.098. Globin from the smokers (10-20 cigarettes/day) contained about 90 pmol CEVal/g, whereas the adduct levels in globin from non-smokers were below the detection limit. The analytical sensitivity should be sufficient to allow monitoring of occupationally exposed workers at levels well below the current Occupational Safety and Health Administration standard of 2 p.p.m.

Novel Antimicrobial Peptides That Inhibit Gram Positive Bacterial Exotoxin Synthesis

PubMed Central

Merriman, Joseph A.; Nemeth, Kimberly A.; Schlievert, Patrick M.

2014-01-01

Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges. PMID:24748386

Red blood cells free α-haemoglobin pool: a biomarker to monitor the β-thalassemia intermedia variability. The ALPHAPOOL study.

PubMed

Vasseur, Corinne; Domingues-Hamdi, Elisa; Ledudal, Katia; Le Corvoisier, Philippe; Barau, Caroline; Ghaleh, Bijan; Rialland, Amandine; Pissard, Serge; Galactéros, Frédéric; Baudin-Creuza, Véronique

2017-10-01

The severity of β-thalassaemia (β-thal) intermedia is mainly correlated to the degree of imbalanced α/non α-globin chain synthesis. The phenotypic diversity of β-thal depends on this imbalance and reflects all possible combinations of α- and β-globin genotypes, levels of fetal haemoglobin (HbF) and co-inheritance of other modulating factors. This study aimed to demonstrate the validity of a new surrogate of α/non α-globin biosynthetic ratio by measuring the soluble α-Hb pool in lysed red blood cells. Our results confirm that the α-Hb pool measurement allows a good discrimination between β-thal intermedia patients, controls and α-thal patients (P < 0·003). Receiver operator characteristic analyses revealed an area under the curve of 0·978 for the α-Hb pool measurement at a threshold of 120 ng free α-Hb/mg of total Hb/ml of haemolysate (ppm) with a sensitivity and specificity of 86% and 100%, respectively, to discriminate between β-thal and not β-thal subjects. Significant correlations were observed between the α-Hb pool and biological parameters of β-thal, the most significant association being observed with red cell hexokinase activity. This study indicates that the α-Hb pool could be a new marker for assistance in diagnostic orientation of β-thal intermedia patients and may be clinically useful for monitoring the evolution of the disequilibrium of globin synthesis in response to treatments. © 2017 John Wiley & Sons Ltd.

Molecular Mechanism of Yisui Shengxue Granule, a Complex Chinese Medicine, on Thalassemia Patients Suffering from Hemolysis and Anemia of Erythrocytes

PubMed Central

Chu, Na-Li; Wu, Zhi-kui; Zhang, Xin-Hua; Fang, Su-Ping; Wang, Wen-Juan; Cheng, Yan-Ling

2014-01-01

The objective of this study was to investigate the therapeutic biological mechanism of Yisui Shengxue Granule (YSSXG), a complex Chinese medicine, on the hemolysis and anemia of erythrocytes from patient with thalassemia disease. Sixteen patients with thalassemia (8 cases of α-thalassemia and 8 cases of β-thalassemia) disease were collected and treated with YSSXG for 3 months. The improvements of blood parameter demonstrated that YSSXG had a positive clinical effect on patients with thalassemia disease. For patients with α-thalassemia disease, RT-PCR showed that YSSXG upregulated the relative mRNA expression level of α-globin to β-globin and downregulated DNMT1, DNMT3a, and DNMT3b mRNA compared with pretreatment. Western blotting showed that YSSXG downregulated the expression of DNMT1 and DNMT3a. For patients with β-thalassemia disease, the relative expression level of A γ-globin to α-globin had an increasing trend and the level of BCL11A mRNA expression obviously increased. For all patients, RT-PCR showed that YSSXG upregulated mRNA expression of SPTA1 and SPTB. Activities of SOD and GSH-Px significantly increased and MDA obviously reduced on erythrocyte and blood serum after YSSXG treatment. TEM showed that YSSXG decreased the content of inclusion bodies. Activities of Na+K+-ATPtase and T-ATPtase of erythrocyte increased significantly after YSSXG treatment. This study provides the basis for mechanisms of YSSXG on thalassemia suffering with hemolysis and anemia of erythrocytes from patient. PMID:25574177

Sequential changes in chromatin structure during transcriptional activation in the beta globin LCR and its target gene.

PubMed

Kim, Kihoon; Kim, AeRi

2010-09-01

Chromatin structure is modulated during transcriptional activation. The changes include the association of transcriptional activators, formation of hypersensitive sites and covalent modifications of histones. To understand the order of the various changes accompanying transcriptional activation, we analyzed the mouse beta globin gene, which is transcriptionally inducible in erythroid MEL cells over a time course of HMBA treatment. Transcription of the globin genes requires the locus control region (LCR) consisting of several hypersensitive sites (HSs). Erythroid specific transcriptional activators such as NF-E2, GATA-1, TAL1 and EKLF were associated with the LCR in the uninduced state before transcriptional activation. The HSs of the LCR were formed in this state as revealed by high sensitivity to DNase I and MNase attack. However the binding of transcriptional activators and the depletion of histones were observed in the promoter of the beta globin gene only after transcriptional activation. In addition, various covalent histone modifications were sequentially detected in lysine residues of histone H3 during the activation. Acetylation of K9, K36 and K27 was notable in both LCR HSs and gene after induction but before transcriptional initiation. Inactive histone marks such as K9me2, K36me2 and K27me2 were removed coincident with transcriptional initiation in the gene region. Taken together, these results indicate that LCR has a substantially active structure in the uninduced state while transcriptional activation serially adds active marks, including histone modifications, and removes inactive marks in the target gene of the LCR. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Stabilization and cytoskeletal-association of LDL receptor mRNA are mediated by distinct domains in its 3' untranslated region.

PubMed

Wilson, G M; Vasa, M Z; Deeley, R G

1998-05-01

The mRNA encoding the human low density lipoprotein (LDL) receptor is transiently stabilized after phorbol ester treatment of HepG2 cells and has been shown to associate with components of the cytoskeleton in this cell line (G. M. Wilson, E. A. Roberts, and R. G. Deeley, J. Lipid Res. 1997. 38: 437-446). Using an episomal expression system, fragments of the 3' untranslated region (3'UTR) of LDL receptor mRNA were transcribed in fusion with the coding region of beta-globin mRNA in HepG2 cells. Analyses of the decay kinetics of these beta-globin-LDL receptor fusion mRNA deletion mutants showed that sequences in the proximal 3'UTR of LDL receptor mRNA including several AU-rich elements (AREs) were sufficient to confer short constitutive mRNA half-life in the heterologous system. Stabilization of LDL receptor mRNA in the presence of PMA required sequences in the distal 3'UTR, at or near three Alu-like repetitive elements. Furthermore, the 3'UTR of LDL receptor mRNA conferred cytoskeletal association on the otherwise unassociated beta-globin mRNA, by a mechanism involving at least two distinct RNA elements. Comparisons of decay kinetics and subcellular localization of endogenous LDL receptor mRNA and beta-globin-LDL receptor mRNA fusions in HepG2 cells have demonstrated that several cis-acting elements in the receptor 3'UTR contribute to post-transcriptional regulation of receptor expression, and provide further support for involvement of the cytoskeleton in the regulation of LDL receptor mRNA turnover.

Gene Addition Strategies for β-Thalassemia and Sickle Cell Anemia.

PubMed

Dong, Alisa C; Rivella, Stefano

2017-01-01

Beta-thalassemia and sickle cell anemia are two of the most common diseases related to the hemoglobin protein. In these diseases, the beta-globin gene is mutated, causing severe anemia and ineffective erythropoiesis. Patients can additionally present with a number of life-threatening co-morbidities, such as stroke or spontaneous fractures. Current treatment involves transfusion and iron chelation; allogeneic bone marrow transplant is the only curative option, but is limited by the availability of matching donors and graft-versus-host disease. As these two diseases are monogenic diseases, they make an attractive setting for gene therapy. Gene therapy aims to correct the mutated beta-globin gene or add back a functional copy of beta- or gamma-globin. Initial gene therapy work was done with oncoretroviral vectors, but has since shifted to lentiviral vectors. Currently, there are a few clinical trials underway to test the curative potential of some of these lentiviral vectors. This review will highlight the work done thus far, and present the challenges still facing gene therapy, such as genome toxicity concerns and achieving sufficient transgene expression to cure those with the most severe forms of thalassemia.

Expression of transcription factors during sodium phenylacetate induced erythroid differentiation in K562 cells.

PubMed

Rath, A V; Schmahl, G E; Niemeyer, C M

1997-01-01

During 15 days of treatment of K562 cells with sodium phenylacetate, we observed an increase in the cellular hemoglobin concentration with a similar increase in the expression of gamma-globin mRNA. Morphological studies demonstrated characteristic features of erythroid differentiation and maturation. At the same time there was no change in the level of expression of the cell surface antigenes CD33, CD34, CD45, CD71 and glycophorin A. Likewise, the level of expression of the erythroid transcription factors GATA-1, GATA-2, NF-E2, SCL and RBTN2, all expressed in untreated K562 cells, did not increase during sodium phenylacetate induced erythroid differentiation. The expression of the nuclear factors Evi-1 and c-myb, known to inhibit erythroid differentiation, did not decrease. We conclude that sodium phenylacetate treatment of K562 cells increases gamma-globin mRNA and induces cell maturation as judged by morphology without affecting the expression of the erythroid transcription factors, some of which are known to be involved in the regulation of beta-like globin genes.

Dynamics of active sites in biological macromolecules using a Green-function approach: An application to heme vibrational dynamics in myoglobin

NASA Astrophysics Data System (ADS)

Rai, Brajesh; Prohofsky, Earl

2003-03-01

Dynamics of functionally active regions of biological macromolecules can be studied using a Green-function technique. This approach uses the fact that in most cases one has a good set of force constants for active sites, and rather poorly defined force field parameters for other regions of the macromolecule. The Green-function method is applied to study the iron vibrational modes of the heme active site in myoglobin. In this approach, the heme active site is viewed as a system interacting with surrounding globin, which acts as an excitation bath. The normal modes of heme and globin are separately calculated using the best available force fields for the two entities. The iron vibrational spectrum of myoglobin is then obtained using the solutions of the heme and globin, and by considering physically meaningful interactions between the two units. The refinement of the Green-function calculations to the experimental data from an x-ray synchrotron-based Nuclear Resonance Vibrational Spectroscopy provides important insights into the character of iron normal modes of myoglobin.

A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.

PubMed

Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica

2016-01-01

Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.

Hb Dartmouth (HBA2: c.200T>C): An α2-Globin Gene Associated with Hb H Disease in One Homozygous Patient.

PubMed

Farashi, Samaneh; Faramarzi Garous, Negin; Ashki, Mehri; Vakili, Shadi; Zeinali, Fatemah; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2015-01-01

Hb H (β4) disease is caused by deletion or inactivation of three out of four α-globin genes. A high incidence of Hb H disease has been reported all over the world. There is a wide spectrum of phenotypic presentations, from clinically asymptomatic to having significant hepatosplenomegaly and requiring occasional or even regular blood transfusions, even more severe anemia, Hb Bart's (γ4) hydrops fetalis syndrome that can cause death in the affected fetuses late in gestation. We here present a case who was diagnosed with Hb H disease that represents a new genotype for this hereditary disorder. Hb Dartmouth is a variant caused by a missense mutation at codon 66 of the α2-globin gene (HBA2: c.200T>C), resulting in the substitution of leucine by proline. We here emphasize the importance of this point mutation involving Hb H disease and also the necessity for prenatal diagnosis (PND) for those who carry this point mutation in the heterozygous state.

Discovery of phenylsulfonylfuroxan derivatives as gamma globin inducers by histone acetylation.

PubMed

Melo, Thais Regina Ferreira de; Kumkhaek, Chutima; Fernandes, Guilherme Felipe Dos Santos; Lopes Pires, Maria Elisa; Chelucci, Rafael Consolin; Barbieri, Karina Pereira; Coelho, Fernanda; Capote, Ticiana Sidorenko de Oliveira; Lanaro, Carolina; Carlos, Iracilda Zeppone; Marcondes, Sisi; Chegaev, Konstantin; Guglielmo, Stefano; Fruttero, Roberta; Chung, Man Chin; Costa, Fernando Ferreira; Rodgers, Griffin P; Dos Santos, Jean Leandro

2018-05-28

N-oxide derivatives 5(a-b), 8(a-b), and 11(a-c) were designed, synthesized and evaluated in vitro and in vivo as potential drugs that are able to ameliorate sickle cell disease (SCD) symptoms. All of the compounds demonstrated the capacity to releasing nitric oxide at different levels ranging from 0.8 to 30.1%, in vivo analgesic activity and ability to reduce TNF-α levels in the supernatants of monocyte cultures. The most active compound (8b) protected 50.1% against acetic acid-induced abdominal constrictions, while dipyrone, which was used as a control only protected 35%. Compounds 8a and 8b inhibited ADP-induced platelet aggregation by 84% and 76.1%, respectively. Both compounds increased γ-globin in K562 cells at 100 μM. The mechanisms involved in the γ-globin increase are related to the acetylation of histones H3 and H4 that is induced by these compounds. In vitro, the most promising compound (8b) was not cytotoxic, mutagenic and genotoxic. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Thalassaemia.

PubMed

Higgs, Douglas R; Engel, James Douglas; Stamatoyannopoulos, George

2012-01-28

Thalassaemia is one of the most common genetic diseases worldwide, with at least 60,000 severely affected individuals born every year. Individuals originating from tropical and subtropical regions are most at risk. Disorders of haemoglobin synthesis (thalassaemia) and structure (eg, sickle-cell disease) were among the first molecular diseases to be identified, and have been investigated and characterised in detail over the past 40 years. Nevertheless, treatment of thalassaemia is still largely dependent on supportive care with blood transfusion and iron chelation. Since 1978, scientists and clinicians in this specialty have met regularly in an international effort to improve the management of thalassaemia, with the aim of increasing the expression of unaffected fetal genes to improve the deficiency in adult β-globin synthesis. In this Seminar we discuss important advances in the understanding of the molecular and cellular basis of normal and abnormal expression of globin genes. We will summarise new approaches to the development of tailored pharmacological agents to alter regulation of globin genes, the first trial of gene therapy for thalassaemia, and future prospects of cell therapy. Copyright © 2012 Elsevier Ltd. All rights reserved.

Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays.

PubMed

Kho, S L; Chua, K H; George, E; Tan, J A M A

2013-07-15

Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.

Shared activity patterns arising at genetic susceptibility loci reveal underlying genomic and cellular architecture of human disease.

PubMed

Baillie, J Kenneth; Bretherick, Andrew; Haley, Christopher S; Clohisey, Sara; Gray, Alan; Neyton, Lucile P A; Barrett, Jeffrey; Stahl, Eli A; Tenesa, Albert; Andersson, Robin; Brown, J Ben; Faulkner, Geoffrey J; Lizio, Marina; Schaefer, Ulf; Daub, Carsten; Itoh, Masayoshi; Kondo, Naoto; Lassmann, Timo; Kawai, Jun; Mole, Damian; Bajic, Vladimir B; Heutink, Peter; Rehli, Michael; Kawaji, Hideya; Sandelin, Albin; Suzuki, Harukazu; Satsangi, Jack; Wells, Christine A; Hacohen, Nir; Freeman, Thomas C; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R; Hume, David A

2018-03-01

Genetic variants underlying complex traits, including disease susceptibility, are enriched within the transcriptional regulatory elements, promoters and enhancers. There is emerging evidence that regulatory elements associated with particular traits or diseases share similar patterns of transcriptional activity. Accordingly, shared transcriptional activity (coexpression) may help prioritise loci associated with a given trait, and help to identify underlying biological processes. Using cap analysis of gene expression (CAGE) profiles of promoter- and enhancer-derived RNAs across 1824 human samples, we have analysed coexpression of RNAs originating from trait-associated regulatory regions using a novel quantitative method (network density analysis; NDA). For most traits studied, phenotype-associated variants in regulatory regions were linked to tightly-coexpressed networks that are likely to share important functional characteristics. Coexpression provides a new signal, independent of phenotype association, to enable fine mapping of causative variants. The NDA coexpression approach identifies new genetic variants associated with specific traits, including an association between the regulation of the OCT1 cation transporter and genetic variants underlying circulating cholesterol levels. NDA strongly implicates particular cell types and tissues in disease pathogenesis. For example, distinct groupings of disease-associated regulatory regions implicate two distinct biological processes in the pathogenesis of ulcerative colitis; a further two separate processes are implicated in Crohn's disease. Thus, our functional analysis of genetic predisposition to disease defines new distinct disease endotypes. We predict that patients with a preponderance of susceptibility variants in each group are likely to respond differently to pharmacological therapy. Together, these findings enable a deeper biological understanding of the causal basis of complex traits.

Shared activity patterns arising at genetic susceptibility loci reveal underlying genomic and cellular architecture of human disease

PubMed Central

Gray, Alan; Neyton, Lucile P. A.; Barrett, Jeffrey; Stahl, Eli A.; Tenesa, Albert; Andersson, Robin; Brown, J. Ben; Faulkner, Geoffrey J.; Lizio, Marina; Schaefer, Ulf; Daub, Carsten; Kondo, Naoto; Lassmann, Timo; Kawai, Jun; Kawaji, Hideya; Suzuki, Harukazu; Satsangi, Jack; Wells, Christine A.; Hacohen, Nir; Freeman, Thomas C.; Hayashizaki, Yoshihide; Forrest, Alistair R. R.; Hume, David A.

2018-01-01

Genetic variants underlying complex traits, including disease susceptibility, are enriched within the transcriptional regulatory elements, promoters and enhancers. There is emerging evidence that regulatory elements associated with particular traits or diseases share similar patterns of transcriptional activity. Accordingly, shared transcriptional activity (coexpression) may help prioritise loci associated with a given trait, and help to identify underlying biological processes. Using cap analysis of gene expression (CAGE) profiles of promoter- and enhancer-derived RNAs across 1824 human samples, we have analysed coexpression of RNAs originating from trait-associated regulatory regions using a novel quantitative method (network density analysis; NDA). For most traits studied, phenotype-associated variants in regulatory regions were linked to tightly-coexpressed networks that are likely to share important functional characteristics. Coexpression provides a new signal, independent of phenotype association, to enable fine mapping of causative variants. The NDA coexpression approach identifies new genetic variants associated with specific traits, including an association between the regulation of the OCT1 cation transporter and genetic variants underlying circulating cholesterol levels. NDA strongly implicates particular cell types and tissues in disease pathogenesis. For example, distinct groupings of disease-associated regulatory regions implicate two distinct biological processes in the pathogenesis of ulcerative colitis; a further two separate processes are implicated in Crohn’s disease. Thus, our functional analysis of genetic predisposition to disease defines new distinct disease endotypes. We predict that patients with a preponderance of susceptibility variants in each group are likely to respond differently to pharmacological therapy. Together, these findings enable a deeper biological understanding of the causal basis of complex traits. PMID:29494619

Parallel evolution of sexual isolation in sticklebacks.

PubMed

Boughman, Janette Wenrick; Rundle, Howard D; Schluter, Dolph

2005-02-01

Mechanisms of speciation are not well understood, despite decades of study. Recent work has focused on how natural and sexual selection cause sexual isolation. Here, we investigate the roles of divergent natural and sexual selection in the evolution of sexual isolation between sympatric species of threespine sticklebacks. We test the importance of morphological and behavioral traits in conferring sexual isolation and examine to what extent these traits have diverged in parallel between multiple, independently evolved species pairs. We use the patterns of evolution in ecological and mating traits to infer the likely nature of selection on sexual isolation. Strong parallel evolution implicates ecologically based divergent natural and/or sexual selection, whereas arbitrary directionality implicates nonecological sexual selection or drift. In multiple pairs we find that sexual isolation arises in the same way: assortative mating on body size and asymmetric isolation due to male nuptial color. Body size and color have diverged in a strongly parallel manner, similar to ecological traits. The data implicate ecologically based divergent natural and sexual selection as engines of speciation in this group.

Bidirectional associations between parenting behavior and child callous-unemotional traits: does parental depression moderate this link?

PubMed

Childs, Amber Wimsatt; Fite, Paula J; Moore, Todd M; Lochman, John E; Pardini, Dustin A

2014-10-01

The current study longitudinally examined bidirectional associations between callous-unemotional (CU) traits and parenting dimensions. This study extended the literature by examining whether parental depression moderated these relations in a pre-adolescent sample. Proposed relations were examined using a longitudinal sample of 120 aggressive children (59.6 % male) who were in the 4th grade (M = 10.56 years, SD = 0.56) at baseline and were followed annually over 4 years. A series of generalized estimating equation (GEE) models were used to examine proposed relations. At the first order level, corporal punishment (p < . 001) and poor supervision/monitoring predicted increases in CU traits (p = 0.03) however, the inverse relations were not found. Importantly, parental depression moderated the link between corporal punishment and CU traits. Specifically, at high levels of depression, corporal punishment was predictive of increases in CU traits, but was unrelated to CU traits at low levels of depression. These findings aid in our understanding of the link between corporal punishment and CU traits by highlighting conditions under which certain parenting behaviors have an impact on CU traits, which in turn, may have important intervention implications. Further clinical implications, limitations and future directions are discussed.

Affective Traits in Schizophrenia and Schizotypy

PubMed Central

Horan, William P.; Blanchard, Jack J.; Clark, Lee Anna; Green, Michael F.

2008-01-01

This article reviews empirical studies of affective traits in individuals with schizophrenia spectrum disorders, population-based investigations of vulnerability to psychosis, and genetic and psychometric high-risk samples. The review focuses on studies that use self-report trait questionnaires to assess Negative Affectivity (NA) and Positive Affectivity (PA), which are conceptualized in contemporary models of personality as broad, temperamentally-based dispositions to experience corresponding emotional states. Individuals with schizophrenia report a pattern of stably elevated NA and low PA throughout the illness course. Among affected individuals, these traits are associated with variability in several clinically important features, including functional outcome, quality of life, and stress reactivity. Furthermore, evidence that elevated NA and low PA (particularly the facet of anhedonia) predict the development of psychosis and are detectable in high-risk samples suggests that these traits play a role in vulnerability to schizophrenia, though they are implicated in other forms of psychopathology as well. Results are discussed in terms of their implications for treatment, etiological models, and future research to advance the study of affective traits in schizophrenia and schizotypy. PMID:18667393

Co-inheritance of α-thalassaemia and β-thalassaemia in a prenatal screening population in mainland China.

PubMed

Li, Jian; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi

2014-12-01

To determine the prevalence of α-thalassaemia in β-thalassaemia individuals in a Chinese population. The standard diagnostic marker for β-thalassaemia was elevation of the Hb A2 level (>3.5%) with low mean corpuscular volume. The common α-thalassaemia mutations were studied by molecular analysis in all identified β-thalassaemia carriers. A prevalence rate of 3.3% for β-thalassaemia was found in our population; α- and β-thalassaemia interactions were found to co-exist in 17.8% of the β-thalassaemia carriers. The -SEA deletion was the most common α-thalassaemia mutation co-inherited with β-thalassaemia, followed by the -α3.7 deletion, the -α4.2 deletion, Hb Quong Sze, and Hb Constant Spring. Our results suggest that it could be valuable to study co-existing α-globin mutations in subjects with β-thalassaemia trait in a prenatal screening programme, especially in populations with a high prevalence of haemoglobinopathies. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Sickle cell disease caused by Hb S/Québec-CHORI: treatment with hydroxyurea and response.

PubMed

Tubman, Venée N; Bennett, Carolyn M; Luo, Hong-yuan; Chui, David H K; Heeney, Matthew M

2007-08-01

Sickle hemoglobin (Hb S;betaGlu 6 Val) is due to an A>T transversion in codon 6 of the beta-globin gene. Other variant hemoglobins mimic Hb A, S, or C on newborn screening and clinical laboratory diagnostic tools, thus making their correct identification potentially difficult. Sickling disorders can result in individuals who are compound heterozygous for beta-globin mutations (e.g., Hb SC, HbSO(Arab)). The authors report a second case of HbS/Québec-CHORI, a severe compound heterozygous sickling disorder and their experience managing this patient with hydroxyurea.

Oxidative stress in β-thalassaemia and sickle cell disease

PubMed Central

Voskou, S.; Aslan, M.; Fanis, P.; Phylactides, M.; Kleanthous, M.

2015-01-01

Sickle cell disease and β-thalassaemia are inherited haemoglobinopathies resulting in structural and quantitative changes in the β-globin chain. These changes lead to instability of the generated haemoglobin or to globin chain imbalance, which in turn impact the oxidative environment both intracellularly and extracellularly. The ensuing oxidative stress and the inability of the body to adequately overcome it are, to a large extent, responsible for the pathophysiology of these diseases. This article provides an overview of the main players and control mechanisms involved in the establishment of oxidative stress in these haemoglobinopathies. PMID:26285072

Drought and increased CO2 alter floral visual and olfactory traits with context-dependent effects on pollinator visitation

Treesearch

William R. Glenny; Justin B. Runyon; Laura A. Burkle

2018-01-01

Climate change can alter species interactions essential for maintaining biodiversity and ecosystem function, such as pollination. Understanding the interactive effects of multiple abiotic conditions on floral traits and pollinator visitation are important to anticipate the implications of climate change on pollinator services. Floral visual and olfactory traits were...

Theoretical Analysis of Occupational Development Aspects from the Viewpoint of the Personality's Constant Individual Traits Concept

ERIC Educational Resources Information Center

Wilsz, Jolanta

2015-01-01

The concept of personality's constant individual traits and its significance, as well as implications for problems connected with choosing an occupation have been presented in the paper. Selected theories of occupational development have been analyzed from the concept viewpoint and certain traits of occupational personality presented by authors of…

The shadows in healthcare leadership.

PubMed

Nigro, Tracey Lynn

2018-05-01

This article outlines personality traits such as psychopathy, narcissism, Machiavellianism, and sadism which, when elevated in health leaders, may have negative effects upon teams, the organizations they work for, and ultimately the public. The implications of such traits for specific core health leadership competency domains are explored as well as potential mitigation approaches to minimize and possibly redirect such personality traits.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Postnatal and non-invasive prenatal detection of β-thalassemia mutations based on Taqman genotyping assays

PubMed Central

Breveglieri, Giulia; Travan, Anna; D’Aversa, Elisabetta; Cosenza, Lucia Carmela; Pellegatti, Patrizia; Guerra, Giovanni; Gambari, Roberto

2017-01-01

The β-thalassemias are genetic disorder caused by more than 200 mutations in the β-globin gene, resulting in a total (β0) or partial (β+) deficit of the globin chain synthesis. The most frequent Mediterranean mutations for β-thalassemia are: β039, β+IVSI-110, β+IVSI-6 and β0IVSI-1. Several molecular techniques for the detection of point mutations have been developed based on the amplification of the DNA target by polymerase chain reaction (PCR), but they could be labor-intensive and technically demanding. On the contrary, TaqMan® genotyping assays are a simple, sensitive and versatile method suitable for the single nucleotide polymorphism (SNP) genotyping affecting the human β-globin gene. Four TaqMan® genotyping assays for the most common β-thalassemia mutations present in the Mediterranean area were designed and validated for the genotype characterization of genomic DNA extracted from 94 subjects comprising 25 healthy donors, 33 healthy carriers and 36 β-thalassemia patients. In addition, 15 specimens at late gestation (21–39 gestational weeks) and 11 at early gestation (5–18 gestational weeks) were collected from pregnant women, and circulating cell-free fetal DNAs were extracted and analyzed with these four genotyping assays. We developed four simple, inexpensive and versatile genotyping assays for the postnatal and prenatal identification of the thalassemia mutations β039, β+IVSI-110, β+IVSI-6, β0IVSI-1. These genotyping assays are able to detect paternally inherited point mutations in the fetus and could be efficiently employed for non-invasive prenatal diagnosis of β-globin gene mutations, starting from the 9th gestational week. PMID:28235086

Molecular analysis and association with clinical and laboratory manifestations in children with sickle cell anemia

PubMed Central

Camilo-Araújo, Roberta Faria; Amancio, Olga Maria Silverio; Figueiredo, Maria Stella; Cabanãs-Pedro, Ana Carolina; Braga, Josefina Aparecida Pellegrini

2014-01-01

Objectives To analyze the frequency of βS-globin haplotypes and alpha-thalassemia, and their influence on clinical manifestations and the hematological profile of children with sickle cell anemia. Method The frequency of βS-globin haplotypes and alpha-thalassemia and any association with clinical and laboratorial manifestations were determined in 117 sickle cell anemia children aged 3–71 months. The confirmation of hemoglobin SS and determination of the haplotypes were achieved by polymerase chain reaction-restriction fragment length polymorphism, and alpha-thalassemia genotyping was by multiplex polymerase chain reaction (single-tube multiplex-polymerase chain reaction). Results The genotype distribution of haplotypes was 43 (36.7%) Central African Republic/Benin, 41 (35.0%) Central African Republic/Central African Republic, 20 (17.0%) Rare/atypical, and 13 (11.1%) Benin/Benin. The frequency of the α3.7 deletion was 1.71% as homozygous (−α3.7/−α3.7) and 11.9% as heterozygous (−α3.7/αα). The only significant association in respect to haplotypes was related to the mean corpuscular volume. The presence of alpha-thalassemia was significantly associated to decreases in mean corpuscular volume, mean corpuscular hemoglobin and reticulocyte count and to an increase in the red blood cell count. There were no significant associations of βS-globin haplotypes and alpha-thalassemia with clinical manifestations. Conclusions In the study population, the frequency of alpha-thalassemia was similar to published data in Brazil with the Central African Republic haplotype being the most common, followed by the Benin haplotype. βS-globin haplotypes and interaction between alpha-thalassemia and sickle cell anemia did not influence fetal hemoglobin concentrations or the number of clinical manifestations. PMID:25305165

Human beta-globin mRNAs that harbor a nonsense codon are degraded in murine erythroid tissues to intermediates lacking regions of exon I or exons I and II that have a cap-like structure at the 5' termini.

PubMed Central

Lim, S K; Maquat, L E

1992-01-01

Previous studies have demonstrated that nonsense codons within beta zero-thalassemic or in vitro-mutagenized human beta-globin transgenes result in the production of mRNAs that are degraded abnormally rapidly in the cytoplasm of murine erythroid cells. As a consequence, three RNA degradative intermediates are formed that lack sequences from either exon I or exons I and II. We show here that the intermediates, like the full-length mRNA from which they derive and the endogenous murine beta maj-globin mRNA, bind to the anticap monoclonal antibody H-20 in a way that is competed by the cap analogue m7G and eliminated by prior exposure to tobacco acid pyrophosphatase. Furthermore, the intermediates, like the two full-length mRNAs, are resistant to a 5'----3' exonuclease activity isolated from HeLa cell nuclei that degrades uncapped but not capped ribopolymers. Based on these observations, the intermediates appear to possess a structure that is indistinguishable from the cap at the 5' end of mRNA, i.e. a methylated nucleoside that is linked to the RNA by a 5'-5' phosphodiester bond. Detection of the intermediates during murine development was concomitant with detection of full-length thalassemic mRNA. Intermediate production appears to be influenced by RNA structure as indicated by the products that derive from a beta zero-thalassemic beta-globin transgene harboring a structural alteration (a 4 bp deletion) that was larger than any of those previously studied. Images PMID:1324170

Potentially Therapeutic Levels of Anti-Sickling Globin Gene Expression Following Lentivirus-mediated Gene Transfer in Sickle Cell Disease Bone Marrow CD34+ Cells

PubMed Central

Urbinati, Fabrizia; Hargrove, Philip W.; Geiger, Sabine; Romero, Zulema; Wherley, Jennifer; Kaufman, Michael L.; Hollis, Roger P.; Chambers, Christopher B.; Persons, Derek A.; Kohn, Donald B.; Wilber, Andrew

2015-01-01

Sickle cell disease (SCD) can be cured by allogeneic hematopoietic stem cell (HSC) transplant. However, this is only possible when a matched donor is available making the development of gene therapy using autologous HSCs a highly desired alternative. We used a culture model of human erythropoiesis to directly compare two insulated, self-inactivating, and erythroid-specific lentiviral vectors, encoding for γ-globin (V5m3-400) or a modified β-globin (βAS3-FB) for production of anti-sickling hemoglobin (Hb) and correction of red cell deformability after deoxygenation. Bone marrow CD34+ cells from three SCD patients were transduced using V5m3-400 or βAS3-FB and compared to mock transduced SCD or healthy donor CD34+ cells. Lentiviral transduction did not impair cell growth or differentiation, as gauged by proliferation and acquisition of erythroid markers. Vector copy number averaged ~1 copy per cell and corrective globin mRNA levels were increased more than 7-fold over mock-transduced controls. Erythroblasts derived from healthy donor and mock-transduced SCD cells produced a low level of HbF that was increased to 23.6 ± 4.1% per vector copy for cells transduced with V5m3-400. Equivalent levels of modified HbA of 17.6 ± 3.8% per vector copy were detected for SCD cells transduced with βAS3-FB. These levels of anti-sickling Hb production were sufficient to reduce sickling of terminal stage RBCs upon deoxygenation. We conclude that the achieved levels of HbF and modified HbA would likely prove therapeutic to SCD patients who lack matched donors. PMID:25681747

Adult, embryonic and fetal hemoglobin are expressed in human glioblastoma cells.

PubMed

Emara, Marwan; Turner, A Robert; Allalunis-Turner, Joan

2014-02-01

Hemoglobin is a hemoprotein, produced mainly in erythrocytes circulating in the blood. However, non-erythroid hemoglobins have been previously reported in other cell types including human and rodent neurons of embryonic and adult brain, but not astrocytes and oligodendrocytes. Human glioblastoma multiforme (GBM) is the most aggressive tumor among gliomas. However, despite extensive basic and clinical research studies on GBM cells, little is known about glial defence mechanisms that allow these cells to survive and resist various types of treatment. We have shown previously that the newest members of vertebrate globin family, neuroglobin (Ngb) and cytoglobin (Cygb), are expressed in human GBM cells. In this study, we sought to determine whether hemoglobin is also expressed in GBM cells. Conventional RT-PCR, DNA sequencing, western blot analysis, mass spectrometry and fluorescence microscopy were used to investigate globin expression in GBM cell lines (M006x, M059J, M059K, M010b, U87R and U87T) that have unique characteristics in terms of tumor invasion and response to radiotherapy and hypoxia. The data showed that α, β, γ, δ, ζ and ε globins are expressed in all tested GBM cell lines. To our knowledge, we are the first to report expression of fetal, embryonic and adult hemoglobin in GBM cells under normal physiological conditions that may suggest an undefined function of those expressed hemoglobins. Together with our previous reports on globins (Ngb and Cygb) expression in GBM cells, the expression of different hemoglobins may constitute a part of series of active defence mechanisms supporting these cells to resist various types of treatments including chemotherapy and radiotherapy.

Effects of common hemoglobin variants on HbA1c measurements in China: results for α- and β-globin variants measured by six methods.

PubMed

Xu, Anping; Chen, Weidong; Xia, Yong; Zhou, Yu; Ji, Ling

2018-04-07

HbA1c is a widely used biomarker for diabetes mellitus management. Here, we evaluated the accuracy of six methods for determining HbA1c values in Chinese patients with common α- and β-globin chains variants in China. Blood samples from normal subjects and individuals exhibiting hemoglobin variants were analyzed for HbA1c, using Sebia Capillarys 2 Flex Piercing (C2FP), Bio-Rad Variant II Turbo 2.0, Tosoh HLC-723 G8 (ver. 5.24), Arkray ADAMS A1c HA-8180V fast mode, Cobas c501 and Trinity Ultra2 systems. DNA sequencing revealed five common β-globin chain variants and three common α-globin chain variants. The most common variant was Hb E, followed by Hb New York, Hb J-Bangkok, Hb G-Coushatta, Hb Q-Thailand, Hb G-Honolulu, Hb Ube-2 and Hb G-Taipei. Variant II Turbo 2.0, Ultra2 and Cobas c501 showed good agreement with C2FP for most samples with variants. HLC-723 G8 yielded no HbA1c values for Hb J-Bangkok, Hb Q-Thailand and Hb G-Honolulu. Samples with Hb E, Hb G-Coushatta, Hb G-Taipei and Hb Ube-2 produced significant negative biases for HLC-723 G8. HA-8180V showed statistically significant differences for Hb E, Hb G-Coushatta, Hb G-Taipei, Hb Q-Thailand and Hb G-Honolulu. HA-8180V yielded no HbA1c values for Hb J-Bangkok. All methods showed good agreement for samples with Hb New York. Some common hemoglobin variants can interfere with HbA1c determination by the most popular methods in China.

A cybernetic model of global personality traits.

PubMed

Van Egeren, Lawrence F

2009-05-01

Neurobehavioral studies of human and animal temperament have shed light on how individual personality traits influence human actions. This approach, however, leaves open questions about how the entire system of traits and temperaments function together to exercise control. To address this key issue, I describe a cybernetic model of control and then apply it to the Big Five (B5) personality traits. Employing evidence from descriptive trait terms, temperamental behavioral processes associated with traits, and empirical correlates of traits, I relate distinct cybernetic processes of self-regulation to the B5 traits. The B5 traits broadly parallel basic cybernetic self-regulation processes. For example, the core behavior activation property of the B5 Extraversion trait can be mapped onto the device output function of automated cybernetic control systems. Implications and limitations of interpreting personality traits in self-regulation terms are discussed.

Genomic variants in the ASS1 gene, involved in the nitric oxide biosynthesis and signaling pathway, predict hydroxyurea treatment efficacy in compound sickle cell disease/β-thalassemia patients.

PubMed

Chalikiopoulou, Constantina; Tavianatou, Anastasia-Gerasimoula; Sgourou, Argyro; Kourakli, Alexandra; Kelepouri, Dimitra; Chrysanthakopoulou, Maria; Kanelaki, Vasiliki-Kaliopi; Mourdoukoutas, Evangelos; Siamoglou, Stavroula; John, Anne; Symeonidis, Argyris; Ali, Bassam R; Katsila, Theodora; Papachatzopoulou, Adamantia; Patrinos, George P

2016-03-01

Hemoglobinopathies exhibit a remarkable phenotypic diversity that restricts any safe association between molecular pathology and clinical outcomes. Herein, we explored the role of genes involved in the nitric oxide biosynthesis and signaling pathway, implicated in the increase of fetal hemoglobin levels and response to hydroxyurea treatment, in 119 Hellenic patients with β-type hemoglobinopathies. We show that two ASS1 genomic variants (namely, rs10901080 and rs10793902) can serve as pharmacogenomic biomarkers to predict hydroxyurea treatment efficacy in sickle cell disease/β-thalassemia compound heterozygous patients. These markers may exert their effect by inducing nitric oxide biosynthesis, either via altering splicing and/or miRNA binding, as predicted by in silico analysis, and ultimately, increase γ-globin levels, via guanylyl cyclase targeting.

A network of amygdala connections predict individual differences in trait anxiety.

PubMed

Greening, Steven G; Mitchell, Derek G V

2015-12-01

In this study we demonstrate that the pattern of an amygdala-centric network contributes to individual differences in trait anxiety. Individual differences in trait anxiety were predicted using maximum likelihood estimates of amygdala structural connectivity to multiple brain targets derived from diffusion-tensor imaging (DTI) and probabilistic tractography on 72 participants. The prediction was performed using a stratified sixfold cross validation procedure using a regularized least square regression model. The analysis revealed a reliable network of regions predicting individual differences in trait anxiety. Higher trait anxiety was associated with stronger connections between the amygdala and dorsal anterior cingulate cortex, an area implicated in the generation of emotional reactions, and inferior temporal gyrus and paracentral lobule, areas associated with perceptual and sensory processing. In contrast, higher trait anxiety was associated with weaker connections between amygdala and regions implicated in extinction learning such as medial orbitofrontal cortex, and memory encoding and environmental context recognition, including posterior cingulate cortex and parahippocampal gyrus. Thus, trait anxiety is not only associated with reduced amygdala connectivity with prefrontal areas associated with emotion modulation, but also enhanced connectivity with sensory areas. This work provides novel anatomical insight into potential mechanisms behind information processing biases observed in disorders of emotion. © 2015 Wiley Periodicals, Inc.

Psychopathy and interests: Implications of psychopathic personality traits for vocational and avocational preferences.

PubMed

Nagel, Madeline G; Watts, Ashley L; Murphy, Brett A; Lilienfeld, Scott O

2018-06-21

General personality traits and interests, both vocational and avocational, have long been considered intertwined constructs. Nevertheless, the linkages between personality disorder features, such as psychopathy, and interests are poorly understood. This study bridges this gap by examining how psychopathic traits relate to vocational and avocational interests, and to what extent these associations are distinctive to psychopathy as opposed to a broader pattern of general and abnormal personality traits. In a sample of 426 community participants, Psychopathic Personality Inventory-Revised Fearless Dominance features of psychopathy were associated with interest in a broad swath of vocational and avocational interests, whereas Self-Centered Impulsivity features were associated with realistic, artistic, enterprising, and conventional interests; most zero-order associations were in the small to medium range. Coldheartedness and the factors derived from the Levenson Self-Report Psychopathy Scale were largely unrelated to interests, although there were several notable exceptions. Narcissistic traits, as well as HEXACO (Honesty-Humility, Emotionality, Extraversion, Agreeableness, Conscientiousness, and Openness) Honesty-Humility, Extraversion, and Openness to Experience, were also related broadly to interests. The patterns of interests associated with personality disorder traits may ultimately bear practical implications for interventions as individuals seek out positions or hobbies that suit their traits. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Future directions in personality, occupational and medical selection: myths, misunderstandings, measurement, and suggestions.

PubMed

Ferguson, Eamonn; Lievens, Filip

2017-05-01

This paper has two objectives: (1) presenting recent advances in personality theory whereby personality traits are conceptualized within a framework that focuses on the dynamic interactions of behaviour, biology, context, and states, and (2) discussing the implications of these developments for measurement and medical selection. We start by presenting evidence that traits are no longer regarded as stable deterministic predictors of behaviour. Instead, traits are found to change across generations, the life span, and in response to environmental contingencies. Thus, there is an urgent need to explore how traits change as function of medical education. Second, drawing on recent theory and research (behavioural reaction norms and the density distribution model) we highlight evidence to show how the expression of trait relevant behaviour is dependent on context, and is distributed with an average (typical behaviour or personality) and a variance (plasticity or adaptability), with traditional personality measure associated with typical responding. Third, we demystify that some traits are better than others showing that so-called "good" traits have a dark-side. Fourth, we show how these developments impact on how personality might be assessed, thereby presenting recent evidence on the use of contextualized personality measures, situational judgment tests, other reports, and implicit measures. Throughout the paper, we outline the key implications of these developments for medical selection practices.

The cultural implications of growth: Modeling nonlinear interaction of trait selection and population dynamics

NASA Astrophysics Data System (ADS)

Antoci, Angelo; Galeotti, Marcello; Russu, Paolo; Luigi Sacco, Pier

2018-05-01

In this paper, we study a nonlinear model of the interaction between trait selection and population dynamics, building on previous work of Ghirlanda et al. [Theor. Popul. Biol. 77, 181-188 (2010)] and Antoci et al. [Commun. Nonlinear Sci. Numer. Simul. 58, 92-106 (2018)]. We establish some basic properties of the model dynamics and present some simulations of the fine-grained structure of alternative dynamic regimes for chosen combinations of parameters. The role of the parameters that govern the reinforcement/corruption of maladaptive vs. adaptive traits is of special importance in determining the model's dynamic evolution. The main implication of this result is the need to pay special attention to the structural forces that may favor the emergence and consolidation of maladaptive traits in contemporary socio-economies, as it is the case, for example, for the stimulation of dysfunctional consumption habits and lifestyles in the pursuit of short-term profits.

The cultural implications of growth: Modeling nonlinear interaction of trait selection and population dynamics.

PubMed

Antoci, Angelo; Galeotti, Marcello; Russu, Paolo; Luigi Sacco, Pier

2018-05-01

In this paper, we study a nonlinear model of the interaction between trait selection and population dynamics, building on previous work of Ghirlanda et al. [Theor. Popul. Biol. 77, 181-188 (2010)] and Antoci et al. [Commun. Nonlinear Sci. Numer. Simul. 58, 92-106 (2018)]. We establish some basic properties of the model dynamics and present some simulations of the fine-grained structure of alternative dynamic regimes for chosen combinations of parameters. The role of the parameters that govern the reinforcement/corruption of maladaptive vs. adaptive traits is of special importance in determining the model's dynamic evolution. The main implication of this result is the need to pay special attention to the structural forces that may favor the emergence and consolidation of maladaptive traits in contemporary socio-economies, as it is the case, for example, for the stimulation of dysfunctional consumption habits and lifestyles in the pursuit of short-term profits.

Family functioning and trait emotional intelligence among youth.

PubMed

Alavi, Masoumeh; Mehrinezhad, Seyed Abolghasem; Amini, Mansour; Parthaman Singh, Minder Kaur A/P

2017-01-01

This study explored the relationship between family functioning and trait emotional intelligence among 547 respondents, between the age of 16 and 24 years from Malaysia, Iran, China, Sudan, Somalia, Morocco, the United Kingdom, Germany and the Netherlands. The questionnaires were Family Adaptability and Cohesion Evaluation Scale III and Trait Emotional Intelligence Questionnaire Short Form. Pearson correlation analysis revealed a significant relationship between family functioning and trait emotional intelligence. The higher the family functioning, the higher the trait emotional intelligence among youths. The findings provide a deeper understanding in the field of family functioning and trait emotional intelligence and have implications for parents, administrators and child relationships dealing with trait emotional intelligence.

[Hemolytic anemia due to hemoglobin Evans in an Argentinean family].

PubMed

Zanotto, María I; Calvo, Karina; Schvartzman, Gabriel; Deana, Alejandra; Noguera, Nélida; Bragós, Irma; Milani, Angela

2010-12-01

Unstable hemoglobins are structural variants of the hemoglobin molecule, mostly originated by single amino-acid replacement in some globin chains. These changes affect molecule stability, leading to loss of solubility, precipitation, and cellular lysis. Patients carrying these unstable hemoglobins may present mild to severe chronic hemolytic anemia. Hemoglobin Evans is an unstable variant originated by replacement of valine with methionine at position 62 of the α-globin chain. We have identified this variant in a girl with an acute hemolytic crisis associated to pharyngitis, as well as in two of her family members. This is the third case of hemolytic anemia due to hemoglobin Evans reported in the literature.

Temporal regulation of Stat5 activity in determination of cell differentiation program

PubMed Central

Hoshino, Akemi; Fujii, Hodaka

2007-01-01

Although Stat5 is activated by various cytokines, only ethrytopoietin (Epo) and a small number of cytokines induce Stat5-dependent erythroid differentiation. Here, by using a reporter gene system to monitor transcriptional activity of Stat5, we showed that Epo but not interleukin (IL)-3 supports sustained activation of Stat5, which induces globin gene expression. IL-3 or IL-2 stimulation inhibits Epo-induced globin gene expression. The acidic region of the IL-2 receptor β chain was essential for this inhibition. These results underscore the importance of temporal regulation of Stat activity for regulation of cytokine-specific cell differentiation. PMID:17511959

The tyrosine B10 hydroxyl is crucial for oxygen avidity of Ascaris hemoglobin.

PubMed

Kloek, A P; Yang, J; Mathews, F S; Frieden, C; Goldberg, D E

1994-01-28

The parasitic nematode Ascaris suum has a gene encoding a two-domain hemoglobin with remarkable oxygen avidity. The strong interaction with oxygen is a consequence of a particularly slow oxygen off-rate. The single polypeptide chain consists of two domains, each of which can be expressed separately in Escherichia coli as a globin-like protein exhibiting oxygen binding characteristics comparable with the native molecule. Site-directed mutagenesis was performed on the gene segment encoding domain one. The E7 position, involved in forming a hydrogen bond with the liganded oxygen in vertebrate globins, is a glutamine in both Ascaris domains. Conversion of this residue to leucine or alanine produced a hemoglobin variant with an oxygen off-rate 5- or 60-fold faster than that of unaltered domain one. Replacement of the tyrosine B10 with either phenylalanine or leucine (as found in vertebrate globins) yielded hemoglobin mutants with oxygen off-rates 280- or 570-fold faster, approaching rates found with vertebrate myoglobins. The data suggest that the distal glutamine hydrogen bonds with the liganded oxygen and that the tyrosine B10 hydroxyl contributes an additional hydrogen bond that appears substantially responsible for the extreme oxygen avidity of Ascaris hemoglobin.

The effects of old and recent migration waves in the distribution of HBB*S globin gene haplotypes

PubMed Central

Lindenau, Juliana D.; Wagner, Sandrine C.; de Castro, Simone M.; Hutz, Mara H.

2016-01-01

Abstract Sickle cell hemoglobin is the result of a mutation at the sixth amino acid position of the beta (β) globin chain. The HBB*S gene is in linkage disequilibrium with five main haplotypes in the β-globin-like gene cluster named according to their ethnic and geographic origins: Bantu (CAR), Benin (BEN), Senegal (SEN), Cameroon (CAM) and Arabian-Indian (ARAB). These haplotypes demonstrated that the sickle cell mutation arose independently at least five times in human history. The distribution of βS haplotypes among Brazilian populations showed a predominance of the CAR haplotype. American populations were clustered in two groups defined by CAR or BEN haplotype frequencies. This scenario is compatible with historical records about the slave trade in the Americas. When all world populations where the sickle cell gene occurs were analyzed, three clusters were disclosed based on CAR, BEN or ARAB haplotype predominance. These patterns may change in the next decades due to recent migrations waves. Since these haplotypes show different clinical characteristics, these recent migrations events raise the necessity to develop optimized public health programs for sickle cell disease screening and management. PMID:27706371

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Two-photon excited fluorescence emission from hemoglobin

NASA Astrophysics Data System (ADS)

Sun, Qiqi; Zeng, Yan; Zhang, Wei; Zheng, Wei; Luo, Yi; Qu, Jianan Y.

2015-03-01

Hemoglobin, one of the most important proteins in blood, is responsible for oxygen transportation in almost all vertebrates. Recently, we discovered two-photon excited hemoglobin fluorescence and achieved label-free microvascular imaging based on the hemoglobin fluorescence. However, the mechanism of its fluorescence emission still remains unknown. In this work, we studied the two-photon excited fluorescence properties of the hemoglobin subunits, heme/hemin (iron (II)/(III) protoporphyrin IX) and globin. We first studied the properties of heme and the similar spectral and temporal characteristics of heme and hemoglobin fluorescence provide strong evidence that heme is the fluorophore in hemoglobin. Then we studied the fluorescence properties of hemin, globin and methemoglobin, and found that the hemin may have the main effect on the methemoglobin fluorescence and that globin has tryptophan fluorescence like other proteins. Finally, since heme is a centrosymmetric molecule, that the Soret band fluorescence of heme and hemoglobin was not observed in the single photon process in the previous study may be due to the parity selection rule. The discovery of heme two-photon excited fluorescence may open a new window for heme biology research, since heme as a cofactor of hemoprotein has many functions, including chemical catalysis, electron transfer and diatomic gases transportation.

Globins Scavenge Sulfur Trioxide Anion Radical*

PubMed Central

Gardner, Paul R.; Gardner, Daniel P.; Gardner, Alexander P.

2015-01-01

Ferrous myoglobin was oxidized by sulfur trioxide anion radical (STAR) during the free radical chain oxidation of sulfite. Oxidation was inhibited by the STAR scavenger GSH and by the heme ligand CO. Bimolecular rate constants for the reaction of STAR with several ferrous globins and biomolecules were determined by kinetic competition. Reaction rate constants for myoglobin, hemoglobin, neuroglobin, and flavohemoglobin are large at 38, 120, 2,600, and ≥ 7,500 × 106 m−1 s−1, respectively, and correlate with redox potentials. Measured rate constants for O2, GSH, ascorbate, and NAD(P)H are also large at ∼100, 10, 130, and 30 × 106 m−1 s−1, respectively, but nevertheless allow for favorable competition by globins and a capacity for STAR scavenging in vivo. Saccharomyces cerevisiae lacking sulfite oxidase and deleted of flavohemoglobin showed an O2-dependent growth impairment with nonfermentable substrates that was exacerbated by sulfide, a precursor to mitochondrial sulfite formation. Higher O2 exposures inactivated the superoxide-sensitive mitochondrial aconitase in cells, and hypoxia elicited both aconitase and NADP+-isocitrate dehydrogenase activity losses. Roles for STAR-derived peroxysulfate radical, superoxide radical, and sulfo-NAD(P) in the mechanism of STAR toxicity and flavohemoglobin protection in yeast are suggested. PMID:26381408

What Students Think They Feel Differs from What They Really Feel – Academic Self-Concept Moderates the Discrepancy between Students’ Trait and State Emotional Self-Reports

PubMed Central

Bieg, Madeleine; Goetz, Thomas; Lipnevich, Anastasiya A.

2014-01-01

This study investigated whether there is a discrepancy pertaining to trait and state academic emotions and whether self-concept of ability moderates this discrepancy. A total of 225 secondary school students from two different countries enrolled in grades 8 and 11 (German sample; n = 94) and grade 9 (Swiss sample; n = 131) participated. Students’ trait academic emotions of enjoyment, pride, anger, and anxiety in mathematics were assessed with a self-report questionnaire, whereas to assess their state academic emotions experience-sampling method was employed. The results revealed that students’ scores on the trait assessment of emotions were generally higher than their scores on the state assessment. Further, as expected, students’ academic self-concept in the domain of mathematics was shown to partly explain the discrepancy between scores on trait and state emotions. Our results indicate that there is a belief-driven discrepancy between what students think they feel (trait assessment) and what they really feel (state assessment). Implications with regard to the assessment of self-reported emotions in future studies and practical implications for the school context are discussed. PMID:24647760

The effect of pre-existing vulnerability factors on a laboratory analogue trauma experience.

PubMed

Laposa, Judith M; Alden, Lynn E

2008-12-01

This study examined how pre-existing emotional and personality vulnerability factors affect responses to an analogue trauma experience. Sixty-eight undergraduate participants viewed a distressing film and completed measures of trait anxiety, intelligence, depression, trait dissociation, as well as changes in state anxiety, then recorded intrusions over the following week. Results revealed that trait anxiety, depression, trait dissociation, change in anxiety, and post-state anxiety were associated with intrusion frequency. Post-state anxiety mediated the relationship between trait anxiety, depression and trait dissociation, and intrusions. Implications for PTSD theories and laboratory trauma analogue research examining specific elements of cognitive models of PTSD are discussed.

Behavioral and Neurological Foundations for the Moral and Legal Implications of Intoxication, Addictive Behaviors and Disinhibition

PubMed Central

Leeman, Robert F.; Grant, Jon E.; Potenza, Marc N.

2009-01-01

Disinhibition and addictive behaviors are related and carry moral implications. Both typically involve diminished consideration of negative consequences, which may result in harm to oneself or others. Disinhibition may occur on state and trait levels, and addictive substances may elicit disinhibitory states, particularly when intoxication is reached. Data suggest that trait disinhibition and addictions may be conceptualized as involving misdirected motivation with underlying biological bases including genetic factors, alterations in neurotransmitter systems and differences in regional brain function. The influences of intoxication on the brain share similarities with cognitive impairments in individuals with chronic substance abuse and those with trait disinhibition related to frontal lobe injuries. These findings raise questions about volitional impairment and morality. Although impaired volition related to disinhibition and addictive behaviors has been studied from multiple perspectives, additional research is needed to further characterize mechanisms of impairment. Such findings may have important implications in multiple legal and psychiatric domains. PMID:19241397

Self-Analysis and Assessment of Entrepreneurial Potential.

ERIC Educational Resources Information Center

King, Albert S.

1985-01-01

Presents an exercise which is designed to identify behavior characteristics and attitudes and enable individuals to identify and understand personality traits that have essential implications for becoming a successful entrepreneur. Discussion includes the personality traits of the successful entrepreneur and situational factors contributing to…

Academic stress and personality interact to increase the neural response to high-calorie food cues.

PubMed

Neseliler, Selin; Tannenbaum, Beth; Zacchia, Maria; Larcher, Kevin; Coulter, Kirsty; Lamarche, Marie; Marliss, Errol B; Pruessner, Jens; Dagher, Alain

2017-09-01

Psychosocial stress is associated with an increased intake of palatable foods and weight gain in stress-reactive individuals. Personality traits have been shown to predict stress-reactivity. However, it is not known if personality traits influence brain activity in regions implicated in appetite control during psychosocial stress. The current study assessed whether Gray's Behavioural Inhibition System (BIS) scale, a measure of stress-reactivity, was related to the activity of brain regions implicated in appetite control during a stressful period. Twenty-two undergraduate students participated in a functional magnetic resonance imaging (fMRI) experiment once during a non-exam period and once during final exams in a counter-balanced order. In the scanner, they viewed food and scenery pictures. In the exam compared with the non-exam condition, BIS scores related to increased perceived stress and correlated with increased blood-oxygen-level dependent (BOLD) response to high-calorie food images in regions implicated in food reward and subjective value, such as the ventromedial prefrontal cortex, (vmPFC) and the amygdala. BIS scores negatively related to the functional connectivity between the vmPFC and the dorsolateral prefrontal cortex. The results demonstrate that the BIS trait influences stress reactivity. This is observed both as an increased activity in brain regions implicated in computing the value of food cues and decreased connectivity of these regions to prefrontal regions implicated in self-control. This suggests that the effects of real life stress on appetitive brain function and self-control is modulated by a personality trait. This may help to explain why stressful periods can lead to overeating in vulnerable individuals. Copyright © 2017 Elsevier Ltd. All rights reserved.

Exploring the Common Dynamics of Homologous Proteins. Application to the Globin Family

PubMed Central

Maguid, Sandra; Fernandez-Alberti, Sebastian; Ferrelli, Leticia; Echave, Julian

2005-01-01

We present a procedure to explore the global dynamics shared between members of the same protein family. The method allows the comparison of patterns of vibrational motion obtained by Gaussian network model analysis. After the identification of collective coordinates that were conserved during evolution, we quantify the common dynamics within a family. Representative vectors that describe these dynamics are defined using a singular value decomposition approach. As a test case, the globin heme-binding family is considered. The two lowest normal modes are shown to be conserved within this family. Our results encourage the development of models for protein evolution that take into account the conservation of dynamical features. PMID:15749782

A new stable alpha chain variant: Hb Basel [alpha14(A12)Trp-->Leu (alpha1)].

PubMed

Hergersberg, Martin; Brunner-Agten, Saskia; Kühne, Thomas; Paulussen, Michael; Huber, Andreas R

2010-06-01

We describe a heterozygosity for a new missense mutation on the alpha1-globin gene of an 18-year-old woman of Portuguese ancestry with severe hypochromic anemia and iron deficiency. Hemoglobin (Hb) analysis by high performance liquid chromatography (HPLC) found a prominent peak constituting about 12% of total Hb. Sequencing of the globin genes of the index patient found the mutation alpha14(A12)Trp-->Leu (alpha1), HBA1:c.44G

A Hemoglobin Variant Associated with Neonatal Cyanosis and Anemia

PubMed Central

Crowley, Moira A.; Mollan, Todd L.; Abdulmalik, Osheisa Y.; Butler, Andrew D.; Goodwin, Emily F.; Sarkar, Arindam; Stolle, Catherine A.; Gow, Andrew J.; Olson, John S.; Weiss, Mitchell J.

2013-01-01

SUMMARY Globin-gene mutations are a rare but important cause of cyanosis. We identified a missense mutation in the fetal G γ-globin gene (HBG2) in a father and daughter with transient neonatal cyanosis and anemia. This new mutation modifies the ligand-binding pocket of fetal hemoglobin by means of two mechanisms. First, the relatively large side chain of methionine decreases both the affinity of oxygen for binding to the mutant hemoglobin subunit and the rate at which it does so. Second, the mutant methionine is converted to aspartic acid post-translationally, probably through oxidative mechanisms. The presence of this polar amino acid in the heme pocket is predicted to enhance hemoglobin denaturation, causing anemia. PMID:21561349

Hb Alesha [beta67(E11)Val-->Met, GTG-->ATG] in an Argentinean girl.

PubMed

Eberle, Silvia Eandi; Noguera, Nélida I; Sciuccati, Gabriela; Bonduel, Mariana; Díaz, Lilian; Staciuk, Raquel; Targovnik, Héctor M; Feliu-Torres, Aurora

2007-01-01

Hb Alesha is caused by a GTG-->ATG mutation at codon 67 of the beta-globin gene, resulting in abnormal beta-globin chains in which the normal beta67(E11) valine is changed to methionine. This hemoglobin (Hb) is also known as Hb Bristol, the first unstable Hb described, since in a fraction of the variant the methionine is modified into an aspartic acid by a posttranslational modification. This replacement disrupts the apolar bonds between the valine and the heme group, producing an unstable Hb and severe hemolysis. We have identified this rare hemoglobinopathy in an Argentinean girl with severe hemolytic anemia, splenomegaly and frequent requirement for red blood cell transfusions.

Mapping Variation in Vegetation Functioning with Imaging Spectroscopy

NASA Astrophysics Data System (ADS)

Townsend, P. A.; Couture, J. J.; Kruger, E. L.; Serbin, S.; Singh, A.

2015-12-01

Imaging spectroscopy (otherwise known as hyperspectral remote sensing) offers the potential to characterize the spatial and temporal variation in biophysical and biochemical properties of vegetation that can be costly or logistically difficult to measure comprehensively using traditional methods. A number of recent studies have illustrated the capacity for imaging spectroscopy data, such as from NASA's AVIRIS sensor, to empirically estimate functional traits related to foliar chemistry and physiology (Singh et al. 2015, Serbin et al. 2015). Here, we present analyses that illustrate the implications of those studies to characterize within-field or -stand variability in ecosystem functioning. In agricultural ecosystems, within-field photosynthetic capacity can vary by 30-50%, likely due to within-field variations in water availability and soil fertility. In general, the variability of foliar traits is lower in forests than agriculture, but can still be significant. Finally, we demonstrate that functional trait variability at the stand scale is strongly related to vegetation diversity. These results have two significant implications: 1) reliance on a small number of field samples to broadly estimate functional traits likely underestimates variability in those traits, and 2) if trait estimations from imaging spectroscopy are reliable, such data offer the opportunity to greatly increase the density of measurements we can use to predict ecosystem function.

Incremental Validity of the DSM-5 Section III Personality Disorder Traits With Respect to Psychosocial Impairment.

PubMed

Simms, Leonard J; Calabrese, William R

2016-02-01

Traditional personality disorders (PDs) are associated with significant psychosocial impairment. DSM-5 Section III includes an alternative hybrid personality disorder (PD) classification approach, with both type and trait elements, but relatively little is known about the impairments associated with Section III traits. Our objective was to study the incremental validity of Section III traits--compared to normal-range traits, traditional PD criterion counts, and common psychiatric symptomatology--in predicting psychosocial impairment. To that end, 628 current/recent psychiatric patients completed measures of PD traits, normal-range traits, traditional PD criteria, psychiatric symptomatology, and psychosocial impairments. Hierarchical regressions revealed that Section III PD traits incrementally predicted psychosocial impairment over normal-range personality traits, PD criterion counts, and common psychiatric symptomatology. In contrast, the incremental effects for normal-range traits, PD symptom counts, and common psychiatric symptomatology were substantially smaller than for PD traits. These findings have implications for PD classification and the impairment literature more generally.

NF-E2 and GATA binding motifs are required for the formation of DNase I hypersensitive site 4 of the human beta-globin locus control region.

PubMed Central

Stamatoyannopoulos, J A; Goodwin, A; Joyce, T; Lowrey, C H

1995-01-01

The beta-like globin genes require the upstream locus control region (LCR) for proper expression. The active elements of the LCR coincide with strong erythroid-specific DNase I-hypersensitive sites (HSs). We have used 5' HS4 as a model to study the formation of these HSs. Previously, we identified a 101 bp element that is required for the formation of this HS. This element binds six proteins in vitro. We now report a mutational analysis of the HS4 HS-forming element (HSFE). This analysis indicates that binding sites for the hematopoietic transcription factors NF-E2 and GATA-1 are required for the formation of the characteristic chromatin structure of the HS following stable transfection into murine erythroleukemia cells. Similarly arranged NF-E2 and GATA binding sites are present in the other HSs of the human LCR, as well as in the homologous mouse and goat sequences and the chicken beta-globin enhancer. A combination of DNase I and micrococcal nuclease sensitivity assays indicates that the characteristic erythroid-specific hypersensitivity of HS4 to DNase I is the result of tissue-specific alterations in both nucleosome positioning and tertiary DNA structure. Images PMID:7828582

Genetic heterogeneity of Beta thalassemia in Lebanon reflects historic and recent population migration.

PubMed

Makhoul, N J; Wells, R S; Kaspar, H; Shbaklo, H; Taher, A; Chakar, N; Zalloua, P A

2005-01-01

Beta thalassemia is an autosomal recessive disorder characterized by reduced (beta(+)) or absent (beta(0)) beta-globin chain synthesis. In Lebanon it is the most predominant genetic defect. In this study we investigated the religious and geographic distribution of the beta-thalassemia mutations identified in Lebanon, and traced their precise origins. A total of 520 beta-globin chromosomes from patients of different religious and regional backgrounds was studied. Beta thalassemia mutations were identified using Amplification Refractory Mutation System (ARMS) PCR or direct gene sequencing. Six (IVS-I-110, IVS-I-1, IVS-I-6, IVS-II-1, cd 5 and the C > T substitution at cd 29) out of 20 beta-globin defects identified accounted for more than 86% of the total beta-thalassemia chromosomes. Sunni Muslims had the highest beta-thalassemia carrier rate and presented the greatest heterogeneity, with 16 different mutations. Shiite Muslims followed closely with 13 mutations, whereas Maronites represented 11.9% of all beta-thalassemic subjects and carried 7 different mutations. RFLP haplotype analysis showed that the observed genetic diversity originated from both new mutational events and gene flow from population migration. This study provides information about the types and distribution of beta-thalassemia mutations within each religious group and geographic region, which is essential for the implementation of screening and prevention programs.

Interaction of Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1)] with Hb E [β26(B8) Glu>Lys] and α(+)-thalassemia: Molecular and Hematological Analysis.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2015-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a mutation at codon 91 of α1-globin gene whereas Hb E is a common β-globin chain variant among Southeast Asian population. We report two hitherto undescribed conditions of Hb Grey Lynn found in Thai individuals. The study was done on two unrelated Thai subjects. Hematological parameters were recorded and Hb analysis was carried out using automated Hb analyzers. Mutations were identified by DNA analysis. Hematological features of the patients were compared with those of various forms of Hb Grey Lynn documented previously. Hb and DNA analyses identified a heterozygous Hb Grey Lynn in one patient and a double heterozygous Hb Grey Lynn and Hb E with α(+)-thalassemia in another. Interaction of α(Grey Lynn) with β(E) chains leads to the formation of a new Hb variant, namely the Hb Grey Lynn E (α(GL)2β(E)2), detectable by liquid chromatography (10.3%) but masked by Hb E on capillary electrophoresis. Interaction of these multiple globin gene defects could lead to complex hemoglobinopathies requiring combined analysis with multiple Hb analyzers followed by DNA testing to provide accurate diagnosis of the cases.

Genetic correction of β-thalassemia patient-specific iPS cells and its use in improving hemoglobin production in irradiated SCID mice.

PubMed

Wang, Yixuan; Zheng, Chen-Guang; Jiang, Yonghua; Zhang, Jiqin; Chen, Jiayu; Yao, Chao; Zhao, Qingguo; Liu, Sheng; Chen, Ke; Du, Juan; Yang, Ze; Gao, Shaorong

2012-04-01

The generation of induced pluripotent stem cells (iPSCs) from differentiated somatic cells by over-expression of several transcription factors has the potential to cure many genetic and degenerative diseases currently recalcitrant to traditional clinical approaches. One such genetic disease is β-thalassemia major (Cooley's anemia). This disease is caused by either a point mutation or the deletion of several nucleotides in the β-globin gene, and it threatens the lives of millions of people in China. In the present study, we successfully generated iPSCs from fibroblasts collected from a 2-year-old patient who was diagnosed with a homozygous 41/42 deletion in his β-globin gene. More importantly, we successfully corrected this genetic mutation in the β-thalassemia iPSCs by homologous recombination. Furthermore, transplantation of the genetically corrected iPSCs-derived hematopoietic progenitors into sub-lethally irradiated immune deficient SCID mice showed improved hemoglobin production compared with the uncorrected iPSCs. Moreover, the generation of human β-globin could be detected in the mice transplanted with corrected iPSCs-derived hematopietic progenitors. Our study provides strong evidence that iPSCs generated from a patient with a genetic disease can be corrected by homologous recombination and that the corrected iPSCs have potential clinical uses.

The Prevalence and Molecular Spectrum of α- and β-Globin Gene Mutations in 14,332 Families of Guangdong Province, China

PubMed Central

Xu, Longchang; Wu, Li; Zhang, Liang; Ma, Yuanzhu; Chen, Tingting; Gao, Shuang; Liang, Juqing; Guo, Hao; Qin, Danqing; Wang, Jicheng; Yuan, Tenglong; Wang, Yixia; Huang, Wei-wei; He, Wen-Fei; Zhang, Yanxia; Liu, Chang; Xia, Sujian; Chen, Qingshan; Zhao, Qingguo; Zhang, Xiaozhuang

2014-01-01

Objective To reveal the familial prevalence and molecular variation of α- and β-globin gene mutations in Guangdong Province. Methods A total of 40,808 blood samples from 14,332 families were obtained and analyzed for both hematological and molecular parameters. Results A high prevalence of α- and β-globin gene mutations was found. Overall, 17.70% of pregnant women, 15.94% of their husbands, 16.03% of neonates, and 16.83% of couples (pregnant women and their husbands) were heterozygous carriers of α- or β-thalassemia. The regions with the highest prevalence were the mountainous and western regions, followed by the Pearl River Delta; the region with the lowest prevalence was Chaoshan. The total familial carrier rate (both spouses were α- or β-thalassemia carriers) was 1.87%, and the individual carrier rates of α- and β-thalassemia were 1.68% and 0.20%, respectively. The total rate of moderate-to-severe fetal thalassemia was 12.78% among couples in which both parents were carriers. Conclusions There was a high prevalence of α- and β-thalassemia in Guangdong Province. This study will contribute to the development of thalassemia prevention and control strategies in Guangdong Province. PMID:24587075

Multivariate analysis of matrix-assisted laser desorption/ionization mass spectrometric data related to glycoxidation products of human globins in nephropathic patients.

PubMed

Lapolla, Annunziata; Ragazzi, Eugenio; Andretta, Barbara; Fedele, Domenico; Tubaro, Michela; Seraglia, Roberta; Molin, Laura; Traldi, Pietro

2007-06-01

To clarify the possible pathogenetic role of oxidation products originated from the glycation of proteins, human globins from nephropathic patients have been studied by matrix-assisted laser desorption/ionization mass spectrometry (MALDI), revealing not only unglycated and monoglycated globins, but also a series of different species. For the last ones, structural assignments were tentatively done on the basis of observed masses and expectations for the Maillard reaction pattern. Consequently, they must be considered only propositive, and the discussion which will follow must be considered in this view. In our opinion this approach does not seem to compromise the intended diagnostic use of the data because distinctions are valid even if the assignments are uncertain. We studied nine healthy subjects and 19 nephropathic patients and processed the data obtained from the MALDI spectra using a multivariate analysis. Our results showed that multivariate analytical techniques enable differential aspects of the profile of molecular species to be identified in the blood of end stage nephropathic patients. A correct grouping can be achieved by principal component analysis (PCA) and the results suggest that several products involved in carbonyl stress exist in nephropathic patients. These compounds may have a relevant role as specific markers of the pathological state.

Synthesis of hemoglobin Gun Hill: increased synthesis of the heme-free βGH globin chain and subunit exchange with a free α-chain pool

PubMed Central

Rieder, Ronald F.

1971-01-01

Hemoglobin Gun Hill is an unstable mutant hemoglobin associated with mild compensated hemolysis. This abnormal protein has a deletion of five amino acids in the β-chains. The deletion includes the heme-binding proximal histidine at position 92. The β-chains of hemoglobin Gun Hill lack heme groups. Approximately 32% of the circulating hemoglobin in heterozygous subjects consists of the mutant hemoglobin. When reticulocytes were incubated with radioactive amino acid the specific activity of hemoglobin Gun Hill was three to six times that of hemoglobin A. Total incorporation of radioactivity into hemoglobin Gun Hill was two to three times that into hemoglobin A. There were 20-50% more total counts in β-Gun Hill (βGH) than in βA. These results indicate that in reticulocytes there was greater synthesis of the abnormal β-chains than βA-chains. The ratio of the specific activities of the α-chains of hemoglobin Gun Hill to the α-chains of hemoglobin A was 20: 1. There was evidence of a free pool of α-chains in the reticulocytes containing hemoglobin Gun Hill. After 10 min of incubation approximately 40% of the total α-chain radioactivity was in the free pool. When protein synthesis was blocked by incubation of reticulocytes with puromycin, the specific activity of the α-chains of hemoglobin Gun Hill continued to increase due to direct exchange of α-subunits between the free pool and preformed hemoglobin Gun Hill. Studies of the assembly of βA and βGH revealed that the rates of translation of the two polypeptide chains were equal and uniform. No evidence was obtained for the existence of “slow points” in the process of globin chain assembly. The studies also suggest that lack of strong heme-globin binding does not hinder the synthesis of globin chains. PMID:5540175

Molecular Epidemiological Survey of Glucose-6-Phosphate Dehydrogenase Deficiency and Thalassemia in Uygur and Kazak Ethnic Groups in Xinjiang, Northwest China.

PubMed

Han, Luhao; Su, Hai; Wu, Hao; Jiang, Weiying; Chen, Suqin

2016-06-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency and thalassemia occur frequently in tropical and subtropical regions, while the prevalence of relationship between the two diseases in Xinjiang has not been reported. We aimed to determine the prevalence of these diseases and clarify the relationship between genotypes and phenotypes of the two diseases in the Uygur and Kazak ethnic groups in Xinjiang. We measured G6PD activity by G6PD:6PGD (glucose acid-6-phosphate dehydrogenase) ratio, identified the gene variants of G6PD and α- and β-globin genes by polymerase chain reaction (PCR)-DNA sequencing and gap-PCR and compared these variants in different ethnic groups in Xinjiang with those adjacent to it. Of the 149 subjects with molecular analysis of G6PD deficiency conducted, a higher prevalence of the combined mutations c.1311C > T/IVSXI + 93T > C and IVSXI + 93T > C, both with normal enzymatic activities, were observed in the Uygur and Kazak subjects. A case of rare mutation HBB: c.135delC [codon 44 (-C) in the heterozygous state], a heterozygous case of HBB: c.68A > G [Hb G-Taipei or β22(B4)Glu→Gly] and several common single nucleotide polymorphisms (SNPs) were found on the β-globin gene. In conclusion, G6PD deficiency with pathogenic mutations and three common α-thalassemia (α-thal) [- -(SEA), -α(3.7) (rightward), -α(4.2) (leftward)] deletions and point mutations of the α-globin gene were not detected in the present study. The average incidence of β-thalassemia (β-thal) in Uygurs was 1.45% (2/138) in Xinjiang. The polymorphisms of G6PD and β-globin genes might be useful genetic markers to trace the origin and migration of the Uygur and Kazak in Xinjiang.

Novel Multiplex Fluorescent PCR-Based Method for HLA Typing and Preimplantational Genetic Diagnosis of β-Thalassemia.

PubMed

Khosravi, Sharifeh; Salehi, Mansour; Ramezanzadeh, Mahboobeh; Mirzaei, Hamed; Salehi, Rasoul

2016-05-01

Thalassemia is curable by bone marrow transplantation; however, finding suitable donors with defined HLA combination remains a major challenge. Cord blood stem cells with preselected HLA system through preimplantation genetic diagnosis (PGD) proved very useful for resolving scarce HLA-matched bone marrow donors. A thalassemia trait couple with an affected child was included in this study. We used informative STR markers at the HLA and beta globin loci to develop a single cell multiplex fluorescent PCR protocol. The protocol was extensively optimized on single lymphocytes isolated from the couple's peripheral blood. The optimized protocol was applied on single blastomeres biopsied from day 3 cleavage stage IVF embryos of the couple. Four IVF embryos biopsied on day 3 and a single blastomere of each were provided for genetic diagnosis of combined β-thalassemia mutations and HLA typing. Of these, one embryo was diagnosed as homozygous normal for the thalassemia mutation and HLA matched with the existing affected sibling. The optimized protocol worked well in PGD clinical cycle for selection of thalassemia-unaffected embryos with the desired HLA system. Copyright © 2016 IMSS. Published by Elsevier Inc. All rights reserved.

Inconsistencies in spontaneous and intentional trait inferences.

PubMed

Ma, Ning; Vandekerckhove, Marie; Baetens, Kris; Van Overwalle, Frank; Seurinck, Ruth; Fias, Wim

2012-11-01

This study explores the fMRI correlates of observers making trait inferences about other people under conflicting social cues. Participants were presented with several behavioral descriptions involving an agent that implied a particular trait. The last behavior was either consistent or inconsistent with the previously implied trait. This was done under instructions that elicited either spontaneous trait inferences ('read carefully') or intentional trait inferences ('infer a trait'). The results revealed that when the behavioral descriptions violated earlier trait implications, regardless of instruction, the medial prefrontal cortex (mPFC) was more strongly recruited as well as the domain-general conflict network including the posterior medial frontal cortex (pmFC) and the right prefrontal cortex (rPFC). These latter two areas were more strongly activated under intentional than spontaneous instructions. These findings suggest that when trait-relevant behavioral information is inconsistent, not only is activity increased in the mentalizing network responsible for trait processing, but control is also passed to a higher level conflict monitoring network in order to detect and resolve the contradiction.

Who Cares About Being Gentle? The Impact of Social Identity and the Gender of One’s Friends on Children’s Display of Same-Gender Favoritism

PubMed Central

Susskind, Joshua E.

2010-01-01

This research assessed children’s same-gender favoritism by examining whether children value traits descriptive of their own gender more than traits descriptive of the other gender. We also investigated whether children’s proportion of same-gender friends relates to their same-gender favoritism. Eighty-one third and fourth grade children from the Midwest and West Coast of the U.S. rated how well 19 personality traits describe boys and girls, and how important each trait is for their gender to possess. Results replicate and extend past trait assignment research by demonstrating that both genders valued same-gender traits significantly more than other-gender traits. Results also indicated that boys with many same-gender friends derogated feminine-stereotyped traits, which has implications for research on masculinity norms within male-dominated peer groups. PMID:21212812

Are Fearless Dominance Traits Superfluous in Operationalizing Psychopathy? Incremental Validity and Sex Differences

PubMed Central

Murphy, Brett; Lilienfeld, Scott; Skeem, Jennifer; Edens, John

2016-01-01

Researchers are vigorously debating whether psychopathic personality includes seemingly adaptive traits, especially social and physical boldness. In a large sample (N=1565) of adult offenders, we examined the incremental validity of two operationalizations of boldness (Fearless Dominance traits in the Psychopathy Personality Inventory, Lilienfeld & Andrews, 1996; Boldness traits in the Triarchic Model of Psychopathy, Patrick et al, 2009), above and beyond other characteristics of psychopathy, in statistically predicting scores on four psychopathy-related measures, including the Psychopathy Checklist-Revised (PCL-R). The incremental validity added by boldness traits in predicting the PCL-R’s representation of psychopathy was especially pronounced for interpersonal traits (e.g., superficial charm, deceitfulness). Our analyses, however, revealed unexpected sex differences in the relevance of these traits to psychopathy, with boldness traits exhibiting reduced importance for psychopathy in women. We discuss the implications of these findings for measurement models of psychopathy. PMID:26866795

Exploring callous and unemotional traits in youth via general personality traits: An eye toward DSM-5.

PubMed

Latzman, Robert D; Lilienfeld, Scott O; Latzman, Natasha E; Clark, Lee Anna

2013-07-01

The current study aimed at better understanding callous-unemotional (CU) traits in youth within a traditional personality trait/temperament framework as well as in relation to current proposals for the Diagnostic and Statistical Manual of Mental Disorders, Fifth Edition (DSM-5). Participants were 174 mothers and their sons age 11-16 years. Mothers and youth reported on youth CU traits and general personality trait/ temperament dimensions. Overall, analyses revealed significant unique associations of personality trait/temperament dimensions with CU total and subscale scores. Personality trait/temperament dimensions explained 36% to 58% of the variance in CU subscales and total score. Furthermore, specific personality dimensions differentially and uniquely predicted various CU subscales, indicating marked specificity in association such that these traits should be considered separately rather than as a single unit. Taken together, these results confirm the importance of considering traditional personality trait models to understand "callous and unemotional" traits and risk for psychopathy more fully. Additionally, our findings bear implications for the conceptualization and operationalization of these traits in DSM-5.

Assessing the Utility of Compound Trait Estimates of Narrow Personality Traits.

PubMed

Credé, Marcus; Harms, Peter D; Blacksmith, Nikki; Wood, Dustin

2016-01-01

It has been argued that approximations of narrow traits can be made through linear combinations of broad traits such as the Big Five personality traits. Indeed, Hough and Ones ( 2001 ) used a qualitative analysis of scale content to arrive at a taxonomy of how Big Five traits might be combined to approximate various narrow traits. However, the utility of such compound trait approximations has yet to be established beyond specific cases such as integrity and customer service orientation. Using data from the Eugene-Springfield Community Sample (Goldberg, 2008 ), we explore the ability of linear composites of scores on Big Five traits to approximate scores on 127 narrow trait measures from 5 well-known non-Big-Five omnibus measures of personality. Our findings indicate that individuals' standing on more than 30 narrow traits can be well estimated from 3 different types of linear composites of scores on Big Five traits without a substantial sacrifice in criterion validity. We discuss theoretical accounts for why such relationships exist as well as the theoretical and practical implications of these findings for researchers and practitioners.

Positive selection on sociobiological traits in invasive fire ants.

PubMed

Privman, Eyal; Cohen, Pnina; Cohanim, Amir B; Riba-Grognuz, Oksana; Shoemaker, DeWayne; Keller, Laurent

2018-06-19

The fire ant Solenopsis invicta and its close relatives are highly invasive. Enhanced social cooperation may facilitate invasiveness in these and other invasive ant species. We investigated whether invasiveness in Solenopsis fire ants was accompanied by positive selection on sociobiological traits by applying a phylogenomics approach to infer ancient selection, and a population genomics approach to infer recent and ongoing selection in both native and introduced S. invicta populations. A combination of whole-genome sequencing of 40 haploid males and reduced-representation genomic sequencing of 112 diploid workers identified 1,758,116 and 169,682 polymorphic markers, respectively. The resulting high-resolution maps of genomic polymorphism provide high inference power to test for positive selection. Our analyses provide evidence of positive selection on putative ion channel genes, which are implicated in neurological functions, and on vitellogenin, which is a key regulator of development and caste determination. Furthermore, molecular functions implicated in pheromonal signaling have experienced recent positive selection. Genes with signatures of positive selection were significantly more often those over-expressed in workers compared with queens and males, suggesting that worker traits are under stronger selection than queen and male traits. These results provide insights into selection pressures and ongoing adaptation in an invasive social insect and support the hypothesis that sociobiological traits are under more positive selection than traits related to non-social traits in such invasive species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Can callous-unemotional traits enhance the understanding, diagnosis, and treatment of serious conduct problems in children and adolescents? A comprehensive review.

PubMed

Frick, Paul J; Ray, James V; Thornton, Laura C; Kahn, Rachel E

2014-01-01

This article provides a comprehensive review of the research on the use of callous and unemotional (CU) traits for designating an important subgroup of children and adolescents with severe conduct problems. It focuses on the etiological significance of recognizing this subgroup of youths with severe conduct problems, its implications for diagnostic classification, and the treatment implications of this research. The review highlights limitations in existing research and provides directions for future research. The available research suggests that children and adolescents with severe conduct problems and elevated CU traits show distinct genetic, cognitive, emotional, biological, environmental, and personality characteristics that seem to implicate different etiological factors underlying their behavior problems relative to other youths with severe conduct problems. Recognizing these subgroups could be critical for guiding future research on the causes of severe conduct problems in children and adolescents. Further, children and adolescents with both severe conduct problems and elevated CU traits appear to be at risk for more severe and persistent antisocial outcomes, even controlling for the severity of their conduct problems, the age of onset of their conduct problems, and common comorbid problems, which supports the clinical importance of designating this group in diagnostic classification systems. Finally, although children and adolescents with both severe conduct problems and elevated CU traits tend to respond less positively to typical interventions provided in mental health and juvenile justice settings, they show positive responses to certain intensive interventions tailored to their unique emotional and cognitive characteristics. (PsycINFO Database Record (c) 2013 APA, all rights reserved).

A discrete emotions approach to positive emotion disturbance in depression

PubMed Central

Gruber, June; Oveis, Christopher; Keltner, Dacher; Johnson, Sheri L.

2012-01-01

Converging findings suggest that depressed individuals exhibit disturbances in positive emotion. No study, however, has ascertained which specific positive emotions are implicated in depression. We report two studies that compare how depressive symptoms relate to distinct positive emotions at both trait and state levels of assessment. In Study 1 (N = 185), we examined associations between depressive symptoms and three trait positive emotions (pride, happy, amusement). Study 2 compared experiential and autonomic reactivity to pride, happy, and amusement film stimuli between depressive (n = 24; DS) and non-depressive (n = 31; NDS) symptom groups. Results indicate that symptoms of depression were most strongly associated with decreased trait pride and decreased positive emotion experience to pride-eliciting films. Discussion focuses on the implications these findings have for understanding emotion deficits in depression as well as for the general study of positive emotion. PMID:21432655

Higher sensory processing sensitivity, introversion and ectomorphism: New biomarkers for human creativity in developing rural areas

PubMed Central

Rizzo-Sierra, Carlos V; Leon-S, Martha E; Leon-Sarmiento, Fidias E

2012-01-01

The highly sensitive trait present in animals, has also been proposed as a human neurobiological trait. People having such trait can process larger amounts of sensory information than usual, making it an excellent attribute that allows to pick up subtle environmental details and cues. Furthermore, this trait correlates to some sort of giftedness such as higher perception, inventiveness, imagination and creativity. We present evidences that support the existance of key neural connectivity between the mentioned trait, higher sensory processing sensitivity, introversion, ectomorphism and creativity. The neurobiological and behavioral implications that these biomarkers have in people living in developing rural areas are discussed as well. PMID:22865969

Genome-wide association implicates numerous genes and pleiotropy underlying ecological trait variation in natural populations of Populus trichocarpa

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKown, Athena; Klapste, Jaroslav; Guy, Robert

2014-01-01

To uncover the genetic basis of phenotypic trait variation, we used 448 unrelated wild accessions of black cottonwood (Populus trichocarpa Torr. & Gray) from natural populations throughout western North America. Extensive information from large-scale trait phenotyping (with spatial and temporal replications within a common garden) and genotyping (with a 34K Populus SNP array) of all accessions were used for gene discovery in a genome-wide association study (GWAS).

Prevalence of sexual dimorphism in mammalian phenotypic traits.

PubMed

Karp, Natasha A; Mason, Jeremy; Beaudet, Arthur L; Benjamini, Yoav; Bower, Lynette; Braun, Robert E; Brown, Steve D M; Chesler, Elissa J; Dickinson, Mary E; Flenniken, Ann M; Fuchs, Helmut; Angelis, Martin Hrabe de; Gao, Xiang; Guo, Shiying; Greenaway, Simon; Heller, Ruth; Herault, Yann; Justice, Monica J; Kurbatova, Natalja; Lelliott, Christopher J; Lloyd, K C Kent; Mallon, Ann-Marie; Mank, Judith E; Masuya, Hiroshi; McKerlie, Colin; Meehan, Terrence F; Mott, Richard F; Murray, Stephen A; Parkinson, Helen; Ramirez-Solis, Ramiro; Santos, Luis; Seavitt, John R; Smedley, Damian; Sorg, Tania; Speak, Anneliese O; Steel, Karen P; Svenson, Karen L; Wakana, Shigeharu; West, David; Wells, Sara; Westerberg, Henrik; Yaacoby, Shay; White, Jacqueline K

2017-06-26

The role of sex in biomedical studies has often been overlooked, despite evidence of sexually dimorphic effects in some biological studies. Here, we used high-throughput phenotype data from 14,250 wildtype and 40,192 mutant mice (representing 2,186 knockout lines), analysed for up to 234 traits, and found a large proportion of mammalian traits both in wildtype and mutants are influenced by sex. This result has implications for interpreting disease phenotypes in animal models and humans.

The Architecture of the Pollen Hoarding Syndrome in Honey Bees: Implications for Understanding Social Evolution, Behavioral Syndromes, and Selective Breeding

PubMed Central

Rueppell, Olav

2014-01-01

Social evolution has influenced every aspect of contemporary honey bee biology, but the details are difficult to reconstruct. The reproductive ground plan hypothesis of social evolution proposes that central regulators of the gonotropic cycle of solitary insects have been coopted to coordinate social complexity in honey bees, such as the division of labor among workers. The predicted trait associations between reproductive physiology and social behavior have been identified in the context of the pollen hoarding syndrome, a larger suite of interrelated traits. The genetic architecture of this syndrome is characterized by a partially overlapping genetic architecture with several consistent, pleiotropic QTL. Despite these central QTL and an integrated hormonal regulation, separate aspects of the pollen hoarding syndrome may evolve independently due to peripheral QTL and additionally segregating genetic variance. The characterization of the pollen hoarding syndrome has also demonstrated that this syndrome involves many non-behavioral traits, which may be the case for numerous “behavioral” syndromes. Furthermore, the genetic architecture of the pollen hoarding syndrome has implications for breeding programs for improving honey health and other desirable traits: If these traits are comparable to the pollen hoarding syndrome, consistent pleiotropic QTL will enable marker assisted selection, while sufficient additional genetic variation may permit the dissociation of trade-offs for efficient multiple trait selection. PMID:25506100

The Architecture of the Pollen Hoarding Syndrome in Honey Bees: Implications for Understanding Social Evolution, Behavioral Syndromes, and Selective Breeding.

PubMed

Rueppell, Olav

2014-05-01

Social evolution has influenced every aspect of contemporary honey bee biology, but the details are difficult to reconstruct. The reproductive ground plan hypothesis of social evolution proposes that central regulators of the gonotropic cycle of solitary insects have been coopted to coordinate social complexity in honey bees, such as the division of labor among workers. The predicted trait associations between reproductive physiology and social behavior have been identified in the context of the pollen hoarding syndrome, a larger suite of interrelated traits. The genetic architecture of this syndrome is characterized by a partially overlapping genetic architecture with several consistent, pleiotropic QTL. Despite these central QTL and an integrated hormonal regulation, separate aspects of the pollen hoarding syndrome may evolve independently due to peripheral QTL and additionally segregating genetic variance. The characterization of the pollen hoarding syndrome has also demonstrated that this syndrome involves many non-behavioral traits, which may be the case for numerous "behavioral" syndromes. Furthermore, the genetic architecture of the pollen hoarding syndrome has implications for breeding programs for improving honey health and other desirable traits: If these traits are comparable to the pollen hoarding syndrome, consistent pleiotropic QTL will enable marker assisted selection, while sufficient additional genetic variation may permit the dissociation of trade-offs for efficient multiple trait selection.

From observational to dynamic genetics

PubMed Central

Haworth, Claire M. A.; Davis, Oliver S. P.

2014-01-01

Twin and family studies have shown that most traits are at least moderately heritable. But what are the implications of finding genetic influence for the design of intervention and prevention programs? For complex traits, heritability does not mean immutability, and research has shown that genetic influences can change with age, context, and in response to behavioral and drug interventions. The most significant implications for intervention will come when we move from observational genetics to investigating dynamic genetics, including genetically sensitive interventions. Future interventions should be designed to overcome genetic risk and draw upon genetic strengths by changing the environment. PMID:24478793

Incorporating Personality Assessment into Counseling To Help College Students Adopt and Maintain Exercise Behaviors.

ERIC Educational Resources Information Center

Buckworth, Janet; Granello, Darcy Haag; Belmore, Jennifer

2002-01-01

The authors investigated the influence of several personality traits on exercise adherence and exercise self-efficacy for 168 undergraduate students. At all levels of exercise adherence, students with different personality traits had different amounts of exercise self-efficacy. Implications for college counselors working with students to improve…

The Effect of Target Age on the Activation of Gender Stereotypes.

ERIC Educational Resources Information Center

Powlishta, Kimberly K.

2000-01-01

Investigated the impact of target age on gender stereotyping. College and elementary students viewed photographs of men, women, boys, and girls, rating each for masculine, feminine, and neutral personality traits. Adults also rated likelihood of masculine and feminine traits in adults versus children. Target age had important implications for…

Masculine Instrumentality and Feminine Expressiveness: Their Relationships with Sex Role Attitudes and Behaviors.

ERIC Educational Resources Information Center

Spence, Janet T.; Helmreich, Robert L.

1980-01-01

The Bem Sex Role Inventory (BSRI) and Personal Attributes Questionnaire (PAQ) largely measure socially desirable instrumental (masculine) and expressive (feminine) traits which have limited relationships with sex role attitudes and behaviors. The literature does suggest that the traits have important implications separate from sex role behaviors.…

The role of experiential avoidance in obsessive-compulsive personality disorder traits.

PubMed

Wheaton, Michael G; Pinto, Anthony

2017-10-01

Obsessive-compulsive personality disorder (OCPD) is one of the most prevalent personality disorders, yet it remains an understudied phenomenon. Experiential avoidance (EA) has been investigated as a factor relevant in many forms of psychopathology, including borderline personality disorder. To date however, no study has yet investigated whether EA might also be relevant to OCPD. We administered a measure of EA and a multidimensional OCPD measure (assessing 5 OCPD trait dimensions and overall severity) to a large community sample (N = 571) as well as a group of individuals with self-identified OCPD features (N = 53). Results revealed that the OCPD group experienced heightened EA relative to the unscreened community sample, even controlling for group differences in distress symptoms. Correlational analyses showed significant relationships between EA and all 5 OCPD trait dimensions and overall severity. Moreover, EA accounted for OCPD traits and severity after controlling for symptoms of depression, anxiety, and stress. Implications for the role of EA in OCPD, including treatment implications, are discussed. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Sowing the seeds of stereotypes: Spontaneous inferences about groups.

PubMed

Hamilton, David L; Chen, Jacqueline M; Ko, Deborah M; Winczewski, Lauren; Banerji, Ishani; Thurston, Joel A

2015-10-01

Although dispositional inferences may be consciously drawn from the trait implications of observed behavior, abundant research has shown that people also spontaneously infer trait dispositions simply in the process of comprehending behavior. These spontaneous trait inferences (STIs) can occur without intention or awareness. All research on STIs has studied STIs based on behaviors of individual persons. Yet important aspects of social life occur in groups, and people regularly perceive groups engaging in coordinated action. We propose that perceivers make spontaneous trait inferences about groups (STIGs), parallel to the STIs formed about individuals. In 5 experiments we showed that (a) perceivers made STIGs comparable with STIs about individuals (based on the same behaviors), (b) a cognitive load manipulation did not affect the occurrence of STIGs, (c) STIGs occurred for groups varying in entitativity, (d) STIGs influenced perceivers' impression ratings of those groups, and (e) STIG-based group impressions generalized to new group members. These experiments provide the first evidence for STIGs, a process that may contribute to the formation of spontaneous group impressions. Implications for stereotype formation are discussed. (c) 2015 APA, all rights reserved).

Interaction of hemoglobin Grey Lynn (Vientiane) with a non-deletional α(+)-thalassemia in an adult Thai proband.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Fucharoen, Supan

2014-01-01

Hemoglobin (Hb) Grey Lynn is a Hb variant caused by a substitution of Phe for Leu at position 91 of α1-globin chain, originally described in individual of unknown ethnic background. This article addresses the interaction of Hb Grey Lynn with a non-deletional α(+)-thalassemia found in Thailand, a hitherto un-described condition. The proband was adult Thai woman referred for investigation of mild anemia with Hb 90 g/L. Hb analyses using low pressure liquid chromatography raised a suspicion of abnormal Hb presence, which was failed to demonstrate by cellulose acetate electrophoresis and capillary electrophoresis. DNA sequencing identified a CTT (Leu) to TTT (Phe) mutation at codon 91 corresponding to the Hb Grey Lynn (Vientiane) [α91(FG3)Leu>Phe (α1) on α1-globin gene and a C deletion between codons 36 and 37 on α2-globin gene causing α(+)-thalassemia. As compared to those observed in a compound heterozygote for Hb Grey Lynn / α(0)-thalassemia reported previously, higher MCV (81.7 fL) and MCH (26.3 pg) values with a lower level of Hb Grey Lynn (19.7%) were observed in the proband. The normochromic normocytic anemia observed could be due to the interaction of Hb Grey Lynn with α(+)-thalassemia. The two mutations could be identified using PCR-RFLP and allele-specific PCR assays developed.

Generation of Mice Deficient in both KLF3/BKLF and KLF8 Reveals a Genetic Interaction and a Role for These Factors in Embryonic Globin Gene Silencing

PubMed Central

Funnell, Alister P. W.; Mak, Ka Sin; Twine, Natalie A.; Pelka, Gregory J.; Norton, Laura J.; Radziewic, Tania; Power, Melinda; Wilkins, Marc R.; Bell-Anderson, Kim S.; Fraser, Stuart T.; Perkins, Andrew C.; Tam, Patrick P.; Pearson, Richard C. M.

2013-01-01

Krüppel-like factors 3 and 8 (KLF3 and KLF8) are highly related transcriptional regulators that bind to similar sequences of DNA. We have previously shown that in erythroid cells there is a regulatory hierarchy within the KLF family, whereby KLF1 drives the expression of both the Klf3 and Klf8 genes and KLF3 in turn represses Klf8 expression. While the erythroid roles of KLF1 and KLF3 have been explored, the contribution of KLF8 to this regulatory network has been unknown. To investigate this, we have generated a mouse model with disrupted KLF8 expression. While these mice are viable, albeit with a reduced life span, mice lacking both KLF3 and KLF8 die at around embryonic day 14.5 (E14.5), indicative of a genetic interaction between these two factors. In the fetal liver, Klf3 Klf8 double mutant embryos exhibit greater dysregulation of gene expression than either of the two single mutants. In particular, we observe derepression of embryonic, but not adult, globin expression. Taken together, these results suggest that KLF3 and KLF8 have overlapping roles in vivo and participate in the silencing of embryonic globin expression during development. PMID:23716600

The Relationship Between Early Life Events, Parental Attachment, and Psychopathic Tendencies in Adolescent Detainees.

PubMed

Christian, Erica J; Meltzer, Christine L; Thede, Linda L; Kosson, David S

2017-04-01

Despite increasing interest in understanding psychopathic traits in youth, the role of early environmental factors in the development of psychopathic traits is not well understood. No prior studies have directly examined the relationship between early life events and psychopathic traits. We examined links between life events in the first 4 years of life and indices of the core affective and interpersonal components of psychopathy. Additionally, we examined relationships between early life events, psychopathic traits, and attachment to parents among 206 adjudicated adolescents. Results indicated that the total number of early life events was positively correlated with indices of the affective component of psychopathy. Moreover, psychopathic traits moderated the relationship between the number of early life events and later reports of attachment to parents. Findings suggest that early environmental factors could have important implications for the development of psychopathic traits and may impact attachment to parents for youth with psychopathic traits.

Spontaneous Trait Inferences on Social Media.

PubMed

Levordashka, Ana; Utz, Sonja

2017-01-01

The present research investigates whether spontaneous trait inferences occur under conditions characteristic of social media and networking sites: nonextreme, ostensibly self-generated content, simultaneous presentation of multiple cues, and self-paced browsing. We used an established measure of trait inferences (false recognition paradigm) and a direct assessment of impressions. Without being asked to do so, participants spontaneously formed impressions of people whose status updates they saw. Our results suggest that trait inferences occurred from nonextreme self-generated content, which is commonly found in social media updates (Experiment 1) and when nine status updates from different people were presented in parallel (Experiment 2). Although inferences did occur during free browsing, the results suggest that participants did not necessarily associate the traits with the corresponding status update authors (Experiment 3). Overall, the findings suggest that spontaneous trait inferences occur on social media. We discuss implications for online communication and research on spontaneous trait inferences.

Callous-unemotional traits and empathy deficits: Mediating effects of affective perspective-taking and facial emotion recognition.

PubMed

Lui, Joyce H L; Barry, Christopher T; Sacco, Donald F

2016-09-01

Although empathy deficits are thought to be associated with callous-unemotional (CU) traits, findings remain equivocal and little is known about what specific abilities may underlie these purported deficits. Affective perspective-taking (APT) and facial emotion recognition may be implicated, given their independent associations with both empathy and CU traits. The current study examined how CU traits relate to cognitive and affective empathy and whether APT and facial emotion recognition mediate these relations. Participants were 103 adolescents (70 males) aged 16-18 attending a residential programme. CU traits were negatively associated with cognitive and affective empathy to a similar degree. The association between CU traits and affective empathy was partially mediated by APT. Results suggest that assessing mechanisms that may underlie empathic deficits, such as perspective-taking, may be important for youth with CU traits and may inform targets of intervention.

No evidence for a role of the serotonin 4 receptor in five-factor personality traits: A positron emission tomography brain study.

PubMed

Stenbæk, Dea Siggaard; Dam, Vibeke Høyrup; Fisher, Patrick MacDonald; Hansen, Nanna; Hjordt, Liv Vadskjær; Frokjaer, Vibe Gedsoe

2017-01-01

Serotonin (5-HT) brain architecture appears to be implicated in normal personality traits as supported by genetic associations and studies using molecular brain imaging. However, so far, no studies have addressed potential contributions to variation in normal personality traits from in vivo serotonin 4 receptor (5-HT4R) brain availability, which has recently become possible to image with Positron Emission Tomography (PET). This is particularly relevant since availability of 5-HT4R has been shown to adapt to synaptic levels of 5-HT and thus offers information about serotonergic tone in the healthy brain. In 69 healthy participants (18 females), the associations between personality traits assessed with the five-factor NEO Personality Inventory-Revised (NEO PI-R) and regional cerebral 5-HT4R binding in neocortex, amygdala, hippocampus, and anterior cingulate cortex (ACC) were investigated using linear regression models. The associations between each of the five personality traits and a latent variable construct of global 5-HT4R levels were also evaluated using latent variable structural equation models. We found no significant associations between the five NEO personality traits and regional 5-HT4R binding (all p-values > .17) or the latent construct of global 5-HT4R levels (all p-values > .37). Our findings indicate that NEO personality traits and 5-HT4R are not related in healthy participants. Under the assumption that global 5-HT4R levels index 5-HT tone, our data also suggest that 5-HT tone per se is not directly implicated in normal personality traits.

No evidence for a role of the serotonin 4 receptor in five-factor personality traits: A positron emission tomography brain study

PubMed Central

Fisher, Patrick MacDonald; Hansen, Nanna; Hjordt, Liv Vadskjær; Frokjaer, Vibe Gedsoe

2017-01-01

Serotonin (5-HT) brain architecture appears to be implicated in normal personality traits as supported by genetic associations and studies using molecular brain imaging. However, so far, no studies have addressed potential contributions to variation in normal personality traits from in vivo serotonin 4 receptor (5-HT4R) brain availability, which has recently become possible to image with Positron Emission Tomography (PET). This is particularly relevant since availability of 5-HT4R has been shown to adapt to synaptic levels of 5-HT and thus offers information about serotonergic tone in the healthy brain. In 69 healthy participants (18 females), the associations between personality traits assessed with the five-factor NEO Personality Inventory-Revised (NEO PI-R) and regional cerebral 5-HT4R binding in neocortex, amygdala, hippocampus, and anterior cingulate cortex (ACC) were investigated using linear regression models. The associations between each of the five personality traits and a latent variable construct of global 5-HT4R levels were also evaluated using latent variable structural equation models. We found no significant associations between the five NEO personality traits and regional 5-HT4R binding (all p-values > .17) or the latent construct of global 5-HT4R levels (all p-values > .37). Our findings indicate that NEO personality traits and 5-HT4R are not related in healthy participants. Under the assumption that global 5-HT4R levels index 5-HT tone, our data also suggest that 5-HT tone per se is not directly implicated in normal personality traits. PMID:28880910

Prevalence of sexual dimorphism in mammalian phenotypic traits

PubMed Central

Karp, Natasha A.; Mason, Jeremy; Beaudet, Arthur L.; Benjamini, Yoav; Bower, Lynette; Braun, Robert E.; Brown, Steve D.M.; Chesler, Elissa J.; Dickinson, Mary E.; Flenniken, Ann M.; Fuchs, Helmut; Angelis, Martin Hrabe de; Gao, Xiang; Guo, Shiying; Greenaway, Simon; Heller, Ruth; Herault, Yann; Justice, Monica J.; Kurbatova, Natalja; Lelliott, Christopher J.; Lloyd, K.C. Kent; Mallon, Ann-Marie; Mank, Judith E.; Masuya, Hiroshi; McKerlie, Colin; Meehan, Terrence F.; Mott, Richard F.; Murray, Stephen A.; Parkinson, Helen; Ramirez-Solis, Ramiro; Santos, Luis; Seavitt, John R.; Smedley, Damian; Sorg, Tania; Speak, Anneliese O.; Steel, Karen P.; Svenson, Karen L.; Obata, Yuichi; Suzuki, Tomohiro; Tamura, Masaru; Kaneda, Hideki; Furuse, Tamio; Kobayashi, Kimio; Miura, Ikuo; Yamada, Ikuko; Tanaka, Nobuhiko; Yoshiki, Atsushi; Ayabe, Shinya; Clary, David A.; Tolentino, Heather A.; Schuchbauer, Michael A.; Tolentino, Todd; Aprile, Joseph Anthony; Pedroia, Sheryl M.; Kelsey, Lois; Vukobradovic, Igor; Berberovic, Zorana; Owen, Celeste; Qu, Dawei; Guo, Ruolin; Newbigging, Susan; Morikawa, Lily; Law, Napoleon; Shang, Xueyuan; Feugas, Patricia; Wang, Yanchun; Eskandarian, Mohammad; Zhu, Yingchun; Nutter, Lauryl M. J.; Penton, Patricia; Laurin, Valerie; Clarke, Shannon; Lan, Qing; Sohel, Khondoker; Miller, David; Clark, Greg; Hunter, Jane; Cabezas, Jorge; Bubshait, Mohammed; Carroll, Tracy; Tondat, Sandra; MacMaster, Suzanne; Pereira, Monica; Gertsenstein, Marina; Danisment, Ozge; Jacob, Elsa; Creighton, Amie; Sleep, Gillian; Clark, James; Teboul, Lydia; Fray, Martin; Caulder, Adam; Loeffler, Jorik; Codner, Gemma; Cleak, James; Johnson, Sara; Szoke-Kovacs, Zsombor; Radage, Adam; Maritati, Marina; Mianne, Joffrey; Gardiner, Wendy; Allen, Susan; Cater, Heather; Stewart, Michelle; Keskivali-Bond, Piia; Sinclair, Caroline; Brown, Ellen; Doe, Brendan; Wardle-Jones, Hannah; Grau, Evelyn; Griggs, Nicola; Woods, Mike; Kundi, Helen; Griffiths, Mark N. D.; Kipp, Christian; Melvin, David G.; Raj, Navis P. S.; Holroyd, Simon A.; Gannon, David J.; Alcantara, Rafael; Galli, Antonella; Hooks, Yvette E.; Tudor, Catherine L.; Green, Angela L.; Kussy, Fiona L.; Tuck, Elizabeth J.; Siragher, Emma J.; Maguire, Simon A.; Lafont, David T.; Vancollie, Valerie E.; Pearson, Selina A.; Gates, Amy S.; Sanderson, Mark; Shannon, Carl; Anthony, Lauren F. E.; Sumowski, Maksymilian T.; McLaren, Robbie S. B.; Swiatkowska, Agnieszka; Isherwood, Christopher M.; Cambridge, Emma L; Wilson, Heather M.; Caetano, Susana S.; Mazzeo, Cecilia Icoresi; Dabrowska, Monika H.; Lillistone, Charlotte; Estabel, Jeanne; Maguire, Anna Karin B.; Roberson, Laura-Anne; Pavlovic, Guillaume; Birling, Marie-Christine; Marie, Wattenhofer-Donze; Jacquot, Sylvie; Ayadi, Abdel; Ali-Hadji, Dalila; Charles, Philippe; André, Philippe; Le Marchand, Elise; El Amri, Amal; Vasseur, Laurent; Aguilar-Pimentel, Antonio; Becker, Lore; Treise, Irina; Moreth, Kristin; Stoeger, Tobias; Amarie, Oana V.; Neff, Frauke; Wurst, Wolfgang; Bekeredjian, Raffi; Ollert, Markus; Klopstock, Thomas; Calzada-Wack, Julia; Marschall, Susan; Brommage, Robert; Steinkamp, Ralph; Lengger, Christoph; Östereicher, Manuela A.; Maier, Holger; Stoeger, Claudia; Leuchtenberger, Stefanie; Yildrim, AliÖ; Garrett, Lillian; Hölter, Sabine M; Zimprich, Annemarie; Seisenberger, Claudia; Bürger, Antje; Graw, Jochen; Eickelberg, Oliver; Zimmer, Andreas; Wolf, Eckhard; Busch, Dirk H; Klingenspor, Martin; Schmidt-Weber, Carsten; Gailus-Durner, Valérie; Beckers, Johannes; Rathkolb, Birgit; Rozman, Jan; Wakana, Shigeharu; West, David; Wells, Sara; Westerberg, Henrik; Yaacoby, Shay; White, Jacqueline K.

2017-01-01

The role of sex in biomedical studies has often been overlooked, despite evidence of sexually dimorphic effects in some biological studies. Here, we used high-throughput phenotype data from 14,250 wildtype and 40,192 mutant mice (representing 2,186 knockout lines), analysed for up to 234 traits, and found a large proportion of mammalian traits both in wildtype and mutants are influenced by sex. This result has implications for interpreting disease phenotypes in animal models and humans. PMID:28650954

Sickle Cell Trait and Fatal Exertional Heat Illness: Implications for Exercise-Related Death of Young Ddults

DTIC Science & Technology

2008-10-22

athletes who utilize ordinary weather reports? Alpha- Thalassemia Protects Against Exertional Mortality with Sickle Cell Trait • 30% of African...Americans have alpha- thalassemia (2-3 alpha genes instead of 4). In those with sickle cell trait the main effect is to lower the Hb S fraction below 36...expected 15 cases with alpha- thalassemia & ប% S • Two cases had Hb S < 36% , implying about a 7.5-fold protection for those with alpha thalassemia

Are individuals with higher psychopathic traits better learners at lying? Behavioural and neural evidence.

PubMed

Shao, R; Lee, T M C

2017-07-25

High psychopathy is characterized by untruthfulness and manipulativeness. However, existing evidence on higher propensity or capacity to lie among non-incarcerated high-psychopathic individuals is equivocal. Of particular importance, no research has investigated whether greater psychopathic tendency is associated with better 'trainability' of lying. An understanding of whether the neurobehavioral processes of lying are modifiable through practice offers significant theoretical and practical implications. By employing a longitudinal design involving university students with varying degrees of psychopathic traits, we successfully demonstrate that the performance speed of lying about face familiarity significantly improved following two sessions of practice, which occurred only among those with higher, but not lower, levels of psychopathic traits. Furthermore, this behavioural improvement associated with higher psychopathic tendency was predicted by a reduction in lying-related neural signals and by functional connectivity changes in the frontoparietal and cerebellum networks. Our findings provide novel and pivotal evidence suggesting that psychopathic traits are the key modulating factors of the plasticity of both behavioural and neural processes underpinning lying. These findings broadly support conceptualization of high-functioning individuals with higher psychopathic traits as having preserved, or arguably superior, functioning in neural networks implicated in cognitive executive processing, but deficiencies in affective neural processes, from a neuroplasticity perspective.

A discrete emotions approach to positive emotion disturbance in depression.

PubMed

Gruber, June; Oveis, Christopher; Keltner, Dacher; Johnson, Sheri L

2011-01-01

Converging findings suggest that depressed individuals exhibit disturbances in positive emotion. No study, however, has ascertained which specific positive emotions are implicated in depression. We report two studies that compare how depressive symptoms relate to distinct positive emotions at both trait and state levels of assessment. In Study 1 (N=185), we examined associations between depressive symptoms and three trait positive emotions (pride, happy, amusement). Study 2 compared experiential and autonomic reactivity to pride, happy, and amusement film stimuli between depressive (n=24; DS) and non-depressive (n=31; NDS) symptom groups. Results indicate that symptoms of depression were most strongly associated with decreased trait pride and decreased positive emotion experience to pride-eliciting films. Discussion focuses on the implications these findings have for understanding emotion deficits in depression as well as for the general study of positive emotion. © 2010 Psychology Press, an imprint of the Taylor & Francis Group, an Informa business

Genetic dissection of the α-globin super-enhancer in vivo

PubMed Central

Hay, Deborah; Hughes, Jim R.; Rode, Christina; Li, Pik-Shan; Pennacchio, Len A.; Sloane-Stanley, Jacqueline A.; Ayyub, Helena; Butler, Sue; Sauka-Spengler, Tatjana; Gibbons, Richard J.; Smith, Andrew J.H.; Wood, William G.; Higgs, Douglas R.

2016-01-01

Many genes determining cell identity are regulated by clusters of mediator-bound enhancer elements collectively referred to as super-enhancers. These have been proposed to manifest higher-order properties important in development and disease. Here, we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer singly and in informative combinations, we demonstrate that each constituent enhancer appears to act independently and in an additive fashion with respect to hematologic phenotype, gene expression, chromatin structure and chromosome conformation, without clear evidence of synergistic or higher-order effects. Our study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation. PMID:27376235

Customizing the genome as therapy for the β-hemoglobinopathies

PubMed Central

Canver, Matthew C.

2016-01-01

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats–based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34+ hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. PMID:27053533

Genetic fatalism and social policy: the implications of behavior genetics research.

PubMed Central

Alper, J. S.; Beckwith, J.

1993-01-01

Recent advances in molecular genetics methods have provided new means of determining the genetic bases of human behavioral traits. The impetus for the use of these approaches for specific behaviors depends, in large part, on previous familial studies on inheritance of such traits. In the past, a finding of a genetic basis for a trait was often accompanied with the idea that that trait is unchangeable. We discuss the definition of "genetic trait" and heritability and examine the relationship between these concepts and the malleability of traits for both molecular and nonmolecular approaches to behavioral genetics. We argue that the malleability of traits is as much a social and political question as it is a biological one and that whether or not a trait is genetic has little relevance to questions concerning determinism, free will, and individual responsibility for actions. We conclude by noting that "scientific objectivity" should not be used to conceal the social perspectives that underlie proposals regarding social change. PMID:7716971

Effects of Trait Hostility, Mapping Interface, and Character Identification on Aggressive Thoughts and Overall Game Experience After Playing a Violent Video Game.

PubMed

Jung, Younbo; Park, Namkee; Lee, Kwan Min

2015-12-01

This study investigated the effects of trait-level hostility, interface types, and character identification on aggressive thoughts and overall game experience after playing a violent video game. Results showed that the mapping interface made participants with high trait-level hostility more readily accessible to aggressive contracts, yet it did not have any significant impact for participants with low trait-level hostility. Participants with low trait-level hostility reported more positive game experience in the mapping interface condition, while participants with high trait-level hostility in the same condition reported more negative game experience. Results also indicated that character identification has moderating effects on activating aggressive thoughts and mediating effects on overall game experience. Implications regarding possible ways of reducing potentially negative outcomes from violent games are discussed.

Personality traits and life satisfaction among online game players.

PubMed

Chen, Lily Shui-Lien; Tu, Hill Hung-Jen; Wang, Edward Shih-Tse

2008-04-01

The DFC Intelligence predicts worldwide online game revenues will reach $9.8 billion by 2009, making online gaming a mainstream recreational activity. Understanding online game player personality traits is therefore important. This study researches the relationship between personality traits and life satisfaction in online game players. Taipei, Taiwan, is the study location, with questionnaire surveys conducted in cyber cafe shops. Multiple regression analysis studies the causal relationship between personality traits and life satisfaction in online game players. The result shows that neuroticism has significant negative influence on life satisfaction. Both openness and conscientiousness have significant positive influence on life satisfaction. Finally, implications for leisure practice and further research are discussed.

Maternal Exposure to Childhood Abuse Is Associated with Mate Selection: Implications for Autism in Offspring

ERIC Educational Resources Information Center

Roberts, Andrea L.; Lyall, Kristen; Weisskopf, Marc G.

2017-01-01

Maternal experience of childhood abuse has been associated with offspring autism. To explore whether familial tendency towards autistic traits--presumably related to genetic predisposition--accounts for this association, we examined whether women who experienced childhood abuse were more likely to select mates with high levels of autistic traits,…

Association between personality traits and Escitalopram treatment efficacy in panic disorder.

PubMed

Võhma, Ülle; Raag, Mait; Tõru, Innar; Aluoja, Anu; Maron, Eduard

2017-08-01

There is strong evidence to suggest that personality factors may interact with the development and clinical expression of panic disorder (PD). A greater understanding of these relationships may have important implications for clinical practice and implications for searching reliable predictors of treatment outcome. The study aimed to examine the effect of escitalopram treatment on personality traits in PD patients, and to identify whether the treatment outcome could be predicted by any personality trait. A study sample consisting of 110 outpatients with PD treated with 10-20 mg/day of escitalopram for 12 weeks. The personality traits were evaluated before and after 12 weeks of medication by using the Swedish universities Scales of Personality (SSP). Although almost all personality traits on the SSP measurement were improved after 12 weeks of medication in comparison with the baseline scores, none of these changes reached a statistically significant level. Only higher impulsivity at baseline SSP predicted non-remission to 12-weeks treatment with escitalopram; however, this association did not withstand the Bonferroni correction in multiple comparisons. All patients were treated in a naturalistic way using an open-label drug, so placebo responses cannot be excluded. The sample size can still be considered not large enough to reveal statistically significant findings. Maladaptive personality disposition in patients with PD seems to have a trait character and shows little trend toward normalization after 12-weeks treatment with the antidepressant, while the association between impulsivity and treatment response needs further investigation.

Plasticity Regulators Modulate Specific Root Traits in Discrete Nitrogen Environments

PubMed Central

Gifford, Miriam L.; Banta, Joshua A.; Katari, Manpreet S.; Hulsmans, Jo; Chen, Lisa; Ristova, Daniela; Tranchina, Daniel; Purugganan, Michael D.; Coruzzi, Gloria M.; Birnbaum, Kenneth D.

2013-01-01

Plant development is remarkably plastic but how precisely can the plant customize its form to specific environments? When the plant adjusts its development to different environments, related traits can change in a coordinated fashion, such that two traits co-vary across many genotypes. Alternatively, traits can vary independently, such that a change in one trait has little predictive value for the change in a second trait. To characterize such “tunability” in developmental plasticity, we carried out a detailed phenotypic characterization of complex root traits among 96 accessions of the model Arabidopsis thaliana in two nitrogen environments. The results revealed a surprising level of independence in the control of traits to environment – a highly tunable form of plasticity. We mapped genetic architecture of plasticity using genome-wide association studies and further used gene expression analysis to narrow down gene candidates in mapped regions. Mutants in genes implicated by association and expression analysis showed precise defects in the predicted traits in the predicted environment, corroborating the independent control of plasticity traits. The overall results suggest that there is a pool of genetic variability in plants that controls traits in specific environments, with opportunity to tune crop plants to a given environment. PMID:24039603

Variation in trait trade-offs allows differentiation among predefined plant functional types: implications for predictive ecology.

PubMed

Verheijen, Lieneke M; Aerts, Rien; Bönisch, Gerhard; Kattge, Jens; Van Bodegom, Peter M

2016-01-01

Plant functional types (PFTs) aggregate the variety of plant species into a small number of functionally different classes. We examined to what extent plant traits, which reflect species' functional adaptations, can capture functional differences between predefined PFTs and which traits optimally describe these differences. We applied Gaussian kernel density estimation to determine probability density functions for individual PFTs in an n-dimensional trait space and compared predicted PFTs with observed PFTs. All possible combinations of 1-6 traits from a database with 18 different traits (total of 18 287 species) were tested. A variety of trait sets had approximately similar performance, and 4-5 traits were sufficient to classify up to 85% of the species into PFTs correctly, whereas this was 80% for a bioclimatically defined tree PFT classification. Well-performing trait sets included combinations of correlated traits that are considered functionally redundant within a single plant strategy. This analysis quantitatively demonstrates how structural differences between PFTs are reflected in functional differences described by particular traits. Differentiation between PFTs is possible despite large overlap in plant strategies and traits, showing that PFTs are differently positioned in multidimensional trait space. This study therefore provides the foundation for important applications for predictive ecology. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Hemoglobin stability: observations on the denaturation of normal and abnormal hemoglobins by oxidant dyes, heat, and alkali

PubMed Central

Rieder, Ronald F.

1970-01-01

Several unstable mutant hemoglobins have alterations which affect areas of the molecule involved in the attachment of heme to globin. Loss of heme from globin has been demonstrated during the denaturation of some of these unstable mutants. The importance of heme ligands for the stability of hemoglobin was illustrated in the present experiments on the denaturation of several hemoglobins and hemoglobin derivatives by heat, oxidative dyes, and alkali. Heating of normal hemolysates diluted to 4 g of hemoglobin per 100 ml at 50°C for 20 hr in 0.05 M sodium phosphate, pH 7.4, caused precipitation of 23-54% of the hemoglobin. Dialysis against water or dilution of the sample decreased denaturation to 12-20%. Precipitation was decreased to less than 3.5% by the presence of 0.015 M potassium cyanide. Increasing the ionic strength of the medium increased precipitation. Cyanide prevented the formation of inclusion bodies when red cells containing unstable hemoglobin Philly, β35 tyr → phe, were incubated with the redox dye new methylene blue. Conversion to methemoglobin increased the rate of alkali denaturation of hemoglobin but the presence of potassium cyanide returned the denaturation rate to that of ferrohemoglobin. The ability of cyanide to decrease heat precipitation of hemoglobin may depend on a dimeric or tetrameric state of the hemoglobin molecule. Purified β-chains, which exist as tetramers, were stabilized but purified monomeric α-chains were not rendered more heat resistant by the ligand. Stabilization of hemoglobin by cyanide required binding of the ligand to only one heme of an αβ-dimer. Hemoglobin Gun Hill, an unstable molecule with heme groups present only on the α-chains was quite heat stable in the presence of cyanide. The binding of cyanide to the iron atom in methemoglobin is thought to be associated with increased planarity of the heme group and increased stability of the heme-globin complex. The stabilizing effect of cyanide in the above experiments suggests that Heinz body formation, heat precipitation of hemoglobin, and the increased alkali denaturation of methemoglobin depend on changes of heme-globin binding. Images PMID:5480860

Hematopoietic stem cell transplantation for people with ß-thalassaemia major.

PubMed

Jagannath, Vanitha A; Fedorowicz, Zbys; Al Hajeri, Amani; Sharma, Akshay

2014-10-15

Thalassemia is an inherited blood disorder, caused by mutations in regulatory genes and transmitted as an autosomal recessive disorder, which results in a reduced rate of synthesis of one of the globin chains that make up haemoglobin. In ß-thalassaemia major there is an underproduction of ß-globin chains combined with excess of free α-globin chains. The excess free α-globin chains damage the red blood cell membranes, leading to their destruction and a phenomenon termed ineffective erythropoiesis. The conventional approach to treatment is based on the correction of haemoglobin status through regular blood transfusions and iron chelation therapy for iron overload. Although conventional treatment has the capacity to improve the quality of life of people with ß-thalassaemia major, allogeneic hematopoietic stem cell transplantation is the only currently available procedure which has the potential to definitively cure the disease. To evaluate the effectiveness and safety of different types of allogeneic hematopoietic stem cell transplantation, in people with severe transfusion-dependant ß-thalassaemia major, ß-thalassaemia intermedia or ß0/+- thalassaemia variants requiring chronic blood transfusion. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register comprising references identified from comprehensive electronic database searches and handsearches of relevant journals and abstract books of conference proceedings.Date of the most recent search: 11 November 2013. Randomised controlled trials and quasi-randomised controlled trials comparing allogeneic hematopoietic stem cell transplantation with each other or with standard therapy (regular transfusion and chelation regimen). Two review authors independently screened studies and had planned to extract data and assess risk of bias using standard Cochrane Collaboration methodologies but no studies were identified for inclusion. No relevant studies were retrieved after a comprehensive search of the literature. We were unable to identify any randomised controlled trials or quasi-randomised controlled trials on the effectiveness and safety of different types of allogeneic stem cell transplantation in people with severe transfusion-dependant ß-thalassaemia major or ß0/+- thalassaemia variants requiring chronic blood transfusion. The absence of high-level evidence for the effectiveness of these interventions emphasises the need for well-designed, adequately-powered, randomised controlled clinical trials.

What are the associations between parenting, callous-unemotional traits, and antisocial behavior in youth? A systematic review of evidence.

PubMed

Waller, Rebecca; Gardner, Frances; Hyde, Luke W

2013-06-01

A growing body of research has examined callous-unemotional (CU) traits among samples of antisocial youth. Debate surrounds the malleability of CU traits and their responsiveness to parenting and parent-focused interventions. This review examines evidence from studies that have investigated various relationships between parenting, CU traits, and antisocial behavior (AB). Studies were categorized according to five distinct research questions each addressing associations among parenting, CU traits, and AB in a different way. The results suggest that dimensions of parenting are prospectively related to changes in CU traits. Subgroups of youth with both high levels of CU traits and AB also appear to have experienced negative parenting practices. However, negative parenting is not consistently related to AB in cross-sectional studies for youth with high levels of CU traits. At the same time, parenting-focused interventions appear effective in reducing the level of AB and CU traits in youth. The findings and implications for future studies are critically discussed as they pose challenges for current etiological theories of AB. Copyright © 2013 Elsevier Ltd. All rights reserved.

Neurocognitive deficits and history of childhood abuse in schizophrenia spectrum disorders: associations with Cluster B personality traits.

PubMed

Lysaker, Paul H; Wickett, Amanda M; Lancaster, Rebecca S; Davis, Louanne W

2004-05-01

Cluster B personality traits have been detected in persons with schizophrenia, at a rate exceeding that of the general population. Unclear, however, is how to account for such high rates of Cluster B traits. Accordingly, this study explored the hypothesis that the presence of these traits may be linked to impairments in neurocognition, and childhood abuse history. To test this, we simultaneously obtained an assessment of Cluster B traits using the Millon Clinical Multiaxial Inventory III, along with measures of attention, verbal memory, affect recognition, executive function and childhood abuse history among 37 persons with schizophrenia spectrum disorders in a post acute phases of illness. Pearson correlation coefficients revealed that higher levels of histrionic and narcissistic traits were related to poorer neurocognition while higher levels of narcissistic traits were negatively correlated with childhood physical abuse. Higher levels of borderline traits were uniquely related to the report of childhood sexual abuse while higher levels of antisocial traits were related to higher levels of childhood physical abuse. Theoretical and clinical implications are discussed.

Facial attractiveness, weight status, and personality trait attribution: The role of attractiveness in weight stigma.

PubMed

Cross, Nicole; Kiefner-Burmeister, Allison; Rossi, James; Borushok, Jessica; Hinman, Nova; Burmeister, Jacob; Carels, Robert A

The current study examined the influence of facial attractiveness and weight status on personality trait attributions (e.g., honest, friendly) among more and less facially attractive as well as thin and overweight models. Participants viewed pictures of one of four types of models (overweight/less attractive, overweight/more attractive, thin/less attractive, thin/more attractive) and rated their attractiveness (facial, body, overall) and personality on 15 traits. Facial attractiveness and weight status additively impacted personality trait ratings. In mediation analyses, the facial attractiveness condition was no longer associated with personality traits after controlling for perceived facial attractiveness in 12 personality traits. Conversely, the thin and overweight condition was no longer associated with personality traits after controlling for perceived body attractiveness in only 2 personality traits. Post hoc moderation analysis indicated that weight status differently influenced the association between body attractiveness and personality trait attribution. Findings bear implications for attractiveness bias, weight bias, and discrimination research. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

The genetics of muscle atrophy and growth: the impact and implications of polymorphisms in animals and humans.

PubMed

Gordon, Erynn S; Gordish Dressman, Heather A; Hoffman, Eric P

2005-10-01

Much of the vast diversity we see in animals and people is governed by genetic loci that have quantitative effects of phenotype (quantitative trait loci; QTLs). Here we review the current knowledge of the genetics of atrophy and hypertrophy in both animal husbandry (meat quantity and quality), and humans (muscle size and performance). The selective breeding of animals for meat has apparently led to a few genetic loci with strong effects, with different loci in different animals. In humans, muscle quantitative trait loci (QTLs) appear to be more complex, with few "major" loci identified to date, although this is likely to change in the near future. We describe how the same phenotypic traits we see as positive, greater lean muscle mass in cattle or a better exercise results in humans, can also have negative "side effects" given specific environmental challenges. We also discuss the strength and limitations of single nucleotide polymorphisms (SNP) association studies; what the reader should look for and expect in a published study. Lastly we discuss the ethical and societal implications of this genetic information. As more and more research into the genetic loci that dictate phenotypic traits become available, the ethical implications of testing for these loci become increasingly important. As a society, most accept testing for genetic diseases or susceptibility, but do we as easily accept testing to determine one's athletic potential to be an Olympic endurance runner, or quarterback on the high school football team.

Evidence for social working memory from a parametric functional MRI study.

PubMed

Meyer, Meghan L; Spunt, Robert P; Berkman, Elliot T; Taylor, Shelley E; Lieberman, Matthew D

2012-02-07

Keeping track of various amounts of social cognitive information, including people's mental states, traits, and relationships, is fundamental to navigating social interactions. However, to date, no research has examined which brain regions support variable amounts of social information processing ("social load"). We developed a social working memory paradigm to examine the brain networks sensitive to social load. Two networks showed linear increases in activation as a function of increasing social load: the medial frontoparietal regions implicated in social cognition and the lateral frontoparietal system implicated in nonsocial forms of working memory. Of these networks, only load-dependent medial frontoparietal activity was associated with individual differences in social cognitive ability (trait perspective-taking). Although past studies of nonsocial load have uniformly found medial frontoparietal activity decreases with increasing task demands, the current study demonstrates these regions do support increasing mental effort when such effort engages social cognition. Implications for the etiology of clinical disorders that implicate social functioning and potential interventions are discussed.

The implications of Big Five standing for the distribution of trait manifestation in behavior: fifteen experience-sampling studies and a meta-analysis.

PubMed

Fleeson, William; Gallagher, Patrick

2009-12-01

One of the fundamental questions in personality psychology is whether and how strongly trait standing relates to the traits that people actually manifest in their behavior when faced with real pressures and real consequences of their actions. One reason this question is fundamental is the common belief that traits do not predict how individuals behave, which leads to the reasonable conclusion that traits are not important to study. However, this conclusion is surprising given that there is almost no data on the ability of traits to predict distributions of naturally occurring, representative behaviors of individuals (and that there are many studies showing that traits do indeed predict specific behaviors). The authors describe a meta-analysis of 15 experience-sampling studies, conducted over the course of 8 years, amassing over 20,000 reports of trait manifestation in behavior. Participants reported traits on typical self-report questionnaires, then described their current behavior multiple times per day for several days as the behavior was occurring. Results show that traits, contrary to expectations, were strongly predictive of individual differences in trait manifestation in behavior, predicting average levels with correlations between .42 and .56 (approaching .60 for stringently restricted studies). Several other ways of summarizing trait manifestation in behavior were also predicted from traits. These studies provide evidence that traits are powerful predictors of actual manifestation of traits in behavior.

Is job performance independent from career success? A conceptual distinction between competence and agency.

PubMed

Mollaret, Patrick; Miraucourt, Delphine

2016-12-01

Adopting a social approach to social judgment, we conducted five studies to validate a conceptual distinction between agency and competence traits. Studies 1-3 revealed that competence traits (e.g., skillful) are associated with job performance, whereas agentic traits (e.g., ambitious) are associated with career success. Study 4 showed that only agency predicted the amount of money people are likely to earn: the more a given trait was considered as agentic, the more it was associated with high monetary values. Study 5 highlighted the predominance of agency traits over competence traits in the evaluation of an employee applying for a promotion. Nevertheless, participants asserted that competence was the main criterion they used to judge the applicant. Implications of the conceptual distinction between agency and competence for social cognition are discussed. © 2016 Scandinavian Psychological Associations and John Wiley & Sons Ltd.

Psychopathic traits modulate microstructural integrity of right uncinate fasciculus in a community population.

PubMed

Sobhani, Mona; Baker, Laura; Martins, Bradford; Tuvblad, Catherine; Aziz-Zadeh, Lisa

2015-01-01

Individuals with psychopathy possess emotional and behavioral abnormalities. Two neural regions, involved in behavioral control and emotion regulation, are often implicated: amygdala and ventromedial prefrontal cortex (VMPFC). Recently, in studies using adult criminal populations, reductions in microstructural integrity of the white matter connections (i.e., uncinate fasciculus (UF)) between these two neural regions have been discovered in criminals with psychopathy, supporting the notion of neural dysfunction in the amygdala-VMPFC circuit. Here, a young adult, community sample is used to assess whether psychopathic traits modulate microstructural integrity of UF, and whether this relationship is dependent upon levels of trait anxiety, which is sometimes used to distinguish subtypes of psychopathy. Results reveal a negative association between psychopathic traits and microstructural integrity of UF, supporting previous findings. However, no moderation of the relationship by trait anxiety was discovered. Findings provide further support for the notion of altered amygdala-VMPFC connectivity in association with higher psychopathic traits.

Reduced amygdala response in youths with disruptive behavior disorders and psychopathic traits: decreased emotional response versus increased top-down attention to nonemotional features.

PubMed

White, Stuart F; Marsh, Abigail A; Fowler, Katherine A; Schechter, Julia C; Adalio, Christopher; Pope, Kayla; Sinclair, Stephen; Pine, Daniel S; Blair, R James R

2012-07-01

Amygdala dysfunction has been reported to exist in youths and adults with psychopathic traits. However, there has been disagreement as to whether this dysfunction reflects a primary emotional deficit or is secondary to atypical attentional control. The authors examined the validity of the contrasting predictions. Participants were 15 children and adolescents (ages 10–17 years) with both disruptive behavior disorders and psychopathic traits and 17 healthy comparison youths. Functional MRI was used to assess the response of the amygdala and regions implicated in top-down attentional control (the dorsomedial and lateral frontal cortices) to emotional expression under conditions of high and low attentional load. Relative to youths with disruptive behavior disorders and psychopathic traits, healthy comparison subjects showed a significantly greater increase in the typical amygdala response to fearful expressions under low relative to high attentional load conditions. There was also a selective inverse relationship between the response to fearful expressions under low attentional load and the callous-unemotional component (but not the narcissism or impulsivity component) of psychopathic traits. In contrast, the two groups did not differ in the significant recruitment of the dorsomedial and lateral frontal cortices as a function of attentional load. Youths with disruptive behavior disorders and psychopathic traits showed reduced amygdala responses to fearful expressions under low attentional load but no indications of increased recruitment of regions implicated in top-down attentional control. These findings suggest that the emotional deficit observed in youths with disruptive behavior disorders and psychopathic traits is primary and not secondary to increased top-down attention to nonemotional stimulus features.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bank, A.; Anderson, W.F.; Zaino, E.C.

This book discusses the topics presented at the symposium on the subject of 'Thalassemia'. Sickle cell anemia is also briefly discussed. The aspects discussed are chromosomal defects of anemias particularly globin synthesis, and the role of messenger RNA and other chromosomes.

The globins of cyanobacteria and algae.

PubMed

Johnson, Eric A; Lecomte, Juliette T J

2013-01-01

Approximately, 20 years ago, a haemoglobin gene was identified within the genome of the cyanobacterium Nostoc commune. Haemoglobins have now been confirmed in multiple species of photosynthetic microbes beyond N. commune, and the diversity of these proteins has recently come under increased scrutiny. This chapter summarizes the state of knowledge concerning the phylogeny, physiology and chemistry of globins in cyanobacteria and green algae. Sequence information is by far the best developed and the most rapidly expanding aspect of the field. Structural and ligand-binding properties have been described for just a few proteins. Physiological data are available for even fewer. Although activities such as nitric oxide dioxygenation and oxygen scavenging are strong candidates for cellular function, dedicated studies will be required to complete the story on this intriguing and ancient group of proteins. © 2013 Elsevier Ltd. All rights reserved.

Genetic dissection of the α-globin super-enhancer in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hay, Deborah; Hughes, Jim R.; Babbs, Christian

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

Customizing the genome as therapy for the β-hemoglobinopathies.

PubMed

Canver, Matthew C; Orkin, Stuart H

2016-05-26

Despite nearly complete understanding of the genetics of the β-hemoglobinopathies for several decades, definitive treatment options have lagged behind. Recent developments in technologies for facile manipulation of the genome (zinc finger nucleases, transcription activator-like effector nucleases, or clustered regularly interspaced short palindromic repeats-based nucleases) raise prospects for their clinical application. The use of genome-editing technologies in autologous CD34(+) hematopoietic stem and progenitor cells represents a promising therapeutic avenue for the β-globin disorders. Genetic correction strategies relying on the homology-directed repair pathway may repair genetic defects, whereas genetic disruption strategies relying on the nonhomologous end joining pathway may induce compensatory fetal hemoglobin expression. Harnessing the power of genome editing may usher in a second-generation form of gene therapy for the β-globin disorders. © 2016 by The American Society of Hematology.

Genetic dissection of the α-globin super-enhancer in vivo

DOE PAGES

Hay, Deborah; Hughes, Jim R.; Babbs, Christian; ...

2016-07-04

Many genes determining cell identity are regulated by clusters of Mediator-bound enhancer elements collectively referred to as super-enhancers. Furthermore, these super-enhancers have been proposed to manifest higher-order properties important in development and disease. Here we report a comprehensive functional dissection of one of the strongest putative super-enhancers in erythroid cells. By generating a series of mouse models, deleting each of the five regulatory elements of the α-globin super-enhancer individually and in informative combinations, we demonstrate that each constituent enhancer seems to act independently and in an additive fashion with respect to hematological phenotype, gene expression, chromatin structure and chromosome conformation,more » without clear evidence of synergistic or higher-order effects. This study highlights the importance of functional genetic analyses for the identification of new concepts in transcriptional regulation.« less

[RDBH-method and big DyeTM terminator technology in accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster].

PubMed

Akperova, G A

2014-11-01

IThe purpose of this study was to evaluate of the efficiency of RDBH-method and Big DyeTM Terminator technology in an accurate diagnosis of β-thalassemia and the allelic polymorphism of β-globin cluster. It was done a complete hematology analysis (HB, MCH, MCV, MCHC, RBC, Hct, HbA2, HbF, Serum iron, Serum ferritin at four children (males, 6-10 years old) and their parents. Molecular analysis included Reverse Dot-Blot Hybridization StripAssay (RDBH) and DNA sequencing on ABI PRISM Big DyeTM Terminator. Hematologic and molecular parameters were contradictory. The homozygosity for β0-thalassemia (β0IVS2.1[G>A] and β0codon 8[-AA]) at three boys with the mild clinical manifestation and heterozygosity of their parents for mutations, and the absence of β-globin mutations at parents and a boy who holds monthly transfusion was established by RDBH-analysis. DNA sequencing by technology Big DyeTM Terminator showed polymorphism at positions -551 and -521 of Cap5'-region (-650-250) - (AT)7(T)7 and (AT)8(T)5. Application of the integrated clinical-molecular approach is an ideal method for an accurate diagnosis, identification of asymptomatic carriers and a reduce of the risk of complications from β-thalassemia, moreover screening of γG-gene and the level of fetal hemoglobin in early childhood will help manage of β-thalassemia clinic and prevent heavy consequences of the disease.

Insulation of the Chicken β-Globin Chromosomal Domain from a Chromatin-Condensing Protein, MENT

PubMed Central

Istomina, Natalia E.; Shushanov, Sain S.; Springhetti, Evelyn M.; Karpov, Vadim L.; A. Krasheninnikov, Igor; Stevens, Kimberly; Zaret, Kenneth S.; Singh, Prim B.; Grigoryev, Sergei A.

2003-01-01

Active genes are insulated from developmentally regulated chromatin condensation in terminally differentiated cells. We mapped the topography of a terminal stage-specific chromatin-condensing protein, MENT, across the active chicken β-globin domain. We observed two sharp transitions of MENT concentration coinciding with the β-globin boundary elements. The MENT distribution profile was opposite to that of acetylated core histones but correlated with that of histone H3 dimethylated at lysine 9 (H3me2K9). Ectopic MENT expression in NIH 3T3 cells caused a large-scale and specific remodeling of chromatin marked by H3me2K9. MENT colocalized with H3me2K9 both in chicken erythrocytes and NIH 3T3 cells. Mutational analysis of MENT and experiments with deacetylase inhibitors revealed the essential role of the reaction center loop domain and an inhibitory affect of histone hyperacetylation on the MENT-induced chromatin remodeling in vivo. In vitro, the elimination of the histone H3 N-terminal peptide containing lysine 9 by trypsin blocked chromatin self-association by MENT, while reconstitution with dimethylated but not acetylated N-terminal domain of histone H3 specifically restored chromatin self-association by MENT. We suggest that histone H3 modification at lysine 9 directly regulates chromatin condensation by recruiting MENT to chromatin in a fashion that is spatially constrained from active genes by gene boundary elements and histone hyperacetylation. PMID:12944473

Creating a monomeric endonuclease TALE-I-SceI with high specificity and low genotoxicity in human cells.

PubMed

Lin, Jianfei; Chen, He; Luo, Ling; Lai, Yongrong; Xie, Wei; Kee, Kehkooi

2015-01-01

To correct a DNA mutation in the human genome for gene therapy, homology-directed repair (HDR) needs to be specific and have the lowest off-target effects to protect the human genome from deleterious mutations. Zinc finger nucleases, transcription activator-like effector nuclease (TALEN) and CRISPR-CAS9 systems have been engineered and used extensively to recognize and modify specific DNA sequences. Although TALEN and CRISPR/CAS9 could induce high levels of HDR in human cells, their genotoxicity was significantly higher. Here, we report the creation of a monomeric endonuclease that can recognize at least 33 bp by fusing the DNA-recognizing domain of TALEN (TALE) to a re-engineered homing endonuclease I-SceI. After sequentially re-engineering I-SceI to recognize 18 bp of the human β-globin sequence, the re-engineered I-SceI induced HDR in human cells. When the re-engineered I-SceI was fused to TALE (TALE-ISVB2), the chimeric endonuclease induced the same HDR rate at the human β-globin gene locus as that induced by TALEN, but significantly reduced genotoxicity. We further demonstrated that TALE-ISVB2 specifically targeted at the β-globin sequence in human hematopoietic stem cells. Therefore, this monomeric endonuclease has the potential to be used in therapeutic gene targeting in human cells. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparison of MicroRNAs Mediated in Reactivation of the γ-Globin in β-Thalassemia Patients, Responders and Non-Responders to Hydroxyurea.

PubMed

Hojjati, Mohammad T; Azarkeivan, Azita; Pourfathollah, Ali A; Amirizadeh, Naser

2017-03-01

Drug induction of Hb F seems to be an ideal therapy for patients with hemoglobin (Hb) disorders, and many efforts have been made to reveal the mechanism behind it. Thus, we examined in vivo expression of some microRNAs (miRNAs) that are thought to be involved in this process. Among β-thalassemia (β-thal) patients who were undergoing hydroxyurea (HU) therapy in the past 3 months and five healthy individuals, five responders and five non-responders, were also included in the study. Erythroid progenitors were isolated by magnetic activated cell sorting (MACS) and miRNA expression analyzed using reverse transcription-polymerase chain reaction (RT-PCR). We showed that γ-globin, miR-210 and miR-486-3p had higher levels in the responders than the non-responders group. Moreover, miR-150 and miR-320 had higher levels in the healthy group than both non-responders and responders groups, but the expression of miR-96 did not show any significant difference between the study groups. To the best of our knowledge, this is the first study proposing that 'induction of cellular hypoxic condition by Hb F inducing agents' could be the milestone of possible mechanisms that explain why responders are able to reactivate γ-globin genes and subsequently, more production of Hb F, in response to these agents in comparison to non-responders. However, further investigations need to be performed to verify this hypothesis.

Iron-heme-Bach1 axis is involved in erythroblast adaptation to iron deficiency.

PubMed

Kobayashi, Masahiro; Kato, Hiroki; Hada, Hiroshi; Itoh-Nakadai, Ari; Fujiwara, Tohru; Muto, Akihiko; Inoguchi, Yukihiro; Ichiyanagi, Kenji; Hojo, Wataru; Tomosugi, Naohisa; Sasaki, Hiroyuki; Harigae, Hideo; Igarashi, Kazuhiko

2017-03-01

Iron plays the central role in oxygen transport by erythrocytes as a constituent of heme and hemoglobin. The importance of iron and heme is also to be found in their regulatory roles during erythroblast maturation. The transcription factor Bach1 may be involved in their regulatory roles since it is deactivated by direct binding of heme. To address whether Bach1 is involved in the responses of erythroblasts to iron status, low iron conditions that induced severe iron deficiency in mice were established. Under iron deficiency, extensive gene expression changes and mitophagy disorder were induced during maturation of erythroblasts. Bach1 -/- mice showed more severe iron deficiency anemia in the developmental phase of mice and a retarded recovery once iron was replenished when compared with wild-type mice. In the absence of Bach1, the expression of globin genes and Hmox1 (encoding heme oxygenase-1) was de-repressed in erythroblasts under iron deficiency, suggesting that Bach1 represses these genes in erythroblasts under iron deficiency to balance the levels of heme and globin. Moreover, an increase in genome-wide DNA methylation was observed in erythroblasts of Bach1 -/- mice under iron deficiency. These findings reveal the principle role of iron as a regulator of gene expression in erythroblast maturation and suggest that the iron-heme-Bach1 axis is important for a proper adaptation of erythroblast to iron deficiency to avoid toxic aggregates of non-heme globin. Copyright© Ferrata Storti Foundation.

The Moderating Role of Anxiety in the Associations of Callous-Unemotional Traits with Self-Report and Laboratory Measures of Affective and Cognitive Empathy.

PubMed

Kahn, Rachel E; Frick, Paul J; Golmaryami, Farrah N; Marsee, Monica A

2017-04-01

In a sample of detained male adolescents (n = 107; Mean age = 15.50; SD = 1.30), we tested whether anxiety moderated the association of CU traits with self-report and computerized measures of affective (emotional reactivity) and cognitive (affective facial recognition and Theory of Mind [ToM]) empathy. Hierarchical regression analyses revealed that CU traits were negatively associated with self-reports of affective empathy and this association was not moderated by level of anxiety. Significant interactions revealed that CU traits were negatively associated with cognitive empathy (self-report) only at high levels of anxiety, whereas CU traits were positively associated with cognitive empathy on the ToM task only at low levels of anxiety. CU traits were also associated with greater fear recognition accuracy at low levels of anxiety. Implications for understanding and treating different variants of CU traits (i.e., primary and secondary) are discussed.

Measures of Narcissism and Their Relations to DSM-5 Pathological Traits: A Critical Reappraisal.

PubMed

Miller, Joshua D; Lynam, Donald R; Campbell, W Keith

2016-02-01

There exists substantial debate about how to best assess pathological narcissism with a variety of measures designed to assess grandiose and vulnerable narcissism, as well as the DSM-IV and DSM-5 based conceptualizations of narcissistic personality disorder (NPD). Wright and colleagues published correlations between several narcissism measures (Narcissistic Personality Inventory [NPI]; Pathological Narcissism Inventory [PNI]; Personality Diagnostic Questionnaire [PDQ] NPD) with the traits comprising the DSM-5 Section III personality trait model. In the current study, we examine the agreement manifested by Wright and colleagues' narcissism-DSM-5 trait profiles with expert ratings of the DSM-5 traits most relevant to descriptions of DSM-IV NPD. Despite concerns regarding the NPI's ability to measure pathological narcissism, its trait profile was strongly correlated with expert ratings, as was PDQ NPD's profile. Conversely, the trait profiles associated with the PNI were primarily uncorrelated with the expert rated NPD profile. The implications of these findings with regard to the assessment of narcissism are discussed. © The Author(s) 2014.

The Relevance of Big Five Trait Content in Behavior to Subjective Authenticity: Do High Levels of Within-Person Behavioral Variability Undermine or Enable Authenticity Achievement?

PubMed Central

Fleeson, William; Wilt, Joshua

2010-01-01

Individuals vary their behavior from moment to moment a great deal, often acting “out of character” for their traits. This article investigates the consequences for authenticity. We compared two hypotheses—trait consistency: individuals feel most authentic when acting in a way consistent with their traits; and state-content significance: some ways of acting feel more authentic because of their content and consequences, regardless of the actor’s corresponding traits. Three studies using experience-sampling methodology in laboratory and natural settings, with participants aged 18–51, strongly supported the state-content significance hypothesis and did not support the trait-consistency hypothesis. Authenticity was consistently associated with acting highly extraverted, agreeable, conscientious, emotionally stable, and intellectual, regardless of the actor’s traits. Discussion focuses on possible implications for within-person variability in behavior and for the nature of the self-concept. PMID:20545814

Changes in tracheid and ray traits in fire scars of North American conifers and their ecophysiological implications

Treesearch

Estelle Arbellay; Markus Stoffel; Elaine K. Sutherland; Kevin T. Smith; Donald A. Falk

2014-01-01

Fire scars have been widely used as proxies for the reconstruction of fire history; however, little is known about the impact of fire injury on wood anatomy. This study investigates changes in tracheid and ray traits in fire scars of Douglas fir (Pseudotsuga menziesii), western larch (Larix occidentalis) and ponderosa pine (

Plasticity in physiological traits in conifers: implications for response to climate change in the western U.S

Treesearch

NE Grulke

2010-01-01

Population variation in ecophysiological traits of four co-occurring montane conifers was measured on a large latitudinal gradient to quantitatively assess their potential for response to environmental change. White fir (Abies concolor) had the highest variability, gross photosynthetic rate (Pg), and foliar carbon (C) and nitrogen (N) content. Despite low water use...

Elephants, Donuts and Hamburgers: Young Children Co-operating To Co-operate and Co-operating To Compete in Two Primary Schools.

ERIC Educational Resources Information Center

Maras, P.; Lewis, A.; Simonds, L.

1999-01-01

Presents a study in which 152 5- to 6-year-old children worked alone or in groups, cooperatively and competitively, over four weeks. Identifies three traits: individualism/collectivism, sociability, and altruism. Examines these traits by gender and age. Discusses implications for primary school pedagogy and social psychological research. (CMK)

The Relationship between Music Preferences of Different Mode and Tempo and Personality Traits--Implications for Music Pedagogy

ERIC Educational Resources Information Center

Dobrota, Snježana; Reic Ercegovac, Ina

2015-01-01

The aim of this research was to examine the relationship between music preferences of different mode and tempo and personality traits. The survey included 323 students who had to fill out the following tests: questionnaire of music preferences, scale of optimism and pessimism and International Personality Item Pool for measuring Big Five…

Within-species patterns challenge our understanding of the causes and consequences of trait variation with implications for trait-based models

NASA Astrophysics Data System (ADS)

Anderegg, L. D.; Berner, L. T.; Badgley, G.; Hillerislambers, J.; Law, B. E.

2017-12-01

Functional traits could facilitate ecological prediction by provide scale-free tools for modeling ecosystem function. Yet much of their utility lies in three key assumptions: 1) that global patterns of trait covariation are the result of universal trade-offs independent of taxonomic scale, so empirical trait-trait relationships can be used to constrain vegetation models 2) that traits respond predictably to environmental gradients and can therefore be reliably quantified to parameterize models and 3) that well sampled traits influence productivity. We use an extensive dataset of within-species leaf trait variation in North American conifers combined with global leaf trait datasets to test these assumptions. We examine traits central to the `leaf economics spectrum', and quantify patterns of trait variation at multiple taxonomic scales. We also test whether site environment explains geographic trait variation within conifers, and ask whether foliar traits explain geographic variation in relative growth rates. We find that most leaf traits vary primarily between rather than within species globally, but that a large fraction of within-PFT trait variation is within-species. We also find that some leaf economics spectrum relationships differ in sign within versus between species, particularly the relationship between leaf lifespan and LMA. In conifers, we find weak and inconsistent relationships between site environment and leaf traits, making it difficult capture within-species leaf trait variation for regional model parameterization. Finally, we find limited relationships between tree relative growth rate and any foliar trait other than leaf lifespan, with leaf traits jointly explaining 42% of within-species growth variation but environmental factors explaining 77% of variation. We suggest that additional traits, particularly whole plant allometry/allocation traits may be better than leaf traits for improving vegetation model performance at smaller taxonomic and spatial scales.

Urban driven phenotypic changes: empirical observations and theoretical implications for eco-evolutionary feedback

PubMed Central

Marzluff, John

2017-01-01

Emerging evidence that cities drive micro-evolution raises the question of whether rapid urbanization of Earth might impact ecosystems by causing systemic changes in functional traits that regulate urban ecosystems' productivity and stability. Intraspecific trait variation—variation in organisms' morphological, physiological or behavioural characteristics stemming from genetic variability and phenotypic plasticity—has significant implications for ecological functions such as nutrient cycling and primary productivity. While it is well established that changes in ecological conditions can drive evolutionary change in species' traits that, in turn, can alter ecosystem function, an understanding of the reciprocal and simultaneous processes associated with such interactions is only beginning to emerge. In urban settings, the potential for rapid trait change may be exacerbated by multiple selection pressures operating simultaneously. This paper reviews evidence on mechanisms linking urban development patterns to rapid phenotypic changes, and differentiates phenotypic changes for which there is evidence of micro-evolution versus phenotypic changes which may represent plasticity. Studying how humans mediate phenotypic trait changes through urbanization could shed light on fundamental concepts in ecological and evolutionary theory. It can also contribute to our understanding of eco-evolutionary feedback and provide insights for maintaining ecosystem function over the long term. This article is part of the themed issue ‘Human influences on evolution, and the ecological and societal consequences’. PMID:27920374

Haemoglobin variants, iron status and anaemia in Sri Lankan adolescents with low red cell indices: A cross sectional survey.

PubMed

Rodrigo, Rexan; Allen, Angela; Manampreri, Aresha; Perera, Luxman; Fisher, Christopher A; Allen, Stephen; Weatherall, David J; Premawardhena, Anuja

2018-07-01

Iron deficiency complicates the use of red cell indices to screen for carriers of haemoglobin variants in many populations. In a cross sectional survey of 7526 secondary school students from 25 districts of Sri Lanka, 1963 (26.0%) students had low red cell indices. Iron deficiency, identified by low serum ferritin, was the major identifiable cause occurring in 550/1806 (30.5%) students. Low red cell indices occurred in iron-replete students with alpha-thalassaemia including those with single alpha-globin gene deletions. Anaemia and low red cell indices were also common in beta-thalassaemia trait. An unexpected finding was that low red cell indices occurred in 713 iron-replete students with a normal haemoglobin genotype. It is common practice to prescribe iron supplements to individuals with low red cell indices. Since low red cell indices were a feature of all forms of α thalassaemia and also of iron deficiency, in areas where both conditions are common, such as Sri Lanka, it is imperative to differentiate between the two, to allow targeted administration of iron supplements and avoid the possible deleterious effects of increased iron availability in iron replete individuals with low red cell indices due to other causes such as α thalassaemia. Copyright © 2018 Elsevier Inc. All rights reserved.

How Likable Are Personality Disorder and General Personality Traits to Those Who Possess Them?

PubMed

Lamkin, Joanna; Maples-Keller, Jessica L; Miller, Joshua D

2018-04-01

The goal of the present study was to investigate whether having higher scores on maladaptive personality traits was related to rating these traits as more likable. Two studies were conducted, one with personality disorder traits (N = 219; M age  = 19.4; 63.8% female; 76.6% Caucasian) and one with general personality traits (N = 198; M age  = 19.5; 69.7% female; 77.3% Caucasian). In each study, participants self-rated their own personality and separately provided ratings of how "likable" they considered those personality traits. As expected, participants rated maladaptive traits more favorably if they considered themselves to possess those traits as well. Also as expected, individuals with higher Antagonism scores (including self-rated Dark Triad constructs of narcissism, psychopathy, and Machiavellianism) rated Antagonism and its related facets as "tolerable"-not necessarily likable, but as less unlikable than the average participant. These findings have implications for the ways that individuals with personality pathology perceive the people around them, which may in turn impact their expectations and behaviors. © 2017 Wiley Periodicals, Inc.

Perceiving the target's state or state provoked by the target? An analysis of the descriptive and evaluative knowledge in person perception.

PubMed

Mignon, Astrid; Mollaret, Patrick

2012-12-01

In line with the theory of traits as generalized affordances, the present article argues that target's states (TSs) and states provoked by a target (other's states (OSs) towards target) are two components of the meaning of traits referring, respectively, to a descriptive and to an evaluative knowledge of people. A preliminary study confirmed that TS and OS were equally representative of a trait. Two studies were designed to study the effects of practising the use of traits as either TS or OS categories (an induction procedure) on a subsequent person perception task, requiring participants to rate photographed targets on a series of traits. Results show that both the differentiation between targets and evaluative consistency of ratings were enhanced under the OS condition compared to TS and control (with no practice of traits) conditions. Importantly, Study 2 tends to show that the effects of the induction procedure are not limited to the practised traits but also generalize to unpractised traits. Implications of these findings for social perception research are discussed. ©2011 The British Psychological Society.

The Contribution of Personality and Refugee Camp Experience to Callous and Unemotional Traits Among Immigrant Adolescents in the United States: Implications for the DSM-5 "Limited Prosocial Emotions" Specifier.

PubMed

Latzman, Robert D; Malikina, Mariya V; Hecht, Lisa K; Lilienfeld, Scott O; Chan, Wing Yi

2016-04-01

Callous and Unemotional (C&U) traits characterize a group of adolescents who engage and persist in especially severe antisocial behaviors. These traits have been included in DSM-5 within a "Limited Prosocial Emotions" (LPE) specifier for Conduct Disorder. To investigate the generalizability of this specifier to non-Western cultures, we examined associations among Big Five personality, refugee camp experience, and C&U traits among 81 immigrant adolescents from non-Western cultures. Adolescents with refugee camp history endorsed higher levels of Uncaring than other adolescents. Personality traits explained 6 (Unemotional) to 18 % (Callousness) of the variance in C&U traits. The association between Neuroticism and Callousness held only for adolescents with a refugee camp history. Our results corroborate the importance of considering personality to understand C&U traits and the LPE specifier. Results also raise questions regarding the applicability of C&U traits to non-Western adolescents with varying pre-immigration experiences, and raise the possibility that the LPE specifier is vulnerable to false-positive identifications among such individuals.

Response Monitoring and Adjustment: Differential Relations with Psychopathic Traits

PubMed Central

Bresin, Konrad; Finy, M. Sima; Sprague, Jenessa; Verona, Edelyn

2014-01-01

Studies on the relation between psychopathy and cognitive functioning often show mixed results, partially because different factors of psychopathy have not been considered fully. Based on previous research, we predicted divergent results based on a two-factor model of psychopathy (interpersonal-affective traits and impulsive-antisocial traits). Specifically, we predicted that the unique variance of interpersonal-affective traits would be related to increased monitoring (i.e., error-related negativity) and adjusting to errors (i.e., post-error slowing), whereas impulsive-antisocial traits would be related to reductions in these processes. Three studies using a diverse selection of assessment tools, samples, and methods are presented to identify response monitoring correlates of the two main factors of psychopathy. In Studies 1 (undergraduates), 2 (adolescents), and 3 (offenders), interpersonal-affective traits were related to increased adjustment following errors and, in Study 3, to enhanced monitoring of errors. Impulsive-antisocial traits were not consistently related to error adjustment across the studies, although these traits were related to a deficient monitoring of errors in Study 3. The results may help explain previous mixed findings and advance implications for etiological models of psychopathy. PMID:24933282

Implicational Schemata and the Attribution of Morality.

ERIC Educational Resources Information Center

Reeder, Glenn D.; Spores, John M.

Attribution of a disposition or trait to a person asserts information about the pattern of that person's behavior. Past research has suggested that a moral disposition implies only moral behavior, while an immoral disposition implies both moral and immoral behavior. The effect of these implicational schemata on attributions of morality was…

Effects of Parent Training on Callous-Unemotional Traits, Effortful Control, and Conduct Problems: Mediation by Parenting.

PubMed

Elizur, Yoel; Somech, Lior Y; Vinokur, Amiram D

2017-01-01

Callous-unemotional (CU) traits and effortful control (EC) are personality and temperament traits implicated in early-onset antisocial trajectories. This secondary analysis of Hitkashrut's randomized controlled trial first tested parent training's effects on EC and CU traits while controlling for more general treatment effects on conduct problems (CP), and subsequently tested mediation by parenting. Prekindergarten teachers in three Israeli cities identified 209 3-5 year-old (163 boys; 46 girls) preschoolers with subclinical-clinical range conduct problems. All participants were Jewish ranging from ultra-orthodox to secular. They were assigned to 14-session co-parent training groups (n = 140 couples), or to minimal intervention control groups with referral to local services as necessary (n = 69 couples). We employed averaged indices of pre- and post-intervention questionnaires completed by both parents. The testing of all hypothesized models controlled for treatment effects on CP in order to strengthen the robustness of the analyses. We found significant concurrent treatment effects on CP and on either CU traits or EC. All effects were mediated by ineffective parenting (IP): a latent variable that was indicated by negative/inconsistent practices and perceived parenting inefficacy. This is the first demonstration of parenting mediated treatment effects on both EC and CU traits in a randomized controlled study conducted in everyday practice contexts. This finding supports a disruption model of change: the reduction of IP facilitates a caregiving environment that affects children's behavior and developing personality. The changing of personality and temperament characteristics implicated in early-onset pathways suggests an innovative prevention strategy for disruptive behavior disorders.

'It means everyone should know their status': exploring lay conceptions of sickle cell trait and sickle cell trait screening among African Americans within middle reproductive age.

PubMed

Mayo-Gamble, Tilicia L; Barnes, Priscilla A; Cunningham Erves, Jennifer; Middlestadt, Susan E; Lin, Hsien-Chang

2017-02-21

This study examined the meaning of sickle cell trait and sickle cell trait screening from the lay perspective of African Americans. African Americans (N = 300), ages 18-35 and unaware of their sickle cell trait status, completed two open-ended questions from a larger survey. One question asked for their understanding of sickle cell trait; the other asked for their understanding of sickle cell trait screening. Content analysis occurred in two phases: (1) In vivo and holistic coding; and (2) focused coding. Four categories emerged illustrating lay conceptions of sickle cell trait; (1) Perceived as an illness; (2) Perceived recognition of the inheritance pattern of sickle cell trait; (3) Perceived lack of knowledge of sickle cell trait; and (4) Perceived importance of sickle cell trait. Five categories emerged illustrating lay conceptions for sickle cell trait screening: (1) Perceived recognition that screening means getting tested for sickle cell trait; (2) Perceived lack of knowledge of sickle cell trait screening; (3) Perceived health benefit of sickle cell trait screening; (4) Perceived importance of sickle cell trait screening; and (5) Perceived barriers to sickle cell trait screening. Sickle cell trait and sickle cell trait screening are concepts that are both regarded as important among this high-risk population. However, there is still misunderstanding concerning the hereditary nature and reproductive implications of sickle cell trait. Interventions seeking to improve communication on the need for sickle cell trait screening should begin by identifying what the population at large understands, knows and/or believes to improve their ability to make informed health decisions.

The Implications of Big-Five Standing for the Distribution of Trait Manifestation in Behavior: Fifteen Experience-Sampling Studies and a Meta-Analysis

PubMed Central

Fleeson, William; Gallagher, M. Patrick

2009-01-01

One of the fundamental questions in personality psychology is whether and how strongly trait standing relates to the traits that people actually manifest in their behavior, when faced with real pressures and real consequences of their actions. One reason this question is fundamental is the common belief that traits do not predict how individuals behave, which leads to the reasonable conclusion that traits are not important to study. However, this conclusion is surprising given that there is almost no data on the ability of traits to predict distributions of naturally occurring, representative behaviors of individuals (and that there are many studies showing that traits do indeed predict specific behaviors). This paper describes a meta-analysis of 15 experience-sampling studies, conducted over the course of eight years, amassing over 20,000 reports of trait manifestation in behavior. Participants reported traits on typical self-report questionnaires, then described their current behavior multiple times per day for several days, as the behavior was occurring. Results showed that traits, contrary to expectations, were strongly predictive of individual differences in trait manifestation in behavior, predicting average levels with correlations between .42 and .56 (approaching .60 for stringently restricted studies). Several other ways of summarizing trait manifestation in behavior were also predicted from traits. These studies provide evidence that traits are powerful predictors of actual manifestation of traits in behavior. PMID:19968421

Trait Approach and Avoidance Motivation: Lateralized Neural Activity Associated with Executive Function

PubMed Central

Spielberg, Jeffrey M.; Miller, Gregory A.; Engels, Anna S.; Herrington, John D.; Sutton, Bradley P.; Banich, Marie T.; Heller, Wendy

2010-01-01

Motivation and executive function are both necessary for the completion of goal-directed behavior. Research investigating the manner in which these processes interact is beginning to emerge and has implicated middle frontal gyrus (MFG) as a site of interaction for relevant neural mechanisms. However, this research has focused on state motivation, and it has not examined functional lateralization. The present study examined the impact of trait levels of approach and avoidance motivation on neural processes associated with executive function. Functional magnetic resonance imaging was conducted while participants performed a color-word Stroop task. Analyses identified brain regions in which trait approach and avoidance motivation (measured by questionnaires) moderated activation associated with executive control. Approach was hypothesized to be associated with left-lateralized MFG activation, whereas avoidance was hypothesized to be associated with right-lateralized MFG activation. Results supported both hypotheses. Present findings implicate areas of middle frontal gyrus in top-down control to guide behavior in accordance with motivational goals. PMID:20728552

Trait approach and avoidance motivation: lateralized neural activity associated with executive function.

PubMed

Spielberg, Jeffrey M; Miller, Gregory A; Engels, Anna S; Herrington, John D; Sutton, Bradley P; Banich, Marie T; Heller, Wendy

2011-01-01

Motivation and executive function are both necessary for the completion of goal-directed behavior. Research investigating the manner in which these processes interact is beginning to emerge and has implicated middle frontal gyrus (MFG) as a site of interaction for relevant neural mechanisms. However, this research has focused on state motivation, and it has not examined functional lateralization. The present study examined the impact of trait levels of approach and avoidance motivation on neural processes associated with executive function. Functional magnetic resonance imaging was conducted while participants performed a color-word Stroop task. Analyses identified brain regions in which trait approach and avoidance motivation (measured by questionnaires) moderated activation associated with executive control. Approach was hypothesized to be associated with left-lateralized MFG activation, whereas avoidance was hypothesized to be associated with right-lateralized MFG activation. Results supported both hypotheses. Present findings implicate areas of middle frontal gyrus in top-down control to guide behavior in accordance with motivational goals. Copyright © 2010 Elsevier Inc. All rights reserved.

Personality Processes: Mechanisms by which Personality Traits “Get Outside the Skin”

PubMed Central

Hampson, Sarah E.

2011-01-01

It is time to better understand why personality traits predict consequential outcomes, which calls for a closer look at personality processes. Personality processes are mechanisms that unfold over time to produce the effects of personality traits. They include reactive and instrumental processes that moderate or mediate the association between traits and outcomes. These mechanisms are illustrated here by a selection of studies of traits representing the three broad domains of personality and temperament: negative emotionality, positive emotionality, and constraint. Personality processes are studied over the short-term, as in event-sampling studies, and over the long-term, as in lifespan research. Implications of findings from the study of processes are considered for resolving issues in models of personality structure, improving and extending methods of personality assessment, and identifying targets for personality interventions. PMID:21740225

Where do spontaneous first impressions of faces come from?

PubMed

Over, Harriet; Cook, Richard

2018-01-01

Humans spontaneously attribute a wide range of traits to strangers based solely on their facial features. These first impressions are known to exert striking effects on our choices and behaviours. In this paper, we provide a theoretical account of the origins of these spontaneous trait inferences. We describe a novel framework ('Trait Inference Mapping') in which trait inferences are products of mappings between locations in 'face space' and 'trait space'. These mappings are acquired during ontogeny and allow excitation of face representations to propagate automatically to associated trait representations. This conceptualization provides a framework within which the relative contribution of ontogenetic experience and genetic inheritance can be considered. Contrary to many existing ideas about the origins of trait inferences, we propose only a limited role for innate mechanisms and natural selection. Instead, our model explains inter-observer consistency by appealing to cultural learning and physiological responses that facilitate or 'canalise' particular face-trait mappings. Our TIM framework has both theoretical and substantive implications, and can be extended to trait inferences from non-facial cues to provide a unified account of first impressions. Copyright © 2017 Elsevier B.V. All rights reserved.

Outcrossing and crossbreeding recovers deteriorated traits in laboratory cultured Steinernema carpocapsae nematodes

PubMed Central

Chaston, John M.; Dillman, Adler R.; Shapiro-Ilan, David I.; Bilgrami, Anwar L.; Gaugler, Randy; Hopper, Keith R.; Adams, Byron J.

2011-01-01

The nematode Steinernema carpocapsae infects and kills many pest insects in agroecosystems and is commonly used in biocontrol of these pests. Growth of the nematodes prior to distribution for biocontrol commonly results in deterioration of traits that are essential for nematode persistence in field applications. To better understand the mechanisms underlying trait deterioration of the efficacy of natural parasitism in entomopathogenic nematodes, we explored the maintenance of fitness related traits including reproductive capacity, heat tolerance, virulence to insects and `tail standing' (formerly called nictation) among laboratory-cultured lines derived from natural, randomly mating populations of S. carpocapsae. Laboratory cultured nematode lines with fitness-related trait values below wild-type levels regained wild-type levels of reproductive and heat tolerance traits when outcrossed with a non-deteriorated line, while virulence and `tail standing' did not deteriorate in our experiments. Crossbreeding two trait-deteriorated lines with each other also resulted in restoration of trait means to wild-type levels in most crossbred lines. Our results implicate inbreeding depression as the primary cause of trait deterioration in the laboratory cultured S. carpocapsae. We further suggest the possibility of creating inbred lines purged of deleterious alleles as founders in commercial nematode growth. PMID:21447341

Genetics Home Reference: methemoglobinemia, beta-globin type

MedlinePlus

... American Society of Hematology Resource List from the University of Kansas Medical Center: ... Melarkode K, Prinzhausen H. Hemoglobin M variant and congenital methemoglobinemia: methylene blue will not be effective in the presence of hemoglobin M. Can J ...

Heterozygous Hb Hope [beta136(H14)Gly --> Asp] in association with heterozygous beta0-thalassemia with apparent homozygous expression, in a Spanish patient.

PubMed

Beneitez, David; Carrera, Alícia; Duran-Suárez, Joan Ramón; Paz, Victoria; León, Antonio; García Talavera, Juan

2006-01-01

Hb Hope [beta136(H14)Gly --> Asp (GGT --> GAT)] has been found alone or in combination with other globin gene mutations in several African-American families, as well as in Japanese, Thai, Laotian, Cuban and Mauritanian families. We report the hematological and molecular characteristics of a heterozygous association of Hb Hope with beta0-thalassemia (thal) in a Spanish patient, in whom the level of expression of abnormal hemoglobin (Hb) by cation exchange high performance liquid chromatography (HPLC) and electrophoresis suggested initially a homozygous expression of the abnormal Hb, although sequencing of the polymerase chain reaction (PCR)-amplified beta-globin gene demonstrated a heterozygous genotype for Hb Hope. To the best of our knowledge, this is the first description of a case of Hb Hope in a Spanish family.

Complete genome sequencing and analysis of Saprospira grandis str. Lewin, a predatory marine bacterium

PubMed Central

Saw, Jimmy H. W.; Yuryev, Anton; Kanbe, Masaomi; Hou, Shaobin; Young, Aaron G.; Aizawa, Shin-Ichi

2012-01-01

Saprospira grandis is a coastal marine bacterium that can capture and prey upon other marine bacteria using a mechanism known as ‘ixotrophy’. Here, we present the complete genome sequence of Saprospira grandis str. Lewin isolated from La Jolla beach in San Diego, California. The complete genome sequence comprises a chromosome of 4.35 Mbp and a plasmid of 54.9 Kbp. Genome analysis revealed incomplete pathways for the biosynthesis of nine essential amino acids but presence of a large number of peptidases. The genome encodes multiple copies of sensor globin-coupled rsbR genes thought to be essential for stress response and the presence of such sensor globins in Bacteroidetes is unprecedented. A total of 429 spacer sequences within the three CRISPR repeat regions were identified in the genome and this number is the largest among all the Bacteroidetes sequenced to date. PMID:22675601

Beta-globin gene cluster haplotypes of Amerindian populations from the Brazilian Amazon region.

PubMed

Guerreiro, J F; Figueiredo, M S; Zago, M A

1994-01-01

We have determined the beta-globin cluster haplotypes for 80 Indians from four Brazilian Amazon tribes: Kayapó, Wayampí, Wayana-Apalaí, and Arára. The results are analyzed together with 20 Yanomámi previously studied. From 2 to 4 different haplotypes were identified for each tribe, and 7 of the possible 32 haplotypes were found in a sample of 172 chromosomes for which the beta haplotypes were directly determined or derived from family studies. The haplotype distribution does not differ significantly among the five populations. The two most common haplotypes in all tribes were haplotypes 2 and 6, with average frequencies of 0.843 and 0.122, respectively. The genetic affinities between Brazilian Indians and other human populations were evaluated by estimates of genetic distance based on haplotype data. The lowest values were observed in relation to Asians, especially Chinese, Polynesians, and Micronesians.

Genetic association studies in β-hemoglobinopathies.

PubMed

Thein, Swee Lay

2013-01-01

Characterization of the molecular basis of the β-thalassemias and sickle cell disease (SCD) clearly showed that individuals with the same β-globin genotypes can have extremely diverse clinical severity. Two key modifiers, an innate ability to produce fetal hemoglobin and coinheritance of α-thalassemia, both derived from family and population studies, affect the pathophysiology of both disorders at the primary level. In the past 2 decades, scientific research had applied genetic approaches to identify additional genetic modifiers. The review summarizes recent genetic studies and key genetic modifiers identified and traces the story of fetal hemoglobin genetics, which has led to an emerging network of globin gene regulation. The discoveries have provided insights on new targets for therapeutic intervention and raise possibilities of developing fetal hemoglobin predictive diagnostics for predicting disease severity in the newborn and for integration into prenatal diagnosis to better inform genetic counseling.

Systematic documentation and analysis of human genetic variation in hemoglobinopathies using the microattribution approach.

PubMed

Giardine, Belinda; Borg, Joseph; Higgs, Douglas R; Peterson, Kenneth R; Philipsen, Sjaak; Maglott, Donna; Singleton, Belinda K; Anstee, David J; Basak, A Nazli; Clark, Barnaby; Costa, Flavia C; Faustino, Paula; Fedosyuk, Halyna; Felice, Alex E; Francina, Alain; Galanello, Renzo; Gallivan, Monica V E; Georgitsi, Marianthi; Gibbons, Richard J; Giordano, Piero C; Harteveld, Cornelis L; Hoyer, James D; Jarvis, Martin; Joly, Philippe; Kanavakis, Emmanuel; Kollia, Panagoula; Menzel, Stephan; Miller, Webb; Moradkhani, Kamran; Old, John; Papachatzopoulou, Adamantia; Papadakis, Manoussos N; Papadopoulos, Petros; Pavlovic, Sonja; Perseu, Lucia; Radmilovic, Milena; Riemer, Cathy; Satta, Stefania; Schrijver, Iris; Stojiljkovic, Maja; Thein, Swee Lay; Traeger-Synodinos, Jan; Tully, Ray; Wada, Takahito; Waye, John S; Wiemann, Claudia; Zukic, Branka; Chui, David H K; Wajcman, Henri; Hardison, Ross C; Patrinos, George P

2011-03-20

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

Point mutations which should not be overlooked in Hb H disease.

PubMed

Farashi, Samaneh; Bayat, Nooshin; Vakili, Shadi; Faramarzi Garous, Negin; Ashki, Mehri; Imanian, Hashem; Najmabadi, Hossein; Azarkeivan, Azita

2016-01-01

Hb H disease is an alpha-thalassemia (α-thal) syndrome characterized by chronic hemolytic anemia that occurs when three of total four α-globin genes lost their function due to completely deletions or different kind of mutations. We here described 66 patients who have been diagnosed for Hb H disease during the last five years in our center. The genotypes involving point mutations present more severe phenotype than deletional forms that make them of primary important to health management. Hb H subjects carry different α-globin genotypes including deletional and non-deletional mutations showing heterogenous clinical manifestations. The Hb H patients presenting a wide range of phenotype carried different deletional, non-deletional mutations or compound heterozygosity of them. We emphasize the importance of some point mutations responsible for more severe form of Hb H disease in Iranian population and the necessity for consideration of prenatal diagnosis (PND) in high-risk couples.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Filon, D.; Oron, V.; Krichevski, S.

The authors characterized nearly 500 [beta]-thalassemia genes from the Israeli population representing a variety of ethnic subgroups. They found 28 different mutations in the [beta]-globin gene, including three mutations ([beta][sup S], [beta][sup C], and [beta][sup O-Arab]) causing hemoglobinopathies. Marked genetic heterogeneity was observed in both the Arab (20 mutations) and Jewish (17 mutations) populations. On the other hand, two ethnic isolates - Druze and Samaritans - had a single mutation each. Fifteen of the [beta]-thalassemia alleles are Mediterranean in type, 5 originated in Kurdistan, 2 are of Indian origin, and 2 sporadic alleles came from Europe. Only one mutant allele-nonsensemore » codon 37-appears to be indigenous to Israel. While human habitation in Israel dates back to early prehistory, the present-day spectrum of [beta]-globin mutations can be largely explained by migration events that occurred in the past millennium. 26 refs., 2 figs., 3 tabs.« less

Contribution of Long-Range Interactions to the Secondary Structure of an Unfolded Globin

PubMed Central

Fedyukina, Daria V.; Rajagopalan, Senapathy; Sekhar, Ashok; Fulmer, Eric C.; Eun, Ye-Jin; Cavagnero, Silvia

2010-01-01

This work explores the effect of long-range tertiary contacts on the distribution of residual secondary structure in the unfolded state of an α-helical protein. N-terminal fragments of increasing length, in conjunction with multidimensional nuclear magnetic resonance, were employed. A protein representative of the ubiquitous globin fold was chosen as the model system. We found that, while most of the detectable α-helical population in the unfolded ensemble does not depend on the presence of the C-terminal region (corresponding to the native G and H helices), specific N-to-C long-range contacts between the H and A-B-C regions enhance the helical secondary structure content of the N terminus (A-B-C regions). The simple approach introduced here, based on the evaluation of N-terminal polypeptide fragments of increasing length, is of general applicability to identify the influence of long-range interactions in unfolded proteins. PMID:20816043

Transcriptional regulation of fetal to adult hemoglobin switching: new therapeutic opportunities

PubMed Central

Wilber, Andrew; Nienhuis, Arthur W.

2011-01-01

In humans, embryonic, fetal, and adult hemoglobins are sequentially expressed in developing erythroblasts during ontogeny. For the past 40 years, this process has been the subject of intensive study because of its value to enlighten the biology of developmental gene regulation and because fetal hemoglobin can significantly ameliorate the clinical manifestations of both sickle cell disease and β-thalassemia. Understanding the normal process of loss of fetal globin expression and activation of adult globin expression could potentially lead to new therapeutic approaches for these hemoglobin disorders. Herein, we briefly review the history of the study of hemoglobin switching and then focus on recent discoveries in the field that now make new therapeutic approaches seem feasible in the future. Erythroid-specific knockdown of fetal gene repressors or enforced expression of fetal gene activators may provide clinically applicable approaches for genetic treatment of hemoglobin disorders that would benefit from increased fetal hemoglobin levels. PMID:21321359

Translational Control of Hemoglobin Synthesis by an Initiation Factor Required for Recycling of Ribosomes and for their Binding to Messenger RNA

PubMed Central

Kaempfer, Raymond; Kaufman, Jennifer

1972-01-01

The continued recycling of ribosomes during protein synthesis in rabbit reticulocyte lysates at 37° requires an initiation factor whose activity is rapidly lost in the absence of added heme. Partially purified factor (i) fully maintains the polysomes; (ii) inhibits the association of 40S and 60S ribosomal subunits into single ribosomes; (iii) promotes the quantitative entry of added 60S subunits into polysomes; (iv) allows the accumulation of ribosomal subunits, instead of single ribosomes, when initiation is blocked with aurin tricarboxylate; and (v) is absolutely required for the binding of globin messenger RNA to ribosomes. These properties suggest that this mammalian initiation factor functions analogously to bacterial IF-3. In addition, the translational control of globin synthesis by heme is exerted, directly or indirectly, through this factor. PMID:4508325

Knowing right from wrong, but just not always feeling it: relations among callous-unemotional traits, psychopathological symptoms, and cognitive and affective morality judgments in 8- to 12-year-old boys.

PubMed

Feilhauer, Johanna; Cima, Maaike; Benjamins, Caroline; Muris, Peter

2013-12-01

The present research expands our understanding of cognitive and affective morality by exploring associations with callous-unemotional (CU) traits and externalizing symptoms. Participants were 46 8- to 12-year-old boys from the community who completed the Affective Morality Index, the Youth Self-Report, and the Inventory of Callous-Unemotional Traits. A pattern of results was found indicating that in particular the combination of high CU traits and high externalizing symptoms was associated with lack of affective morality, and an increased perceived likelihood of recommitting antisocial acts (recidivism). The implications of these findings and suggestions for future research are discussed.

Toward a psychopathology of self-control theory: the importance of narcissistic traits.

PubMed

Vaughn, Michael G; DeLisi, Matt; Beaver, Kevin M; Wright, John Paul; Howard, Matthew O

2007-01-01

Research on self-control and related constructs is central to individual-level explanations of antisocial behavior. However, less research attention has been paid to the psychopathological underpinnings of self-control. The current study explores relationships between self-control and psychiatric symptoms, head injury, trauma history, substance use, guiltlessness and narcissistic traits in a statewide population of juvenile offenders. Results support the importance of these variables, in particular narcissistic traits, in better explicating theories of self-control. Implications for research on the psychopathological underpinnings of self-control are highlighted. Copyright (c) 2007 John Wiley & Sons, Ltd.

A meta-analysis of zooplankton functional traits influencing ecosystem function.

PubMed

Hébert, Marie-Pier; Beisner, Beatrix E; Maranger, Roxane

2016-04-01

The use of functional traits to characterize community composition has been proposed as a more effective way to link community structure to ecosystem functioning. Organismal morphology, body stoichiometry, and physiology can be readily linked to large-scale ecosystem processes through functional traits that inform on interspecific and species-environment interactions; yet such effect traits are still poorly included in trait-based approaches. Given their key trophic position in aquatic ecosystems, individual zooplankton affect energy fluxes and elemental processing. We compiled a large database of zooplankton traits contributing to carbon, nitrogen, and phosphorus cycling and examined the effect of classification and habitat (marine vs. freshwater) on trait relationships. Respiration and nutrient excretion rates followed mass-dependent scaling in both habitats, with exponents ranging from 0.70 to 0.90. Our analyses revealed surprising differences in allometry and respiration between habitats, with freshwater species having lower length-specific mass and three times higher mass-specific respiration rates. These differences in traits point to implications for ecological strategies as well as overall carbon storage and fluxes based on habitat type. Our synthesis quantifies multiple trait relationships and links organisms to ecosystem processes they influence, enabling a more complete integration of aquatic community ecology and biogeochemistry through the promising use of effect traits.

Psychopathic Traits and Moral Disengagement Interact to Predict Bullying and Cyberbullying Among Adolescents.

PubMed

Orue, Izaskun; Calvete, Esther

2016-07-01

The aim of this study was to test a model in which psychopathic traits (callous-unemotional, grandiose-manipulative, and impulsive-irresponsible) and moral disengagement individually and interactively predict two types of bullying (traditional and cyberbullying) in a community sample of adolescents. A total of 765 adolescents (464 girls and 301 boys) completed measures of moral disengagement and psychopathic traits at Time 1, and measures of bullying and cyberbullying at Time 1 and 1 year later, at Time 2. The results showed that callous-unemotional traits predicted both traditional bullying and cyberbullying, grandiose-manipulative and impulsive-irresponsible traits only predicted traditional bullying, and moral disengagement only predicted cyberbullying. Callous-Unemotional Traits × Moral Disengagement and Grandiose-Manipulative × Moral Disengagement were significantly correlated with the residual change in cyberbullying. Callous-unemotional traits were positively related to cyberbullying at high levels of moral disengagement but not when moral disengagement was low. In contrast, grandiose-manipulative traits were positively related to cyberbullying at low levels of moral disengagement but not when moral disengagement was high. These findings have implications for both prevention and intervention. Integrative approaches that promote moral growth are needed, including a deeper understanding of why bullying is morally wrong and ways to stimulate personality traits that counteract psychopathic traits.

Reciprocal influences between negative life events and callous-unemotional traits.

PubMed

Kimonis, Eva R; Centifanti, Luna C M; Allen, Jennifer L; Frick, Paul J

2014-11-01

Children with conduct problems and co-occurring callous-unemotional (CU) traits show more severe, stable, and aggressive antisocial behaviors than those without CU traits. Exposure to negative life events has been identified as an important contributing factor to the expression of CU traits across time, although the directionality of this effect has remained unknown due to a lack of longitudinal study. The present longitudinal study examined potential bidirectional effects of CU traits leading to experiencing more negative life events and negative life events leading to increases in CU traits across 3 years among a sample of community-based school-aged (M = 10.9, SD = 1.71 years) boys and girls (N = 98). Repeated rating measures of CU traits, negative life events and conduct problems completed by children and parents during annual assessments were moderately to highly stable across time. Cross-lagged models supported a reciprocal relationship of moderate magnitude between child-reported CU traits and "controllable" negative life events. Parent-reported CU traits predicted "uncontrollable" life events at the earlier time point and controllable life events at the later time point, but no reciprocal effect was evident. These findings have important implications for understanding developmental processes that contribute to the stability of CU traits in youth.

The relationship between temperamental traits and the level of performance of an eye-hand co-ordination task in jet pilots.

PubMed

Biernacki, Marcin; Tarnowski, Adam

2008-01-01

When assessing the psychological suitability for the profession of a pilot, it is important to consider personality traits and psychomotor abilities. Our study aimed at estimating the role of temperamental traits as components of pilots' personality in eye-hand co-ordination. The assumption was that differences in the escalation of the level of temperamental traits, as measured with the Formal Characteristic of Behaviour-Temperament Inventory (FCB-TI), will significantly influence eye-hand co-ordination. At the level of general scores, enhanced briskness proved to be the most important trait for eye-hand co-ordination. An analysis of partial scores additionally underlined the importance of sensory sensitivity, endurance and activity. The application of eye-hand co-ordination tasks, which involve energetic and temporal dimensions of performance, helped to disclose the role of biologically-based personality traits in psychomotor performance. The implication of these findings for selecting pilots is discussed.

Personality traits and perceived social support among depressed older adults.

PubMed

Cukrowicz, Kelly C; Franzese, Alexis T; Thorp, Steven R; Cheavens, Jennifer S; Lynch, Thomas R

2008-09-01

The contribution of personality traits and social support to mental health is well established, but to our knowledge there have been no longitudinal investigations of the relation between personality and social support in depressed older adults. In the current study, we examined a repeated measures multi-level mixed model of change in perceived social support to determine whether personality traits and depressive symptoms were associated with changes in perceived social support over the 3 year study interval in a sample of depressed older adults. Results suggest that Conscientiousness and Extraversion were personality traits that were significantly predictive of changes in perceived social support over this time interval. Based on these results it appears that, among depressed older adults, those with conscientious or extraverted personality traits are more likely to resist impulses to withdraw from relationships. In addition, these traits may lead to more satisfying interactions and greater perceived social support over time. The implications of these results are discussed.

Exploring the Relationship Between Autistic-Like Traits and ADHD Behaviors in Early Childhood: Findings from a Community Twin Study of 2-Year-Olds

PubMed Central

Ronald, Angelica; Edelson, Lisa R.; Asherson, Philip; Saudino, Kimberly J.

2014-01-01

Behaviors characteristic of autism and ADHD emerge in early childhood, yet research investigating their comorbidity has focused on older children. This study aimed to explore the nature of the relationship between autistic-like traits and ADHD behaviors in a community sample of 2-year-olds. Twins from the Boston University Twin Project (N=312 pairs) were assessed by their parents on autistic-like traits and ADHD behaviors using the Childhood Behavior Checklist. Phenotypic analyses showed that after controlling for general cognitive ability and socioeconomic status, autistic-like traits (total scale as well as social and nonsocial subscales) correlated positively with ADHD behaviors (r=0.23–0.26). Structural equation model-fitting analyses revealed that there were modest shared genetic influences between ADHD- and autistic traits (genetic correlation = 0.27) as well as some common environmental influences explaining their covariation. Implications for identifying shared biological pathways underlying autistic-like traits and ADHD behaviors are discussed. PMID:19908138

Overlap between autistic and schizotypal personality traits is not accounted for by anxiety and depression.

PubMed

Mealey, Alex; Abbott, Gavin; Byrne, Linda K; McGillivray, Jane

2014-10-30

Autism spectrum and schizophrenia spectrum disorders are classified separately in the DSM-5, yet research indicates that these two disorders share overlapping features. The aim of the present study was to examine the overlap between autistic and schizotypal personality traits and whether anxiety and depression act as confounding variables in this relationship within a non-clinical population. One hundred and forty-four adults completed the Autism Spectrum Quotient and the Schizotypal Personality Questionnaire and the Depression Anxiety Stress Scales-21. A number of associations were seen between autistic and schizotypal personality traits. However, negative traits were the only schizotypal feature to uniquely predict global autistic traits, thus highlighting the importance of interpersonal qualities in the overlap of autistic and schizotypal characteristics. The inclusion of anxiety and depression did not alter relationships between autistic and schizotypal traits, indicating that anxiety and depression are not confounders of this relationship. These findings have important implications for the conceptualisation of both disorders. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Emotional Intelligence and Callous-Unemotional Traits in Incarcerated Adolescents

PubMed Central

Kahn, Rachel E.; Ermer, Elsa; Salovey, Peter; Kiehl, Kent A.

2016-01-01

Emotional intelligence (EI) is the ability to perceive, manage, and reason about emotions and to use this information to guide thinking and behavior adaptively. Youth with callous-unemotional (CU) traits demonstrate a variety of affective deficits, including impairment in recognition of emotion and reduced emotional responsiveness to distress or pain in others. We examined the association between ability EI and CU traits in a sample of incarcerated adolescents (n = 141) using an expert-rater device (Psychopathy Checklist Youth Version (PCL-YV; 1) and self-report assessments of CU traits. EI was assessed using the Mayer-Salovey-Caruso Emotional Intelligence Test-Youth Version, Research Version (MSCEIT-YV-R; 2). Similar to findings in adult forensic populations, high levels of CU traits in high risk youth were associated with lower EI, particularly higher order EI skills. Identifying impairment on EI abilities may have important implications for emerging treatment and intervention developments for youth with high levels of CU traits. PMID:26779640

Attitudes without Objects: Evidence for a Dispositional Attitude, its Measurement, and its Consequences

PubMed Central

Hepler, Justin; Albarracin, Dolores

2013-01-01

We hypothesized that individuals may differ in the dispositional tendency to have positive versus negative attitudes, a trait termed the Dispositional Attitude. Across four studies, we developed a 16-item Dispositional Attitude Measure (DAM) and investigated its internal consistency, test-retest reliability, factor structure, convergent validity, discriminant validity, and predictive validity. DAM scores were (a) positively correlated with positive affect traits, curiosity-related traits, and individual pre-existing attitudes, (b) negatively correlated with negative affect traits, and (c) uncorrelated with theoretically unrelated traits. Dispositional attitudes also significantly predicted the valence of novel attitudes while controlling for theoretically relevant traits (such as the big-five and optimism). The dispositional attitude construct represents a new perspective in which attitudes are not simply a function of the properties of the stimuli under consideration, but are also a function of the properties of the evaluator. We discuss the intriguing implications of dispositional attitudes for many areas of research, including attitude formation, persuasion, and behavior prediction. PMID:23586409

Attitudes without objects: evidence for a dispositional attitude, its measurement, and its consequences.

PubMed

Hepler, Justin; Albarracín, Dolores

2013-06-01

We hypothesized that individuals may differ in the dispositional tendency to have positive vs. negative attitudes, a trait termed the dispositional attitude. Across 4 studies, we developed a 16-item Dispositional Attitude Measure (DAM) and investigated its internal consistency, test-retest reliability, factor structure, convergent validity, discriminant validity, and predictive validity. DAM scores were (a) positively correlated with positive affect traits, curiosity-related traits, and individual preexisting attitudes; (b) negatively correlated with negative affect traits; and (c) uncorrelated with theoretically unrelated traits. Dispositional attitudes also significantly predicted the valence of novel attitudes while controlling for theoretically relevant traits (such as the Big 5 and optimism). The dispositional attitude construct represents a new perspective in which attitudes are not simply a function of the properties of the stimuli under consideration, but are also a function of the properties of the evaluator. We discuss the intriguing implications of dispositional attitudes for many areas of research, including attitude formation, persuasion, and behavior prediction. PsycINFO Database Record (c) 2013 APA, all rights reserved.

Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

PubMed

Kaushik, Mahima; Kukreti, Shrikant

2015-01-01

Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

Estimating the age of Hb G-Coushatta [β22(B4)Glu→Ala] mutation by haplotypes of β-globin gene cluster in Denizli, Turkey.

PubMed

Ozturk, Onur; Arikan, Sanem; Atalay, Ayfer; Atalay, Erol O

2018-05-01

Hb G-Coushatta variant was reported from various populations' parts of the world such as Thai, Korea, Algeria, Thailand, China, Japan and Turkey. In our study, we aimed to discuss the possible historical relationships of the Hb G-Coushatta mutation with the possible migration routes of the world. For this purpose, associated haplotypes were determined using polymorphic loci in the beta globin gene cluster of hemoglobin G-Coushatta and normal populations in Denizli, Turkey. We performed statistical analysis such as haplotype analysis, Hardy-Weinberg equilibrium, measurement of genetic diversity and population differentiation parameters, analysis of molecular variance using F-statistics, historical-demographic analyses, mismatch distribution analysis of both populations and applied the test statistics in Arlequin ver. 3.5 software program. The diversity of haplotypes has been shown to indicate different genetic origins for two populations. However, AMOVA results, molecular diversity parameters and population demographic expansion times showed that the Hb G-Coushatta mutation develops on the normal population gene pool. Our estimated τ values showed the average time since the demographic expansion for normal and Hb G-Coushatta populations ranged from approximately 42,000 to 38,000 ybp, respectively. Our data suggest that Hb G-Coushatta population originate in normal population in Denizli, Turkey. These results support the hypothesis that the multiple origin of Hb G-Coushatta and indicate that mutation may have been triggered the formation of new variants on beta globin haplotypes. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

Number and location of mouse mammary tumor virus proviral DNA in mouse DNA of normal tissue and of mammary tumors.

PubMed Central

Groner, B; Hynes, N E

1980-01-01

The Southern DNA filter transfer technique was used to characterize the genomic location of the mouse mammary tumor proviral DNA in different inbred strains of mice. Two of the strains (C3H and CBA) arose from a cross of a Bagg albino (BALB/c) mouse and a DBA mouse. The mouse mammary tumor virus-containing restriction enzyme DNA fragments of these strains had similar patterns, suggesting that the proviruses of these mice are in similar genomic locations. Conversely, the pattern arising from the DNA of the GR mouse, a strain genetically unrelated to the others, appeared different, suggesting that its mouse mammary tumor proviruses are located in different genomic sites. The structure of another gene, that coding for beta-globin, was also compared. The mice strains which we studied can be categorized into two classes, expressing either one or two beta-globin proteins. The macroenvironment of the beta-globin gene appeared similar among the mice strains belonging to one genetic class. Female mice of the C3H strain exogenously transmit mouse mammary tumor virus via the milk, and their offspring have a high incidence of mammary tumor occurrence. DNA isolated from individual mammary tumors taken from C3H mice or from BALB/c mice foster nursed on C3H mothers was analyzed by the DNA filter transfer technique. Additional mouse mammary tumor virus-containing fragments were found in the DNA isolated from each mammary tumor. These proviral sequences were integrated into different genomic sites in each tumor. Images PMID:6245257

Large-scale production of embryonic red blood cells from human embryonic stem cells.

PubMed

Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

2006-12-01

To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

Biophysical Characterisation of Neuroglobin of the Icefish, a Natural Knockout for Hemoglobin and Myoglobin. Comparison with Human Neuroglobin

PubMed Central

Giordano, Daniela; Boron, Ignacio; Abbruzzetti, Stefania; Van Leuven, Wendy; Nicoletti, Francesco P.; Forti, Flavio; Bruno, Stefano; Cheng, C-H. Christina; Moens, Luc; di Prisco, Guido; Nadra, Alejandro D.; Estrin, Darío; Smulevich, Giulietta; Dewilde, Sylvia; Viappiani, Cristiano; Verde, Cinzia

2012-01-01

The Antarctic icefish Chaenocephalus aceratus lacks the globins common to most vertebrates, hemoglobin and myoglobin, but has retained neuroglobin in the brain. This conserved globin has been cloned, over-expressed and purified. To highlight similarities and differences, the structural features of the neuroglobin of this colourless-blooded fish were compared with those of the well characterised human neuroglobin as well as with the neuroglobin from the retina of the red blooded, hemoglobin and myoglobin-containing, closely related Antarctic notothenioid Dissostichus mawsoni. A detailed structural and functional analysis of the two Antarctic fish neuroglobins was carried out by UV-visible and Resonance Raman spectroscopies, molecular dynamics simulations and laser-flash photolysis. Similar to the human protein, Antarctic fish neuroglobins can reversibly bind oxygen and CO in the Fe2+ form, and show six-coordination by distal His in the absence of exogenous ligands. A very large and structured internal cavity, with discrete docking sites, was identified in the modelled three-dimensional structures of the Antarctic neuroglobins. Estimate of the free-energy barriers from laser-flash photolysis and Implicit Ligand Sampling showed that the cavities are accessible from the solvent in both proteins. Comparison of structural and functional properties suggests that the two Antarctic fish neuroglobins most likely preserved and possibly improved the function recently proposed for human neuroglobin in ligand multichemistry. Despite subtle differences, the adaptation of Antarctic fish neuroglobins does not seem to parallel the dramatic adaptation of the oxygen carrying globins, hemoglobin and myoglobin, in the same organisms. PMID:23226490

Triplication of a four-gene set during evolution of the goat beta-globin locus produced three genes now expressed differentially during development.

PubMed Central

Townes, T M; Fitzgerald, M C; Lingrel, J B

1984-01-01

Distinct hemoglobins are synthesized in goats at different stages of development, similar to humans. Embryonic hemoglobins (zeta 2 epsilon 2 and alpha 2 epsilon 2) are synthesized initially and are followed sequentially by fetal (alpha 2 beta F2), preadult (alpha 2 beta C2), and adult (alpha 2 beta A2) hemoglobins. To help understand the basis of these switches, the genes of the beta-globin locus have been cloned and their linkage arrangement has been determined by the isolation of lambda phage carrying overlapping inserts of genomic goat DNA. The locus extends over 120 kilobase pairs and consists of 12 genes arranged in the following order: epsilon I-epsilon II-psi beta X-beta C-epsilon III-epsilon IV-psi beta Z-beta A-epsilon V-epsilon VI-psi beta Y-beta F. Comparison of the nucleotide sequence of the 12 genes shows that the locus is organized into three homologous four-gene sets that presumably evolved by the triplication of an ancestral set of four genes (epsilon-epsilon-psi beta-beta). Interestingly, the three genes (beta C, beta A, and beta F) located at the ends of the four-gene sets are expressed at different stages of development. Therefore, the goat beta F-, beta C-, and beta A-globin genes appear to have evolved by a mechanism that includes the triplication of 40-50 kilobase pairs of DNA and the recruitment of newly formed genes for expression in fetal, preadult, and adult life. PMID:6593719

The Glass Half Empty: How Emotional Exhaustion Affects the State-Trait Discrepancy in Self-Reports of Teaching Emotions

PubMed Central

Goetz, Thomas; Becker, Eva S.; Bieg, Madeleine; Keller, Melanie M.; Frenzel, Anne C.; Hall, Nathan C.

2015-01-01

Following from previous research on intensity bias and the accessibility model of emotional self-report, the present study examined the role of emotional exhaustion in explaining the discrepancy in teachers’ reports of their trait (habitual) versus state (momentary, “real”) emotions. Trait reports (habitual emotions, exhaustion) were assessed via trait questionnaires, and state reports (momentary emotions) were assessed in real time via the experience sampling method by using personal digital assistants (N = 69 high school teachers; 1,089 measures within teachers). In line with our assumptions, multi-level analyses showed that, as compared to the state assessment, teachers reported higher levels of habitual teaching-related emotions of anger, anxiety, shame, boredom, enjoyment, and pride. Additionally, the state-trait discrepancy in self-reports of negative emotions was accounted for by teachers’ emotional exhaustion, with high exhaustion levels corresponding with a greater state-trait discrepancy. Exhaustion levels did not moderate the state-trait discrepancy in positive emotions indicating that perceived emotional exhaustion may reflect identity-related cognitions specific to the negative belief system. Implications for research and educational practice are discussed. PMID:26368911

DSM-5 pathological personality traits and the personality assessment inventory.

PubMed

Hopwood, Christopher J; Wright, Aidan G C; Krueger, Robert F; Schade, Nick; Markon, Kristian E; Morey, Leslie C

2013-06-01

Section 3 of the DSM-5 will include a pathological personality trait system rooted in the quantitative epistemology of personality and clinical psychology. This system has the potential to enhance the clinical utility of the diagnostic nosology by providing a means for the dimensional assessment of individuals with psychopathology. However, there is limited research on the associations of DSM-5 traits with common mental disorders and related clinical phenomena as measured by currently popular assessment instruments. The purpose of this article was to evaluate the convergence of the DSM-5 trait system with a well-validated broadband clinical instrument, the Personality Assessment Inventory (PAI). Bivariate correlations were examined and factor analytic methods were used to examine the degree to which the DSM-5 traits and PAI capture common variance in personality and mental health. In a student sample (N = 1,001), we found broad convergence between the DSM-5 traits and PAI, which could be organized effectively using five factors. The implications of these findings for using traits to address issues related to diagnostic co-occurrence and heterogeneity in routine clinical assessment are discussed.

Impetus for worship: an exploratory study of adolescents' idol adoration behaviors.

PubMed

Lin, Ying-Ching; Lin, Chien-Hsin

2007-01-01

The objective of this article is to explore the idolization behaviors of Taiwanese adolescents. The study gathered 1,636 questionnaires from 13 senior high schools across northern, central, southern, and eastern Taiwan. The results indicate that adolescents' gender correlates with the idol type they choose to adore when the idol is male. This study summarizes "exterior," "interior," "wealth," and "athlete" as four underlying idol traits attracting adolescents. Various types of idols are considered to be significantly different on these four traits. The impacts of the four traits on adolescents' worship levels are nonsymmetrical. While the traits of exterior and athlete are worship facilitators, the trait of wealth is a prohibitor. By contrast, the trait of interior is neutral and has no effect on worship levels. Furthermore, adolescents are involved in higher levels of worship when the idol is a media star or is the opposite gender of the adolescent. Generally, adolescents' worship levels are heightened by the illusion of a perfect idol, indicating nonrational worship behaviors. Implications regarding the association between adolescents' cognitive abilities and idols' traits are discussed for future research.

The Glass Half Empty: How Emotional Exhaustion Affects the State-Trait Discrepancy in Self-Reports of Teaching Emotions.

PubMed

Goetz, Thomas; Becker, Eva S; Bieg, Madeleine; Keller, Melanie M; Frenzel, Anne C; Hall, Nathan C

2015-01-01

Following from previous research on intensity bias and the accessibility model of emotional self-report, the present study examined the role of emotional exhaustion in explaining the discrepancy in teachers' reports of their trait (habitual) versus state (momentary, "real") emotions. Trait reports (habitual emotions, exhaustion) were assessed via trait questionnaires, and state reports (momentary emotions) were assessed in real time via the experience sampling method by using personal digital assistants (N = 69 high school teachers; 1,089 measures within teachers). In line with our assumptions, multi-level analyses showed that, as compared to the state assessment, teachers reported higher levels of habitual teaching-related emotions of anger, anxiety, shame, boredom, enjoyment, and pride. Additionally, the state-trait discrepancy in self-reports of negative emotions was accounted for by teachers' emotional exhaustion, with high exhaustion levels corresponding with a greater state-trait discrepancy. Exhaustion levels did not moderate the state-trait discrepancy in positive emotions indicating that perceived emotional exhaustion may reflect identity-related cognitions specific to the negative belief system. Implications for research and educational practice are discussed.

The Relationship Between Trait Procrastination, Internet Use, and Psychological Functioning: Results From a Community Sample of German Adolescents.

PubMed

Reinecke, Leonard; Meier, Adrian; Beutel, Manfred E; Schemer, Christian; Stark, Birgit; Wölfling, Klaus; Müller, Kai W

2018-01-01

Adolescents with a strong tendency for irrational task delay (i.e., high trait procrastination) may be particularly prone to use Internet applications simultaneously to other tasks (e.g., during homework) and in an insufficiently controlled fashion. Both Internet multitasking and insufficiently controlled Internet usage may thus amplify the negative mental health implications that have frequently been associated with trait procrastination. The present study explored this role of Internet multitasking and insufficiently controlled Internet use for the relationship between trait procrastination and impaired psychological functioning in a community sample of N = 818 early and middle adolescents. Results from multiple regression analyses indicate that trait procrastination was positively related to Internet multitasking and insufficiently controlled Internet use. Insufficiently controlled Internet use, but not Internet multitasking, was found to partially statistically mediate the association between trait procrastination and adolescents' psychological functioning (i.e., stress, sleep quality, and relationship satisfaction with parents). The study underlines that adolescents with high levels of trait procrastination may have an increased risk for negative outcomes of insufficiently controlled Internet use.

The Relationship Between Trait Procrastination, Internet Use, and Psychological Functioning: Results From a Community Sample of German Adolescents

PubMed Central

Reinecke, Leonard; Meier, Adrian; Beutel, Manfred E.; Schemer, Christian; Stark, Birgit; Wölfling, Klaus; Müller, Kai W.

2018-01-01

Adolescents with a strong tendency for irrational task delay (i.e., high trait procrastination) may be particularly prone to use Internet applications simultaneously to other tasks (e.g., during homework) and in an insufficiently controlled fashion. Both Internet multitasking and insufficiently controlled Internet usage may thus amplify the negative mental health implications that have frequently been associated with trait procrastination. The present study explored this role of Internet multitasking and insufficiently controlled Internet use for the relationship between trait procrastination and impaired psychological functioning in a community sample of N = 818 early and middle adolescents. Results from multiple regression analyses indicate that trait procrastination was positively related to Internet multitasking and insufficiently controlled Internet use. Insufficiently controlled Internet use, but not Internet multitasking, was found to partially statistically mediate the association between trait procrastination and adolescents’ psychological functioning (i.e., stress, sleep quality, and relationship satisfaction with parents). The study underlines that adolescents with high levels of trait procrastination may have an increased risk for negative outcomes of insufficiently controlled Internet use. PMID:29942268

The effect of age and role information on expectations for big five personality traits.

PubMed

Wood, Dustin; Roberts, Brent W

2006-11-01

In four studies, the authors investigated the extent to which expectations for personality traits in age-graded roles correspond to patterns of personality trait change across the life course. In Studies 1 (N = 43) and 2 (N = 126), the authors examined the age-graded roles of high school student, college student, parent, and grandparent and found that expectations for how people behave in these age-graded roles showed strong parallels to the documented pattern of personality trait development and that this pattern of expectations was largely shared by younger and older participants. In Studies 3 (N = 252) and 4 (N = 123), the authors separated age and role information (e.g., marital, parental, and employment status) and found that people use both sources of information independently in forming expectations of others. The implications for understanding the interplay of expectations and personality trait development are discussed.

Coherence and other autistic spectrum traits and eating disorders: building from mechanism to treatment. The Birgit Olsson lecture.

PubMed

Treasure, Janet

2013-02-01

To revisit Gillberg's hypothesis proposed in 1992, which was that anorexia nervosa should be considered within the spectrum of autistic disorders. A search was made of the literature relating to the behavioural traits, and cognitive, emotional and neuroanatomical intermediate phenotypes that are shared between autistic spectrum disorders (ASD) and anorexia nervosa. People with eating disorders in the acute phase (less so after recovery) share some behavioural traits (social impairment and restricted and repetitive behaviours) and intermediate phenotypes (weak central coherence, and impaired set shifting and theory of mind) with people in the autistic spectrum. Behavioural and intermediate neuropsychological traits are shared between eating disorders and ASD. In part, these are familial but also they are accentuated by the illness state and may be secondary to starvation. These traits have implications for prognosis and treatment.

The circle of life: A cross-cultural comparison of children's attribution of life-cycle traits.

PubMed

Burdett, Emily R R; Barrett, Justin L

2016-06-01

Do children attribute mortality and other life-cycle traits to all minded beings? The present study examined whether culture influences young children's ability to conceptualize and differentiate human beings from supernatural beings (such as God) in terms of life-cycle traits. Three-to-5-year-old Israeli and British children were questioned whether their mother, a friend, and God would be subject to various life-cycle processes: Birth, death, ageing, existence/longevity, and parentage. Children did not anthropomorphize but differentiated among human and supernatural beings, attributing life-cycle traits to humans, but not to God. Although 3-year-olds differentiated significantly among agents, 5-year-olds attributed correct life-cycle traits more consistently than younger children. The results also indicated some cross-cultural variation in these attributions. Implications for biological conceptual development are discussed. © 2015 The British Psychological Society.

Elevated Autism Spectrum Disorder Traits in Young Children with OCD.

PubMed

Stewart, Elyse; Cancilliere, Mary Kathryn; Freeman, Jennifer; Wellen, Brianna; Garcia, Abbe; Sapyta, Jeffrey; Franklin, Martin

2016-12-01

Studies have shown a high prevalence of autistic spectrum traits in both children and adults with psychiatric disorders; however the prevalence rate has not yet been investigated in young children with OCD. The aim of the current study was to (1) determine whether ASD traits indicated by the Social Communication Questionnaire (SCQ) and the Social Responsiveness Scale (SRS) were elevated in young children with OCD who do not have a specific ASD diagnosis and (2) determine if ASD traits were associated with OCD severity. Participants (N = 127) were children ages 5-8 years enrolled in the pediatric obsessive-compulsive disorder treatment study for young children (POTS Jr.). Results indicated that the SRS showed elevated autistic traits in the sample and was associated with OCD severity whereas the SCQ did not indicate heightened ASD symptoms. Implications of these results are discussed.

Differential effects of social stress on laboratory-based decision-making are related to both impulsive personality traits and gender.

PubMed

Wise, Richard J; Phung, Alissa L; Labuschagne, Izelle; Stout, Julie C

2015-01-01

Urgency is the tendency to make impulsive decisions under extreme positive or negative emotional states. Stress, gender and impulsive personality traits are all known to influence decision-making, but no studies have examined the interplay of all of these factors. We exposed 78 men and women to a stress or a non-stress condition, and then administered the Balloon Analogue Risk Task. We found that stress effects varied as a function of gender and urgency traits. Under stress, women low in negative urgency and men high in negative urgency made fewer risky decisions. Positive urgency yielded a similar pattern. Thus, decisions under stress depend on a complex interplay between gender and impulsive personality traits. These findings have implications for clinical disorders, such as substance use disorders, in which there are known deficits in decision-making and high levels of impulsive traits.

Juvenile Psychopathic Personality Traits are Associated with Poor Reading Achievement

PubMed Central

DeLisi, Matt; Beaver, Kevin M.; Wexler, Jade; Barth, Amy; Fletcher, Jack

2011-01-01

The current study sought to further the understanding of the linkage between maladaptive behavior and cognitive problems by examining the relations between psychopathic personality traits and reading comprehension performance. Data were derived from a study of 432 predominately African-American and Hispanic middle-school students. Dependent variables consisted of three measures of reading comprehension. Psychopathy measures included the Inventory of Callous-Unemotional traits (ICU—teacher rated) and the self-reported Youth Psychopathic traits Inventory (YPI). Findings from regression models indicated that self-report and teacher ratings of psychopathy were statistically significant inverse predictors of reading performance. Specifically, affective facets of psychopathy were potent predictors of reading comprehension over and above ADHD, IQ, and an impulsivity component of psychopathy. Study results extend the utility of psychopathy construct generally and affective traits specifically to reading achievement, which has broad implications. Findings are discussed with respect to future research and prevention. PMID:20957434

Brief report: Trait emotional intelligence, peer nominations, and scholastic achievement in adolescence.

PubMed

Mancini, Giacomo; Andrei, Federica; Mazzoni, Elvis; Biolcati, Roberta; Baldaro, Bruno; Trombini, Elena

2017-08-01

Current research on trait EI in adolescents suggests that the construct impacts on several important domains of youths' psychological functioning, including school adjustment and achievement. The purpose of this study is to explore the role of trait EI and of its subcomponents, on adolescent's academic achievement. Data were collected from 321 Italian adolescents (162 female; Mage = 15.5, SD = 1.86; aged 13-18 years) recruited from secondary schools. The effects of perceived and actual peer nominations, gender, personality dimensions, and non-verbal cognitive abilities were also controlled. Results highlight that trait EI as assessed by means of the TEIQue impacts Italian but not math's grades, while trait EI's factors predicted both academic subjects, with significant contributions of Self-Control and Sociability. Limitations and implications are discussed. Copyright © 2017 The Foundation for Professionals in Services for Adolescents. Published by Elsevier Ltd. All rights reserved.

Long-Term Prophylactic Antibiotic Treatment: Effects on Survival, Immunocompetence and Reproduction Success of Parasemia plantaginis (Lepidoptera: Erebidae).

PubMed

Dickel, Franziska; Freitak, Dalial; Mappes, Johanna

2016-01-01

Hundreds of insect species are nowadays reared under laboratory conditions. Rearing of insects always implicates the risk of diseases, among which microbial infections are the most frequent and difficult problems. Although there are effective prophylactic treatments, the side effects of applied antibiotics are not well understood. We examined the effect of prophylactic antibiotic treatment on the overwintering success of wood tiger moth (Parasemia plantaginis) larvae, and the postdiapause effect on their life-history traits. Four weeks before hibernation larvae were treated with a widely used antibiotic (fumagillin). We monitored moths' survival and life-history traits during the following 10 mo, and compared them to those of untreated control larvae. Prophylactic antibiotic treatment had no effect on survival but we show effects on some life-history traits by decreasing the developmental time of treated larvae. However, we also revealed relevant negative effects, as antibiotic treated individuals show a decreased number of laid eggs and also furthermore a suppressed immunocompetence. These results implicate, that a prophylactic medication can also lead to negative effects on life-history traits and reproductive success, which should be seriously taken in consideration when applying a prophylactic treatment to laboratory reared insect populations. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

The developmental genetics of human hemoglobin.

PubMed

Weatherall, D J; Wood, W G; Jones, R W; Clegg, J B

1985-01-01

Clearly, it is impossible to combine the diverse information briefly outlined in this review to provide a coherent model of the regulation of globin gene expression during development. One of the great difficulties in this field is uncertainty as to whether the mutations which are associated with persistent gamma chain production or, for the matter, the experimental models which have been used to study the differential expression of the fetal and adult globin genes, have any real relevance to an understanding of the normal switching process. Probably they do, but only with respect to one aspect of what must be an extremely complex multi-step regulatory system. The consistent changes in chromatin and methylation state of the beta globin gene cluster which are associated with activation of the different gene loci at different stages of development provide an anatomical explanation for the activity of these loci but tell us nothing about their mode of regulation. However, the gene or chromosome transfer experiments suggest that there may be developmental-stage specific trans regulatory factors which may be involved in the regulation of these genes, presumably by interacting in some way with chromatin. This is a very promising lead. Equally interesting is the possibility that the upstream mutations which are being found in some of the forms of non-deletion HPFH could provide a clue as to the site of these interactions. Thus at least we have an indication of what might be the most productive area of investigation for trying to characterize the mechanisms of regulation at the chromosomal level. This may be as far as we can go in the immediate future. The central question remains, however. How is the differential expression of the globin genes during development actually timed? All we know at the moment is that it is related fairly closely to gestational age. The only experimental data relating to this question is derived from the sheep transplant model, and suggests that there might be some form of "developmental clock' built into the hemopoietic stem cell. Here we are in considerable difficulties because we don't have an obvious experimental model with which to analyze time-related events. None of the forms of HPFH is, strictly speaking, a heterochronic mutation.(ABSTRACT TRUNCATED AT 400 WORDS)

Mapping eQTLs in the Norfolk Island Genetic Isolate Identifies Candidate Genes for CVD Risk Traits

PubMed Central

Benton, Miles C.; Lea, Rod A.; Macartney-Coxson, Donia; Carless, Melanie A.; Göring, Harald H.; Bellis, Claire; Hanna, Michelle; Eccles, David; Chambers, Geoffrey K.; Curran, Joanne E.; Harper, Jacquie L.; Blangero, John; Griffiths, Lyn R.

2013-01-01

Cardiovascular disease (CVD) affects millions of people worldwide and is influenced by numerous factors, including lifestyle and genetics. Expression quantitative trait loci (eQTLs) influence gene expression and are good candidates for CVD risk. Founder-effect pedigrees can provide additional power to map genes associated with disease risk. Therefore, we identified eQTLs in the genetic isolate of Norfolk Island (NI) and tested for associations between these and CVD risk factors. We measured genome-wide transcript levels of blood lymphocytes in 330 individuals and used pedigree-based heritability analysis to identify heritable transcripts. eQTLs were identified by genome-wide association testing of these transcripts. Testing for association between CVD risk factors (i.e., blood lipids, blood pressure, and body fat indices) and eQTLs revealed 1,712 heritable transcripts (p < 0.05) with heritability values ranging from 0.18 to 0.84. From these, we identified 200 cis-acting and 70 trans-acting eQTLs (p < 1.84 × 10−7) An eQTL-centric analysis of CVD risk traits revealed multiple associations, including 12 previously associated with CVD-related traits. Trait versus eQTL regression modeling identified four CVD risk candidates (NAAA, PAPSS1, NME1, and PRDX1), all of which have known biological roles in disease. In addition, we implicated several genes previously associated with CVD risk traits, including MTHFR and FN3KRP. We have successfully identified a panel of eQTLs in the NI pedigree and used this to implicate several genes in CVD risk. Future studies are required for further assessing the functional importance of these eQTLs and whether the findings here also relate to outbred populations. PMID:24314549

The genomic architecture of mastitis resistance in dairy sheep.

PubMed

Banos, G; Bramis, G; Bush, S J; Clark, E L; McCulloch, M E B; Smith, J; Schulze, G; Arsenos, G; Hume, D A; Psifidi, A

2017-08-16

Mastitis is the most prevalent disease in dairy sheep with major economic, hygienic and welfare implications. The disease persists in all dairy sheep production systems despite the implementation of improved management practises. Selective breeding for enhanced mastitis resistance may provide the means to further control the disease. In the present study, we investigated the genetic architecture of four mastitis traits in dairy sheep. Individual animal records for clinical mastitis occurrence and three mastitis indicator traits (milk somatic cell count, total viable bacterial count in milk and the California mastitis test) were collected monthly throughout lactation for 609 ewes of the Greek Chios breed. All animals were genotyped with a custom-made 960-single nucleotide polymorphism (SNP) DNA array based on markers located in quantitative trait loci (QTL) regions for mastitis resistance previously detected in three other distinct dairy sheep populations. Heritable variation and strong positive genetic correlations were estimated for clinical mastitis occurrence and the three mastitis indicator traits. SNP markers significantly associated with these mastitis traits were confirmed on chromosomes 2, 3, 5, 16 and 19. We identified pathways, molecular interaction networks and functional gene clusters for mastitis resistance. Candidate genes within the detected regions were identified based upon analysis of an ovine transcriptional atlas and transcriptome data derived from milk somatic cells. Relevant candidate genes implicated in innate immunity included SOCS2, CTLA4, C6, C7, C9, PTGER4, DAB2, CARD6, OSMR, PLXNC1, IDH1, ICOS, FYB, and LYFR. The results confirmed the presence of animal genetic variability in mastitis resistance and identified genomic regions associated with specific mastitis traits in the Chios sheep. The conserved genetic architecture of mastitis resistance between distinct dairy sheep breeds suggests that across-breed selection programmes would be feasible.

Plastic flies: the regulation and evolution of trait variability in Drosophila.

PubMed

Shingleton, Alexander W; Tang, Hui Yuan

2012-01-01

Individuals within species and populations vary. Such variation arises through environmental and genetic factors and ensures that no two individuals are identical. However, it is clear that not all traits show the same degree of intraspecific variation. Some traits, in particular secondary sexual characteristics used by males to compete for and attract females, are extremely variable among individuals in a population. Other traits, for example brain size in mammals, are not. Recent research has begun to explore the possibility that the extent of phenotypic variation (here referred to as "variability") may be a character itself and subject to natural selection. While these studies support the concept of variability as an evolvable trait, controversy remains over what precisely the trait is. At the heart of this controversy is the fact that there are very few examples of developmental mechanisms that regulate trait variability in response to any source of variation, be it environmental or genetic. Here, we describe a recent study from our laboratory that identifies such a mechanism. We then place the study in the context of current research on the regulation of trait variability, and discuss the implications for our understanding of the developmental regulation and evolution of phenotypic variation.

The relationship between autistic traits and social anxiety, worry, obsessive-compulsive, and depressive symptoms: specific and non-specific mediators in a student sample.

PubMed

Liew, Shi Min; Thevaraja, Nishta; Hong, Ryan Y; Magiati, Iliana

2015-03-01

The high prevalence of anxiety symptoms in individuals with autism spectrum disorders has now been well documented. There is also a positive relationship between autistic traits and anxiety symptoms in unselected samples and individuals with anxiety disorders have more autistic traits compared to those without. Less is known, however, regarding which elements of autistic traits (i.e., social versus non-social/behavioral) or which other variables may mediate this relationship. This study investigated the shared and specific role of five autistic-trait related mediators (social problem-solving, social competence, teasing experiences, prevention from/punishment for preferred repetitive behaviors and aversive sensory experiences) in a non-clinical sample of 252 university students. Autistic traits positively correlated with both anxiety and depressive symptoms. Social competence mediated the relationship between autistic traits and social anxiety symptoms only, while only prevention from preferred repetitive behaviors and frequent aversive sensory experiences mediated the relationship between autistic traits, worry and obsessive-compulsive symptoms. Replication of these findings is required in longitudinal studies and with clinical samples. Limitations of the study are discussed and possible implications for intervention are tentatively suggested.

Emotional communication in families of conduct problem children with high versus low callous-unemotional traits.

PubMed

Pasalich, Dave S; Dadds, Mark R; Vincent, Lucy C; Cooper, Francesca A; Hawes, David J; Brennan, John

2012-01-01

This study examined relationships between parent-child emotional communication and callous-unemotional (CU) traits and conduct problems. References to negative and positive emotions made by clinic-referred boys (3-9 years) and their parents were coded from direct observations of family interactions involving the discussion of shared emotional experiences. Although frequencies of parents' emotion expression did not generally relate to levels of CU traits, boys higher on CU traits were observed to be more expressive of negative emotions in conversation with their caregivers-specifically for sadness and fear. Independent coders did not judge these children to be less genuine in their emotion expression compared to their low-CU counterparts. We also examined whether CU traits moderated the relationship between parents' focus on emotions and conduct problem severity. Higher levels of maternal focus on negative emotions were found to be associated with lower conduct problems in high-CU boys but related to higher conduct problems in low-CU boys. Frequencies of fathers' emotional communication were unrelated to either child CU traits or conduct problems. We discuss the implications of these findings for the conceptualization of CU traits in preadolescent children, and interventions for conduct problems in children elevated on these traits.

Psychopathic Personality Traits Associated with Abnormal Selective Attention and Impaired Cognitive Control

PubMed Central

Sadeh, Naomi; Verona, Edelyn

2008-01-01

The current study investigated how mechanisms of attention that have been well-characterized in the cognitive psychology literature (Lavie, Hirst, De Fockert, & Viding, 2004; Maylor & Lavie, 1998) may be differentially associated with psychopathic traits in non-incarcerated men. Previous research on cognition and psychopathy indicates that primary psychopathic traits are associated with over-focused attention and/or reduced processing of information peripheral to the focus of attention. Conversely, deficits in executive functioning, such as working memory and cognitive control, are implicated in secondary psychopathic traits. Results revealed a significant relationship between traits typically associated with primary psychopathy (e.g., low anxiety, social dominance, fearlessness, callousness) and reduced processing of task-irrelevant distractors, suggesting diminished basic attentional capacity among individuals high on these traits. In contrast, some characteristics linked to secondary psychopathy (e.g., social alienation, cynicism) showed a positive relationship with impaired working memory functioning, indicative of deficits in cognitive control, whereas other traits (i.e., self-centeredness, antagonism) did not. These results suggest that psychopathic traits are differentially related to selective impairments in attentional functioning, which may help explain the observed heterogeneity in psychopathic manifestations. PMID:18763886

The Genetic Basis of Upland/Lowland Ecotype Divergence in Switchgrass (Panicum virgatum)

PubMed Central

Milano, Elizabeth R.; Lowry, David B.; Juenger, Thomas E.

2016-01-01

The evolution of locally adapted ecotypes is a common phenomenon that generates diversity within plant species. However, we know surprisingly little about the genetic mechanisms underlying the locally adapted traits involved in ecotype formation. The genetic architecture underlying locally adapted traits dictates how an organism will respond to environmental selection pressures, and has major implications for evolutionary ecology, conservation, and crop breeding. To understand the genetic architecture underlying the divergence of switchgrass (Panicum virgatum) ecotypes, we constructed a genetic mapping population through a four-way outbred cross between two northern upland and two southern lowland accessions. Trait segregation in this mapping population was largely consistent with multiple independent loci controlling the suite of traits that characterizes ecotype divergence. We assembled a joint linkage map using ddRADseq, and mapped quantitative trait loci (QTL) for traits that are divergent between ecotypes, including flowering time, plant size, physiological processes, and disease resistance. Overall, we found that most QTL had small to intermediate effects. While we identified colocalizing QTL for multiple traits, we did not find any large-effect QTL that clearly controlled multiple traits through pleiotropy or tight physical linkage. These results indicate that ecologically important traits in switchgrass have a complex genetic basis, and that similar loci may underlie divergence across the geographic range of the ecotypes. PMID:27613751

The Mediation Effect of Coping Style on the Relations between Personality and Life Satisfaction in Chinese Adolescents

PubMed Central

Xu, Le; Liu, Ru-De; Ding, Yi; Mou, Xiaohong; Wang, Jia; Liu, Ying

2017-01-01

Previous findings showed the associations between each of the Big Five personality trait and adolescents’ life satisfaction were different. Some traits (extraversion and neuroticism) correlated with adolescents’ life satisfaction, while other traits did not have the same associations with adolescents’ life satisfaction. In order to explain why the Big Five traits differed in their associations with adolescents’ life satisfaction, the present study verified the relations between each of the Big Five personality traits and life satisfaction, and demonstrated the mediating effects of coping style on the relations between these personality traits and life satisfaction in a sample of 2,357 Chinese adolescents. The results demonstrated that four of the Big Five personality traits (extraversion, agreeableness, conscientiousness, and neuroticism) had significant associations with life satisfaction. Further, coping style partially mediated the relations between these four traits and life satisfaction, whereas coping style fully mediated the relation between openness to new experience and life satisfaction. The results implied a plausible explanation for why the Big Five traits differed in their associations with life satisfaction found among the previous literature: that there might be some partial or full mediation variables (such as coping style in this study) left unexamined. Theoretical and practical implications of this study on further research and educational practice are discussed. PMID:28706496

Effects of parental emotional warmth on the relationship between regional gray matter volume and depression-related personality traits.

PubMed

Yang, Junyi; Yin, Ping; Wei, Dongtao; Wang, Kangcheng; Li, Yongmei; Qiu, Jiang

2017-06-01

The depression-related personality trait is associated with the severity of patients' current depressive symptoms and with the vulnerability to depression within the nonclinical groups. However, little is known about the anatomical structure associated with the depression-related personality traits within the nonclinical sample. Parenting behavior is associated with the depression symptoms; however, whether or not parenting behavior influence the neural basis of the depression-related personality traits is unclear. Thus in current study, first, we used voxel-based morphometry to identify the brain regions underlying individual differences in depression-related personality traits, as measured by the revised Neuroticism-Extraversion-Openness Personality Inventory, in a large sample of young healthy adults. Second, we use mediation analysis to investigate the relationship between parenting behavior and neural basis of depression-related personality traits. The results revealed that depression-related personality traits were positively correlated with gray matter volume mainly in medial frontal gyrus (MFG) that is implicated in the self-referential processing and emotional regulation. Furthermore, parental emotional warmth acted as a mediational mechanism underlying the association between the MFG volume and the depression-related personality trait. Together, our findings suggested that the family environment might play an important role in the acquisition and process of the depression-related personality traits.

Impulsive responding in threat and reward contexts as a function of PTSD symptoms and trait disinhibition.

PubMed

Sadeh, Naomi; Spielberg, Jeffrey M; Hayes, Jasmeet P

2018-01-01

We examined current posttraumatic stress disorder (PTSD) symptoms, trait disinhibition, and affective context as contributors to impulsive and self-destructive behavior in 94 trauma-exposed Veterans. Participants completed an affective Go/No-Go task (GNG) with different emotional contexts (threat, reward, and a multidimensional threat/reward condition) and current PTSD, trait disinhibition, and risky/self-destructive behavior measures. PTSD interacted with trait disinhibition to explain recent engagement in risky/self-destructive behavior, with Veterans scoring high on trait disinhibition and current PTSD symptoms reporting the highest levels of these behaviors. On the GNG task, commission errors were also associated with the interaction of PTSD symptoms and trait disinhibition. Specifically, PTSD symptoms were associated with greater commission errors in threat vs. reward contexts for individuals who were low on trait disinhibition. In contrast, veterans high on PTSD and trait disinhibition exhibited the greatest number of commission errors in the multidimensional affective context that involved both threat and reward processing. Results highlight the interactive effects of PTSD and disinhibited personality traits, as well as threat and reward systems, as risk factors for impulsive and self-destructive behavior in trauma-exposed groups. Findings have clinical implications for understanding heterogeneity in the expression of PTSD and its association with disinhibited behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

Outcrossing and crossbreeding recovers deteriorated traits in laboratory cultured Steinernema carpocapsae nematodes.

PubMed

Chaston, John M; Dillman, Adler R; Shapiro-Ilan, David I; Bilgrami, Anwar L; Gaugler, Randy; Hopper, Keith R; Adams, Byron J

2011-06-01

The nematode Steinernema carpocapsae infects and kills many pest insects in agro-ecosystems and is commonly used in biocontrol of these pests. Growth of the nematodes prior to distribution for biocontrol commonly results in deterioration of traits that are essential for nematode persistence in field applications. To better understand the mechanisms underlying trait deterioration of the efficacy of natural parasitism in entomopathogenic nematodes, we explored the maintenance of fitness related traits including reproductive capacity, heat tolerance, virulence to insects and 'tail standing' (formerly called nictation) among laboratory-cultured lines derived from natural, randomly mating populations of S. carpocapsae. Laboratory cultured nematode lines with fitness-related trait values below wild-type levels regained wild-type levels of reproductive and heat tolerance traits when outcrossed with a non-deteriorated line, while virulence and 'tail standing' did not deteriorate in our experiments. Crossbreeding two trait-deteriorated lines with each other also resulted in restoration of trait means to wild-type levels in most crossbred lines. Our results implicate inbreeding depression as the primary cause of trait deterioration in the laboratory cultured S. carpocapsae. We further suggest the possibility of creating inbred lines purged of deleterious alleles as founders in commercial nematode growth. Copyright © 2011 Australian Society for Parasitology Inc. All rights reserved.

Associations between autistic traits and fractional anisotropy values in white matter tracts in a nonclinical sample of young adults.

PubMed

Bradstreet, Lauren E; Hecht, Erin E; King, Tricia Z; Turner, Jessica L; Robins, Diana L

2017-01-01

Whereas a number of studies have examined relationships among brain activity, social cognitive skills, and autistic traits, fewer studies have evaluated whether structural connections among brain regions relate to these traits and skills. Uncinate fasciculus (UF) and inferior longitudinal fasciculus (ILF) are white matter tracts that may underpin the behavioral expression of these skills because they connect regions within or provide sensory information to brain areas implicated in social cognition, and structural differences in these tracts have been associated with autistic traits. We examined relationships among self-reported autistic traits, mentalizing, and water diffusivity in UF and ILF in a nonclinical sample of 24 young adults (mean age = 21.92 years, SD = 4.72 years; 15 women). We measured autistic traits using the Autism-Spectrum Quotient, and we measured mentalizing using the Dynamic Interactive Shapes Clips task. We used Tract-Based Spatial Statistics and randomize to examine relationships among fractional anisotropy (FA) values in bilateral ILF and UF, age, cognitive abilities, autistic traits, and mentalizing. Autistic traits were positively related to FA values in left ILF. No other relationships between FA values and other variables were significant. Results suggest that left ILF may be involved in the expression of autistic traits in individuals without clinical diagnoses.