Targeting YAP/TAZ-TEAD protein-protein interactions using fragment-based and computational modeling approaches

PubMed Central

Verma, Chandra

2017-01-01

The Hippo signaling pathway, which is implicated in the regulation of organ size, has emerged as a potential target for the development of cancer therapeutics. YAP, TAZ (transcription co-activators) and TEAD (transcription factor) are the downstream transcriptional machinery and effectors of the pathway. Formation of the YAP/TAZ-TEAD complex leads to transcription of growth-promoting genes. Conversely, disrupting the interactions of the complex decreases cell proliferation. Herein, we screened a 1000-member fragment library using Thermal Shift Assay and identified a hit fragment. We confirmed its binding at the YAP/TAZ-TEAD interface by X-ray crystallography, and showed that it occupies the same hydrophobic pocket as a conserved phenylalanine of YAP/TAZ. This hit fragment serves as a scaffold for the development of compounds that have the potential to disrupt YAP/TAZ-TEAD interactions. Structure-activity relationship studies and computational modeling were also carried out to identify more potent compounds that may bind at this validated druggable binding site. PMID:28570566

Morphological, Genome and Gene Expression Changes in Newly Induced Autopolyploid Chrysanthemum lavandulifolium (Fisch. ex Trautv.) Makino.

PubMed

Gao, Ri; Wang, Haibin; Dong, Bin; Yang, Xiaodong; Chen, Sumei; Jiang, Jiafu; Zhang, Zhaohe; Liu, Chen; Zhao, Nan; Chen, Fadi

2016-10-09

Autopolyploidy is widespread in higher plants and plays an important role in the process of evolution. The present study successfully induced autotetraploidys from Chrysanthemum lavandulifolium by colchicine. The plant morphology, genomic, transcriptomic, and epigenetic changes between tetraploid and diploid plants were investigated. Ligulate flower, tubular flower and leaves of tetraploid plants were greater than those of the diploid plants. Compared with diploid plants, the genome changed as a consequence of polyploidization in tetraploid plants, namely, 1.1% lost fragments and 1.6% novel fragments occurred. In addition, DNA methylation increased after genome doubling in tetraploid plants. Among 485 common transcript-derived fragments (TDFs), which existed in tetraploid and diploid progenitors, 62 fragments were detected as differentially expressed TDFs, 6.8% of TDFs exhibited up-regulated gene expression in the tetraploid plants and 6.0% exhibited down-regulation. The present study provides a reference for further studying the autopolyploidization role in the evolution of C. lavandulifolium. In conclusion, the autopolyploid C. lavandulifolium showed a global change in morphology, genome and gene expression compared with corresponding diploid.

The planarian regeneration transcriptome reveals a shared but temporally shifted regulatory program between opposing head and tail scenarios.

PubMed

Kao, Damian; Felix, Daniel; Aboobaker, Aziz

2013-11-16

Planarians can regenerate entire animals from a small fragment of the body. The regenerating fragment is able to create new tissues and remodel existing tissues to form a complete animal. Thus different fragments with very different starting components eventually converge on the same solution. In this study, we performed an extensive RNA-seq time-course on regenerating head and tail fragments to observe the differences and similarities of the transcriptional landscape between head and tail fragments during regeneration. We have consolidated existing transcriptomic data for S. mediterranea to generate a high confidence set of transcripts for use in genome wide expression studies. We performed a RNA-seq time-course on regenerating head and tail fragments from 0 hours to 3 days. We found that the transcriptome profiles of head and tail regeneration were very different at the start of regeneration; however, an unexpected convergence of transcriptional profiles occurred at 48 hours when head and tail fragments are still morphologically distinct. By comparing differentially expressed transcripts at various time-points, we revealed that this divergence/convergence pattern is caused by a shared regulatory program that runs early in heads and later in tails.Additionally, we also performed RNA-seq on smed-prep(RNAi) tail fragments which ultimately fail to regenerate anterior structures. We find the gene regulation program in response to smed-prep(RNAi) to display the opposite regulatory trend compared to the previously mentioned share regulatory program during regeneration. Using annotation data and comparative approaches, we also identified a set of approximately 4,800 triclad specific transcripts that were enriched amongst the genes displaying differential expression during the regeneration time-course. The regeneration transcriptome of head and tail regeneration provides us with a rich resource for investigating the global expression changes that occurs during regeneration. We show that very different regenerative scenarios utilize a shared core regenerative program. Furthermore, our consolidated transcriptome and annotations allowed us to identity triclad specific transcripts that are enriched within this core regulatory program. Our data support the hypothesis that both conserved aspects of animal developmental programs and recent evolutionarily innovations work in concert to control regeneration.

Transcription of Gypsy Elements in a Y-Chromosome Male Fertility Gene of Drosophila Hydei

PubMed Central

Hochstenbach, R.; Harhangi, H.; Schouren, K.; Bindels, P.; Suijkerbuijk, R.; Hennig, W.

1996-01-01

We have found that defective gypsy retrotransposons are a major constituent of the lampbrush loop pair Nooses in the short arm of the Y chromosome of Drosophila hydei. The loop pair is formed by male fertility gene Q during the primary spermatocyte stage of spermatogenesis, each loop being a single transcription unit with an estimated length of 260 kb. Using fluorescent in situ hybridization, we show that throughout the loop transcripts gypsy elements are interspersed with blocks of a tandemly repetitive Y-specific DNA sequence, ay1. Nooses transcripts containing both sequence types show a wide size range on Northern blots, do not migrate to the cytoplasm, and are degraded just before the first meiotic division. Only one strand of ay1 and only the coding strand of gypsy can be detected in the loop transcripts. However, as cloned genomic DNA fragments also display opposite orientations of ay1 and gypsy, such DNA sections cannot be part of the Nooses. Hence, they are most likely derived from the flanking heterochromatin. The direction of transcription of ay1 and gypsy thus appears to be of a functional significance. PMID:8852843

Broad genomic and transcriptional analysis reveals a highly derived genome in dinoflagellate mitochondria

PubMed Central

Jackson, Christopher J; Norman, John E; Schnare, Murray N; Gray, Michael W; Keeling, Patrick J; Waller, Ross F

2007-01-01

Background Dinoflagellates comprise an ecologically significant and diverse eukaryotic phylum that is sister to the phylum containing apicomplexan endoparasites. The mitochondrial genome of apicomplexans is uniquely reduced in gene content and size, encoding only three proteins and two ribosomal RNAs (rRNAs) within a highly compacted 6 kb DNA. Dinoflagellate mitochondrial genomes have been comparatively poorly studied: limited available data suggest some similarities with apicomplexan mitochondrial genomes but an even more radical type of genomic organization. Here, we investigate structure, content and expression of dinoflagellate mitochondrial genomes. Results From two dinoflagellates, Crypthecodinium cohnii and Karlodinium micrum, we generated over 42 kb of mitochondrial genomic data that indicate a reduced gene content paralleling that of mitochondrial genomes in apicomplexans, i.e., only three protein-encoding genes and at least eight conserved components of the highly fragmented large and small subunit rRNAs. Unlike in apicomplexans, dinoflagellate mitochondrial genes occur in multiple copies, often as gene fragments, and in numerous genomic contexts. Analysis of cDNAs suggests several novel aspects of dinoflagellate mitochondrial gene expression. Polycistronic transcripts were found, standard start codons are absent, and oligoadenylation occurs upstream of stop codons, resulting in the absence of termination codons. Transcripts of at least one gene, cox3, are apparently trans-spliced to generate full-length mRNAs. RNA substitutional editing, a process previously identified for mRNAs in dinoflagellate mitochondria, is also implicated in rRNA expression. Conclusion The dinoflagellate mitochondrial genome shares the same gene complement and fragmentation of rRNA genes with its apicomplexan counterpart. However, it also exhibits several unique characteristics. Most notable are the expansion of gene copy numbers and their arrangements within the genome, RNA editing, loss of stop codons, and use of trans-splicing. PMID:17897476

Cloning and expression analysis of a new anther-specific gene CaMF4 in Capsicum annuum.

PubMed

Hao, Xuefeng; Chen, Changming; Chen, Guoju; Cao, Bihao; Lei, Jianjun

2017-03-01

Our previous study on the genic male sterile-fertile line 114AB of Capsicum annuum indicated a diversity of differentially expressed cDNA fragments in fertile and sterile lines. In this study, a transcript-derived fragment (TDF), male fertile 4 (CaMF4) was chosen for further investigation to observe that this specific fragment accumulates in the flower buds of the fertile line. The full genomic DNA sequence of CaMF4 was 894 bp in length, containing two exons and one intron, and the complete coding sequence encoded a putative 11.53 kDa protein of 109 amino acids. The derived protein of CaMF4 shared similarity with the members of PGPS/D3 protein family. The expression of CaMF4 was detected in both the flower buds at stage 8 and open flowers of the male fertile line. In contrast to this observation, expression of CaMF4 was not detected in any organs of the male sterile line. Further analysis revealed that CaMF4 was expressed particularly in anthers of the fertile line. Our results suggest that CaMF4 is an anther-specific gene and might be indispensable for anther or pollen development in C. annuum.

Fragmentation of tRNA in Phytophthora infestans asexual life cycle stages and during host plant infection.

PubMed

Åsman, Anna K M; Vetukuri, Ramesh R; Jahan, Sultana N; Fogelqvist, Johan; Corcoran, Pádraic; Avrova, Anna O; Whisson, Stephen C; Dixelius, Christina

2014-12-10

The oomycete Phytophthora infestans possesses active RNA silencing pathways, which presumably enable this plant pathogen to control the large numbers of transposable elements present in its 240 Mb genome. Small RNAs (sRNAs), central molecules in RNA silencing, are known to also play key roles in this organism, notably in regulation of critical effector genes needed for infection of its potato host. To identify additional classes of sRNAs in oomycetes, we mapped deep sequencing reads to transfer RNAs (tRNAs) thereby revealing the presence of 19-40 nt tRNA-derived RNA fragments (tRFs). Northern blot analysis identified abundant tRFs corresponding to half tRNA molecules. Some tRFs accumulated differentially during infection, as seen by examining sRNAs sequenced from P. infestans-potato interaction libraries. The putative connection between tRF biogenesis and the canonical RNA silencing pathways was investigated by employing hairpin RNA-mediated RNAi to silence the genes encoding P. infestans Argonaute (PiAgo) and Dicer (PiDcl) endoribonucleases. By sRNA sequencing we show that tRF accumulation is PiDcl1-independent, while Northern hybridizations detected reduced levels of specific tRNA-derived species in the PiAgo1 knockdown line. Our findings extend the sRNA diversity in oomycetes to include fragments derived from non-protein-coding RNA transcripts and identify tRFs with elevated levels during infection of potato by P. infestans.

Tandem Mass Spectrometry of Modified and Platinated Oligoribonucleotides

NASA Astrophysics Data System (ADS)

Nyakas, Adrien; Stucki, Silvan R.; Schürch, Stefan

2011-05-01

Therapeutic approaches for treatment of various diseases aim at the interruption of transcription or translation. Modified oligonucleotides, such as 2'- O-methyl- and methylphosphonate-derivatives, exhibit high resistance against cellular nucleases, thus rendering application for, e.g., antigene or antisense purposes possible. Other approaches are based on administration of cross-linking agents, such as cis-diamminedichloroplatinum(II) (cisplatin, DDP), which is still the most widely used anticancer drug worldwide. Due to the formation of 1,2-intrastrand cross links at adjacent guanines, replication of the double-strand is disturbed, thus resulting in significant cytotoxicity. Evidence for the gas-phase dissociation mechanism of platinated RNA is given, based on nano-electrospray ionization high-resolution multistage tandem mass spectrometry (MS n ). Confirmation was found by investigating the fragmentation pattern of platinated and unplatinated 2'-methoxy oligoribonucleotide hexamers and their corresponding methylphosphonate derivatives. Platinated 2'-methoxy oligoribonucleotides exhibit a similar gas-phase dissociation behavior as the corresponding DNA and RNA sequences, with the 3'-C-O bond adjacent to the vicinal guanines being cleaved preferentially, leading to wx-ion formation. By examination of the corresponding platinated methylphosphonate derivatives of the 2'-methoxy oligoribonucleotides, the key role of the negatively charged phosphate oxygen atoms in direct proximity to the guanines was proven. The significant alteration of fragmentation due to platination is demonstrated by comparison of the fragment ion patterns of unplatinated and platinated 2'- O-methyl- and 2'- O-methyl methylphosphonate oligoribonucleotides, and the results obtained by H/D exchange experiments.

Inhibition of Retinoblastoma Protein Inactivation

DTIC Science & Technology

2016-09-01

Retinoblastoma protein, E2F transcription factor, high throughput screen, drug discovery, x-ray crystallography 16. SECURITY CLASSIFICATION OF: 17...developed a method to perform fragment based screening by x-ray crystallography . 2.0 KEYWORDS Retinoblastoma (Rb) pathway, E2F transcription factor...cancer, cell-cycle inhibition, activation, modulation, inhibition, high throughput screening, fragment-based screening, x-ray crystallography

POM-ZP3, a bipartite transcript derived from human ZP3 and a POM121 homologue

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kipersztok, S.; Osawa, G.A.; Liang, L.F.

1995-01-20

Human POM-ZP3 is a novel bipartite RNA transcript that is derived from a gene homologous to rat POM121 (a nuclear pore membrane protein) and ZP3 (a sperm receptor ligand in the zona pellucida). The 5{prime} region is 77% identical to the 5{prime} end of the coding region of rat POM121 and appears to represent a partial duplication of a gene encoding a human homologue of this rodent gene. The 3{prime} end of the POM-ZP3 transcript is 99% identical to ZP3 and appears to have arisen from a duplication of the last four exons (exons 5-8) of ZP3. Using Northern blotsmore » and RT-PCR, POM-ZP3 transcripts were detected in human ovaries, testes, spleen, thymus, lymphocytes, prostate, and intestines. The longest open reading frame encodes a conceptual protein of 210 amino acids, the first 76 of which are 83% identical to residues 241-315 of rat POM121. The next 125 amino acids are 98% identical to residues 239-363 of the 424-amino-acid human ZP3 protein. By fluorescence in situ hybridization, genomic fragments of ZP3 and a human homologue of POM121 were localized to chromosome 7q11.23. Taken together, these data suggest that partial duplications of human ZP3 and a POM121-like gene have resulted in a fusion transcript, POM-ZP3, that is expressed in multiple human tissues. 24 refs., 5 figs.« less

Micropreparative capillary gel electrophoresis of DNA: rapid expressed sequence tag library construction.

PubMed

Shi, Liang; Khandurina, Julia; Ronai, Zsolt; Li, Bi-Yu; Kwan, Wai King; Wang, Xun; Guttman, András

2003-01-01

A capillary gel electrophoresis based automated DNA fraction collection technique was developed to support a novel DNA fragment-pooling strategy for expressed sequence tag (EST) library construction. The cDNA population is first cleaved by BsaJ I and EcoR I restriction enzymes, and then subpooled by selective ligation with specific adapters followed by polymerase chain reaction (PCR) amplification and labeling. Combination of this cDNA fingerprinting method with high-resolution capillary gel electrophoresis separation and precise fractionation of individual cDNA transcript representatives avoids redundant fragment selection and concomitant repetitive sequencing of abundant transcripts. Using a computer-controlled capillary electrophoresis device the transcript representatives were separated by their size and fractions were automatically collected in every 30 s into 96-well plates. The high resolving power of the sieving matrix ensured sequencing grade separation of the DNA fragments (i.e., single-base resolution) and successful fraction collection. Performance and precision of the fraction collection procedure was validated by PCR amplification of the collected DNA fragments followed by capillary electrophoresis analysis for size and purity verification. The collected and PCR-amplified transcript representatives, ranging up to several hundred base pairs, were then sequenced to create an EST library.

cDNA-AFLP analysis of transcripts induced in chickpea plants by TiO2 nanoparticles during cold stress.

PubMed

Amini, Saeed; Maali-Amiri, Reza; Mohammadi, Rahmat; Kazemi-Shahandashti, Seyyedeh-Sanam

2017-02-01

We evaluated the effect of TiO 2 nanoparticles (NPs) on cold tolerance (CT) development in two chickpea (Cicer arietinum L.) genotypes (Sel96Th11439, cold tolerant, and ILC533, cold susceptible) by using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique during the first and sixth days of cold stress (CS) at 4 °C. Selective amplification by primer combinations generated 4200 transcript-derived fragments (TDFs) while 100 of them (2.62%) were differentially expressed. During CS, 60 differentially expressed TDFs of TiO 2 NPs-treated plants were cloned and 10 of them produced successfully readable sequences. These data represented different groups of genes involved in metabolism pathways, cellular defense, cell connections and signaling, transcriptional regulation and chromatin architecture. Two out of 10 TDFs were unknown genes with uncharacterized functions or sequences without homology to known ones. The network-based analysis showed a gene-gene relationship in response to CS. Quantitative reverse-transcriptase polymerase chain reaction (qPCR) confirmed differential expression of identified genes (six out of 10 TDFs) with potential functions in CT and showed similar patterns with cDNA-AFLP results. An increase in transcription level of these TDFs, particularly on the first day of CS, was crucial for developing CT through decreasing electrolyte leakage index (ELI) content in tolerant plants compared to susceptible ones, as well as in TiO 2 NPs-treated plants compared to control ones. It could also indicate probable role of TiO 2 NPs against CS-induced oxidative stress. Therefore, a new application of TiO 2 NPs in CT development is suggested for preventing or controlling the damages in field conditions and increasing crop productivity. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Hongyan, E-mail: hongyan_dong@hc-sc.gc.ca; Yauk, Carole L.; Wade, Michael G.

Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined withmore » chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism.« less

Transcriptional responses in Honey Bee larvae infected with chalkbrood fungus

PubMed Central

2010-01-01

Background Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. Results We used cDNA-AFLP ®Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples. We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-κB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Conclusions Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to transcriptional regulation, apoptotic degradation of ubiquitinated proteins, nutritional regulation, and RNA processing. We found that immune regulation of the anti-fungal responses in honey bee involves highly coordinated activation of both NF-κB signaling pathways, leading to production of anti-microbial peptides. Significantly, activation of immune responses in the infected bee larvae was associated with down-regulation of major storage proteins, leading to depletion of nutritional resources. PMID:20565973

Transcriptional responses in honey bee larvae infected with chalkbrood fungus.

PubMed

Aronstein, Katherine A; Murray, Keith D; Saldivar, Eduardo

2010-06-21

Diseases and other stress factors working synergistically weaken honey bee health and may play a major role in the losses of bee populations in recent years. Among a large number of bee diseases, chalkbrood has been on the rise. We present here the experimental identification of honey bee genes that are differentially expressed in response to infection of honey bee larvae with the chalkbrood fungus, Ascosphaera apis. We used cDNA-AFLP Technology to profile transcripts in infected and uninfected bee larvae. From 64 primer combinations, over 7,400 transcriptionally-derived fragments were obtained A total of 98 reproducible polymorphic cDNA-AFLP fragments were excised and sequenced, followed by quantitative real-time RT-PCR (qRT-PCR) analysis of these and additional samples.We have identified a number of differentially-regulated transcripts that are implicated in general mechanisms of stress adaptation, including energy metabolism and protein transport. One of the most interesting differentially-regulated transcripts is for a chitinase-like enzyme that may be linked to anti-fungal activities in the honey bee larvae, similarly to gut and fat-body specific chitinases found in mosquitoes and the red flour beetle. Surprisingly, we did not find many components of the well-characterized NF-kappaB intracellular signaling pathways to be differentially-regulated using the cDNA-AFLP approach. Therefore, utilizing qRT-PCR, we probed some of the immune related genes to determine whether the lack of up-regulation of their transcripts in our analysis can be attributed to lack of immune activation or to limitations of the cDNA-AFLP approach. Using a combination of cDNA-AFLP and qRT-PCR analyses, we were able to determine several key transcriptional events that constitute the overall effort in the honey bee larvae to fight natural fungal infection. Honey bee transcripts identified in this study are involved in critical functions related to transcriptional regulation, apoptotic degradation of ubiquitinated proteins, nutritional regulation, and RNA processing. We found that immune regulation of the anti-fungal responses in honey bee involves highly coordinated activation of both NF-kappaB signaling pathways, leading to production of anti-microbial peptides. Significantly, activation of immune responses in the infected bee larvae was associated with down-regulation of major storage proteins, leading to depletion of nutritional resources.

Oligo-dT anchored cDNA-SCoT: a novel differential display method for analyzing differential gene expression in response to several stress treatments in mango (Mangifera indica L.).

PubMed

Luo, Cong; He, Xin-Hua; Hu, Ying; Yu, Hai-xia; Ou, Shi-Jin; Fang, Zhong-Bin

2014-09-15

Differential display is a powerful technique for analyzing differences in gene expression. Oligo-dT cDNAstart codon targeted marker (cDNA-SCoT) technique is a novel, simple, cheap, rapid, and efficient method for differential gene expression research. In the present study, the oligo-dT anchored cDNA-SCoT technique was exploited to identify differentially expressed genes during several stress treatments in mango. A total of 37 primers combined with oligo-dT anchor primers 3side amplified approximately 150 fragments of 150 bp to 1500 bp in length. Up to 100 fragments were differentially expressed among the stress treatments and control samples, among which 92 were obtained and sequenced. Out of the 92 transcript derived fragments (TDFs), 70% were highly homologous to known genes, and 30% encoded unclassified proteins with unknown functions. The expression pattern of nine genes with known functions involved in several abiotic stresses in other species was confirmed by quantitative reverse transcription polymerase chain reaction (qRT-PCR) under cold (4 °C), salinity (NaCl), polyethylene glycol (PEG, MW 6000), and heavy metal treatments in leaves and stems at different time points (0, 24, 48, and 72 h). The expression patterns of the genes (TDF4, TDF7, TDF23, TDF45, TDF49, TDF50, TDF57, TDF91 and TDF92) that had direct or indirect relationships with cold, salinity, drought and heavy metal stress response were analyzed through qRT-PCR. The possible roles of these genes are discussed. This study suggests that the oligo-dT anchored cDNA-SCoT differential display method is a useful tool to serve as an initial step for characterizing transcriptional changes induced by abiotic stresses and provide gene information for further study and application in genetic improvement and breeding in mango. Copyright © 2014 Elsevier B.V. All rights reserved.

SKI2 mediates degradation of RISC 5′-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis

PubMed Central

Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

2015-01-01

Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20–24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5′, but not 3′-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5′ to the cleavage site, but several examples of 3′-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5′-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5′-cleavage fragments. PMID:26464441

Identification of aluminum-regulated genes by cDNA-AFLP analysis of roots in two contrasting genotypes of highbush blueberry (Vaccinium corymbosum L.).

PubMed

Inostroza-Blancheteau, Claudio; Aquea, Felipe; Reyes-Díaz, Marjorie; Alberdi, Miren; Arce-Johnson, Patricio

2011-09-01

To investigate the molecular mechanisms of Al(3+)-stress in blueberry, a cDNA-amplified fragment length polymorphism (cDNA-AFLP) analysis was employed to identify Al-regulated genes in roots of contrasting genotypes of highbush blueberry (Brigitta, Al(3+)-resistant and Bluegold, Al(3+)-sensitive). Plants grown in hydroponic culture were treated with 0 and 100 μM Al(3+) and collected at different times over 48 h. Seventy transcript-derived fragments (TDFs) were identified as being Al(3+) responsive, 31 of which showed significant homology to genes with known or putative functions. Twelve TDFs were homologous to uncharacterized genes and 27 did not have significant matches. The expression pattern of several of the genes with known functions in other species was confirmed by quantitative relative real-time RT-PCR. Twelve genes of known or putative function were related to cellular metabolism, nine associated to stress responses and other transcription and transport facilitation processes. Genes involved in signal transduction, photosynthetic and energy processes were also identified, suggesting that a multitude of processes are implicated in the Al(3+)-stress response as reported previously for other species. The Al(3+)-stress response genes identified in this study could be involved in Al(3+)-resistance in woody plants.

Rye B chromosomes encode a functional Argonaute-like protein with in vitro slicer activities similar to its A chromosome paralog.

PubMed

Ma, Wei; Gabriel, Tobias Sebastian; Martis, Mihaela Maria; Gursinsky, Torsten; Schubert, Veit; Vrána, Jan; Doležel, Jaroslav; Grundlach, Heidrun; Altschmied, Lothar; Scholz, Uwe; Himmelbach, Axel; Behrens, Sven-Erik; Banaei-Moghaddam, Ali Mohammad; Houben, Andreas

2017-01-01

B chromosomes (Bs) are supernumerary, dispensable parts of the nuclear genome, which appear in many different species of eukaryote. So far, Bs have been considered to be genetically inert elements without any functional genes. Our comparative transcriptome analysis and the detection of active RNA polymerase II (RNAPII) in the proximity of B chromatin demonstrate that the Bs of rye (Secale cereale) contribute to the transcriptome. In total, 1954 and 1218 B-derived transcripts with an open reading frame were expressed in generative and vegetative tissues, respectively. In addition to B-derived transposable element transcripts, a high percentage of short transcripts without detectable similarity to known proteins and gene fragments from A chromosomes (As) were found, suggesting an ongoing gene erosion process. In vitro analysis of the A- and B-encoded AGO4B protein variants demonstrated that both possess RNA slicer activity. These data demonstrate unambiguously the presence of a functional AGO4B gene on Bs and that these Bs carry both functional protein coding genes and pseudogene copies. Thus, B-encoded genes may provide an additional level of gene control and complexity in combination with their related A-located genes. Hence, physiological effects, associated with the presence of Bs, may partly be explained by the activity of B-located (pseudo)genes. © 2016 IPK Gatersleben. New Phytologist © 2016 New Phytologist Trust.

Sequencing the cap-snatching repertoire of H1N1 influenza provides insight into the mechanism of viral transcription initiation

PubMed Central

Koppstein, David; Ashour, Joseph; Bartel, David P.

2015-01-01

The influenza polymerase cleaves host RNAs ∼10–13 nucleotides downstream of their 5′ ends and uses this capped fragment to prime viral mRNA synthesis. To better understand this process of cap snatching, we used high-throughput sequencing to determine the 5′ ends of A/WSN/33 (H1N1) influenza mRNAs. The sequences provided clear evidence for nascent-chain realignment during transcription initiation and revealed a strong influence of the viral template on the frequency of realignment. After accounting for the extra nucleotides inserted through realignment, analysis of the capped fragments indicated that the different viral mRNAs were each prepended with a common set of sequences and that the polymerase often cleaved host RNAs after a purine and often primed transcription on a single base pair to either the terminal or penultimate residue of the viral template. We also developed a bioinformatic approach to identify the targeted host transcripts despite limited information content within snatched fragments and found that small nuclear RNAs and small nucleolar RNAs contributed the most abundant capped leaders. These results provide insight into the mechanism of viral transcription initiation and reveal the diversity of the cap-snatched repertoire, showing that noncoding transcripts as well as mRNAs are used to make influenza mRNAs. PMID:25901029

Fragmentation of the large subunit ribosomal RNA gene in oyster mitochondrial genomes.

PubMed

Milbury, Coren A; Lee, Jung C; Cannone, Jamie J; Gaffney, Patrick M; Gutell, Robin R

2010-09-02

Discontinuous genes have been observed in bacteria, archaea, and eukaryotic nuclei, mitochondria and chloroplasts. Gene discontinuity occurs in multiple forms: the two most frequent forms result from introns that are spliced out of the RNA and the resulting exons are spliced together to form a single transcript, and fragmented gene transcripts that are not covalently attached post-transcriptionally. Within the past few years, fragmented ribosomal RNA (rRNA) genes have been discovered in bilateral metazoan mitochondria, all within a group of related oysters. In this study, we have characterized this fragmentation with comparative analysis and experimentation. We present secondary structures, modeled using comparative sequence analysis of the discontinuous mitochondrial large subunit rRNA genes of the cupped oysters C. virginica, C. gigas, and C. hongkongensis. Comparative structure models for the large subunit rRNA in each of the three oyster species are generally similar to those for other bilateral metazoans. We also used RT-PCR and analyzed ESTs to determine if the two fragmented LSU rRNAs are spliced together. The two segments are transcribed separately, and not spliced together although they still form functional rRNAs and ribosomes. Although many examples of discontinuous ribosomal genes have been documented in bacteria and archaea, as well as the nuclei, chloroplasts, and mitochondria of eukaryotes, oysters are some of the first characterized examples of fragmented bilateral animal mitochondrial rRNA genes. The secondary structures of the oyster LSU rRNA fragments have been predicted on the basis of previous comparative metazoan mitochondrial LSU rRNA structure models.

Genetic characterization of plasmid-associated triphenylmethane reductase in Listeria monocytogenes.

PubMed

Dutta, Vikrant; Elhanafi, Driss; Osborne, Jason; Martinez, Mira Rakic; Kathariou, Sophia

2014-09-01

The enzyme triphenylmethane reductase (TMR) reduces toxic triphenylmethane dyes into colorless, nontoxic derivatives, and TMR-producing microorganisms have been proposed as bioremediation tools. Analysis of the genome of Listeria monocytogenes H7858 (1998-1999 hot dog outbreak) revealed that the plasmid (pLM80) of this strain harboring a gene cassette (bcrABC) conferring resistance to benzalkonium chloride (BC) and other quaternary ammonium disinfectants also harbored a gene (tmr) highly homologous to TMR-encoding genes from diverse Gram-negative bacteria. The pLM80-associated tmr was located two genes downstream of bcrABC as part of a putative IS1216 composite transposon. To confirm the role of tmr in triphenylmethane dye detoxification, we introduced various tmr-harboring fragments of pLM80 in a pLM80-cured derivative of strain H7550, from the same outbreak as H7858, and assessed the resistance of the constructs to the triphenylmethane dyes crystal violet (CV) and malachite green. Transcriptional and subcloning data suggest that the regulation of TMR is complex. Constructs harboring fragments spanning bcrABC and tmr were CV resistant, and in such constructs tmr transcription was induced by sublethal levels of either BC or CV. However, constructs harboring only tmr and its upstream intergenic region could also confer resistance to CV, albeit at lower levels. Screening a panel of BC-resistant L. monocytogenes strains revealed that all those harboring bcrABC and adjacent pLM80 sequences, including tmr, were resistant to CV and decolorized this dye. The findings suggest a potential role of TMR as a previously unknown adaptive attribute for environmental persistence of L. monocytogenes. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

CACTA-superfamily transposable element is inserted in MYB transcription factor gene of soybean line producing variegated seeds.

PubMed

Yan, Fan; Di, Shaokang; Takahashi, Ryoji

2015-08-01

The R gene of soybean, presumably encoding a MYB transcription factor, controls seed coat color. The gene consists of multiple alleles, R (black), r-m (black spots and (or) concentric streaks on brown seed), and r (brown seed). This study was conducted to determine the structure of the MYB transcription factor gene in a near-isogenic line (NIL) having r-m allele. PCR amplification of a fragment of the candidate gene Glyma.09G235100 generated a fragment of about 1 kb in the soybean cultivar Clark, whereas a fragment of about 14 kb in addition to fragments of 1 and 1.4 kb were produced in L72-2040, a Clark 63 NIL with the r-m allele. Clark 63 is a NIL of Clark with the rxp and Rps1 alleles. A DNA fragment of 13 060 bp was inserted in the intron of Glyma.09G235100 in L72-2040. The fragment had the CACTA motif at both ends, imperfect terminal inverted repeats (TIR), inverse repetition of short sequence motifs close to the 5' and 3' ends, and a duplication of three nucleotides at the site of integration, indicating that it belongs to a CACTA-superfamily transposable element. We designated the element as Tgm11. Overall nucleotide sequence, motifs of TIR, and subterminal repeats were similar to those of Tgm1 and Tgs1, suggesting that these elements comprise a family.

SKI2 mediates degradation of RISC 5'-cleavage fragments and prevents secondary siRNA production from miRNA targets in Arabidopsis.

PubMed

Branscheid, Anja; Marchais, Antonin; Schott, Gregory; Lange, Heike; Gagliardi, Dominique; Andersen, Stig Uggerhøj; Voinnet, Olivier; Brodersen, Peter

2015-12-15

Small regulatory RNAs are fundamental in eukaryotic and prokaryotic gene regulation. In plants, an important element of post-transcriptional control is effected by 20-24 nt microRNAs (miRNAs) and short interfering RNAs (siRNAs) bound to the ARGONAUTE1 (AGO1) protein in an RNA induced silencing complex (RISC). AGO1 may cleave target mRNAs with small RNA complementarity, but the fate of the resulting cleavage fragments remains incompletely understood. Here, we show that SKI2, SKI3 and SKI8, subunits of a cytoplasmic cofactor of the RNA exosome, are required for degradation of RISC 5', but not 3'-cleavage fragments in Arabidopsis. In the absence of SKI2 activity, many miRNA targets produce siRNAs via the RNA-dependent RNA polymerase 6 (RDR6) pathway. These siRNAs are low-abundant, and map close to the cleavage site. In most cases, siRNAs were produced 5' to the cleavage site, but several examples of 3'-spreading were also identified. These observations suggest that siRNAs do not simply derive from RDR6 action on stable 5'-cleavage fragments and hence that SKI2 has a direct role in limiting secondary siRNA production in addition to its function in mediating degradation of 5'-cleavage fragments. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structural and Antimicrobial Features of Peptides Related to Myticin C, a Special Defense Molecule from the Mediterranean Mussel Mytilus galloprovincialis.

PubMed

Domeneghetti, Stefania; Franzoi, Marco; Damiano, Nunzio; Norante, Rosa; El Halfawy, Nancy M; Mammi, Stefano; Marin, Oriano; Bellanda, Massimo; Venier, Paola

2015-10-28

Mussels (Mytilus spp.) have a large repertoire of cysteine-stabilized α,β peptides, and myticin C (MytC) was identified in some hundreds of transcript variants after in vivo immunostimulation. Using a sequence expressed in Italian mussels, we computed the MytC structure and synthesized the mature MytC and related peptide fragments (some of them also prepared in oxidized form) to accurately assess their antibacterial and antifungal activity. Only when tested at pH 5 was the reduced MytC as well as reduced and oxidized fragments including structural β-elements able to inhibit Gram-positive and -negative bacteria (MIC ranges of 4-32 and 8-32 μM, respectively). Such fragments caused selective Escherichia coli killing (MBC of 8-32 μM) but scarcely inhibited two fungal strains. In detail, the antimicrobial β-hairpin MytC[19-40]SOX caused membrane-disrupting effects in E. coli despite its partially ordered conformation in membrane-mimetic environments. In perspective, MytC-derived peptides could be employed to protect acidic mucosal tissues, in cosmetic and food products, and, possibly, as adjuvants in aquaculture.

Differential gene expression for Curvularia eragrostidis pathogenic incidence in crabgrass (Digitaria sanguinalis) revealed by cDNA-AFLP analysis.

PubMed

Wang, Jianshu; Wang, Xuemin; Yuan, Bohua; Qiang, Sheng

2013-01-01

Gene expression profiles of Digitaria sanguinalis infected by Curvularia eragrostidis strain QZ-2000 at two concentrations of conidia and two dew durations were analyzed by cDNA amplified fragment length polymorphisms (cDNA-AFLP). Inoculum strength was more determinant of gene expression than dew duration. A total of 256 primer combinations were used for selective amplification and 1214 transcript-derived fragments (TDFs) were selected for their differential expression. Of these, 518 up-regulated differentially expressed TDFs were identified. Forty-six differential cDNA fragments were chosen to be cloned and 35 of them were successfully cloned and sequenced, of which 25 were homologous to genes of known function according to the GenBank database. Only 6 genes were up-regulated in Curvularia eragrostidis-inoculated D. sanguinalis, with functions involved in signal transduction, energy metabolism, cell growth and development, stress responses, abscisic acid biosynthesis and response. It appears that a few pathways may be important parts of the pathogenic strategy of C. eragrostidis strain QZ-2000 on D. sanguinalis. Our study provides the fundamentals to further study the pathogenic mechanism, screen for optimal C. eragrostidis strains as potential mycoherbicide and apply this product to control D. sanguinalis.

Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

PubMed

Szymanski, Maciej; Karlowski, Wojciech M

2016-01-01

In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

The Fragmented Mitochondrial Ribosomal RNAs of Plasmodium falciparum

PubMed Central

Feagin, Jean E.; Harrell, Maria Isabel; Lee, Jung C.; Coe, Kevin J.; Sands, Bryan H.; Cannone, Jamie J.; Tami, Germaine; Schnare, Murray N.; Gutell, Robin R.

2012-01-01

Background The mitochondrial genome in the human malaria parasite Plasmodium falciparum is most unusual. Over half the genome is composed of the genes for three classic mitochondrial proteins: cytochrome oxidase subunits I and III and apocytochrome b. The remainder encodes numerous small RNAs, ranging in size from 23 to 190 nt. Previous analysis revealed that some of these transcripts have significant sequence identity with highly conserved regions of large and small subunit rRNAs, and can form the expected secondary structures. However, these rRNA fragments are not encoded in linear order; instead, they are intermixed with one another and the protein coding genes, and are coded on both strands of the genome. This unorthodox arrangement hindered the identification of transcripts corresponding to other regions of rRNA that are highly conserved and/or are known to participate directly in protein synthesis. Principal Findings The identification of 14 additional small mitochondrial transcripts from P. falcipaurm and the assignment of 27 small RNAs (12 SSU RNAs totaling 804 nt, 15 LSU RNAs totaling 1233 nt) to specific regions of rRNA are supported by multiple lines of evidence. The regions now represented are highly similar to those of the small but contiguous mitochondrial rRNAs of Caenorhabditis elegans. The P. falciparum rRNA fragments cluster on the interfaces of the two ribosomal subunits in the three-dimensional structure of the ribosome. Significance All of the rRNA fragments are now presumed to have been identified with experimental methods, and nearly all of these have been mapped onto the SSU and LSU rRNAs. Conversely, all regions of the rRNAs that are known to be directly associated with protein synthesis have been identified in the P. falciparum mitochondrial genome and RNA transcripts. The fragmentation of the rRNA in the P. falciparum mitochondrion is the most extreme example of any rRNA fragmentation discovered. PMID:22761677

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Yirui; Scheuermann, Thomas H.; Partch, Carrie L.

The hypoxia-inducible factor complex (HIF-α·aryl hydrocarbon receptor nuclear translocator (ARNT)) requires association with several transcription coactivators for a successful cellular response to hypoxic stress. In addition to the conventional global transcription coactivator CREB-binding protein/p300 (CBP/p300) that binds to the HIF-α transactivation domain, a new group of transcription coactivators called the coiled-coil coactivators (CCCs) interact directly with the second PER-ARNT-SIM (PAS) domain of ARNT (ARNT PAS-B). These less studied transcription coactivators play essential roles in the HIF-dependent hypoxia response, and CCC misregulation is associated with several forms of cancer. To better understand CCC protein recruitment by the heterodimeric HIF transcription factor,more » we used x-ray crystallography, NMR spectroscopy, and biochemical methods to investigate the structure of the ARNT PAS-B domain in complex with the C-terminal fragment of a coiled-coil coactivator protein, transforming acidic coiled-coil coactivator 3 (TACC3). We found that the HIF-2α PAS-B domain also directly interacts with TACC3, motivating an NMR data-derived model suggesting a means by which TACC3 could form a ternary complex with HIF-2α PAS-B and ARNT PAS-B via β-sheet/coiled-coil interactions. Furthermore, these findings suggest that TACC3 could be recruited as a bridge to cooperatively mediate between the HIF-2α PAS-B·ARNT PAS-B complex, thereby participating more directly in HIF-dependent gene transcription than previously anticipated.« less

Dynamics in the tomato root transcriptome on infection with the potato cyst nematode Globodera rostochiensis.

PubMed

Swiecicka, Magdalena; Filipecki, Marcin; Lont, Dieuwertje; Van Vliet, Joke; Qin, Ling; Goverse, Aska; Bakker, Jaap; Helder, Johannes

2009-07-01

Plant parasitic nematodes infect roots and trigger the formation of specialized feeding sites by substantial reprogramming of the developmental process of root cells. In this article, we describe the dynamic changes in the tomato root transcriptome during early interactions with the potato cyst nematode Globodera rostochiensis. Using amplified fragment length polymorphism-based mRNA fingerprinting (cDNA-AFLP), we monitored 17 600 transcript-derived fragments (TDFs) in infected and uninfected tomato roots, 1-14 days after inoculation with nematode larvae. Six hundred and twenty-four TDFs (3.5%) showed significant differential expression on nematode infection. We employed GenEST, a computer program which links gene expression profiles generated by cDNA-AFLP and databases of cDNA sequences, to identify 135 tomato sequences. These sequences were grouped into eight functional categories based on the presence of genes involved in hormone regulation, plant pathogen defence response, cell cycle and cytoskeleton regulation, cell wall modification, cellular signalling, transcriptional regulation, primary metabolism and allocation. The presence of unclassified genes was also taken into consideration. This article describes the responsiveness of numerous tomato genes hitherto uncharacterized during infection with endoparasitic cyst nematodes. The analysis of transcriptome profiles allowed the sequential order of expression to be dissected for many groups of genes and the genes to be connected with the biological processes involved in compatible interactions between the plant and nematode.

Distinct colonization patterns and cDNA-AFLP transcriptome profiles in compatible and incompatible interactions between melon and different races of Fusarium oxysporum f. sp. melonis

PubMed Central

2011-01-01

Background Fusarium oxysporum f. sp. melonis Snyd. & Hans. (FOM) causes Fusarium wilt, the most important infectious disease of melon (Cucumis melo L.). The four known races of this pathogen can be distinguished only by infection on appropriate cultivars. No molecular tools are available that can discriminate among the races, and the molecular basis of compatibility and disease progression are poorly understood. Resistance to races 1 and 2 is controlled by a single dominant gene, whereas only partial polygenic resistance to race 1,2 has been described. We carried out a large-scale cDNA-AFLP analysis to identify host genes potentially related to resistance and susceptibility as well as fungal genes associated with the infection process. At the same time, a systematic reisolation procedure on infected stems allowed us to monitor fungal colonization in compatible and incompatible host-pathogen combinations. Results Melon plants (cv. Charentais Fom-2), which are susceptible to race 1,2 and resistant to race 1, were artificially infected with a race 1 strain of FOM or one of two race 1,2 w strains. Host colonization of stems was assessed at 1, 2, 4, 8, 14, 16, 18 and 21 days post inoculation (dpi), and the fungus was reisolated from infected plants. Markedly different colonization patterns were observed in compatible and incompatible host-pathogen combinations. Five time points from the symptomless early stage (2 dpi) to obvious wilting symptoms (21 dpi) were considered for cDNA-AFLP analysis. After successful sequencing of 627 transcript-derived fragments (TDFs) differentially expressed in infected plants, homology searching retrieved 305 melon transcripts, 195 FOM transcripts expressed in planta and 127 orphan TDFs. RNA samples from FOM colonies of the three strains grown in vitro were also included in the analysis to facilitate the detection of in planta-specific transcripts and to identify TDFs differentially expressed among races/strains. Conclusion Our data suggest that resistance against FOM in melon involves only limited transcriptional changes, and that wilting symptoms could derive, at least partially, from an active plant response. We discuss the pathogen-derived transcripts expressed in planta during the infection process and potentially related to virulence functions, as well as transcripts that are differentially expressed between the two FOM races grown in vitro. These transcripts provide candidate sequences that can be further tested for their ability to distinguish between races. Sequence data from this article have been deposited in GenBank, Accession Numbers: HO867279-HO867981. PMID:21338485

Intact Pneumococci Trigger Transcription of Interferon-Related Genes in Human Monocytes, while Fragmented, Autolyzed Bacteria Subvert This Response

PubMed Central

Nordén, Rickard; Martner, Anna; Samuelsson, Ebba; Hynsjö, Lars; Wold, Agnes E.

2017-01-01

ABSTRACT A peculiar trait of pneumococci (Streptococcus pneumoniae) is their propensity to undergo spontaneous lysis during stationary growth due to activation of the enzyme autolysin (LytA), which fragments the peptidoglycan cell wall. The fragments that are generated upon autolysis impair phagocytosis and reduce production of interleukin-12 (IL-12) and gamma interferon (IFN-γ) by human leukocytes in response to intact pneumococci, thereby impeding crucial host defenses. The objective was to identify additional monocyte genes whose transcription is induced by intact pneumococci and subverted by autolyzed bacteria. Monocytes were isolated from healthy blood donors and stimulated for 3 h with UV-inactivated S. pneumoniae (Rx1PLY− LytA+ strain), which is capable of autolyzing, its LytA− isogenic autolysin-deficient mutant, or a mixture of the two (containing twice the initial bacterial concentration). Gene expression was assessed by Illumina microarray, and selected findings were confirmed by reverse transcription-quantitative real-time PCR (RT-qPCR), enzyme-linked immunosorbent assay (ELISA), and flow cytometry. In all, we identified 121 genes that were upregulated to a significantly higher degree by intact than autolyzed pneumococci. These included IFNB1 and a large set of interferon-induced genes, such as IFIT3, RSAD2, CFCL1, and CXCL10 genes, as well as IL12B and CD40 genes. RT-qPCR revealed that transcription of these genes in response to intact pneumococci diminished when autolyzed pneumococci were admixed and that this pattern was independent of pneumolysin. Thus, transcription of interferon-related genes is triggered by intact pneumococci and subverted by fragments generated by spontaneous bacterial autolysis. We suggest that interferon-related pathways are important for elimination of pneumococci and that autolysis contributes to virulence by extinguishing these pathways. PMID:28223347

Antibiosis functions during interactions of Trichoderma afroharzianum and Trichoderma gamsii with plant pathogenic Rhizoctonia and Pythium.

PubMed

Zhang, Xinjian; Harvey, Paul R; Stummer, Belinda E; Warren, Rosemary A; Zhang, Guangzhi; Guo, Kai; Li, Jishun; Yang, Hetong

2015-09-01

Trichoderma afroharzianum is one of the best characterized Trichoderma species, and strains have been utilized as plant disease suppressive inoculants. In contrast, Trichoderma gamsii has only recently been described, and there is limited knowledge of its disease suppressive efficacies. Comparative studies of changes in gene expression during interactions of these species with their target plant pathogens will provide fundamental information on pathogen antibiosis functions. In the present study, we used complementary DNA amplified fragment length polymorphism (cDNA-AFLP) analysis to investigate changes in transcript profiling of T. afroharzianum strain LTR-2 and T. gamsii strain Tk7a during in vitro interactions with plant pathogenic Rhizoctonia solani and Pythium irregulare. Considerable differences were resolved in the overall expression profiles of strains LTR-2 and Tk7a when challenged with either plant pathogen. In strain LTR-2, previously reported mycoparasitism-related genes such as chitinase, polyketide synthase, and non-ribosomal peptide synthetase were found to be differentially expressed. This was not so for strain Tk7a, with the only previously reported antibiosis-associated genes being small secreted cysteine-rich proteins. Although only one differentially expressed gene was common to both strains LTR-2 and Tk7a, numerous genes reportedly associated with pathogen antibiosis processes were differentially expressed in both strains, including degradative enzymes and membrane transport proteins. A number of novel potential antibiosis-related transcripts were found from strains LTR-2 and Tk7a and remain to be identified. The expression kinetics of 20 Trichoderma (10 from strain LTR-2, 10 from strain Tk7a) transcript-derived fragments (TDFs) were quantified by quantitative reverse transcription PCR (RT-qPCR) at pre- and post-mycelia contact stages of Trichoderma-prey interactions, thereby confirming differential gene expression. Collectively, this research is providing information to elucidate the antibiosis mechanisms and disease suppressive activities of T. afroharzianum and T. gamsii against soilborne fungal and oomycete plant pathogens.

Promoter mapping of the mouse Tcp-10bt gene in transgenic mice identifies essential male germ cell regulatory sequences.

PubMed

Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C

1996-03-01

Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

AFLP-based transcript profiling for cassava genome-wide expression analysis in the onset of storage root formation.

PubMed

Sojikul, Punchapat; Kongsawadworakul, Panida; Viboonjun, Unchera; Thaiprasit, Jittrawan; Intawong, Burapat; Narangajavana, Jarunya; Svasti, Mom Rajawong Jisnuson

2010-10-01

Cassava (Manihot esculenta Crantz) is a root crop that accumulates large quantities of starch, and it is an important source of carbohydrate. Study on gene expressions during storage root development provides important information on storage root formation and starch accumulation as well as unlock new traits for improving of starch yield. cDNA-Amplified Fragment Length Polymorphism (AFLP) was used to compare gene expression profiles in fibrous and storage roots of cassava cultivar Kasetsart 50. Total of 155 differentially expressed transcript-derived fragments with undetectable or low expression in leaves were characterized and classified into 11 groups regarding to their functions. The four major groups were no similarity (20%), hypothetical or unknown proteins (17%), cellular metabolism and biosynthesis (17%) and cellular communication and signaling (14%). Interestingly, sulfite reductase (MeKD82), calcium-dependent protein kinase (CDPK) (MeKD83), ent-kaurene synthase (KS) (MeKD106) and hexose transporter (HT) (MeKD154) showed root-specific expression patterns. This finding is consistent with previously reported genes involved in the initiation of potato tuber. Semi-quantitative reverse transcription polymerase chain reaction of early-developed root samples confirmed that those four genes exhibited significant expression with similar pattern in the storage root initiation and early developmental stages. We proposed that KS and HT may involve in transient induction of CDPK expression, which may play an important role in the signaling pathway of storage root initiation. Sulfite reductase, on the other hand, may involve in storage root development by facilitating sulfur-containing protein biosynthesis or detoxifying the cyanogenic glucoside content through aspartate biosynthesis. Copyright © Physiologia Plantarum 2010.

Profiling and Quantifying Differential Gene Transcription Provide Insights into Ganoderic Acid Biosynthesis in Ganoderma lucidum in Response to Methyl Jasmonate

PubMed Central

Shi, Liang; Mu, Da-Shuai; Jiang, Ai-Liang; Han, Qin; Zhao, Ming-Wen

2013-01-01

Ganoderma lucidum is a mushroom with traditional medicinal properties that has been widely used in China and other countries in Eastern Asia. Ganoderic acids (GA) produced by G. lucidum exhibit important pharmacological activities. Previous studies have demonstrated that methyl jasmonate (MeJA) is a potent inducer of GA biosynthesis and the expression of genes involved in the GA biosynthesis pathway in G. lucidum. To further explore the mechanism of GA biosynthesis, cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) was used to identify genes that are differentially expressed in response to MeJA. Using 64 primer combinations, over 3910 transcriptionally derived fragments (TDFs) were obtained. Reliable sequence data were obtained for 390 of 458 selected TDFs. Ninety of these TDFs were annotated with known functions through BLASTX searching the GenBank database, and 12 annotated TDFs were assigned into secondary metabolic pathways by searching the KEGGPATHWAY database. Twenty-five TDFs were selected for qRT-PCR analysis to confirm the expression patterns observed with cDNA-AFLP. The qRT-PCR results were consistent with the altered patterns of gene expression revealed by the cDNA-AFLP technique. Additionally, the transcript levels of 10 genes were measured at the mycelium, primordia, and fruiting body developmental stages of G. lucidum. The greatest expression levels were reached during primordia for all of the genes except cytochrome b2 reached its highest expression level in the mycelium stage. This study not only identifies new candidate genes involved in the regulation of GA biosynthesis but also provides further insight into MeJA-induced gene expression and secondary metabolic response in G. lucidum. PMID:23762280

In vitro transcription of a cloned mouse ribosomal RNA gene.

PubMed Central

Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M

1981-01-01

An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446

Identification of genes differentially expressed during interaction of Mexican lime tree infected with "Candidatus Phytoplasma aurantifolia"

PubMed Central

2011-01-01

Background "Candidatus Phytoplasma aurantifolia", is the causative agent of witches' broom disease in Mexican lime trees (Citrus aurantifolia L.), and is responsible for major losses of Mexican lime trees in Southern Iran and Oman. The pathogen is strictly biotrophic, and thus is completely dependent on living host cells for its survival. The molecular basis of compatibility and disease development in this system is poorly understood. Therefore, we have applied a cDNA- amplified fragment length polymorphism (AFLP) approach to analyze gene expression in Mexican lime trees infected by "Ca. Phytoplasma aurantifolia". Results We carried out cDNA-AFLP analysis on grafted infected Mexican lime trees of the susceptible cultivar at the representative symptoms stage. Selective amplifications with 43 primer combinations allowed the visualisation of 55 transcript-derived fragments that were expressed differentially between infected and non-infected leaves. We sequenced 51 fragments, 36 of which were identified as lime tree transcripts after homology searching. Of the 36 genes, 70.5% were down-regulated during infection and could be classified into various functional groups. We showed that Mexican lime tree genes that were homologous to known resistance genes tended to be repressed in response to infection. These included the genes for modifier of snc1 and autophagy protein 5. Furthermore, down-regulation of genes involved in metabolism, transcription, transport and cytoskeleton was observed, which included the genes for formin, importin β 3, transducin, L-asparaginase, glycerophosphoryl diester phosphodiesterase, and RNA polymerase β. In contrast, genes that encoded a proline-rich protein, ubiquitin-protein ligase, phosphatidyl glycerol specific phospholipase C-like, and serine/threonine-protein kinase were up-regulated during the infection. Conclusion The present study identifies a number of candidate genes that might be involved in the interaction of Mexican lime trees with "Candidatus Phytoplasma aurantifolia". These results should help to elucidate the molecular basis of the infection process and to identify genes that could be targeted to increase plant resistance and inhibit the growth and reproduction of the pathogen. PMID:21194490

Identification and characterization of Kaposi's sarcoma-associated herpesvirus open reading frame 11 promotor activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Lei

2008-01-01

Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less

A maize death acid, 10-oxo-11-phytoenoic acid, is the predominant cyclopentenone signal present during multiple stress and developmental conditions

PubMed Central

Christensen, Shawn A.; Huffaker, Alisa; Hunter, Charles T.; Alborn, Hans T.; Schmelz, Eric A.

2016-01-01

abstract Recently we investigated the function of the 9-lipoxygenase (LOX) derived cyclopentenones 10-oxo-11-phytoenoic acid (10-OPEA) and 10-oxo-11,15-phytodienoic acid (10-OPDA) and identified their C-14 and C-12 derivatives. 10-OPEA accumulation is elicited by fungal and insect attack and acts as a strong inhibitor of microbial and herbivore growth. Although structurally similar, comparative analyses between 10-OPEA and its 13-LOX analog 12-oxo-phytodienoic acid (12-OPDA) demonstrate specificity in transcript accumulation linked to detoxification, secondary metabolism, jasmonate regulation, and protease inhibition. As a potent cell death signal, 10-OPEA activates cysteine protease activity leading to ion leakage and apoptotic-like DNA fragmentation. In this study we further elucidate the distribution, abundance, and functional roles of 10-OPEA, 10-OPDA, and 12-OPDA, in diverse organs under pathogen- and insect-related stress. PMID:26669723

A hairpin within YAP mRNA 3′UTR functions in regulation at post-transcription level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Yuen; Wang, Yuan; Feng, Jinyan

2015-04-03

The central dogma of gene expression is that DNA is transcribed into messenger RNAs, which in turn serve as the template for protein synthesis. Recently, it has been reported that mRNAs display regulatory roles that rely on their ability to compete for microRNA binding, independent of their protein-coding function. However, the regulatory mechanism of mRNAs remains poorly understood. Here, we report that a hairpin within YAP mRNA 3′untranslated region (3′UTR) functions in regulation at post-transcription level through generating endogenous siRNAs (esiRNAs). Bioinformatics analysis for secondary structure showed that YAP mRNA displayed a hairpin structure (termed standard hairpin, S-hairpin) within itsmore » 3′UTR. Surprisingly, we observed that the overexpression of S-hairpin derived from YAP 3′UTR (YAP-sh) increased the luciferase reporter activities of transcriptional factor NF-κB and AP-1 in 293T cells. Moreover, we identified that a fragment from YAP-sh, an esiRNA, was able to target mRNA 3′UTR of NF2 (a member of Hippo-signaling pathway) and YAP mRNA 3′UTR itself in hepatoma cells. Thus, we conclude that the YAP-sh within YAP mRNA 3′UTR may serve as a novel regulatory element, which functions in regulation at post-transcription level. Our finding provides new insights into the mechanism of mRNAs in regulatory function. - Highlights: • An S-hairpin within YAP mRNA 3′UTR possesses regulatory function. • YAP-sh acts as a regulatory element for YAP at post-transcription level. • YAP-sh-3p20, an esiRNA derived from YAP-sh, targets mRNAs of YAP and NF2. • YAP-sh-3p20 depresses the proliferation of HepG2 cells in vitro.« less

Dexamethasone Enhances 1α,25-Dihydroxyvitamin D3 Effects by Increasing Vitamin D Receptor Transcription*

PubMed Central

Hidalgo, Alejandro A.; Deeb, Kristin K.; Pike, J. Wesley; Johnson, Candace S.; Trump, Donald L.

2011-01-01

Calcitriol, the active form of vitamin D, in combination with the glucocorticoid dexamethasone (Dex) has been shown to increase the antitumor effects of calcitriol in squamous cell carcinoma. In this study we found that pretreatment with Dex potentiates calcitriol effects by inhibiting cell growth and increasing vitamin D receptor (VDR) and VDR-mediated transcription. Treatment with actinomycin D inhibits Vdr mRNA synthesis, indicating that Dex regulates VDR expression at transcriptional level. Real time PCR shows that treatment with Dex increases Vdr transcripts in a time- and a dose-dependent manner, indicating that Dex directly regulates expression of Vdr. RU486, an inhibitor of glucocorticoids, inhibits Dex-induced Vdr expression. In addition, the silencing of glucocorticoid receptor (GR) abolishes the induction of Vdr by Dex, indicating that Dex increases Vdr transcripts in a GR-dependent manner. A fragment located 5.2 kb upstream of Vdr transcription start site containing two putative glucocorticoid response elements (GREs) was evaluated using a luciferase-based reporter assay. Treatment with 100 nm Dex induces transcription of luciferase driven by the fragment. Deletion of the GRE distal to transcription start site was sufficient to abolish Dex induction of luciferase. Also, chromatin immunoprecipitation reveals recruitment of GR to distal GRE with Dex treatment. We conclude that Dex increases VDR and vitamin D effects by increasing Vdr de novo transcription in a GR-dependent manner. PMID:21868377

Dual targeting of gene delivery by genetic modification of adenovirus serotype 5 fibers and cell-selective transcriptional control.

PubMed

Work, L M; Ritchie, N; Nicklin, S A; Reynolds, P N; Baker, A H

2004-08-01

Adenovirus (Ad)-mediated gene delivery is a promising approach for genetic manipulation of the vasculature and is being used in both preclinical models and clinical trials. However, safety concerns relating to infection of nontarget tissue and the poor infectivity of vascular cells compared to other cell types necessitates Ad vector refinement. Here, we combine a transductional targeting approach to improve vascular cell infectivity through RGD peptide insertion into adenovirus fibers, combined with transcriptional targeting to endothelial cells using a approximately 1 kb fragment of the fms-like tyrosine kinase receptor-1 (FLT-1) promoter. Single- and double-modified vectors were characterized in human cell lines that either support or have silenced FLT-1 expression. In rat hepatocytes and endothelial cells, the double modification substantially shifted transduction profiles toward vascular endothelial cells. Furthermore, in intact aortae derived from spontaneously hypertensive rats that display enhanced alphav integrin expression on dysfunctional endothelium, enhanced levels of transduction were observed using the double-modified vector but not in aortae derived from normotensive control rats. Our data indicate that Ad-mediated transduction can be beneficially modified in vitro and in vivo by combining fiber modification and a cell-selective promoter within a single-component vector system.

Coiled-coil coactivators play a structural role mediating interactions in hypoxia-inducible factor heterodimerization

DOE PAGES

Guo, Yirui; Scheuermann, Thomas H.; Partch, Carrie L.; ...

2015-01-27

The hypoxia-inducible factor complex (HIF-α·aryl hydrocarbon receptor nuclear translocator (ARNT)) requires association with several transcription coactivators for a successful cellular response to hypoxic stress. In addition to the conventional global transcription coactivator CREB-binding protein/p300 (CBP/p300) that binds to the HIF-α transactivation domain, a new group of transcription coactivators called the coiled-coil coactivators (CCCs) interact directly with the second PER-ARNT-SIM (PAS) domain of ARNT (ARNT PAS-B). These less studied transcription coactivators play essential roles in the HIF-dependent hypoxia response, and CCC misregulation is associated with several forms of cancer. To better understand CCC protein recruitment by the heterodimeric HIF transcription factor,more » we used x-ray crystallography, NMR spectroscopy, and biochemical methods to investigate the structure of the ARNT PAS-B domain in complex with the C-terminal fragment of a coiled-coil coactivator protein, transforming acidic coiled-coil coactivator 3 (TACC3). We found that the HIF-2α PAS-B domain also directly interacts with TACC3, motivating an NMR data-derived model suggesting a means by which TACC3 could form a ternary complex with HIF-2α PAS-B and ARNT PAS-B via β-sheet/coiled-coil interactions. Furthermore, these findings suggest that TACC3 could be recruited as a bridge to cooperatively mediate between the HIF-2α PAS-B·ARNT PAS-B complex, thereby participating more directly in HIF-dependent gene transcription than previously anticipated.« less

Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, W.M.; Sylvester, J.E.

1994-09-01

In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less

Localization of TFIIB binding regions using serial analysis of chromatin occupancy

PubMed Central

Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon

2007-01-01

Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859

Phytoremediation of chromium using Salix species: cloning ESTs and candidate genes involved in the Cr response.

PubMed

Quaggiotti, Silvia; Barcaccia, Gianni; Schiavon, Michela; Nicolé, Silvia; Galla, Giulio; Rossignolo, Virginia; Soattin, Marica; Malagoli, Mario

2007-11-01

In this research a differential display based on the detection of cDNA-AFLP markers was used to identify candidate genes potentially involved in the regulation of the response to chromium in four different willow species (Salix alba, Salix eleagnos, Salix fragilis and Salix matsudana) chosen on the basis of their suitability in phytoremediation techniques. Our approach enabled the assay of a large set of mRNA-related fragments and increased the reliability of amplification-based transcriptome analysis. The vast majority of transcript-derived fragments were shared among samples within species and thus attributable to constitutively expressed genes. However, a number of differentially expressed mRNAs were scored in each species and a total of 68 transcripts displaying an altered expression in response to Cr were isolated and sequenced. Public database querying revealed that 44.1% and 4.4% of the cloned ESTs score significant similarity with genes encoding proteins having known or putative function, or with genes coding for unknown proteins, respectively, whereas the remaining 51.5% did not retrieve any homology. Semi-quantitative RT-PCR analysis of seven candidate genes fully confirmed the expression patterns obtained by cDNA-AFLP. Our results indicate the existence of common mechanisms of gene regulation in response to Cr, pathogen attack and senescence-mediated programmed cell death, and suggest a role for the genes isolated in the cross-talk of the signaling pathways governing the adaptation to biotic and abiotic stresses.

Whole-genome expression analysis of mammalian-wide interspersed repeat elements in human cell lines.

PubMed

Carnevali, Davide; Conti, Anastasia; Pellegrini, Matteo; Dieci, Giorgio

2017-02-01

With more than 500,000 copies, mammalian-wide interspersed repeats (MIRs), a sub-group of SINEs, represent ∼2.5% of the human genome and one of the most numerous family of potential targets for the RNA polymerase (Pol) III transcription machinery. Since MIR elements ceased to amplify ∼130 myr ago, previous studies primarily focused on their genomic impact, while the issue of their expression has not been extensively addressed. We applied a dedicated bioinformatic pipeline to ENCODE RNA-Seq datasets of seven human cell lines and, for the first time, we were able to define the Pol III-driven MIR transcriptome at single-locus resolution. While the majority of Pol III-transcribed MIR elements are cell-specific, we discovered a small set of ubiquitously transcribed MIRs mapping within Pol II-transcribed genes in antisense orientation that could influence the expression of the overlapping gene. We also identified novel Pol III-transcribed ncRNAs, deriving from transcription of annotated MIR fragments flanked by unique MIR-unrelated sequences, and confirmed the role of Pol III-specific internal promoter elements in MIR transcription. Besides demonstrating widespread transcription at these retrotranspositionally inactive elements in human cells, the ability to profile MIR expression at single-locus resolution will facilitate their study in different cell types and states including pathological alterations. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Calcium Handling by Endoplasmic Reticulum and Mitochondria in a Cell Model of Huntington’s Disease

PubMed Central

De Mario, Agnese; Scarlatti, Chiara; Costiniti, Veronica; Primerano, Simona; Lopreiato, Raffaele; Calì, Tito; Brini, Marisa; Giacomello, Marta; Carafoli, Ernesto

2016-01-01

Huntington disease (HD) is caused by the CAG (Q) expansion in exon 1 of the IT15 gene encoding a polyglutamine (poly-Q) stretch of the Huntingtin protein (Htt). In the wild type protein, the repeats specify a stretch of up 34 Q in the N-terminal portion of Htt. In the pathological protein (mHtt) the poly-Q tract is longer. Proteolytic cleavage of the protein liberates an N-terminal fragment containing the expanded poly-Q tract becomes harmful to cells, in particular to striatal neurons. The fragments cause the transcriptional dysfunction of genes that are essential for neuronal survival. Htt, however, could also have non-transcriptional effects, e.g. it could directly alter Ca2+ homeostasis and/or mitochondrial morphology and function. Ca2+ dyshomeostasis and mitochondrial dysfunction are considered important in the molecular aetiology of the disease. Here we have analyzed the effect of the overexpression of Htt fragments (18Q, wild type form, wtHtt and 150Q mutated form, mHtt) on Ca2+ homeostasis in striatal neuronal precursor cells (Q7/7). We have found that the transient overexpression of the Htt fragments increases Ca2+ transients in the mitochondria of cells stimulated with Ca2+-mobilizing agonists. The bulk Ca2+ transients in the cytosol were unaffected, but the Ca2+ content of the endoplasmic reticulum was significantly decreased in the case of mHtt expression. To rule out possible transcriptional effects due to the presence of mHtt, we have measured the mRNA level of a subunit of the respiratory chain complex II, whose expression is commonly altered in many HD models. No effects on the mRNA level was found suggesting that, in our experimental condition, transcriptional action of Htt is not occurring and that the effects on Ca2+ homeostasis were dependent to non-transcriptional mechanisms. PMID:26819834

Calcium Handling by Endoplasmic Reticulum and Mitochondria in a Cell Model of Huntington's Disease.

PubMed

De Mario, Agnese; Scarlatti, Chiara; Costiniti, Veronica; Primerano, Simona; Lopreiato, Raffaele; Calì, Tito; Brini, Marisa; Giacomello, Marta; Carafoli, Ernesto

2016-01-06

Huntington disease (HD) is caused by the CAG (Q) expansion in exon 1 of the IT15 gene encoding a polyglutamine (poly-Q) stretch of the Huntingtin protein (Htt). In the wild type protein, the repeats specify a stretch of up 34 Q in the N-terminal portion of Htt. In the pathological protein (mHtt) the poly-Q tract is longer. Proteolytic cleavage of the protein liberates an N-terminal fragment containing the expanded poly-Q tract becomes harmful to cells, in particular to striatal neurons. The fragments cause the transcriptional dysfunction of genes that are essential for neuronal survival. Htt, however, could also have non-transcriptional effects, e.g. it could directly alter Ca2+ homeostasis and/or mitochondrial morphology and function. Ca2+ dyshomeostasis and mitochondrial dysfunction are considered important in the molecular aetiology of the disease. Here we have analyzed the effect of the overexpression of Htt fragments (18Q, wild type form, wtHtt and 150Q mutated form, mHtt) on Ca2+ homeostasis in striatal neuronal precursor cells (Q7/7). We have found that the transient overexpression of the Htt fragments increases Ca2+ transients in the mitochondria of cells stimulated with Ca2+-mobilizing agonists. The bulk Ca2+ transients in the cytosol were unaffected, but the Ca2+ content of the endoplasmic reticulum was significantly decreased in the case of mHtt expression. To rule out possible transcriptional effects due to the presence of mHtt, we have measured the mRNA level of a subunit of the respiratory chain complex II, whose expression is commonly altered in many HD models. No effects on the mRNA level was found suggesting that, in our experimental condition, transcriptional action of Htt is not occurring and that the effects on Ca2+ homeostasis were dependent to non-transcriptional mechanisms.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Expression of growth hormone and its transcription factor, Pit-1, in early bovine development.

PubMed

Joudrey, E M; Lechniak, D; Petrik, J; King, W A

2003-03-01

During bovine embryogenesis, bovine growth hormone (bGH) contributes to proliferation, differentiation, and modulation of embryo metabolism. Pituitary-specific transcription factor-1 (Pit-1) is a transcription factor that binds to promoters of GH, prolactin (PRL), and thyroid-stimulating hormone-beta (TSHbeta) encoding genes. A polymorphism in the fifth exon of the bGH gene resulting in a leucine (Leu) to valine (Val) substitution provides an Alu I restriction site when the Leu allele is present. To determine the onset of embryonic expression of the bGH gene, oocytes derived from ovaries homozygous for Leu alleles were fertilized in vitro with spermatozoa obtained from a Val homozygote. For each developmental stage examined, three separate pools of embryos composed of approximately 100 cell samples underwent RNA isolation, reverse transcription to cDNA, and amplification by nested PCR (nPCR). Bovine GH gene transcripts were identified at 2- to 4-cell (n = 162), 8- to 16-cell (n = 73), morulae (n = 51), and blastocyst (n = 15) stages. Likewise, transcripts for Pit-1 were detected at 2-cell (n = 125), 4-cell (n = 114), 8-cell (n = 56), 12-to-32-cell (n = 32), morulae (n = 68), and blastocyst (n = 14) stages. After digestion with Alu1, bGH cDNA was genotyped by restriction fragment length polymorphism (RFLP) analysis. Bovine GH mRNA was present in all pools of stages examined. Both Leu and Val alleles (maternal and paternal) were only detected in pools of embryos that had reached 8- to 16-cell stage. Results suggest that transcription of the bGH gene begins at the 8- to 16-cell stage in bovine embryos, possibly under control of the transcription factor, Pit-1, and that RFLP analysis of the bGH gene can be used to determine parental origin of transcripts in early embryonic development. Copyright 2003 Wiley-Liss, Inc.

The transcription factor CCAAT-binding factor CBF/NF-Y regulates the proximal promoter activity in the human alpha 1(XI) collagen gene (COL11A1).

PubMed

Matsuo, Noritaka; Yu-Hua, Wang; Sumiyoshi, Hideaki; Sakata-Takatani, Keiko; Nagato, Hitoshi; Sakai, Kumiko; Sakurai, Mami; Yoshioka, Hidekatsu

2003-08-29

We have characterized the proximal promoter region of the human COL11A1 gene. Transient transfection assays indicate that the segment from -199 to +1 is necessary for the activation of basal transcription. Electrophoretic mobility shift assays (EMSAs) demonstrated that the ATTGG sequence, within the -147 to -121 fragment, is critical to bind nuclear proteins in the proximal COL11A1 promoter. We demonstrated that the CCAAT binding factor (CBF/NF-Y) bound to this region using an interference assay with consensus oligonucleotides and a supershift assay with specific antibodies in an EMSA. In a chromatin immunoprecipitation assay and EMSA using DNA-affinity-purified proteins, CBF/NF-Y proteins directly bound this region in vitro and in vivo. We also showed that four tandem copies of the CBF/NF-Y-binding fragment produced higher transcriptional activity than one or two copies, whereas the absence of a CBF/NF-Y-binding fragment suppressed the COL11A1 promoter activity. Furthermore, overexpression of a dominant-negative CBF-B/NF-YA subunit significantly inhibited promoter activity in both transient and stable cells. These results indicate that the CBF/NF-Y proteins regulate the transcription of COL11A1 by directly binding to the ATTGG sequence in the proximal promoter region.

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Mixture models reveal multiple positional bias types in RNA-Seq data and lead to accurate transcript concentration estimates.

PubMed

Tuerk, Andreas; Wiktorin, Gregor; Güler, Serhat

2017-05-01

Accuracy of transcript quantification with RNA-Seq is negatively affected by positional fragment bias. This article introduces Mix2 (rd. "mixquare"), a transcript quantification method which uses a mixture of probability distributions to model and thereby neutralize the effects of positional fragment bias. The parameters of Mix2 are trained by Expectation Maximization resulting in simultaneous transcript abundance and bias estimates. We compare Mix2 to Cufflinks, RSEM, eXpress and PennSeq; state-of-the-art quantification methods implementing some form of bias correction. On four synthetic biases we show that the accuracy of Mix2 overall exceeds the accuracy of the other methods and that its bias estimates converge to the correct solution. We further evaluate Mix2 on real RNA-Seq data from the Microarray and Sequencing Quality Control (MAQC, SEQC) Consortia. On MAQC data, Mix2 achieves improved correlation to qPCR measurements with a relative increase in R2 between 4% and 50%. Mix2 also yields repeatable concentration estimates across technical replicates with a relative increase in R2 between 8% and 47% and reduced standard deviation across the full concentration range. We further observe more accurate detection of differential expression with a relative increase in true positives between 74% and 378% for 5% false positives. In addition, Mix2 reveals 5 dominant biases in MAQC data deviating from the common assumption of a uniform fragment distribution. On SEQC data, Mix2 yields higher consistency between measured and predicted concentration ratios. A relative error of 20% or less is obtained for 51% of transcripts by Mix2, 40% of transcripts by Cufflinks and RSEM and 30% by eXpress. Titration order consistency is correct for 47% of transcripts for Mix2, 41% for Cufflinks and RSEM and 34% for eXpress. We, further, observe improved repeatability across laboratory sites with a relative increase in R2 between 8% and 44% and reduced standard deviation.

Gene expression profiling of three different stressors in the water flea Daphnia magna.

PubMed

Jansen, Mieke; Vergauwen, Lucia; Vandenbrouck, Tine; Knapen, Dries; Dom, Nathalie; Spanier, Katina I; Cielen, Anke; De Meester, Luc

2013-07-01

Microarrays are an ideal tool to screen for differences in gene expression of thousands of genes simultaneously. However, often commercial arrays are not available. In this study, we performed microarray analyses to evaluate patterns of gene transcription following exposure to two natural and one anthropogenic stressor. cDNA microarrays compiled of three life stage specific and three stressor-specific EST libraries, yielding 1734 different EST sequences, were used. We exposed juveniles of the water flea Daphnia magna for 48, 96 and 144 h to three stressors known to exert strong selection in natural populations of this species i.e. a sublethal concentration of the pesticide carbaryl, infective spores of the endoparasite Pasteuria ramosa, and fish predation risk mimicked by exposure to fish kairomones. A total of 148 gene fragments were differentially expressed compared to the control. Based on a PCA, the exposure treatments were separated into two main groups based on the extent of the transcriptional response: a low and a high (144 h of fish or carbaryl exposure and 96 h of parasite exposure) stress group. Firstly, we observed a general stress-related transcriptional expression profile independent of the treatment characterized by repression of transcripts involved in transcription, translation, signal transduction and energy metabolism. Secondly, we observed treatment-specific responses including signs of migration to deeper water layers in response to fish predation, structural challenge of the cuticle in response to carbaryl exposure, and disturbance of the ATP production in parasite exposure. A third important conclusion is that transcription expression patterns exhibit stress-specific changes over time. Parasite exposure shows the most differentially expressed gene fragments after 96 h. The peak of differentially expressed transcripts came only after 144 h of fish exposure, while carbaryl exposure induced a more stable number of differently expressed gene fragments over time.

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

PubMed Central

Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

1977-01-01

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.

PubMed Central

Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

1988-01-01

Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031

Isolation of a promoter region in mouse cytochrome P450 3A (Cyp3A16) gene and its transcriptional control.

PubMed

Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T

1997-02-07

An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.

An unusual fragmentation of oxetane-embedded tetracyclic ketal systems.

PubMed

Rao, G Hari Mangeswara; Khan, Faiz Ahmed

2013-11-01

An unusual route for the synthesis of functionalized cyclobutane derivatives starting from functionalized norbornane derivatives is reported. Base-induced fragmentation of an oxetanol-type moiety embedded in a tetracyclic norbornyl ketal leads to a cyclobutane-fused derivative as the major or exclusive product. The fragmentation reaction for bridgehead-bromine-substituted derivatives was much faster than for the corresponding chlorine-substituted substrates. The functionalized cyclobutane product was formed exclusively in high yield in the former case, while the latter furnished a minor uncyclized side product in varying yields.

Temperature sensing in Yersinia pestis: regulation of yopE transcription by lcrF.

PubMed Central

Hoe, N P; Minion, F C; Goguen, J D

1992-01-01

In Escherichia coli, a yopE::lacZ fusion was found to be regulated by temperature in the presence of the cloned BamHI G fragment of Yersinia pestis plasmid pCD1, which contains the lcrF locus. Increasing the copy number of lcrF relative to that of the yopE reporter had a negligible effect on the induction ratio (26 versus 37 degrees C) but caused large reductions in the absolute levels of yopE transcription. We localized the lcrF gene by monitoring the induction phenotype of BamHI G deletion derivatives. Sequencing revealed an open reading frame capable of encoding a protein of 30.8 kDa. A protein product of this size was detected in a T7 expression system, and LcrF-dependent yopE-specific DNA binding activity was observed. As expected, LcrF exhibited 98% homology to VirF of Yersinia enterocolitica and significant homology to the carboxy termini of other members of the AraC family of transcriptional regulatory proteins. These proteins could be divided into two classes according to function: those regulating operons involved in catabolism of carbon and energy sources and those involved in regulating virulence genes. lcrF::lacZ transcriptional fusions were constructed and analyzed in Y. pestis and E. coli. The activity of the fusions was not affected by the native pCD1 virulence plasmid, an intact lcrF gene, or temperature. Thus, induction of lcrF transcription is not essential for temperature-dependent activation of yopE transcription. A portion of LcrF was found associated with the membrane fraction in E. coli; however, pulse-chase experiments indicated that this result is an artifact of fractionation. Images PMID:1624422

The suppression of tomato defence response genes upon potato cyst nematode infection indicates a key regulatory role of miRNAs.

PubMed

Święcicka, Magdalena; Skowron, Waldemar; Cieszyński, Piotr; Dąbrowska-Bronk, Joanna; Matuszkiewicz, Mateusz; Filipecki, Marcin; Koter, Marek Daniel

2017-04-01

Potato cyst nematode Globodera rostochiensis is an obligate parasite of solanaceous plants, triggering metabolic and morphological changes in roots which may result in substantial crop yield losses. Previously, we used the cDNA-AFLP to study the transcriptional dynamics in nematode infected tomato roots. Now, we present the rescreening of already published, upregulated transcript-derived fragment dataset using the most current tomato transcriptome sequences. Our reanalysis allowed to add 54 novel genes to 135, already found as upregulated in tomato roots upon G. rostochiensis infection (in total - 189). We also created completely new catalogue of downregulated sequences leading to the discovery of 76 novel genes. Functional classification of candidates showed that the 'wound, stress and defence response' category was enriched in the downregulated genes. We confirmed the transcriptional dynamics of six genes by qRT-PCR. To place our results in a broader context, we compared the tomato data with Arabidopsis thaliana, revealing similar proportions of upregulated and downregulated genes as well as similar enrichment of defence related transcripts in the downregulated group. Since transcript suppression is quite common in plant-nematode interactions, we assessed the possibility of miRNA-mediated inverse correlation on several tomato sequences belonging to NB-LRR and receptor-like kinase families. The qRT-PCR of miRNAs and putative target transcripts showed an opposite expression pattern in 9 cases. These results together with in silico analyses of potential miRNA targeting to the full repertoire of tomato R-genes show that miRNA mediated gene suppression may be a key regulatory mechanism during nematode parasitism. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

A fragment substitution in the promoter of CsHDZIV11/CsGL3 is responsible for fruit spine density in cucumber (Cucumis sativus L.).

PubMed

Zhang, Haiyang; Wang, Lina; Zheng, Shuangshuang; Liu, Zezhou; Wu, Xiaoqin; Gao, Zhihui; Cao, Chenxing; Li, Qiang; Ren, Zhonghai

2016-07-01

The indel in the promoter of CsHDZIV11 co-segregates with fruit spine density and could be used for molecular breeding in cucumber. Fruit spine density is an important quality trait for marketing in cucumber (Cucumis sativus L.). However, the molecular basis of fruit spine density in cucumber remains unclear. In this study, we isolated a mutant, few spines 1 (fs1), from CNS2 (wild type, WT), a North China-type cucumber with a high density of fruit spines. Genetic analysis showed that fs1 was controlled by a single recessive Mendelian factor. Bulked segregant analysis combined with genome resequencing were used for mapping fs1 in the F2 population derived from a cross between the fs1 mutant and WT, and it was located on chromosome 6 through association analysis. To develop more polymorphic markers to locate fs1, another F2 population was constructed from the cross between fs1 and 'Chinese long' 9930. Then, fs1 was narrowed down to a 110.4-kb genomic region containing 25 annotated genes. A fragment substitution was identified in the promoter region of Csa6M514870 between fs1 and WT. This fragment in fs1 was also present in wild cucumber. Csa6M514870 encodes a PDF2-related protein, a homeodomain-leucine zipper IV transcription factor (CsHDZIV11/CsGL3) sharing high identity and similarity with proteins related to trichome formation or epidermal cell differentiation. Quantitative reverse-transcription PCR revealed a higher expression level of CsHDZIV11 in young fruits from fs1 compared to WT. A molecular marker based on this indel co-segregated with the spine density. This work provides a solid foundation not only for understanding the molecular mechanism of fruit spine density, but also for molecular breeding in cucumber.

Identification of plant genes regulated in resistant potato Solanum sparsipilum during the early stages of infection by Globodera pallida.

PubMed

Jolivet, Katell; Grenier, Eric; Bouchet, Jean-Paul; Esquibet, Magali; Kerlan, Marie-Claire; Caromel, Bernard; Mugniéry, Didier; Lefebvre, Véronique

2007-04-01

Using a complementary (c)DNA-amplified fragment length polymorphism (AFLP) approach, we investigated differential gene expression linked to resistance mechanisms during the incompatible potato - Globodera pallida interaction. Expression was compared between a resistant and a susceptible potato clone, inoculated or not inoculated with G. pallida. These clones were issued from a cross between the resistant Solanum sparsipilum spl329.18 accession and the susceptible dihaploid S. tuberosum Caspar H3, and carried, respectively, resistant and susceptible alleles at the resistance quantitative trait loci (QTLs). Analysis was done on root fragments picked up at 4 time points, during a period of 6 days after infection, from penetration of the nematode in the root to degradation of the feeding site in resistant plants. A total of 2560 transcript-derived fragments (TDFs) were analyzed, resulting in the detection of 46 TDFs that were up- or downregulated. The number of TDFs that were up- or downregulated increased with time after inoculation. The majority of TDFs were upregulated at only 1 or 2 time points in response to infection. After isolation and sequencing of the TDFs of interest, a subset of 36 sequences were identified, among which 22 matched plant sequences and 2 matched nematode sequences. Some of the TDFs that matched plant genes showed clear homologies to genes involved in cell-cycle regulation, transcription regulation, resistance downstream signalling pathways, and defense mechanisms. Other sequences with homologies to plant genes of unknown function or without any significant similarity to known proteins were also found. Although not exhaustive, these results represent the most extensive list of genes with altered RNA levels after the incompatible G. pallida-potato interaction that has been published to date. The function of these genes could provide insight into resistance or plant defense mechanisms during incompatible potato-cyst nematode interactions.

The 193-base pair Gsg2 (haspin) promoter region regulates germ cell-specific expression bidirectionally and synchronously.

PubMed

Tokuhiro, Keizo; Miyagawa, Yasushi; Yamada, Shuichi; Hirose, Mika; Ohta, Hiroshi; Nishimune, Yoshitake; Tanaka, Hiromitsu

2007-03-01

Haspin is a unique protein kinase expressed predominantly in haploid male germ cells. The genomic structure of haspin (Gsg2) has revealed it to be intronless, and the entire transcription unit is in an intron of the integrin alphaE (Itgae) gene. Transcription occurs from a bidirectional promoter that also generates an alternatively spliced integrin alphaE-derived mRNA (Aed). In mice, the testis-specific alternative splicing of Aed is expressed bidirectionally downstream from the Gsg2 transcription initiation site, and a segment consisting of 26 bp transcribes both genomic DNA strands between Gsg2 and the Aed transcription initiation sites. To investigate the mechanisms for this unique gene regulation, we cloned and characterized the Gsg2 promoter region. The 193-bp genomic fragment from the 5' end of the Gsg2 and Aed genes, fused with EGFP and DsRed genes, drove the expression of both proteins in haploid germ cells of transgenic mice. This promoter element contained only a GC-rich sequence, and not the previously reported DNA sequences known to bind various transcription factors--with the exception of E2F1, TCFAP2A1 (AP2), and SP1. Here, we show that the 193-bp DNA sequence is sufficient for the specific, bidirectional, and synchronous expression in germ cells in the testis. We also demonstrate the existence of germ cell nuclear factors specifically bound to the promoter sequence. This activity may be regulated by binding to the promoter sequence with germ cell-specific nuclear complex(es) without regulation via DNA methylation.

The MluI cell cycle box (MCB) motifs, but not damage-responsive elements (DREs), are responsible for the transcriptional induction of the rhp51+ gene in response to DNA replication stress.

PubMed

Sartagul, Wugangerile; Zhou, Xin; Yamada, Yuki; Ma, Ning; Tanaka, Katsunori; Furuyashiki, Tomoyuki; Ma, Yan

2014-01-01

DNA replication stress induces the transcriptional activation of rhp51+, a fission yeast recA homolog required for repair of DNA double strand breaks. However, the mechanism by which DNA replication stress activates rhp51+ transcription is not understood. The promoter region of rhp51+ contains two damage-responsive elements (DREs) and two MluI cell cycle box (MCB) motifs. Using luciferase reporter assays, we examined the role of these elements in rhp51+ transcription. The full-length rhp51+ promoter and a promoter fragment containing MCB motifs only, but not a fragment containing DREs, mediated transcriptional activation upon DNA replication stress. Removal of the MCB motifs from the rhp51+ promoter abolished the induction of rhp51+ transcription by DNA replication stress. Consistent with a role for MCB motifs in rhp51+ transcription activation, deletion of the MBF (MCB-binding factor) co-repressors Nrm1 and Yox1 precluded rhp51+ transcriptional induction in response to DNA replication stress. Using cells deficient in checkpoint signaling molecules, we found that the Rad3-Cds1/Chk1 pathway partially mediated rhp51+ transcription in response to DNA replication stress, suggesting the involvement of unidentified checkpoint signaling pathways. Because MBF is critical for G1/S transcription, we examined how the cell cycle affected rhp51+ transcription. The transcription of rhp51+ and cdc18+, an MBF-dependent G1/S gene, peaked simultaneously in synchronized cdc25-22 cells. Furthermore, DNA replication stress maintained transcription of rhp51+ similarly to cdc18+. Collectively, these results suggest that MBF and its regulators mediate rhp51+ transcription in response to DNA replication stress, and underlie rhp51+ transcription at the G1/S transition.

Characterization of a tandemly repeated DNA sequence family originally derived by retroposition of tRNA(Glu) in the newt.

PubMed

Nagahashi, S; Endoh, H; Suzuki, Y; Okada, N

1991-11-20

A previous report from this laboratory showed that in vitro transcription of total genomic DNA of the newt Cynopus pyrrhogaster resulted in a discrete sized 8 S RNA, which represented highly repetitive and transcribable sequences with a glutamic acid tRNA-like structure in the newt genome. We isolated four independent clones from a newt genomic library and determined the complete sequences of three 2000 to 2400 base-pair PstI fragments spanning the 8 S RNA gene. The glutamic acid tRNA-related segment in the 8 S RNA gene contains the CCA sequence expected as the 3' terminus of a tRNA molecule. Further, the 11 nucleotides located 13 nucleotides upstream from one of the two transcription initiation sites of the 8 S RNA were found to be repeated in the region upstream from the termination site, suggesting that the original unit, which is shorter than the 8 S RNA, was retrotransposed via cDNA intermediates from the PolIII transcript. In the upstream region of the 8 S RNA gene, a 360 nucleotide unit containing the glutamic acid tRNA-related segment was found to be duplicated (clones NE1 and NE10) or triplicated (clone NE3). Except for the difference in the number of the 360 nucleotide unit, the three sequences of the 2000 to 2400 base-pair PstI fragment were essentially the same with only a few mutations and minor deletions. Inverse polymerase chain reaction and sequence determination of the products, together with a Southern hybridization experiment, demonstrated that the family consists of a tandemly repeated unit of 3300, 3700 or 4100 base-pairs. Thus during evolution, this family in the newt was created by retroposition via cDNA intermediates, followed by duplication or triplication of the 360 nucleotide unit and multiplication of the 3300 to 4100 base-pair region at the DNA level.

cDNA-AFLP analysis of differential gene expression related to cell chemotactic and encystment of Azospirillum brasilense.

PubMed

Li, Huamin; Cui, Yanhua; Wu, Lixian; Tu, Ran; Chen, Sanfeng

2011-12-20

Our previous study indicated org35 was involved in chemotaxis and interacted with nitrogen fixation transcriptional activator NifA via PAS domain. In order to reveal the role of org35 in nitrogen regulation, the downstream target genes of org35 were identified. We here report differentially expressed genes in org35 mutants comparing with wild type Sp7 by means of cDNA-AFLP. Four up-regulated transcript-derived fragments (TDFs) homologues of chemotaxis transduction proteins were found, including CheW, methyl-accepting chemotaxis protein and response regulator CheY-like receiver. Three distinct TDFs (AB46, AB58 and AB63) were similar to PHB de-polymerase C-terminus, cell shape-determining protein and flagellin domain protein. And 11 TDFs showed similarities with signal transduction proteins, including homologous protein of the nitrogen regulation protein NtrY and nitrate/nitrite response regulator protein NarL. These data suggested that the Azospirillum brasilense org35 was a multi-effecter and involved in chemotaxis, cyst development and regulation of nitrogen fixation. Copyright © 2010 Elsevier GmbH. All rights reserved.

Compositions and methods for detecting gene rearrangements and translocations

DOEpatents

Rowley, Janet D.; Diaz, Manuel O.

2000-01-01

Disclosed is a series of nucleic acid probes for use in diagnosing and monitoring certain types of leukemia using, e.g., Southern and Northern blot analyses and fluorescence in situ hybridization (FISH). These probes detect rearrangements, such as translocations involving chromosome band 11q23 with other chromosomes bands, including 4q21, 6q27, 9p22, 19p13.3, in both dividing leukemic cells and interphase nuclei. The breakpoints in all such translocations are clustered within an 8.3 kb BamHI genomic region of the MLL gene. A novel 0.7 kb BamH1 cDNA fragment derived from this gene detects rearrangements on Southern blot analysis with a single BamHI restriction digest in all patients with the common 11q23 translocations and in patients with other 11q23 anomalies. Northern blot analyses are presented demonstrating that the MLL gene has multiple transcripts and that transcript size differentiates leukemic cells from normal cells. Also disclosed are MLL fusion proteins, MLL protein domains and anti-MLL antibodies.

Fragmentation pathways of 2-substituted pyrrole derivatives using electrospray ionization ion trap and electrospray ionization quadrupole time-of-flight mass spectrometry.

PubMed

Liang, Xianrui; Guo, Zili; Yu, Chuanming

2013-10-30

Pyrrole derivatives are of considerable importance and are present in a wide range of natural products and used extensively in drug discovery. Fragmentation pathway studies play an important role in the structural identification of pyrrole derivatives. As a part of our ongoing work on heterocycles, fragmentation pathways of 2-substituted pyrrole derivatives were investigated by mass spectrometry (MS). Twelve pyrrole derivatives were synthesized and analyzed. Low-resolution fragmentation ions of all the compounds were generated by ion trap mass spectrometry (ITMS(n) ) with an electrospray ionization (ESI) source in positive mode. Hybrid quadrupole time-of-flight mass spectrometry (QTOFMS) was used to determine the elemental compositions of the resultant product ions. The side-chain substituents at the 2-position influence the fragmentation pathways. Typical losses of H2 O, aldehydes and pyrrole moieties from the [M + H](+) ion are observed for the compounds with side chains bearing aromatic groups at the 2-position of the pyrrole. However, losses of H2 O, alcohols and C3 H6 are the main cleavage pathways for compounds 6 and 12 with nonphenyl-substituted side chains at the 2-position. Typical fragmentation mechanisms of 2-substituted pyrrole derivatives are proposed and elucidated based on the observations of ITMS(n) and QTOFMS spectra. The results showed that the fragmentation pathways were remarkably influenced by the side-chain substituents at the 2-position of pyrrole. This investigation should have value in the structural identification of this series of molecules or compounds with similar structures. Copyright © 2013 John Wiley & Sons, Ltd.

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE PAGES

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

2015-03-22

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Kelli F.; Kawashima, Tomokazu; Goldberg, Robert B.

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean ( Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we usemore » site-directed mutagenesis experiments in transgenic tobacco globularstage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. Lastly, a homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.« less

A cis-regulatory module activating transcription in the suspensor contains five cis-regulatory elements.

PubMed

Henry, Kelli F; Kawashima, Tomokazu; Goldberg, Robert B

2015-06-01

Little is known about the molecular mechanisms by which the embryo proper and suspensor of plant embryos activate specific gene sets shortly after fertilization. We analyzed the upstream region of the Scarlet Runner Bean (Phaseolus coccineus) G564 gene in order to understand how genes are activated specifically in the suspensor during early embryo development. Previously, we showed that a 54-bp fragment of the G564 upstream region is sufficient for suspensor transcription and contains at least three required cis-regulatory sequences, including the 10-bp motif (5'-GAAAAGCGAA-3'), the 10 bp-like motif (5'-GAAAAACGAA-3'), and Region 2 motif (partial sequence 5'-TTGGT-3'). Here, we use site-directed mutagenesis experiments in transgenic tobacco globular-stage embryos to identify two additional cis-regulatory elements within the 54-bp cis-regulatory module that are required for G564 suspensor transcription: the Fifth motif (5'-GAGTTA-3') and a third 10-bp-related sequence (5'-GAAAACCACA-3'). Further deletion of the 54-bp fragment revealed that a 47-bp fragment containing the five motifs (the 10-bp, 10-bp-like, 10-bp-related, Region 2 and Fifth motifs) is sufficient for suspensor transcription, and represents a cis-regulatory module. A consensus sequence for each type of motif was determined by comparing motif sequences shown to activate suspensor transcription. Phylogenetic analyses suggest that the regulation of G564 is evolutionarily conserved. A homologous cis-regulatory module was found upstream of the G564 ortholog in the Common Bean (Phaseolus vulgaris), indicating that the regulation of G564 is evolutionarily conserved in closely related bean species.

Identification, cloning, and sequencing of a fragment of Amsacta moorei entomopoxvirus DNA containing the spheroidin gene and three vaccinia virus-related open reading frames.

PubMed Central

Hall, R L; Moyer, R W

1991-01-01

Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245

Preparation and Analysis of Positioned Mononucleosomes

PubMed Central

Kulaeva, Olga; Studitsky, Vasily M.

2016-01-01

Short DNA fragments containing single nucleosomes have been extensively employed as simple model experimental systems for analysis of many intranuclear processes, including binding of proteins to nucleosomes, covalent histone modifications, transcription, DNA repair and ATP-dependent chromatin remodeling. Here we describe several recently developed procedures for obtaining and analysis of mononucleosomes assembled on 200–350-bp DNA fragments. PMID:25827872

The Old Saxon Leipzig "Heliand" Manuscript Fragment (MS L): New Evidence Concerning Luther, the Poet, and Ottonian Heritage

ERIC Educational Resources Information Center

Price, Timothy Blaine

2010-01-01

Begun as an investigation of the linguistic and paleographic evidence on the Old Saxon Leipzig "Heliand" fragment, the dissertation encompasses three analyses spanning over a millennium of that manuscript's existence. First, a direct analysis clarifies errors in the published transcription (4.2). The corrections result from digital…

Inhibition of Retinoblastoma Protein Inactivation

DTIC Science & Technology

2017-11-01

SUBJECT TERMS cell cycle, Retinoblastoma protein, E2F transcription factor, high throughput screen, drug discovery, x-ray crystallography 16. SECURITY...screening by x-ray crystallography . 2.0 KEYWORDS Retinoblastoma (Rb) pathway, E2F transcription factor, cancer, cell-cycle inhibition, activation...modulation, inhibition, high throughput screening, fragment-based screening, x-ray crystallography . 3.0 ACCOMPLISHMENTS Summary: We

Alu sequence involvement in transcriptional insulation of the keratin 18 gene in transgenic mice.

PubMed Central

Thorey, I S; Ceceña, G; Reynolds, W; Oshima, R G

1993-01-01

The human keratin 18 (K18) gene is expressed in a variety of adult simple epithelial tissues, including liver, intestine, lung, and kidney, but is not normally found in skin, muscle, heart, spleen, or most of the brain. Transgenic animals derived from the cloned K18 gene express the transgene in appropriate tissues at levels directly proportional to the copy number and independently of the sites of integration. We have investigated in transgenic mice the dependence of K18 gene expression on the distal 5' and 3' flanking sequences and upon the RNA polymerase III promoter of an Alu repetitive DNA transcription unit immediately upstream of the K18 promoter. Integration site-independent expression of tandemly duplicated K18 transgenes requires the presence of either an 825-bp fragment of the 5' flanking sequence or the 3.5-kb 3' flanking sequence. Mutation of the RNA polymerase III promoter of the Alu element within the 825-bp fragment abolishes copy number-dependent expression in kidney but does not abolish integration site-independent expression when assayed in the absence of the 3' flanking sequence of the K18 gene. The characteristics of integration site-independent expression and copy number-dependent expression are separable. In addition, the formation of the chromatin state of the K18 gene, which likely restricts the tissue-specific expression of this gene, is not dependent upon the distal flanking sequences of the 10-kb K18 gene but rather may depend on internal regulatory regions of the gene. Images PMID:7692231

Development of an accurate and high-throughput methodology for structural comprehension of chlorophylls derivatives. (II) Dephytylated derivatives.

PubMed

Chen, Kewei; Ríos, José Julián; Roca, María; Pérez-Gálvez, Antonio

2015-09-18

Dephytylated chlorophylls (chlorophyllides and pheophorbides) are the starting point of the chlorophyll catabolism in green tissues, components of the chlorophyll pattern in storage/processed food vegetables, as well as the favoured structural arrangement for chlorophyll absorption. In addition, dephytylated native chlorophylls are prone to several modifications of their structure yielding pyro-, 13(2)-hydroxy- and 15(1)-hydroxy-lactone derivatives. Despite of these outstanding remarks only few of them have been analysed by MS(n). Besides new protocols for obtaining standards, we have developed a new high throughput methodology able to determine the fragmentation pathway of 16 dephytylated chlorophyll derivatives, elucidating the structures of the new product ions and new mechanisms of fragmentation. The new methodology combines, by first time, high resolution time-of-flight mass spectrometry and powerful post-processing software. Native chlorophyllides and pheophorbides mainly exhibit product ions that involve the fragmentation of D ring, as well as additional exclusive product ions. The introduction of an oxygenated function at E ring enhances the progress of fragmentation reactions through the β-keto ester group, developing also exclusive product ions for 13(2)-hydroxy derivatives and for 15(1)-hydroxy-lactone ones. Consequently, while MS(2)-based reactions of phytylated chlorophyll derivatives point to fragmentations at the phytyl and propionic chains, dephytylated chlorophyll derivatives behave different as the absence of phytyl makes β-keto ester group and E ring more prone to fragmentation. Proposals of the key reaction mechanisms underlying the origin of new product ions have been made. Copyright © 2015 Elsevier B.V. All rights reserved.

Influence of backwashing on the microbial community in a biofilm developed on biological activated carbon used in a drinking water treatment plant.

PubMed

Kasuga, I; Shimazaki, D; Kunikane, S

2007-01-01

The influence of backwashing on the biofilm community developed on biological activated carbon (BAC) used in a drinking water treatment plant was investigated by means of bacterial cell enumeration and terminal-restriction fragment length polymorphism (T-RFLP) fingerprinting analysis of bacterial and eukaryotic ribosomal RNA genes (rDNA). After backwashing, the attached bacterial abundance in the top layer of the BAC bed decreased to 64% of that before backwashing. The community level changes caused by backwashing were examined through the T-RFLP profiles. In the bacterial 16S rDNA analysis, the relative abundances of some terminal-restriction fragments (T-RFs) including the Planctomycetes-derived fragment increased; however, the relative abundances of some T-RFs including the Betaproteobacteria-derived fragments decreased. In the eukaryotic 18S rDNA analysis, the relative abundances of some T-RFs including the protozoan Cercozoa-derived fragments increased; however, the relative abundances of some T-RFs including the metazoan Chaetonotus- and Paratripyla-derived fragments decreased. The T-RFLP analysis suggests that backwashing can cause changes in the relative compositions of microorganisms in a BAC biofilm in the top layer of the bed.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Structure and regulation of an archaebacterial promoter: An in vivo study. Progress report, August 1, 1991--March 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Daniels, C.J.

1993-06-01

We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less

Subacute Sclerosing Panencephalitis in an Infant: Diagnostic Role of Viral Genome Analysis

PubMed Central

Baram, Tallie Z.; Gonzalez-Gomez, Ignacio; Xie, Zong-De; Yao, Dapeng; Gilles, Floyd H.; Nelson, Marvin D.; Nguyen, Hahn T.; Peters, Julius

2013-01-01

Subacute sclerosing panencephalitis (SSPE) is related to “defective” measles virus or vaccination, though an association with parainfluenza viruses has been reported. SSPE is characterized by a slow, erratic course and elevated cerebrospinal fluid measles titers. An immunocompetent, vaccinated infant, with onset of symptoms in parainfiuenza virus season and a catastrophic course is described. Cerebrospinal fluid titers were negative, but postmortem brain had typical SSPE lesions. Patient brain-derived RNA, subjected to reverse transcription followed by polymerase chain reaction yielded polymerase chain reaction products with measles virus but not parainfluenza virus genes. The sequenced fragment revealed multiple mutations, typical for SSPE. SSPE can thus present in infants, with short latency and no cerebrospinal fluid antibodies. Viral genomic analysis may be diagnostic, permitting early therapy. PMID:8024248

Increase in the growth inhibition of bovine pulmonary artery smooth muscle cells by an O-hexanoyl low-molecular-weight heparin derivative.

PubMed

Garg, Hari G; Hales, Charles A; Yu, Lunyin; Butler, Melissa; Islam, Tasneem; Xie, Jin; Linhardt, Robert J

2006-11-06

Proliferation of pulmonary artery smooth muscle cells (PASMCs) appears to play a significant role in chronic pulmonary hypertension. The proliferation of PASMCs is strongly inhibited by some commercial heparin preparations. Heparin fragments were prepared by periodate treatment, followed by sodium borohydride reduction, to enhance potency. The tributylammonium salt of this fragmented heparin was O-acylated with hexanoic anhydride. Gradient polyacrylamide gel electrophoresis showed that the major heparin fragment contained eight disaccharide units. NMR analysis showed that approximately one hexanoyl group per disaccharide residue was present. The O-hexanoyl heparin fragments were assayed for growth inhibitory effect on bovine PASMCs in culture. This derivative was found to be more effective in growth inhibition of bovine PASMCs in culture than the heparin from which it was derived. In the future, it is envisioned that this or similar derivatives may be an effective treatment for pulmonary hypertension.

Annotation of differentially expressed genes in the somatic embryogenesis of musa and their location in the banana genome.

PubMed

Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-Graciamedrano, Rosa Maria

2013-01-01

Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100-4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa.

Genome-wide mapping of autonomous promoter activity in human cells

PubMed Central

van Arensbergen, Joris; FitzPatrick, Vincent D.; de Haas, Marcel; Pagie, Ludo; Sluimer, Jasper; Bussemaker, Harmen J.; van Steensel, Bas

2017-01-01

Previous methods to systematically characterize sequence-intrinsic activity of promoters have been limited by relatively low throughput and the length of sequences that could be tested. Here we present Survey of Regulatory Elements (SuRE), a method to assay more than 108 DNA fragments, each 0.2–2kb in size, for their ability to drive transcription autonomously. In SuRE, a plasmid library is constructed of random genomic fragments upstream of a 20bp barcode and decoded by paired-end sequencing. This library is then transfected into cells and transcribed barcodes are quantified in the RNA by high throughput sequencing. When applied to the human genome, we achieved a 55-fold genome coverage, allowing us to map autonomous promoter activity genome-wide. By computational modeling we delineated subregions within promoters that are relevant for their activity. For instance, we show that antisense promoter transcription is generally dependent on the sense core promoter sequences, and that most enhancers and several families of repetitive elements act as autonomous transcription initiation sites. PMID:28024146

Fe65 does not stabilize AICD during activation of transcription in a luciferase assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huysseune, Sandra; Kienlen-Campard, Pascal; Octave, Jean-Noel

2007-09-21

The APP intracellular domain (AICD) could be involved in signaling via interaction with the adaptor protein Fe65, and with the histone acetyl transferase Tip60. However, the real function of AICD and Fe65 in regulation of transcription remains controversial. In this study, the human APPGal4 fusion protein was expressed in CHO cells and the transcriptional activity of AICDGal4 was measured in a luciferase-based reporter assay. AICDGal4 was stabilized by expression of Fe65 and levels of AICDGal4 controlled luciferase activity. On the contrary, when human APP was expressed in CHO cells, coexpression of Fe65 increased luciferase activity without affecting the amount ofmore » AICD fragment. AICD produced from APP was protected from degradation by orthophenanthroline, but not by lactacystine, indicating that AICD is not a substrate of the chymotryptic activity of the proteasome. It is concluded that Fe65 can control luciferase activity without stabilizing the labile AICD fragment.« less

Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.

PubMed

Konopiński, R; Nowak, R; Siedlecki, J A

1996-10-17

Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.

Inhibition of adenovirus replication by the E1A antisense transcript initiated from hsp70 and VA-1 promoters.

PubMed

Miroshnichenko, O I; Borisenko, A S; Ponomareva, T I; Tikhonenko, T I

1990-03-01

The E1A region of the adenoviral genome, important for initiation of virus infection and activation of other viral genes, was chosen as a target for engineering antisense RNA (asRNA) to inhibit adenovirus 5 (Ad5) replication in COS-1 cell culture in vitro. The hsp70 promoter, taken from the appropriate heat-shock-protein gene of Drosophila melanogaster, and the VA-1 RNA promoter, derived from the Ad5 gene coding for low-molecular-mass VA-1 RNA and recognized by RNA polymerase III were used as regulatory elements of transcription. The two types of recombinant constructs contained E1A fragments of 710 bp (hsp70 constructs) or 380 or 740 bp (VA-1 RNA constructs) in reverse orientation relative to the promoter position, as well as a transcription termination signal, the SV40 ori, and the gene controlling Geneticin (antibiotic G418) resistance (G418R). After selection of transfected COS-1 cells in the presence of G418, a number of stable G418R cell lines were raised which expressed engineered asRNAs. Plating of Ad5 suspensions of known titre on monolayers of transfected COS-1 cells clearly showed strong inhibition of adenovirus replication by asRNAs: 75% with the hsp70 promoter and 90% with the VA-1 RNA promoter.

Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a.

PubMed

Khedgikar, Vikram; Abbruzzese, Genevieve; Mathavan, Ketan; Szydlo, Hannah; Cousin, Helene; Alfandari, Dominique

2017-08-22

Adam13/33 is a cell surface metalloprotease critical for cranial neural crest (CNC) cell migration. It can cleave multiple substrates including itself, fibronectin, ephrinB, cadherin-11, pcdh8 and pcdh8l (this work). Cleavage of cadherin-11 produces an extracellular fragment that promotes CNC migration. In addition, the adam13 cytoplasmic domain is cleaved by gamma secretase, translocates into the nucleus and regulates multiple genes. Here, we show that adam13 interacts with the arid3a/dril1/Bright transcription factor. This interaction promotes a proteolytic cleavage of arid3a and its translocation to the nucleus where it regulates another transcription factor: tfap2α. Tfap2α in turn activates multiple genes including the protocadherin pcdh8l (PCNS). The proteolytic activity of adam13 is critical for the release of arid3a from the plasma membrane while the cytoplasmic domain appears critical for the cleavage of arid3a. In addition to this transcriptional control of pcdh8l, adam13 cleaves pcdh8l generating an extracellular fragment that also regulates cell migration.

Dual control of pcdh8l/PCNS expression and function in Xenopus laevis neural crest cells by adam13/33 via the transcription factors tfap2α and arid3a

PubMed Central

Khedgikar, Vikram; Abbruzzese, Genevieve; Mathavan, Ketan; Szydlo, Hannah; Cousin, Helene

2017-01-01

Adam13/33 is a cell surface metalloprotease critical for cranial neural crest (CNC) cell migration. It can cleave multiple substrates including itself, fibronectin, ephrinB, cadherin-11, pcdh8 and pcdh8l (this work). Cleavage of cadherin-11 produces an extracellular fragment that promotes CNC migration. In addition, the adam13 cytoplasmic domain is cleaved by gamma secretase, translocates into the nucleus and regulates multiple genes. Here, we show that adam13 interacts with the arid3a/dril1/Bright transcription factor. This interaction promotes a proteolytic cleavage of arid3a and its translocation to the nucleus where it regulates another transcription factor: tfap2α. Tfap2α in turn activates multiple genes including the protocadherin pcdh8l (PCNS). The proteolytic activity of adam13 is critical for the release of arid3a from the plasma membrane while the cytoplasmic domain appears critical for the cleavage of arid3a. In addition to this transcriptional control of pcdh8l, adam13 cleaves pcdh8l generating an extracellular fragment that also regulates cell migration. PMID:28829038

Characterization of Betula platyphylla gene transcripts associated with early development of male inflorescence.

PubMed

Xing, Lei; Liu, Xue-Mei

2012-02-01

Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.

Regulation of GluR2 promoter activity by neurotrophic factors via a neuron-restrictive silencer element.

PubMed

Brené, S; Messer, C; Okado, H; Hartley, M; Heinemann, S F; Nestler, E J

2000-05-01

The AMPA glutamate receptor subunit GluR2, which plays a critical role in regulation of AMPA channel function, shows altered levels of expression in vivo after several chronic perturbations. To evaluate the possibility that transcriptional mechanisms are involved, we studied a 1254-nucleotide fragment of the 5'-promoter region of the mouse GluR2 gene in neural-derived cell lines. We focused on regulation of GluR2 promoter activity by two neurotrophic factors, which are known to be altered in vivo in some of the same systems that show GluR2 regulation. Glial-cell line derived neurotrophic factor (GDNF) and brain-derived neurotrophic factor (BDNF) both induced GluR2 promoter activity. This was associated with increased expression of endogenous GluR2 immunoreactivity in the cells as measured by Western blotting. The effect of GDNF and BDNF appeared to be mediated via a NRSE (neuron-restrictive silencer element) present within the GluR2 promoter. The response to these neurotrophic factors was lost upon mutating or deleting this site, but not several other putative response elements present within the promoter. Moreover, overexpression of REST (restrictive element silencer transcription factor; also referred to as NRSF or neuron restrictive silencer factor), which is known to act on NRSEs in other genes to repress gene expression, blocked the ability of GDNF to induce GluR2 promoter activity. However, GDNF did not alter endogenous levels of REST in the cells. Together, these findings suggest that GluR2 expression can be regulated by neurotrophic factors via an apparently novel mechanism involving the NRSE present within the GluR2 gene promoter.

Independent Structural Domains in Paramyxovirus Polymerase Protein*

PubMed Central

Dochow, Melanie; Krumm, Stefanie A.; Crowe, James E.; Moore, Martin L.; Plemper, Richard K.

2012-01-01

All enzymatic activities required for genomic replication and transcription of nonsegmented negative strand RNA viruses (or Mononegavirales) are believed to be concentrated in the viral polymerase (L) protein. However, our insight into the organization of these different enzymatic activities into a bioactive tertiary structure remains rudimentary. Fragments of Mononegavirales polymerases analyzed to date cannot restore bioactivity through trans-complementation, unlike the related L proteins of segmented NSVs. We investigated the domain organization of phylogenetically diverse Paramyxovirus L proteins derived from measles virus (MeV), Nipah virus (NiV), and respiratory syncytial virus (RSV). Through a comprehensive in silico and experimental analysis of domain intersections, we defined MeV L position 615 as an interdomain candidate in addition to the previously reported residue 1708. Only position 1708 of MeV and the homologous positions in NiV and RSV L also tolerated the insertion of epitope tags. Splitting of MeV L at residue 1708 created fragments that were unable to physically interact and trans-complement, but strikingly, these activities were reconstituted by the addition of dimerization tags to the fragments. Equivalently split fragments of NiV, RSV, and MeV L oligomerized with comparable efficiency in all homo- and heterotypic combinations, but only the homotypic pairs were able to trans-complement. These results demonstrate that synthesis as a single polypeptide is not required for the Mononegavirales polymerases to adopt a proper tertiary conformation. Paramyxovirus polymerases are composed of at least two truly independent folding domains that lack a traditional interface but require molecular compatibility for bioactivity. The functional probing of the L domain architecture through trans-complementation is anticipated to be applicable to all Mononegavirales polymerases. PMID:22215662

Differential gene expression during conidiation in the grape powdery mildew pathogen, Erysiphe necator.

PubMed

Wakefield, Laura; Gadoury, David M; Seem, Robert C; Milgroom, Michael G; Sun, Qi; Cadle-Davidson, Lance

2011-07-01

Asexual sporulation (conidiation) is coordinately regulated in the grape powdery mildew pathogen Erysiphe necator but nothing is known about its genetic regulation. We hypothesized that genes required for conidiation in other fungi would be upregulated at conidiophore initiation or full conidiation (relative to preconidiation vegetative growth and development of mature ascocarps), and that the obligate biotrophic lifestyle of E. necator would necessitate some novel gene regulation. cDNA amplified fragment length polymorphism analysis with 45 selective primer combinations produced ≈1,600 transcript-derived fragments (TDFs), of which 620 (39%) showed differential expression. TDF sequences were annotated using BLAST analysis of GenBank and of a reference transcriptome for E. necator developed by 454-FLX pyrosequencing of a normalized cDNA library. One-fourth of the differentially expressed, annotated sequences had similarity to fungal genes of unknown function. The remaining genes had annotated function in metabolism, signaling, transcription, transport, and protein fate. As expected, a portion of orthologs known in other fungi to be involved in developmental regulation was upregulated immediately prior to or during conidiation; particularly noteworthy were several genes associated with the light-dependent VeA regulatory system, G-protein signaling (Pth11 and a kelch repeat), and nuclear transport (importin-β and Ran). This work represents the first investigation into differential gene expression during morphogenesis in E. necator and identifies candidate genes and hypotheses for characterization in powdery mildews. Our results indicate that, although control of conidiation in powdery mildews may share some basic elements with established systems, there are significant points of divergence as well, perhaps due, in part, to the obligate biotrophic lifestyle of powdery mildews.

Sequence analysis of dolphin ferritin H and L subunits and possible iron-dependent translational control of dolphin ferritin gene

PubMed Central

Takaesu, Azusa; Watanabe, Kiyotaka; Takai, Shinji; Sasaki, Yukako; Orino, Koichi

2008-01-01

Background Iron-storage protein, ferritin plays a central role in iron metabolism. Ferritin has dual function to store iron and segregate iron for protection of iron-catalyzed reactive oxygen species. Tissue ferritin is composed of two kinds of subunits (H: heavy chain or heart-type subunit; L: light chain or liver-type subunit). Ferritin gene expression is controlled at translational level in iron-dependent manner or at transcriptional level in iron-independent manner. However, sequencing analysis of marine mammalian ferritin subunits has not yet been performed fully. The purpose of this study is to reveal cDNA-derived amino acid sequences of cetacean ferritin H and L subunits, and demonstrate the possibility of expression of these subunits, especially H subunit, by iron. Methods Sequence analyses of cetacean ferritin H and L subunits were performed by direct sequencing of polymerase chain reaction (PCR) fragments from cDNAs generated via reverse transcription-PCR of leukocyte total RNA prepared from blood samples of six different dolphin species (Pseudorca crassidens, Lagenorhynchus obliquidens, Grampus griseus, Globicephala macrorhynchus, Tursiops truncatus, and Delphinapterus leucas). The putative iron-responsive element sequence in the 5'-untranslated region of the six different dolphin species was revealed by direct sequencing of PCR fragments obtained using leukocyte genomic DNA. Results Dolphin H and L subunits consist of 182 and 174 amino acids, respectively, and amino acid sequence identities of ferritin subunits among these dolphins are highly conserved (H: 99–100%, (99→98) ; L: 98–100%). The conserved 28 bp IRE sequence was located -144 bp upstream from the initiation codon in the six different dolphin species. Conclusion These results indicate that six different dolphin species have conserved ferritin sequences, and suggest that these genes are iron-dependently expressed. PMID:18954429

[Isolation of ABA-regulated genes in Oryza sativa through fluorescent differential display PCR (FDD-PCR)].

PubMed

Xu, Shou Ling; Shen, Si Shi; Xu, Zhi Hong; Xue, Hong Wei

2002-12-01

Abscisic acid (ABA) was critical in plant seed development and response to environmental factors such as stress situations. To study the possible ABA related signaling transduction pathways, we tried to isolate the ABA-regulated genes through fluorescent differential display PCR (FDD-PCR) technology using rice seedling as materials (treated with ABA for 2, 4, 8 and 12h). In the 17 fragments isolated, 14 and 3 clones were up-and down-regulated respectively. Sequence analyses revealed that the encoded proteins were involved in photosynthesis (7 fragments), signal transduction (1 fragments), transcription (2 fragments), metabolism and resistance (6 fragments), and unknown protein (1 fragments). 3 clones, encoding putative alpha/beta hydrolase fold, putative vacuolar H+ -ATPase B subunit, putative tyrosine phosphatase, were confirmed to be regulated under ABA treatment by RT-PCR and northern blot analysis. FDD-PCR and possible functional mechanisms of ABA were discussed.

The Antiviral Mechanism of an Influenza A Virus Nucleoprotein-Specific Single-Domain Antibody Fragment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanke, Leo; Knockenhauer, Kevin E.; Brewer, R. Camille

Alpaca-derived single-domain antibody fragments (VHHs) that target the influenza A virus nucleoprotein (NP) can protect cells from infection when expressed in the cytosol. We found that one such VHH, αNP-VHH1, exhibits antiviral activity similar to that of Mx proteins by blocking nuclear import of incoming viral ribonucleoproteins (vRNPs) and viral transcription and replication in the nucleus. We determined a 3.2-Å crystal structure of αNP-VHH1 in complex with influenza A virus NP. The VHH binds to a nonconserved region on the body domain of NP, which has been associated with binding to host factors and serves as a determinant of hostmore » range. Several of the NP/VHH interface residues determine sensitivity of NP to antiviral Mx GTPases. The structure of the NP/αNP-VHH1 complex affords a plausible explanation for the inhibitory properties of the VHH and suggests a rationale for the antiviral properties of Mx proteins. Such knowledge can be leveraged for much-needed novel antiviral strategies. IMPORTANCEInfluenza virus strains can rapidly escape from protection afforded by seasonal vaccines or acquire resistance to available drugs. Additional ways to interfere with the virus life cycle are therefore urgently needed. The influenza virus nucleoprotein is one promising target for antiviral interventions. We have previously isolated alpaca-derived single-domain antibody fragments (VHHs) that protect cells from influenza virus infection if expressed intracellularly. We show here that one such VHH exhibits antiviral activities similar to those of proteins of the cellular antiviral defense (Mx proteins). We determined the three-dimensional structure of this VHH in complex with the influenza virus nucleoprotein and identified the interaction site, which overlaps regions that determine sensitivity of the virus to Mx proteins. Our data define a new vulnerability of influenza virus, help us to better understand the cellular antiviral mechanisms, and provide a well-characterized tool to further study them.« less

Development of a cell-based high throughput luciferase enzyme fragment complementation assay to identify nuclear-factor-e2-related transcription factor 2 activators.

PubMed

Xie, Wensheng; Pao, Christina; Graham, Taylor; Dul, Ed; Lu, Quinn; Sweitzer, Thomas D; Ames, Robert S; Li, Hu

2012-12-01

Nuclear-factor-E2-related transcription factor 2 (Nrf2) regulates a large panel of Phase II genes and plays an important role in cell survival. Nrf2 activation has been shown as preventing cigarette smoke-induced alveolar enlargement in mice. Therefore, activation of the Nrf2 protein by small-molecule activators represents an attractive therapeutic strategy that is used for chronic obstructive pulmonary disease. In this article, we describe a cell-based luciferase enzyme fragment complementation assay that identifies Nrf2 activators. This assay is based on the interaction of Nrf2 with its nuclear partner MafK or runt-related transcription factor 2 (RunX2) and is dependent on the reconstitution of a "split" luciferase. Firefly luciferase is split into two fragments, which are genetically fused to Nrf2 and MafK or RunX2, respectively. BacMam technology was used to deliver the fusion constructs into cells for expression of the tagged proteins. When the BacMam-transduced cells were treated with Nrf2 activators, the Nrf2 protein was stabilized and translocated into the nucleus where it interacted with MafK or RunX2. The interaction of Nrf2 and MafK or RunX2 brought together the two luciferase fragments that form an active luciferase. The assay was developed in a 384-well format and was optimized by titrating the BacMam concentration, transduction time, cell density, and fetal bovine serum concentration. It was further validated with known Nrf2 activators. Our data show that this assay is robust, sensitive, and amenable to high throughput screening of a large compound collection for the identification of novel Nrf2 activators.

Functional Domains of the TOL Plasmid Transcription Factor XylS

PubMed Central

Kaldalu, Niilo; Toots, Urve; de Lorenzo, Victor; Ustav, Mart

2000-01-01

The alkylbenzoate degradation genes of Pseudomonas putida TOL plasmid are positively regulated by XylS, an AraC family protein, in a benzoate-dependent manner. In this study, we used deletion mutants and hybrid proteins to identify which parts of XylS are responsible for the DNA binding, transcriptional activation, and benzoate inducibility. We found that a 112-residue C-terminal fragment of XylS binds specifically to the Pm operator in vitro, protects this sequence from DNase I digestion identically to the wild-type (wt) protein, and activates the Pm promoter in vivo. When overexpressed, that C-terminal fragment could activate transcription as efficiently as wt XylS. All the truncations, which incorporated these 112 C-terminal residues, were able to activate transcription at least to some extent when overproduced. Intactness of the 210-residue N-terminal portion was found to be necessary for benzoate responsiveness of XylS. Deletions in the N-terminal and central regions seriously reduced the activity of XylS and caused the loss of effector control, whereas insertions into the putative interdomain region did not change the basic features of the XylS protein. Our results confirm that XylS consists of two parts which probably interact with each other. The C-terminal domain carries DNA-binding and transcriptional activation abilities, while the N-terminal region carries effector-binding and regulatory functions. PMID:10648539

Elongated Hypocotyl 5-Homolog (HYH) Negatively Regulates Expression of the Ambient Temperature-Responsive MicroRNA Gene MIR169

PubMed Central

Serivichyaswat, Phanu T.; Susila, Hendry; Ahn, Ji Hoon

2017-01-01

Arabidopsis microRNA169 (miR169) is an ambient temperature-responsive microRNA that plays an important role in stress responses and the floral transition. However, the transcription factors that regulate the expression of MIR169 have remained unknown. In this study, we show that Elongated Hypocotyl 5-Homolog (HYH) directly binds to the promoter of MIR169a and negatively regulates its expression. Absolute quantification identified MIR169a as the major locus producing miR169. GUS reporter assays revealed that the deletion of a 498-bp fragment (–1,505 to –1,007, relative to the major transcriptional start site) of MIR169a abolished its ambient temperature-responsive expression. DNA-affinity chromatography followed by liquid chromatography-mass spectrometry analysis identified transcription factor HYH as a trans-acting factor that binds to the 498-bp promoter fragment of pri-miR169a. Electrophoretic mobility shift assays and chromatin immunoprecipitation–quantitative PCR demonstrated that the HYH.2 protein, a predominant isoform of HYH, directly associated with a G-box-like motif in the 498-bp fragment of pri-miR169a. Higher enrichment of HYH.2 protein on the promoter region of MIR169a was seen at 23°C, consistent with the presence of more HYH.2 protein in the cell at the temperature. Transcript levels of pri-miR169a increased in hyh mutants and decreased in transgenic plants overexpressing HYH. Consistent with the negative regulation of MIR169a by HYH, the diurnal levels of HYH mRNA and pri-miR169a showed opposite patterns. Taken together, our results suggest that HYH is a transcription factor that binds to a G-box-like motif in the MIR169a promoter and negatively regulates ambient temperature-responsive expression of MIR169a at higher temperatures in Arabidopsis. PMID:29270188

Mitochondrial nad2 gene is co-transcripted with CMS-associated orfB gene in cytoplasmic male-sterile stem mustard (Brassica juncea).

PubMed

Yang, Jing-Hua; Zhang, Ming-Fang; Yu, Jing-Quan

2009-02-01

The transcriptional patterns of mitochondrial respiratory related genes were investigated in cytoplasmic male-sterile and fertile maintainer lines of stem mustard, Brassica juncea. There were numerous differences in nad2 (subunit 2 of NADH dehydrogenase) between stem mustard CMS and its maintainer line. One novel open reading frame, hereafter named orfB gene, was located at the downstream of mitochondrial nad2 gene in the CMS. The novel orfB gene had high similarity with YMF19 family protein, orfB in Raphanus sativus, Helianthus annuus, Nicotiana tabacum and Beta vulgaris, orfB-CMS in Daucus carota, atp8 gene in Arabidopsis thaliana, 5' flanking of orf224 in B. napus (nap CMS) and 5' flanking of orf220 gene in CMS Brassica juncea. Three copies probed by specific fragment (amplified by primers of nad2F and nad2R from CMS) were found in the CMS line following Southern blotting digested with HindIII, but only a single copy in its maintainer line. Meanwhile, two transcripts were shown in the CMS line following Northern blotting while only one transcript was detected in the maintainer line, which were probed by specific fragment (amplified by primers of nad2F and nad2R from CMS). Meanwhile, the expression of nad2 gene was reduced in CMS bud compared to that in its maintainer line. We thus suggested that nad2 gene may be co-transcripted with CMS-associated orfB gene in the CMS. In addition, the specific fragment that was amplified by primers of nad2F and nad2R just spanned partial sequences of nad2 gene and orfB gene. Such alterations in the nad2 gene would impact the activity of NADH dehydrogenase, and subsequently signaling, inducing the expression of nuclear genes involved in male sterility in this type of cytoplasmic male sterility.

FOXO1 orchestrates the bone-suppressing function of gut-derived serotonin

PubMed Central

Kode, Aruna; Mosialou, Ioanna; Silva, Barbara C.; Rached, Marie-Therese; Zhou, Bin; Wang, Ji; Townes, Tim M.; Hen, Rene; DePinho, Ronald A.; Guo, X. Edward; Kousteni, Stavroula

2012-01-01

Serotonin is a critical regulator of bone mass, fulfilling different functions depending on its site of synthesis. Brain-derived serotonin promotes osteoblast proliferation, whereas duodenal-derived serotonin suppresses it. To understand the molecular mechanisms of duodenal-derived serotonin action on osteoblasts, we explored its transcriptional mediation in mice. We found that the transcription factor FOXO1 is a crucial determinant of the effects of duodenum-derived serotonin on bone formation We identified two key FOXO1 complexes in osteoblasts, one with the transcription factor cAMP-responsive element–binding protein 1 (CREB) and another with activating transcription factor 4 (ATF4). Under normal levels of circulating serotonin, the proliferative activity of FOXO1 was promoted by a balance between its interaction with CREB and ATF4. However, high circulating serotonin levels prevented the association of FOXO1 with CREB, resulting in suppressed osteoblast proliferation. These observations identify FOXO1 as the molecular node of an intricate transcriptional machinery that confers the signal of duodenal-derived serotonin to inhibit bone formation. PMID:22945629

Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

PubMed

Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

2018-03-01

LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

PubMed Central

2011-01-01

In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV), a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP). We selected an 829 bp fragment of the nucleoprotein (N) gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively. PMID:21352564

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Nitric Oxide- and Hydrogen Peroxide-Responsive Gene Regulation during Cell Death Induction in Tobacco1[W

PubMed Central

Zago, Elisa; Morsa, Stijn; Dat, James F.; Alard, Philippe; Ferrarini, Alberto; Inzé, Dirk; Delledonne, Massimo; Van Breusegem, Frank

2006-01-01

Nitric oxide (NO) and hydrogen peroxide (H2O2) are regulatory molecules in various developmental processes and stress responses. Tobacco (Nicotiana tabacum) leaves exposed to moderate high light dramatically potentiated NO-mediated cell death in catalase-deficient (CAT1AS) but not in wild-type plants, providing genetic evidence for a partnership between NO and H2O2 during the induction of programmed cell death. With this experimental model system, the specific impact on gene expression was characterized by either NO or H2O2 alone or both molecules combined. By means of genome-wide cDNA-amplified fragment length polymorphism analysis, transcriptional changes were compared in high light-treated CAT1AS and wild-type leaves treated with or without the NO donor sodium nitroprusside. Differential gene expression was detected for 214 of the approximately 8,000 transcript fragments examined. For 108 fragments, sequence analysis revealed homology to genes with a role in signal transduction, defense response, hormone interplay, proteolysis, transport, and metabolism. Surprisingly, only 16 genes were specifically induced by the combined action of NO and H2O2, whereas the majority were regulated by either of them alone. At least seven transcription factors were mutually up-regulated, indicating significant overlap between NO and H2O2 signaling pathways. These results consolidate significant cross-talk between NO and H2O2, provide new insight into the early transcriptional response of plants to increased NO and H2O2 levels, and identify target genes of the combined action of NO and H2O2 during the induction of plant cell death. PMID:16603664

LBH589, A Hydroxamic Acid-Derived HDAC Inhibitor, is Neuroprotective in Mouse Models of Huntington’s Disease

PubMed Central

Chopra, Vanita; Quinti, Luisa; Khanna, Prarthana; Paganetti, Paolo; Kuhn, Rainer; Young, Anne B.; Kazantsev, Aleksey G.; Hersch, Steven

2016-01-01

Background: Modulation of gene transcription by HDAC inhibitors has been shown repeatedly to be neuroprotective in cellular, invertebrate, and rodent models of Huntington’s disease (HD). It has been difficult to translate these treatments to the clinic, however, because existing compounds have limited potency or brain bioavailability. Objective: In the present study, we assessed the therapeutic potential of LBH589, an orally bioavailable hydroxamic acid-derived nonselective HDAC inhibitor in mouse models of HD. Method: The efficacy of LBH589 is tested in two HD mouse models using various biochemical, behavioral and neuropathological outcome measures. Results: We show that LBH589 crosses the blood brain barrier; induces histone hyperacetylation and prevents striatal neuronal shrinkage in R6/2 HD mice. In full-length knock-in HD mice LBH589-treatment improves motor performance and reduces neuronal atrophy. Conclusions: Our efficacious results of LBH589 in fragment and full-length mouse models of HD suggest that LBH589 is a promising candidate for clinical assessment in HD patients and provides confirmation that non-selective HDAC inhibitors can be viable clinical candidates. PMID:27983565

LBH589, A Hydroxamic Acid-Derived HDAC Inhibitor, is Neuroprotective in Mouse Models of Huntington's Disease.

PubMed

Chopra, Vanita; Quinti, Luisa; Khanna, Prarthana; Paganetti, Paolo; Kuhn, Rainer; Young, Anne B; Kazantsev, Aleksey G; Hersch, Steven

2016-12-15

Modulation of gene transcription by HDAC inhibitors has been shown repeatedly to be neuroprotective in cellular, invertebrate, and rodent models of Huntington's disease (HD). It has been difficult to translate these treatments to the clinic, however, because existing compounds have limited potency or brain bioavailability. In the present study, we assessed the therapeutic potential of LBH589, an orally bioavailable hydroxamic acid-derived nonselective HDAC inhibitor in mouse models of HD. The efficacy of LBH589 is tested in two HD mouse models using various biochemical, behavioral and neuropathological outcome measures. We show that LBH589 crosses the blood brain barrier; induces histone hyperacetylation and prevents striatal neuronal shrinkage in R6/2 HD mice. In full-length knock-in HD mice LBH589-treatment improves motor performance and reduces neuronal atrophy. Our efficacious results of LBH589 in fragment and full-length mouse models of HD suggest that LBH589 is a promising candidate for clinical assessment in HD patients and provides confirmation that non-selective HDAC inhibitors can be viable clinical candidates.

Transcriptional activity across the Epstein-Barr virus genome in Raji cells during latency and after induction of an abortive lytic cycle.

PubMed

Kirchner, E A; Bornkamm, G W; Polack, A

1991-10-01

We have studied the relative rate of transcription across the Epstein-Barr virus genome in the Burkitt's lymphoma cell line Raji by nuclear run-on analysis during latency and after induction of an abortive lytic cycle with 12-0-tetradecanoylphorbol 13-acetate (TPA) and 5-iodo-2'-deoxyuridine (IUdR). During latency the entire, or almost the entire, viral genome was found to be transcriptionally active to a low or intermediate extent, with some variation in activity along the genome. The fragment with the highest transcriptional activity was EcoRI J, which contains the genes encoding the small nuclear RNAs EBER1 and -2, transcribed predominantly by RNA polymerase III. An intermediate level of transcription was observed between positions 10 and 138 (kb), with areas of slightly higher activity on the large internal repeats and the left duplicated region (DL). The remaining part of the viral genome, between position 138 and the termini, and the termini and position 10 (kb) (with the exception of the EcoRI J fragment), showed very little transcriptional activity, except for the intermediately active regions carrying the righthand oriLyt (DR) and the terminal repeats. Upon induction of the viral genome with TPA and IUdR, the viral genome was transcriptionally active at a rate at least tenfold that seen during latency. Polymerases were not equally distributed along the genome after induction; the highest density was found in regions 48 to 58 kb, 82 to 84 kb, 102 to 104 kb, 118 to 122 kb and 142 to 145 kb of the viral genome. High transcriptional activity correlated with distinct transcription units in some cases, i.e. BamHI H1LF1 (DL), BamHI MLF1, BamHI ZLF1/BamHI RLF1 and BamHI X (thymidine kinase), but not in others (BamHI H2). Besides initiation of transcription, other regulatory processes such as stabilization and processing of primary transcripts may also contribute to regulation of virus gene expression. Addition of cycloheximide completely abolished the transcriptional activation of the genome mediated by TPA and IUdR.

Characterization of circulating transfer RNA-Derived RNA fragments in cattle

USDA-ARS?s Scientific Manuscript database

The objective was to characterize naturally occurring circulating transfer RNA-derived RNA Fragments (tRFs) in cattle. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences a...

7-Methylxanthine methyltransferase of coffee plants. Gene isolation and enzymatic properties.

PubMed

Ogawa, M; Herai, Y; Koizumi, N; Kusano, T; Sano, H

2001-03-16

Caffeine is synthesized through sequential three-step methylation of xanthine derivatives at positions 7-N, 3-N, and 1-N. However, controversy exists as to the number and properties of the methyltransferases involved. Using primers designed on the basis of conserved amino acid regions of tea caffeine synthase and Arabidopsis hypothetical proteins, a particular DNA fragment was amplified from an mRNA population of coffee plants. Subsequently, this fragment was used as a probe, and four independent clones were isolated from a cDNA library derived from coffee young leaves. Upon expression in Escherichia coli, one of them was found to encode a protein possessing 7-methylxanthine methyltransferase activity and was designated as CaMXMT. It consists of 378 amino acids with a relative molecular mass of 42.7 kDa and shows similarity to tea caffeine synthase (35.8%) and salicylic acid methyltransferase (34.1%). The bacterially expressed protein exhibited an optimal pH for activity ranging between 7 and 9 and methylated almost exclusively 7-methylxanthine with low activity toward paraxanthine, indicating a strict substrate specificity regarding the 3-N position of the purine ring. K(m) values were estimated to be 50 and 12 microM for 7-methylxanthine and S-adenosyl-l-methionine, respectively. Transcripts of CaMXMT could be shown to accumulate in young leaves and stems containing buds, and green fluorescent protein fusion protein assays indicated localization in cytoplasmic fractions. The results suggest that, in coffee plants, caffeine is synthesized through three independent methylation steps from xanthosine, in which CaMXMT catalyzes the second step to produce theobromine.

A peptide fragment of ependymin neurotrophic factor uses protein kinase C and the mitogen-activated protein kinase pathway to activate c-Jun N-terminal kinase and a functional AP-1 containing c-Jun and c-Fos proteins in mouse NB2a cells.

PubMed

Adams, David S; Hasson, Brendan; Boyer-Boiteau, Anne; El-Khishin, Adam; Shashoua, Victor E

2003-05-01

Ependymin (EPN) is a goldfish brain neurotrophic factor previously shown to function in a variety of cellular events related to long-term memory formation and neuronal regeneration. CMX-8933, an 8-amino-acid synthetic peptide fragment of EPN, was designed for aiding an investigation of the biological properties of this glycoprotein. We reported from previous studies that treatment of mouse neuroblastoma (NB2a) cultures with CMX-8933 promotes activation of transcription factor AP-1, a characteristic previously associated with the following full-length neurotrophic factors: nerve growth factor, neurotropin-3, and brain-derived neurotrophic factor. The CMX-8933-activated AP-1 specifically bound an AP-1 consensus probe and appeared to contain c-Jun and c-Fos protein components in antibody supershift experiments. Because AP-1 influences a variety of positive and negative cellular processes, determined in part by its exact protein composition and mechanism of activation, we extended these initial AP-1 observations in the current study to confirm the identity of the CMX-8933-activated c-Jun and c-Fos components. CMX-8933 increases the enzymatic activity of c-Jun N-terminal kinase (JNK), increases the phosphorylation of JNK and c-Jun proteins, and increases the cellular titers of c-Jun and c-Fos mRNAs. Furthermore, the AP-1 activated by CMX-8933 is functional, insofar as it transactivates both synthetic and natural AP-1-dependent reporter plasmids. Inhibition studies indicate that activation of the 8933-induced AP-1 occurs via the mitogen-activated protein kinase pathway. These data are in agreement with the recently proposed model for the conversion of short- to long-term synaptic plasticity and memory, in which a JNK-activated transcription factor AP-1, containing c-Jun and c-Fos components, functions at the top of a hierarchy of transcription factors known to regulate long-term neural plasticity. Copyright 2003 Wiley-Liss, Inc.

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants

PubMed Central

Shis, David L.; Bennett, Matthew R.

2013-01-01

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host’s native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits. PMID:23479654

Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants.

PubMed

Shis, David L; Bennett, Matthew R

2013-03-26

The construction of synthetic gene circuits relies on our ability to engineer regulatory architectures that are orthogonal to the host's native regulatory pathways. However, as synthetic gene circuits become larger and more complicated, we are limited by the small number of parts, especially transcription factors, that work well in the context of the circuit. The current repertoire of transcription factors consists of a limited selection of activators and repressors, making the implementation of transcriptional logic a complicated and component-intensive process. To address this, we modified bacteriophage T7 RNA polymerase (T7 RNAP) to create a library of transcriptional AND gates for use in Escherichia coli by first splitting the protein and then mutating the DNA recognition domain of the C-terminal fragment to alter its promoter specificity. We first demonstrate that split T7 RNAP is active in vivo and compare it with full-length enzyme. We then create a library of mutant split T7 RNAPs that have a range of activities when used in combination with a complimentary set of altered T7-specific promoters. Finally, we assay the two-input function of both wild-type and mutant split T7 RNAPs and find that regulated expression of the N- and C-terminal fragments of the split T7 RNAPs creates AND logic in each case. This work demonstrates that mutant split T7 RNAP can be used as a transcriptional AND gate and introduces a unique library of components for use in synthetic gene circuits.

Cloning of a methanol-inducible moxF promoter and its analysis in moxB mutants of Methylobacterium extorquens AM1rif.

PubMed Central

Morris, C J; Lidstrom, M E

1992-01-01

In Methylobacterium extorquens AM1, gene encoding methanol dehydrogenase polypeptides are transcriptionally regulated in response to C1 compounds, including methanol (M. E. Lidstrom and D. I. Stirling, Annu. Rev. Microbiol. 44:27-57, 1990). In order to study this regulation, a transcriptional fusion has been constructed between a beta-galactosidase reporter gene and a 1.55-kb XhoI-SalI fragment of M. extorquens AM1rif DNA encoding the N terminus of the methanol dehydrogenase large subunit (moxF) and 1,289 bp of upstream DNA. The fusion exhibited orientation-specific promoter activity in M. extorquens AM1rif but was expressed constitutively when the transcriptional fusion was located on the plasmid. However, correct regulation was restored when the construction was inserted in the M. extorquens AM1rif chromosome. This DNA fragment was shown to contain both the moxFJGI promoter and the sequences necessary in cis for its transcriptional regulation by methanol. Transcription from this promoter was studied in the M. extorquens AM1rif moxB mutant strains UV4rif and UV25rif, which have a pleiotropic phenotype with regard to the components of methanol oxidation. In these mutants, beta-galactosidase activity from the fusion was reduced to a level equal to that of the vector background when the fusion was present in both plasmid and chromosomal locations. Since both constitutive and methanol-inducible promoter activities were lost in the mutants, moxB appears to be required for transcription of the genes encoding the methanol dehydrogenase polypeptides. Images PMID:1624436

Modeling the integration of bacterial rRNA fragments into the human cancer genome.

PubMed

Sieber, Karsten B; Gajer, Pawel; Dunning Hotopp, Julie C

2016-03-21

Cancer is a disease driven by the accumulation of genomic alterations, including the integration of exogenous DNA into the human somatic genome. We previously identified in silico evidence of DNA fragments from a Pseudomonas-like bacteria integrating into the 5'-UTR of four proto-oncogenes in stomach cancer sequencing data. The functional and biological consequences of these bacterial DNA integrations remain unknown. Modeling of these integrations suggests that the previously identified sequences cover most of the sequence flanking the junction between the bacterial and human DNA. Further examination of these reads reveals that these integrations are rich in guanine nucleotides and the integrated bacterial DNA may have complex transcript secondary structures. The models presented here lay the foundation for future experiments to test if bacterial DNA integrations alter the transcription of the human genes.

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Motif discovery and motif finding from genome-mapped DNase footprint data.

PubMed

Kulakovskiy, Ivan V; Favorov, Alexander V; Makeev, Vsevolod J

2009-09-15

Footprint data is an important source of information on transcription factor recognition motifs. However, a footprinting fragment can contain no sequences similar to known protein recognition sites. Inspection of genome fragments nearby can help to identify missing site positions. Genome fragments containing footprints were supplied to a pipeline that constructed a position weight matrix (PWM) for different motif lengths and selected the optimal PWM. Fragments were aligned with the SeSiMCMC sampler and a new heuristic algorithm, Bigfoot. Footprints with missing hits were found for approximately 50% of factors. Adding only 2 bp on both sides of a footprinting fragment recovered most hits. We automatically constructed motifs for 41 Drosophila factors. New motifs can recognize footprints with a greater sensitivity at the same false positive rate than existing models. Also we discuss possible overfitting of constructed motifs. Software and the collection of regulatory motifs are freely available at http://line.imb.ac.ru/DMMPMM.

Study the fragment size distribution in dynamic fragmentation of laser shock loding tin

NASA Astrophysics Data System (ADS)

He, Weihua; Xin, Jianting; Chu, Genbai; Shui, Min; Xi, Tao; Zhao, Yongqiang; Gu, Yuqiu

2017-06-01

Characterizing the distribution of fragment size produced from dynamic fragmentation process is very important for fundamental science like predicting material dymanic response performance and for a variety of engineering applications. However, only a few data about fragment mass or size have been obtained due to its great challenge in its dynamic measurement. This paper would focus on investigating the fragment size distribution from the dynamic fragmentation of laser shock-loaded metal. Material ejection of tin sample with wedge shape groove in the free surface is collected with soft recovery technique. Via fine post-shot analysis techniques including X-ray micro-tomography and the improved watershed method, it is found that fragments can be well detected. To characterize their size distributions, a random geometric statistics method based on Poisson mixtures was derived for dynamic heterogeneous fragmentation problem, which leads to a linear combinational exponential distribution. Finally we examined the size distribution of laser shock-loaded tin with the derived model, and provided comparisons with other state-of-art models. The resulting comparisons prove that our proposed model can provide more reasonable fitting result for laser shock-loaded metal.

Cell signaling and transcription factor genes expressed during whole body regeneration in a colonial chordate.

PubMed

Rinkevich, Yuval; Rinkevich, Baruch; Reshef, Ram

2008-10-12

The restoration of adults from fragments of blood vessels in botryllid ascidians (termed whole body regeneration [WBR]) represents an inimitable event in the chordates, which is poorly understood on the mechanistic level. To elucidate mechanisms underlying this phenomenon, a subtracted EST library for early WBR stages was previously assembled, revealing 76 putative genes belonging to major signaling pathways, including Notch/Delta, JAK/STAT, protein kinases, nuclear receptors, Ras oncogene family members, G-Protein coupled receptor (GPCR) and transforming growth factor beta (TGF-beta) signaling. RT-PCR on selected transcripts documented specific up-regulation in only regenerating fragments, pointing to a broad activation of these signaling pathways at onset of WBR. The followed-up expression pattern of seven representative transcripts from JAK/STAT signaling (Bl-STAT), the Ras oncogene family (Bl-Rap1A, Bl-Rab-33), the protein kinase family (Bl-Mnk), Bl-Cnot, Bl-Slit and Bl-Bax inhibitor, revealed systemic and site specific activations during WBR in a sub-population of circulatory cells. WBR in the non-vertebrate chordate Botrylloides leachi is a multifaceted phenomenon, presided by a complex array of cell signaling and transcription factors. Above results, provide a first insight into the whole genome molecular machinery of this unique regeneration process, and reveal the broad participation of cell signaling and transcription factors in the process. While regeneration involves the participation of specific cell populations, WBR signals are systemically expressed at the organism level.

Transcriptional regulation of the human mitochondrial peptide deformylase (PDF).

PubMed

Pereira-Castro, Isabel; Costa, Luís Teixeira da; Amorim, António; Azevedo, Luisa

2012-05-18

The last years of research have been particularly dynamic in establishing the importance of peptide deformylase (PDF), a protein of the N-terminal methionine excision (NME) pathway that removes formyl-methionine from mitochondrial-encoded proteins. The genomic sequence of the human PDF gene is shared with the COG8 gene, which encodes a component of the oligomeric golgi complex, a very unusual case in Eukaryotic genomes. Since PDF is crucial in maintaining mitochondrial function and given the atypical short distance between the end of COG8 coding sequence and the PDF initiation codon, we investigated whether the regulation of the human PDF is affected by the COG8 overlapping partner. Our data reveals that PDF has several transcription start sites, the most important of which only 18 bp from the initiation codon. Furthermore, luciferase-activation assays using differently-sized fragments defined a 97 bp minimal promoter region for human PDF, which is capable of very strong transcriptional activity. This fragment contains a potential Sp1 binding site highly conserved in mammalian species. We show that this binding site, whose mutation significantly reduces transcription activation, is a target for the Sp1 transcription factor, and possibly of other members of the Sp family. Importantly, the entire minimal promoter region is located after the end of COG8's coding region, strongly suggesting that the human PDF preserves an independent regulation from its overlapping partner. Copyright © 2012 Elsevier Inc. All rights reserved.

Cleavage of rRNA ensures translational cessation in sperm at fertilization

PubMed Central

Johnson, G.D.; Sendler, E.; Lalancette, C.; Hauser, R.; Diamond, M.P.; Krawetz, S.A.

2011-01-01

Intact ribosomal RNAs (rRNAs) comprise the majority of somatic transcripts, yet appear conspicuously absent in spermatozoa, perhaps reflecting cytoplasmic expulsion during spermatogenesis. To discern their fate, total RNA retained in mature spermatozoa from three fertile donors was characterized by Next Generation Sequencing. In all samples, >75% of total sequence reads aligned to rRNAs. The distribution of reads along the length of these transcripts exhibited a high degree of non-uniformity that was reiterated between donors. The coverage of sequencing reads was inversely correlated with guanine-cytosine (GC)-richness such that sequences greater than ∼70% GC were virtually absent in all sperm RNA samples. To confirm the loss of sequence, the relative abundance of specific regions of the 28S transcripts in sperm was established by 7-Deaza-2′-deoxy-guanosine-5′-triphosphate RT–PCR. The inability to amplify specific regions of the 28S sequence from sperm despite the abundant representation of this transcript in the sequencing libraries demonstrates that approximately three-quarters of RNA retained in the mature male gamete are products of rRNA fragmentation. Hence, cleavage (not expulsion of the RNA component of the translational machinery) is responsible for preventing spurious translation following spermiogenesis. These results highlight the potential importance of those transcripts, including many mRNAs, which evade fragmentation and remain intact when sperm are delivered at fertilization. Sequencing data are deposited in GEO as: GSE29160. PMID:21831882

Molecular mechanism of transcription inhibition by phage T7 gp2 protein.

PubMed

Mekler, Vladimir; Minakhin, Leonid; Sheppard, Carol; Wigneshweraraj, Sivaramesh; Severinov, Konstantin

2011-11-11

Escherichia coli T7 bacteriophage gp2 protein is a potent inhibitor of host RNA polymerase (RNAP). gp2 inhibits formation of open promoter complex by binding to the β' jaw, an RNAP domain that interacts with downstream promoter DNA. Here, we used an engineered promoter with an optimized sequence to obtain and characterize a specific promoter complex containing RNAP and gp2. In this complex, localized melting of promoter DNA is initiated but does not propagate to include the point of the transcription start. As a result, the complex is transcriptionally inactive. Using a highly sensitive RNAP beacon assay, we performed quantitative real-time measurements of specific binding of the RNAP-gp2 complex to promoter DNA and various promoter fragments. In this way, the effect of gp2 on RNAP interaction with promoters was dissected. As expected, gp2 greatly decreased RNAP affinity to downstream promoter duplex. However, gp2 also inhibited RNAP binding to promoter fragments that lacked downstream promoter DNA that interacts with the β' jaw. The inhibition was caused by gp2-mediated decrease of the RNAP binding affinity to template and non-template strand segments of the transcription bubble downstream of the -10 promoter element. The inhibition of RNAP interactions with single-stranded segments of the transcription bubble by gp2 is a novel effect, which may occur via allosteric mechanism that is set in motion by the gp2 binding to the β' jaw. Copyright © 2011 Elsevier Ltd. All rights reserved.

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus

PubMed Central

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-01-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function. PMID:25333630

Structure-based design of novel naproxen derivatives targeting monomeric nucleoprotein of Influenza A virus.

PubMed

Tarus, Bogdan; Bertrand, Hélène; Zedda, Gloria; Di Primo, Carmelo; Quideau, Stéphane; Slama-Schwok, Anny

2015-09-01

The nucleoprotein (NP) binds the viral RNA genome as oligomers assembled with the polymerase in a ribonucleoprotein complex required for transcription and replication of influenza A virus. Novel antiviral candidates targeting the nucleoprotein either induced higher order oligomers or reduced NP oligomerization by targeting the oligomerization loop and blocking its insertion into adjacent nucleoprotein subunit. In this study, we used a different structure-based approach to stabilize monomers of the nucleoprotein by drugs binding in its RNA-binding groove. We recently identified naproxen as a drug competing with RNA binding to NP with antiinflammatory and antiviral effects against influenza A virus. Here, we designed novel derivatives of naproxen by fragment extension for improved binding to NP. Molecular dynamics simulations suggested that among these derivatives, naproxen A and C0 were most promising. Their chemical synthesis is described. Both derivatives markedly stabilized NP monomer against thermal denaturation. Naproxen C0 bound tighter to NP than naproxen at a binding site predicted by MD simulations and shown by competition experiments using wt NP or single-point mutants as determined by surface plasmon resonance. MD simulations suggested that impeded oligomerization and stabilization of monomeric NP is likely to be achieved by drugs binding in the RNA grove and inducing close to their binding site conformational changes of key residues hosting the oligomerization loop as observed for the naproxen derivatives. Naproxen C0 is a potential antiviral candidate blocking influenza nucleoprotein function.

Complexation of molecular clips containing fragments of diphenylglycoluril and benzocrown ethers with paraquat and its derivatives

PubMed Central

Kikot', Leonid S; Kulygina, Catherine Yu; Lyapunov, Alexander Yu; Shishkina, Svetlana V; Zubatyuk, Roman I; Bogaschenko, Tatiana Yu

2017-01-01

The complexation of molecular clips containing fragments of diphenylglycoluril and benzocrown ethers with paraquat and its derivatives has been studied both in solution and in the solid state. In this paper we studied the influence of the crown ether ring size and the nature of the substituents at the nitrogen atoms of the paraquat derivatives on the composition and stability of these complexes. PMID:29062427

Annotation of Differentially Expressed Genes in the Somatic Embryogenesis of Musa and Their Location in the Banana Genome

PubMed Central

Maldonado-Borges, Josefina Ines; Ku-Cauich, José Roberto; Escobedo-GraciaMedrano, Rosa Maria

2013-01-01

Analysis of cDNA-AFLP was used to study the genes expressed in zygotic and somatic embryogenesis of Musa acuminata Colla ssp. malaccensis, and a comparison was made between their differential transcribed fragments (TDFs) and the sequenced genome of the double haploid- (DH-) Pahang of the malaccensis subspecies that is available in the network. A total of 253 transcript-derived fragments (TDFs) were detected with apparent size of 100–4000 bp using 5 pairs of AFLP primers, of which 21 were differentially expressed during the different stages of banana embryogenesis; 15 of the sequences have matched DH-Pahang chromosomes, with 7 of them being homologous to gene sequences encoding either known or putative protein domains of higher plants. Four TDF sequences were located in all Musa chromosomes, while the rest were located in one or two chromosomes. Their putative individual function is briefly reviewed based on published information, and the potential roles of these genes in embryo development are discussed. Thus the availability of the genome of Musa and the information of TDFs sequences presented here opens new possibilities for an in-depth study of the molecular and biochemical research of zygotic and somatic embryogenesis of Musa. PMID:24027442

The VP35 and VP40 proteins of filoviruses. Homology between Marburg and Ebola viruses.

PubMed

Bukreyev, A A; Volchkov, V E; Blinov, V M; Netesov, S V

1993-05-03

The fragments of genomic RNA sequences of Marburg (MBG) and Ebola (EBO) viruses are reported. These fragments were found to encode the VP35 and VP40 proteins. The canonic sequences were revealed before and after each open reading frame. It is suggested that these sequences are mRNA extremities and at the same time the regulatory elements for mRNA transcription. Homology between the MBG and EBO proteins was discovered.

Glucocorticoid receptor represses brain-derived neurotrophic factor expression in neuron-like cells.

PubMed

Chen, Hui; Lombès, Marc; Le Menuet, Damien

2017-04-12

Brain-derived neurotrophic factor (BDNF) is involved in many functions such as neuronal growth, survival, synaptic plasticity and memorization. Altered expression levels are associated with many pathological situations such as depression, epilepsy, Alzheimer's, Huntington's and Parkinson's diseases. Glucocorticoid receptor (GR) is also crucial for neuron functions, via binding of glucocorticoid hormones (GCs). GR actions largely overlap those of BDNF. It has been proposed that GR could be a regulator of BDNF expression, however the molecular mechanisms involved have not been clearly defined yet. Herein, we analyzed the effect of a GC agonist dexamethasone (DEX) on BDNF expression in mouse neuronal primary cultures and in the newly characterized, mouse hippocampal BZ cell line established by targeted oncogenesis. Mouse Bdnf gene exhibits a complex genomic structure with 8 untranslated exons (I to VIII) splicing onto one common and unique coding exon IX. We found that DEX significantly downregulated total BDNF mRNA expression by around 30%. Expression of the highly expressed exon IV and VI containing transcripts was also reduced by DEX. The GR antagonist RU486 abolished this effect, which is consistent with specific GR-mediated action. Transient transfection assays allowed us to define a short 275 bp region within exon IV promoter responsible for GR-mediated Bdnf repression. Chromatin immunoprecipitation experiments demonstrated GR recruitment onto this fragment, through unidentified transcription factor tethering. Altogether, GR downregulates Bdnf expression through direct binding to Bdnf regulatory sequences. These findings bring new insights into the crosstalk between GR and BDNF signaling pathways both playing a major role in physiology and pathology of the central nervous system.

Preclinical activity of combined HDAC and KDM1A inhibition in glioblastoma

PubMed Central

Singh, Melissa M.; Johnson, Blake; Venkatarayan, Avinashnarayan; Flores, Elsa R.; Zhang, Jianping; Su, Xiaoping; Barton, Michelle; Lang, Frederick; Chandra, Joya

2015-01-01

Background Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem cell (GSC) population or has an effect in vivo is yet to be determined. Therefore, we evaluated the translational potential of combined HDAC and KDM1A inhibition on patient-derived GSCs and xenograft GBM mouse models. We also investigated the changes in transcriptional programing induced by the combination in an effort to understand the induced molecular mechanisms of GBM cell death. Methods Patient-derived GSCs were treated with the combination of vorinostat, a pan-HDAC inhibitor, and tranylcypromine, a KDM1A inhibitor, and viability was measured. To characterize transcriptional profiles associated with cell death, we used RNA-Seq and validated gene changes by RT-qPCR and protein expression via Western blot. Apoptosis was measured using DNA fragmentation assays. Orthotopic xenograft studies were conducted to evaluate the effects of the combination on tumorigenesis and to validate gene changes in vivo. Results The combination of vorinostat and tranylcypromine reduced GSC viability and displayed efficacy in the U87 xenograft model. Additionally, the combination led to changes in apoptosis-related genes, particularly TP53 and TP73 in vitro and in vivo. Conclusions These data support targeting HDACs and KDM1A in combination as a strategy for GBM and identifies TP53 and TP73 as being altered in response to treatment. PMID:25795306

Mode of inheritance and evidence for cistron heterogeneity of chloroplast 16S ribosomal RNA genes in Nicotiana.

PubMed

Vacek, A T; Bourque, D P

1980-09-01

Oligonucleotide maps (fingerprints) of T1 RNase digests of 125I-labeled 16 S chloroplast rRNA of Nicotiana tabacum and N. gossei revealed the presence of T1 oligonucleotide fragment 100 in the 16 S rRNA of N. gossei while N. tabacum 16 S rRNA had a unique T1 oligonucleotide (fragment 101) as well as some fragment 100. From the positions in the fingerprints and from fingerprints of secondary enzymatic digestion of the fragments, we conclude that fragments 100 and 101 are similar in sequence and size, but fragment 100 probably contains an extra uracil residue. This difference is shown to be maternally inherited, thus confirming the location of 16 S chloroplast rRNA genes on chloroplast DNA and ruling out the possibility of genetically active chloroplast rRNA genes in the nucleus. The presence of both fragments 100 and 101 in N. tabacum may indicate sequence heterogeneity between the two cistrons for 16 S chloroplast rRNA. These results demonstrate the feasibility of determining the inheritance of organelle genes by genetic analysis of their primary transcripts.

Autoantibodies to IA-2 in IDDM: location of major antigenic determinants.

PubMed

Zhang, B; Lan, M S; Notkins, A L

1997-01-01

Thirty-three IDDM sera that immunoprecipitated full-length IA-2 were tested for reactivity with different fragments of the IA-2 molecule. The fragments were prepared by PCR amplification of IA-2 cDNA and by expression in a rabbit reticulocyte transcription/translation system. Whereas all 33 sera reacted with the intracellular domain (amino acid 604 to 979), none of the sera reacted with the extracellular domain of IA-2 (amino acid 31 to 577). Analysis of the reactivity of IDDM sera with the different regions of the intracellular domain showed that 94% (31 of the 33) reacted with the COOH-terminus (amino acid 771 to 979), 40% reacted with the NH2-terminus (amino acid 604 to 776), and 40% reacted with the middle portion (amino acid 692 to 875). Of the 31 sera that reacted with the COOH-terminus, 14 of these reacted only with the COOH-terminus and with no other region. Of the 13 sera that reacted with the NH2-terminus, only one reacted exclusively with the NH2-terminus. Treatments of the different domains of IA-2 with trypsin showed that only the COOH-terminus was resistant to trypsin, arguing that it is from this region of the IA-2 molecule that the 40-kDa tryptic fragment from insulinoma cells is derived. From these experiments, it is concluded that the major antigenic determinant of IA-2 is located at the COOH-terminus and that minor antigenic determinants are located at the NH2-terminus and middle portion of the intracellular domain.

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Identification of novel transcriptional regulators of Zat12 using comprehensive yeast one-hybrid screens.

PubMed

Ben Daniel, Bat-Hen; Cattan, Esther; Wachtel, Chaim; Avrahami, Dorit; Glick, Yair; Malichy, Asaf; Gerber, Doron; Miller, Gad

2016-08-01

To appropriately acclimate to environmental stresses, plants have to rapidly activate a specific transcriptional program. Yet, the identity and function of many of the transcriptional regulators that mediate early responses to abiotic stress stimuli is still unknown. In this work we employed the promoter of the multi-stress-responsive zinc-finger protein Zat12 in yeast one-hybrid (Y1H) screens to identify early abiotic stress-responsive transcriptional regulators. Analysis of Zat12 promoter fragments fused to luciferase underlined an approximately 200 bp fragment responsive to NaCl and to reactive oxygen species (ROS). Using these segments and others as baits against Y1H control or stress Arabidopsis prey libraries, we identified 15 potential Zat12 transcriptional regulators. Among the prominent proteins identified were known transcription factors including bZIP29 and ANAC91 as well as unknown function proteins such as a homolog of the human USB1, a U6 small nuclear RNA (snRNA) processing protein, and dormancy/auxin-associated family protein 2 (DRM2). Altered expression of Zat12 during high light stress in the knockout mutants further indicated the involvement of these proteins in the regulation of Zat12. Using a state of the art microfluidic approach we showed that AtUSB1 and DRM2 can specifically bind dsDNA and were able to identify the preferred DNA-binding motif of all four proteins. Overall, the proteins identified in this work provide an important start point for charting the earliest signaling network of Zat12 and of other genes required for acclimation to abiotic stresses. © 2016 Scandinavian Plant Physiology Society.

Chromosome map of the thermophilic archaebacterium Thermococcus celer

NASA Technical Reports Server (NTRS)

Noll, K. M.; Woese, C. R. (Principal Investigator)

1989-01-01

A physical map for the chromosome of the thermophilic archaebacterium Thermococcus celer Vu13 has been constructed. Thirty-four restriction endonucleases were tested for their ability to generate large restriction fragments from the chromosome of T. celer. Of these, the enzymes NheI, SpeI, and XbaI yielded the fewest fragments when analyzed by pulsed-field electrophoresis. NheI and SpeI each gave 5 fragments, while XbaI gave 12. The size of the T. celer chromosome was determined from the sum of the apparent sizes of restriction fragments derived from single and double digests by using these enzymes and was found to be 1,890 +/- 27 kilobase pairs. Partial and complete digests allowed the order of all but three small (less than 15 kilobase pairs) fragments to be deduced. These three fragments were assigned positions by using hybridization probes derived from these restriction fragments. The positions of the other fragments were confirmed by using hybridization probes derived in the same manner. The positions of the 5S, 16S, and 23S rRNA genes as well as the 7S RNA gene were located on this map by using cloned portions of these genes as hybridization probes. The 5S rRNA gene was localized 48 to 196 kilobases from the 5' end of the 16S gene. The 7S RNA gene was localized 190 to 504 kilobases from the 3' end of the 23S gene. These analyses demonstrated that the chromosome of T. celer is a single, circular DNA molecule. This is the first such demonstration of the structure of an archaebacterial chromosome.

The complete mitochondrial genome of the Antarctic springtail Cryptopygus antarcticus (Hexapoda: Collembola)

PubMed Central

Carapelli, Antonio; Comandi, Sara; Convey, Peter; Nardi, Francesco; Frati, Francesco

2008-01-01

Background Mitogenomics data, i.e. complete mitochondrial genome sequences, are popular molecular markers used for phylogenetic, phylogeographic and ecological studies in different animal lineages. Their comparative analysis has been used to shed light on the evolutionary history of given taxa and on the molecular processes that regulate the evolution of the mitochondrial genome. A considerable literature is available in the fields of invertebrate biochemical and ecophysiological adaptation to extreme environmental conditions, exemplified by those of the Antarctic. Nevertheless, limited molecular data are available from terrestrial Antarctic species, and this study represents the first attempt towards the description of a mitochondrial genome from one of the most widespread and common collembolan species of Antarctica. Results In this study we describe the mitochondrial genome of the Antarctic collembolan Cryptopygus antarcticus Willem, 1901. The genome contains the standard set of 37 genes usually present in animal mtDNAs and a large non-coding fragment putatively corresponding to the region (A+T-rich) responsible for the control of replication and transcription. All genes are arranged in the gene order typical of Pancrustacea. Three additional short non-coding regions are present at gene junctions. Two of these are located in positions of abrupt shift of the coding polarity of genes oriented on opposite strands suggesting a role in the attenuation of the polycistronic mRNA transcription(s). In addition, remnants of an additional copy of trnL(uag) are present between trnS(uga) and nad1. Nucleotide composition is biased towards a high A% and T% (A+T = 70.9%), as typically found in hexapod mtDNAs. There is also a significant strand asymmetry, with the J-strand being more abundant in A and C. Within the A+T-rich region, some short sequence fragments appear to be similar (in position and primary sequence) to those involved in the origin of the N-strand replication of the Drosophila mtDNA. Conclusion The mitochondrial genome of C. antarcticus shares several features with other pancrustacean genomes, although the presence of unusual non-coding regions is also suggestive of molecular rearrangements that probably occurred before the differentiation of major collembolan families. Closer examination of gene boundaries also confirms previous observations on the presence of unusual start and stop codons, and suggests a role for tRNA secondary structures as potential cleavage signals involved in the maturation of the primary transcript. Sequences potentially involved in the regulation of replication/transcription are present both in the A+T-rich region and in other areas of the genome. Their position is similar to that observed in a limited number of insect species, suggesting unique replication/transcription mechanisms for basal and derived hexapod lineages. This initial description and characterization of the mitochondrial genome of C. antarcticus will constitute the essential foundation prerequisite for investigations of the evolutionary history of one of the most speciose collembolan genera present in Antarctica and other localities of the Southern Hemisphere. PMID:18593463

Natural-product-derived fragments for fragment-based ligand discovery

NASA Astrophysics Data System (ADS)

Over, Björn; Wetzel, Stefan; Grütter, Christian; Nakai, Yasushi; Renner, Steffen; Rauh, Daniel; Waldmann, Herbert

2013-01-01

Fragment-based ligand and drug discovery predominantly employs sp2-rich compounds covering well-explored regions of chemical space. Despite the ease with which such fragments can be coupled, this focus on flat compounds is widely cited as contributing to the attrition rate of the drug discovery process. In contrast, biologically validated natural products are rich in stereogenic centres and populate areas of chemical space not occupied by average synthetic molecules. Here, we have analysed more than 180,000 natural product structures to arrive at 2,000 clusters of natural-product-derived fragments with high structural diversity, which resemble natural scaffolds and are rich in sp3-configured centres. The structures of the cluster centres differ from previously explored fragment libraries, but for nearly half of the clusters representative members are commercially available. We validate their usefulness for the discovery of novel ligand and inhibitor types by means of protein X-ray crystallography and the identification of novel stabilizers of inactive conformations of p38α MAP kinase and of inhibitors of several phosphatases.

Identification, cloning and characterization of the tomato TCP transcription factor family.

PubMed

Parapunova, Violeta; Busscher, Marco; Busscher-Lange, Jacqueline; Lammers, Michiel; Karlova, Rumyana; Bovy, Arnaud G; Angenent, Gerco C; de Maagd, Ruud A

2014-06-06

TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development.

Identification, cloning and characterization of the tomato TCP transcription factor family

PubMed Central

2014-01-01

Background TCP proteins are plant-specific transcription factors, which are known to have a wide range of functions in different plant species such as in leaf development, flower symmetry, shoot branching, and senescence. Only a small number of TCP genes has been characterised from tomato (Solanum lycopersicum). Here we report several functional features of the members of the entire family present in the tomato genome. Results We have identified 30 Solanum lycopersicum SlTCP genes, most of which have not been described before. Phylogenetic analysis clearly distinguishes two homology classes of the SlTCP transcription factor family - class I and class II. Class II differentiates in two subclasses, the CIN-TCP subclass and the CYC/TB1 subclass, involved in leaf development and axillary shoots formation, respectively. The expression patterns of all members were determined by quantitative PCR. Several SlTCP genes, like SlTCP12, SlTCP15 and SlTCP18 are preferentially expressed in the tomato fruit, suggesting a role during fruit development or ripening. These genes are regulated by RIN (RIPENING INHIBITOR), CNR (COLORLESS NON-RIPENING) and SlAP2a (APETALA2a) proteins, which are transcription factors with key roles in ripening. With a yeast one-hybrid assay we demonstrated that RIN binds the promoter fragments of SlTCP12, SlTCP15 and SlTCP18, and that CNR binds the SlTCP18 promoter. This data strongly suggests that these class I SlTCP proteins are involved in ripening. Furthermore, we demonstrate that SlTCPs bind the promoter fragments of members of their own family, indicating that they regulate each other. Additional yeast one-hybrid studies performed with Arabidopsis transcription factors revealed binding of the promoter fragments by proteins involved in the ethylene signal transduction pathway, contributing to the idea that these SlTCP genes are involved in the ripening process. Yeast two-hybrid data shows that SlTCP proteins can form homo and heterodimers, suggesting that they act together in order to form functional protein complexes and together regulate developmental processes in tomato. Conclusions The comprehensive analysis we performed, like phylogenetic analysis, expression studies, identification of the upstream regulators and the dimerization specificity of the tomato TCP transcription factor family provides the basis for functional studies to reveal the role of this family in tomato development. PMID:24903607

Increasing Chemical Space Coverage by Combining Empirical and Computational Fragment Screens

PubMed Central

2015-01-01

Most libraries for fragment-based drug discovery are restricted to 1,000–10,000 compounds, but over 500,000 fragments are commercially available and potentially accessible by virtual screening. Whether this larger set would increase chemotype coverage, and whether a computational screen can pragmatically prioritize them, is debated. To investigate this question, a 1281-fragment library was screened by nuclear magnetic resonance (NMR) against AmpC β-lactamase, and hits were confirmed by surface plasmon resonance (SPR). Nine hits with novel chemotypes were confirmed biochemically with KI values from 0.2 to low mM. We also computationally docked 290,000 purchasable fragments with chemotypes unrepresented in the empirical library, finding 10 that had KI values from 0.03 to low mM. Though less novel than those discovered by NMR, the docking-derived fragments filled chemotype holes from the empirical library. Crystal structures of nine of the fragments in complex with AmpC β-lactamase revealed new binding sites and explained the relatively high affinity of the docking-derived fragments. The existence of chemotype holes is likely a general feature of fragment libraries, as calculation suggests that to represent the fragment substructures of even known biogenic molecules would demand a library of minimally over 32,000 fragments. Combining computational and empirical fragment screens enables the discovery of unexpected chemotypes, here by the NMR screen, while capturing chemotypes missing from the empirical library and tailored to the target, with little extra cost in resources. PMID:24807704

Improving RNA-Seq expression estimates by correcting for fragment bias

PubMed Central

2011-01-01

The biochemistry of RNA-Seq library preparation results in cDNA fragments that are not uniformly distributed within the transcripts they represent. This non-uniformity must be accounted for when estimating expression levels, and we show how to perform the needed corrections using a likelihood based approach. We find improvements in expression estimates as measured by correlation with independently performed qRT-PCR and show that correction of bias leads to improved replicability of results across libraries and sequencing technologies. PMID:21410973

AKT1, LKB1, and YAP1 revealed as MYC interactors with NanoLuc-based protein-fragment complementation assay. | Office of Cancer Genomics

Cancer.gov

The c-Myc (MYC) transcription factor is a major cancer driver and a well-validated therapeutic target. However, directly targeting MYC has been challenging. Thus, identifying proteins that interact with and regulate MYC may provide alternative strategies to inhibit its oncogenic activity. Here we report the development of a NanoLuc®-based protein-fragment complementation assay (NanoPCA) and mapping of the MYC protein interaction hub in live mammalian cells.

A receptor tyrosine kinase, UFO/Axl, and other genes isolated by a modified differential display PCR are overexpressed in metastatic prostatic carcinoma cell line DU145.

PubMed

Jacob, A N; Kalapurakal, J; Davidson, W R; Kandpal, G; Dunson, N; Prashar, Y; Kandpal, R P

1999-01-01

We have used a modified differential display PCR protocol for isolating 3' restriction fragments of cDNAs specifically expressed or overexpressed in metastatic prostate carcinoma cell line DU145. Several cDNA fragments were identified that matched to milk fat globule protein, UFO/Axl, a receptor tyrosine kinase, human homologue of a Xenopus maternal transcript, laminin and laminin receptor, human carcinoma-associated antigen, and some expressed sequence tags. The transcript for milk fat globule protein, a marker protein shown to be overexpressed in breast tumors, was elevated in DU145 cells. The expression of UFO/Axl, a receptor tyrosine kinase, was considerably higher in DU145 cells as compared to normal prostate cells and prostatic carcinoma cell line PC-3. The overexpression of UFO oncogene in DU145 cells is discussed in the context of prostate cancer metastasis.

The Myxococcus xanthus Spore Cuticula Protein C Is a Fragment of FibA, an Extracellular Metalloprotease Produced Exclusively in Aggregated Cells

PubMed Central

Lee, Bongsoo; Mann, Petra; Grover, Vidhi; Treuner-Lange, Anke; Kahnt, Jörg; Higgs, Penelope I.

2011-01-01

Myxococcus xanthus is a soil bacterium with a complex life cycle involving distinct cell fates, including production of environmentally resistant spores to withstand periods of nutrient limitation. Spores are surrounded by an apparently self-assembling cuticula containing at least Proteins S and C; the gene encoding Protein C is unknown. During analyses of cell heterogeneity in M. xanthus, we observed that Protein C accumulated exclusively in cells found in aggregates. Using mass spectrometry analysis of Protein C either isolated from spore cuticula or immunoprecipitated from aggregated cells, we demonstrate that Protein C is actually a proteolytic fragment of the previously identified but functionally elusive zinc metalloprotease, FibA. Subpopulation specific FibA accumulation is not due to transcriptional regulation suggesting post-transcriptional regulation mechanisms mediate its heterogeneous accumulation patterns. PMID:22174937

Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

PubMed Central

Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M

1982-01-01

A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

Expression of human papillomavirus 6 in inverted papilloma arising in a renal transplant recipient.

PubMed

Harris, M O; Beck, J C; Terrell, J E; McClatchey, K D; Carey, T E; Bradford, C R

1998-01-01

A 36-year-old renal transplant recipient taking cyclosporin A presented with bilateral nasal polypoid lesions involving the nasal septum and lateral nasal walls. Pathologic findings from surgical excision demonstrated inverted papilloma (IP) with focal atypia and mild dysplasia. DNA extracted from the tissue was tested with the polymerase chain reaction (PCR) using human papillomavirus (HPV) E6 and L1 consensus primers. This revealed amplification of the expected size fragment consistent with the presence of HPV DNA. Hybridization of PCR products with HPV type-specific oligonucleotide probes revealed a strong signal with only HPV 6. This result was confirmed by PCR amplification with HPV 6 type-specific primers. RNA extracted from the tissue was subjected to reverse transcription PCR (RT-PCR) with a primer pair specific for viral E6/E7 transcripts. The HPV early proteins, E6 and E7, are the transforming proteins implicated as critical for tumorigenesis. RT-PCR experiments generated products representing the E1/E4 spliced transcript originating from the E6/E6 promoter and a smaller unclassified fragment. These results provide evidence for HPV 6 E6/E7 expression in IP, lending credence to the concept that HPV may play a role in the origin of this neoplasm. Histologically normal nasal tissue from the same patient contained HPV DNA and similar transcripts to those described in the IP specimen.

Feeding ecology and ingestion of plastic fragments by Priacanthus arenatus: What's the fisheries contribution to the problem?

PubMed

Cardozo, Ana L P; Farias, Eduardo G G; Rodrigues-Filho, Jorge L; Moteiro, Isabel B; Scandolo, Tatianny M; Dantas, David V

2018-05-01

Atlantic Bigeye (Priacanthus arenatus) is a demersal species from the Priacanthidae family with little literature relating to its biology and catch aspects. Due to this lack of research, the focus of this effort was to describe the feeding preferences of Atlantic Bigeye and to evaluate the influence of plastic debris derived from the local fisheries activities on its diet. The most important items were Corophiidae, Penaeidae, Actinopterygii, Isopoda, Cephalopoda, Policheta and plastic. Plastic was present in 49.17% of the stomachs analyzed. A total of 210 plastic fragments were found, and 63% were derived from fishing. Of those, 55% were derived from paint fragments from vessels and 8% from synthetic fibers (PA). The results suggest that plastic fragments found in stomachs are related to the species' natural diet and that this debris is locally deposited in the coastal environment. Fishing resources appear to have been affected by this local marine pollution. Copyright © 2018 Elsevier Ltd. All rights reserved.

Genes encoding major light-harvesting polypeptides are clustered on the genome of the cyanobacterium Fremyella diplosiphon.

PubMed Central

Conley, P B; Lemaux, P G; Lomax, T L; Grossman, A R

1986-01-01

The polypeptide composition of the phycobilisome, the major light-harvesting complex of prokaryotic cyanobacteria and certain eukaryotic algae, can be modulated by different light qualities in cyanobacteria exhibiting chromatic adaptation. We have identified genomic fragments encoding a cluster of phycobilisome polypeptides (phycobiliproteins) from the chromatically adapting cyanobacterium Fremyella diplosiphon using previously characterized DNA fragments of phycobiliprotein genes from the eukaryotic alga Cyanophora paradoxa and from F. diplosiphon. Characterization of two lambda-EMBL3 clones containing overlapping genomic fragments indicates that three sets of phycobiliprotein genes--the alpha- and beta-allophycocyanin genes plus two sets of alpha- and beta-phycocyanin genes--are clustered within 13 kilobases on the cyanobacterial genome and transcribed off the same strand. The gene order (alpha-allophycocyanin followed by beta-allophycocyanin and beta-phycocyanin followed by alpha-phycocyanin) appears to be a conserved arrangement found previously in a eukaryotic alga and another cyanobacterium. We have reported that one set of phycocyanin genes is transcribed as two abundant red light-induced mRNAs (1600 and 3800 bases). We now present data showing that the allophycocyanin genes and a second set of phycocyanin genes are transcribed into major mRNAs of 1400 and 1600 bases, respectively. These transcripts are present in RNA isolated from cultures grown in red and green light, although lower levels of the 1600-base phycocyanin transcript are present in cells grown in green light. Furthermore, a larger transcript of 1750 bases hybridizes to the allophycocyanin genes and may be a precursor to the 1400-base species. Images PMID:3086870

Caspase-3/7-mediated Cleavage of β2-spectrin is Required for Acetaminophen-induced Liver Damage

PubMed Central

Baek, Hye Jung; Lee, Yong Min; Kim, Tae Hyun; Kim, Joo-Young; Park, Eun Jung; Iwabuchi, Kuniyoshi; Mishra, Lopa; Kim, Sang Soo

2016-01-01

The ubiquitously expressed β2-spectrin (β2SP, SPTBN1) is the most common non-erythrocytic member of the β-spectrin gene family. Loss of β2-spectrin leads to defects in liver development, and its haploinsufficiency spontaneously leads to chronic liver disease and the eventual development of hepatocellular cancer. However, the specific role of β2-spectrin in liver homeostasis remains to be elucidated. Here, we reported that β2-spectrin was cleaved by caspase-3/7 upon treatment with acetaminophen which is the main cause of acute liver injury. Blockage of β2-spectrin cleavage robustly attenuated β2-spectrin-specific functions, including regulation of the cell cycle, apoptosis, and transcription. Cleaved fragments of β2-spectrin were physiologically active, and the N- and C-terminal fragments retained discrete interaction partners and activity in transcriptional regulation and apoptosis, respectively. Cleavage of β2-spectrin facilitated the redistribution of the resulting fragments under conditions of liver damage induced by acetaminophen. In contrast, downregulation of β2-spectrin led to resistance to acetaminophen-induced cytotoxicity, and its insufficiency in the liver promoted suppression of acetaminophen-induced liver damage and enhancement of liver regeneration. Conclusions: β2-Spectrin, a TGF-β mediator and signaling molecule, is cleaved and activated by caspase-3/7, consequently enhancing apoptosis and transcriptional control to determine cell fate upon liver damage. These findings have extended our knowledge on the spectrum of β2-spectrin functions from a scaffolding protein to a target and transmitter of TGF-β in liver damage. PMID:26884715

The groESL Chaperone Operon of Lactobacillus johnsonii†

PubMed Central

Walker, D. Carey; Girgis, Hany S.; Klaenhammer, Todd R.

1999-01-01

The Lactobacillus johnsonii VPI 11088 groESL operon was localized on the chromosome near the insertion element IS1223. The operon was initially cloned as a series of three overlapping PCR fragments, which were sequenced and used to design primers to amplify the entire operon. The amplified fragment was used as a probe to recover the chromosomal copy of the groESL operon from a partial library of L. johnsonii VPI 11088 (NCK88) DNA, cloned in the shuttle vector pTRKH2. The 2,253-bp groESL fragment contained three putative open reading frames, two of which encoded the ubiquitous GroES and GroEL chaperone proteins. Analysis of the groESL promoter region revealed three transcription initiation sites, as well as three sets of inverted repeats (IR) positioned between the transcription and translation start sites. Two of the three IR sets bore significant homology to the CIRCE elements, implicated in negative regulation of the heat shock response in many bacteria. Northern analysis and primer extension revealed that multiple temperature-sensitive promoters preceded the groESL chaperone operon, suggesting that stress protein production in L. johnsonii is strongly regulated. Maximum groESL transcription activity was observed following a shift to 55°C, and a 15 to 30-min exposure of log-phase cells to this temperature increased the recovery of freeze-thawed L. johnsonii VPI 11088. These results suggest that a brief, preconditioning heat shock can be used to trigger increased chaperone production and provide significant cross-protection from the stresses imposed during the production of frozen culture concentrates. PMID:10388700

Full expression of Bacillus anthracis toxin gene in the presence of bicarbonate requires a 2.7-kb-long atxA mRNA that contains a terminator structure.

PubMed

Bertin, Marine; Château, Alice; Fouet, Agnès

2010-05-01

Bacillus anthracis toxin gene expression requires AtxA, a virulence regulator that also activates capsule gene transcription and controls expression of more than a hundred genes. Here we report that atxA mRNA is 2.7-kb-long and ends, after a 500 nt-long 3' untranslated region, with a stem loop structure followed by a run of U's. The presence of this structure stabilizes atxA mRNA and is necessary for AtxA maximal accumulation, full expression of the PA toxin gene, pagA and optimal PA accumulation. This structure displays terminator activity independently of its orientation when cloned between an inducible promoter and a reporter gene. The 3.6-kb-long DNA fragment carrying both AtxA promoters and the terminator is sufficient for full expression of pagA in the presence of bicarbonate. No pXO1-encoded element other than the DNA fragment encompassing the 2.7 kb atxA transcript and the pagA promoter is required for bicarbonate induction of pagA transcription. (c) 2010 Elsevier Masson SAS. All rights reserved.

Identifying and analysing protostellar disc fragments in smoothed particle hydrodynamics simulations

NASA Astrophysics Data System (ADS)

Hall, Cassandra; Forgan, Duncan; Rice, Ken

2017-09-01

We present a new method of identifying protostellar disc fragments in a simulation based on density derivatives, and analyse our data using this and the existing CLUMPFIND method, which is based on an ordered search over all particles in gravitational potential energy. Using smoothed particle hydrodynamics, we carry out nine simulations of a 0.25 M⊙ disc around a 1 M⊙ star, all of which fragment to form at least two bound objects. We find that when using all particles ordered in gravitational potential space, only fragments that survive the duration of the simulation are detected. When we use the density derivative method, all fragments are detected, so the two methods are complementary, as using the two methods together allows us to identify all fragments, and to then determine those that are likely to be destroyed. We find a tentative empirical relationship between the dominant azimuthal wavenumber in the disc m and the maximum semimajor axis a fragment may achieve in a simulation, such that amax∝1/m. We find the fragment destruction rate to be around half that predicted from population synthesis models. This is due to fragment-fragment interactions in the early gas phase of the disc, which can cause scattering and eccentricity pumping on short time-scales, and affects the fragment's internal structure. We therefore caution that measurements of eccentricity as a function of semimajor axis may not necessarily constrain the formation mechanism of giant planets and brown dwarfs.

Combining Random Gene Fission and Rational Gene Fusion To Discover Near-Infrared Fluorescent Protein Fragments That Report on Protein–Protein Interactions

PubMed Central

2015-01-01

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

PubMed

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

Transcriptional regulation of IGF-I expression in skeletal muscle

NASA Technical Reports Server (NTRS)

McCall, G. E.; Allen, D. L.; Haddad, F.; Baldwin, K. M.

2003-01-01

The present study investigated the role of transcription in the regulation of insulin-like growth factor (IGF)-I expression in skeletal muscle. RT-PCR was used to determine endogenous expression of IGF-I pre-mRNA and mRNA in control (Con) and functionally overloaded (FO) rat plantaris. The transcriptional activities of five different-length IGF-I promoter fragments controlling transcription of a firefly luciferase (FLuc) reporter gene were tested in vitro by transfection of myoblasts or in vivo during FO by direct gene transfer into the plantaris. Increased endogenous IGF-I gene transcription during 7 days of plantaris FO was evidenced by an approximately 140-160% increase (P < 0.0001) in IGF-I pre-mRNA (a transcriptional marker). IGF-I mRNA expression also increased by approximately 90% (P < 0.0001), and it was correlated (R = 0.93; P < 0.0001) with the pre-mRNA increases. The three longest IGF-I exon 1 promoters induced reporter gene expression in proliferating C2C12 and L6E9 myoblasts. In differentiated L6E9 myotubes, promoter activity increased approximately two- to threefold over myoblasts. Overexpression of calcineurin and MyoD increased the activity of the -852/+192 promoter in C2C12 myotubes by approximately 5- and approximately 18-fold, respectively. However, FO did not induce these exogenous promoter fragments. Nevertheless, the present findings are consistent with the hypothesis that the IGF-I gene is transcriptionally regulated during muscle hypertrophy in vivo as evidenced by the induction of the endogenous IGF-I pre-mRNA during plantaris FO. The exon 1 promoter region of the IGF-I gene is sufficient to direct inducible expression in vitro; however, an in vivo response to FO may require elements outside the -852/+346 region of the exon 1 IGF-I promoter or features inherent to the endogenous IGF-I gene.

A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

PubMed

Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

2012-07-01

A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

Isolation and characterization of the CNBr peptides from the proteolytically derived N-terminal fragment of ovine opsin.

PubMed Central

Brett, M; Findlay, J B

1983-01-01

Ovine rhodopsin may be cleaved in situ by Staphylococcus aureus V8 proteinase into two membrane-bound fragments designated V8-L (27 000 mol.wt.) and V8-S (12 000 mol.wt.). After purification of the proteolysed complex by affinity chromatography in detergent using concanavalin A immobilized on Sepharose 4B, the two polypeptide fragments may be separated by gel-permeation chromatography on Sephadex LH-60. Digestion of the N-terminal-derived V8-L fragment with CNBr in 70% (v/v) trifluoroacetic acid resulted in a peptide mixture that could be fractionated by procedures involving gel-permeation chromatography in organic and aqueous solvents and the use of differential solubility. The complete or partial sequences of all ten peptides are reported. PMID:6224479

Evolutionary Acquisition and Loss of Saxitoxin Biosynthesis in Dinoflagellates: the Second “Core” Gene, sxtG

PubMed Central

Orr, Russell J. S.; Stüken, Anke; Murray, Shauna A.

2013-01-01

Saxitoxin and its derivatives are potent neurotoxins produced by several cyanobacteria and dinoflagellate species. SxtA is the initial enzyme in the biosynthesis of saxitoxin. The dinoflagellate full mRNA and partial genomic sequences have previously been characterized, and it appears that sxtA originated in dinoflagellates through a horizontal gene transfer from a bacterium. So far, little is known about the remaining genes involved in this pathway in dinoflagellates. Here we characterize sxtG, an amidinotransferase enzyme gene that putatively encodes the second step in saxitoxin biosynthesis. In this study, the entire sxtG transcripts from Alexandrium fundyense CCMP1719 and Alexandrium minutum CCMP113 were amplified and sequenced. The transcripts contained typical dinoflagellate spliced leader sequences and eukaryotic poly(A) tails. In addition, partial sxtG transcript fragments were amplified from four additional Alexandrium species and Gymnodinium catenatum. The phylogenetic inference of dinoflagellate sxtG, congruent with sxtA, revealed a bacterial origin. However, it is not known if sxtG was acquired independently of sxtA. Amplification and sequencing of the corresponding genomic sxtG region revealed noncanonical introns. These introns show a high interspecies and low intraspecies variance, suggesting multiple independent acquisitions and losses. Unlike sxtA, sxtG was also amplified from Alexandrium species not known to synthesize saxitoxin. However, amplification was not observed for 22 non-saxitoxin-producing dinoflagellate species other than those of the genus Alexandrium or G. catenatum. This result strengthens our hypothesis that saxitoxin synthesis has been secondarily lost in conjunction with sxtA for some descendant species. PMID:23335767

Evolutionary acquisition and loss of saxitoxin biosynthesis in dinoflagellates: the second "core" gene, sxtG.

PubMed

Orr, Russell J S; Stüken, Anke; Murray, Shauna A; Jakobsen, Kjetill S

2013-04-01

Saxitoxin and its derivatives are potent neurotoxins produced by several cyanobacteria and dinoflagellate species. SxtA is the initial enzyme in the biosynthesis of saxitoxin. The dinoflagellate full mRNA and partial genomic sequences have previously been characterized, and it appears that sxtA originated in dinoflagellates through a horizontal gene transfer from a bacterium. So far, little is known about the remaining genes involved in this pathway in dinoflagellates. Here we characterize sxtG, an amidinotransferase enzyme gene that putatively encodes the second step in saxitoxin biosynthesis. In this study, the entire sxtG transcripts from Alexandrium fundyense CCMP1719 and Alexandrium minutum CCMP113 were amplified and sequenced. The transcripts contained typical dinoflagellate spliced leader sequences and eukaryotic poly(A) tails. In addition, partial sxtG transcript fragments were amplified from four additional Alexandrium species and Gymnodinium catenatum. The phylogenetic inference of dinoflagellate sxtG, congruent with sxtA, revealed a bacterial origin. However, it is not known if sxtG was acquired independently of sxtA. Amplification and sequencing of the corresponding genomic sxtG region revealed noncanonical introns. These introns show a high interspecies and low intraspecies variance, suggesting multiple independent acquisitions and losses. Unlike sxtA, sxtG was also amplified from Alexandrium species not known to synthesize saxitoxin. However, amplification was not observed for 22 non-saxitoxin-producing dinoflagellate species other than those of the genus Alexandrium or G. catenatum. This result strengthens our hypothesis that saxitoxin synthesis has been secondarily lost in conjunction with sxtA for some descendant species.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Soo Kyung; Gwak, Jungsug; Song, Im-Sook

Highlights: {yields} TopIn activates p53-dependent transcription in colon cancer cells. {yields} TopIn induces apoptosis in colon cancer cells. {yields} TopIn selectively inhibits topoisomerase I activity. {yields} TopIn does not affect the activity of BCRP and MDR-1. -- Abstract: The tumor suppressor p53 plays an important role in cellular emergency mechanisms through regulating the genes involved in cell cycle arrest and apoptosis. To identify small molecules that can activate p53-responsive transcription, we performed chemical screening using genetically engineered HCT116 reporter cells. We found that TopIn (7-phenyl-6H-[1,2,5]oxadiazolo[3,4-e]indole 3-oxide) efficiently activated p53-mediated transcriptional activity and induced phosphorylation of p53 at Ser15, thereby stabilizingmore » the p53 protein. Furthermore, TopIn upregulated the expression of p21{sup WAF1/CIP1}, a downstream target of p53, and suppressed cellular proliferation in various colon cancer cells. Additionally, TopIn induced DNA fragmentation, caspase-3/7 activation and poly ADP ribose polymerase cleavage, typical biochemical markers of apoptosis, in p53 wild-type and mutated colon cancer cells. Finally, we found that TopIn inhibited topoisomerase I activity, but not topoisomerase II, in vitro and induced the formation of the topoisomerase I-DNA complex in HCT116 colon cancer cells. Unlike camptothecin (CPT) and its derivative SN38, TopIn did not affect the activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP) or multidrug-resistant protein-1 (MDR-1). These results suggest that TopIn may present a promising new topoisomerase I-targeting anti-tumor therapeutics.« less

Differentially Expressed Genes in Resistant and Susceptible Common Bean (Phaseolus vulgaris L.) Genotypes in Response to Fusarium oxysporum f. sp. phaseoli

PubMed Central

Xue, Renfeng; Wu, Jing; Zhu, Zhendong; Wang, Lanfen; Wang, Xiaoming; Wang, Shumin; Blair, Matthew W.

2015-01-01

Fusarium wilt of common bean (Phaseolus vulgaris L.), caused by Fusarium oxysporum Schlechtend.:Fr. f.sp. phaseoli (Fop), is one of the most important diseases of common beans worldwide. Few natural sources of resistance to Fop exist and provide only moderate or partial levels of protection. Despite the economic importance of the disease across multiple crops, only a few of Fop induced genes have been analyzed in legumes. Therefore, our goal was to identify transcriptionally regulated genes during an incompatible interaction between common bean and the Fop pathogen using the cDNA amplified fragment length polymorphism (cDNA-AFLP) technique. We generated a total of 8,730 transcript-derived fragments (TDFs) with 768 primer pairs based on the comparison of a moderately resistant and a susceptible genotype. In total, 423 TDFs (4.9%) displayed altered expression patterns after inoculation with Fop inoculum. We obtained full amplicon sequences for 122 selected TDFs, of which 98 were identified as annotated known genes in different functional categories based on their putative functions, 10 were predicted but non-annotated genes and 14 were not homologous to any known genes. The 98 TDFs encoding genes of known putative function were classified as related to metabolism (22), signal transduction (21), protein synthesis and processing (20), development and cytoskeletal organization (12), transport of proteins (7), gene expression and RNA metabolism (4), redox reactions (4), defense and stress responses (3), energy metabolism (3), and hormone responses (2). Based on the analyses of homology, 19 TDFs from different functional categories were chosen for expression analysis using quantitative RT-PCR. The genes found to be important here were implicated at various steps of pathogen infection and will allow a better understanding of the mechanisms of defense and resistance to Fop and similar pathogens. The differential response genes discovered here could also be used as molecular markers in association mapping or QTL analysis. PMID:26030070

Target-Derived Neurotrophins Coordinate Transcription and Transport of Bclw to Prevent Axonal Degeneration

PubMed Central

Cosker, Katharina E.; Pazyra-Murphy, Maria F.; Fenstermacher, Sara J.

2013-01-01

Establishment of neuronal circuitry depends on both formation and refinement of neural connections. During this process, target-derived neurotrophins regulate both transcription and translation to enable selective axon survival or elimination. However, it is not known whether retrograde signaling pathways that control transcription are coordinated with neurotrophin-regulated actions that transpire in the axon. Here we report that target-derived neurotrophins coordinate transcription of the antiapoptotic gene bclw with transport of bclw mRNA to the axon, and thereby prevent axonal degeneration in rat and mouse sensory neurons. We show that neurotrophin stimulation of nerve terminals elicits new bclw transcripts that are immediately transported to the axons and translated into protein. Bclw interacts with Bax and suppresses the caspase6 apoptotic cascade that fosters axonal degeneration. The scope of bclw regulation at the levels of transcription, transport, and translation provides a mechanism whereby sustained neurotrophin stimulation can be integrated over time, so that axonal survival is restricted to neurons connected within a stable circuit. PMID:23516285

Revealing the transcriptomic complexity of switchgrass by PacBio long-read sequencing.

PubMed

Zuo, Chunman; Blow, Matthew; Sreedasyam, Avinash; Kuo, Rita C; Ramamoorthy, Govindarajan Kunde; Torres-Jerez, Ivone; Li, Guifen; Wang, Mei; Dilworth, David; Barry, Kerrie; Udvardi, Michael; Schmutz, Jeremy; Tang, Yuhong; Xu, Ying

2018-01-01

Switchgrass ( Panicum virgatum L.) is an important bioenergy crop widely used for lignocellulosic research. While extensive transcriptomic analyses have been conducted on this species using short read-based sequencing techniques, very little has been reliably derived regarding alternatively spliced (AS) transcripts. We present an analysis of transcriptomes of six switchgrass tissue types pooled together, sequenced using Pacific Biosciences (PacBio) single-molecular long-read technology. Our analysis identified 105,419 unique transcripts covering 43,570 known genes and 8795 previously unknown genes. 45,168 are novel transcripts of known genes. A total of 60,096 AS transcripts are identified, 45,628 being novel. We have also predicted 1549 transcripts of genes involved in cell wall construction and remodeling, 639 being novel transcripts of known cell wall genes. Most of the predicted transcripts are validated against Illumina-based short reads. Specifically, 96% of the splice junction sites in all the unique transcripts are validated by at least five Illumina reads. Comparisons between genes derived from our identified transcripts and the current genome annotation revealed that among the gene set predicted by both analyses, 16,640 have different exon-intron structures. Overall, substantial amount of new information is derived from the PacBio RNA data regarding both the transcriptome and the genome of switchgrass.

Leukemia patient-derived lymphoblastoid cell lines exhibit increased induction of leukemia-associated transcripts following high-dose irradiation.

PubMed

Spencer, A; Granter, N

1999-09-01

Improvement in diagnostic cytogenetic techniques has led to the recognition of an increasing number of leukemia-associated chromosomal translocations and inversions. These genetic lesions frequently are associated with the disruption of putative transcription factors and the production of hybrid transcripts that are implicated in leukemogenesis. Epidemiologic evidence suggests that some, but not all, individuals with a history of gamma-irradiation exposure are at increased risk of developing chronic myeloid leukemia (CML). CML is characterized by the Philadelphia chromosome and transcription of the resulting hybrid BCR-ABL gene. Utilizing the leukemia-associated BCR-ABL p210 transcript as a marker, we sought differences in the induction of illegitimate genetic recombination following high-dose gamma-irradiation of karyotypically normal lymphoblastoid cell lines (LCL) derived from individuals with and without a history of myeloid leukemias. Six LCL [4 leukemia patient derived [2 acute myeloid leukemia and 2 CML] and 2 from normal individuals were analyzed with reverse transcriptase polymerase chain reaction for BCR-ABL under stringent conditions following exposure to 0, 50, or 100 Gy of LET gamma-irradiation delivered via a Varian linear accelerator at 4 MV. Transcripts identical to disease-associated b2a2 and b3a2 transcripts were detected both spontaneously (background illegitimate genetic recombination) and following gamma-irradiation. Background BCR-ABL positivity was demonstrable in 4 of the 6 LCL, with no significant difference in detection between leukemic- and nonleukemic-derived LCL. Overall, increasing gamma-irradiation dose resulted in an increased frequency of BCR-ABL transcript detection (0 Gy vs 50 Gy vs 100 Gy,p = 0.0023, Chi-square test). Within the leukemic- but not the nonleukemic-derived LCL there was significantly greater BCR-ABL positivity after gamma-irradiation compared to unirradiated equivalents. Furthermore, the BCR-ABL positivity of both the AML- and CML-derived LCL after gamma-irradiation was significantly greater than that of the nonleukemic-derived LCL after gamma-irradiation. We speculate that this difference in the detection of illegitimate after gamma-irradiation recombination may be due to aberrant DNA double strand break repair mechanisms in individuals predisposed to the development of myeloid leukemias.

Differential Inflammatory-Response Kinetics of Human Keratinocytes upon Cytosolic RNA- and DNA-Fragment Induction.

PubMed

Danis, Judit; Janovák, Luca; Gubán, Barbara; Göblös, Anikó; Szabó, Kornélia; Kemény, Lajos; Bata-Csörgő, Zsuzsanna; Széll, Márta

2018-03-08

Keratinocytes are non-professional immune cells contributing actively to innate immune responses partially by reacting to a wide range of molecular patterns by activating pattern recognition receptors. Cytosolic nucleotide fragments as pathogen- or self-derived trigger factors are activating inflammasomes and inducing anti-viral signal transduction pathways as well as inducing expression of inflammatory cytokines. We aimed to compare the induced inflammatory reactions in three keratinocyte cell types-normal human epidermal keratinocytes, the HaCaT cell line and the HPV-KER cell line-upon exposure to the synthetic RNA and DNA analogues poly(I:C) and poly(dA:dT) to reveal the underlying signaling events. Both agents induced the expression of interleukin-6 and tumor necrosis factor α in all cell types; however, notable kinetic and expression level differences were found. Western blot analysis revealed rapid activation of the nuclear factor κB (NF-κB), mitogen activated protein kinase and signal transducers of activator of transcription (STAT) signal transduction pathways in keratinocytes upon poly(I:C) treatment, while poly(dA:dT) induced slower activation. Inhibition of NF-κB, p38, STAT-1 and STAT-3 signaling resulted in decreased cytokine expression, whereas inhibition of mitogen-activated protein kinase kinase 1/2 (MEK1/2) signaling showed a negative feedback role in both poly(I:C)- and poly(dA:dT)-induced cytokine expression. Based on our in vitro results nucleotide fragments are able to induce inflammatory reactions in keratinocytes, but with different rate and kinetics of cytokine expression, explained by faster activation of signaling routes by poly(I:C) than poly(dA:dT).

Differential Inflammatory-Response Kinetics of Human Keratinocytes upon Cytosolic RNA- and DNA-Fragment Induction

PubMed Central

Danis, Judit; Janovák, Luca; Gubán, Barbara; Göblös, Anikó; Szabó, Kornélia; Bata-Csörgő, Zsuzsanna; Széll, Márta

2018-01-01

Keratinocytes are non-professional immune cells contributing actively to innate immune responses partially by reacting to a wide range of molecular patterns by activating pattern recognition receptors. Cytosolic nucleotide fragments as pathogen- or self-derived trigger factors are activating inflammasomes and inducing anti-viral signal transduction pathways as well as inducing expression of inflammatory cytokines. We aimed to compare the induced inflammatory reactions in three keratinocyte cell types—normal human epidermal keratinocytes, the HaCaT cell line and the HPV-KER cell line—upon exposure to the synthetic RNA and DNA analogues poly(I:C) and poly(dA:dT) to reveal the underlying signaling events. Both agents induced the expression of interleukin-6 and tumor necrosis factor α in all cell types; however, notable kinetic and expression level differences were found. Western blot analysis revealed rapid activation of the nuclear factor κB (NF-κB), mitogen activated protein kinase and signal transducers of activator of transcription (STAT) signal transduction pathways in keratinocytes upon poly(I:C) treatment, while poly(dA:dT) induced slower activation. Inhibition of NF-κB, p38, STAT-1 and STAT-3 signaling resulted in decreased cytokine expression, whereas inhibition of mitogen-activated protein kinase kinase 1/2 (MEK1/2) signaling showed a negative feedback role in both poly(I:C)- and poly(dA:dT)-induced cytokine expression. Based on our in vitro results nucleotide fragments are able to induce inflammatory reactions in keratinocytes, but with different rate and kinetics of cytokine expression, explained by faster activation of signaling routes by poly(I:C) than poly(dA:dT). PMID:29518010

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

PubMed

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Gas chromatographic-mass spectrometric characterization of thebaol, an opium constituent, and its structural analogs.

PubMed

Megutnishvili, Levan; Todua, Nino; Stein, Stephen; Mikaia, Anzor

2018-05-18

A GC-MS method is described for the characterization of thebaol, a component of opium poppy. The method includes preliminary sample derivatization to TMS, TBDMS, TFA, PFP and HFB substituted products. Fragmentation of resulting derivatives is unique under electron ionization, and proceeds via consecutive loss of two radicals that violate the "even-electron rule". Peaks of [M-2CH 3 ] +. and [M-C 4 H 9 -CH 3 ] +. ions show maximum intensities in the spectra of trimethyl- and tert-butyldimethylsilyl-thebaols. Elimination of perfluoroalkyl and methyl radicals from M +. is characteristic for TFA, PFP and HFB thebaols. The same fragmentation peculiarity is characteristic for derivatives prepared from related natural compounds containing vicinal 2-methoxyphenol moieties. The unique fragmentation of trialkylsilyl and perfluoroacyl derivatives of thebaol can be successfully used for thebaol determination within complex mixtures. This is part 4 from the series "Analytical derivatives in mass spectrometry", parts 1, 2 and 3 see [1-3]. Copyright © 2018 Elsevier B.V. All rights reserved.

Global Identification and Characterization of Transcriptionally Active Regions in the Rice Genome

PubMed Central

Stolc, Viktor; Deng, Wei; He, Hang; Korbel, Jan; Chen, Xuewei; Tongprasit, Waraporn; Ronald, Pamela; Chen, Runsheng; Gerstein, Mark; Wang Deng, Xing

2007-01-01

Genome tiling microarray studies have consistently documented rich transcriptional activity beyond the annotated genes. However, systematic characterization and transcriptional profiling of the putative novel transcripts on the genome scale are still lacking. We report here the identification of 25,352 and 27,744 transcriptionally active regions (TARs) not encoded by annotated exons in the rice (Oryza. sativa) subspecies japonica and indica, respectively. The non-exonic TARs account for approximately two thirds of the total TARs detected by tiling arrays and represent transcripts likely conserved between japonica and indica. Transcription of 21,018 (83%) japonica non-exonic TARs was verified through expression profiling in 10 tissue types using a re-array in which annotated genes and TARs were each represented by five independent probes. Subsequent analyses indicate that about 80% of the japonica TARs that were not assigned to annotated exons can be assigned to various putatively functional or structural elements of the rice genome, including splice variants, uncharacterized portions of incompletely annotated genes, antisense transcripts, duplicated gene fragments, and potential non-coding RNAs. These results provide a systematic characterization of non-exonic transcripts in rice and thus expand the current view of the complexity and dynamics of the rice transcriptome. PMID:17372628

Constitutive Transcription and Stable RNA Accumulation in Plastids during the Conversion of Chloroplasts to Chromoplasts in Ripening Tomato Fruits 1

PubMed Central

Marano, María Rosa; Carrillo, Néstor

1992-01-01

The size distribution of plastid transcripts during chromoplast differentiation in ripening tomato (Lycopersicon esculentum L.) fruits was determined using northern blot analysis. Hybridization of total cellular RNA from leaves and fruits with several tobacco chloroplast DNA probes showed distinct transcript patterns in chloroplasts and chromoplasts. We also compared transcriptional rates by probing immobilized DNA fragments of small size (representing about 85% of the plastid genome) with run-on transcripts from tomato plastids. The relative rates of transcription of the various DNA regions were very similar in chloro- and chromoplasts. Parallel determination of the steady-state levels of plastid RNA showed no strict correlation between synthesis rate and RNA accumulation. Differences in the relative abundance of transcripts between chloro- and chromoplasts were not very pronounced and were limited to a small number of genes. The results indicate that the conversion of chloroplasts to chromoplasts at the onset of tomato fruit ripening proceeds with no important variations in the relative transcription rates and with only moderate changes in the relative stability of plastid-encoded transcripts. Images Figure 1 Figure 4 PMID:16653091

Size-dependent enrichment of waste slag aggregate fragments abraded from asphalt concrete.

PubMed

Takahashi, Fumitake; Shimaoka, Takayuki; Gardner, Kevin; Kida, Akiko

2011-10-30

Authors consider the environmental prospects of using melted waste slag as the aggregate for asphalt pavement. In particular, the enrichment of slag-derived fragments in fine abrasion dust particles originated from slag asphalt concrete and its size dependency were concerned. A series of surface abrasion tests for asphalt concrete specimens, containing only natural aggregates as reference or 30 wt% of substituted slag aggregates, were performed. Although two of three slag-asphalt concretes generated 1.5-3.0 times larger amount of abrasion dust than the reference asphalt concrete did, it could not be explained only by abrasion resistance of slag. The enrichment of slag-derived fragments in abrasion dust, estimated on the basis of the peak intensity of quartz and heavy metal concentrations, had size dependency for all slag-asphalt concretes. Slag-derived fragments were enriched in abrasion dust particles with diameters of 150-1000 μm. Enrichment factors were 1.4-2.1. In contrast, there was no enrichment in abrasion dust particles with diameter less than 75 μm. This suggests that prior airborne-size fragmentation of substituted slag aggregates does not need to be considered for tested slag aggregates when environmental risks of abrasion dust of slag-asphalt pavement are assessed. Copyright © 2011 Elsevier B.V. All rights reserved.

Method for identifying mutagenic agents which induce large, multilocus deletions in DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bradley, W.E.C.; Belouchi, A.; Dewyse, P.

1993-07-13

A method of identifying a mutagenic agent is described which includes a large, multilocus deletions in DNA in mammalian cells comprising: (i) exposing a class III heterozygous CHO cell line to a potential mutagenic agent under investigation, and allowing any mutation of the cell line to proceed, said cell line being characterized in that a restriction fragment length variation exists in on mutation it becomes resistant to 2,6-diaminopurine and in that the DNA sequence adjacent to the two alleles of the APRT gene such that the DNA sequence adjacent to one of the two alleles can be digested with themore » enzyme BclI but the DNA sequence variation adjacent to the other of the two alleles cannot be digested with BclI, (ii) isolating induced mutations of the cell line deficient in APRT function, (iii) isolating DNA from the induced mutants, (iv) digesting the isolated DNA with BclI enzyme to produce digested fragments including a 19 kb fragment and any 2 kb fragment, which fragments hybridize with the labeled probe derived from DNA fragment PDI, (v) separating any digested fragments, (vi) transferring the separated fragments of (v) to a solid support, (vii) hybridizing the supported separated fragments with a labeled probe derived from the clone DNA fragment PD 1, (viii) determining fragments having undergone loss of the 2 kb band identified by the probe, as an identification of parent mutants in which the loss occurred, and (ix) evaluating the mutating ability of the potential mutagenic agent.« less

Proteomic Analysis Reveals the Contribution of TGFβ/Smad4 Signaling Pathway to Cell Differentiation During Planarian Tail Regeneration.

PubMed

Chen, Xiaoguang; Xu, Cunshuan

2017-06-01

After planarian tail is cut off, posterior end of the remaining fragment will regenerate a new tail within about 1 week. However, many details of this process remain unclear up to date. For this reason, we performed the dynamic proteomic analysis of the regenerating tail fragments at 6, 12, 24, 72, 120, and 168 h post-amputation (hpa). Using two-dimensional electrophoresis (2-DE) in combination with MALDI-TOF-TOF/MS analysis, a total of 1088 peptides were identified as significantly changed between tail-cutting groups and 0-h group, 482 of which have identifiable protein names. Of these 482 proteins, there were 111 originating from the Turbellaria. Protein functional categorization showed that these 111 proteins are mainly related to differentiation and development, transcription and translation, cell signal transduction, and cell proliferation. The screening of key protein considered the transcription factor Smad4 as important protein for planarian tail regeneration. Cell signaling pathway analysis, combined with proteomic profiling of regenerating tail fragment, showed that TGFβ/Smad4 pathway was activated during planarian tail regeneration. Based on a comprehensive analysis of 2-DE MALDI-TOF-TOF/MS and bioinformatics analyses, it could be concluded that TGFβ/Smad4 pathway perhaps plays an important role in tail regeneration via promoting cell differentiation.

Halogeno-substituted 2-aminobenzoic acid derivatives for negative ion fragmentation studies of N-linked carbohydrates.

PubMed

Harvey, David J

2005-01-01

Negative ion electrospray mass spectra of high-mannose N-linked glycans derivatised with 2-aminobenzoic acids and ionised from solutions containing ammonium hydroxide gave prominent [M-H](-) ions accompanied by weaker [M-2H](2-) ions. Fragmentation of both types of ions gave prominent singly charged glycosidic cleavage ions containing the derivatised reducing terminus and ions from the non-reducing terminus that appeared to be products of cross-ring cleavages. Differentiation of these two groups of ions was conveniently achieved in a single spectrum by use of chloro- or bromo-substituted benzoic acids in order to label ions containing the derivative with an atom with a distinctive isotope pattern. Fragmentation of the doubly charged ions gave more abundant fragments, both singly and doubly charged, than did fragmentation of the singly charged ions, but information of chain branching was masked by the appearance of prominent ions produced by internal cleavages. Copyright (c) 2005 John Wiley & Sons, Ltd.

The APSES protein Sok2 is a positive regulator of sporulation in Ashbya gossypii.

PubMed

Wasserstrom, Lisa; Dünkler, Alexander; Walther, Andrea; Wendland, Jürgen

2017-12-01

Ashbya gossypii is a homothallic, flavinogenic, filamentous ascomycete that starts overproduction of riboflavin and fragments its mycelium quantitatively into spore producing sporangia at the end of a growth phase. Mating is not required for sporulation and the standard homothallic laboratory strain is a MATa strain. Here we show that ectopic expression of Saccharomyces cerevisiae MATα2 in A. gossypii completely suppresses sporulation, inhibits riboflavin overproduction and downregulates among others AgSOK2. AgSok2 belongs to a fungal-specific group of (APSES) transcription factors. Deletion of AgSOK2 strongly reduces riboflavin production and blocks sporulation. The initiator of meiosis, AgIME1, is a transcription factor essential for sporulation. We characterized the AgIME1 promoter region required for complementation of the Agime1 mutant. Reporter assays with AgIME1 promoter fragments fused to lacZ showed that AgSok2 does not control AgIME1 transcription. However, global transcriptome analysis identified two other essential regulators of sporulation, AgIME2 and AgNDT80, as potential targets of AgSok2. Our data suggest that sporulation and riboflavin production in A. gossypii are under mating type locus and nutritional control. Sok2, a target of the cAMP/protein kinase A pathway, serves as a central positive regulator to promote sporulation. This contrasts Saccharomyces cerevisiae where Sok2 is a repressor of IME1 transcription. © 2017 John Wiley & Sons Ltd.

Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

PubMed

Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

2017-05-01

Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

Tests of a Structural Theory of the Memory Trace.

ERIC Educational Resources Information Center

Jones, Gregory V.

1978-01-01

Jones (1976) has shown that the memory trace resulting from the viewing of a picture corresponds to a "fragment" of that picture. This research shows that the fragmentation hypothesis also correctly represents the recall of memories derived from sentences, i.e., the functional unit of memory, the mnemonic trace, is a fragment of the original item.…

Analysis of glycerophosphocholine molecular species as derivatives of 7-[(chlorocarbonyl)-methoxy]-4-methylcoumarin.

PubMed

Wheelan, P; Zirrolli, J A; Clay, K L

1992-01-01

A method has been developed for the analysis of derivatized diradylglycerols obtained from glycerophosphocholine (GPC) of transformed murine bone marrow-derived mast cells that provided high performance liquid chromatography (HPLC) separation of GPC subclasses and molecular species separation with on-line quantitation using UV detection. In addition, the derivatized diradylglycerol species were unequivocably identified by continuous flow fast-atom bombardment mass spectrometry. GPC was initially isolated by thin-layer chromatography (TLC), the phosphocholine group was hydrolyzed, and the resultant diradylglycerol was derivatized with 7-[(chlorocarbonyl)-methoxy]-4-methylcoumarin (CMMC). After separation of the derivatized subclasses by normal phase HPLC, the individual molecular species of the alkylacyl and diacyl subclasses were quantitated and collected during a subsequent reverse phase HPLC step. With an extinction coefficient of 14,700 l mol-1 cm-1 at a wavelength detection of 320 nm, the CMMC derivatives afforded sensitive UV detection (100 pmol) and quantitation of the molecular species. Continuous flow fast-atom bombardment mass spectrometry of the alkylacyl CMMC derivatives yielded abundant [MH]+ ions and a single fragment ion formed by loss of alkylketene from the sn-2 acyl group, [MH-(R = C = O)]+. No fragmentation of the sn-1 alkyl chain was observed. Diacyl derivatives also produced abundant [MH]+ ions plus two fragment ions arising from loss of RCOOH from each of the acyl substituents and two fragment ions from the loss of alkyketene from each acyl group. Individual molecular species substituents were assigned from these ions.

Fragment Length of Circulating Tumor DNA.

PubMed

Underhill, Hunter R; Kitzman, Jacob O; Hellwig, Sabine; Welker, Noah C; Daza, Riza; Baker, Daniel N; Gligorich, Keith M; Rostomily, Robert C; Bronner, Mary P; Shendure, Jay

2016-07-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134-144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132-145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA.

[Transcriptome analysis of Dunaliella viridis].

PubMed

Zhu, Shuai-qi; Gong, Yi-fu; Hang, Yu-qing; Liu, Hao; Wang, He-yu

2015-08-01

In order to understand the gene information, function, haloduric pathway (glycerolipid metabolism) and related key genes for Dunaliella viridis, we used Illumina HiSeqTM 2000 high-throughput sequencing technology to sequence its transcriptome. Trinity soft was used to assemble the data to form transcripts. Based on the Clusters of Orthologous Groups (COG), Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG ) databases, we carried out functional annotation and classification, pathway annotation, and the opening reading fragment (ORF) sequence prediction of transcripts. The key genes in the glycerolipid metabolism were analyzed. The results suggested that 81,593 transcripts were found, and 77,117 ORF sequences were predicted, accounting for 94.50% of all transcripts. COG classification results showed that 16,569 transcripts were assigned to 24 categories. GO classification annotated 76,436 transcripts. The number of transcripts for biologcial processes was 30,678, accounting for 40.14% of all transcripts. KEGG pathway analysis showed that 26,428 transcripts were annotated to 317 pathways, and 131 pathways were related to metabolism, accounting for 41.32% of all annotated pathways. Only one transcript was annotated as coding the key enzyme dihydroxyacetone kinase involved in the glycerolipid pathway. This enzyme could be related to glycerol biosynthesis under salt stress. This study further improved the gene information and laid the foundation of metabolic pathway research for Dunaliella viridis.

ATF3 plays a protective role against toxicity by N-terminal fragment of mutant huntingtin in stable PC12 cell line

PubMed Central

Liang, Yideng; Jiang, Haibing; Ratovitski, Tamara; Jie, Chunfa; Nakamura, Masayuki; Hirschhorn, Ricky R.; Wang, Xiaofang; Smith, Wanli W.; Hai, Tsonwin; Poirier, Michelle A.; Ross, Christopher A.

2009-01-01

Huntington's disease is a progressive neurodegenerative disorder caused by a polyglutamine expansion near the N-terminus of huntingtin. The mechanisms of polyglutamine neurotoxicity, and cellular responses are not fully understood. We have studied gene expression profiles by cDNA array using an inducible PC12 cell model expressing an N-terminal huntingtin fragment with expanded polyglutamine (Htt-N63-148Q). Mutant huntingtin Htt-N63 induced cell death and increased the mRNA and protein levels of activating transcription factor 3 (ATF3). Mutant Htt-N63 also significantly enhanced ATF3 transcriptional activity by a promoter-based reporter assay. Overexpression of ATF3 protects against mutant Htt-N63 toxicity and knocking down ATF3 expression reduced Htt-N63 toxicity in a stable PC12 cell line. These results indicated that ATF3 plays a critical role in toxicity induced by mutant Htt-N63 and may lead to a useful therapeutic target. PMID:19559011

Identification of a transcription factor like protein at the TOR locus in Leishmania mexicana amazonensis.

PubMed

Detke, S

1997-12-15

The TOR gene (TOxic nucleoside Resistance gene) was mapped to a 2.3 kb fragment on the amplified DNA from tubercidin resistant Leishmania (TUB). This DNA fragment conferred upon wild type cells resistance to tubercidin, inosine dialdehyde, formycin A and B and allopurinol riboside and a reduced ability to accumulate purine nucleobases and nucleosides. These properties were characteristic of the parental TUB cells which carried the intact amplified DNA and have been hypothesized to be caused by a reduction in the activity of the multiple purine transporters within this organism. The TOR gene was found to be partially homologous to the rodent and human Oct-6/SCIP/Tst-1 gene. It lacked, however, the POU specific domain of this class of transcription factors and contained only the first two helices of the POU homeodomain. This truncated homeodomain was not required to confer resistance upon wild type cells to toxic nucleosides, suggesting that TOR was not a repressor with independent DNA binding capability.

Partial bisulfite conversion for unique template sequencing

PubMed Central

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael

2018-01-01

Abstract We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. PMID:29161423

Detection of non-coding RNA in bacteria and archaea using the DETR'PROK Galaxy pipeline.

PubMed

Toffano-Nioche, Claire; Luo, Yufei; Kuchly, Claire; Wallon, Claire; Steinbach, Delphine; Zytnicki, Matthias; Jacq, Annick; Gautheret, Daniel

2013-09-01

RNA-seq experiments are now routinely used for the large scale sequencing of transcripts. In bacteria or archaea, such deep sequencing experiments typically produce 10-50 million fragments that cover most of the genome, including intergenic regions. In this context, the precise delineation of the non-coding elements is challenging. Non-coding elements include untranslated regions (UTRs) of mRNAs, independent small RNA genes (sRNAs) and transcripts produced from the antisense strand of genes (asRNA). Here we present a computational pipeline (DETR'PROK: detection of ncRNAs in prokaryotes) based on the Galaxy framework that takes as input a mapping of deep sequencing reads and performs successive steps of clustering, comparison with existing annotation and identification of transcribed non-coding fragments classified into putative 5' UTRs, sRNAs and asRNAs. We provide a step-by-step description of the protocol using real-life example data sets from Vibrio splendidus and Escherichia coli. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

[Novel hybrid inhibitors of the phage T7 RNA polymerase: synthesis, docking and screening in vitro].

PubMed

Kostina, V H; Pal'chykovs'ka, L H; Platonov, M O; Vasyl'chenko, O V; Lysenko, N A; Alekseeva, I V

2012-01-01

A number of new hybrid heteroaromatic compounds, consisting of tricyclic fragments (acridone, thioxanthone and phenazine) and bicyclic fragments (benzimidazole, benzothiazole and benzoxazole) were synthesized using the method, developed by the authors. As a result of screening against the transcription model system of the phage T7 DNA-dependent RNA polymerase three effective inhibitors of the RNA syntheses with the IC50 value of 8.9, 5.7 and 19.8 microM were detected. To cast light on the mode of interaction between the synthesized compounds and the target, the molecular docking was applied to the model pocket of the phage T7 RNA polymerase transcription complex. It was established that these ligands form networks of H-bonds with residues of the pocket conservative amino acids and pi-interaction with the Mg2+ ion. A planar geometry of the hybrid molecules, realized due to the intramolecular H-bonds, proved to be an important structural feature, which correlates with an efficacious inhibitory activity.

Efficient exploration of chemical space by fragment-based screening.

PubMed

Hall, Richard J; Mortenson, Paul N; Murray, Christopher W

2014-01-01

Screening methods seek to sample a vast chemical space in order to identify starting points for further chemical optimisation. Fragment based drug discovery exploits the superior sampling of chemical space that can be achieved when the molecular weight is restricted. Here we show that commercially available fragment space is still relatively poorly sampled and argue for highly sensitive screening methods to allow the detection of smaller fragments. We analyse the properties of our fragment library versus the properties of X-ray hits derived from the library. We particularly consider properties related to the degree of planarity of the fragments. Copyright © 2014 Elsevier Ltd. All rights reserved.

Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.

PubMed

Vieille-Grosjean, I; Huber, P

1995-03-03

The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.

Identification and Comparative Expression Profiles of Chemoreception Genes Revealed from Major Chemoreception Organs of the Rice Leaf Folder, Cnaphalocrocis medinalis (Lepidoptera: Pyralidae)

PubMed Central

Zeng, Fang-Fang; Zhao, Zhen-Fei; Yan, Miao-Jun; Zhou, Wen; Zhang, Zan; Zhang, Aijun; Lu, Zhong-Xian; Wang, Man-Qun

2015-01-01

To better understand the olfactory mechanisms in the rice leaf folder, Cnaphalocrocis medinalis (Guenée), a serious pest of rice in Asia, we established six partial transcriptomes from antennae, protarsus, and reproductive organs of male and female adults. A total of 102 transcripts were identified, including 29 odorant receptors (ORs), 15 ionotropic receptors (IRs), 30 odorant-binding proteins (OBPs), 26 chemosensory proteins (CSPs), and 2 sensory neuron membrane proteins (SNMPs). The expression patterns of these genes were calculated by fragments per kilobase of exon per million fragments mapped (FPKM) and validated by real-time quantitative PCR (RT-qPCR). Some transcripts were exclusively expressed in specific organs, such as female protarsus, whereas others were universally expressed, this varied expression profile may provide insights into the specific functions mediated by chemoreception proteins in insects. To the best of our knowledge, among the 102 identified transcripts, 81 are novel and have never been reported before. In addition, it also is the first time that ORs and IRs are identified in C. medinalis. Our findings significantly enhance the currently limited understanding olfactory mechanisms of the olfactory mechanisms underlying the chemoreception system in C. medinalis. PMID:26657286

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity

PubMed Central

Regis, David P.; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L.; Stefaniak, Maureen E.; Campo, Joseph J.; Carucci, Daniel J.; Roth, David A.; He, Huaping; Felgner, Philip L.; Doolan, Denise L.

2009-01-01

We have evaluated a technology called Transcriptionally Active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data. PMID:18164079

Transcriptionally active PCR for antigen identification and vaccine development: in vitro genome-wide screening and in vivo immunogenicity.

PubMed

Regis, David P; Dobaño, Carlota; Quiñones-Olson, Paola; Liang, Xiaowu; Graber, Norma L; Stefaniak, Maureen E; Campo, Joseph J; Carucci, Daniel J; Roth, David A; He, Huaping; Felgner, Philip L; Doolan, Denise L

2008-03-01

We have evaluated a technology called transcriptionally active PCR (TAP) for high throughput identification and prioritization of novel target antigens from genomic sequence data using the Plasmodium parasite, the causative agent of malaria, as a model. First, we adapted the TAP technology for the highly AT-rich Plasmodium genome, using well-characterized P. falciparum and P. yoelii antigens and a small panel of uncharacterized open reading frames from the P. falciparum genome sequence database. We demonstrated that TAP fragments encoding six well-characterized P. falciparum antigens and five well-characterized P. yoelii antigens could be amplified in an equivalent manner from both plasmid DNA and genomic DNA templates, and that uncharacterized open reading frames could also be amplified from genomic DNA template. Second, we showed that the in vitro expression of the TAP fragments was equivalent or superior to that of supercoiled plasmid DNA encoding the same antigen. Third, we evaluated the in vivo immunogenicity of TAP fragments encoding a subset of the model P. falciparum and P. yoelii antigens. We found that antigen-specific antibody and cellular immune responses induced by the TAP fragments in mice were equivalent or superior to those induced by the corresponding plasmid DNA vaccines. Finally, we developed and demonstrated proof-of-principle for an in vitro humoral immunoscreening assay for down-selection of novel target antigens. These data support the potential of a TAP approach for rapid high throughput functional screening and identification of potential candidate vaccine antigens from genomic sequence data.

Detection of collagen triple helix repeat containing-1 and nuclear factor (erythroid-derived 2)-like 3 in colorectal cancer.

PubMed

Palma, Marco; Lopez, Lissett; García, Margarita; de Roja, Nuria; Ruiz, Tamara; García, Julita; Rosell, Elisabet; Vela, Carmen; Rueda, Paloma; Rodriguez, María-Jose

2012-02-09

Collagen Triple Helix Repeat Containing-1 (CTHRC1) and Nuclear factor (erythroid-derived 2)-like 3 (NFE2L3) may be useful biomarker candidates for the diagnosis of colorectal cancer (CRC) since they have shown an increase messenger RNA transcripts (mRNA) expression level in adenomas and colorectal tumours when compared to normal tissues. To evaluate CTHRC1 and NFE2L3 as cancer biomarkers, it was generated and characterised several novel specific polyclonal antibodies (PAb), monoclonal antibodies (MAbs) and soluble Fab fragments (sFabs) against recombinant CTHRC1 and NFE2L3 proteins, which were obtained from different sources, including a human antibody library and immunised animals. The antibodies and Fab fragments were tested for recognition of native CTHRC1 and NFE2L3 proteins by immunoblotting analysis and enzyme-linked immunosorbent assay (ELISA) in colorectal cell lines derived from tumour and cancer tissues. Both, antibodies and a Fab fragment showed high specificity since they recognised only their corresponding recombinant antigens, but not a panel of different unrelated- and related proteins.In Western blot analysis of CTHRC1, a monoclonal antibody designated CH21D7 was able to detect a band of the apparent molecular weight of a full-length CTHRC1 in the human colon adenocarcinoma cell line HT29. This result was confirmed by a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with the monoclonal antibodies CH21D7 and CH24G2, detecting CTHRC1 in HT29 and in the colon adenocarcinoma cell line SW620.Similar experiments were performed with PAb, MAbs, and sFab against NFE2L3. The immunoblot analysis showed that the monoclonal antibody 41HF8 recognised NFE2L3 in HT29, and leukocytes. These results were verified by DAS-ELISA assay using the pairs PAb/sFab E5 and MAb 41HF8/sFab E5.Furthermore, an immunoassay for simultaneous detection of the two cancer biomarkers was developed using a Dissociation-Enhanced Lanthanide Fluorescent Immunoassay technology (DELFIA). In conclusion, the antibodies obtained in this study are specific for CTHRC1 and NFE2L3 since they do not cross-react with unrelated- and related proteins and are useful for specific measurement of native CTHRC1 and NFE2L3 proteins. The antibodies and immunoassays may be useful for the analysis of CTHRC1 and NFE2L3 in clinical samples and for screening of therapeutic compounds in CRC.

Fragment-Based Discovery of Pyrimido[1,2-b]indazole PDE10A Inhibitors.

PubMed

Chino, Ayaka; Seo, Ryushi; Amano, Yasushi; Namatame, Ichiji; Hamaguchi, Wataru; Honbou, Kazuya; Mihara, Takuma; Yamazaki, Mayako; Tomishima, Masaki; Masuda, Naoyuki

2018-01-01

In this study, we report the identification of potent pyrimidoindazoles as phosphodiesterase10A (PDE10A) inhibitors by using the method of fragment-based drug discovery (FBDD). The pyrazolopyridine derivative 2 was found to be a fragment hit compound which could occupy a part of the binding site of PDE10A enzyme by using the method of the X-ray co-crystal structure analysis. On the basis of the crystal structure of compound 2 and PDE10A protein, a number of compounds were synthesized and evaluated, by means of structure-activity relationship (SAR) studies, which culminated in the discovery of a novel pyrimidoindazole derivative 13 having good physicochemical properties.

The Importance of Three-Body Interactions in Molecular Dynamics Simulations of Water with the Fragment Molecular Orbital Method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pruitt, Spencer R.; Nakata, Hiroya; Nagata, Takeshi

2016-04-12

The analytic first derivative with respect to nuclear coordinates is formulated and implemented in the framework of the three-body fragment molecular orbital (FMO) method. The gradient has been derived and implemented for restricted Hartree-Fock, second-order Møller-Plesset perturbation, and density functional theories. The importance of the three-body fully analytic gradient is illustrated through the failure of the two-body FMO method during molecular dynamics simulations of a small water cluster. The parallel implementation of the fragment molecular orbital method, its parallel efficiency, and its scalability on the Blue Gene/Q architecture up to 262,144 CPU cores, are also discussed.

Analytic second derivative of the energy for density-functional tight-binding combined with the fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: hiroya.nakata.gt@kyocera.jp; Nishimoto, Yoshio; Fedorov, Dmitri G.

2016-07-28

The analytic second derivative of the energy is developed for the fragment molecular orbital (FMO) method combined with density-functional tight-binding (DFTB), enabling simulations of infrared and Raman spectra of large molecular systems. The accuracy of the method is established in comparison to full DFTB without fragmentation for a set of representative systems. The performance of the FMO-DFTB Hessian is discussed for molecular systems containing up to 10 041 atoms. The method is applied to the study of the binding of α-cyclodextrin to polyethylene glycol, and the calculated IR spectrum of an epoxy amine oligomer reproduces experiment reasonably well.

DebriSat Fragment Characterization System and Processing Status

NASA Technical Reports Server (NTRS)

Rivero, M.; Shiotani, B.; M. Carrasquilla; Fitz-Coy, N.; Liou, J. C.; Sorge, M.; Huynh, T.; Opiela, J.; Krisko, P.; Cowardin, H.

2016-01-01

The DebriSat project is a continuing effort sponsored by NASA and DoD to update existing break-up models using data obtained from hypervelocity impact tests performed to simulate on-orbit collisions. After the impact tests, a team at the University of Florida has been working to characterize the fragments in terms of their mass, size, shape, color and material content. The focus of the post-impact effort has been the collection of 2 mm and larger fragments resulting from the hypervelocity impact test. To date, in excess of 125K fragments have been recovered which is approximately 40K more than the 85K fragments predicted by the existing models. While the fragment collection activities continue, there has been a transition to the characterization of the recovered fragments. Since the start of the characterization effort, the focus has been on the use of automation to (i) expedite the fragment characterization process and (ii) minimize the effects of human subjectivity on the results; e.g., automated data entry processes were developed and implemented to minimize errors during transcription of the measurement data. At all steps of the process, however, there is human oversight to ensure the integrity of the data. Additionally, repeatability and reproducibility tests have been developed and implemented to ensure that the instrumentations used in the characterization process are accurate and properly calibrated.

Long non-coding RNA nuclear paraspeckle assembly transcript 1 inhibits the apoptosis of retina Müller cells after diabetic retinopathy through regulating miR-497/brain-derived neurotrophic factor axis.

PubMed

Li, Xiu-Juan

2018-05-01

The role of long non-coding RNA in diabetic retinopathy, a serious complication of diabetes mellitus, has attracted increasing attention in recent years. The purpose of this study was to explore whether long non-coding RNA nuclear paraspeckle assembly transcript 1 was involved in the context of diabetic retinopathy and its underlying mechanisms. Our results revealed that nuclear paraspeckle assembly transcript 1 was significantly downregulated in the retina of diabetes mellitus rats. Meanwhile, miR-497 was significantly increased in diabetes mellitus rats' retina and high glucose-treated Müller cells, but brain-derived neurotrophic factor was increased. We also found that high glucose-induced apoptosis of Müller cells was accompanied by the significant downregulation of nuclear paraspeckle assembly transcript 1 in vitro. Further study demonstrated that high glucose-promoted Müller cells apoptosis through downregulating nuclear paraspeckle assembly transcript 1 and downregulated nuclear paraspeckle assembly transcript 1 mediated this effect via negative regulating miR-497. Moreover, brain-derived neurotrophic factor was negatively regulated by miR-497 and associated with the apoptosis of Müller cells under high glucose. Our results suggested that under diabetic conditions, downregulated nuclear paraspeckle assembly transcript 1 decreased the expression of brain-derived neurotrophic factor through elevating miR-497, thereby promoting Müller cells apoptosis and aggravating diabetic retinopathy.

Direct connection between the different QCD orders for parton distribution and fragmentation functions

NASA Astrophysics Data System (ADS)

Shevchenko, O. Yu.

2013-06-01

The formulas directly connecting parton distribution functions and fragmentation functions at the next-to-leading-order QCD with the same quantities at the leading order are derived. These formulas are universal, i.e., have the same form for all kinds of parton distribution functions and fragmentation functions, differing only in the respective splitting functions entering there.

Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

PubMed

Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

2015-01-01

Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and reproduction performance.

Identification of peptides in functional Scamorza ovine milk cheese.

PubMed

Albenzio, M; Santillo, A; Marino, R; Della Malva, A; Caroprese, M; Sevi, A

2015-12-01

Ovine bulk milk was used to produce Scamorza cheese with probiotics: either a mix of Bifidobacterium longum and Bifidobacterium lactis or Lactobacillus acidophilus as the probiotic strains. Peptides obtained from reverse phase-HPLC water-soluble extract of Scamorza cheeses were analyzed using a quadrupole time-of-flight liquid chromatography-mass spectrometry system. Identified fragments were derived from casein hydrolysis or probiotic bacterial enzymes; some of the fragments showed encrypted peptide sequences that shared structural homology with previously described bioactive peptides in ovine milk and dairy products. Bifidobacterium longum and B. lactis showed greater proteolytic potential both in terms of level of pH 4.6 water-soluble nitrogen extract and ability to generate peptides with potential biofunctionality. Fragments deriving from microbial enzymes may be regarded as tracing fragments useful for monitoring probiotic activity in functional Scamorza cheese. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Hypochlorite and superoxide radicals can act synergistically to induce fragmentation of hyaluronan and chondroitin sulphates

PubMed Central

2004-01-01

Activated phagocytes release the haem enzyme MPO (myeloperoxidase) and also generate superoxide radicals (O2•−), and hence H2O2, via an oxidative burst. Reaction of MPO with H2O2 in the presence of chloride ions generates HOCl (the physiological mixture of hypochlorous acid and its anion present at pH 7.4). Exposure of glycosaminoglycans to a MPO–H2O2–Cl− system or reagent HOCl generates long-lived chloramides [R-NCl-C(O)-R′] derived from the glycosamine N-acetyl functions. Decomposition of these species by transition metal ions gives polymer-derived amidyl (nitrogen-centred) radicals [R-N•-C(O)-R′], polymer-derived carbon-centred radicals and site-specific strand scission. In the present study, we have shown that exposure of glycosaminoglycan chloramides to O2•− also promotes chloramide decomposition and glycosaminoglycan fragmentation. These processes are inhibited by superoxide dismutase, metal ion chelators and the metal ion-binding protein BSA, consistent with chloramide decomposition and polymer fragmentation occurring via O2•−-dependent one-electron reduction, possibly catalysed by trace metal ions. Polymer fragmentation induced by O2•− [generated by the superoxide thermal source 1, di-(4-carboxybenzyl)hyponitrite] was demonstrated to be entirely chloramide dependent as no fragmentation occurred with the native polymers or when the chloramides were quenched by prior treatment with methionine. EPR spin-trapping experiments using 5,5-dimethyl1-pyrroline-N-oxide and 2-methyl-2-nitrosopropane have provided evidence for both O2•− and polymer-derived carbon-centred radicals as intermediates. The results obtained are consistent with a mechanism involving one-electron reduction of the chloramides to yield polymer-derived amidyl radicals, which subsequently undergo intramolecular hydrogen atom abstraction reactions to give carbon-centred radicals. The latter undergo fragmentation reactions in a site-specific manner. This synergistic damage to glycosaminoglycans induced by HOCl and O2•− may be of significance at sites of inflammation where both oxidants are generated concurrently. PMID:15078224

Variable RNA expression from recently acquired, endogenous viral elements (EVE) of white spot syndrome virus (WSSV) in shrimp.

PubMed

Utari, Heny Budi; Soowannayan, Chumporn; Flegel, Timothy W; Whityachumnarnkul, Boonsirm; Kruatrachue, Maleeya

2017-11-01

The viral accommodation hypothesis proposes that endogenous viral elements (EVE) from both RNA and DNA viruses are being continually integrated into the shrimp genome by natural host processes and that they can result in tolerance to viral infection by fortuitous production of antisense, immunospecific RNA (imRNA). Thus, we hypothesized that previously reported microarray results for the presence of white spot syndrome virus (WSSV) open reading frames (ORFs) formerly called 151, 366 and 427 in a domesticated giant tiger shrimp (Penaeus monodon) breeding stock might have represented expression from EVE, since the stock had shown uninterrupted freedom from white spot disease (WSD) for many generations. To test this hypothesis, 128 specimens from a current stock generation were confirmed for freedom from WSSV infection using two nested PCR detection methods. Subsequent nested-PCR testing revealed 33/128 specimens (26%) positive for at least one of the ORF at very high sequence identity (95-99%) to extant WSSV. Positive results for ORF 366 (now known to be a fragment of the WSSV capsid protein gene) dominated (28/33 = 84.8%), so 9 arbitrarily selected 366-positive specimens were tested by strand-specific, nested RT-PCR using DNase-treated RNA templates. This revealed variable RNA expression in individual shrimp including no RNA transcripts (n = 1), sense transcripts only (n = 1), antisense transcripts only (n = 2) or transcripts of both sense (n = 5). The latter 7 expression products indicated specimens producing putative imRNA. The variable types and numbers of the EVE and the variable RNA expression (including potential imRNA) support predictions of the viral accommodation hypothesis that EVE are randomly produced and expressed. Positive nested PCR test results for EVE of ORF 366 using DNA templates derived from shrimp sperm (germ cells), indicated that they were heritable. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genome Shuffling and Gentamicin-Resistance to Improve ε-Poly-L-Lysine Productivity of Streptomyces albulus W-156.

PubMed

Wang, Liang; Chen, Xusheng; Wu, Guangyao; Zeng, Xin; Ren, Xidong; Li, Shu; Tang, Lei; Mao, Zhonggui

2016-12-01

Genome shuffling has been a recently effective method for screening the desirable phenotypes of industrial strains. Here, we combined genome shuffling and gentamicin resistance to improve the production of ε-poly-L-lysine in Streptomyces albulus W-156. Five starting mutants with higher ε-poly-L-lysine (ε-PL) productivities were firstly obtained by atmospheric and room temperature plasma (ARTP) mutagenesis. After three rounds of genome shuffling with increasing concentration of gentamicin for selection, S. albulus AG3-28, was finally got with a production of 3.43 g/L in shaking flask. In a 5-L fermenter, AG3-28 exhibited a higher ε-PL productivity (56.5 g/L) than the initial strain W-156 (37.5 g/L). Key enzyme activities in primary and secondary metabolic pathways were analyzed, and the transcription levels of hrdD and pls were determined by quantitative real time-polymerase chain reaction (qRT-PCR). Increase of key enzyme activities and the upregulation of the gene transcriptional levels demonstrated that ε-PL synthetic pathway in AG3-28 was obviously strengthened, which might be responsible for the high productivity. Moreover, hyper-yield strain AG3-28 was found to produce a slightly lower ε-PL polymerization degree than the parent strain. Amplified fragment length polymorphism (AFLP) analysis reflects the genetic diversity among the derivates after genome shuffling.

Recovering complete mitochondrial genome sequences from RNA-Seq: A case study of Polytomella non-photosynthetic green algae.

PubMed

Tian, Yao; Smith, David Roy

2016-05-01

Thousands of mitochondrial genomes have been sequenced, but there are comparatively few available mitochondrial transcriptomes. This might soon be changing. High-throughput RNA sequencing (RNA-Seq) techniques have made it fast and cheap to generate massive amounts of mitochondrial transcriptomic data. Here, we explore the utility of RNA-Seq for assembling mitochondrial genomes and studying their expression patterns. Specifically, we investigate the mitochondrial transcriptomes from Polytomella non-photosynthetic green algae, which have among the smallest, most reduced mitochondrial genomes from the Archaeplastida as well as fragmented rRNA-coding regions, palindromic genes, and linear chromosomes with telomeres. Isolation of whole genomic RNA from the four known Polytomella species followed by Illumina paired-end sequencing generated enough mitochondrial-derived reads to easily recover almost-entire mitochondrial genome sequences. Read-mapping and coverage statistics also gave insights into Polytomella mitochondrial transcriptional architecture, revealing polycistronic transcripts and the expression of telomeres and palindromic genes. Ultimately, RNA-Seq is a promising, cost-effective technique for studying mitochondrial genetics, but it does have drawbacks, which are discussed. One of its greatest potentials, as shown here, is that it can be used to generate near-complete mitochondrial genome sequences, which could be particularly useful in situations where there is a lack of available mtDNA data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Identification of water-deficit responsive genes in maritime pine (Pinus pinaster Ait.) roots.

PubMed

Dubos, Christian; Plomion, Christophe

2003-01-01

Root adaptation to soil environmental factors is very important to maritime pine, the main conifer species used for reforestation in France. The range of climates in the sites where this species is established varies from flooded in winter to drought-prone in summer. No studies have yet focused on the morphological, physiological or molecular variability of the root system to adapt its growth to such an environment. We developed a strategy to isolate drought-responsive genes in the root tissue in order to identify the molecular mechanisms that trees have evolved to cope with drought (the main problem affecting wood productivity), and to exploit this information to improve drought stress tolerance. In order to provide easy access to the root system, seedlings were raised in hydroponic solution. Polyethylene glycol was used as an osmoticum to induce water deficit. Using the cDNA-AFLP technique, we screened more than 2500 transcript derived fragments, of which 33 (1.2%) showed clear variation in presence/absence between non stressed and stressed medium. The relative abundance of these transcripts was then analysed by reverse northern. Only two out of these 33 genes showed significant opposite behaviour between both techniques. The identification and characterization of water-deficit responsive genes in roots provide the emergence of physiological understanding of the patterns of gene expression and regulation involved in the drought stress response of maritime pine.

Structural Basis of TLR5-Flagellin Recognition and Signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoon, Sung-il; Kurnasov, Oleg; Natarajan, Venkatesh

2012-03-01

Toll-like receptor 5 (TLR5) binding to bacterial flagellin activates signaling through the transcription factor NF-{kappa}B and triggers an innate immune response to the invading pathogen. To elucidate the structural basis and mechanistic implications of TLR5-flagellin recognition, we determined the crystal structure of zebrafish TLR5 (as a variable lymphocyte receptor hybrid protein) in complex with the D1/D2/D3 fragment of Salmonella flagellin, FliC, at 2.47 angstrom resolution. TLR5 interacts primarily with the three helices of the FliC D1 domain using its lateral side. Two TLR5-FliC 1:1 heterodimers assemble into a 2:2 tail-to-tail signaling complex that is stabilized by quaternary contacts of themore » FliC D1 domain with the convex surface of the opposing TLR5. The proposed signaling mechanism is supported by structure-guided mutagenesis and deletion analyses on CBLB502, a therapeutic protein derived from FliC.« less

Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

PubMed Central

Schuster, W; Brennicke, A

1987-01-01

We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

Multiple melanocortin receptors are expressed in bone cells

NASA Technical Reports Server (NTRS)

Zhong, Qing; Sridhar, Supriya; Ruan, Ling; Ding, Ke-Hong; Xie, Ding; Insogna, Karl; Kang, Baolin; Xu, Jianrui; Bollag, Roni J.; Isales, Carlos M.

2005-01-01

Melanocortin receptors belong to the seven transmembrane domain, G-protein coupled family of receptors. There are five members of this receptor family labeled MC1R-MC5R. These receptors are activated by fragments derived from a larger molecule, proopiomelanocortin (POMC) and include ACTH, alpha beta and gamma-MSH and beta-endorphin. Because of in vitro and in vivo data suggesting direct effects of these POMC molecules on bone and bone turnover, we examined bone and bone derived cells for the presence of the various members of the melanocortin receptor family. We report that the five known melanocortin receptors are expressed to varying degrees in osteoblast-like and osteoclastic cells. POMC fragments increased proliferation and expression of a variety of genes in osteoblastic cells. Furthermore, POMC mRNA was detected in osteoclastic cells. These data demonstrate that POMC-derived peptide hormones acting through high affinity melanocortin receptors have specific effects on bone cells. Thus, in addition to the indirect effects of POMC-derived hormones on bone turnover through their modulation of steroid hormone secretion, POMC fragments may have direct and specific effects on bone cell subpopulations.

Antimicrobial Effects of Helix D-derived Peptides of Human Antithrombin III*

PubMed Central

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K. V.; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-01-01

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix d-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. PMID:25202017

Antimicrobial effects of helix D-derived peptides of human antithrombin III.

PubMed

Papareddy, Praveen; Kalle, Martina; Bhongir, Ravi K V; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

2014-10-24

Antithrombin III (ATIII) is a key antiproteinase involved in blood coagulation. Previous investigations have shown that ATIII is degraded by Staphylococcus aureus V8 protease, leading to release of heparin binding fragments derived from its D helix. As heparin binding and antimicrobial activity of peptides frequently overlap, we here set out to explore possible antibacterial effects of intact and degraded ATIII. In contrast to intact ATIII, the results showed that extensive degradation of the molecule yielded fragments with antimicrobial activity. Correspondingly, the heparin-binding, helix D-derived, peptide FFFAKLNCRLYRKANKSSKLV (FFF21) of human ATIII, was found to be antimicrobial against particularly the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa. Fluorescence microscopy and electron microscopy studies demonstrated that FFF21 binds to and permeabilizes bacterial membranes. Analogously, FFF21 was found to induce membrane leakage of model anionic liposomes. In vivo, FFF21 significantly reduced P. aeruginosa infection in mice. Additionally, FFF21 displayed anti-endotoxic effects in vitro. Taken together, our results suggest novel roles for ATIII-derived peptide fragments in host defense. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Dissection of TALE-dependent gene activation reveals that they induce transcription cooperatively and in both orientations

PubMed Central

Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens

2017-01-01

Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators. PMID:28301511

Dissection of TALE-dependent gene activation reveals that they induce transcription cooperatively and in both orientations.

PubMed

Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens

2017-01-01

Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators.

Structural Basis of Transcriptional Gene Silencing Mediated by Arabidopsis MOM1

PubMed Central

Nishimura, Taisuke; Molinard, Guillaume; Petty, Tom J.; Broger, Larissa; Gabus, Caroline; Halazonetis, Thanos D.; Thore, Stéphane; Paszkowski, Jerzy

2012-01-01

Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2) as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA–independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation. PMID:22346760

Structural basis of transcriptional gene silencing mediated by Arabidopsis MOM1.

PubMed

Nishimura, Taisuke; Molinard, Guillaume; Petty, Tom J; Broger, Larissa; Gabus, Caroline; Halazonetis, Thanos D; Thore, Stéphane; Paszkowski, Jerzy

2012-02-01

Shifts between epigenetic states of transcriptional activity are typically correlated with changes in epigenetic marks. However, exceptions to this rule suggest the existence of additional, as yet uncharacterized, layers of epigenetic regulation. MOM1, a protein of 2,001 amino acids that acts as a transcriptional silencer, represents such an exception. Here we define the 82 amino acid domain called CMM2 (Conserved MOM1 Motif 2) as a minimal MOM1 fragment capable of transcriptional regulation. As determined by X-ray crystallography, this motif folds into an unusual hendecad-based coiled-coil. Structure-based mutagenesis followed by transgenic complementation tests in plants demonstrate that CMM2 and its dimerization are effective for transcriptional suppression at chromosomal loci co-regulated by MOM1 and the siRNA pathway but not at loci controlled by MOM1 in an siRNA-independent fashion. These results reveal a surprising separation of epigenetic activities that enable the single, large MOM1 protein to coordinate cooperating mechanisms of epigenetic regulation.

Nucleotide sequence and transcriptional start site of the Methylobacterium organophilum XX methanol dehydrogenase structural gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Machlin, S.M.; Hanson, R.S.

The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less

Transcription Factor Stat5, A Novel Therapeutic Protein, Inhibits Metastatic Potential and Invasive Characteristics of Human Breast Cancer Cells

DTIC Science & Technology

2004-10-01

digestion and cloned into pLoxpNeo upstream of the PGK-neomycin cassette. A 1.3 kb fragment with the first coding exon was amplified by Pfx polymerase ...introducing a XhoI site on the 5’-end of the amplification product. The PCR fragment was cloned blunt into the HinDIII(blunt) site 5’ of the single...functionality of each of the loxP sites was tested in AM-1 cells (Invitrogen) that express Cre recombinase . Step 2: Gene targeting in embryonic stem

Comparative Analysis of Latex Transcriptome Reveals Putative Molecular Mechanisms Underlying Super Productivity of Hevea brasiliensis

PubMed Central

Li, Heping; Fan, Yujie; Yang, Jianghua; Qi, Jiyan; Li, Huibo

2013-01-01

Increasing demand for natural rubber prompts studies into the mechanisms governing the productivity of rubber tree ( Hevea brasiliensis ). It is very interesting to notice that a rubber tree of clone PR107 in Yunnan, China is reported to yield more than 20 times higher than the average rubber tree. This super-high-yielding (SHY) rubber tree (designated as SY107), produced 4.12 kg of latex (cytoplasm of rubber producing laticifers, containing about 30% of rubber) per tapping, more than 7-fold higher than that of the control. This rubber tree is therefore a good material to study how the rubber production is regulated at a molecular aspect. A comprehensive cDNA-AFLP transcript profiling was performed on the latex of SY107 and its average counterparts by using the 384 selective primer pairs for two restriction enzyme combinations (ApoI/MseI and TaqI/MseI). A total of 746 differentially expressed (DE) transcript-derived fragments (TDFs) were identified, of which the expression patterns of 453 TDFs were further confirmed by RT-PCR. These RT-PCR confirmed TDFs represented 352 non-redundant genes, of which 215 had known or partially known functions and were grouped into 10 functional categories. The top three largest categories were transcription and protein synthesis (representing 24.7% of the total genes), defense and stress (15.3%), and primary and secondary metabolism (14.0%). Detailed analysis of the DE-genes suggests notable characteristics of SHY phenotype in improved sucrose loading capability, rubber biosynthesis-preferred sugar utilization, enhanced general metabolism and timely stress alleviation. However, the SHY phenotype has little correlation with rubber-biosynthesis pathway genes. PMID:24066172

cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.).

PubMed

Jayaraman, Ananthi; Puranik, Swati; Rai, Neeraj Kumar; Vidapu, Sudhakar; Sahu, Pranav Pankaj; Lata, Charu; Prasad, Manoj

2008-11-01

Plant growth and productivity are affected by various abiotic stresses such as heat, drought, cold, salinity, etc. The mechanism of salt tolerance is one of the most important subjects in plant science as salt stress decreases worldwide agricultural production. In our present study we used cDNA-AFLP technique to compare gene expression profiles of a salt tolerant and a salt-sensitive cultivar of foxtail millet (Seteria italica) in response to salt stress to identify early responsive differentially expressed transcripts accumulated upon salt stress and validate the obtained result through quantitative real-time PCR (qRT-PCR). The expression profile was compared between a salt tolerant (Prasad) and susceptible variety (Lepakshi) of foxtail millet in both control condition (L0 and P0) and after 1 h (L1 and P1) of salt stress. We identified 90 transcript-derived fragments (TDFs) that are differentially expressed, out of which 86 TDFs were classified on the basis of their either complete presence or absence (qualitative variants) and 4 on differential expression pattern levels (quantitative variants) in the two varieties. Finally, we identified 27 non-redundant differentially expressed cDNAs that are unique to salt tolerant variety which represent different groups of genes involved in metabolism, cellular transport, cell signaling, transcriptional regulation, mRNA splicing, seed development and storage, etc. The expression patterns of seven out of nine such genes showed a significant increase of differential expression in tolerant variety after 1 h of salt stress in comparison to salt-sensitive variety as analyzed by qRT-PCR. The direct and indirect relationship of identified TDFs with salinity tolerance mechanism is discussed.

Fragment Length of Circulating Tumor DNA

PubMed Central

Underhill, Hunter R.; Kitzman, Jacob O.; Hellwig, Sabine; Welker, Noah C.; Daza, Riza; Gligorich, Keith M.; Rostomily, Robert C.; Shendure, Jay

2016-01-01

Malignant tumors shed DNA into the circulation. The transient half-life of circulating tumor DNA (ctDNA) may afford the opportunity to diagnose, monitor recurrence, and evaluate response to therapy solely through a non-invasive blood draw. However, detecting ctDNA against the normally occurring background of cell-free DNA derived from healthy cells has proven challenging, particularly in non-metastatic solid tumors. In this study, distinct differences in fragment length size between ctDNAs and normal cell-free DNA are defined. Human ctDNA in rat plasma derived from human glioblastoma multiforme stem-like cells in the rat brain and human hepatocellular carcinoma in the rat flank were found to have a shorter principal fragment length than the background rat cell-free DNA (134–144 bp vs. 167 bp, respectively). Subsequently, a similar shift in the fragment length of ctDNA in humans with melanoma and lung cancer was identified compared to healthy controls. Comparison of fragment lengths from cell-free DNA between a melanoma patient and healthy controls found that the BRAF V600E mutant allele occurred more commonly at a shorter fragment length than the fragment length of the wild-type allele (132–145 bp vs. 165 bp, respectively). Moreover, size-selecting for shorter cell-free DNA fragment lengths substantially increased the EGFR T790M mutant allele frequency in human lung cancer. These findings provide compelling evidence that experimental or bioinformatic isolation of a specific subset of fragment lengths from cell-free DNA may improve detection of ctDNA. PMID:27428049

c-MYC inhibition impairs hypoxia response in glioblastoma multiforme

PubMed Central

Falchetti, Maria Laura; Illi, Barbara; Bozzo, Francesca; Valle, Cristiana; Helmer-Citterich, Manuela; Ferrè, Fabrizio; Nasi, Sergio; Levi, Andrea

2016-01-01

The c-MYC oncoprotein is a DNA binding transcription factor that enhances the expression of many active genes. c-MYC transcriptional signatures vary according to the transcriptional program defined in each cell type during differentiation. Little is known on the involvement of c-MYC in regulation of gene expression programs that are induced by extracellular cues such as a changing microenvironment. Here we demonstrate that inhibition of c-MYC in glioblastoma multiforme cells blunts hypoxia-dependent glycolytic reprogramming and mitochondria fragmentation in hypoxia. This happens because c-MYC inhibition alters the cell transcriptional response to hypoxia and finely tunes the expression of a subset of Hypoxia Inducible Factor 1-regulated genes. We also show that genes whose expression in hypoxia is affected by c-MYC inhibition are able to distinguish the Proneural subtype of glioblastoma multiforme, thus potentially providing a molecular signature for this class of tumors that are the least tractable among glioblastomas. PMID:27119353

The nucleotide sequence of the putative transcription initiation site of a cloned ribosomal RNA gene of the mouse.

PubMed Central

Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M

1980-01-01

Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156

Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements.

PubMed

Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit

2015-03-09

We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

Genome-Wide Analysis of Alternative Splicing Landscapes Modulated during Plant-Virus Interactions in Brachypodium distachyon

PubMed Central

Scholthof, Karen-Beth G.

2015-01-01

In eukaryotes, alternative splicing (AS) promotes transcriptome and proteome diversity. The extent of genome-wide AS changes occurring during a plant-microbe interaction is largely unknown. Here, using high-throughput, paired-end RNA sequencing, we generated an isoform-level spliceome map of Brachypodium distachyon infected with Panicum mosaic virus and its satellite virus. Overall, we detected ∼44,443 transcripts in B. distachyon, ∼30% more than those annotated in the reference genome. Expression of ∼28,900 transcripts was ≥2 fragments per kilobase of transcript per million mapped fragments, and ∼42% of multi-exonic genes were alternatively spliced. Comparative analysis of AS patterns in B. distachyon, rice (Oryza sativa), maize (Zea mays), sorghum (Sorghum bicolor), Arabidopsis thaliana, potato (Solanum tuberosum), Medicago truncatula, and poplar (Populus trichocarpa) revealed conserved ratios of the AS types between monocots and dicots. Virus infection quantitatively altered AS events in Brachypodium with little effect on the AS ratios. We discovered AS events for >100 immune-related genes encoding receptor-like kinases, NB-LRR resistance proteins, transcription factors, RNA silencing, and splicing-associated proteins. Cloning and molecular characterization of SCL33, a serine/arginine-rich splicing factor, identified multiple novel intron-retaining splice variants that are developmentally regulated and modulated during virus infection. B. distachyon SCL33 splicing patterns are also strikingly conserved compared with a distant Arabidopsis SCL33 ortholog. This analysis provides new insights into AS landscapes conserved among monocots and dicots and uncovered AS events in plant defense-related genes. PMID:25634987

Recombinant PrPSc shares structural features with brain-derived PrPSc: Insights from limited proteolysis.

PubMed

Sevillano, Alejandro M; Fernández-Borges, Natalia; Younas, Neelam; Wang, Fei; R Elezgarai, Saioa; Bravo, Susana; Vázquez-Fernández, Ester; Rosa, Isaac; Eraña, Hasier; Gil, David; Veiga, Sonia; Vidal, Enric; Erickson-Beltran, Melissa L; Guitián, Esteban; Silva, Christopher J; Nonno, Romolo; Ma, Jiyan; Castilla, Joaquín; R Requena, Jesús

2018-01-01

Very solid evidence suggests that the core of full length PrPSc is a 4-rung β-solenoid, and that individual PrPSc subunits stack to form amyloid fibers. We recently used limited proteolysis to map the β-strands and connecting loops that make up the PrPSc solenoid. Using high resolution SDS-PAGE followed by epitope analysis, and mass spectrometry, we identified positions ~116/118, 133-134, 141, 152-153, 162, 169 and 179 (murine numbering) as Proteinase K (PK) cleavage sites in PrPSc. Such sites likely define loops and/or borders of β-strands, helping us to predict the threading of the β-solenoid. We have now extended this approach to recombinant PrPSc (recPrPSc). The term recPrPSc refers to bona fide recombinant prions prepared by PMCA, exhibiting infectivity with attack rates of ~100%. Limited proteolysis of mouse and bank vole recPrPSc species yielded N-terminally truncated PK-resistant fragments similar to those seen in brain-derived PrPSc, albeit with varying relative yields. Along with these fragments, doubly N- and C-terminally truncated fragments, in particular ~89/97-152, were detected in some recPrPSc preparations; similar fragments are characteristic of atypical strains of brain-derived PrPSc. Our results suggest a shared architecture of recPrPSc and brain PrPSc prions. The observed differences, in particular the distinct yields of specific PK-resistant fragments, are likely due to differences in threading which result in the specific biochemical characteristics of recPrPSc. Furthermore, recombinant PrPSc offers exciting opportunities for structural studies unachievable with brain-derived PrPSc.

Transcription of exogenous and endogenous deoxyribonucleic acid templates in cold-shocked Bacillus subtilis.

PubMed Central

Kuhl, S J; Brown, L R

1980-01-01

Ribonucleic acid (RNA) synthesis was examined in cold-shocked Bacillus subtilis cells. The cells were grown to mid-log stage, harvested, and cold shocked. RNA synthesis was monitored by the incorporation of [3H]uridine triphosphate or [alpha 32P]adenosine triphosphate into trichloroacetic acid-precipitable material in the presence of all four nucleoside triphosphates. The inhibition of RNA synthesis in cold-shocked cells by lipiarmycin, ethidium bromide, rifampin. or streptolydigin was analyzed using mutant or wild-type cells. Also examined were the effects of temperature, salt concentration, and the addition of polyamines or highly phosphorylated nucleotides. In ultraviolet-irradiated and cold-shocked cells, RNA wynthesis decreased to low levels. The addition of exogenous phi 29 or TSP-1 template to these cells caused a 13- to 20-fold increase in RNA synthesis, as monitored by trichloroacetic acid-precipitable counts. RNA synthesized in the presence of phi 29 deoxyribonucleic acid (DNA) hybridizes mainly to EcoRI fragments A and C of phi 29 DBA, These two fragments direct transcription by purified RNA polymerase in vitro and hybridize to early phi 29 DNA produced in vivo. Our results with TSP-1 DNA in this system indicated that the RNA produced hybridizes to the same fragments as early RNA produced in vivo. Plasmic pUB110 DNA was not transcribed in this system. Images PMID:6157674

Collision-induced fragmentation of negative ions from N-linked glycans derivatized with 2-aminobenzoic acid.

PubMed

Harvey, David J

2005-05-01

N-Linked glycans from bovine ribonuclease B, chicken ovalbumin, bovine fetuin, porcine thyroglobulin and human alpha(1)-acid glycoprotein were derivatized with 2-aminobenzoic acid by reductive amination and their tandem mass spectra were recorded by negative ion electrospray ionization with a quadrupole time-of-flight mass spectrometer. Derivatives were also prepared from 2-amino-5-methyl- and 2-amino-4,5-dimethoxybenzoic acid in order to confirm the identity of fragment ions containing the reducing terminus. Major fragments from the [M - H](-) ions from the neutral glycans retained the derivative (Y-type cleavages) and provided information on sequence and branching. Other major fragments were products of A-type cross-ring cleavages giving information on antenna structure. Singly doubly and triply charged ions were formed from sialylated glycans. They produced major fragments by loss of sialic acid and a series of singly charged ions that were similar to those from the neutral analogues. Doubly charge ions were also produced by the neutral glycans and were fragmented to form product ions with one and two charges. Again, the fragment ions with a single charge were similar to those from the singly charged parents, but branching information was less obvious because of the occurrence of more abundant ions produced by multiple cleavages. Detection limits were around 200 fmol (3 : 1 signal-to-noise ratio). Copyright 2005 John Wiley & Sons, Ltd.

Occupancy of RNA Polymerase II Phosphorylated on Serine 5 (RNAP S5P) and RNAP S2P on Varicella-Zoster Virus Genes 9, 51, and 66 Is Independent of Transcript Abundance and Polymerase Location within the Gene.

PubMed

Henderson, Heather H; Timberlake, Kensey B; Austin, Zoe A; Badani, Hussain; Sanford, Bridget; Tremblay, Keriann; Baird, Nicholas L; Jones, Kenneth; Rovnak, Joel; Frietze, Seth; Gilden, Don; Cohrs, Randall J

2016-02-01

Regulation of gene transcription in varicella-zoster virus (VZV), a ubiquitous human neurotropic alphaherpesvirus, requires coordinated binding of multiple host and virus proteins onto specific regions of the virus genome. Chromatin immunoprecipitation (ChIP) is widely used to determine the location of specific proteins along a genomic region. Since the size range of sheared virus DNA fragments governs the limit of accurate protein localization, particularly for compact herpesvirus genomes, we used a quantitative PCR (qPCR)-based assay to determine the efficiency of VZV DNA shearing before ChIP, after which the assay was used to determine the relationship between transcript abundance and the occupancy of phosphorylated RNA polymerase II (RNAP) on the gene promoter, body, and terminus of VZV genes 9, 51, and 66. The abundance of VZV gene 9, 51, and 66 transcripts in VZV-infected human fetal lung fibroblasts was determined by reverse transcription-linked quantitative PCR. Our results showed that the C-terminal domain of RNAP is hyperphosphorylated at serine 5 (S5(P)) on VZV genes 9, 51, and 66 independently of transcript abundance and the location within the virus gene at both 1 and 3 days postinfection (dpi). In contrast, phosphorylated serine 2 (S2(P))-modified RNAP was not detected at any virus gene location at 3 dpi and was detected at levels only slightly above background levels at 1 dpi. Regulation of herpesvirus gene transcription is an elaborate choreography between proteins and DNA that is revealed by chromatin immunoprecipitation (ChIP). We used a quantitative PCR-based assay to determine fragment size after DNA shearing, a critical parameter in ChIP assays, and exposed a basic difference in the mechanism of transcription between mammalian cells and VZV. We found that hyperphosphorylation at serine 5 of the C-terminal domain of RNAP along the lengths of VZV genes (the promoter, body, and transcription termination site) was independent of mRNA abundance. In contrast, little to no enrichment of serine 3 phosphorylation of RNAP was detected at these virus gene regions. This is distinct from the findings for RNAP at highly regulated host genes, where RNAP S5(P) occupancy decreased and S2(P) levels increased as the polymerase transited through the gene. Overall, these results suggest that RNAP associates with human and virus transcriptional units through different mechanisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

EIMS Fragmentation Pathways and MRM Quantification of 7α/β-Hydroxy-Dehydroabietic Acid TMS Derivatives

NASA Astrophysics Data System (ADS)

Rontani, Jean-François; Aubert, Claude; Belt, Simon T.

2015-09-01

EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH4-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.

Enantioselective Synthesis of α-Methylene-β-hydroxy Carboxylic Acid Derivatives via a Diastereoselective Aldol-β-Elimination Sequence: Application to the C(15)–C(21) Fragment of Tedanolide C

PubMed Central

Barth, Roland; Roush, William R.

2010-01-01

An enantioselective synthesis of α-methylene-β-hydroxy carboxylic acid derivatives via a highly diastereoselective, one-pot syn-aldol and β-elimination sequence utilizing the chiral β-(phenylselenyl)propionyl imide 15 is described. This new method, which constitutes an alternative to the Baylis-Hillman reaction, has been applied to the synthesis of the C(15)-C(21) fragment of tedanolide C. PMID:20405855

Development of a new vector using Soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans.

PubMed

Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun

2016-02-01

A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.

Transcriptional Differences between Rhesus Embryonic Stem Cells Generated from In Vitro and In Vivo Derived Embryos

PubMed Central

Harvey, Alexandra J.; Mao, Shihong; Lalancette, Claudia; Krawetz, Stephen A.; Brenner, Carol A.

2012-01-01

Numerous studies have focused on the transcriptional signatures that underlie the maintenance of embryonic stem cell (ESC) pluripotency. However, it remains unclear whether ESC retain transcriptional aberrations seen in in vitro cultured embryos. Here we report the first global transcriptional profile comparison between ESC generated from either in vitro cultured or in vivo derived primate embryos by microarray analysis. Genes involved in pluripotency, oxygen regulation and the cell cycle were downregulated in rhesus ESC generated from in vitro cultured embryos (in vitro ESC). Significantly, several gene differences are similarly downregulated in preimplantation embryos cultured in vitro, which have been associated with long term developmental consequences and disease predisposition. This data indicates that prior to derivation, embryo quality may influence the molecular signature of ESC lines, and may differentially impact the physiology of cells prior to or following differentiation. PMID:23028448

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed Central

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-01-01

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene. Images PMID:2602141

The divergently transcribed genes encoding yeast ribosomal proteins L46 and S24 are activated by shared RPG-boxes.

PubMed

Kraakman, L S; Mager, W H; Maurer, K T; Nieuwint, R T; Planta, R J

1989-12-11

Transcription of the majority of the ribosomal protein (rp) genes in yeast is activated through common cis-acting elements, designated RPG-boxes. These elements have been shown to act as specific binding sites for the protein factor TUF/RAP1/GRF1 in vitro. Two such elements occur in the intergenic region separating the divergently transcribed genes encoding L46 and S24. To investigate whether the two RPG-boxes mediate transcription activation of both the L46 and S24 gene, two experimental strategies were followed: cloning of the respective genes on multicopy vectors and construction of fusion genes. Cloning of the L46 + S24 gene including the intergenic region in a multicopy yeast vector indicated that both genes are transcriptionally active. Using constructs in which only the S24 or the L46 gene is present, with or without the intergenic region, we obtained evidence that the intergenic region is indispensable for transcription activation of either gene. To demarcate the element(s) responsible for this activation, fusions of the intergenic region in either orientation to the galK reporter gene were made. Northern analysis of the levels of hybrid mRNA demonstrated that the intergenic region can serve as an heterologous promoter when it is in the 'S24-orientation'. Surprisingly, however, when fused in the reverse orientation the intergenic region did hardly confer transcription activity on the fusion gene. Furthermore, a 274 bp FnuDII-FnuDII fragment from the intergenic region that contains the RPG-boxes, could replace the naturally occurring upstream activation site (UASrpg) of the L25 rp-gene only when inserted in the 'S24-orientation'. Removal of 15 bp from the FnuDII fragment appeared to be sufficient to obtain transcription activation in the 'L46 orientation' as well. Analysis of a construct in which the RPG-boxes were selectively deleted from the promoter region of the L46 gene indicated that the RPG-boxes are needed for efficient transcriptional activation of the L46 gene. We conclude that all promoter elements for the S24 gene are located within the intergenic region, where the RPG-boxes are the most likely UAS-elements. However, the intergenic region (including the RPG-boxes) is required but not sufficient to confer transcription activity on the L46 gene.

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

PubMed

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

Distinct heat shock factors and chromatin modifications mediate the organ-autonomous transcriptional memory of heat stress.

PubMed

Liu, Hsiang-Chin; Lämke, Jörn; Lin, Siou-Ying; Hung, Meng-Ju; Liu, Kuan-Ming; Charng, Yee-Yung; Bäurle, Isabel

2018-05-11

Plants can be primed by a stress cue to mount a faster or stronger activation of defense mechanisms upon a subsequent stress. A crucial component of such stress priming is the modified reactivation of genes upon recurring stress; however, the underlying mechanisms are poorly understood. Here, we report that dozens of Arabidopsis thaliana genes display transcriptional memory, i.e. stronger upregulation after a recurring heat stress, that lasts for at least three days. We define a set of transcription factors involved in this memory response and show that the transcriptional memory results in enhanced transcriptional activation within minutes after the onset of a heat stress cue. Further, we show that the transcriptional memory is active in all tissues. It may last for up to a week, and is associated with histone H3 lysine 4 hyper-methylation during this time. This transcriptional memory is cis-encoded, as we identify a promoter fragment that confers memory onto a heterologous gene. In summary, heat-induced transcriptional memory is a widespread and sustained response, and our study provides a framework for future mechanistic studies of somatic stress memory in higher plants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Analytic second derivatives of the energy in the fragment molecular orbital method

NASA Astrophysics Data System (ADS)

Nakata, Hiroya; Nagata, Takeshi; Fedorov, Dmitri G.; Yokojima, Satoshi; Kitaura, Kazuo; Nakamura, Shinichiro

2013-04-01

We developed the analytic second derivatives of the energy for the fragment molecular orbital (FMO) method. First we derived the analytic expressions and then introduced some approximations related to the first and second order coupled perturbed Hartree-Fock equations. We developed a parallel program for the FMO Hessian with approximations in GAMESS and used it to calculate infrared (IR) spectra and Gibbs free energies and to locate the transition states in SN2 reactions. The accuracy of the Hessian is demonstrated in comparison to ab initio results for polypeptides and a water cluster. By using the two residues per fragment division, we achieved the accuracy of 3 cm-1 in the reduced mean square deviation of vibrational frequencies from ab initio for all three polyalanine isomers, while the zero point energy had the error not exceeding 0.3 kcal/mol. The role of the secondary structure on IR spectra, zero point energies, and Gibbs free energies is discussed.

Fragment Production and Survival in Irradiated Disks: A Comprehensive Cooling Criterion

NASA Astrophysics Data System (ADS)

Kratter, Kaitlin M.; Murray-Clay, Ruth A.

2011-10-01

Accretion disks that become gravitationally unstable can fragment into stellar or substellar companions. The formation and survival of these fragments depends on the precarious balance between self-gravity, internal pressure, tidal shearing, and rotation. Disk fragmentation depends on two key factors: (1) whether the disk can get to the fragmentation boundary of Q = 1 and (2) whether fragments can survive for many orbital periods. Previous work suggests that to reach Q = 1, and have fragments survive, a disk must cool on an orbital timescale. Here we show that disks heated primarily by external irradiation always satisfy the standard cooling time criterion. Thus, even though irradiation heats disks and makes them more stable in general, once they reach the fragmentation boundary, they fragment more easily. We derive a new cooling criterion that determines fragment survival and calculate a pressure-modified Hill radius, which sets the maximum size of pressure-supported objects in a Keplerian disk. We conclude that fragmentation in protostellar disks might occur at slightly smaller radii than previously thought and recommend tests for future simulations that will better predict the outcome of fragmentation in real disks.

Characterization of dFOXO binding sites upstream of the Insulin Receptor P2 promoter across the Drosophila phylogeny

PubMed Central

Orengo, Dorcas J.; Aguadé, Montserrat

2017-01-01

The insulin/TOR signal transduction pathway plays a critical role in determining such important traits as body and organ size, metabolic homeostasis and life span. Although this pathway is highly conserved across the animal kingdom, the affected traits can exhibit important differences even between closely related species. Evolutionary studies of regulatory regions require the reliable identification of transcription factor binding sites. Here we have focused on the Insulin Receptor (InR) expression from its P2 promoter in the Drosophila genus, which in D. melanogaster is up-regulated by hypophosphorylated Drosophila FOXO (dFOXO). We have finely characterized this transcription factor binding sites in vitro along the 1.3 kb region upstream of the InR P2 promoter in five Drosophila species. Moreover, we have tested the effect of mutations in the characterized dFOXO sites of D. melanogaster in transgenic flies. The number of experimentally established binding sites varies across the 1.3 kb region of any particular species, and their distribution also differs among species. In D. melanogaster, InR expression from P2 is differentially affected by dFOXO binding sites at the proximal and distal halves of the species 1.3 kb fragment. The observed uneven distribution of binding sites across this fragment might underlie their differential contribution to regulate InR transcription. PMID:29200426

Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

PubMed

Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

2009-04-01

We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

PubMed

Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

2015-05-01

Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

NASA Astrophysics Data System (ADS)

Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

1980-09-01

A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

Cloning and expression of calmodulin gene in Scoparia dulcis.

PubMed

Saitoh, Daisuke; Asakura, Yuki; Nkembo, Marguerite Kasidimoko; Shite, Masato; Sugiyama, Ryuji; Lee, Jung-Bum; Hayashi, Toshimitsu; Kurosaki, Fumiya

2007-06-01

A homology-based cloning strategy yielded a cDNA clone, designated Sd-cam, encoding calmodulin protein from Scoparia dulcis. The restriction digests of genomic DNA of S. dulcis showed a single hybridized signal when probed with the fragment of this gene in Southern blot analyses, suggesting that Sd-cam occurs as a sole gene encoding calmodulin in the plant. The reverse-transcription polymerase chain reaction analysis revealed that Sd-cam was appreciably expressed in leaf, root and stem tissues. It appeared that transcription of this gene increased transiently when the leaf cultures of S. dulcis were treated with methyl jasmonate and calcium ionophore A23187. These results suggest that transcriptional activation of Sd-cam is one of the early cellular events of the methyl jasmonate-induced responses of S. dulcis.

Minimal Pharmacophoric Elements and Fragment Hopping, an Approach Directed at Molecular Diversity and Isozyme Selectivity. Design of Selective Neuronal Nitric Oxide Synthase Inhibitors

PubMed Central

Ji, Haitao; Stanton, Benjamin Z.; Igarashi, Jotaro; Li, Huiying; Martásek, Pavel; Roman, Linda J.; Poulos, Thomas L.; Silverman, Richard B.

2010-01-01

Fragment hopping, a new fragment-based approach for de novo inhibitor design focusing on ligand diversity and isozyme selectivity, is described. The core of this approach is the derivation of the minimal pharmacophoric element for each pharmacophore. Sites for both ligand binding and isozyme selectivity are considered in deriving the minimal pharmacophoric elements. Five general-purpose libraries are established: the basic fragment library, the bioisostere library, the rules for metabolic stability, the toxicophore library, and the side chain library. These libraries are employed to generate focused fragment libraries to match the minimal pharmacophoric elements for each pharmacophore and then to link the fragment to the desired molecule. This method was successfully applied to neuronal nitric oxide synthase (nNOS), which is implicated in stroke and neurodegenerative diseases. Starting with the nitroarginine-containing dipeptide inhibitors we developed previously, a small organic molecule with a totally different chemical structure was designed, which showed nanomolar nNOS inhibitory potency and more than 1000-fold nNOS selectivity. The crystallographic analysis confirms that the small organic molecule with a constrained conformation can exactly mimic the mode of action of the dipeptide nNOS inhibitors. Therefore, a new peptidomimetic strategy, referred to as fragment hopping, which creates small organic molecules that mimic the biological function of peptides by a pharmacophore-driven strategy for fragment-based de novo design, has been established as a new type of fragment-based inhibitor design. As an open system, the newly established approach efficiently incorporates the concept of early “ADME/Tox” considerations and provides a basic platform for medicinal chemistry-driven efforts. PMID:18321097

Synthesis and properties of 1,3-dioxo-1H-inden-2(3H)-ylidene fragment and (3-(dicyanomethylene)-5,5-dimethylcyclohex-1-enyl)vinyl fragment containing derivatives of azobenzene for holographic recording materials

NASA Astrophysics Data System (ADS)

Zarins, Elmars; Kokars, Valdis; Ozols, Andris; Augustovs, Peteris

2011-06-01

New glassy 1,3-dioxo-1H-inden-2(3H)-ylidene fragment und (3-(dicyanomethylene)-5,5-dimethylcyclohex-1-enyl)vinyl fragment containing push-pull type derivatives of azobenzene able to create thin layers have been synthesized. Thin films of synthesized glasses for holographic recording were prepared using spin coating technique from saturated chloroform solution. Holographic grating recording in films of 6a-b, 7 and 12 has been experimentally studied at 633 and 532 nm in both transmission and reflection modes with p-p recording beam polarizations. The film 12 was found to be the most efficient at both wavelengths in transmission mode exhibiting the maximum self-diffraction efficiency of 9.9% at 633 nm, and 15.3% at 532 nm. The film of 6a was the most efficient in reflection mode with the maximum selfdiffraction efficiency of about 3%.

Synthesis of Water-Soluble Amino Functionalized Multithiacalix[4]arene via Quaternization of Tertiary Amino Groups.

PubMed

Nosov, Roman; Padnya, Pavel; Shurpik, Dmitriy; Stoikov, Ivan

2018-05-08

A convenient approach to the synthesis of multithiacalix[4]arene derivatives containing amino groups and phthalimide fragments by the formation of quaternary ammonium salts is presented. As the initial macrocycle for the synthesis of multithiacalix[4]arenes, a differently substituted p-tert- butylthiacalix[4]arene containing bromoacetamide and three phthalimide fragments was used in a 1,3-alternate conformation. The macrocycle in cone conformation containing the tertiary amino groups was found to be a convenient core for the multithiacalix[4]arene systems. Interaction of the core multithiacalix[4]arene with monobromoacetamide derivatives of p-tert- butylthiacalix[4]arene resulted in formation in high yields of pentakisthiacalix[4]arene containing quaternary ammonium and phthalimide fragments. The removal of phthalimide groups led to the formation of amino multithiacalix[4]arene in a good yield. Based on dynamic light scattering, it was shown that the synthesized amino multithiacalix[4]arene, with pronounced hydrophobic and hydrophilic fragments, formed dendrimer-like nanoparticles in water via direct supramolecular self-assembly.

Establishment of a rat hepatoma-derived cell line proliferating in D-phenylalanine medium and expressing D-amino-acid oxidase.

PubMed

Yoda, N; Konno, R; Nagashima, S

2001-01-01

A cell line (R-Y121B.DF) has been established from a cell line (R-Y121B) derived from a rat hepatoma line (H4-II-E). The R-Y121B.DF cells have been continuously cultured in a serum-free modified Eagle's minimum essential medium in which L-phenylalanine was replaced by D-phenylalanine. They had D-amino-acid oxidase (DAO) activity which is essential for the growth in the medium containing D-amino acids. The enzyme activity of the R-Y121B.DF cells was approximately one-fourth of that of the rat liver. Northern hybridization using a DAO cDNA probe detected a hybridizing signal in the R-Y121B.DF cells and the rat liver but not in the parental R-Y121B and H4-II-E cells. Reverse transcription-polymerase chain reaction using DAO-specific primers amplified a DNA fragment of the expected size in the R-Y121B.DF cells but not in the R-Y121B and H4-II-E cells. This fragment was confirmed to be DAO cDNA by nucleotide sequencing. Western blotting showed that DAO protein was present in the R-Y121B.DF cells and the rat liver but not in the R-Y121B and H4-II-E cells. Southern hybridization showed that the DAO gene structure was not different among the R-Y121B.DF cells, R-Y121B cells, H4-II-E cells, and the rat liver. These results indicate that the R-Y121B.DF is a unique cell line which proliferates in the medium containing D-phenylalanine and explicitly expresses DAO. This line is useful for the study of DAO in vitro.

Investigation of Contingency Patterns of Teachers' Scaffolding in Teaching and Learning Mathematics

ERIC Educational Resources Information Center

Anwar; Yuwono, Ipung; Irawan, Edy Bambang; As'ari, Abdur Rahman

2017-01-01

The purpose of this study is to investigate the patterns of scaffolding contingency in teaching and learning mathematics carried out by three teachers. Contingency patterns are obtained by examining the transcription from video recording of conversation fragments between teachers and students during the provision of scaffolding. The contingency…

[Construction of enterohemorrhagic Escherichia coli O157:H7 strains with espF gene deletion and complementation].

PubMed

Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong

2015-11-01

To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.

Embryo Aggregation in Pig Improves Cloning Efficiency and Embryo Quality.

PubMed

Buemo, Carla Paola; Gambini, Andrés; Moro, Lucia Natalia; Hiriart, María Inés; Fernández-Martín, Rafael; Collas, Philippe; Salamone, Daniel Felipe

2016-01-01

In this study, we analyzed the effects of the cloned embryo aggregation on in vitro embryo development and embryo quality by measuring blastocyst diameter and cell number, DNA fragmentation levels and the expression of genes associated with pluripotency, apoptosis, trophoblast and DNA methylation in the porcine. Zona-free reconstructed cloned embryos were cultured in the well of the well system, placing one (1x non aggregated group) or three (3x group) embryos per microwell. Our results showed that aggregation of three embryos increased blastocyst formation rate and blastocyst diameter of cloned pig embryos. DNA fragmentation levels in 3x aggregated cloned blastocysts were significantly decreased compared to 1x blastocysts. Levels of Oct4, Klf4, Igf2, Bax and Dnmt 1 transcripts were significantly higher in aggregated embryos, whereas Nanog levels were not affected. Transcripts of Cdx2 and Bcl-xl were essentially non-detectable. Our study suggests that embryo aggregation in the porcine may be beneficial for cloned embryo development and embryo quality, through a reduction in apoptotic levels and an improvement in cell reprogramming.

Analysis of tandem repeat units of the promoter of capsanthin/capsorubin synthase (Ccs) gene in pepper fruit.

PubMed

Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui

2017-07-01

Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Partial bisulfite conversion for unique template sequencing.

PubMed

Kumar, Vijay; Rosenbaum, Julie; Wang, Zihua; Forcier, Talitha; Ronemus, Michael; Wigler, Michael; Levy, Dan

2018-01-25

We introduce a new protocol, mutational sequencing or muSeq, which uses sodium bisulfite to randomly deaminate unmethylated cytosines at a fixed and tunable rate. The muSeq protocol marks each initial template molecule with a unique mutation signature that is present in every copy of the template, and in every fragmented copy of a copy. In the sequenced read data, this signature is observed as a unique pattern of C-to-T or G-to-A nucleotide conversions. Clustering reads with the same conversion pattern enables accurate count and long-range assembly of initial template molecules from short-read sequence data. We explore count and low-error sequencing by profiling 135 000 restriction fragments in a PstI representation, demonstrating that muSeq improves copy number inference and significantly reduces sporadic sequencer error. We explore long-range assembly in the context of cDNA, generating contiguous transcript clusters greater than 3,000 bp in length. The muSeq assemblies reveal transcriptional diversity not observable from short-read data alone. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fluorescence resonance energy transfer analysis of escherichia coli RNA polymerase and polymerase-DNA complexes.

PubMed

Heyduk, T; Niedziela-Majka, A

Fluorescence resonance energy transfer (FRET) is a technique allowing measurements of atomic-scale distances in diluted solutions of macromolecules under native conditions. This feature makes FRET a powerful tool to study complicated biological assemblies. In this report we review the applications of FRET to studies of transcription initiation by Escherichia coli RNA polymerase. The versatility of FRET for studies of a large macromolecular assembly such as RNA polymerase is illustrated by examples of using FRET to address several different aspects of transcription initiation by polymerase. FRET has been used to determine the architecture of polymerase, its complex with single-stranded DNA, and the conformation of promoter fragment bound to polymerase. FRET has been also used as a binding assay to determine the thermodynamics of promoter DNA fragment binding to the polymerase. Functional conformational changes in the specificity subunit of polymerase responsible for the modulation of the promoter binding activity of the enzyme and the mechanistic aspects of the transition from the initiation to the elongation complex were also investigated. Copyright 2002 Wiley Periodicals, Inc.

Combinatorial Effects of the Glucocorticoid Receptor and Krüppel-Like Transcription Factor 15 on Bovine Herpesvirus 1 Transcription and Productive Infection.

PubMed

El-Mayet, Fouad S; Sawant, Laximan; Thunuguntla, Prasanth; Jones, Clinton

2017-11-01

Bovine herpesvirus 1 (BoHV-1), an important bovine pathogen, establishes lifelong latency in sensory neurons. Latently infected calves consistently reactivate from latency following a single intravenous injection of the synthetic corticosteroid dexamethasone. The immediate early transcription unit 1 (IEtu1) promoter, which drives bovine ICP0 (bICP0) and bICP4 expression, is stimulated by dexamethasone because it contains two glucocorticoid receptor (GR) response elements (GREs). Several Krüppel-like transcription factors (KLF), including KLF15, are induced during reactivation from latency, and they stimulate certain viral promoters and productive infection. In this study, we demonstrate that the GR and KLF15 were frequently expressed in the same trigeminal ganglion (TG) neuron during reactivation and cooperatively stimulated productive infection and IEtu1 GREs in mouse neuroblastoma cells (Neuro-2A). We further hypothesized that additional regions in the BoHV-1 genome are transactivated by the GR or stress-induced transcription factors. To test this hypothesis, BoHV-1 DNA fragments (less than 400 bp) containing potential GR and KLF binding sites were identified and examined for transcriptional activation by stress-induced transcription factors. Intergenic regions within the unique long 52 gene (UL52; a component of the DNA primase/helicase complex), bICP4, IEtu2, and the unique short region were stimulated by KLF15 and the GR. Chromatin immunoprecipitation studies revealed that the GR and KLF15 interacted with sequences within IEtu1 GREs and the UL52 fragment. Coimmunoprecipitation studies demonstrated that KLF15 and the GR were associated with each other in transfected cells. Since the GR stimulates KLF15 expression, we suggest that these two transcription factors form a feed-forward loop that stimulates viral gene expression and productive infection following stressful stimuli. IMPORTANCE Bovine herpesvirus 1 (BoHV-1) is an important viral pathogen that causes respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. Copyright © 2017 American Society for Microbiology.

Combinatorial Effects of the Glucocorticoid Receptor and Krüppel-Like Transcription Factor 15 on Bovine Herpesvirus 1 Transcription and Productive Infection

PubMed Central

El-mayet, Fouad S.; Sawant, Laximan; Thunuguntla, Prasanth

2017-01-01

ABSTRACT Bovine herpesvirus 1 (BoHV-1), an important bovine pathogen, establishes lifelong latency in sensory neurons. Latently infected calves consistently reactivate from latency following a single intravenous injection of the synthetic corticosteroid dexamethasone. The immediate early transcription unit 1 (IEtu1) promoter, which drives bovine ICP0 (bICP0) and bICP4 expression, is stimulated by dexamethasone because it contains two glucocorticoid receptor (GR) response elements (GREs). Several Krüppel-like transcription factors (KLF), including KLF15, are induced during reactivation from latency, and they stimulate certain viral promoters and productive infection. In this study, we demonstrate that the GR and KLF15 were frequently expressed in the same trigeminal ganglion (TG) neuron during reactivation and cooperatively stimulated productive infection and IEtu1 GREs in mouse neuroblastoma cells (Neuro-2A). We further hypothesized that additional regions in the BoHV-1 genome are transactivated by the GR or stress-induced transcription factors. To test this hypothesis, BoHV-1 DNA fragments (less than 400 bp) containing potential GR and KLF binding sites were identified and examined for transcriptional activation by stress-induced transcription factors. Intergenic regions within the unique long 52 gene (UL52; a component of the DNA primase/helicase complex), bICP4, IEtu2, and the unique short region were stimulated by KLF15 and the GR. Chromatin immunoprecipitation studies revealed that the GR and KLF15 interacted with sequences within IEtu1 GREs and the UL52 fragment. Coimmunoprecipitation studies demonstrated that KLF15 and the GR were associated with each other in transfected cells. Since the GR stimulates KLF15 expression, we suggest that these two transcription factors form a feed-forward loop that stimulates viral gene expression and productive infection following stressful stimuli. IMPORTANCE Bovine herpesvirus 1 (BoHV-1) is an important viral pathogen that causes respiratory disease and suppresses immune responses in cattle; consequently, life-threatening bacterial pneumonia can occur. Following acute infection, BoHV-1 establishes lifelong latency in sensory neurons. Reactivation from latency is initiated by the synthetic corticosteroid dexamethasone. Dexamethasone stimulates lytic cycle viral gene expression in sensory neurons of calves latently infected with BoHV-1, culminating in virus shedding and transmission. Two stress-induced cellular transcription factors, Krüppel-like transcription factor 15 (KLF15) and the glucocorticoid receptor (GR), cooperate to stimulate productive infection and viral transcription. Additional studies demonstrated that KLF15 and the GR form a stable complex and that these stress-induced transcription factors bind to viral DNA sequences, which correlates with transcriptional activation. The ability of the GR and KLF15 to synergistically stimulate viral gene expression and productive infection may be critical for the ability of BoHV-1 to reactivate from latency following stressful stimuli. PMID:28794031

The RNA methyltransferase Dnmt2 is required for efficient Dicer-2-dependent siRNA pathway activity in Drosophila.

PubMed

Durdevic, Zeljko; Mobin, Mehrpouya Balaghy; Hanna, Katharina; Lyko, Frank; Schaefer, Matthias

2013-09-12

Transfer RNA (tRNA) fragmentation in response to stress conditions has been described in many organisms. tRNA fragments have been found in association with small interfering RNA (siRNA) components, but the biological role of these interactions remains unclear. We report here that the tRNA methyltransferase Dnmt2 is essential for efficient Dicer-2 (Dcr-2) function in Drosophila. Using small RNA (sRNA) sequencing, we confirmed that Dnmt2 limits the extent of tRNA fragmentation during the heat-shock response. tRNAs as well as tRNA fragments serve as Dcr-2 substrates, and Dcr-2 degrades tRNA-derived sequences, especially under heat-shock conditions. tRNA-derived RNAs are able to inhibit Dcr-2 activity on long double-stranded RNAs (dsRNAs). Consequently, heat-shocked Dnmt2 mutant animals accumulate dsRNAs, produce fewer siRNAs, and show misregulation of siRNA pathway-dependent genes. These results reveal the impact of tRNA fragmentation on siRNA pathways and implicate tRNA modifications in the regulation of sRNA homeostasis during the heat-shock response. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Fragment size distribution statistics in dynamic fragmentation of laser shock-loaded tin

NASA Astrophysics Data System (ADS)

He, Weihua; Xin, Jianting; Zhao, Yongqiang; Chu, Genbai; Xi, Tao; Shui, Min; Lu, Feng; Gu, Yuqiu

2017-06-01

This work investigates the geometric statistics method to characterize the size distribution of tin fragments produced in the laser shock-loaded dynamic fragmentation process. In the shock experiments, the ejection of the tin sample with etched V-shape groove in the free surface are collected by the soft recovery technique. Subsequently, the produced fragments are automatically detected with the fine post-shot analysis techniques including the X-ray micro-tomography and the improved watershed method. To characterize the size distributions of the fragments, a theoretical random geometric statistics model based on Poisson mixtures is derived for dynamic heterogeneous fragmentation problem, which reveals linear combinational exponential distribution. The experimental data related to fragment size distributions of the laser shock-loaded tin sample are examined with the proposed theoretical model, and its fitting performance is compared with that of other state-of-the-art fragment size distribution models. The comparison results prove that our proposed model can provide far more reasonable fitting result for the laser shock-loaded tin.

A short region of the promoter of the breast cancer associated PLU-1 gene can regulate transcription in vitro and in vivo.

PubMed

Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce

2004-07-01

The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.

Tumor protein D52 expression is post-transcriptionally regulated by T-cell intercellular antigen (TIA) 1 and TIA-related protein via mRNA stability.

PubMed

Motohashi, Hiromi; Mukudai, Yoshiki; Ito, Chihiro; Kato, Kosuke; Shimane, Toshikazu; Kondo, Seiji; Shirota, Tatsuo

2017-05-04

Although tumor protein D52 (TPD52) family proteins were first identified nearly 20 years ago, their molecular regulatory mechanisms remain unclear. Therefore, we investigated the post-transcriptional regulation of TPD52 family genes. An RNA immunoprecipitation (RIP) assay showed the potential binding ability of TPD52 family mRNAs to several RNA-binding proteins, and an RNA degradation assay revealed that TPD52 is subject to more prominent post-transcriptional regulation than are TPD53 and TPD54. We subsequently focused on the 3'-untranslated region (3'-UTR) of TPD52 as a cis -acting element in post-transcriptional gene regulation. Several deletion mutants of the 3'-UTR of TPD52 mRNA were constructed and ligated to the 3'-end of a reporter green fluorescence protein gene. An RNA degradation assay revealed that a minimal cis -acting region, located in the 78-280 region of the 5'-proximal region of the 3'-UTR, stabilized the reporter mRNA. Biotin pull-down and RIP assays revealed specific binding of the region to T-cell intracellular antigen 1 (TIA-1) and TIA-1-related protein (TIAR). Knockdown of TIA-1/TIAR decreased not only the expression, but also the stability of TPD52 mRNA; it also decreased the expression and stability of the reporter gene ligated to the 3'-end of the 78-280 fragment. Stimulation of transforming growth factor-β and epidermal growth factor decreased the binding ability of these factors, resulting in decreased mRNA stability. These results indicate that the 78-280 fragment and TIA-1/TIAR concordantly contribute to mRNA stability as a cis -acting element and trans -acting factor(s), respectively. Thus, we here report the specific interactions between these elements in the post-transcriptional regulation of the TPD52 gene. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

Structural characterization of a novel full-length transcript promoter from Horseradish Latent Virus (HRLV) and its transcriptional regulation by multiple stress responsive transcription factors.

PubMed

Khan, Ahamed; Shrestha, Ankita; Bhuyan, Kashyap; Maiti, Indu B; Dey, Nrisingha

2018-01-01

The promoter fragment described in this study can be employed for strong transgene expression under both biotic and abiotic stress conditions. Plant-infecting Caulimoviruses have evolved multiple regulatory mechanisms to address various environmental stimuli during the course of evolution. One such mechanism involves the retention of discrete stress responsive cis-elements which are required for their survival and host-specificity. Here we describe the characterization of a novel Caulimoviral promoter isolated from Horseradish Latent Virus (HRLV) and its regulation by multiple stress responsive Transcription factors (TFs) namely DREB1, AREB1 and TGA1a. The activity of full length transcript (Flt-) promoter from HRLV (- 677 to + 283) was investigated in both transient and transgenic assays where we identified H12 (- 427 to + 73) as the highest expressing fragment having ~ 2.5-fold stronger activity than the CaMV35S promoter. The H12 promoter was highly active and near-constitutive in the vegetative and reproductive parts of both Tobacco and Arabidopsis transgenic plants. Interestingly, H12 contains a distinct cluster of cis-elements like dehydration-responsive element (DRE-core; GCCGAC), an ABA-responsive element (ABRE; ACGTGTC) and as-1 element (TGACG) which are known to be induced by cold, drought and pathogen/SA respectively. The specific binding of DREB1, AREB1 and TGA1a to DRE, ABRE and as-1 elements respectively were confirmed by the gel-binding assays using H12 promoter-specific probes. Detailed mutational analysis of the H12 promoter suggested that the presence of DRE-core and as-1 element was indispensable for its activity which was further confirmed by the transactivation assays. Our studies imply that H12 could be a valuable genetic tool for regulated transgene expression under diverse environmental conditions.

Differential Regulation of Brain-Derived Neurotrophic Factor Transcripts during the Consolidation of Fear Learning

ERIC Educational Resources Information Center

Ressler, Kerry J.; Rattiner, Lisa M.; Davis, Michael

2004-01-01

Brain-derived neurotrophic factor (BDNF) has been implicated as a molecular mediator of learning and memory. The BDNF gene contains four differentially regulated promoters that generate four distinct mRNA transcripts, each containing a unique noncoding 5[prime]-exon and a common 3[prime]-coding exon. This study describes novel evidence for the…

The residual repair capacity of xeroderma pigmentosum complementation group C fibroblasts is highly specific for transcriptionally active DNA.

PubMed Central

Venema, J; van Hoffen, A; Natarajan, A T; van Zeeland, A A; Mullenders, L H

1990-01-01

We have measured removal of pyrimidine dimers in defined DNA sequences in confluent and actively growing normal human and xeroderma pigmentosum complementation group C (XP-C) fibroblasts exposed to 10 J/m2 UV-irradiation. In normal fibroblasts 45% and 90% of the dimers are removed from the transcriptionally active adenosine deaminase (ADA) gene within 4 and 24 hours after irradiation respectively. Equal repair efficiencies are found in fragments located entirely within the transcription unit or partly in the 3' flanking region of the ADA gene. The rate and extent of dimer removal from the dihydrofolate reductase (DHFR) gene is very similar to that of the ADA gene. Repair of the transcriptionally inactive 754 locus is less efficient: 18% and 52% of the dimers are removed within 4 and 24 hours respectively. In spite of the limited overall repair capacity, confluent XP-C fibroblasts efficiently remove dimers from the ADA and DHFR genes: about 90% and 50% within 24 hours respectively. The 3' end of the ADA gene is repaired as efficiently as in normal human fibroblasts, but less efficient repair occurs in DNA fragments located in the DHFR gene and at the 5' end of the ADA gene. Repair of the inactive 754 locus does not exceed the very slow rate of dimer removal from the genome overall. Confluent and actively growing XP-C cells show similar efficiencies of repair of the ADA, DHFR and 754 genes. Our findings suggest the existence of two independently operating pathways directed towards repair of pyrimidine dimers in either active or inactive chromatin. XP-C cells have lost the capacity to repair inactive chromatin, but are still able to repair active chromatin. Images PMID:2308842

A study of the effectiveness of machine learning methods for classification of clinical interview fragments into a large number of categories.

PubMed

Hasan, Mehedi; Kotov, Alexander; Carcone, April; Dong, Ming; Naar, Sylvie; Hartlieb, Kathryn Brogan

2016-08-01

This study examines the effectiveness of state-of-the-art supervised machine learning methods in conjunction with different feature types for the task of automatic annotation of fragments of clinical text based on codebooks with a large number of categories. We used a collection of motivational interview transcripts consisting of 11,353 utterances, which were manually annotated by two human coders as the gold standard, and experimented with state-of-art classifiers, including Naïve Bayes, J48 Decision Tree, Support Vector Machine (SVM), Random Forest (RF), AdaBoost, DiscLDA, Conditional Random Fields (CRF) and Convolutional Neural Network (CNN) in conjunction with lexical, contextual (label of the previous utterance) and semantic (distribution of words in the utterance across the Linguistic Inquiry and Word Count dictionaries) features. We found out that, when the number of classes is large, the performance of CNN and CRF is inferior to SVM. When only lexical features were used, interview transcripts were automatically annotated by SVM with the highest classification accuracy among all classifiers of 70.8%, 61% and 53.7% based on the codebooks consisting of 17, 20 and 41 codes, respectively. Using contextual and semantic features, as well as their combination, in addition to lexical ones, improved the accuracy of SVM for annotation of utterances in motivational interview transcripts with a codebook consisting of 17 classes to 71.5%, 74.2%, and 75.1%, respectively. Our results demonstrate the potential of using machine learning methods in conjunction with lexical, semantic and contextual features for automatic annotation of clinical interview transcripts with near-human accuracy. Copyright © 2016 Elsevier Inc. All rights reserved.

Gene expression analysis by cDNA-AFLP highlights a set of new signaling networks and translational control during seed dormancy breaking in Nicotiana plumbaginifolia.

PubMed

Bove, Jérôme; Lucas, Philippe; Godin, Béatrice; Ogé, Laurent; Jullien, Marc; Grappin, Philippe

2005-03-01

Seed dormancy in Nicotiana plumbaginifolia is characterized by an abscisic acid accumulation linked to a pronounced germination delay. Dormancy can be released by 1 year after-ripening treatment. Using a cDNA-amplified fragment length polymorphism (cDNA-AFLP) approach we compared the gene expression patterns of dormant and after-ripened seeds, air-dry or during one day imbibition and analyzed 15,000 cDNA fragments. Among them 1020 were found to be differentially regulated by dormancy. Of 412 sequenced cDNA fragments, 83 were assigned to a known function by search similarities to public databases. The functional categories of the identified dormancy maintenance and breaking responsive genes, give evidence that after-ripening turns in the air-dry seed to a new developmental program that modulates, at the RNA level, components of translational control, signaling networks, transcriptional control and regulated proteolysis.

Petrogenesis of Igneous-Textured Clasts in Martian Meteorite Northwest Africa 7034

NASA Technical Reports Server (NTRS)

Santos, A. R.; Agee, C. B.; Humayun, M.; McCubbin, F. M.; Shearer, C. K.

2016-01-01

The martian meteorite Northwest Africa 7034 (and pairings) is a breccia that samples a variety of materials from the martian crust. Several previous studies have identified multiple types of igneous-textured clasts within the breccia [1-3], and these clasts have the potential to provide insight into the igneous evolution of Mars. One challenge presented by studying these small rock fragments is the lack of field context for this breccia (i.e., where on Mars it formed), so we do not know how many sources these small rock fragments are derived from or the exact formation his-tory of these sources (i.e., are the sources mantle de-rived melt or melts contaminated by a meteorite impactor on Mars). Our goal in this study is to examine specific igneous-textured clast groups to determine if they are petrogenetically related (i.e., from the same igneous source) and determine more information about their formation history, then use them to derive new insights about the igneous history of Mars. We will focus on the basalt clasts, FTP clasts (named due to their high concentration of iron, titanium, and phosphorous), and mineral fragments described by [1] (Fig. 1). We will examine these materials for evidence of impactor contamination (as proposed for some materials by [2]) or mantle melt derivation. We will also test the petrogenetic models proposed in [1], which are igneous processes that could have occurred regardless of where the melt parental to the clasts was formed. These models include 1) derivation of the FTP clasts from a basalt clast melt through silicate liquid immiscibility (SLI), 2) derivation of the FTP clasts from a basalt clast melt through fractional crystallization, and 3) a lack of petrogenetic relationship between these clast groups. The relationship between the clast groups and the mineral fragments will also be explored.

Multiple transcription factors directly regulate Hox gene lin-39 expression in ventral hypodermal cells of the C. elegans embryo and larva, including the hypodermal fate regulators LIN-26 and ELT-6.

PubMed

Liu, Wan-Ju; Reece-Hoyes, John S; Walhout, Albertha J M; Eisenmann, David M

2014-05-13

Hox genes encode master regulators of regional fate specification during early metazoan development. Much is known about the initiation and regulation of Hox gene expression in Drosophila and vertebrates, but less is known in the non-arthropod invertebrate model system, C. elegans. The C. elegans Hox gene lin-39 is required for correct fate specification in the midbody region, including the Vulval Precursor Cells (VPCs). To better understand lin-39 regulation and function, we aimed to identify transcription factors necessary for lin-39 expression in the VPCs, and in particular sought factors that initiate lin-39 expression in the embryo. We used the yeast one-hybrid (Y1H) method to screen for factors that bound to 13 fragments from the lin-39 region: twelve fragments contained sequences conserved between C. elegans and two other nematode species, while one fragment was known to drive reporter gene expression in the early embryo in cells that generate the VPCs. Sixteen transcription factors that bind to eight lin-39 genomic fragments were identified in yeast, and we characterized several factors by verifying their physical interactions in vitro, and showing that reduction of their function leads to alterations in lin-39 levels and lin-39::GFP reporter expression in vivo. Three factors, the orphan nuclear hormone receptor NHR-43, the hypodermal fate regulator LIN-26, and the GATA factor ELT-6 positively regulate lin-39 expression in the embryonic precursors to the VPCs. In particular, ELT-6 interacts with an enhancer that drives GFP expression in the early embryo, and the ELT-6 site we identified is necessary for proper embryonic expression. These three factors, along with the factors ZTF-17, BED-3 and TBX-9, also positively regulate lin-39 expression in the larval VPCs. These results significantly expand the number of factors known to directly bind and regulate lin-39 expression, identify the first factors required for lin-39 expression in the embryo, and hint at a positive feedback mechanism involving GATA factors that maintains lin-39 expression in the vulval lineage. This work indicates that, as in other organisms, the regulation of Hox gene expression in C. elegans is complicated, redundant and robust.

Absorption and dissociative photoionization cross sections of NH3 from 80 to 1120 A

NASA Technical Reports Server (NTRS)

Samson, James A. R.; Haddad, G. N.; Kilcoyne, L. D.

1987-01-01

The total absorption, photoionization, and dissociative photoionization cross sections of ammonia have been measured from 80 to 1120 A. All possible fragment ions have been observed including doubly ionized ammonia. The absolute ionization efficiencies have also been measured in this spectral range. The appearance potentials of the fragment ions have been measured and are compared with the calculated appearance potentials derived from published heats of formation and ionization potentials of the fragments.

Development of an accurate and high-throughput methodology for structural comprehension of chlorophylls derivatives. (I) Phytylated derivatives.

PubMed

Chen, Kewei; Ríos, José Julián; Pérez-Gálvez, Antonio; Roca, María

2015-08-07

Phytylated chlorophyll derivatives undergo specific oxidative reactions through the natural metabolism or during food processing or storage, and consequently pyro-, 13(2)-hydroxy-, 15(1)-hydroxy-lactone chlorophylls, and pheophytins (a and b) are originated. New analytical procedures have been developed here to reproduce controlled oxidation reactions that specifically, and in reasonable amounts, produce those natural target standards. At the same time and under the same conditions, 16 natural chlorophyll derivatives have been analyzed by APCI-HPLC-hrMS(2) and most of them by the first time. The combination of the high-resolution MS mode with powerful post-processing software has allowed the identification of new fragmentation patterns, characterizing specific product ions for some particular standards. In addition, new hypotheses and reaction mechanisms for the established MS(2)-based reactions have been proposed. As a general rule, the main product ions involve the phytyl and the propionic chains but the introduction of oxygenated functional groups at the isocyclic ring produces new and specific productions and at the same time inhibits some particular fragmentations. It is noteworthy that all b derivatives, except 15(1)-hydroxy-lactone compounds, undergo specific CO losses. We propose a new reaction mechanism based in the structural configuration of a and b chlorophyll derivatives that explain the exclusive CO fragmentation in all b series except for 15(1)-hydroxy-lactone b and all a series compounds. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel fragment-based QSAR modeling and combinatorial design of pyrazole-derived CRK3 inhibitors as potent antileishmanials.

PubMed

Goyal, Sukriti; Dhanjal, Jaspreet K; Tyagi, Chetna; Goyal, Manisha; Grover, Abhinav

2014-07-01

The CRK3 cyclin-dependent kinase of Leishmania plays an important role in regulating the cell-cycle progression at the G2/M phase checkpoint transition, proliferation, and viability inside the host macrophage. In this study, a novel fragment-based QSAR model has been developed using 22 pyrazole-derived compounds exhibiting inhibitory activity against Leishmanial CRK3. Unlike other QSAR methods, this fragment-based method gives flexibility to study the relationship between molecular fragments of interest and their contribution for the variation in the biological response by evaluating cross-term fragment descriptors. Based on the fragment-based QSAR model, a combinatorial library was generated, and top two compounds were reported after predicting their activity. The QSAR model showed satisfactory statistical parameters for the data set (r(2) = 0.8752, q(2) = 0.6690, F-ratio = 30.37, and pred_r(2) = 0.8632) with four descriptors describing the nature of substituent groups and the environment of the substitution site. Evaluation of the model implied that electron-rich substitution at R1 position improves the inhibitory activity, while decline in inhibitory activity was observed in presence of nitrogen at R2 position. The analysis carried out in this study provides a substantial basis for consideration of the designed pyrazole-based leads as potent antileishmanial drugs. © 2014 John Wiley & Sons A/S.

Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera).

PubMed

Johnson, Reed M; Evans, Jay D; Robinson, Gene E; Berenbaum, May R

2009-09-01

Colony collapse disorder (CCD) is a mysterious disappearance of honey bees that has beset beekeepers in the United States since late 2006. Pathogens and other environmental stresses, including pesticides, have been linked to CCD, but a causal relationship has not yet been demonstrated. Because the gut acts as a primary interface between the honey bee and its environment as a site of entry for pathogens and toxins, we used whole-genome microarrays to compare gene expression between guts of bees from CCD colonies originating on both the east and west coasts of the United States and guts of bees from healthy colonies sampled before the emergence of CCD. Considerable variation in gene expression was associated with the geographical origin of bees, but a consensus list of 65 transcripts was identified as potential markers for CCD status. Overall, elevated expression of pesticide response genes was not observed. Genes involved in immune response showed no clear trend in expression pattern despite the increased prevalence of viruses and other pathogens in CCD colonies. Microarray analysis revealed unusual ribosomal RNA fragments that were conspicuously more abundant in the guts of CCD bees. The presence of these fragments may be a possible consequence of picorna-like viral infection, including deformed wing virus and Israeli acute paralysis virus, and may be related to arrested translation. Ribosomal fragment abundance and presence of multiple viruses may prove to be useful diagnostic markers for colonies afflicted with CCD.

Changes in transcript abundance relating to colony collapse disorder in honey bees (Apis mellifera)

PubMed Central

Johnson, Reed M.; Evans, Jay D.; Robinson, Gene E.; Berenbaum, May R.

2009-01-01

Colony collapse disorder (CCD) is a mysterious disappearance of honey bees that has beset beekeepers in the United States since late 2006. Pathogens and other environmental stresses, including pesticides, have been linked to CCD, but a causal relationship has not yet been demonstrated. Because the gut acts as a primary interface between the honey bee and its environment as a site of entry for pathogens and toxins, we used whole-genome microarrays to compare gene expression between guts of bees from CCD colonies originating on both the east and west coasts of the United States and guts of bees from healthy colonies sampled before the emergence of CCD. Considerable variation in gene expression was associated with the geographical origin of bees, but a consensus list of 65 transcripts was identified as potential markers for CCD status. Overall, elevated expression of pesticide response genes was not observed. Genes involved in immune response showed no clear trend in expression pattern despite the increased prevalence of viruses and other pathogens in CCD colonies. Microarray analysis revealed unusual ribosomal RNA fragments that were conspicuously more abundant in the guts of CCD bees. The presence of these fragments may be a possible consequence of picorna-like viral infection, including deformed wing virus and Israeli acute paralysis virus, and may be related to arrested translation. Ribosomal fragment abundance and presence of multiple viruses may prove to be useful diagnostic markers for colonies afflicted with CCD. PMID:19706391

Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

PubMed Central

Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

2002-01-01

We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells. PMID:12133007

Co-operation of the transcription factor hepatocyte nuclear factor-4 with Sp1 or Sp3 leads to transcriptional activation of the human haem oxygenase-1 gene promoter in a hepatoma cell line.

PubMed

Takahashi, Shigeru; Matsuura, Naomi; Kurokawa, Takako; Takahashi, Yuji; Miura, Takashi

2002-11-01

We reported previously that the 5'-flanking region (nucleotides -1976 to -1655) of the human haem oxygenase-1 ( hHO-1 ) gene enhances hHO-1 promoter activity in human hepatoma HepG2 cells, but not in HeLa cells [Takahashi, Takahashi, Ito, Nagano, Shibahara and Miura (1999) Biochim. Biophys. Acta 1447, 231-235]. To define more precisely the regulatory elements involved, in the present study we have functionally dissected this region and localized the enhancer to a 50 bp fragment (-1793 to -1744). Site-direct mutagenesis analysis revealed that two regions were responsible for this enhancer activity, i.e. a hepatocyte nuclear factor-4 (HNF-4) homologous region and a GC box motif homologous region. Mutation in either region alone moderately decreased enhancer activity. However, mutations in both regions reduced promoter activity to the basal level. Electrophoretic mobility-shift assays demonstrated that the P5-2 fragment (-1793 to -1744) interacted with at least two nuclear factors, i.e. HNF-4 and Sp1/Sp3. Co-transfection experiments using Drosophila SL2 cells revealed that HNF-4 and Sp1/Sp3 synergistically stimulated the enhancer activity of the P5-2 fragment. These results indicate that co-operation of HNF-4 with Sp1 or Sp3 leads to the activation of hHO-1 gene expression in hepatoma cells.

Nuclear translocation of doublecortin-like protein kinase and phosphorylation of a transcription factor JDP2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagamine, Tadashi; Nomada, Shohgo; Onouchi, Takashi

2014-03-28

Highlights: • Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase. • In living cells, DCLK was cleaved into two functional fragments. • zDCLK(kinase) was translocated into the nucleus by osmotic stresses. • Jun dimerization protein 2 (JDP2) was identified as zDCLK(kinase)-binding protein. • JDP2 was efficiently phosphorylated by zDCLK(kinase) only when histone was present. - Abstract: Doublecortin-like protein kinase (DCLK) is a microtubule-associated protein kinase predominantly expressed in brain. In a previous paper, we reported that zebrafish DCLK2 (zDCLK) was cleaved into two functional fragments; the N-terminal zDCLK(DC + SP) with microtubule-binding activity and the C-terminal zDCLK(kinase) with amore » Ser/Thr protein kinase activity. In this study, we demonstrated that zDCLK(kinase) was widely distributed in the cytoplasm and translocated into the nucleus when the cells were treated under hyperosmotic conditions with NaCl or mannitol. By two-hybrid screening using the C-terminal domain of DCLK, Jun dimerization protein 2 (JDP2), a nuclear transcription factor, was identified as zDCLK(kinase)-binding protein. Furthermore, JDP2 served as an efficient substrate for zDCLK(kinase) only when histone was present. These results suggest that the kinase fragment of DCLK is translocated into the nucleus upon hyperosmotic stresses and that the kinase efficiently phosphorylates JDP2, a possible target in the nucleus, with the aid of histones.« less

RNA-Seq Reveals an Integrated Immune Response in Nucleated Erythrocytes

PubMed Central

Morera, Davinia; Roher, Nerea; Ribas, Laia; Balasch, Joan Carles; Doñate, Carmen; Callol, Agnes; Boltaña, Sebastian; Roberts, Steven; Goetz, Giles; Goetz, Frederick W.; MacKenzie, Simon A.

2011-01-01

Background Throughout the primary literature and within textbooks, the erythrocyte has been tacitly accepted to have maintained a unique physiological role; namely gas transport and exchange. In non-mammalian vertebrates, nucleated erythrocytes are present in circulation throughout the life cycle and a fragmented series of observations in mammals support a potential role in non-respiratory biological processes. We hypothesised that nucleated erythrocytes could actively participate via ligand-induced transcriptional re-programming in the immune response. Methodology/Principal Findings Nucleated erythrocytes from both fish and birds express and regulate specific pattern recognition receptor (PRR) mRNAs and, thus, are capable of specific pathogen associated molecular pattern (PAMP) detection that is central to the innate immune response. In vitro challenge with diverse PAMPs led to de novo specific mRNA synthesis of both receptors and response factors including interferon-alpha (IFNα) that exhibit a stimulus-specific polysomal shift supporting active translation. RNA-Seq analysis of the PAMP (Poly (I∶C), polyinosinic∶polycytidylic acid)-erythrocyte response uncovered diverse cohorts of differentially expressed mRNA transcripts related to multiple physiological systems including the endocrine, reproductive and immune. Moreover, erythrocyte-derived conditioned mediums induced a type-1 interferon response in macrophages thus supporting an integrative role for the erythrocytes in the immune response. Conclusions/Significance We demonstrate that nucleated erythrocytes in non-mammalian vertebrates spanning significant phylogenetic distance participate in the immune response. RNA-Seq studies highlight a mRNA repertoire that suggests a previously unrecognized integrative role for the erythrocytes in other physiological systems. PMID:22046430

Long-term boron-deficiency-responsive genes revealed by cDNA-AFLP differ between Citrus sinensis roots and leaves

PubMed Central

Lu, Yi-Bin; Qi, Yi-Ping; Yang, Lin-Tong; Lee, Jinwook; Guo, Peng; Ye, Xin; Jia, Meng-Yang; Li, Mei-Li; Chen, Li-Song

2015-01-01

Seedlings of Citrus sinensis (L.) Osbeck were supplied with boron (B)-deficient (without H3BO3) or -sufficient (10 μM H3BO3) nutrient solution for 15 weeks. We identified 54 (38) and 38 (45) up (down)-regulated cDNA-AFLP bands (transcript-derived fragments, TDFs) from B-deficient leaves and roots, respectively. These TDFs were mainly involved in protein and amino acid metabolism, carbohydrate and energy metabolism, nucleic acid metabolism, cell transport, signal transduction, and stress response and defense. The majority of the differentially expressed TDFs were isolated only from B-deficient roots or leaves, only seven TDFs with the same GenBank ID were isolated from the both. In addition, ATP biosynthesis-related TDFs were induced in B-deficient roots, but unaffected in B-deficient leaves. Most of the differentially expressed TDFs associated with signal transduction and stress defense were down-regulated in roots, but up-regulated in leaves. TDFs related to protein ubiquitination and proteolysis were induced in B-deficient leaves except for one TDF, while only two down-regulated TDFs associated with ubiquitination were detected in B-deficient roots. Thus, many differences existed in long-term B-deficiency-responsive genes between roots and leaves. In conclusion, our findings provided a global picture of the differential responses occurring in B-deficient roots and leaves and revealed new insight into the different adaptive mechanisms of C. sinensis roots and leaves to B-deficiency at the transcriptional level. PMID:26284101

Ethylene responsive factor ERF110 mediates ethylene-regulated transcription of a sex determination-related orthologous gene in two Cucumis species.

PubMed

Tao, Qianyi; Niu, Huanhuan; Wang, Zhongyuan; Zhang, Wenhui; Wang, Hu; Wang, Shenhao; Zhang, Xian; Li, Zheng

2018-05-25

In plants, unisexual flowers derived from developmental sex determination form separate stamens and pistils that facilitate cross pollination. In cucumber and melon, ethylene plays a key role in sex determination. Six sex determination-related genes have been identified in ethylene biosynthesis in these Cucumis species. The interactions among these genes are thought to involve ethylene signaling; however, the underlying mechanism of regulation remains unknown. In this study, hormone treatment and qPCR assays were used to confirm expression of these sex determination-related genes in cucumber and melon is ethylene sensitive. RNA-Seq analysis subsequently helped identify the ethylene responsive factor (ERF) gene, CsERF110, related to ethylene signaling and sex determination. CsERF110 and its melon ortholog, CmERF110, shared a conserved AP2/ERF domain and showed ethylene-sensitive expression. Yeast one-hybrid and ChIP-PCR assays further indicated that CsERF110 bound to at least two sites in the promoter fragment of CsACS11, while transient transformation analysis showed that CsERF110 and CmERF110 enhance CsACS11 and CmACS11 promoter activity, respectively. Taken together, these findings suggest that CsERF110 and CmERF110 respond to ethylene signaling, mediating ethylene-regulated transcription of CsACS11 and CmACS11 in cucumber and melon, respectively. Furthermore, the mechanism involved in its regulation is thought to be conserved in these two Cucumis species.

Genomic Characterization of Variable Surface Antigens Reveals a Telomere Position Effect as a Prerequisite for RNA Interference-Mediated Silencing in Paramecium tetraurelia

PubMed Central

Baranasic, Damir; Oppermann, Timo; Cheaib, Miriam; Cullum, John; Schmidt, Helmut

2014-01-01

ABSTRACT Antigenic or phenotypic variation is a widespread phenomenon of expression of variable surface protein coats on eukaryotic microbes. To clarify the mechanism behind mutually exclusive gene expression, we characterized the genetic properties of the surface antigen multigene family in the ciliate Paramecium tetraurelia and the epigenetic factors controlling expression and silencing. Genome analysis indicated that the multigene family consists of intrachromosomal and subtelomeric genes; both classes apparently derive from different gene duplication events: whole-genome and intrachromosomal duplication. Expression analysis provides evidence for telomere position effects, because only subtelomeric genes follow mutually exclusive transcription. Microarray analysis of cultures deficient in Rdr3, an RNA-dependent RNA polymerase, in comparison to serotype-pure wild-type cultures, shows cotranscription of a subset of subtelomeric genes, indicating that the telomere position effect is due to a selective occurrence of Rdr3-mediated silencing in subtelomeric regions. We present a model of surface antigen evolution by intrachromosomal gene duplication involving the maintenance of positive selection of structurally relevant regions. Further analysis of chromosome heterogeneity shows that alternative telomere addition regions clearly affect transcription of closely related genes. Consequently, chromosome fragmentation appears to be of crucial importance for surface antigen expression and evolution. Our data suggest that RNAi-mediated control of this genetic network by trans-acting RNAs allows rapid epigenetic adaptation by phenotypic variation in combination with long-term genetic adaptation by Darwinian evolution of antigen genes. PMID:25389173

Intestinal flora of FAP patients containing APC-like sequences.

PubMed

Hainova, K; Adamcikova, Z; Ciernikova, S; Stevurkova, V; Tyciakova, S; Zajac, V

2014-01-01

Colorectal cancer mortality is one of the most common cause of cancer-related mortality. A multiple risk factors are associated with colorectal cancer, including hereditary, enviromental and inflammatory syndromes affecting the gastrointestinal tract. Familial adenomatous polyposis (FAP) is characterized by the emergence of hundreds to thousands of colorectal adenomatous polyps and FAP syndrome is caused by mutations within the adenomatous polyposis coli (APC) tumor suppressor gene. We analyzed 21 rectal bacterial subclones isolated from FAP patient 41-1 with confirmed 5bp ACAAA deletion within codons 1060-1063 for the presence of APC-like sequences in longest exon 15. The studied section was defined by primers 15Efor-15Erev, what correlates with mutation cluster region (MCR) in which the 75% of all APC germline mutations were detected. More than 90% homology was showed by sequencing and subsequent software comparison. The expression of APC-like sequences was demostrated by Western blot analysis using monoclonal and polyclonal antibodies against APC protein. To study missing link between the DNA analysis (PCR, DNA sequencing) and protein expresion experiments (Western blotting) we analyzed bacterial transcripts containing the 15Efor-15Erev sequence of APC gene by reverse transcription-PCR, what indicated that an APC gene derived fragment may be produced. We observed 97-100 % homology after computer comparison of cDNA PCR products. Our results suggest that presence of APC-like sequences in intestinal/rectal bacteria is enrichment of bacterial genetic information in which horizontal gene transfer between humans and microflora play an important role.

Tryptophan derivatives regulate the transcription of Oct4 in stem-like cancer cells.

PubMed

Cheng, Jie; Li, Wenxin; Kang, Bo; Zhou, Yanwen; Song, Jiasheng; Dan, Songsong; Yang, Ying; Zhang, Xiaoqian; Li, Jingchao; Yin, Shengyong; Cao, Hongcui; Yao, Hangping; Zhu, Chenggang; Yi, Wen; Zhao, Qingwei; Xu, Xiaowei; Zheng, Min; Zheng, Shusen; Li, Lanjuan; Shen, Binghui; Wang, Ying-Jie

2015-06-10

The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to environmental toxicants, is increasingly recognized as a key player in embryogenesis and tumorigenesis. Here we show that a variety of tryptophan derivatives that act as endogenous AhR ligands can affect the transcription level of the master pluripotency factor Oct4. Among them, ITE enhances the binding of the AhR to the promoter of Oct4 and suppresses its transcription. Reduction of endogenous ITE levels in cancer cells by tryptophan deprivation or hypoxia leads to Oct4 elevation, which can be reverted by administration with synthetic ITE. Consequently, synthetic ITE induces the differentiation of stem-like cancer cells and reduces their tumorigenic potential in both subcutaneous and orthotopic xenograft tumour models. Thus, our results reveal a role of tryptophan derivatives and the AhR signalling pathway in regulating cancer cell stemness and open a new therapeutic avenue to target stem-like cancer cells.

Tryptophan derivatives regulate the transcription of Oct4 in stem-like cancer cells

PubMed Central

Cheng, Jie; Li, Wenxin; Kang, Bo; Zhou, Yanwen; Song, Jiasheng; Dan, Songsong; Yang, Ying; Zhang, Xiaoqian; Li, Jingchao; Yin, Shengyong; Cao, Hongcui; Yao, Hangping; Zhu, Chenggang; Yi, Wen; Zhao, Qingwei; Xu, Xiaowei; Zheng, Min; Zheng, Shusen; Li, Lanjuan; Shen, Binghui; Wang, Ying-Jie

2015-01-01

The aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor that responds to environmental toxicants, is increasingly recognized as a key player in embryogenesis and tumorigenesis. Here we show that a variety of tryptophan derivatives that act as endogenous AhR ligands can affect the transcription level of the master pluripotency factor Oct4. Among them, ITE enhances the binding of the AhR to the promoter of Oct4 and suppresses its transcription. Reduction of endogenous ITE levels in cancer cells by tryptophan deprivation or hypoxia leads to Oct4 elevation, which can be reverted by administration with synthetic ITE. Consequently, synthetic ITE induces the differentiation of stem-like cancer cells and reduces their tumorigenic potential in both subcutaneous and orthotopic xenograft tumour models. Thus, our results reveal a role of tryptophan derivatives and the AhR signalling pathway in regulating cancer cell stemness and open a new therapeutic avenue to target stem-like cancer cells. PMID:26059097

Targeting α-synuclein oligomers by protein-fragment complementation for drug discovery in synucleinopathies.

PubMed

Moussaud, Simon; Malany, Siobhan; Mehta, Alka; Vasile, Stefan; Smith, Layton H; McLean, Pamela J

2015-05-01

Reducing the burden of α-synuclein oligomeric species represents a promising approach for disease-modifying therapies against synucleinopathies such as Parkinson's disease and dementia with Lewy bodies. However, the lack of efficient drug discovery strategies that specifically target α-synuclein oligomers has been a limitation to drug discovery programs. Here we describe an innovative strategy that harnesses the power of bimolecular protein-fragment complementation to monitor synuclein-synuclein interactions. We have developed two robust models to monitor α-synuclein oligomerization by generating novel stable cell lines expressing α-synuclein fusion proteins for either fluorescent or bioluminescent protein-fragment complementation under the tetracycline-controlled transcriptional activation system. A pilot screen was performed resulting in the identification of two potential hits, a p38 MAPK inhibitor and a casein kinase 2 inhibitor, thereby demonstrating the suitability of our protein-fragment complementation assay for the measurement of α-synuclein oligomerization in living cells at high throughput. The application of the strategy described herein to monitor α-synuclein oligomer formation in living cells with high throughput will facilitate drug discovery efforts for disease-modifying therapies against synucleinopathies and other proteinopathies.

A primer set to determine sex in the small Indian mongoose, Herpestes auropunctatus.

PubMed

Murata, C; Ogura, G; Kuroiwa, A

2011-03-01

To enable the accurate sexing of individuals of introduced populations of the small Indian mongoose, Herpestes auropunctatus, we designed a primer set for the amplification of the sex-specific fragments EIF2S3Y and EIF2S3X. Using this primer set, the expected amplification products were obtained for all samples of genomic DNA tested: males yielded two bands and females a single band. Sequencing of each PCR product confirmed that the 769-bp fragment amplified from DNA samples of both sexes was derived from EIF2S3X, whereas the 546-bp fragment amplified only from male DNA samples was derived from EIF2S3Y. The results indicated that this primer set is useful for sex identification in this species. © 2010 Blackwell Publishing Ltd.

Protection against β-amyloid neurotoxicity by a non-toxic endogenous N-terminal β-amyloid fragment and its active hexapeptide core sequence.

PubMed

Forest, Kelly H; Alfulaij, Naghum; Arora, Komal; Taketa, Ruth; Sherrin, Tessi; Todorovic, Cedomir; Lawrence, James L M; Yoshikawa, Gene T; Ng, Ho-Leung; Hruby, Victor J; Nichols, Robert A

2018-01-01

High levels (μM) of beta amyloid (Aβ) oligomers are known to trigger neurotoxic effects, leading to synaptic impairment, behavioral deficits, and apoptotic cell death. The hydrophobic C-terminal domain of Aβ, together with sequences critical for oligomer formation, is essential for this neurotoxicity. However, Aβ at low levels (pM-nM) has been shown to function as a positive neuromodulator and this activity resides in the hydrophilic N-terminal domain of Aβ. An N-terminal Aβ fragment (1-15/16), found in cerebrospinal fluid, was also shown to be a highly active neuromodulator and to reverse Aβ-induced impairments of long-term potentiation. Here, we show the impact of this N-terminal Aβ fragment and a shorter hexapeptide core sequence in the Aβ fragment (Aβcore: 10-15) to protect or reverse Aβ-induced neuronal toxicity, fear memory deficits and apoptotic death. The neuroprotective effects of the N-terminal Aβ fragment and Aβcore on Aβ-induced changes in mitochondrial function, oxidative stress, and apoptotic neuronal death were demonstrated via mitochondrial membrane potential, live reactive oxygen species, DNA fragmentation and cell survival assays using a model neuroblastoma cell line (differentiated NG108-15) and mouse hippocampal neuron cultures. The protective action of the N-terminal Aβ fragment and Aβcore against spatial memory processing deficits in amyloid precursor protein/PSEN1 (5XFAD) mice was demonstrated in contextual fear conditioning. Stabilized derivatives of the N-terminal Aβcore were also shown to be fully protective against Aβ-triggered oxidative stress. Together, these findings indicate an endogenous neuroprotective role for the N-terminal Aβ fragment, while active stabilized N-terminal Aβcore derivatives offer the potential for therapeutic application. © 2017 International Society for Neurochemistry.

"Mini-array" transcriptional analysis of the Listeria monocytogenes lecithinase operon as a class project: A student investigative molecular biology laboratory experience*.

PubMed

Christensen, Douglas; Jovic, Marko

2006-05-01

This report describes a molecular biotechnology-based laboratory curriculum developed to accompany an undergraduate genetics course. During the course of a semester, students researched the pathogen, developed a research question, designed experiments, and performed transcriptional analysis of a set of genes that confer virulence to the food-borne pathogen, Listeria monocytogenes. Gene fragments were amplified via PCR and utilized in "mini-arrays," a dot-blot-based format suitable for the simultaneous transcriptional analysis of multiple genes. The project provides exposure to a wide range of molecular techniques and can be easily modified for variations in class size. Data are generated at various steps of the process, allowing for student interpretation, troubleshooting, and assessment opportunities. Copyright © 2006 International Union of Biochemistry and Molecular Biology, Inc.

The effects of potato virus Y-derived virus small interfering RNAs of three biologically distinct strains on potato (Solanum tuberosum) transcriptome.

PubMed

Moyo, Lindani; Ramesh, Shunmugiah V; Kappagantu, Madhu; Mitter, Neena; Sathuvalli, Vidyasagar; Pappu, Hanu R

2017-07-17

Potato virus Y (PVY) is one of the most economically important pathogen of potato that is present as biologically distinct strains. The virus-derived small interfering RNAs (vsiRNAs) from potato cv. Russet Burbank individually infected with PVY-N, PVY-NTN and PVY-O strains were recently characterized. Plant defense RNA-silencing mechanisms deployed against viruses produce vsiRNAs to degrade homologous viral transcripts. Based on sequence complementarity, the vsiRNAs can potentially degrade host RNA transcripts raising the prospect of vsiRNAs as pathogenicity determinants in virus-host interactions. This study investigated the global effects of PVY vsiRNAs on the host potato transcriptome. The strain-specific vsiRNAs of PVY, expressed in high copy number, were analyzed in silico for their proclivity to target potato coding and non-coding RNAs using psRobot and psRNATarget algorithms. Functional annotation of target coding transcripts was carried out to predict physiological effects of the vsiRNAs on the potato cv. Russet Burbank. The downregulation of selected target coding transcripts was further validated using qRT-PCR. The vsiRNAs derived from biologically distinct strains of PVY displayed diversity in terms of absolute number, copy number and hotspots for siRNAs on their respective genomes. The vsiRNAs populations were derived with a high frequency from 6 K1, P1 and Hc-Pro for PVY-N, P1, Hc-Pro and P3 for PVY-NTN, and P1, 3' UTR and NIa for PVY-O genomic regions. The number of vsiRNAs that displayed interaction with potato coding transcripts and number of putative coding target transcripts were comparable between PVY-N and PVY-O, and were relatively higher for PVY-NTN. The most abundant target non-coding RNA transcripts for the strain specific PVY-derived vsiRNAs were found to be MIR821, 28S rRNA,18S rRNA, snoR71, tRNA-Met and U5. Functional annotation and qRT-PCR validation suggested that the vsiRNAs target genes involved in plant hormone signaling, genetic information processing, plant-pathogen interactions, plant defense and stress response processes in potato. The findings suggested that the PVY-derived vsiRNAs could act as a pathogenicity determinant and as a counter-defense strategy to host RNA silencing in PVY-potato interactions. The broad range of host genes targeted by PVY vsiRNAs in infected potato suggests a diverse role for vsiRNAs that includes suppression of host stress responses and developmental processes. The interactome scenario is the first report on the interaction between one of the most important Potyvirus genome-derived siRNAs and the potato transcripts.

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

NASA Astrophysics Data System (ADS)

Nakata, Hiroya; Fedorov, Dmitri G.; Zahariev, Federico; Schmidt, Michael W.; Kitaura, Kazuo; Gordon, Mark S.; Nakamura, Shinichiro

2015-03-01

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluated for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in SN2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.

Lessons from hot spot analysis for fragment-based drug discovery

PubMed Central

Hall, David R.; Vajda, Sandor

2015-01-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high affinity, druglike ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from protein three-dimensional structure, and how their strength, number and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. PMID:26538314

3D reconstruction of highly fragmented bone fractures

NASA Astrophysics Data System (ADS)

Willis, Andrew; Anderson, Donald; Thomas, Thad; Brown, Thomas; Marsh, J. Lawrence

2007-03-01

A system for the semi-automatic reconstruction of highly fragmented bone fractures, developed to aid in treatment planning, is presented. The system aligns bone fragment surfaces derived from segmentation of volumetric CT scan data. Each fragment surface is partitioned into intact- and fracture-surfaces, corresponding more or less to cortical and cancellous bone, respectively. A user then interactively selects fracture-surface patches in pairs that coarsely correspond. A final optimization step is performed automatically to solve the N-body rigid alignment problem. The work represents the first example of a 3D bone fracture reconstruction system and addresses two new problems unique to the reconstruction of fractured bones: (1) non-stationary noise inherent in surfaces generated from a difficult segmentation problem and (2) the possibility that a single fracture surface on a fragment may correspond to many other fragments.

Accumulation of linear mitochondrial DNA fragments in the nucleus shortens the chronological life span of yeast.

PubMed

Cheng, Xin; Ivessa, Andreas S

2012-10-01

Translocation of mitochondrial DNA (mtDNA) fragments to the nucleus and insertion of those fragments into nuclear DNA has been observed in several organisms ranging from yeast to plants and mammals. Disruption of specific nuclear genes by de novo insertions of mtDNA fragments has even been linked to the initiation of several human diseases. Recently, we demonstrated that baker's yeast strains with high rates of mtDNA fragments migrating to the nucleus (yme1-1 mutant) exhibit short chronological life spans (CLS). The yeast CLS is determined by the survival of non-dividing cell populations. Here, we show that lack of the non-homologous-end-joining enzyme DNA ligase IV (DNL4) can rescue the short CLS of the yme1-1 mutant. In fission yeast, DNA ligase IV has been shown to be required for the capture of mtDNA fragments during the repair of double-stranded DNA breaks in nuclear DNA. In further analyses using pulse field gel and 2D gel electrophoresis we demonstrate that linear mtDNA fragments with likely nuclear localization accumulate in the yme1-1 mutant. The accumulation of the linear mtDNA fragments in the yme1-1 mutant is suppressed when Dnl4 is absent. We propose that the linear nuclear mtDNA fragments accelerate the aging process in the yme1-1 mutant cells by possibly affecting nuclear processes including DNA replication, recombination, and repair as well as transcription of nuclear genes. We speculate further that Dnl4 protein has besides its function as a ligase also a role in DNA protection. Dnl4 protein may stabilize the linear mtDNA fragments in the nucleus by binding to their physical ends. In the absence of Dnl4 protein the linear fragments are therefore unprotected and possibly degraded by nuclear nucleases. Copyright © 2012 Elsevier GmbH. All rights reserved.

Hypervelocity Impact Test Fragment Modeling: Modifications to the Fragment Rotation Analysis and Lightcurve Code

NASA Technical Reports Server (NTRS)

Gouge, Michael F.

2011-01-01

Hypervelocity impact tests on test satellites are performed by members of the orbital debris scientific community in order to understand and typify the on-orbit collision breakup process. By analysis of these test satellite fragments, the fragment size and mass distributions are derived and incorporated into various orbital debris models. These same fragments are currently being put to new use using emerging technologies. Digital models of these fragments are created using a laser scanner. A group of computer programs referred to as the Fragment Rotation Analysis and Lightcurve code uses these digital representations in a multitude of ways that describe, measure, and model on-orbit fragments and fragment behavior. The Dynamic Rotation subroutine generates all of the possible reflected intensities from a scanned fragment as if it were observed to rotate dynamically while in orbit about the Earth. This calls an additional subroutine that graphically displays the intensities and the resulting frequency of those intensities as a range of solar phase angles in a Probability Density Function plot. This document reports the additions and modifications to the subset of the Fragment Rotation Analysis and Lightcurve concerned with the Dynamic Rotation and Probability Density Function plotting subroutines.

Synthetic Promoters Functional in Francisella novicida and Escherichia coli

PubMed Central

McWhinnie, Ralph L.

2014-01-01

In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126

Transcriptional Activation of c3 and hsp70 as Part of the Immune Response of Acropora millepora to Bacterial Challenges

PubMed Central

Brown, Tanya; Bourne, David; Rodriguez-Lanetty, Mauricio

2013-01-01

The impact of disease outbreaks on coral physiology represents an increasing concern for the fitness and resilience of reef ecosystems. Predicting the tolerance of corals to disease relies on an understanding of the coral immune response to pathogenic interactions. This study explored the transcriptional response of two putative immune genes (c3 and c-type lectin) and one stress response gene (hsp70) in the reef building coral, Acropora millepora challenged for 48 hours with bacterial strains, Vibrio coralliilyticus and Alteromonas sp. at concentrations of 106 cells ml-1. Coral fragments challenged with V. coralliilyticus appeared healthy while fragments challenged with Alteromonas sp. showed signs of tissue lesions after 48 hr. Coral-associated bacterial community profiles assessed using denaturing gradient gel electrophoresis changed after challenge by both bacterial strains with the Alteromonas sp. treatment demonstrating the greatest community shift. Transcriptional profiles of c3 and hsp70 increased at 24 hours and correlated with disease signs in the Alteromonas sp. treatment. The expression of hsp70 also showed a significant increase in V. coralliilyticus inoculated corals at 24 h suggesting that even in the absence of disease signs, the microbial inoculum activated a stress response in the coral. C-type lectin did not show a response to any of the bacterial treatments. Increase in gene expression of c3 and hsp70 in corals showing signs of disease indicates their potential involvement in immune and stress response to microbial challenges. PMID:23861754

Characterization of Long-Chain Fatty Acid as N-(4-Aminomethylphenyl) Pyridinium Derivative by MALDI LIFT-TOF/TOF Mass Spectrometry

NASA Astrophysics Data System (ADS)

Frankfater, Cheryl; Jiang, Xuntian; Hsu, Fong-Fu

2018-05-01

Charge remote fragmentation (CRF) elimination of CnH2n+2 residues along the aliphatic tail of long chain fatty acid is hall mark of keV high-energy CID fragmentation process. It is an important fragmentation pathway leading to structural characterization of biomolecules by CID tandem mass spectrometry. In this report, we describe MALDI LIFT TOF-TOF mass spectrometric approach to study a wide variety of fatty acids (FAs), which were derivatized to N-(4-aminomethylphenyl) pyridinium (AMPP) derivative, and desorbed as M+ ions by laser with or without matrix. The high-energy MALDI LIFT TOF-TOF mass spectra of FA-AMPP contain fragment ions mainly deriving from CRF cleavages of CnH2n+2 residues, as expected. These ions together with ions from specific cleavages of the bond(s) involving the functional group within the molecule provide more complete structural identification than those produced by low-energy CID/HCD using a linear ion-trap instrument. However, this LIFT TOF-TOF mass spectrometric approach inherits low sensitivity, a typical feature of high-energy CID tandem mass spectrometry. Because of the lack of unit mass precursor ion selection with sufficient sensitivity of the current LIFT TOF-TOF technology, product ion spectra from same chain length fatty acids with difference in one or two double bonds in a mixture are not distinguishable.

Conserved expression of transposon-derived non-coding transcripts in primate stem cells.

PubMed

Ramsay, LeeAnn; Marchetto, Maria C; Caron, Maxime; Chen, Shu-Huang; Busche, Stephan; Kwan, Tony; Pastinen, Tomi; Gage, Fred H; Bourque, Guillaume

2017-02-28

A significant portion of expressed non-coding RNAs in human cells is derived from transposable elements (TEs). Moreover, it has been shown that various long non-coding RNAs (lncRNAs), which come from the human endogenous retrovirus subfamily H (HERVH), are not only expressed but required for pluripotency in human embryonic stem cells (hESCs). To identify additional TE-derived functional non-coding transcripts, we generated RNA-seq data from induced pluripotent stem cells (iPSCs) of four primate species (human, chimpanzee, gorilla, and rhesus) and searched for transcripts whose expression was conserved. We observed that about 30% of TE instances expressed in human iPSCs had orthologous TE instances that were also expressed in chimpanzee and gorilla. Notably, our analysis revealed a number of repeat families with highly conserved expression profiles including HERVH but also MER53, which is known to be the source of a placental-specific family of microRNAs (miRNAs). We also identified a number of repeat families from all classes of TEs, including MLT1-type and Tigger families, that contributed a significant amount of sequence to primate lncRNAs whose expression was conserved. Together, these results describe TE families and TE-derived lncRNAs whose conserved expression patterns can be used to identify what are likely functional TE-derived non-coding transcripts in primate iPSCs.

Recommended approaches in the application of ...

EPA Pesticide Factsheets

ABSTRACT:Only a fraction of chemicals in commerce have been fully assessed for their potential hazards to human health due to difficulties involved in conventional regulatory tests. It has recently been proposed that quantitative transcriptomic data can be used to determine benchmark dose (BMD) and estimate a point of departure (POD). Several studies have shown that transcriptional PODs correlate with PODs derived from analysis of pathological changes, but there is no consensus on how the genes that are used to derive a transcriptional POD should be selected. Because of very large number of unrelated genes in gene expression data, the process of selecting subsets of informative genes is a major challenge. We used published microarray data from studies on rats exposed orally to multiple doses of six chemicals for 5, 14, 28, and 90 days. We evaluated eight different approaches to select genes for POD derivation and compared them to three previously proposed approaches. The relationship between transcriptional BMDs derived using these 11 approaches were compared with PODs derived from apical data that might be used in a human health risk assessment. We found that transcriptional benchmark dose values for all 11 approaches were remarkably aligned with different apical PODs, while a subset of between 3 and 8 of the approaches met standard statistical criteria across the 5-, 14-, 28-, and 90-day time points and thus qualify as effective estimates of apical PODs. Our r

A PRELIMINARY ASSESSMENT OF THE MONTREAL PROCESS INDICATORS OF FOREST FRAGMENTATION FOR THE UNITED STATES

EPA Science Inventory

As part of the 2003 U.S. Report on Sustainable Forests, four metrics of forest fragmentation patch size, edge amount, inter-patch contrast - were measured within 142,602 non overlapping 56.25 km2 analysis units on land-cover maps derived from satellite imagery for the 48 contermi...

Development of reverse transcription-PCR assays specific for detection of equine encephalitis viruses.

PubMed

Linssen, B; Kinney, R M; Aguilar, P; Russell, K L; Watts, D M; Kaaden, O R; Pfeffer, M

2000-04-01

Specific and sensitive reverse transcription-PCR (RT-PCR) assays were developed for the detection of eastern, western, and Venezuelan equine encephalitis viruses (EEE, WEE, and VEE, respectively). Tests for specificity included all known alphavirus species. The EEE-specific RT-PCR amplified a 464-bp region of the E2 gene exclusively from 10 different EEE strains from South and North America with a sensitivity of about 3,000 RNA molecules. In a subsequent nested PCR, the specificity was confirmed by the amplification of a 262-bp fragment, increasing the sensitivity of this assay to approximately 30 RNA molecules. The RT-PCR for WEE amplified a fragment of 354 bp from as few as 2,000 RNA molecules. Babanki virus, as well as Mucambo and Pixuna viruses (VEE subtypes IIIA and IV), were also amplified. However, the latter viruses showed slightly smaller fragments of about 290 and 310 bp, respectively. A subsequent seminested PCR amplified a 195-bp fragment only from the 10 tested strains of WEE from North and South America, rendering this assay virus specific and increasing its sensitivity to approximately 20 RNA molecules. Because the 12 VEE subtypes showed too much divergence in their 26S RNA nucleotide sequences to detect all of them by the use of nondegenerate primers, this assay was confined to the medically important and closely related VEE subtypes IAB, IC, ID, IE, and II. The RT-PCR-seminested PCR combination specifically amplified 342- and 194-bp fragments of the region covering the 6K gene in VEE. The sensitivity was 20 RNA molecules for subtype IAB virus and 70 RNA molecules for subtype IE virus. In addition to the subtypes mentioned above, three of the enzootic VEE (subtypes IIIB, IIIC, and IV) showed the specific amplicon in the seminested PCR. The practicability of the latter assay was tested with human sera gathered as part of the febrile illness surveillance in the Amazon River Basin of Peru near the city of Iquitos. All of the nine tested VEE-positive sera showed the expected 194-bp amplicon of the VEE-specific RT-PCR-seminested PCR.

Apollo 16 soils - Grain size analyses and petrography

NASA Technical Reports Server (NTRS)

Heiken, G. H.; Mckay, D. S.; Fruland, R. M.

1973-01-01

Soils from South Ray Crater, North Ray Crater, and the interray area of Station 10 have a similar provenance, containing breccia fragments of low to medium metamorphic grade and low light/dark lithic fragment ratios; these appear to be characteristic of the Cayley Formation. The primary difference between soils possibly derived from North Ray and South Ray craters is in the agglutinate content. A soil from Stone Mountain (Station 4) is characterized by breccia fragments of medium to high metamorphic grade and a high light/dark lithic fragment ratio; this soil may be derived from the Descartes Formation. Differences between the selenomorphic units, the Descartes and Cayley formations, may be lithologic as well as structural. The mean grain size varies from 84 to 280 microns, and all of the samples are poorly to very poorly sorted. There appears to be a relation between the sorting, grain size, and agglutinate content, with the finer-grained, better sorted soils containing more than 30% agglutinates. 'Shadowed' soils, collected close to large boulders, are similar in all respects to the 'reference' soils collected at least 5 m from the boulders.

The ways and means of fragment-based drug design.

PubMed

Doak, Bradley C; Norton, Raymond S; Scanlon, Martin J

2016-11-01

Fragment-based drug design (FBDD) has emerged as a mainstream approach for the rapid and efficient identification of building blocks that can be used to develop high-affinity ligands against protein targets. One of the strengths of FBDD is the relative ease and low cost of the primary screen to identify fragments that bind. However, the fragments that emerge from primary screens often have low affinities, with K D values in the high μM to mM range, and a significant challenge for FBDD is to develop the initial fragments into more potent ligands. Successful fragment elaboration often requires co-structures of the fragments bound to their target proteins, as well as a range of biophysical and biochemical assays to track potency and efficacy. These challenges have led to the development of specific chemical strategies for the elaboration of weakly-binding fragments into more potent "hits" and lead compounds. In this article we review different approaches that have been employed to meet these challenges and describe some of the strategies that have resulted in several fragment-derived compounds entering clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.

Identification of ovule transcripts from the Apospory-Specific Genomic Region (ASGR)-carrier chromosome

PubMed Central

2011-01-01

Background Apomixis, asexual seed production in plants, holds great potential for agriculture as a means to fix hybrid vigor. Apospory is a form of apomixis where the embryo develops from an unreduced egg that is derived from a somatic nucellar cell, the aposporous initial, via mitosis. Understanding the molecular mechanism regulating aposporous initial specification will be a critical step toward elucidation of apomixis and also provide insight into developmental regulation and downstream signaling that results in apomixis. To discover candidate transcripts for regulating aposporous initial specification in P. squamulatum, we compared two transcriptomes derived from microdissected ovules at the stage of aposporous initial formation between the apomictic donor parent, P. squamulatum (accession PS26), and an apomictic derived backcross 8 (BC8) line containing only the Apospory-Specific Genomic Region (ASGR)-carrier chromosome from P. squamulatum. Toward this end, two transcriptomes derived from ovules of an apomictic donor parent and its apomictic backcross derivative at the stage of apospory initiation, were sequenced using 454-FLX technology. Results Using 454-FLX technology, we generated 332,567 reads with an average read length of 147 base pairs (bp) for the PS26 ovule transcriptome library and 363,637 reads with an average read length of 142 bp for the BC8 ovule transcriptome library. A total of 33,977 contigs from the PS26 ovule transcriptome library and 26,576 contigs from the BC8 ovule transcriptome library were assembled using the Multifunctional Inertial Reference Assembly program. Using stringent in silico parameters, 61 transcripts were predicted to map to the ASGR-carrier chromosome, of which 49 transcripts were verified as ASGR-carrier chromosome specific. One of the alien expressed genes could be assigned as tightly linked to the ASGR by screening of apomictic and sexual F1s. Only one transcript, which did not map to the ASGR, showed expression primarily in reproductive tissue. Conclusions Our results suggest that a strategy of comparative sequencing of transcriptomes between donor parent and backcross lines containing an alien chromosome of interest can be an efficient method of identifying transcripts derived from an alien chromosome in a chromosome addition line. PMID:21521529

Plasma RNA integrity analysis: methodology and validation.

PubMed

Wong, Blenda C K; Lo, Y M Dennis

2006-09-01

The detection of cell-free RNA in plasma and serum of human subjects has found increasing applications in the field of medical diagnostics. However, many questions regarding the biology of circulating RNA remain to be addressed. One issue concerns the molecular nature of these circulating RNA species. We have recently developed a simple and quantitative method to investigate the integrity of plasma RNA. Our results have suggested that cell-free RNA in plasma is generally present as fragmented molecules instead of intact transcripts, with a predominance of 5' fragments. In this article, we summarize the basic principles in the experimental design for plasma RNA integrity analysis and highlight some of the important technical considerations for this type of investigation.

Renormalization of the fragmentation equation: exact self-similar solutions and turbulent cascades.

PubMed

Saveliev, V L; Gorokhovski, M A

2012-12-01

Using an approach developed earlier for renormalization of the Boltzmann collision integral [Saveliev and Nanbu, Phys. Rev. E 65, 051205 (2002)], we derive an exact divergence form for the fragmentation operator. Then we reduce the fragmentation equation to the continuity equation in size space, with the flux given explicitly. This allows us to obtain self-similar solutions and to find the integral of motion for these solutions (we call it the bare flux). We show how these solutions can be applied as a description of cascade processes in three- and two-dimensional turbulence. We also suggested an empirical cascade model of impact fragmentation of brittle materials.

Relativistic corrections to heavy quark fragmentation to S-wave heavy mesons

NASA Astrophysics Data System (ADS)

Sang, Wen-Long; Yang, Lan-Fei; Chen, Yu-Qi

2009-07-01

The relativistic corrections of order v2 to the fragmentation functions for the heavy quark to S-wave heavy quarkonia are calculated in the framework of the nonrelativistic quantum chromodynamics factorization formula. We derive the fragmentation functions by using the Collins-Soper definition in both the Feynman gauge and the axial gauge. We also extract them through the process Z0→Hq qmacr in the limit MZ/m→∞. We find that all results obtained by these two different methods and in different gauges are the same. We estimate the relative size of the relativistic corrections to the fragmentation functions.

Relativistic corrections to heavy quark fragmentation to S-wave heavy mesons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sang Wenlong; Yang Lanfei; Chen Yuqi

The relativistic corrections of order v{sup 2} to the fragmentation functions for the heavy quark to S-wave heavy quarkonia are calculated in the framework of the nonrelativistic quantum chromodynamics factorization formula. We derive the fragmentation functions by using the Collins-Soper definition in both the Feynman gauge and the axial gauge. We also extract them through the process Z{sup 0}{yields}Hqq in the limit M{sub Z}/m{yields}{infinity}. We find that all results obtained by these two different methods and in different gauges are the same. We estimate the relative size of the relativistic corrections to the fragmentation functions.

Generalized Boltzmann-Type Equations for Aggregation in Gases

NASA Astrophysics Data System (ADS)

Adzhiev, S. Z.; Vedenyapin, V. V.; Volkov, Yu. A.; Melikhov, I. V.

2017-12-01

The coalescence and fragmentation of particles in a dispersion system are investigated by applying kinetic theory methods, namely, by generalizing the Boltzmann kinetic equation to coalescence and fragmentation processes. Dynamic equations for the particle concentrations in the system are derived using the kinetic equations of motion. For particle coalescence and fragmentation, equations for the particle momentum, coordinate, and mass distribution functions are obtained and the coalescence and fragmentation coefficients are calculated. The equilibrium mass and velocity distribution functions of the particles in the dispersion system are found in the approximation of an active terminal group (Becker-Döring-type equation). The transition to a continuum description is performed.

Spectroscopic studies of bacteriorhodopsin fragments dissolved in organic solution.

PubMed Central

Torres, J; Padrós, E

1995-01-01

Fourier transform infrared and UV fourth-derivative spectroscopies were used to study the secondary structure of bacteriorhodopsin and its chymotryptic and one of the sodium borohydride fragments dissolved in chloroform-methanol (1:1, v/v), 0.1 M LiClO4. The C1 fragment (helices C, D, E, F, and G) showed an alpha-helical content of about 53%, whereas C2 (helices A and B) had about 60%, and B2 (helices F and G) about 65% alpha-helix. The infrared main band indicated differences in alpha-helical properties between these fragments. These techniques were also used to obtain information on the interactions among helices. According to the results obtained from the hydrogen/deuterium exchange kinetics, about 40% of the amide protons of C2 are particularly protected against exchange, whereas for the C1 fragment this process is unexpectedly fast. UV fourth-derivative spectra of these samples were used to obtain information about the environment of Trp side chains. The results showed that the Trp residues of C2 are more shielded from the solvent than those of C1 or B2. The results of this work indicate that the specific interactions existing between the transmembrane segments induce different types of helical conformations in native bacteriorhodopsin. PMID:7612847

The Human DNA glycosylases NEIL1 and NEIL3 Excise Psoralen-Induced DNA-DNA Cross-Links in a Four-Stranded DNA Structure.

PubMed

Martin, Peter R; Couvé, Sophie; Zutterling, Caroline; Albelazi, Mustafa S; Groisman, Regina; Matkarimov, Bakhyt T; Parsons, Jason L; Elder, Rhoderick H; Saparbaev, Murat K

2017-12-12

Interstrand cross-links (ICLs) are highly cytotoxic DNA lesions that block DNA replication and transcription by preventing strand separation. Previously, we demonstrated that the bacterial and human DNA glycosylases Nei and NEIL1 excise unhooked psoralen-derived ICLs in three-stranded DNA via hydrolysis of the glycosidic bond between the crosslinked base and deoxyribose sugar. Furthermore, NEIL3 from Xenopus laevis has been shown to cleave psoralen- and abasic site-induced ICLs in Xenopus egg extracts. Here we report that human NEIL3 cleaves psoralen-induced DNA-DNA cross-links in three-stranded and four-stranded DNA substrates to generate unhooked DNA fragments containing either an abasic site or a psoralen-thymine monoadduct. Furthermore, while Nei and NEIL1 also cleave a psoralen-induced four-stranded DNA substrate to generate two unhooked DNA duplexes with a nick, NEIL3 targets both DNA strands in the ICL without generating single-strand breaks. The DNA substrate specificities of these Nei-like enzymes imply the occurrence of long uninterrupted three- and four-stranded crosslinked DNA-DNA structures that may originate in vivo from DNA replication fork bypass of an ICL. In conclusion, the Nei-like DNA glycosylases unhook psoralen-derived ICLs in various DNA structures via a genuine repair mechanism in which complex DNA lesions can be removed without generation of highly toxic double-strand breaks.

Unraveling Biochemical Pathways Affected by Mitochondrial Dysfunctions Using Metabolomic Approaches

PubMed Central

Demine, Stéphane; Reddy, Nagabushana; Renard, Patricia; Raes, Martine; Arnould, Thierry

2014-01-01

Mitochondrial dysfunction(s) (MDs) can be defined as alterations in the mitochondria, including mitochondrial uncoupling, mitochondrial depolarization, inhibition of the mitochondrial respiratory chain, mitochondrial network fragmentation, mitochondrial or nuclear DNA mutations and the mitochondrial accumulation of protein aggregates. All these MDs are known to alter the capacity of ATP production and are observed in several pathological states/diseases, including cancer, obesity, muscle and neurological disorders. The induction of MDs can also alter the secretion of several metabolites, reactive oxygen species production and modify several cell-signalling pathways to resolve the mitochondrial dysfunction or ultimately trigger cell death. Many metabolites, such as fatty acids and derived compounds, could be secreted into the blood stream by cells suffering from mitochondrial alterations. In this review, we summarize how a mitochondrial uncoupling can modify metabolites, the signalling pathways and transcription factors involved in this process. We describe how to identify the causes or consequences of mitochondrial dysfunction using metabolomics (liquid and gas chromatography associated with mass spectrometry analysis, NMR spectroscopy) in the obesity and insulin resistance thematic. PMID:25257998

Downregulation of Cinnamyl-Alcohol Dehydrogenase in Switchgrass by RNA Silencing Results in Enhanced Glucose Release after Cellulase Treatment

PubMed Central

Saathoff, Aaron J.; Sarath, Gautam; Chow, Elaine K.; Dien, Bruce S.; Tobias, Christian M.

2011-01-01

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. “Alamo” with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin. PMID:21298014

Downregulation of cinnamyl-alcohol dehydrogenase in switchgrass by RNA silencing results in enhanced glucose release after cellulase treatment.

PubMed

Saathoff, Aaron J; Sarath, Gautam; Chow, Elaine K; Dien, Bruce S; Tobias, Christian M

2011-01-27

Cinnamyl alcohol dehydrogenase (CAD) catalyzes the last step in monolignol biosynthesis and genetic evidence indicates CAD deficiency in grasses both decreases overall lignin, alters lignin structure and increases enzymatic recovery of sugars. To ascertain the effect of CAD downregulation in switchgrass, RNA mediated silencing of CAD was induced through Agrobacterium mediated transformation of cv. "Alamo" with an inverted repeat construct containing a fragment derived from the coding sequence of PviCAD2. The resulting primary transformants accumulated less CAD RNA transcript and protein than control transformants and were demonstrated to be stably transformed with between 1 and 5 copies of the T-DNA. CAD activity against coniferaldehyde, and sinapaldehyde in stems of silenced lines was significantly reduced as was overall lignin and cutin. Glucose release from ground samples pretreated with ammonium hydroxide and digested with cellulases was greater than in control transformants. When stained with the lignin and cutin specific stain phloroglucinol-HCl the staining intensity of one line indicated greater incorporation of hydroxycinnamyl aldehydes in the lignin.

Phenoxyacetic acid degradation by the 2,4-dichlorophenoxyacetic acid (TFD) pathway of plasmid pJP4: mapping and characterization of the TFD regulatory gene, tfdR.

PubMed Central

Harker, A R; Olsen, R H; Seidler, R J

1989-01-01

Plasmid pJP4 enables Alcaligenes eutrophus JMP134 to degrade 3-chlorobenzoate and 2,4-dichlorophenoxyacetic acid (TFD). Plasmid pRO101 is a derivative of pJP4 obtained by insertion of Tn1721 into a nonessential region of pJP4. Plasmid pRO101 was transferred by conjugation to several Pseudomonas strains and to A. eutrophus AEO106, a cured isolate of JMP134. AEO106(pRO101) and some Pseudomonas transconjugants grew on TFD. Transconjugants with a chromosomally encoded phenol hydroxylase also degraded phenoxyacetic acid (PAA) in the presence of an inducer of the TFD pathway, namely, TFD or 3-chlorobenzoate. A mutant of one such phenol-degrading strain, Pseudomonas putida PPO300(pRO101), grew on PAA as the sole carbon source in the absence of inducer. This isolate carried a mutant plasmid, designated pRO103, derived from pRO101 through the deletion of a 3.9-kilobase DNA fragment. Plasmid pRO103 constitutively expressed the TFD pathway, and this allowed the metabolism of PAA in the absence of the inducer, TFD. Complementation of pRO103 in trans by a DNA fragment corresponding to the fragment deleted in pRO101 indicates that a negative control-regulatory gene (tfdR) is located on the BamHI E fragment of pRO101. Other subcloning experiments resulted in the cloning of the tfdA monooxygenase gene on a 3.5-kilobase fragment derived from pRO101. This subclone, in the absence of other pRO101 DNA, constitutively expressed the tfdA gene and allowed PPO300 to grow on PAA. Preliminary evidence suggests that the monooxygenase activity encoded by this DNA fragment is feedback-inhibited by phenols. Images PMID:2914848

Thermodynamics-based models of transcriptional regulation with gene sequence.

PubMed

Wang, Shuqiang; Shen, Yanyan; Hu, Jinxing

2015-12-01

Quantitative models of gene regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled or heuristic approximations of the underlying regulatory mechanisms. In this work, we have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence. The proposed model relies on a continuous time, differential equation description of transcriptional dynamics. The sequence features of the promoter are exploited to derive the binding affinity which is derived based on statistical molecular thermodynamics. Experimental results show that the proposed model can effectively identify the activity levels of transcription factors and the regulatory parameters. Comparing with the previous models, the proposed model can reveal more biological sense.

Route to three-dimensional fragments using diversity-oriented synthesis

PubMed Central

Hung, Alvin W.; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J. Anthony; Clemons, Paul A.; Young, Damian W.

2011-01-01

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp2-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various “difficult” targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp3-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules. PMID:21482811

Route to three-dimensional fragments using diversity-oriented synthesis.

PubMed

Hung, Alvin W; Ramek, Alex; Wang, Yikai; Kaya, Taner; Wilson, J Anthony; Clemons, Paul A; Young, Damian W

2011-04-26

Fragment-based drug discovery (FBDD) has proven to be an effective means of producing high-quality chemical ligands as starting points for drug-discovery pursuits. The increasing number of clinical candidate drugs developed using FBDD approaches is a testament of the efficacy of this approach. The success of fragment-based methods is highly dependent on the identity of the fragment library used for screening. The vast majority of FBDD has centered on the use of sp(2)-rich aromatic compounds. An expanded set of fragments that possess more 3D character would provide access to a larger chemical space of fragments than those currently used. Diversity-oriented synthesis (DOS) aims to efficiently generate a set of molecules diverse in skeletal and stereochemical properties. Molecules derived from DOS have also displayed significant success in the modulation of function of various "difficult" targets. Herein, we describe the application of DOS toward the construction of a unique set of fragments containing highly sp(3)-rich skeletons for fragment-based screening. Using cheminformatic analysis, we quantified the shapes and physical properties of the new 3D fragments and compared them with a database containing known fragment-like molecules.

The role of Foxi family transcription factors in otic placode and neural crest cell development

PubMed Central

Edlund, Renée K.; Birol, Onur; Groves, Andrew K.

2015-01-01

The mammalian outer, middle and inner ears have different embryonic origins and evolved at different times in the vertebrate lineage. The outer ear is derived from first and second branchial arch ectoderm and mesoderm, the middle ear ossicles are derived from neural crest mesenchymal cells that invade the first and second branchial arches, whereas the inner ear and its associated vestibule-acoustic (VIIIth) ganglion are derived from the otic placode. In this review, we discuss recent findings in the development of these structures and describe the contributions of members of a Forkhead transcription factor family, the Foxi family to their formation. Foxi transcription factors are critical for formation of the otic placode, survival of the branchial arch neural crest, and developmental remodeling of the branchial arch ectoderm. PMID:25662269

Physical process in the coma of comet 67P derived from narrowband imaging of fragment species

NASA Astrophysics Data System (ADS)

Perez Lopez, F.; Küppers, M.; Marín-Yaseli de la Parra, J.; Besse, S.; Moissl, R.

2017-09-01

During the rendezvous of the Rosetta spacecraft with comet 67P/Churyumov-Gerasimenko, the OSIRIS scientific cameras monitored the near-nucleus gas environment in various narrow-band filters, observing various fragment species. It turned out that the excitation processes in the innermost coma are significantly different from the overall coma, as observed from the ground [1]. In particular, some of the observed emissions of fragments (daughter molecules) are created by direct dissociation of parent molecules, and in those cases the spatial distribution of the emission directly maps the distribution of parent molecules. We investigate the evolution of the brightness and distribution of the emissions over time to improve our understanding of the underlying emission mechanisms and to derive the spatial distribution of H2O and CO2. The outcome will provide constraints on the homogeneity of the cometary nucleus.

Antihypertensive effects of continuous oral administration of nattokinase and its fragments in spontaneously hypertensive rats.

PubMed

Fujita, Mitsugu; Ohnishi, Katsunori; Takaoka, Shinsaku; Ogasawara, Kazuya; Fukuyama, Ryo; Nakamuta, Hiromichi

2011-01-01

To determine whether the antihypertensive effect of nattokinase is associated with the protease activity of this enzyme, we compared nattokinase with the fragments derived from nattokinase, which possessed no protease activity, in terms of the effect on hypertension in spontaneously hypertensive rats (SHR). In the continuous oral administration test, the groups were given a basic diet alone (control), the basic diet containing nattokinase (0.2, 2.6 mg/g diet) or the basic diet containing the fragments derived from nattokinase (0.2, 0.6 mg/g diet). The group fed the basic diet containing high-dosage nattokinase (2.6 mg/g diet) showed significant reductions in systolic blood pressure (SBP), diastolic blood pressure (DBP) and plasma fibrinogen level, compared with control group and no influence on activities of renin and angiotensin-converting enzyme (ACE, EC 3.4.15.1), and plasma angiotensin II level in the renin-angiotensin system. The treatment of the basic diet containing high-dosage fragments (0.6 mg/g diet) significantly decreased SBP, DBP and plasma angiotensin II level in plasma but the treatment did not influence on plasma fibrinogen level. These results suggest that nattokinase and its fragments are different from each other in the mechanism to reduce hypertension. Nattokinase, retained its protease activity after absorbance across the intestines, may decrease blood pressure through cleavage of fibrinogen in plasma. The fragments, which absorbed as nattokinase-degradation products, prevents the elevation of plasma angiotensin II level to suppress hypertension.

Characterization of a human MSX-2 cDNA and its fragment isolated as a transformation suppressor gene against v-Ki-ras oncogene.

PubMed

Takahashi, C; Akiyama, N; Matsuzaki, T; Takai, S; Kitayama, H; Noda, M

1996-05-16

A cDNA (termed CT124) encoding a carboxyl-terminal fragment of the human homeobox protein MSX-2 was found to induce flat reversion when expressed in v-Ki-ras-transformed NIH3T3 cells. Although the expression of endogenous MSX-2 gene is low in most of the normal adult tissues examined, it is frequently activated in carcinoma-derived cell lines. Likewise, the gene is inactive in NIH3T3 cells but is transcriptionally activated after transformation by v-Ki-ras oncogene, suggesting that the intact MSX-2 may play a positive, rather than suppressive, role in cell transformation. To test this possibility, we isolated a near full-length human MSX-2 cDNA and tested its activities in two cell systems, i.e. fibroblast and myoblast. In NIH3T3 fibroblasts, although the gene by itself failed to confer a transformed phenotype, antisense MSX-2 cDNA as well as truncated CT124 cDNA interfered with the transforming activities of v-Ki-ras oncogene. In C2C12 myoblasts, MSX-2 was found to suppress MyoD gene expression, as do activated ras oncogenes, under certain culture conditions, and CT124 was found to inhibit the activities of both MSX-2 and ras in this system as well. Our findings not only suggest that CT124 may act as a dominant suppressor of MSX-2 but also raise the possibility that MSX-2 gene may be an important downstream target for the Ras signaling pathways.

Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons

PubMed Central

Young, Allison; Petros, Timothy; Karayannis, Theofanis; McKenzie Chang, Melissa; Lavado, Alfonso; Iwano, Tomohiko; Nakajima, Miho; Taniguchi, Hiroki; Huang, Z. Josh; Heintz, Nathaniel; Oliver, Guillermo; Matsuzaki, Fumio; Machold, Robert P.

2015-01-01

Neurogliaform (RELN+) and bipolar (VIP+) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been elucidated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). Interestingly, Prox1 promotes the maturation of CGE-derived interneuron subtypes through intrinsic differentiation programs that operate in tandem with extrinsically driven neuronal activity-dependent pathways. Thus Prox1 represents the first identified transcription factor specifically required for the embryonic and postnatal acquisition of CGE-derived cortical interneuron properties. SIGNIFICANCE STATEMENT Despite the recognition that 30% of GABAergic cortical interneurons originate from the caudal ganglionic eminence (CGE), to date, a specific transcriptional program that selectively regulates the development of these populations has not yet been identified. Moreover, while CGE-derived interneurons display unique patterns of tangential and radial migration and preferentially populate the superficial layers of the cortex, identification of a molecular program that controls these events is lacking. Here, we demonstrate that the homeodomain transcription factor Prox1 is expressed in postmitotic CGE-derived cortical interneuron precursors and is maintained into adulthood. We found that Prox1 function is differentially required during both embryonic and postnatal stages of development to direct the migration, differentiation, circuit integration, and maintenance programs within distinct subtypes of CGE-derived interneurons. PMID:26377473

Peptide fragments of a beta-defensin derivative with potent bactericidal activity.

PubMed

Reynolds, Natalie L; De Cecco, Martin; Taylor, Karen; Stanton, Chloe; Kilanowski, Fiona; Kalapothakis, Jason; Seo, Emily; Uhrin, Dusan; Campopiano, Dominic; Govan, John; Macmillan, Derek; Barran, Perdita; Dorin, Julia R

2010-05-01

Beta-defensins are known to be both antimicrobial and able to chemoattract various immune cells. Although the sequences of paralogous genes are not highly conserved, the core defensin structure is retained. Defb14-1C(V) has bactericidal activity similar to that of its parent peptide (murine beta-defensin Defb14) despite all but one of the canonical six cysteines being replaced with alanines. The 23-amino-acid N-terminal half of Defb14-1C(V) is a potent antimicrobial while the C-terminal half is not. Here, we use a library of peptide derivatives to demonstrate that the antimicrobial activity can be localized to a particular region. Overlapping fragments of the N-terminal region were tested for their ability to kill Gram-positive and Gram-negative bacteria. We demonstrate that the most N-terminal fragments (amino acids 1 to 10 and 6 to 17) are potent antimicrobials against Gram-negative bacteria whereas fragments based on sequence more C terminal than amino acid 13 have very poor activity against both Gram-positive and -negative types. We further test a series of N-terminal deletion peptides in both their monomeric and dimeric forms. We find that bactericidal activity is lost against both Gram types as the deletion region increases, with the point at which this occurs varying between bacterial strains. The dimeric form of the peptides is more resistant to the peptide deletions, but this is not due just to increased charge. Our results indicate that the primary sequence, together with structure, is essential in the bactericidal action of this beta-defensin derivative peptide and importantly identifies a short fragment from the peptide that is a potent bactericide.

Peptide Fragments of a β-Defensin Derivative with Potent Bactericidal Activity ▿

PubMed Central

Reynolds, Natalie L.; De Cecco, Martin; Taylor, Karen; Stanton, Chloe; Kilanowski, Fiona; Kalapothakis, Jason; Seo, Emily; Uhrin, Dusan; Campopiano, Dominic; Govan, John; Macmillan, Derek; Barran, Perdita; Dorin, Julia R.

2010-01-01

β-Defensins are known to be both antimicrobial and able to chemoattract various immune cells. Although the sequences of paralogous genes are not highly conserved, the core defensin structure is retained. Defb14-1CV has bactericidal activity similar to that of its parent peptide (murine β-defensin Defb14) despite all but one of the canonical six cysteines being replaced with alanines. The 23-amino-acid N-terminal half of Defb14-1CV is a potent antimicrobial while the C-terminal half is not. Here, we use a library of peptide derivatives to demonstrate that the antimicrobial activity can be localized to a particular region. Overlapping fragments of the N-terminal region were tested for their ability to kill Gram-positive and Gram-negative bacteria. We demonstrate that the most N-terminal fragments (amino acids 1 to 10 and 6 to 17) are potent antimicrobials against Gram-negative bacteria whereas fragments based on sequence more C terminal than amino acid 13 have very poor activity against both Gram-positive and -negative types. We further test a series of N-terminal deletion peptides in both their monomeric and dimeric forms. We find that bactericidal activity is lost against both Gram types as the deletion region increases, with the point at which this occurs varying between bacterial strains. The dimeric form of the peptides is more resistant to the peptide deletions, but this is not due just to increased charge. Our results indicate that the primary sequence, together with structure, is essential in the bactericidal action of this β-defensin derivative peptide and importantly identifies a short fragment from the peptide that is a potent bactericide. PMID:20176896

Isolation of a high-affinity Bet v 1-specific IgG-derived ScFv from a subject vaccinated with hypoallergenic Bet v 1 fragments.

PubMed

Gadermaier, E; Marth, K; Lupinek, C; Campana, R; Hofer, G; Blatt, K; Smiljkovic, D; Roder, U; Focke-Tejkl, M; Vrtala, S; Keller, W; Valent, P; Valenta, R; Flicker, S

2018-01-09

Recombinant hypoallergenic allergen derivatives have been used in clinical immunotherapy studies, and clinical efficacy seems to be related to the induction of blocking IgG antibodies recognizing the wild-type allergens. However, so far no treatment-induced IgG antibodies have been characterized. To clone, express, and characterize IgG antibodies induced by vaccination with two hypoallergenic recombinant fragments of the major birch pollen allergen, Bet v 1 in a nonallergic subject. A phage-displayed combinatorial single-chain fragment (ScFv) library was constructed from blood of the immunized subject and screened for Bet v 1-reactive antibody fragments. ScFvs were tested for specificity and cross-reactivity to native Bet v 1 and related pollen and food allergens, and epitope mapping was performed. Germline ancestor genes of the antibody were analyzed with the ImMunoGeneTics (IMGT) database. The affinity to Bet v 1 and cross-reactive allergens was determined by surface plasmon resonance measurements. The ability to inhibit patients' IgE binding to ELISA plate-bound allergens and allergen-induced basophil activation was assessed. A combinatorial ScFv library was obtained from the vaccinated donor after three injections with the Bet v 1 fragments. Despite being almost in germline configuration, ScFv (clone H3-1) reacted with high affinity to native Bet v 1 and homologous allergens, inhibited allergic patients' polyclonal IgE binding to Bet v 1, and partially suppressed allergen-induced basophil activation. Immunization with unfolded hypoallergenic allergen derivatives induces high-affinity antibodies even in nonallergic subjects which recognize the folded wild-type allergens and inhibit polyclonal IgE binding of allergic patients. © 2018 The Authors. Allergy Published by John Wiley & Sons Ltd.

Age-associated reduction of cellular spreading/mechanical force up-regulates matrix metalloproteinase-1 expression and collagen fibril fragmentation via c-Jun/AP-1 in human dermal fibroblasts.

PubMed

Qin, Zhaoping; Voorhees, John J; Fisher, Gary J; Quan, Taihao

2014-12-01

The dermal compartment of human skin is largely composed of dense collagen-rich fibrils, which provide structural and mechanical support. Skin dermal fibroblasts, the major collagen-producing cells, are interact with collagen fibrils to maintain cell spreading and mechanical force for function. A characteristic feature of aged human skin is fragmentation of collagen fibrils, which is initiated by matrix metalloproteinase 1 (MMP-1). Fragmentation impairs fibroblast attachment and thereby reduces spreading. Here, we investigated the relationship among fibroblast spreading, mechanical force, MMP-1 expression, and collagen fibril fragmentation. Reduced fibroblast spreading due to cytoskeletal disruption was associated with reduced cellular mechanical force, as determined by atomic force microscopy. These reductions substantially induced MMP-1 expression, which led to collagen fibril fragmentation and disorganization in three-dimensional collagen lattices. Constraining fibroblast size by culturing on slides coated with collagen micropatterns also significantly induced MMP-1 expression. Reduced spreading/mechanical force induced transcription factor c-Jun and its binding to a canonical AP-1 binding site in the MMP-1 proximal promoter. Blocking c-Jun function with dominant negative mutant c-Jun significantly reduced induction of MMP-1 expression in response to reduced spreading/mechanical force. Furthermore, restoration of fibroblast spreading/mechanical force led to decline of c-Jun and MMP-1 levels and eliminated collagen fibril fragmentation and disorganization. These data reveal a novel mechanism by which alteration of fibroblast shape/mechanical force regulates c-Jun/AP-1-dependent expression of MMP-1 and consequent collagen fibril fragmentation. This mechanism provides a foundation for understanding the cellular and molecular basis of age-related collagen fragmentation in human skin. © 2014 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA.

PubMed

Weiberg, Arne; Pöhler, Dirk; Morgenstern, Burkhard; Karlovsky, Petr

2008-10-13

cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation) was written in Perl. cDNA-AFLP protocols described in the literature and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each of the marking enzymes is recommended.

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

DNA methylation levels analysis in four tissues of sea cucumber Apostichopus japonicus based on fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) during aestivation.

PubMed

Zhao, Ye; Chen, Muyan; Storey, Kenneth B; Sun, Lina; Yang, Hongsheng

2015-03-01

DNA methylation plays an important role in regulating transcriptional change in response to environmental stimuli. In the present study, DNA methylation levels of tissues of the sea cucumber Apostichopus japonicus were analyzed by the fluorescence-labeled methylation-sensitive amplified polymorphism (F-MSAP) technique over three stages of the aestivation cycle. Overall, a total of 26,963 fragments were amplified including 9112 methylated fragments among four sea cucumber tissues using 18 pairs of selective primers. Results indicated an average DNA methylation level of 33.79% for A. japonicus. The incidence of DNA methylation was different across tissue types in the non-aestivation stage: intestine (30.16%), respiratory tree (27.61%), muscle (27.94%) and body wall (56.25%). Our results show that hypermethylation accompanied deep-aestivation in A. japonicus, which suggests that DNA methylation may have an important role in regulating global transcriptional suppression during aestivation. Further analysis indicated that the main DNA modification sites were focused on intestine and respiratory tree tissues and that full-methylation but not hemi-methylation levels exhibited significant increases in the deep-aestivation stage. Copyright © 2014 Elsevier Inc. All rights reserved.

Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.

PubMed

Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng

2012-08-01

A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

PubMed

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

PubMed

Yousaf, Nasim; Gould, David

2017-01-01

Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

Quantification of silkworm coactivator of MBF1 mRNA by SYBR Green I real-time RT-PCR reveals tissue- and stage-specific transcription levels.

PubMed

Li, Guang-li; Roy, Bhaskar; Li, Xing-hua; Yue, Wan-fu; Wu, Xiao-feng; Liu, Jian-mei; Zhang, Chuan-xi; Miao, Yun-gen

2009-05-01

Transcriptional coactivators play a crucial role in gene transcription and expression. Multiprotein bridging factor 1 (MBF1) is a transcriptional coactivator necessary for transcriptional activation caused by DNA-binding activators, such as FTZ-F1 and GCN4. Until now, very few studies have been reported in the silkworm. We selected the Bombyx mori because it is a model insect and acts as an economic animal for silk industry. In this study, we conducted the quantitative analysis of MBF1 mRNA in silkworm B. mori L. with actin (A3) as internal standard by means of SYBR Green I real-time RT-PCR method. The total RNA was extracted from the silk gland, epidermis, fat body, and midguts of the fifth instar B. mori larvae. The mRNA was reverse transcripted, and the cDNA fragments of MBF1 mRNA and actin gene were amplified by RT-PCR using specific primers. MBF1 mRNA expression in different tissues of silkworm B. mori L. was quantified using standardized SYBR Green I RT-PCR. The results suggested MBF1 gene was expressed in all investigated organs but highly expressed in the silk gland, showing its relation to biosynthesis of silk proteins.

Lessons from Hot Spot Analysis for Fragment-Based Drug Discovery.

PubMed

Hall, David R; Kozakov, Dima; Whitty, Adrian; Vajda, Sandor

2015-11-01

Analysis of binding energy hot spots at protein surfaces can provide crucial insights into the prospects for successful application of fragment-based drug discovery (FBDD), and whether a fragment hit can be advanced into a high-affinity, drug-like ligand. The key factor is the strength of the top ranking hot spot, and how well a given fragment complements it. We show that published data are sufficient to provide a sophisticated and quantitative understanding of how hot spots derive from a protein 3D structure, and how their strength, number, and spatial arrangement govern the potential for a surface site to bind to fragment-sized and larger ligands. This improved understanding provides important guidance for the effective application of FBDD in drug discovery. Copyright © 2015 Elsevier Ltd. All rights reserved.

Impact and explosion crater ejecta, fragment size, and velocity

NASA Technical Reports Server (NTRS)

Okeefe, J. D.; Ahrens, T. J.

1985-01-01

The present investigation had the objective to develop models for the distribution of fragments which are ejected at a given velocity for both impact and explosion cratering. It is pointed out that the results have application to the physics of planetary accretion and the origin of meteorites. The impact ejection of fine dust into the earth's atmosphere has been proposed as a mechanism for extinctions which occurred at the end of the Cretaceous. A technique is developed for determining the distribution of fragments which are ejected at a given velocity. The experimental data base for the distribution fragments in the ejecta blankets of impact, explosion, and nuclear craters, are discussed. Attention is also given to impact flow field calculations, fragmentation theory, and the applications of the derived relations.

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.

PubMed

Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A

2018-05-01

Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.

Low-energy collision-induced fragmentation of negative ions derived from ortho-, meta-, and para-hydroxyphenyl carbaldehydes, ketones, and related compounds.

PubMed

Attygalle, Athula B; Ruzicka, Josef; Varughese, Deepu; Bialecki, Jason B; Jafri, Sayed

2007-09-01

Collision-induced dissociation (CID) mass spectra of anions derived from several hydroxyphenyl carbaldehydes and ketones were recorded and mechanistically rationalized. For example, the spectrum of m/z 121 ion of deprotonated ortho-hydroxybenzaldehyde shows an intense peak at m/z 93 for a loss of carbon monoxide attributable to an ortho-effect mediated by a charge-directed heterolytic fragmentation mechanism. In contrast, the m/z 121 ion derived from meta and para isomers undergoes a charge-remote homolytic cleavage to eliminate an *H and form a distonic anion radical, which eventually loses CO to produce a peak at m/z 92. In fact, for the para isomer, this two-step homolytic mechanism is the most dominant fragmentation pathway. The spectrum of the meta isomer on the other hand, shows two predominant peaks at m/z 92 and 93 representing both homolytic and heterolytic fragmentations, respectively. (18)O-isotope-labeling studies confirmed that the oxygen in the CO molecule that is eliminated from the anion of meta-hydroxybenzaldehyde originates from either the aldehydic or the phenolic group. In contrast, anions of ortho-hydroxybenzaldehyde and 2-hydroxy-1-naphthaldehyde, both of which show two consecutive CO eliminations, specifically lose the carbonyl oxygen first, followed by that of the phenolic group. Anions from 2-hydroxyphenyl alkyl ketones lose a ketene by a hydrogen transfer predominantly from the alpha position. Interestingly, a very significant charge-remote 1,4-elimination of a H(2) molecule was observed from the anion derived from 2,4-dihydroxybenzaldehyde. For this mechanism to operate, a labile hydrogen atom should be available on the hydroxyl group adjacent to the carbaldehyde functionality.

Fv-clasp: An Artificially Designed Small Antibody Fragment with Improved Production Compatibility, Stability, and Crystallizability.

PubMed

Arimori, Takao; Kitago, Yu; Umitsu, Masataka; Fujii, Yuki; Asaki, Ryoko; Tamura-Kawakami, Keiko; Takagi, Junichi

2017-10-03

Antibody fragments are frequently used as a "crystallization chaperone" to aid structural analysis of complex macromolecules that are otherwise crystallization resistant, but conventional fragment formats have not been designed for this particular application. By fusing an anti-parallel coiled-coil structure derived from the SARAH domain of human Mst1 kinase to the variable region of an antibody, we succeeded in creating a novel chimeric antibody fragment of ∼37 kDa, termed "Fv-clasp," which exhibits excellent crystallization compatibility while maintaining the binding ability of the original IgG molecule. The "clasp" and the engineered disulfide bond at the bottom of the Fv suppressed the internal mobility of the fragment and shielded hydrophobic residues, likely contributing to the high heat stability and the crystallizability of the Fv-clasp. Finally, Fv-clasp antibodies showed superior "chaperoning" activity over conventional Fab fragments, and facilitated the structure determination of an ectodomain fragment of integrin α6β1. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of cis-elements and evaluation of upstream regulatory region of a rice anther-specific gene, OSIPP3, conferring pollen-specific expression in Oryza sativa (L.) ssp. indica.

PubMed

Manimaran, P; Raghurami Reddy, M; Bhaskar Rao, T; Mangrauthia, Satendra K; Sundaram, R M; Balachandran, S M

2015-12-01

Pollen-specific expression. Promoters comprise of various cis-regulatory elements which control development and physiology of plants by regulating gene expression. To understand the promoter specificity and also identification of functional cis-acting elements, progressive 5' deletion analysis of the promoter fragments is widely used. We have evaluated the activity of regulatory elements of 5' promoter deletion sequences of anther-specific gene OSIPP3, viz. OSIPP3-∆1 (1504 bp), OSIPP3-∆2 (968 bp), OSIPP3-∆3 (388 bp) and OSIPP3-∆4 (286 bp) through the expression of transgene GUS in rice. In silico analysis of 1504-bp sequence harboring different copy number of cis-acting regulatory elements such as POLLENLELAT52, GTGANTG10, enhancer element of LAT52 and LAT56 indicated that they were essential for high level of expression in pollen. Histochemical GUS analysis of the transgenic plants revealed that 1504- and 968-bp fragments directed GUS expression in roots and anthers, while the 388- and 286-bp fragments restricted the GUS expression to only pollen, of which 388 bp conferred strong GUS expression. Further, GUS staining analysis of different panicle development stages (P1-P6) confirmed that the GUS gene was preferentially expressed only at P6 stage (late pollen stage). The qRT-PCR analysis of GUS transcript revealed 23-fold higher expression of GUS transcript in OSIPP3-Δ1 followed by OSIPP3-Δ2 (eightfold) and OSIPP3-Δ3 (threefold) when compared to OSIPP3-Δ4. Based on our results, we proposed that among the two smaller fragments, the 388-bp upstream regulatory region could be considered as a promising candidate for pollen-specific expression of agronomically important transgenes in rice.

Identification of linker regions and domain borders of the transcription activator protein NtrC from Escherichia coli by limited proteolysis, in-gel digestion, and mass spectrometry.

PubMed

Bantscheff, M; Weiss, V; Glocker, M O

1999-08-24

We have developed a mass spectrometry based method for the identification of linker regions and domain borders in multidomain proteins. This approach combines limited proteolysis and in-gel proteolytic digestions and was applied to the determination of linkers in the transcription factor NtrC from Escherichia coli. Limited proteolysis of NtrC with thermolysin and papain revealed that initial digestion yielded two major bands in SDS-PAGE that were identified by mass spectrometry as the R-domain and the still covalently linked OC-domains. Subsequent steps in limited proteolysis afforded further cleavage of the OC-fragment into the O- and the C-domain at accessible amino acid residues. Mass spectrometric identification of the tryptic/thermolytic peptides obtained after in-gel total proteolysis of the SDS-PAGE-separated domains determined the domain borders and showed that the protease accessible linker between R- and O-domain comprised amino acids Val-131 and Gln-132 within the "Q-linker" in agreement with papain and subtilisin digestion. The region between amino acid residues Thr-389 and Gln-396 marked the hitherto unknown linker sequence that connects the O- with the C-domain. High abundances of proline-, alanine-, serine-, and glutamic acid residues were found in this linker structure (PASE-linker) of related NtrC response regulator proteins. While R- and C-domains remained stable under the applied limited proteolysis conditions, the O-domain was further truncated yielding a core fragment that comprised the sequence from Ile-140 to Arg-320. ATPase activity was lost after separation of the R-domain from the OC-fragment. However, binding of OC- and C- fragments to specific DNA was observed by characteristic band-shifts in migration retardation assays, indicating intact tertiary structures of the C-domain. The outlined strategy proved to be highly efficient and afforded lead information of tertiary structural features necessary for protein design and engineering and for structure-function studies.

Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian

The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less

Tracing neuronal circuits in transgenic animals by transneuronal control of transcription (TRACT)

PubMed Central

Huang, Ting-hao; Niesman, Peter; Arasu, Deepshika; Lee, Donghyung; De La Cruz, Aubrie L; Callejas, Antuca; Hong, Elizabeth J

2017-01-01

Understanding the computations that take place in brain circuits requires identifying how neurons in those circuits are connected to one another. We describe a technique called TRACT (TRAnsneuronal Control of Transcription) based on ligand-induced intramembrane proteolysis to reveal monosynaptic connections arising from genetically labeled neurons of interest. In this strategy, neurons expressing an artificial ligand (‘donor’ neurons) bind to and activate a genetically-engineered artificial receptor on their synaptic partners (‘receiver’ neurons). Upon ligand-receptor binding at synapses the receptor is cleaved in its transmembrane domain and releases a protein fragment that activates transcription in the synaptic partners. Using TRACT in Drosophila we have confirmed the connectivity between olfactory receptor neurons and their postsynaptic targets, and have discovered potential new connections between neurons in the circadian circuit. Our results demonstrate that the TRACT method can be used to investigate the connectivity of neuronal circuits in the brain. PMID:29231171

Expression and regulation of estrogen-converting enzymes in ectopic human endometrial tissue.

PubMed

Fechner, Sabine; Husen, Bettina; Thole, Hubert; Schmidt, Markus; Gashaw, Isabella; Kimmig, Rainer; Winterhager, Elke; Grümmer, Ruth

2007-10-01

To investigate the regulation of estrogen-converting enzymes in human ectopic endometrial tissue. Animal study. Academic medical center. Sixty female nude mice with implanted human endometrial tissue. Twenty-two premenopausal women undergoing endometrial biopsy or hysterectomy. Human endometrial tissue was implanted into the peritoneal cavity of nude mice, and the effect of therapeutic drugs on transcription of steroid receptors and estrogen-converting enzymes was analyzed. Transcript levels of steroid hormone receptors, 17beta-hydroxysteroid dehydrogenase type 1 and 2, aromatase, and steroid sulfatase as well as proliferation rate were analyzed in the human ectopic endometrial tissue. Steroid receptors and estrogen-converting enzymes were expressed in the ectopic human endometrial fragments. Application of medroxyprogesterone acetate, dydrogesterone, danazol, and the aromatase inhibitor finrozole significantly inhibited aromatase transcription. In addition, danazol caused a significant decrease in transcription of steroid sulfatase, and finrozole, of 17beta-hydroxysteroid dehydrogenase type 1 in parallel to a decrease in proliferation rate in the ectopic human endometrial tissue. Pharmacological regulation of transcription of estrogen-converting enzymes in human endometrium cultured in nude mice may help to develop new therapeutic concepts based on local regulation of estrogen metabolism in endometriosis.

Functional analysis of the promoter of the molt-inhibiting hormone (mih) gene in mud crab Scylla paramamosain.

PubMed

Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping

2018-04-01

In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.

Defining the microbial transcriptional response to colitis through integrated host and microbiome profiling

PubMed Central

Ilott, Nicholas Edward; Bollrath, Julia; Danne, Camille; Schiering, Chris; Shale, Matthew; Adelmann, Krista; Krausgruber, Thomas; Heger, Andreas; Sims, David; Powrie, Fiona

2016-01-01

The gut microbiome is significantly altered in inflammatory bowel diseases, but the basis of these changes is not well understood. We have combined metagenomic and metatranscriptomic profiling of the gut microbiome to assess modifications to both bacterial community structure and transcriptional activity in a mouse model of colitis. By using transcriptomic analysis of colonic tissue and luminal RNA derived from the host, we have also characterised how host transcription relates to the microbial transcriptional response in inflammation. In colitis, increased abundance and transcription of diverse microbial gene families involved in responses to nutrient deprivation, antimicrobial peptide production and oxidative stress support an adaptation of multiple commensal genera to withstand a diverse set of environmental stressors in the inflammatory environment. These data are supported by a transcriptional signature of activated macrophages and granulocytes in the gut lumen during colitis, a signature that includes the transcription of the key antimicrobial genes S100a8 and S100a9 (calprotectin). Genes involved in microbial resistance to oxidative stress, including Dps/ferritin, Fe-dependent peroxidase and glutathione S-transferase were identified as changing to a greater extent at the level of transcription than would be predicted by DNA abundance changes, implicating a role for increased oxygen tension and/or host-derived reactive oxygen species in driving transcriptional changes in commensal microbes. PMID:27003245

The effect of chemical carcinogenesis on rat glutathione S-transferase P1 gene transcriptional regulation.

PubMed

Liu, D; Liao, M; Zuo, J; Henner, W D; Fan, F

2001-03-01

To investigate mechanisms of rat glutathione S-transferase P1 gene (rGSTP1) expression regulation during chemical carcinogenesis. we studied enhancer elements located in the region between -2.5 kb to -2.2 kb. The region was upstream from the start site of transcription and was divided into two major fragments, GPEI and GPEII. The GPEII fragment was further divided into two smaller fragments, GPEII- I and GPEII-2. Using a luciferase reporter system, we identified a strong enhancer of GPEI and a weak enhancer of GPEII in HeLa and a rat hepatoma cell line CBRH79 19 cell. The enhancer of GPEII was located within the GPEII-I region. Chemical stimulation by glycidyl methatylate (GMA) and phorbol 12-o-tetradecanoate 13-acetate (TPA) analysis revealed that induction of rGSTP1 expression was mainly through GPEI. Although H2O2 could enhance GPEII enhancer activity, the enhancement is not mediated by the NF-kappaB factor that bound the NF-kappaB site in GPEII. Using electrophoretic mobility shift assays (EMSA) and the UV cross-linking assays, we found that HeLa and CBRH7919 cells had proteins that specifically bound GPEI core sequence and a 64 kDa protein that interacted with GPEII-1. The cells from normal rat liver did not express the binding proteins. Therefore, the trans-acting factors seem to be closely related to GPEI, GPEII enhancer activities and may play an important role in high expression of rGSTPI gene.

Universal odd-even staggering in isotopic fragmentation and spallation cross sections of neutron-rich fragments

NASA Astrophysics Data System (ADS)

Mei, B.; Tu, X. L.; Wang, M.

2018-04-01

An evident odd-even staggering (OES) in fragment cross sections has been experimentally observed in many fragmentation and spallation reactions. However, quantitative comparisons of this OES effect in different reaction systems are still scarce for neutron-rich nuclei near the neutron drip line. By employing a third-order difference formula, the magnitudes of this OES in extensive experimental cross sections are systematically investigated for many neutron-rich nuclei with (N -Z ) from 1 to 23 over a broad range of atomic numbers (Z ≈3 -50 ). A comparison of these magnitude values extracted from fragment cross sections measured in different fragmentation and spallation reactions with a large variety of projectile-target combinations over a wide energy range reveals that the OES magnitude is almost independent of the projectile-target combinations and the projectile energy. The weighted average of these OES magnitudes derived from cross sections accurately measured in different reaction systems is adopted as the evaluation value of the OES magnitude. These evaluated OES magnitudes are recommended to be used in fragmentation and spallation models to improve their predictions for fragment cross sections.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Syed, M. Bukhari; Blum, J.; Jansson, K. Wahlberg

Previous work on protoplanetary dust growth shows a halt at centimeter sizes owing to the occurrence of bouncing at velocities of ≳0.1 m s{sup −1} and fragmentation at velocities ≳1 m s{sup −1}. To overcome these barriers, spatial concentration of centimeter-sized dust pebbles and subsequent gravitational collapse have been proposed. However, numerical investigations have shown that dust aggregates may undergo fragmentation during the gravitational collapse phase. This fragmentation in turn changes the size distribution of the solids and thus must be taken into account in order to understand the properties of the planetesimals that form. To explore the fate of dustmore » pebbles undergoing fragmenting collisions, we conducted laboratory experiments on dust-aggregate collisions with a focus on establishing a collision model for this stage of planetesimal formation. In our experiments, we analyzed collisions of dust aggregates with masses between 0.7 and 91 g mass ratios between target and projectile from 1 to 126 at a fixed porosity of 65%, within the velocity range of 1.5–8.7 m s{sup −1}, at low atmospheric pressure of ∼10{sup −3} mbar, and in free-fall conditions. We derived the mass of the largest fragment, the fragment size/mass distribution, and the efficiency of mass transfer as a function of collision velocity and projectile/target aggregate size. Moreover, we give recipes for an easy-to-use fragmentation and mass-transfer model for further use in modeling work. In a companion paper, we use the experimental findings and the derived dust-aggregate collision model to investigate the fate of dust pebbles during gravitational collapse.« less

In vivo protein stabilization based on fragment complementation and a split GFP system.

PubMed

Lindman, Stina; Hernandez-Garcia, Armando; Szczepankiewicz, Olga; Frohm, Birgitta; Linse, Sara

2010-11-16

Protein stabilization was achieved through in vivo screening based on the thermodynamic linkage between protein folding and fragment complementation. The split GFP system was found suitable to derive protein variants with enhanced stability due to the correlation between effects of mutations on the stability of the intact chain and the effects of the same mutations on the affinity between fragments of the chain. PGB1 mutants with higher affinity between fragments 1 to 40 and 41 to 56 were obtained by in vivo screening of a library of the 1 to 40 fragments against wild-type 41 to 56 fragments. Colonies were ranked based on the intensity of green fluorescence emerging from assembly and folding of the fused GFP fragments. The DNA from the brightest fluorescent colonies was sequenced, and intact mutant PGB1s corresponding to the top three sequences were expressed, purified, and analyzed for stability toward thermal denaturation. The protein sequence derived from the top fluorescent colony was found to yield a 12 °C increase in the thermal denaturation midpoint and a free energy of stabilization of -8.7 kJ/mol at 25 °C. The stability rank order of the three mutant proteins follows the fluorescence rank order in the split GFP system. The variants are stabilized through increased hydrophobic effect, which raises the free energy of the unfolded more than the folded state; as well as substitutions, which lower the free energy of the folded more than the unfolded state; optimized van der Waals interactions; helix stabilization; improved hydrogen bonding network; and reduced electrostatic repulsion in the folded state.

Triamines and their derivatives as bifunctional chelating agents

DOEpatents

Troutner, David E.; John, Christy S.; Pillai, Maroor R. A.

1992-03-31

A group of functionalized triamine chelants and their derivatives that form complexes with radioactive metal ions are disclosed. The complexes can be covalently attached to a protein or an antibody or antibody fragment and used for therapeutic and/or diagnostic purposes.

Genetic study of the functional organization of the colicin E1 molecule.

PubMed Central

Suit, J L; Fan, M L; Kayalar, C; Luria, S E

1985-01-01

Colicin E1 fragments obtained by genetic manipulations of the ColE1 plasmid were tested for bactericidal activity, binding to bacterial cells, and reactions with a series of anticolicin monoclonal antibodies. Two of the fragments were also tested for ability to form channels in liposomal vesicles. The results are in agreement with studies from chemically and enzymatically derived colicin fragments, assigning the receptor binding activity to the central part of the molecule and the killing activity to a region near the carboxyl terminus. PMID:2579061

Generation of single domain antibody fragments derived from camelids and generation of manifold constructs.

PubMed

Vincke, Cécile; Gutiérrez, Carlos; Wernery, Ulrich; Devoogdt, Nick; Hassanzadeh-Ghassabeh, Gholamreza; Muyldermans, Serge

2012-01-01

Immunizing a camelid (camels and llamas) with soluble, properly folded proteins raises an affinity-matured immune response in the unique camelid heavy-chain only antibodies (HCAbs). The peripheral blood lymphocytes of the immunized animal are used to clone the antigen-binding antibody fragment from the HCAbs in a phage display vector. A representative aliquot of the library of these antigen-binding fragments is used to retrieve single domain antigen-specific binders by successive rounds of panning. These single domain antibody fragments are cloned in tandem to generate manifold constructs (bivalent, biparatopic or bispecific constructs) to increase their functional affinity, to increase specificity, or to connect two independent antigen molecules.

Renormalization of the fragmentation equation: Exact self-similar solutions and turbulent cascades

NASA Astrophysics Data System (ADS)

Saveliev, V. L.; Gorokhovski, M. A.

2012-12-01

Using an approach developed earlier for renormalization of the Boltzmann collision integral [Saveliev and Nanbu, Phys. Rev. E1539-375510.1103/PhysRevE.65.051205 65, 051205 (2002)], we derive an exact divergence form for the fragmentation operator. Then we reduce the fragmentation equation to the continuity equation in size space, with the flux given explicitly. This allows us to obtain self-similar solutions and to find the integral of motion for these solutions (we call it the bare flux). We show how these solutions can be applied as a description of cascade processes in three- and two-dimensional turbulence. We also suggested an empirical cascade model of impact fragmentation of brittle materials.

In vitro DNA fragmentation of mitochondrial DNA caused by single-stranded breakage related to macroplasmodial senescence of the true slime mold, Physarum polycephalum.

PubMed

Abe, T; Takano, H; Sasaki, N; Mori, K; Kawano, S

2000-02-01

We found that mitochondrial DNA (mtDNA) isolated from Physarum polycephalum fragmented itself in weak ionic solutions. The mtDNA was dissolved in STE (saline Tris-EDTA: 150 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA), TE (10 mM Tris-HCl, 1 mM EDTA) and DW, and then electrophoresed in an agarose gel. The intact 86-kbp mtDNA band was seen in STE, but several novel bands appeared in TE and DW. In TE, two discrete bands appeared at 6.7-kbp (alpha-band) and 5.0-kbp (beta-band), whereas at least 17 discrete bands were observed in distilled water (DW). These fragmentation patterns were not stoichiometric, as seen when using restriction endonucleases, but were clearly different from the degradation of DNA caused by a physical shearing force or a contaminating nuclease. In this paper, we characterize this in vitro fragmentation of mtDNA from P. polycephalum. We located 19 fragments, including the alpha and beta fragments, on a mtDNA restriction map, and demonstrated that these cleavage sites were S1 nuclease-sensitive regions, which are single-stranded DNA regions such as nicks and gaps in the mtDNA. The alpha and beta fragments are derived from the region encoding ribosomal RNAs (rRNAs) and the ATP synthase (atpA) gene, while the other 17 fragments are not derived from any specific region, but the cleavage sites are located throughout the mtDNA molecule. In P. polycephalum, it is well known that the growth rate of macroplasmodia decreases with aging. Equal amounts of mtDNA from juvenile and aged macroplasmodia were electrophoresed and the frequency of the beta fragment in each sample was measured. The ratio of the beta band to the total signal including background was estimated to be 3.3-4.0% in juvenile macroplasmodia, whereas it increased to 8.3-28.2% in aged macroplasmodia. This result suggests that the in vitro fragmentation of mtDNA is associated with macroplasmodial senescence. The single-stranded breakage of mtDNA of P. polycephalum may accumulate with age.

A binary search approach to whole-genome data analysis.

PubMed

Brodsky, Leonid; Kogan, Simon; Benjacob, Eshel; Nevo, Eviatar

2010-09-28

A sequence analysis-oriented binary search-like algorithm was transformed to a sensitive and accurate analysis tool for processing whole-genome data. The advantage of the algorithm over previous methods is its ability to detect the margins of both short and long genome fragments, enriched by up-regulated signals, at equal accuracy. The score of an enriched genome fragment reflects the difference between the actual concentration of up-regulated signals in the fragment and the chromosome signal baseline. The "divide-and-conquer"-type algorithm detects a series of nonintersecting fragments of various lengths with locally optimal scores. The procedure is applied to detected fragments in a nested manner by recalculating the lower-than-baseline signals in the chromosome. The algorithm was applied to simulated whole-genome data, and its sensitivity/specificity were compared with those of several alternative algorithms. The algorithm was also tested with four biological tiling array datasets comprising Arabidopsis (i) expression and (ii) histone 3 lysine 27 trimethylation CHIP-on-chip datasets; Saccharomyces cerevisiae (iii) spliced intron data and (iv) chromatin remodeling factor binding sites. The analyses' results demonstrate the power of the algorithm in identifying both the short up-regulated fragments (such as exons and transcription factor binding sites) and the long--even moderately up-regulated zones--at their precise genome margins. The algorithm generates an accurate whole-genome landscape that could be used for cross-comparison of signals across the same genome in evolutionary and general genomic studies.

[Preliminary analysis of retinal gene expression profile of diabetic rat].

PubMed

Mei, Yan; Zhou, Hong-ying; Xiang, Tao; Lu, You-guang; Li, Ai-dong; Tang, En-jie; Yang, Hui-jun

2005-10-01

Establishing the retinal gene expression profiles of non-diabetic rat and diabetic rat and comparing the profiles in order to analyze the possible genes related with diabetic retinopathy. The whole retinal transcriptional fragments of non-diabetic rat and 8-week diabetic rat were obtained by restriction fragments differential display-PCR (RFDD-PCR). Bioinformatic analysis of retinal gene expression was performed using soft wares, including Fragment Analysis. After comparison of the expression profiles, the related gene fragments of diabetic retinopathy were initially selected as the target gene of further approach. A total of 3639 significant fragments were obtained. By means of more than 3-fold contrast of fluorescent intensity as the differential expression standard, the authors got 840 differential fragments, accounting for 23.08% of the expressed numbers and including 5 visual related genes, 13 excitatory neruotransmitter genes and 3 inhibitory neurotransmitter genes. At the 8th week, the expression of Rhodopsin kinase, beta-arrestin, Phosducinìrod photoreceptor cGMP-gated channel and Rpe65 as well as iGlu R1-4 were down-regulated. mGluRs and GABA-Rs were all up-regulated, whereas the expression of GlyR was unchanged. These results prompt again that the changes in retinal nervous layer of rat have occurred at an early stage of diabetes. The genes expression pattern of visual related genes and excitatory and inhibitory neurotransmitters in rat diabetic retina have been involved in neuro-dysfunctions of diabetic retina.

Genetics in methylotrophic bacteria: Appendix. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lidstrom, M.E.

This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less

Identification of Primary Transcriptional Regulation of Cell Cycle-Regulated Genes upon DNA Damage

PubMed Central

Zhou, Tong; Chou, Jeff; Mullen, Thomas E.; Elkon, Rani; Zhou, Yingchun; Simpson, Dennis A.; Bushel, Pierre R.; Paules, Richard S.; Lobenhofer, Edward K.; Hurban, Patrick; Kaufmann, William K.

2007-01-01

The changes in global gene expression in response to DNA damage may derive from either direct induction or repression by transcriptional regulation or indirectly by synchronization of cells to specific cell cycle phases, such as G1 or G2. We developed a model that successfully estimated the expression levels of >400 cell cycle-regulated genes in normal human fibroblasts based on the proportions of cells in each phase of the cell cycle. By isolating effects on the gene expression associated with the cell cycle phase redistribution after genotoxin treatment, the direct transcriptional target genes were distinguished from genes for which expression changed secondary to cell synchronization. Application of this model to ionizing radiation (IR)-treated normal human fibroblasts identified 150 of 406 cycle-regulated genes as putative direct transcriptional targets of IR-induced DNA damage. Changes in expression of these genes after IR treatment derived from both direct transcriptional regulation and cell cycle synchronization. PMID:17404513

Heterologous expression of the Phycomyces blakesleeanus phytoene dehydrogenase gene (carB) in Mucor circinelloides.

PubMed

Ruiz-Hidalgo, M J; Eslava, A P; Alvarez, M I; Benito, E P

1999-11-01

A phytoene dehydrogenase-deficient mutant of Mucor circinelloides accumulating only phytoene was transformed with the gene encoding the corresponding enzyme (carB gene) of Phycomyces blakesleeanus. Carotenoids derived from phytoene were detected in the transformants showing that the P. blakesleeanus carB gene complements the M. circinelloides carB mutation. These newly formed carotenoids accumulated in low quantities, indicating that functional complementation was poor. carB mRNA molecules correctly transcribed were detected in the transformants, but they represented a small proportion of the total population of carB-derived mRNAs, mostly constituted by truncated transcripts and by transcripts longer than the transcript that is functional in Phycomyces. These results showed that the P. blakesleeanus carB gene was expressed in M. circinelloides and suggested that the poor complementation observed was owing, at least in part, to the lack of specificity in the recognition of the transcription initiation and termination signals of the P. blakesleeanus carB gene by the M. circinelloides transcriptional machinery.

Analytic second derivative of the energy for density functional theory based on the three-body fragment molecular orbital method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakata, Hiroya, E-mail: nakata.h.ab@m.titech.ac.jp; RIKEN, Research Cluster for Innovation, Nakamura Lab, 2-1 Hirosawa, Wako, Saitama 351-0198; Japan Society for the Promotion of Science, Kojimachi Business Center Building, 5-3-1 Kojimachi, Chiyoda-ku, Tokyo 102-0083

2015-03-28

Analytic second derivatives of the energy with respect to nuclear coordinates have been developed for spin restricted density functional theory (DFT) based on the fragment molecular orbital method (FMO). The derivations were carried out for the three-body expansion (FMO3), and the two-body expressions can be obtained by neglecting the three-body corrections. Also, the restricted Hartree-Fock (RHF) Hessian for FMO3 can be obtained by neglecting the density-functional related terms. In both the FMO-RHF and FMO-DFT Hessians, certain terms with small magnitudes are neglected for computational efficiency. The accuracy of the FMO-DFT Hessian in terms of the Gibbs free energy is evaluatedmore » for a set of polypeptides and water clusters and found to be within 1 kcal/mol of the corresponding full (non-fragmented) ab initio calculation. The FMO-DFT method is also applied to transition states in S{sub N}2 reactions and for the computation of the IR and Raman spectra of a small Trp-cage protein (PDB: 1L2Y). Some computational timing analysis is also presented.« less

New sulfurated derivatives of cinnamic acids and rosmaricine as inhibitors of STAT3 and NF-κB transcription factors.

PubMed

Gabriele, Elena; Brambilla, Dario; Ricci, Chiara; Regazzoni, Luca; Taguchi, Kyoko; Ferri, Nicola; Asai, Akira; Sparatore, Anna

2017-12-01

A set of new sulfurated drug hybrids, mainly derived from caffeic and ferulic acids and rosmaricine, has been synthesized and their ability to inhibit both STAT3 and NF-κB transcription factors have been evaluated. Results showed that most of the new hybrid compounds were able to strongly and selectively bind to STAT3, whereas the parent drugs were devoid of this ability at the tested concentrations. Some of them were also able to inhibit the NF-κB transcriptional activity in HCT-116 cell line and inhibited HCT-116 cell proliferation in vitro with IC 50 in micromolar range, thus suggesting a potential anticancer activity. Taken together, our study described the identification of new derivatives with dual STAT3/NF-κB inhibitory activity, which may represent hit compounds for developing multi-target anticancer agents.

[Polymorphism among RFL-PPR homologs in sunflower (Helianthus annuus L.) lines with varying ability for the suppression of the cytoplasmic male sterility phenotype].

PubMed

Anisimova, I N; Alpatieva, N V; Rozhkova, V T; Kuznetsova, E B; Pinaev, A G; Gavrilova, V A

2014-07-01

A complex comparative genetic approach was used for the investigation of the structural and functional diversity of genes for the restoration of sunflower pollen fertility. It includes (i) hybridological analysis; (ii) analysis of polymorphism among EST fragments.homologous to the known Rf genes that contain repeated motives of 35 amino acids (RFL-PPR); (iii) the development of molecular markers. Monogenic segregation in three interline cross combinations and the results of molecular marker analysis confirmed the allelic differences of parental lines in the Mendelian locus for CMS PET1 pollen fertility restoration. Introns were found in two RFL-PPR fragments. Two allelic variants of the QHL12D20 fragment were detected among the sixty lines of the sunflower genetic collection. An intron of QHL12D20 fragment was homologous to an intron of the AHBP-1B gene; the product of this gene-has a similarity with the transcription factor of the bZIP-family of Arabidopsis. A relationship between the QHL12D20 polymorphism and the functional state of the Rfl locus was revealed.

Pyrin gene and mutants thereof, which cause familial Mediterranean fever

DOEpatents

Kastner, Daniel L [Bethesda, MD; Aksentijevichh, Ivona [Bethesda, MD; Centola, Michael [Tacoma Park, MD; Deng, Zuoming [Gaithersburg, MD; Sood, Ramen [Rockville, MD; Collins, Francis S [Rockville, MD; Blake, Trevor [Laytonsville, MD; Liu, P Paul [Ellicott City, MD; Fischel-Ghodsian, Nathan [Los Angeles, CA; Gumucio, Deborah L [Ann Arbor, MI; Richards, Robert I [North Adelaide, AU; Ricke, Darrell O [San Diego, CA; Doggett, Norman A [Santa Cruz, NM; Pras, Mordechai [Tel-Hashomer, IL

2003-09-30

The invention provides the nucleic acid sequence encoding the protein associated with familial Mediterranean fever (FMF). The cDNA sequence is designated as MEFV. The invention is also directed towards fragments of the DNA sequence, as well as the corresponding sequence for the RNA transcript and fragments thereof. Another aspect of the invention provides the amino acid sequence for a protein (pyrin) associated with FMF. The invention is directed towards both the full length amino acid sequence, fusion proteins containing the amino acid sequence and fragments thereof. The invention is also directed towards mutants of the nucleic acid and amino acid sequences associated with FMF. In particular, the invention discloses three missense mutations, clustered in within about 40 to 50 amino acids, in the highly conserved rfp (B30.2) domain at the C-terminal of the protein. These mutants include M6801, M694V, K695R, and V726A. Additionally, the invention includes methods for diagnosing a patient at risk for having FMF and kits therefor.

Extracellular vesicle-mediated transfer of processed and functional RNY5 RNA

PubMed Central

Chakrabortty, Sudipto K.; Prakash, Ashwin; Nechooshtan, Gal; Hearn, Stephen; Gingeras, Thomas R.

2015-01-01

Extracellular vesicles (EVs) have been proposed as a means to promote intercellular communication. We show that when human primary cells are exposed to cancer cell EVs, rapid cell death of the primary cells is observed, while cancer cells treated with primary or cancer cell EVs do not display this response. The active agents that trigger cell death are 29- to 31-nucleotide (nt) or 22- to 23-nt processed fragments of an 83-nt primary transcript of the human RNY5 gene that are highly likely to be formed within the EVs. Primary cells treated with either cancer cell EVs, deproteinized total RNA from either primary or cancer cell EVs, or synthetic versions of 31- and 23-nt fragments trigger rapid cell death in a dose-dependent manner. The transfer of processed RNY5 fragments through EVs may reflect a novel strategy used by cancer cells toward the establishment of a favorable microenvironment for their proliferation and invasion. PMID:26392588

Genomic structure and chromosomal mapping of the human CD22 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilson, G.L.; Kozlow, E.; Kehrl, J.H.

1993-06-01

The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less

Levels of circulating MMP-7 degraded elastin are elevated in pulmonary disorders.

PubMed

Kristensen, J H; Larsen, L; Dasgupta, B; Brodmerkel, C; Curran, M; Karsdal, M A; Sand, J M B; Willumsen, N; Knox, A J; Bolton, C E; Johnson, S R; Hägglund, P; Svensson, B; Leeming, D J

2015-11-01

Elastin is a signature protein of the lungs. Matrix metalloproteinase-7 (MMP-7) is important in lung defence mechanisms and degrades elastin. However, MMP-7 activity in regard to elastin degradation has never been quantified serologically in patients with lung diseases. An assay for the quantification of MMP-7 generated elastin fragments (ELM7) was therefore developed to investigate MMP-7 derived elastin degradation in pulmonary disorders such as idiopathic pulmonary fibrosis (IPF) and lung cancer. Monoclonal antibodies (mABs) were raised against eight carefully selected MMP-7 cleavage sites on elastin. After characterisation and validation of the mABs, one mAB targeting the ELM7 fragment was chosen. ELM7 fragment levels were assessed in serum samples from patients diagnosed with IPF (n=123, baseline samples, CTgov reg. NCT00786201), and lung cancer (n=40) and compared with age- and sex-matched controls. The ELM7 assay was specific towards in vitro MMP-7 degraded elastin and the ELM7 neoepitope but not towards other MMP-7 derived elastin fragments. Serum ELM7 levels were significantly increased in IPF (113%, p<0.0001) and lung cancer (96%, p<0.0001) compared to matched controls. MMP-7-generated elastin fragments can be quantified in serum and may reflect pathological lung tissue turnover in several important lung diseases. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Metal nanoparticles in diesel exhaust derived by in-cylinder melting of detached engine fragments

NASA Astrophysics Data System (ADS)

Liati, Anthi; Pandurangi, Sushant Sunil; Boulouchos, Konstantinos; Schreiber, Daniel; Arroyo Rojas Dasilva, Yadira

2015-01-01

A wide range of environmental and health effects are linked to combustion-generated pollutants related to traffic. Nanoparticles, in particular, are a major concern for humans since they can be inhaled and have potentially toxic effects. The variability and sources of combustion-related nanoparticle pollutants remain inadequately investigated. Here we report the presence of ca. 5-100 nm large Fe3O4 nanoparticles, in form of agglomerates, in diesel exhaust. The mode of occurrence of these nanoparticles, in combination with their chemical composition matching that of steel indicate that they derive by melting of engine fragments in the combustion chamber and subsequent crystallization during cooling. To evaluate this hypothesis, we applied CFD simulations of material transport in the cylinder of a diesel engine, assuming detachment of steel fragments from various sites of the cylinder. The CFD results show that fragments ≤20 μm in size dislodged from the piston surface or from the fuel nozzle interior can be indeed transported to such hot areas of the combustion chamber where they can melt. The simulation results concur with the experimental observations and point out that metal nanoparticle formation by in-cylinder melting of engine fragments can occur in diesel engines. The present study proposes a hitherto neglected formation mechanism of metal nanoparticle emissions from internal combustion engines raising possible environmental and health concerns, especially in urban areas.

p53-mediated inhibition of angiogenesis through up-regulation of a collagen prolyl hydroxylase.

PubMed

Teodoro, Jose G; Parker, Albert E; Zhu, Xiaochun; Green, Michael R

2006-08-18

Recent evidence suggests that antiangiogenic therapy is sensitive to p53 status in tumors, implicating a role for p53 in the regulation of angiogenesis. Here we show that p53 transcriptionally activates the alpha(II) collagen prolyl-4-hydroxylase [alpha(II)PH] gene, resulting in the extracellular release of antiangiogenic fragments of collagen type 4 and 18. Conditioned media from cells ectopically expressing either p53 or alpha(II)PH selectively inhibited growth of primary human endothelial cells. When expressed intracellularly or exogenously delivered, alpha(II)PH significantly inhibited tumor growth in mice. Our results reveal a genetic and biochemical linkage between the p53 tumor suppressor pathway and the synthesis of antiangiogenic collagen fragments.

Triamines and their derivatives as bifunctional chelating agents

DOEpatents

Troutner, D.E.; John, C.S.; Pillai, M.R.A.

1992-03-31

A group of functionalized triamine chelants and their derivatives that form complexes with radioactive metal ions are disclosed. The complexes can be covalently attached to a protein or an antibody or antibody fragment and used for therapeutic and/or diagnostic purposes. No Drawings

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2014-04-01

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

2011-06-07

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Nucleic acid encoding a self-assembling split-fluorescent protein system

DOEpatents

Waldo, Geoffrey S.; Cabantous, Stephanie

2015-07-14

The invention provides a protein labeling and detection system based on self-complementing fragments of fluorescent and chromophoric proteins. The system of the invention is exemplified with various combinations of self-complementing fragments derived from Aequorea victoria Green Fluorescent Protein (GFP), which are used to detect and quantify protein solubility in multiple assay formats, both in vitro and in vivo.

Development of SCAR Markers for the DNA-Based Detection of the Asian Long-Horned Beetle; Anoplophora glabripennis (Motschulsky)

Treesearch

Damodar R. Kethidi; David B. Roden; Tim R. Ladd; Peter J. Krell; Arthur Ratnakaran; Qili Feng

2003-01-01

DNA markers were identified for the molecular detection of the Asian long-horned beetle (ALB), Anoplophora glabripennis (Mot.), based on sequence charaterized amplified regions (SCARS) derived from random amplified polymorphic DNA (RAPD) fragments. A 2,740-bp DNA fragment that was present only in ALB and not in other Cerambycids was identified after...

Application of the fragment molecular orbital method analysis to fragment-based drug discovery of BET (bromodomain and extra-terminal proteins) inhibitors.

PubMed

Ozawa, Motoyasu; Ozawa, Tomonaga; Ueda, Kazuyoshi

2017-06-01

The molecular interactions of inhibitors of bromodomains (BRDs) were investigated. BRDs are protein interaction modules that recognizing ε-N-acetyl-lysine (εAc-Lys) motifs found in histone tails and are promising protein-protein interaction (PPI) targets. First, we analyzed a peptide ligand containing εAc-Lys to evaluate native PPIs. We then analyzed tetrahydroquinazoline-6-yl-benzensulfonamide derivatives found by fragment-based drug design (FBDD) and examined their interactions with the protein compared with the peptide ligand in terms of the inter-fragment interaction energy. In addition, we analyzed benzodiazepine derivatives that are high-affinity ligands for BRDs and examined differences in the CH/π interactions of the amino acid residues. We further surveyed changes in the charges of the amino acid residues among individual ligands, performed pair interaction energy decomposition analysis and estimated the water profile within the ligand binding site. Thus, useful insights for drug design were provided. Through these analyses and considerations, we show that the FMO method is a useful drug design tool to evaluate the process of FBDD and to explore PPI inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.

Endoscopic Stone Measurement During Ureteroscopy.

PubMed

Ludwig, Wesley W; Lim, Sunghwan; Stoianovici, Dan; Matlaga, Brian R

2018-01-01

Currently, stone size cannot be accurately measured while performing flexible ureteroscopy (URS). We developed novel software for ureteroscopic, stone size measurement, and then evaluated its performance. A novel application capable of measuring stone fragment size, based on the known distance of the basket tip in the ureteroscope's visual field, was designed and calibrated in a laboratory setting. Complete URS procedures were recorded and 30 stone fragments were extracted and measured using digital calipers. The novel software program was applied to the recorded URS footage to obtain ureteroscope-derived stone size measurements. These ureteroscope-derived measurements were then compared with the actual-measured fragment size. The median longitudinal and transversal errors were 0.14 mm (95% confidence interval [CI] 0.1, 0.18) and 0.09 mm (95% CI 0.02, 0.15), respectively. The overall software accuracy and precision were 0.17 and 0.15 mm, respectively. The longitudinal and transversal measurements obtained by the software and digital calipers were highly correlated (r = 0.97 and 0.93). Neither stone size nor stone type was correlated with error measurements. This novel method and software reliably measured stone fragment size during URS. The software ultimately has the potential to make URS safer and more efficient.

A detailed mechanistic fragmentation analysis of methamphetamine and select regioisomers by GC/MS.

PubMed

Sachs, Sandra B; Woo, Francis

2007-03-01

A novel ring-substituted methamphetamine regioisomer, N,alpha,4-trimethyl phenmethylamine, was synthesized in order to study the validity of proposed structures for various mass spectrometry (MS)-derived peaks in a methamphetamine fragmentation pattern. While other research efforts have studied aspects of methamphetamine in detail, a full fragmentation study has not been reported previously. In addition to showing molecular structures represented by fragment peaks, mechanisms for selected processes are detailed. An empirically derived procedure to easily determine by simple spectral peak pattern recognition the geometry of dimethyl- or ethyl-substituted immonium ions (RRC = N+ RR) where m/z = 58 is outlined. These results are platform independent for electron ionization (EI) instruments, but have also proven to be helpful in explaining spectral peaks observed in spectra from ion trap systems. The spectrum for the synthesized methamphetamine regioisomer was accurately predicted using this methodology. While this approach is useful in some casework, the converse may be more useful: when an unexpected or unusual peak pattern arises in a spectrum, being able to analyze it to determine the structure of the molecule. This paper gives an analyst the means to begin such retro-synthetic analyses.

De novo design of molecular architectures by evolutionary assembly of drug-derived building blocks.

PubMed

Schneider, G; Lee, M L; Stahl, M; Schneider, P

2000-07-01

An evolutionary algorithm was developed for fragment-based de novo design of molecules (TOPAS, TOPology-Assigning System). This stochastic method aims at generating a novel molecular structure mimicking a template structure. A set of approximately 25,000 fragment structures serves as the building block supply, which were obtained by a straightforward fragmentation procedure applied to 36,000 known drugs. Eleven reaction schemes were implemented for both fragmentation and building block assembly. This combination of drug-derived building blocks and a restricted set of reaction schemes proved to be a key for the automatic development of novel, synthetically tractable structures. In a cyclic optimization process, molecular architectures were generated from a parent structure by virtual synthesis, and the best structure of a generation was selected as the parent for the subsequent TOPAS cycle. Similarity measures were used to define 'fitness', based on 2D-structural similarity or topological pharmacophore distance between the template molecule and the variants. The concept of varying library 'diversity' during a design process was consequently implemented by using adaptive variant distributions. The efficiency of the design algorithm was demonstrated for the de novo construction of potential thrombin inhibitors mimicking peptide and non-peptide template structures.

Structural alphabets derived from attractors in conformational space

PubMed Central

2010-01-01

Background The hierarchical and partially redundant nature of protein structures justifies the definition of frequently occurring conformations of short fragments as 'states'. Collections of selected representatives for these states define Structural Alphabets, describing the most typical local conformations within protein structures. These alphabets form a bridge between the string-oriented methods of sequence analysis and the coordinate-oriented methods of protein structure analysis. Results A Structural Alphabet has been derived by clustering all four-residue fragments of a high-resolution subset of the protein data bank and extracting the high-density states as representative conformational states. Each fragment is uniquely defined by a set of three independent angles corresponding to its degrees of freedom, capturing in simple and intuitive terms the properties of the conformational space. The fragments of the Structural Alphabet are equivalent to the conformational attractors and therefore yield a most informative encoding of proteins. Proteins can be reconstructed within the experimental uncertainty in structure determination and ensembles of structures can be encoded with accuracy and robustness. Conclusions The density-based Structural Alphabet provides a novel tool to describe local conformations and it is specifically suitable for application in studies of protein dynamics. PMID:20170534

Terminal Restriction Fragment Length Polymorphism Analysis Program, a Web-Based Research Tool for Microbial Community Analysis

PubMed Central

Marsh, Terence L.; Saxman, Paul; Cole, James; Tiedje, James

2000-01-01

Rapid analysis of microbial communities has proven to be a difficult task. This is due, in part, to both the tremendous diversity of the microbial world and the high complexity of many microbial communities. Several techniques for community analysis have emerged over the past decade, and most take advantage of the molecular phylogeny derived from 16S rRNA comparative sequence analysis. We describe a web-based research tool located at the Ribosomal Database Project web site (http://www.cme.msu.edu/RDP/html/analyses.html) that facilitates microbial community analysis using terminal restriction fragment length polymorphism of 16S ribosomal DNA. The analysis function (designated TAP T-RFLP) permits the user to perform in silico restriction digestions of the entire 16S sequence database and derive terminal restriction fragment sizes, measured in base pairs, from the 5′ terminus of the user-specified primer to the 3′ terminus of the restriction endonuclease target site. The output can be sorted and viewed either phylogenetically or by size. It is anticipated that the site will guide experimental design as well as provide insight into interpreting results of community analysis with terminal restriction fragment length polymorphisms. PMID:10919828

Heterologous gene expression driven by carbonic anhydrase gene promoter in Dunaliella salina

NASA Astrophysics Data System (ADS)

Chai, Yurong; Lu, Yumin; Wang, Tianyun; Hou, Weihong; Xue, Lexun

2006-12-01

Dunaliella salina, a halotolerant unicellular green alga without a rigid cell wall, can live in salinities ranging from 0.05 to 5 mol/L NaCl. These features of D. salina make it an ideal host for the production of antibodies, oral vaccine, and commercially valuable polypeptides. To produce high level of heterologous proteins from D. salina, highly efficient promoters are required to drive expression of target genes under controlled condition. In the present study, we cloned a 5' franking region of 1.4 kb from the carbonic anhydrase ( CAH) gene of D. salina by genomic walking and PCR. The fragment was ligated to the pMD18-T vector and characterized. Sequence analysis indicated that this region contained conserved motifs, including a TATA- like box and CAAT-box. Tandem (GT)n repeats that had a potential role of transcriptional control, were also found in this region. The transcription start site (TSS) of the CAH gene was determined by 5' RACE and nested PCR method. Transformation assays showed that the 1.4 kb fragment was able to drive expression of the selectable bar (bialaphos resistance) gene when the fusion was transformed into D. salina by biolistics. Northern blotting hybridizations showed that the bar transcript was most abundant in cells grown in 2 mol/L NaCl, and less abundant in 0.5 mol/L NaCl, indicating that expression of the bar gene was induced at high salinity. These results suggest the potential use of the CAH gene promoter to induce the expression of heterologous genes in D. salina under varied salt condition.

Zebrafish ( Danio rerio) as a model for investigating the safety of GM feed ingredients (soya and maize); performance, stress response and uptake of dietary DNA sequences.

PubMed

Sissener, Nini H; Johannessen, Lene E; Hevrøy, Ernst M; Wiik-Nielsen, Christer R; Berdal, Knut G; Nordgreen, Andreas; Hemre, Gro-Ingunn

2010-01-01

A 20-d zebrafish (Danio rerio) feeding trial, in which a near doubling of fish weight was achieved, was conducted with GM feed ingredients to evaluate feed intake, growth, stress response and uptake of dietary DNA. A partial aim of the study was to assess zebrafish as a model organism in GM safety assessments. Roundup Ready soya (RRS), YieldGard Bt maize (MON810) and their non-modified, maternal, near-isogenic lines were used in a 2 x 2 factorial design. Soya variety and maize variety were the main factors, both with two levels; non-GM and GM. Compared with fish fed non-GM maize, those fed GM maize exhibited significantly better growth, had lower mRNA transcription levels of superoxide dismutase (SOD)-1 and a tendency (non-significant) towards lower transcription of heat shock protein 70 in liver. Sex of the fish and soya variety had significant interaction effects on total RNA yield from the whole liver and transcription of SOD-1, suggesting that some diet component affecting males and females differently was present in different levels in the GM and the non-GM soya used in the present study. Dietary DNA sequences were detected in all of the organs analysed, but not all of the samples. Soya and maize rubisco (non-transgenic, multicopy genes) were most frequently detected, while MON810 transgenic DNA fragments were detected in some samples and RRS fragments were not detected. In conclusion, zebrafish shows promise as a model for this application.

ChoG is the main inducible extracellular cholesterol oxidase of Rhodococcus sp. strain CECT3014.

PubMed

Fernández de Las Heras, Laura; Mascaraque, Victoria; García Fernández, Esther; Navarro-Llorens, Juana María; Perera, Julián; Drzyzga, Oliver

2011-07-20

Cholesterol catabolism has been reported in different bacteria and particularly in several Rhodococcus species, but the genetic of this complex pathway is not yet very well defined. In this work we report the isolation and sequencing of a 9.8 kb DNA fragment of Rhodococcus sp. strain CECT3014, a bacterial strain that we here identify as a Rhodococcus erythropolis strain. In this DNA fragment we found several ORF that are probably involved in steroid catabolism, and choG, a gene encoding a putative cholesterol oxidase whose functional characterization we here report. ChoG protein is a class II cholesterol oxidase with all the structural features of the enzymes of this group. The disruption of the choG gene does not alter the ability of strain CECT3014 cells to grow on cholesterol, but it abolishes the production of extracellular cholesterol oxidase. This later effect is reverted when the mutant cells are transformed with a plasmid expressing choG. We conclude that choG is the gene responsible for the inducible extracellular cholesterol oxidase activity of strain CECT3014. This activity distributes between the cellular membrane and the culture supernatant in a way that suggests it is produced by the same ChoG protein that occurs in two different locations. RT-PCR transcript analysis showed a dual scheme of choG expression: a low constitutive independent transcription, plus a cholesterol induced transcription of choG into a polycistronic kstD-hsd4B-choG mRNA. Copyright © 2010 Elsevier GmbH. All rights reserved.

Alpha-Secretase ADAM10 Regulation: Insights into Alzheimer’s Disease Treatment

PubMed Central

Peron, Rafaela; Vatanabe, Izabela Pereira; Manzine, Patricia Regina; Camins, Antoni

2018-01-01

ADAM (a disintegrin and metalloproteinase) is a family of widely expressed, transmembrane and secreted proteins of approximately 750 amino acids in length with functions in cell adhesion and proteolytic processing of the ectodomains of diverse cell-surface receptors and signaling molecules. ADAM10 is the main α-secretase that cleaves APP (amyloid precursor protein) in the non-amyloidogenic pathway inhibiting the formation of β-amyloid peptide, whose accumulation and aggregation leads to neuronal degeneration in Alzheimer’s disease (AD). ADAM10 is a membrane-anchored metalloprotease that sheds, besides APP, the ectodomain of a large variety of cell-surface proteins including cytokines, adhesion molecules and notch. APP cleavage by ADAM10 results in the production of an APP-derived fragment, sAPPα, which is neuroprotective. As increased ADAM10 activity protects the brain from β-amyloid deposition in AD, this strategy has been proved to be effective in treating neurodegenerative diseases, including AD. Here, we describe the physiological mechanisms regulating ADAM10 expression at different levels, aiming to propose strategies for AD treatment. We report in this review on the physiological regulation of ADAM10 at the transcriptional level, by epigenetic factors, miRNAs and/or translational and post-translational levels. In addition, we describe the conditions that can change ADAM10 expression in vitro and in vivo, and discuss how this knowledge may help in AD treatment. Regulation of ADAM10 is achieved by multiple mechanisms that include transcriptional, translational and post-translational strategies, which we will summarize in this review. PMID:29382156

Characterization and analysis of a transcriptome from the boreal spider crab Hyas araneus.

PubMed

Harms, Lars; Frickenhaus, Stephan; Schiffer, Melanie; Mark, Felix C; Storch, Daniela; Pörtner, Hans-Otto; Held, Christoph; Lucassen, Magnus

2013-12-01

Research investigating the genetic basis of physiological responses has significantly broadened our understanding of the mechanisms underlying organismic response to environmental change. However, genomic data are currently available for few taxa only, thus excluding physiological model species from this approach. In this study we report the transcriptome of the model organism Hyas araneus from Spitsbergen (Arctic). We generated 20,479 transcripts, using the 454 GS FLX sequencing technology in combination with an Illumina HiSeq sequencing approach. Annotation by Blastx revealed 7159 blast hits in the NCBI non-redundant protein database. The comparison between the spider crab H. araneus transcriptome and EST libraries of the European lobster Homarus americanus and the porcelain crab Petrolisthes cinctipes yielded 3229/2581 sequences with a significant hit, respectively. The clustering by the Markov Clustering Algorithm (MCL) revealed a common core of 1710 clusters present in all three species and 5903 unique clusters for H. araneus. The combined sequencing approaches generated transcripts that will greatly expand the limited genomic data available for crustaceans. We introduce the MCL clustering for transcriptome comparisons as a simple approach to estimate similarities between transcriptomic libraries of different size and quality and to analyze homologies within the selected group of species. In particular, we identified a large variety of reverse transcriptase (RT) sequences not only in the H. araneus transcriptome and other decapod crustaceans, but also sea urchin, supporting the hypothesis of a heritable, anti-viral immunity and the proposed viral fragment integration by host-derived RTs in marine invertebrates. © 2013.

Automated LC-HRMS(/MS) Approach for the Annotation of Fragment Ions Derived from Stable Isotope Labeling-Assisted Untargeted Metabolomics

PubMed Central

2014-01-01

Structure elucidation of biological compounds is still a major bottleneck of untargeted LC-HRMS approaches in metabolomics research. The aim of the present study was to combine stable isotope labeling and tandem mass spectrometry for the automated interpretation of the elemental composition of fragment ions and thereby facilitate the structural characterization of metabolites. The software tool FragExtract was developed and evaluated with LC-HRMS/MS spectra of both native 12C- and uniformly 13C (U-13C)-labeled analytical standards of 10 fungal substances in pure solvent and spiked into fungal culture filtrate of Fusarium graminearum respectively. Furthermore, the developed approach is exemplified with nine unknown biochemical compounds contained in F. graminearum samples derived from an untargeted metabolomics experiment. The mass difference between the corresponding fragment ions present in the MS/MS spectra of the native and U-13C-labeled compound enabled the assignment of the number of carbon atoms to each fragment signal and allowed the generation of meaningful putative molecular formulas for each fragment ion, which in turn also helped determine the elemental composition of the precursor ion. Compared to laborious manual analysis of the MS/MS spectra, the presented algorithm marks an important step toward efficient fragment signal elucidation and structure annotation of metabolites in future untargeted metabolomics studies. Moreover, as demonstrated for a fungal culture sample, FragExtract also assists the characterization of unknown metabolites, which are not contained in databases, and thus exhibits a significant contribution to untargeted metabolomics research. PMID:24965664

Directly transforming PCR-amplified DNA fragments into plant cells is a versatile system that facilitates the transient expression assay.

PubMed

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells.

Directly Transforming PCR-Amplified DNA Fragments into Plant Cells Is a Versatile System That Facilitates the Transient Expression Assay

PubMed Central

Lu, Yuming; Chen, Xi; Wu, Yuxuan; Wang, Yanping; He, Yuqing; Wu, Yan

2013-01-01

A circular plasmid containing a gene coding sequence has been broadly used for studying gene regulation in cells. However, to accommodate a quick screen plasmid construction and preparation can be time consuming. Here we report a PCR amplified dsDNA fragments (PCR-fragments) based transient expression system (PCR-TES) for suiting in the study of gene regulation in plant cells. Instead of transforming plasmids into plant cells, transient expression of PCR-fragments can be applicable. The transformation efficiency and expression property of PCR-fragments are comparable to transformation using plasmids. We analyzed the transformation efficiency in PCR-TES at transcription and protein levels. Our results indicate that the PCR-TES is as versatile as the conventional transformation system using plasmid DNA. Through reconstituting PYR1-mediated ABA signaling pathway in Arabidopsis mesophyll protoplasts, we were not only validating the practicality of PCR-TES but also screening potential candidates of CDPK family members which might be involved in the ABA signaling. Moreover, we determined that phosphorylation of ABF2 by CPK4 could be mediated by ABA-induced PYR1 and ABI1, demonstrating a crucial role of CDPKs in the ABA signaling. In summary, PCR-TES can be applicable to facilitate analyzing gene regulation and for the screen of putative regulatory molecules at the high throughput level in plant cells. PMID:23468926

Transcriptional specialization of human dendritic cell subsets in response to microbial vaccines

PubMed Central

Banchereau, Romain; Baldwin, Nicole; Cepika, Alma-Martina; Athale, Shruti; Xue, Yaming; Yu, Chun I; Metang, Patrick; Cheruku, Abhilasha; Berthier, Isabelle; Gayet, Ingrid; Wang, Yuanyuan; Ohouo, Marina; Snipes, LuAnn; Xu, Hui; Obermoser, Gerlinde; Blankenship, Derek; Oh, Sangkon; Ramilo, Octavio; Chaussabel, Damien; Banchereau, Jacques; Palucka, Karolina; Pascual, Virginia

2014-01-01

The mechanisms by which microbial vaccines interact with human APCs remain elusive. Herein, we describe the transcriptional programs induced in human DCs by pathogens, innate receptor ligands and vaccines. Exposure of DCs to influenza, Salmonella enterica and Staphylococcus aureus allows us to build a modular framework containing 204 transcript clusters. We use this framework to characterize the responses of human monocytes, monocyte-derived DCs and blood DC subsets to 13 vaccines. Different vaccines induce distinct transcriptional programs based on pathogen type, adjuvant formulation and APC targeted. Fluzone, Pneumovax and Gardasil, respectively, activate monocyte-derived DCs, monocytes and CD1c+ blood DCs, highlighting APC specialization in response to vaccines. Finally, the blood signatures from individuals vaccinated with Fluzone or infected with influenza reveal a signature of adaptive immunity activation following vaccination and symptomatic infections, but not asymptomatic infections. These data, offered with a web interface, may guide the development of improved vaccines. PMID:25335753

XRN2 is required for the degradation of target RNAs by RNase H1-dependent antisense oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Obika, Satoshi, E-mail: obika@phs.osaka-u.ac.jp

Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood. To better understand this degradation pathway, we depleted the expression of two major 5′ to 3′ exoribonucleases (XRNs), named XRN1 and XRN2, and analyzed the levels of 3′ fragments of the target RNAs in vitro. We found that the 3′ fragments of target pre-mRNA generated by ASO were almost completely degraded from their 5′ ends by nuclear XRN2 after RNase H1-mediatedmore » cleavage, whereas the 3′ fragments of mature mRNA were partially degraded by XRN2. In contrast to ASO, small interference RNA (siRNA) could reduce the expression level of only mature mRNA, and the 3′ fragment was degraded by cytoplasmic XRN1. Our findings indicate that the RNAs targeted by RNase H1-dependent ASO are rapidly degraded in the nucleus, contrary to the cytoplasmic degradation pathway mediated by siRNA. - Highlights: • We compared the degradation mechanism of the transcript targeted by ASO and siRNA. • We focused on two 5′ to 3′ exoribonucleases, cytoplasmic XRN1, and nuclear XRN2. • The 3′ fragment of target pre-mRNA generated by ASO was degraded by XRN2. • The 3′ fragment of target mRNA generated by ASO was partially degraded by XRN2. • XRN1 depletion promoted accumulation of the 3′ fragment of mRNA generated by siRNA.« less

Molecular dynamics simulations demonstrate the regulation of DNA-DNA attraction by H4 histone tail acetylations and mutations.

PubMed

Korolev, Nikolay; Yu, Hang; Lyubartsev, Alexander P; Nordenskiöld, Lars

2014-10-01

The positively charged N-terminal histone tails play a crucial role in chromatin compaction and are important modulators of DNA transcription, recombination, and repair. The detailed mechanism of the interaction of histone tails with DNA remains elusive. To model the unspecific interaction of histone tails with DNA, all-atom molecular dynamics (MD) simulations were carried out for systems of four DNA 22-mers in the presence of 20 or 16 short fragments of the H4 histone tail (variations of the 16-23 a. a. KRHRKVLR sequence, as well as the unmodified fragment a. a.13-20, GGAKRHRK). This setup with high DNA concentration, explicit presence of DNA-DNA contacts, presence of unstructured cationic peptides (histone tails) and K(+) mimics the conditions of eukaryotic chromatin. A detailed account of the DNA interactions with the histone tail fragments, K(+) and water is presented. Furthermore, DNA structure and dynamics and its interplay with the histone tail fragments binding are analysed. The charged side chains of the lysines and arginines play major roles in the tail-mediated DNA-DNA attraction by forming bridges and by coordinating to the phosphate groups and to the electronegative sites in the minor groove. Binding of all species to DNA is dynamic. The structure of the unmodified fully-charged H4 16-23 a.a. fragment KRHRKVLR is dominated by a stretched conformation. The H4 tail a. a. fragment GGAKRHRK as well as the H4 Lys16 acetylated fragment are highly flexible. The present work allows capturing typical features of the histone tail-counterion-DNA structure, interaction and dynamics. © 2014 Wiley Periodicals, Inc.

Transcription regulation by distal enhancers

PubMed Central

Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric

2012-01-01

Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system. PMID:22771987

Fragment-based approaches to the discovery of kinase inhibitors.

PubMed

Mortenson, Paul N; Berdini, Valerio; O'Reilly, Marc

2014-01-01

Protein kinases are one of the most important families of drug targets, and aberrant kinase activity has been linked to a large number of disease areas. Although eminently targetable using small molecules, kinases present a number of challenges as drug targets, not least obtaining selectivity across such a large and relatively closely related target family. Fragment-based drug discovery involves screening simple, low-molecular weight compounds to generate initial hits against a target. These hits are then optimized to more potent compounds via medicinal chemistry, usually facilitated by structural biology. Here, we will present a number of recent examples of fragment-based approaches to the discovery of kinase inhibitors, detailing the construction of fragment-screening libraries, the identification and validation of fragment hits, and their optimization into potent and selective lead compounds. The advantages of fragment-based methodologies will be discussed, along with some of the challenges associated with using this route. Finally, we will present a number of key lessons derived both from our own experience running fragment screens against kinases and from a large number of published studies.

Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

PubMed

Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

2018-02-01

To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

Isomer Information from Ion Mobility Separation of High-Mannose Glycan Fragments.

PubMed

Harvey, David J; Seabright, Gemma E; Vasiljevic, Snezana; Crispin, Max; Struwe, Weston B

2018-05-01

Extracted arrival time distributions of negative ion CID-derived fragments produced prior to traveling-wave ion mobility separation were evaluated for their ability to provide structural information on N-linked glycans. Fragmentation of high-mannose glycans released from several glycoproteins, including those from viral sources, provided over 50 fragments, many of which gave unique collisional cross-sections and provided additional information used to assign structural isomers. For example, cross-ring fragments arising from cleavage of the reducing terminal GlcNAc residue on Man 8 GlcNAc 2 isomers have unique collision cross-sections enabling isomers to be differentiated in mixtures. Specific fragment collision cross-sections enabled identification of glycans, the antennae of which terminated in the antigenic α-galactose residue, and ions defining the composition of the 6-antenna of several of the glycans were also found to have different cross-sections from isomeric ions produced in the same spectra. Potential mechanisms for the formation of the various ions are discussed and the estimated collisional cross-sections are tabulated. Graphical Abstract ᅟ.

Is an observed non-co-linear RNA product spliced in trans, in cis or just in vitro?

PubMed Central

Yu, Chun-Ying; Liu, Hsiao-Jung; Hung, Li-Yuan; Kuo, Hung-Chih; Chuang, Trees-Juen

2014-01-01

Global transcriptome investigations often result in the detection of an enormous number of transcripts composed of non-co-linear sequence fragments. Such ‘aberrant’ transcript products may arise from post-transcriptional events or genetic rearrangements, or may otherwise be false positives (sequencing/alignment errors or in vitro artifacts). Moreover, post-transcriptionally non-co-linear (‘PtNcl’) transcripts can arise from trans-splicing or back-splicing in cis (to generate so-called ‘circular RNA’). Here, we collected previously-predicted human non-co-linear RNA candidates, and designed a validation procedure integrating in silico filters with multiple experimental validation steps to examine their authenticity. We showed that >50% of the tested candidates were in vitro artifacts, even though some had been previously validated by RT-PCR. After excluding the possibility of genetic rearrangements, we distinguished between trans-spliced and circular RNAs, and confirmed that these two splicing forms can share the same non-co-linear junction. Importantly, the experimentally-confirmed PtNcl RNA events and their corresponding PtNcl splicing types (i.e. trans-splicing, circular RNA, or both sharing the same junction) were all expressed in rhesus macaque, and some were even expressed in mouse. Our study thus describes an essential procedure for confirming PtNcl transcripts, and provides further insight into the evolutionary role of PtNcl RNA events, opening up this important, but understudied, class of post-transcriptional events for comprehensive characterization. PMID:25053845

Flp and Cre expressed from Flp–2A–Cre and Flp–IRES–Cre transcription units mediate the highest level of dual recombinase-mediated cassette exchange

PubMed Central

Anderson, Rachelle P.; Voziyanova, Eugenia; Voziyanov, Yuri

2012-01-01

Recombinase-mediated cassette exchange (RMCE) is a powerful tool for unidirectional integration of DNA fragments of interest into a pre-determined genome locale. In this report, we examined how the efficiency of dual RMCE catalyzed by Flp and Cre depends on the nature of transcription units that express the recombinases. The following recombinase transcription units were analyzed: (i) Flp and Cre genes expressed as individual transcription units located on different vectors, (ii) Flp and Cre genes expressed as individual transcription units located on the same vector, (iii) Flp and Cre genes expressed from a single promoter and separated by internal ribosome entry sequence and (iv) Flp and Cre coding sequences separated by the 2A peptide and expressed as a single gene. We found that the highest level of dual RMCE (35–45% of the transfected cells) can be achieved when Flp and Cre recombinases are expressed as Flp–2A–Cre and Flp–IRES–Cre transcription units. In contrast, the lowest level of dual RMCE (∼1% of the transfected cells) is achieved when Flp and Cre are expressed as individual transcription units. The analysis shows that it is the relative Flp–to–Cre ratio that critically affects the efficiency of dual RMCE. Our results will be helpful for maximizing the efficiency of dual RMCE aimed to engineer and re-engineer genomes. PMID:22270085

Functional analysis of a WRKY transcription factor involved in transcriptional activation of the DBAT gene in Taxus chinensis.

PubMed

Li, S; Zhang, P; Zhang, M; Fu, C; Yu, L

2013-01-01

Although the regulation of taxol biosynthesis at the transcriptional level remains unclear, 10-deacetylbaccatin III-10 β-O-acetyl transferase (DBAT) is a critical enzyme in the biosynthesis of taxol. The 1740 bp fragment 5'-flanking sequence of the dbat gene was cloned from Taxus chinensis cells. Important regulatory elements needed for activity of the dbat promoter were located by deletion analyses in T. chinensis cells. A novel WRKY transcription factor, TcWRKY1, was isolated with the yeast one-hybrid system from a T. chinensis cell cDNA library using the important regulatory elements as bait. The gene expression of TcWRKY1 in T. chinensis suspension cells was specifically induced by methyl jasmonate (MeJA). Biochemical analysis indicated that TcWRKY1 protein specifically interacts with the two W-box (TGAC) cis-elements among the important regulatory elements. Overexpression of TcWRKY1 enhanced dbat expression in T. chinensis suspension cells, and RNA interference (RNAi) reduced the level of transcripts of dbat. These results suggest that TcWRKY1 participates in regulation of taxol biosynthesis in T. chinensis cells, and that dbat is a target gene of this transcription factor. This research also provides a potential candidate gene for engineering increased taxol accumulation in Taxus cell cultures. © 2012 German Botanical Society and The Royal Botanical Society of the Netherlands.

DNA wrapping and distortion by an oligomeric homeodomain protein.

PubMed

Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

2008-10-31

Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

Identification, expression analysis, and the regulating function on C/EBPs of KLF10 in Dalian purple sea urchin, Strongylocentrotus nudus.

PubMed

Wu, Kaikai; Jia, Zhiying; Wang, Qi'ai; Wei, Zhenlin; Zhou, Zunchun; Liu, Xiaolin

2017-10-01

Accumulating evidence indicates that Krüppel-like factors (KLFs) play important roles in fat biology via the regulation of CCAAT/enhancer binding proteins (C/EBPs). However, KLFs and C/EBPs have not been identified from Strongylocentrotus nudus, and their roles in this species are not clear. In this study, the full-length cDNA of S. nudus KLF10 (SnKLF10) and three cDNA fragments of S. nudus C/EBPs (SnC/EBPs) were obtained. Examination of tissue distribution and expression patterns during gonadal development implied that SnKLF10 and SnC/EBPs play important roles in gonadal lipogenesis. The presence of transcription factor-binding sites (TFBSs) for KLFs in SnC/EBPs, and the results of an over-expression assay, revealed that SnKLF10 negatively regulates the transcription of SnC/EBPs. In addition, the core promoter regions of SnC/EBPs were determined, and multiple TFBSs for transcription factor (TFs) were identified, which are potential regulators of SnC/EBP transcription. Taken together, these results suggest that SnC/EBP genes are potential targets of SnKLF10, and that SnKLF10 plays a role in lipogenesis by repressing the transcription of SnC/EBPs. These findings provide information for further studies of KLF10 in invertebrates and provide new insight into the regulatory mechanisms of C/EBP transcription.

Evacuation areas for transportation accidents involving propellant tank pressure bursts

NASA Technical Reports Server (NTRS)

Siewert, R. D.

1972-01-01

Evacuation areas are defined for those transportation accidents where volatile chemical propellant tanks are exposed to fire in the wreckage and eventually explode with consequent risks from fragments in surrounding populated areas. An evacuation area with a minimum radius of 600 m (2000 ft) is recommended to limit the statistical probability of fatality to one in 100 such accidents. The result was made possible by the derivation of a distribution function of distances reached by fragments from bursting chemical car tanks. Data concerning fragments was obtained from reports or tank car pressure bursts between 1958 and 1971.

Neuron-derived orphan receptor 1 transduces survival signals in neuronal cells in response to hypoxia-induced apoptotic insults.

PubMed

Chio, Chung-Ching; Wei, Li; Chen, Tyng Guey; Lin, Chien-Min; Shieh, Ja-Ping; Yeh, Poh-Shiow; Chen, Ruei-Ming

2016-06-01

OBJECT Hypoxia can induce cell death or trigger adaptive mechanisms to guarantee cell survival. Neuron-derived orphan receptor 1 (NOR-1) works as an early-response protein in response to a variety of environmental stresses. In this study, the authors evaluated the roles of NOR-1 in hypoxia-induced neuronal insults. METHODS Neuro-2a cells were exposed to oxygen/glucose deprivation (OGD). Cell viability, cell morphology, cas-pase-3 activity, DNA fragmentation, and cell apoptosis were assayed to determine the mechanisms of OGD-induced neuronal insults. RNA and protein analyses were carried out to evaluate the effects of OGD on expressions of NOR-1, cAMP response element-binding (CREB), and cellular inhibitor of apoptosis protein 2 (cIAP2) genes. Translations of these gene expressions were knocked down using RNA interference. Mice subjected to traumatic brain injury (TBI) and NOR-1 was immunodetected. RESULTS Exposure of neuro-2a cells to OGD decreased cell viability in a time-dependent manner. Additionally, OGD led to cell shrinkage, DNA fragmentation, and cell apoptosis. In parallel, treatment of neuro-2a cells with OGD time dependently increased cellular NOR-1 mRNA and protein expressions. Interestingly, administration of TBI also augmented NOR-1 levels in the impacted regions of mice. As to the mechanism, exposure to OGD increased nuclear levels of the transcription factor CREB protein. Downregulating CREB expression using RNA interference simultaneously inhibited OGD-induced NOR-1 mRNA expression. Also, levels of cIAP2 mRNA and protein in neuro-2a cells were augmented by OGD. After reducing cIAP2 translation, OGD-induced cell death was reduced. Sequentially, application of NOR-1 small interfering RNA to neuro-2a cells significantly inhibited OGD-induced cIAP2 mRNA expression and concurrently alleviated hypoxia-induced alterations in cell viability, caspase-3 activation, DNA damage, and cell apoptosis. CONCLUSIONS This study shows that NOR-1 can transduce survival signals in neuronal cells responsible for hypoxiainduced apoptotic insults through activation of a CREB/cIAP2-dependent mechanism.

Fragment-Based Identification of Influenza Endonuclease Inhibitors

PubMed Central

2016-01-01

The influenza virus is responsible for millions of cases of severe illness annually. Yearly variance in the effectiveness of vaccination, coupled with emerging drug resistance, necessitates the development of new drugs to treat influenza infections. One attractive target is the RNA-dependent RNA polymerase PA subunit. Herein we report the development of inhibitors of influenza PA endonuclease derived from lead compounds identified from a metal-binding pharmacophore (MBP) library screen. Pyromeconic acid and derivatives thereof were found to be potent inhibitors of endonuclease. Guided by modeling and previously reported structural data, several sublibraries of molecules were elaborated from the MBP hits. Structure–activity relationships were established, and more potent molecules were designed and synthesized using fragment growth and fragment merging strategies. This approach ultimately resulted in the development of a lead compound with an IC50 value of 14 nM, which displayed an EC50 value of 2.1 μM against H1N1 influenza virus in MDCK cells. PMID:27291165

Active Fragments from Pro- and Antiapoptotic BCL-2 Proteins Have Distinct Membrane Behavior Reflecting Their Functional Divergence

PubMed Central

Guillemin, Yannis; Lopez, Jonathan; Gimenez, Diana; Fuertes, Gustavo; Valero, Juan Garcia; Blum, Loïc; Gonzalo, Philippe; Salgado, Jesùs; Girard-Egrot, Agnès; Aouacheria, Abdel

2010-01-01

Background The BCL-2 family of proteins includes pro- and antiapoptotic members acting by controlling the permeabilization of mitochondria. Although the association of these proteins with the outer mitochondrial membrane is crucial for their function, little is known about the characteristics of this interaction. Methodology/Principal Findings Here, we followed a reductionist approach to clarify to what extent membrane-active regions of homologous BCL-2 family proteins contribute to their functional divergence. Using isolated mitochondria as well as model lipid Langmuir monolayers coupled with Brewster Angle Microscopy, we explored systematically and comparatively the membrane activity and membrane-peptide interactions of fragments derived from the central helical hairpin of BAX, BCL-xL and BID. The results show a connection between the differing abilities of the assayed peptide fragments to contact, insert, destabilize and porate membranes and the activity of their cognate proteins in programmed cell death. Conclusion/Significance BCL-2 family-derived pore-forming helices thus represent structurally analogous, but functionally dissimilar membrane domains. PMID:20140092

Infrequent detectable somatic mutations of the RET and glial cell line-derived neurotrophic factor (GDNF) genes in human pituitary adenomas.

PubMed

Yoshimoto, K; Tanaka, C; Moritani, M; Shimizu, E; Yamaoka, T; Yamada, S; Sano, T; Itakura, M

1999-02-01

RET is a receptor tyrosine kinase expressed in neuroendocrine cells and tumors. RET is activated by a ligand complex comprising glial cell line-derived neurotrophic factor (GDNF) and GDNF receptor-alpha (GDNFR-alpha). Activating mutations of the RET proto-oncogene were found in multiple endocrine neoplasia (MEN) 2 and in sporadic medullary thyroid carcinoma and pheochromocytoma of neuroendocrine origin. Mutations of the RET proto-oncogene and the glial cell line-derived neurotrophic factor (GDNF) gene were examined in human pituitary tumors. No mutations of the RET proto-oncogene including the cysteine-rich region or codon 768 and 918 in the tyrosine kinase domain were detected in 172 human pituitary adenomas either by polymerase chain reaction (PCR)-single strand conformation polymorphism (SSCP) or by PCR-restriction fragment length polymorphism (RFLP). Further, somatic mutations of the GDNF gene in 33 human pituitary adenomas were not detected by PCR-SSCP. One polymorphism of the GDNF gene at codon 145 of TGC or TGT was observed in a prolactinoma. The RET proto-oncogene message was detected in a normal human pituitary gland or 4 of 4 human pituitary adenomas with reverse transcription (RT)-PCR, and in rodent pituitary tumor cell lines with Western blotting. The expression of GDNF gene was detected in 1 of 4 human somatotroph adenomas, 1 of 2 corticotroph adenomas, and 2 of 6 rodent pituitary tumor cell lines with RT-PCR. Based on these, it is concluded that somatic mutations of the RET proto-oncogene or the GDNF gene do not appear to play a major role in the pituitary tumorigenesis in examined tumors.

Rates of species loss from Amazonian forest fragments

PubMed Central

Ferraz, Gonçalo; Russell, Gareth J.; Stouffer, Philip C.; Bierregaard, Richard O.; Pimm, Stuart L.; Lovejoy, Thomas E.

2003-01-01

In the face of worldwide habitat fragmentation, managers need to devise a time frame for action. We ask how fast do understory bird species disappear from experimentally isolated plots in the Biological Dynamics of Forest Fragments Project, central Amazon, Brazil. Our data consist of mist-net records obtained over a period of 13 years in 11 sites of 1, 10, and 100 hectares. The numbers of captures per species per unit time, analyzed under different simplifying assumptions, reveal a set of species-loss curves. From those declining numbers, we derive a scaling rule for the time it takes to lose half the species in a fragment as a function of its area. A 10-fold decrease in the rate of species loss requires a 1,000-fold increase in area. Fragments of 100 hectares lose one half of their species in <15 years, too short a time for implementing conservation measures. PMID:14614134

SPY: A new scission point model based on microscopic ingredients to predict fission fragments properties

NASA Astrophysics Data System (ADS)

Lemaître, J.-F.; Dubray, N.; Hilaire, S.; Panebianco, S.; Sida, J.-L.

2013-12-01

Our purpose is to determine fission fragments characteristics in a framework of a scission point model named SPY for Scission Point Yields. This approach can be considered as a theoretical laboratory to study fission mechanism since it gives access to the correlation between the fragments properties and their nuclear structure, such as shell correction, pairing, collective degrees of freedom, odd-even effects. Which ones are dominant in final state? What is the impact of compound nucleus structure? The SPY model consists in a statistical description of the fission process at the scission point where fragments are completely formed and well separated with fixed properties. The most important property of the model relies on the nuclear structure of the fragments which is derived from full quantum microscopic calculations. This approach allows computing the fission final state of extremely exotic nuclei which are inaccessible by most of the fission model available on the market.

Impact and explosion crater ejecta, fragment size, and velocity

NASA Technical Reports Server (NTRS)

Okeefe, J. D.; Ahrens, T. J.

1983-01-01

A model was developed for the mass distribution of fragments that are ejected at a given velocity for impact and explosion craters. The model is semi-empirical in nature and is derived from (1) numerical calculations of cratering and the resultant mass versus ejection velocity, (2) observed ejecta blanket particle size distributions, (3) an empirical relationship between maximum ejecta fragment size and crater diameter and an assumption on the functional form for the distribution of fragements ejected at a given velocity. This model implies that for planetary impacts into competent rock, the distribution of fragments ejected at a given velocity are nearly monodisperse, e.g., 20% of the mass of the ejecta at a given velocity contain fragments having a mass less than 0.1 times a mass of the largest fragment moving at that velocity. Using this model, the largest fragment that can be ejected from asteroids, the moon, Mars, and Earth is calculated as a function of crater diameter. In addition, the internal energy of ejecta versus ejecta velocity is found. The internal energy of fragments having velocities exceeding the escape velocity of the moon will exceed the energy required for incipient melting for solid silicates and thus, constrains the maximum ejected solid fragment size.

Identification of nuclear genes controlling chlorophyll synthesis in barley by RNA-seq.

PubMed

Shmakov, Nickolay A; Vasiliev, Gennadiy V; Shatskaya, Natalya V; Doroshkov, Alexey V; Gordeeva, Elena I; Afonnikov, Dmitry A; Khlestkina, Elena K

2016-11-16

Albinism in plants is characterized by lack of chlorophyll and results in photosynthesis impairment, abnormal plant development and premature death. These abnormalities are frequently encountered in interspecific crosses and tissue culture experiments. Analysis of albino mutant phenotypes with full or partial chlorophyll deficiency can shed light on genetic determinants and molecular mechanisms of albinism. Here we report analysis of RNA-seq transcription profiling of barley (Hordeum vulgare L.) near-isogenic lines, one of which is a carrier of mutant allele of the Alm gene for albino lemma and pericarp phenotype (line i:BwAlm). 1221 genome fragments have statistically significant changes in expression levels between lines i:BwAlm and Bowman, with 148 fragments having increased expression levels in line i:BwAlm, and 1073 genome fragments, including 42 plastid operons, having decreased levels of expression in line i:BwAlm. We detected functional dissimilarity between genes with higher and lower levels of expression in i:BwAlm line. Genes with lower level of expression in the i:BwAlm line are mostly associated with photosynthesis and chlorophyll synthesis, while genes with higher expression level are functionally associated with vesicle transport. Differentially expressed genes are shown to be involved in several metabolic pathways; the largest fraction of such genes was observed for the Calvin-Benson-Bassham cycle. Finally, de novo assembly of transcriptome contains several transcripts, not annotated in current H. vulgare genome version. Our results provide the new information about genes which could be involved in formation of albino lemma and pericarp phenotype. They demonstrate the interplay between nuclear and chloroplast genomes in this physiological process.

Characterization of the hupSL promoter activity in Nostoc punctiforme ATCC 29133

PubMed Central

2009-01-01

Background In cyanobacteria three enzymes are directly involved in the hydrogen metabolism; a nitrogenase that produces molecular hydrogen, H2, as a by-product of nitrogen fixation, an uptake hydrogenase that recaptures H2 and oxidize it, and a bidirectional hydrogenase that can both oxidize and produce H2.Nostoc punctiforme ATCC 29133 is a filamentous dinitrogen fixing cyanobacterium containing a nitrogenase and an uptake hydrogenase but no bidirectional hydrogenase. Generally, little is known about the transcriptional regulation of the cyanobacterial uptake hydrogenases. In this study gel shift assays showed that NtcA has a specific affinity to a region of the hupSL promoter containing a predicted NtcA binding site. The predicted NtcA binding site is centred at 258.5 bp upstream the transcription start point (tsp). To further investigate the hupSL promoter, truncated versions of the hupSL promoter were fused to either gfp or luxAB, encoding the reporter proteins Green Fluorescent Protein and Luciferase, respectively. Results Interestingly, all hupsSL promoter deletion constructs showed heterocyst specific expression. Unexpectedly the shortest promoter fragment, a fragment covering 57 bp upstream and 258 bp downstream the tsp, exhibited the highest promoter activity. Deletion of the NtcA binding site neither affected the expression to any larger extent nor the heterocyst specificity. Conclusion Obtained data suggest that the hupSL promoter in N. punctiforme is not strictly dependent on the upstream NtcA cis element and that the shortest promoter fragment (-57 to tsp) is enough for a high and heterocyst specific expression of hupSL. This is highly interesting because it indicates that the information that determines heterocyst specific gene expression might be confined to this short sequence or in the downstream untranslated leader sequence. PMID:19284581

Identification and qualification of 500 nuclear, single-copy, orthologous genes for the Eupulmonata (Gastropoda) using transcriptome sequencing and exon capture.

PubMed

Teasdale, Luisa C; Köhler, Frank; Murray, Kevin D; O'Hara, Tim; Moussalli, Adnan

2016-09-01

The qualification of orthology is a significant challenge when developing large, multiloci phylogenetic data sets from assembled transcripts. Transcriptome assemblies have various attributes, such as fragmentation, frameshifts and mis-indexing, which pose problems to automated methods of orthology assessment. Here, we identify a set of orthologous single-copy genes from transcriptome assemblies for the land snails and slugs (Eupulmonata) using a thorough approach to orthology determination involving manual alignment curation, gene tree assessment and sequencing from genomic DNA. We qualified the orthology of 500 nuclear, protein-coding genes from the transcriptome assemblies of 21 eupulmonate species to produce the most complete phylogenetic data matrix for a major molluscan lineage to date, both in terms of taxon and character completeness. Exon capture targeting 490 of the 500 genes (those with at least one exon >120 bp) from 22 species of Australian Camaenidae successfully captured sequences of 2825 exons (representing all targeted genes), with only a 3.7% reduction in the data matrix due to the presence of putative paralogs or pseudogenes. The automated pipeline Agalma retrieved the majority of the manually qualified 500 single-copy gene set and identified a further 375 putative single-copy genes, although it failed to account for fragmented transcripts resulting in lower data matrix completeness when considering the original 500 genes. This could potentially explain the minor inconsistencies we observed in the supported topologies for the 21 eupulmonate species between the manually curated and 'Agalma-equivalent' data set (sharing 458 genes). Overall, our study confirms the utility of the 500 gene set to resolve phylogenetic relationships at a range of evolutionary depths and highlights the importance of addressing fragmentation at the homolog alignment stage for probe design. © 2016 John Wiley & Sons Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Zhipan; Lu, Qingtao; Wen, Xiaogang

Highlights: Black-Right-Pointing-Pointer Rice rubisco activase promoter was analyzed in transgenic Arabidopsis system. Black-Right-Pointing-Pointer Region conferring tissue specific and light inducible expression of Rca was identified. Black-Right-Pointing-Pointer -58 to +43 bp region mediates tissue-specific expression of rice Rca. Black-Right-Pointing-Pointer Light inducible expression of rice Rca is mediated by -297 to -58 bp region. Black-Right-Pointing-Pointer Rice nuclear proteins bind specifically with the light inducible region. -- Abstract: To gain a better understanding of the regulatory mechanism of the rice rubisco activase (Rca) gene, variants of the Rca gene promoter (one full-length and four deletion mutants) fused to the coding region of themore » bacterial reporter gene {beta}-glucuronidase (GUS) were introduced into Arabidopsis via Agrobacterium-mediated transformation. Our results show that a 340 bp fragment spanning from -297 to +43 bp relative to the transcription initiation site is enough to promote tissue-specific and light-inducible expression of the rice Rca gene as done by the full-length promoter (-1428 to +43 bp). Further deletion analysis indicated that the region conferring tissue-specificity of Rca expression is localized within a 105 bp fragment from -58 to +43 bp, while light-inducible expression of Rca is mediated by the region from -297 to -58 bp. Gel shift assays and competition experiments demonstrated that rice nuclear proteins bind specifically with the fragment conferring light responsiveness at more than one binding site. This implies that multiple cis-elements may be involved in light-induced expression of the rice Rca gene. These works provide a useful reference for understanding transcriptional regulation mechanism of the rice Rca gene, and lay a strong foundation for further detection of related cis-elements and trans-factors.« less

Regulatory interactions between the human HOXB1, HOXB2, and HOXB3 proteins and the upstream sequence of the Otx2 gene in embryonal carcinoma cells.

PubMed

Guazzi, S; Pintonello, M L; Viganò, A; Boncinelli, E

1998-05-01

Vertebrate Hox and Otx genes encode homeodomain-containing transcription factors thought to transduce positional information along the body axis in the segmental portion of the trunk and in the rostral brain, respectively. Moreover, Hox and Otx2 genes show a complementary spatial regulation during embryogenesis. In this report, we show that a 1821-base pair (bp) upstream DNA fragment of the Otx2 gene is positively regulated by co-transfection with expression vectors for the human HOXB1, HOXB2, and HOXB3 proteins in an embryonal carcinoma cell line (NT2/D1) and that a shorter fragment of only 534 bp is able to drive this regulation. We also identified the HOXB1, HOXB2, and HOXB3 DNA-binding region on the 534-bp Otx2 genomic fragment using nuclear extracts from Hox-transfected COS cells and 12.5 days postcoitum mouse embryos or HOXB3 homeodomain-containing bacterial extracts. HOXB1, HOXB3, and nuclear extracts from 12.5 days postcoitum mouse embryos bind to a sequence containing two palindromic TAATTA sites, which bear four copies of the ATTA core sequence, a common feature of most HOM-C/HOX binding sites. HOXB2 protected an adjacent site containing a direct repeat of an ACTT sequence, quite divergent from the ATTA consensus. The region bound by the three homeoproteins is strikingly conserved through evolution and necessary (at least for HOXB1 and HOXB3) to mediate the up-regulation of the Otx2 transcription. Taken together, our data support the hypothesis that anteriorly expressed Hox genes might play a role in the refinement of the Otx2 early expression boundaries in vivo.

Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).

PubMed

Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J

2014-01-01

DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.

The minimal promoter region of the dense-core vesicle protein IA-2: transcriptional regulation by CREB.

PubMed

Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L

2015-06-01

IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.

The head-regeneration transcriptome of the planarian Schmidtea mediterranea.

PubMed

Sandmann, Thomas; Vogg, Matthias C; Owlarn, Suthira; Boutros, Michael; Bartscherer, Kerstin

2011-08-16

Planarian flatworms can regenerate their head, including a functional brain, within less than a week. Despite the enormous potential of these animals for medical research and regenerative medicine, the mechanisms of regeneration and the molecules involved remain largely unknown. To identify genes that are differentially expressed during early stages of planarian head regeneration, we generated a de novo transcriptome assembly from more than 300 million paired-end reads from planarian fragments regenerating the head at 16 different time points. The assembly yielded 26,018 putative transcripts, including very long transcripts spanning multiple genomic supercontigs, and thousands of isoforms. Using short-read data from two platforms, we analyzed dynamic gene regulation during the first three days of head regeneration. We identified at least five different temporal synexpression classes, including genes specifically induced within a few hours after injury. Furthermore, we characterized the role of a conserved Runx transcription factor, smed-runt-like1. RNA interference (RNAi) knockdown and immunofluorescence analysis of the regenerating visual system indicated that smed-runt-like1 encodes a transcriptional regulator of eye morphology and photoreceptor patterning. Transcriptome sequencing of short reads allowed for the simultaneous de novo assembly and differential expression analysis of transcripts, demonstrating highly dynamic regulation during head regeneration in planarians.

The head-regeneration transcriptome of the planarian Schmidtea mediterranea

PubMed Central

2011-01-01

Background Planarian flatworms can regenerate their head, including a functional brain, within less than a week. Despite the enormous potential of these animals for medical research and regenerative medicine, the mechanisms of regeneration and the molecules involved remain largely unknown. Results To identify genes that are differentially expressed during early stages of planarian head regeneration, we generated a de novo transcriptome assembly from more than 300 million paired-end reads from planarian fragments regenerating the head at 16 different time points. The assembly yielded 26,018 putative transcripts, including very long transcripts spanning multiple genomic supercontigs, and thousands of isoforms. Using short-read data from two platforms, we analyzed dynamic gene regulation during the first three days of head regeneration. We identified at least five different temporal synexpression classes, including genes specifically induced within a few hours after injury. Furthermore, we characterized the role of a conserved Runx transcription factor, smed-runt-like1. RNA interference (RNAi) knockdown and immunofluorescence analysis of the regenerating visual system indicated that smed-runt-like1 encodes a transcriptional regulator of eye morphology and photoreceptor patterning. Conclusions Transcriptome sequencing of short reads allowed for the simultaneous de novo assembly and differential expression analysis of transcripts, demonstrating highly dynamic regulation during head regeneration in planarians. PMID:21846378

Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export.

PubMed

Karijolich, John; Zhao, Yang; Alla, Ravi; Glaunsinger, Britt

2017-06-02

Short interspersed nuclear elements (SINEs) are retrotransposons evolutionarily derived from endogenous RNA Polymerase III RNAs. Though SINE elements have undergone exaptation into gene regulatory elements, how transcribed SINE RNA impacts transcriptional and post-transcriptional regulation is largely unknown. This is partly due to a lack of information regarding which of the loci have transcriptional potential. Here, we present an approach (short interspersed nuclear element sequencing, SINE-seq), which selectively profiles RNA Polymerase III-derived SINE RNA, thereby identifying transcriptionally active SINE loci. Applying SINE-seq to monitor murine B2 SINE expression during a gammaherpesvirus infection revealed transcription from 28 270 SINE loci, with ∼50% of active SINE elements residing within annotated RNA Polymerase II loci. Furthermore, B2 RNA can form intermolecular RNA-RNA interactions with complementary mRNAs, leading to nuclear retention of the targeted mRNA via a mechanism involving p54nrb. These findings illuminate a pathway for the selective regulation of mRNA export during stress via retrotransposon activation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-wide mapping of infection-induced SINE RNAs reveals a role in selective mRNA export

PubMed Central

Zhao, Yang; Alla, Ravi

2017-01-01

Abstract Short interspersed nuclear elements (SINEs) are retrotransposons evolutionarily derived from endogenous RNA Polymerase III RNAs. Though SINE elements have undergone exaptation into gene regulatory elements, how transcribed SINE RNA impacts transcriptional and post-transcriptional regulation is largely unknown. This is partly due to a lack of information regarding which of the loci have transcriptional potential. Here, we present an approach (short interspersed nuclear element sequencing, SINE-seq), which selectively profiles RNA Polymerase III-derived SINE RNA, thereby identifying transcriptionally active SINE loci. Applying SINE-seq to monitor murine B2 SINE expression during a gammaherpesvirus infection revealed transcription from 28 270 SINE loci, with ∼50% of active SINE elements residing within annotated RNA Polymerase II loci. Furthermore, B2 RNA can form intermolecular RNA–RNA interactions with complementary mRNAs, leading to nuclear retention of the targeted mRNA via a mechanism involving p54nrb. These findings illuminate a pathway for the selective regulation of mRNA export during stress via retrotransposon activation. PMID:28334904

Identification of a second murine interleukin-11 receptor alpha-chain gene (IL11Ra2) with a restricted pattern of expression.

PubMed

Robb, L; Hilton, D J; Brook-Carter, P T; Begley, C G

1997-03-15

The interleukin-11 receptor alpha-chain, a member of the hematopoietin receptor superfamily, forms, together with gp130, a functional high-affinity receptor complex for interleukin 11. We, and others, reported the cloning of the murine interleukin 11 receptor alpha-chain cDNA (IL11Ra) and recently described the structure of the IL11Ra locus. We also described the presence of a second IL11Ra-like locus in some mouse strains. In this study we report that the second locus, designated IL11Ra2, encodes an mRNA species. The transcript was 99% identical to the IL11Ra transcript in the coding and 3'-untranslated region, but had a different 5'-untranslated region. The complete genomic organization of the IL11Ra2 locus is presented, and the two loci are shown to be located on a 200-kb NaeI genomic fragment. Comparison of the expression pattern of the IL11Ra and IL11Ra2 genes using an RT-PCR restriction fragment length polymorphism strategy revealed that while the expression of IL11Ra was widespread, expression of IL11Ra2 was restricted to testis, lymph node, and thymus.

C-terminal fragment of amebin promotes actin filament bundling, inhibits acto-myosin ATPase activity and is essential for amoeba migration.

PubMed

Jóźwiak, Jolanta; Rzhepetskyy, Yuriy; Sobczak, Magdalena; Kocik, Elżbieta; Skórzewski, Radosław; Kłopocka, Wanda; Rędowicz, Maria Jolanta

2011-02-01

Amebin [formerly termed as ApABP-FI; Sobczak et al. (2007) Biochem. Cell Biol. 85] is encoded in Amoeba proteus by two transcripts, 2672-nt and 1125-nt. A product of the shorter transcript (termed as C-amebin), comprising C-terminal 375 amino-acid-residue fragment of amebin, has been expressed and purified as the recombinant GST-fusion protein. GST-C-amebin bound both to monomeric and filamentous actin. The binding was Ca(2+)-independent and promoted filament bundling, as revealed with the transmission electron microscopy. GST-C-amebin significantly decreased MgATPase activity of rabbit skeletal muscle acto-S1. Removal with endoproteinase ArgC of a positively charged C-terminal region of GST-amebin containing KLASMWEQ sequence abolished actin-binding and bundling as well as the ATPase-inhibitory effect of C-amebin, indicating that this protein region was involved in the interaction with actin. Microinjection of amoebae with antibody against C-terminus of amebin significantly affected amoebae morphology, disturbed cell polarization and transport of cytoplasmic granules as well as blocked migration. These data indicate that amebin may be one of key regulators of the actin-cytoskeleton dynamics and actin-dependent motility in A. proteus. Copyright © 2010 Elsevier Inc. All rights reserved.

An accurate algorithm for the detection of DNA fragments from dilution pool sequencing experiments.

PubMed

Bansal, Vikas

2018-01-01

The short read lengths of current high-throughput sequencing technologies limit the ability to recover long-range haplotype information. Dilution pool methods for preparing DNA sequencing libraries from high molecular weight DNA fragments enable the recovery of long DNA fragments from short sequence reads. These approaches require computational methods for identifying the DNA fragments using aligned sequence reads and assembling the fragments into long haplotypes. Although a number of computational methods have been developed for haplotype assembly, the problem of identifying DNA fragments from dilution pool sequence data has not received much attention. We formulate the problem of detecting DNA fragments from dilution pool sequencing experiments as a genome segmentation problem and develop an algorithm that uses dynamic programming to optimize a likelihood function derived from a generative model for the sequence reads. This algorithm uses an iterative approach to automatically infer the mean background read depth and the number of fragments in each pool. Using simulated data, we demonstrate that our method, FragmentCut, has 25-30% greater sensitivity compared with an HMM based method for fragment detection and can also detect overlapping fragments. On a whole-genome human fosmid pool dataset, the haplotypes assembled using the fragments identified by FragmentCut had greater N50 length, 16.2% lower switch error rate and 35.8% lower mismatch error rate compared with two existing methods. We further demonstrate the greater accuracy of our method using two additional dilution pool datasets. FragmentCut is available from https://bansal-lab.github.io/software/FragmentCut. vibansal@ucsd.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Palaeosymbiosis Revealed by Genomic Fossils of Wolbachia in a Strongyloidean Nematode

PubMed Central

Koutsovoulos, Georgios; Makepeace, Benjamin; Tanya, Vincent N.; Blaxter, Mark

2014-01-01

Wolbachia are common endosymbionts of terrestrial arthropods, and are also found in nematodes: the animal-parasitic filaria, and the plant-parasite Radopholus similis. Lateral transfer of Wolbachia DNA to the host genome is common. We generated a draft genome sequence for the strongyloidean nematode parasite Dictyocaulus viviparus, the cattle lungworm. In the assembly, we identified nearly 1 Mb of sequence with similarity to Wolbachia. The fragments were unlikely to derive from a live Wolbachia infection: most were short, and the genes were disabled through inactivating mutations. Many fragments were co-assembled with definitively nematode-derived sequence. We found limited evidence of expression of the Wolbachia-derived genes. The D. viviparus Wolbachia genes were most similar to filarial strains and strains from the host-promiscuous clade F. We conclude that D. viviparus was infected by Wolbachia in the past, and that clade F-like symbionts may have been the source of filarial Wolbachia infections. PMID:24901418

The Effect of Silver Carp Skin-Derived Peptides on the Activities of VEGF and Hsp70.1 Gene Transcription Promoters.

PubMed

Wojtkowiak, Diana; Piechowicz, Janina; Grzenkowicz-Wydra, Jolanta; Wosiński, Stanisław; Dominiak, Marzena; Hadzik, Jakub; Frydrychowski, Andrzej F

2016-01-01

Studies conducted on human cell culture models have demonstrated that collagen-derived peptides can exert a beneficial effect in medicine. However, all these studies were conducted using animal collagen samples, most often originating from bovine or porcine skin. Currently attempts are being made to replace animal collagen with fish collagen. The aim of the study was to compare the effect of silver carp skin-derived peptide extract on the transcriptional activities of human VEGF and hsp70.1 gene promoters inserted into the plasmids with secreted alkaline phosphatase as a reporter gene. Changes in the activity of the promoters were investigated using a HEK293FT cell line transfected with pVEGF-SEAP or pHsp70-SEAP. The cells were cultured in dishes containing peptides separated using reverse-phase high performance liquid chromatography. The study demonstrated that the silver carp skin-derived peptide extract exerts both an inhibitory effect on the VEGF gene promoter and activating effect on the hsp70.1 gene promoter. Higher biological activity was recorded in the case of a freshly prepared peptide extract compared to one stored at 4°C for three months. The silver carp skin-derived collagen peptides influence VEGF and hsp70.1 gene promoters' transcriptional activity.

A beta-galactosidase gene is expressed during mature fruit abscission of 'Valencia' orange (Citrus sinensis).

PubMed

Wu, Zhencai; Burns, Jacqueline K

2004-07-01

beta-galactosidases have been detected in a wide range of plants and are characterized by their ability to hydrolyse terminal non-reducing beta-D-galactosyl residues from beta-D-galactosides. These enzymes have been detected in a wide range of plant organs and tissues. In a search for differentially expressed genes during the abscission process in citrus, sequences encoding beta-galactosidase were identified. Three cDNA fragments of a beta-galactosidase gene were isolated from a cDNA subtraction library constructed from mature fruit abscission zones 48 h after the application of a mature fruit-specific abscission agent, 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMN-pyrazole). Based on sequence information derived from these fragments, a full-length cDNA of 2847 nucleotides (GenBank accession number AY029198) encoding beta-galactosidase was isolated from mature fruit abscission zones by 5'- and 3'-RACE approaches. The beta-galactosidase cDNA encoded a protein of 737 amino acid residues with a calculated molecular weight of 82 kDa. The deduced protein was highly homologous to plant beta-galactosidases expressed in fruit ripening. Southern blot analysis demonstrated that at least two closely related beta-galactosidase genes were present in 'Valencia' orange. Temporal expression patterns in mature fruit abscission zones indicated beta-galactosidase mRNA was detected 48 h after treatment of CMN-pyrazole and ethephon in mature fruit abscission zones. beta-galactosidase transcripts were detected in leaf abscission zones only after ethephon application. The citrus beta-galactosidase was expressed in stamens and petals of fully opened flowers and young fruitlets. The results suggest that this beta-galactosidase may play a role during abscission as well as early growth and development processes in flowers and fruitlets.

Metabolic and Genetic Properties of Petriella setifera Precultured on Waste

PubMed Central

Oszust, Karolina; Panek, Jacek; Pertile, Giorgia; Siczek, Anna; Oleszek, Marta; Frąc, Magdalena

2018-01-01

Although fungi that belong to Petriella genus are considered to be favorable agents in the process of microbial decomposition or as plant endophytes, they may simultaneously become plant pests. Hence, nutrition factors are supposed to play an important role. Therefore, it was hypothesized that Petriella setifera compost isolates, precultured on three different waste-based media containing oak sawdust, beet pulp (BP) and wheat bran (WB) will subsequently reveal different metabolic properties and shifts in genetic fingerprinting. In fact, the aim was to measure the influence of selected waste on the properties of P. setifera. The metabolic potential was evaluated by the ability of five P. setifera strains to decompose oak sawdust, BP and WB following the MT2 plate® method and the catabolic abilities of the fungus to utilize the carbon compounds located on filamentous fungi (FF) plates®. Genetic diversity was evaluated using Amplified Fragment Length Polymorphism analysis performed both on DNA sequences and on transcript-derived fragments. P. setifera isolates were found to be more suitable for decomposing waste materials rich in protein, N, P, K and easily accessible sugars (as found in WB and BP), than those rich in lignocellulose (oak sawdust). Surprisingly, among the different waste media, lignocellulose-rich sawdust-based culture chiefly triggered changes in the metabolic and genetic features of P. setifera. Most particularly, it contributed to improvements in the ability of the fungus to utilize waste-substrates in MT2 plate® and two times increase the ability to catabolize carbon compounds located in FF plates®. Expressive metabolic properties resulting from being grown in sawdust-based substrate were in accordance with differing genotype profiles but not transcriptome. Intraspecific differences among P. setifera isolates are described. PMID:29472904

Identification and properties of the largest subunit of the DNA-dependent RNA polymerase of fish lymphocystis disease virus: dramatic difference in the domain organization in the family Iridoviridae.

PubMed

Müller, M; Schnitzler, P; Koonin, E V; Darai, G

1995-05-01

Cytoplasmic DNA viruses encode a DNA-dependent RNA polymerase (DdRP) that is essential for transcription of viral genes. The amino acid sequences of the known largest subunits of DdRPs from different species contain highly conserved regions. Oligonucleotide primers, deduced from two conserved domains (RQP[T/S]LH and NADFDGDE) were used for detecting the corresponding gene of fish lymphocystis disease virus (FLCDV), a member of the family Iridoviridae, which replicates in the cytoplasm of infected cells of flatfish. The gene coding for the largest subunit of the DdRP was identified using a PCR-derived probe. The screening of the complete EcoRI gene library of the viral genome led to the identification of the gene locus of the largest subunit of the DdRP within the EcoRI DNA fragment B (12.4 kbp, 0.034 to 0.165 map units). The nucleotide sequence of a part (8334 bp) of the EcoRI DNA fragment B was determined and a large ORF on the lower strand (ATG = 5787; TAA = 2190) was detected which encodes a protein of 1199 amino acids. Comparison of the amino acid sequences of the largest subunits of the DdRP (RPO1) of FLCDV and Chilo iridescent virus (CIV) revealed a dramatic difference in their domain organization. Unlike the 1051 aa RPO1 of CIV, which lacks the C-terminal domain conserved in eukaryotic, eubacterial and other viral RNA polymerases, the 1199 aa RPO1 of FLCDV is fully collinear with its cellular and viral homologues. Despite this difference, comparative analysis of the amino acid sequences of viral and cellular RNA polymerases suggests a common origin for the largest RNA polymerase subunits of FLCDV and CIV.

A New Secondary Structure Assignment Algorithm Using Cα Backbone Fragments

PubMed Central

Cao, Chen; Wang, Guishen; Liu, An; Xu, Shutan; Wang, Lincong; Zou, Shuxue

2016-01-01

The assignment of secondary structure elements in proteins is a key step in the analysis of their structures and functions. We have developed an algorithm, SACF (secondary structure assignment based on Cα fragments), for secondary structure element (SSE) assignment based on the alignment of Cα backbone fragments with central poses derived by clustering known SSE fragments. The assignment algorithm consists of three steps: First, the outlier fragments on known SSEs are detected. Next, the remaining fragments are clustered to obtain the central fragments for each cluster. Finally, the central fragments are used as a template to make assignments. Following a large-scale comparison of 11 secondary structure assignment methods, SACF, KAKSI and PROSS are found to have similar agreement with DSSP, while PCASSO agrees with DSSP best. SACF and PCASSO show preference to reducing residues in N and C cap regions, whereas KAKSI, P-SEA and SEGNO tend to add residues to the terminals when DSSP assignment is taken as standard. Moreover, our algorithm is able to assign subtle helices (310-helix, π-helix and left-handed helix) and make uniform assignments, as well as to detect rare SSEs in β-sheets or long helices as outlier fragments from other programs. The structural uniformity should be useful for protein structure classification and prediction, while outlier fragments underlie the structure–function relationship. PMID:26978354

Transcription regulation by distal enhancers: who's in the loop?

PubMed

Stadhouders, Ralph; van den Heuvel, Anita; Kolovos, Petros; Jorna, Ruud; Leslie, Kris; Grosveld, Frank; Soler, Eric

2012-01-01

Genome-wide chromatin profiling efforts have shown that enhancers are often located at large distances from gene promoters within the noncoding genome. Whereas enhancers can stimulate transcription initiation by communicating with promoters via chromatin looping mechanisms, we propose that enhancers may also stimulate transcription elongation by physical interactions with intronic elements. We review here recent findings derived from the study of the hematopoietic system.

Cell type-specific termination of transcription by transposable element sequences.

PubMed

Conley, Andrew B; Jordan, I King

2012-09-30

Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the extent to which TE sequences actually terminate transcription of human gene across the genome remains an open question. Using high-throughput sequencing data, we have characterized over 9,000 distinct TE-derived sequences that provide transcription termination sites for 5,747 human genes across eight different cell types. Rarefaction curve analysis suggests that there may be twice as many TE-derived termination sites (TE-TTS) genome-wide among all human cell types. The local chromatin environment for these TE-TTS is similar to that seen for 3' UTR canonical TTS and distinct from the chromatin environment of other intragenic TE sequences. However, those TE-TTS located within the introns of human genes were found to be far more cell type-specific than the canonical TTS. TE-TTS were much more likely to be found in the sense orientation than other intragenic TE sequences of the same TE family and TE-TTS in the sense orientation terminate transcription more efficiently than those found in the antisense orientation. Alu sequences were found to provide a large number of relatively weak TTS, whereas LTR elements provided a smaller number of much stronger TTS. TE sequences provide numerous termination sites to human genes, and TE-derived TTS are particularly cell type-specific. Thus, TE sequences provide a powerful mechanism for the diversification of transcriptional profiles between cell types and among evolutionary lineages, since most TE-TTS are evolutionarily young. The extent of transcription termination by TEs seen here, along with the preference for sense-oriented TE insertions to provide TTS, is consistent with the observed antisense orientation bias of human TEs.

Sequence analysis of the pyruvylated galactan sulfate-derived oligosaccharides by negative-ion electrospray tandem mass spectrometry.

PubMed

Li, Na; Mao, Wenjun; Liu, Xue; Wang, Shuyao; Xia, Zheng; Cao, Sujian; Li, Lin; Zhang, Qi; Liu, Shan

2016-10-04

Five sulfated oligosaccharide fragments, F1-F5, were prepared from a pyruvylated galactan sulfate from the green alga Codium divaricatum, by partial depolymerization using mild acid hydrolysis and purification with gel-permeation chromatography. Negative-ion electrospray tandem mass spectrometry with collision-induced dissociation (ES-CID-MS/MS) is attempted for sequence determination of the sulfated oligosaccharides. The sequence of F1 with homogeneous disaccharide composition was first characterized to be Galp-(4SO4)-(1 → 3)-Galp by detailed nuclear magnetic resonance spectroscopic analyses. The fragmentation pattern of F1 in the product ion spectra was established on the basis of negative-ion ES-CID MS/MS, which was then applied to sequence analysis of other sulfated oligosaccharides. The sequences of F2 and F3 were deduced to be Galp-(4SO4)-(1 → 3)-Galp-(1 → 3)-Galp-(1 → 3)-Galp and 3,4-O-(1-carboxyethylidene)-Galp-(6SO4)-(1 → 3)-Galp, respectively. The sequences of major fragments in F4 and F5 were also deduced. The investigation demonstrated that negative-ion ES-CID-MS/MS was an efficient method for the sequence analysis of the pyruvylated galactan sulfate-derived oligosaccharides which revealed the patterns of substitution and glycosidic linkages. The pyruvylated galactan sulfate-derived oligosaccharides were novel sulfated oligosaccharides different from other algal polysaccharide-derived oligosaccharides. Copyright © 2016 Elsevier Ltd. All rights reserved.

Measurement of gluconeogenesis using glucose fragments and mass spectrometry after ingestion of deuterium oxide.

USDA-ARS?s Scientific Manuscript database

We report a new method to measure the fraction of glucose derived from gluconeogenesis using gas chromatography-mass spectrometry and positive chemical ionization. After ingestion of deuterium oxide by subjects, glucose derived from gluconeogenesis is labeled with deuterium. Our calculations of gluc...

Telomere erosion varies during in vitro aging of normal human fibroblasts from young and adult donors.

PubMed

Figueroa, R; Lindenmaier, H; Hergenhahn, M; Nielsen, K V; Boukamp, P

2000-06-01

The life span of normal fibroblasts in vitro (Hayflick limit) depends on donor age, and telomere shortening has been proposed as a potential mechanism. By quantitative fluorescence in situ hybridization and Southern blot analysis, we show progressive telomere loss to about 5 kb mean telomere restriction fragment length in fibroblasts from two adult donors within 40 population doublings, whereas in fibroblasts from two infant donors, telomere erosion is reduced, leaving a mean telomere restriction fragment length of approximately 7 kb at senescence (after approximately 60 population doublings). Aging of fibroblasts from both infant and adult donors was not accompanied by chromosomal abnormalities but was correlated with increased telomere repeat-binding factor 2 expression at both the protein and transcriptional level.

[Rapid analysis on phenolic compounds in Rheum palmatum based on UPLC-Q-TOF/MSE combined with diagnostic ions filter].

PubMed

Wang, Qing; Lu, Zhi-Wei; Liu, Yue-Hong; Wang, Ming-Ling; Fu, Shuang; Zhang, Qing-Qing; Zhao, Hui-Zhen; Zhang, Zhi-Xin; Xie, Zi-Ye; Huang, Zheng-Hai; Yu, Hong-Hong; Zhou, Wen-Juan; Gao, Xiao-Yan

2017-05-01

Diagnostic ions filter method was used to rapidly detect and identify the phenolic compounds in Rheum palmatum based on ultra performance liquid chromatography coupled with quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MSE). The representative authentic standards of phenolic compounds, including gallic acid, (+)-catechin, (－)-epicatechin, (－)-epicatechin-3-O-gallate and procyanidin B2, were subjected to analysis by UPLC-Q-TOF/MSE system with negative ion mode. Fragmentation patterns of each standard were summarized based on assigned fragment ions. The prominent product ions were selected as diagnostic ions. Subsequently, diagnostic ions filter was employed to rapidly recognize analogous skeletons. Combined with retention time, accurate mass, characteristic fragments and previous literature data, the structures of the filtered compounds were identified or tentatively characterized. A total 63 phenolic compounds (36 phenolic acid derivatives, 8 flavonoid derivatives and 19 tennis derivatives) in R. palmatum were identified, including 6 potential new compounds. The method of diagnostic ions filter could rapidly detect and identify phenolic compounds in R. palmatum This study provides a method for rapid detection of phenolic compounds in R. palmatum and is expected to complete the material basis of rhubarb. Copyright© by the Chinese Pharmaceutical Association.

Fragment profiling of low molecular weight heparins using reversed phase ion pair liquid chromatography-electrospray mass spectrometry.

PubMed

Xu, Xiaohui; Li, Daoyuan; Chi, Lequan; Du, Xuzhao; Bai, Xue; Chi, Lianli

2015-04-30

Low molecular weight heparins (LMWHs) are linear and highly charged carbohydrate polymers prepared by chemical or enzymatic depolymerization of heparin. Compared to unfractionated heparin (UFH), LMWHs are prevalently used as clinical anticoagulant drugs due to their lower side effects and better bioavailability. The work presented herein provides a rapid and powerful fragment mapping method for structural characterization of LMWHs. The chain fragments of two types of LMWHs, enoxaparin and nadroparin, were generated by controlled enzymatic digestion with each of heparinase I (Hep I, Enzyme Commission (EC) # 4.2.2.7), heparinase II (Hep II, no EC # assigned) and heparinase III (Hep III, EC # 4.2.2.8). Reversed phase ion pair high performance liquid chromatography (RPIP-HPLC) coupled with electrospray ion trap time-of-flight mass spectrometry (ESI-IT-TOF-MS) was used to profile the oligosaccharide chains ranging from disaccharides to decasaccharides. A database containing all theoretical structural compositions was established to assist the mass spectra interpretation. The six digests derived by three enzymes from two types of LMWHs exhibited distinguishable fingerprinting patterns. And a total of 94 enoxaparin fragments and 109 nadroparin fragments were detected and identified. Besides the common LMWH oligosaccharides, many components containing characteristic LMWH structures such as saturated L-idopyranosuronic acid, 2,5-anhydro-D-mannitol, 1,6-anhydro-D-aminopyranose, as well as odd number oligosaccharides were also revealed. Quantitative comparison of major components derived from innovator and generic nadroparin products was presented. This approach to profile LMWHs' fragments offers a highly reproducible, high resolution and information-rich tool for evaluating the quality of this category of anticoagulant drugs or comparing structural similarities among samples from various sources. Copyright © 2015 Elsevier Ltd. All rights reserved.

Preliminary Characterization Results from the DebriSat Project

NASA Technical Reports Server (NTRS)

Rivero, M.; Shiotani, B.; Kleespies, J.; Toledo-Burdett, R.; Moraguez, M.; Carrasquila, M.; Fitz-Coy, N.; Liou, J.-C.; Sorge, M.; Huynh, T.

2016-01-01

The DebriSat project is a continuing effort sponsored by NASA and DoD to update existing break-up models using data obtained from two separate hypervelocity impact tests used to simulate on-orbit collisions. To protect the fragments resulting from the impact tests, "soft-catch" arenas made of polyurethane foam panels were utilized. After each impact test, the test chamber was cleaned and debris resulting from the catastrophic demise of the test article were collected and shipped to the University of Florida for post-impact processing. The post-impact processing activities include collecting, characterizing, and cataloging of the fragments. Since the impact tests, a team of students has been working to characterize the fragments in terms of their mass, size, shape, color and material content. The focus of the 20 months since the impact tests has been on the collection of 2 millimeters- and larger fragments resulting from impact test on the 56 kilogram-representative LEO (Low Earth Orbit) satellite referred to as DebriSat. To date we have recovered in excess of 115,000 fragments, 30,000 more than the prediction of 85,000 fragments from the existing model. We continue to collect fragments but have transitioned to the characterization phase of the post-impact activities. Since the start of the characterization phase, the focus has been to utilize automation to (i) expedite fragment characterization process and (ii) minimize human-in-the- loop. We have developed and implemented such automated processes; e.g., we have automated the data entry process to reduce operator errors during transcription of the measurement data. However, at all steps of the process, there is human oversight to ensure the integrity of the data. Additionally, we have developed and implemented repeatability and reproducibility tests to ensure that the instrumentation used in the characterization process is accurate and properly calibrated. In this paper, the implemented processes are described and preliminary results presented. Additionally, lessons learned from the implemented automations and their impacts on the integrity of the results are discussed.

A preliminary assessment of Montreal process indicators of forest fragmentation for the United States

Treesearch

Kurt H. Riitters; James D. Wickham; John W. Coulston

2004-01-01

Abstract. As part of the U.S. 2003 National Report on Sustainable Forests, four metrics of forest fragmentation – patch size, edge amount, inter-patch distance, and patch contrast – were measured within 137 744 non-overlapping 5625 ha analysis units on land-cover maps derived from satellite imagery for the 48 conterminous States. The perimeter of a...

Hypochlorite-induced damage to proteins: formation of nitrogen-centred radicals from lysine residues and their role in protein fragmentation.

PubMed Central

Hawkins, C L; Davies, M J

1998-01-01

Stimulated monocytes and neutrophils generate hypochlorite (HOCl) via the release of the enzyme myeloperoxidase and hydrogen peroxide. HOCl damages proteins by reaction with amino acid side-chains or backbone cleavage. Little information is available about the mechanisms and intermediates involved in these reactions. EPR spin trapping has been employed to identify radicals on proteins, peptides and amino acids after treatment with HOCl. Reaction with HOCl gives both high- and low-molecular-mass nitrogen-centred, protein-derived radicals; the yield of the latter increases with both higher HOCl:protein ratios and enzymic digestion. These radicals, which arise from lysine side-chain amino groups, react with ascorbate, glutathione and Trolox. Reaction of HOCl-treated proteins with excess methionine eliminates radical formation, which is consistent with lysine-derived chloramines (via homolysis of N-Cl bonds) being the radical source. Incubation of HOCl-treated proteins, after removal of excess oxidant, gives rise to both nitrogen-centred radicals, over a period of hours, and time-dependent fragmentation of the protein. Treatment with excess methionine or antioxidants (Trolox, ascorbate, glutathione) protects against fragmentation; urate and bilirubin do not. Chloramine formation and nitrogen-centred radicals are therefore key species in HOCl-induced protein fragmentation. PMID:9620862

Synthesis of the ABC tricyclic fragment of the pectenotoxins via stereocontrolled cyclization of a gamma-hydroxyepoxide appended to the AB spiroacetal unit.

PubMed

Halim, Rosliana; Brimble, Margaret A; Merten, Jörn

2006-04-07

The stereocontrolled synthesis of the C1-C16 ABC spiroacetal-containing tricyclic fragment of pectenotoxin-7 6 has been accomplished. The key AB spiroacetal aldehyde 9 was successfully synthesized via acid catalyzed cyclization of protected ketone precursor 28 that was readily prepared from aldehyde 12 and sulfone 13. The syn stereochemistry in aldehyde 12 was installed using an asymmetric aldol reaction proceeding via a titanium enolate. The stereogenic centre in sulfone 13 was derived from (R)-(+)-glycidol. The absolute stereochemistry of the final spiroacetal aldehyde 9 was confirmed by NOE studies establishing the (S)-stereochemistry of the spiroacetal centre. Construction of the tetrahydrofuran C ring system began with Wittig olefination of the AB spiroacetal aldehyde 9 with (carbethoxyethylidene)triphenylphosphorane 10 affording the desired (E)-olefin 32. Appendage of a three carbon chain to the AB spiroacetal fragment was achieved via addition of acetylene 11 to the unstable allylic iodide 39. Epoxidation of (E)-enyne 8 via in situ formation of L-fructose derived dioxirane generated the desired syn-epoxide 36. Semi-hydrogenation of the resulting epoxide 36 followed by dihydroxylation of the alkene effected concomitant cyclization, thus completing the synthesis of the ABC spiroacetal ring fragment 6.

GC-MS and GC-IRD studies on the ring isomers of N-methyl-2-methoxyphenyl-3-butanamines (MPBA) related to 3,4-MDMA.

PubMed

Awad, Tamer; Maher, Hadir M; DeRuiter, Jack; Clark, C Randall

2011-05-01

The mass spectra of the controlled substance 3,4-MDMA and its regioisomer 2,3-MDMA are characterized by an imine fragment base peak at m/z 58 and additional fragments at m/z 135/136 for the methylenedioxybenzyl cation and radical cation, respectively. Three positional ring methoxy isomers of N-methyl-2-(methoxyphenyl)-3-butanamine (MPBA) have an isobaric relationship to 2,3- and 3,4-MDMA. All five compounds have the same molecular weight and produce similar EI mass spectra. This lack of mass spectral specificity for the isomers in addition to the possibility of chromatographic co-elution could result in misidentification. The lack of reference materials for the potential imposter molecules constitutes a significant analytical challenge. Perfluoroacylation of the amine group reduced the nitrogen basicity and provided individual fragmentation pathways for discrimination among these compounds based on unique fragment ions and the relative abundance of common ions. Studies using gas chromatography with infrared detection provided additional structure-IR spectra relationships. The underivatized amines and the perfluoroacylated derivatives (PFPA and HFBA) were resolved by capillary gas chromatography on a 100% dimethylpolysiloxane stationary phase. The perfluoroacylated derivatives showed better resolution on a cyclodextrin modified stationary phase.

Structural insights into the mycobacteria transcription initiation complex from analysis of X-ray crystal structures

DOE PAGES

Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.; ...

2017-07-13

The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the a CTD may play a role in Mtb transcription regulation. Here, our results reveal the structure of an Actinobacteria-unique insert ofmore » the RNAP β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σ A, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less

Phosphorylation of XPB helicase regulates TFIIH nucleotide excision repair activity

PubMed Central

Coin, Frédéric; Auriol, Jérome; Tapias, Angel; Clivio, Pascale; Vermeulen, Wim; Egly, Jean-Marc

2004-01-01

Nucleotide excision repair (NER) removes damage from DNA in a tightly regulated multiprotein process. The xeroderma pigmentosum group B (XPB) helicase subunit of TFIIH functions in NER and transcription. The serine 751 (S751) residue of XPB was found to be phosphorylated in vivo. This phosphorylation inhibits NER and the microinjection of a phosphomimicking XPB-S751E mutant is unable to correct the NER defect of XP-B cells. Conversely, XPB-S751 dephosphorylation or its substitution with alanine (S751A) restores NER both in vivo and in vitro. Surprisingly, phospho/dephosphorylation of S751 spares TFIIH-dependent transcription. Finally, the phosphorylation of XPB-S751 does not impair the TFIIH unwinding of the DNA around the lesion, but rather prevents the 5′ incision triggered by the ERCC1-XPF endonuclease. These data support an additional role for XPB in promoting the incision of the damaged fragment and reveal a point of NER regulation on TFIIH without interference in its transcription activity. PMID:15549133

Staufen1 senses overall transcript secondary structure to regulate translation

PubMed Central

Ricci, Emiliano P; Kucukural, Alper; Cenik, Can; Mercier, Blandine C; Singh, Guramrit; Heyer, Erin E; Ashar-Patel, Ami; Peng, Lingtao; Moore, Melissa J

2015-01-01

Human Staufen1 (Stau1) is a double-stranded RNA (dsRNA)-binding protein implicated in multiple post-transcriptional gene-regulatory processes. Here we combined RNA immunoprecipitation in tandem (RIPiT) with RNase footprinting, formaldehyde cross-linking, sonication-mediated RNA fragmentation and deep sequencing to map Staufen1-binding sites transcriptome wide. We find that Stau1 binds complex secondary structures containing multiple short helices, many of which are formed by inverted Alu elements in annotated 3′ untranslated regions (UTRs) or in ‘strongly distal’ 3′ UTRs. Stau1 also interacts with actively translating ribosomes and with mRNA coding sequences (CDSs) and 3′ UTRs in proportion to their GC content and propensity to form internal secondary structure. On mRNAs with high CDS GC content, higher Stau1 levels lead to greater ribosome densities, thus suggesting a general role for Stau1 in modulating translation elongation through structured CDS regions. Our results also indicate that Stau1 regulates translation of transcription-regulatory proteins. PMID:24336223

Generation of Marker-free Transgenic Plants Concurrently Resistant to a DNA Geminivirus and a RNA Tospovirus

PubMed Central

Yang, Ching-Fu; Chen, Kuan-Chun; Cheng, Ying-Hui; Raja, Joseph A. J.; Huang, Ya-Ling; Chien, Wan-Chu; Yeh, Shyi-Dong

2014-01-01

Global threats of ssDNA geminivirus and ss(-)RNA tospovirus on crops necessitate the development of transgenic resistance. Here, we constructed a two-T DNA vector carrying a hairpin of the intergenic region (IGR) of Ageratum yellow vein virus (AYVV), residing in an intron inserted in an untranslatable nucleocapsid protein (NP) fragment of Melon yellow spot virus (MYSV). Transgenic tobacco lines highly resistant to AYVV and MYSV were generated. Accumulation of 24-nt siRNA, higher methylation levels on the IGR promoters of the transgene, and suppression of IGR promoter activity of invading AYVV indicate that AYVV resistance is mediated by transcriptional gene silencing. Lack of NP transcript and accumulation of corresponding siRNAs indicate that MYSV resistance is mediated through post-transcriptional gene silencing. Marker-free progenies with concurrent resistance to both AYVV and MYSV, stably inherited as dominant nuclear traits, were obtained. Hence, we provide a novel way for concurrent control of noxious DNA and RNA viruses with less biosafety concerns. PMID:25030413

Promoter analysis of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum.

PubMed

Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H

1999-10-28

We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.

Structural insights into the mycobacteria transcription initiation complex from analysis of X-ray crystal structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.

The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the αCTD may play a role in Mtb transcription regulation. Our results reveal the structure of an Actinobacteria-unique insert of the RNAPmore » β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σA, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less

Structural insights into the mycobacteria transcription initiation complex from analysis of X-ray crystal structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hubin, Elizabeth A.; Lilic, Mirjana; Darst, Seth A.

The mycobacteria RNA polymerase (RNAP) is a target for antimicrobials against tuberculosis, motivating structure/function studies. Here we report a 3.2 Å-resolution crystal structure of a Mycobacterium smegmatis (Msm) open promoter complex (RPo), along with structural analysis of the Msm RPo and a previously reported 2.76 Å-resolution crystal structure of an Msm transcription initiation complex with a promoter DNA fragment. We observe the interaction of the Msm RNAP α-subunit C-terminal domain (αCTD) with DNA, and we provide evidence that the a CTD may play a role in Mtb transcription regulation. Here, our results reveal the structure of an Actinobacteria-unique insert ofmore » the RNAP β' subunit. Finally, our analysis reveals the disposition of the N-terminal segment of Msm σ A, which may comprise an intrinsically disordered protein domain unique to mycobacteria. The clade-specific features of the mycobacteria RNAP provide clues to the profound instability of mycobacteria RPo compared with E. coli.« less

Intronic L1 Retrotransposons and Nested Genes Cause Transcriptional Interference by Inducing Intron Retention, Exonization and Cryptic Polyadenylation

PubMed Central

Kaer, Kristel; Branovets, Jelena; Hallikma, Anni; Nigumann, Pilvi; Speek, Mart

2011-01-01

Background Transcriptional interference has been recently recognized as an unexpectedly complex and mostly negative regulation of genes. Despite a relatively few studies that emerged in recent years, it has been demonstrated that a readthrough transcription derived from one gene can influence the transcription of another overlapping or nested gene. However, the molecular effects resulting from this interaction are largely unknown. Methodology/Principal Findings Using in silico chromosome walking, we searched for prematurely terminated transcripts bearing signatures of intron retention or exonization of intronic sequence at their 3′ ends upstream to human L1 retrotransposons, protein-coding and noncoding nested genes. We demonstrate that transcriptional interference induced by intronic L1s (or other repeated DNAs) and nested genes could be characterized by intron retention, forced exonization and cryptic polyadenylation. These molecular effects were revealed from the analysis of endogenous transcripts derived from different cell lines and tissues and confirmed by the expression of three minigenes in cell culture. While intron retention and exonization were comparably observed in introns upstream to L1s, forced exonization was preferentially detected in nested genes. Transcriptional interference induced by L1 or nested genes was dependent on the presence or absence of cryptic splice sites, affected the inclusion or exclusion of the upstream exon and the use of cryptic polyadenylation signals. Conclusions/Significance Our results suggest that transcriptional interference induced by intronic L1s and nested genes could influence the transcription of the large number of genes in normal as well as in tumor tissues. Therefore, this type of interference could have a major impact on the regulation of the host gene expression. PMID:22022525

[Novel bidirectional promoter from human genome].

PubMed

Orekhova, A S; Sverdlova, P S; Spirin, P V; Leonova, O G; Popenko, V I; Prasolov, V S; Rubtsov, P M

2011-01-01

In human and other mammalian genomes a number of closely linked gene pairs transcribed in opposite directions are found. According to bioinformatic analysis up to 10% of human genes are arranged in this way. In present work the fragment of human genome was cloned that separates genes localized at 2p13.1 and oriented "head-to-head", coding for hypothetical proteins with unknown functions--CCDC (Coiled Coil Domain Containing) 142 and TTC (TetraTricopeptide repeat Containing) 31. Intergenic CCDC142-TTC31 region overlaps with CpG-island and contains a number of potential binding sites for transcription factors. This fragment functions as bidirectional promoter in the system ofluciferase reporter gene expression upon transfection of human embryonic kidney (HEK293) cells. The vectors containing genes of two fluorescent proteins--green (EGFP) and red (DsRed2) in opposite orientations separated by the fragment of CCDC142-TTC31 intergenic region were constructed. In HEK293 cells transfected with these vectors simultaneous expression of two fluorescent proteins is observed. Truncated versions of intergenic region were obtained and their promoter activity measured. Minimal promoter fragment contains elements Inr, BRE, DPE characteristic for TATA-less promoters. Thus, from the human genome the novel bidirectional promoter was cloned that can be used for simultaneous constitutive expression of two genes in human cells.

A phthalide derivative isolated from endophytic fungi Pestalotiopsis photiniae induces G1 cell cycle arrest and apoptosis in human HeLa cells.

PubMed

Chen, C; Yang, R L

2013-08-01

MP [4-(3',3'-dimethylallyloxy)-5-methyl-6-methoxyphthalide] was obtained from liquid culture of Pestalotiopsis photiniae isolated from the Chinese Podocarpaceae plant Podocarpus macrophyllus. MP significantly inhibited the proliferation of HeLa tumor cell lines. After treatment with MP, characteristic apoptotic features such as DNA fragmentation and chromatin condensation were observed in DAPI-stained HeLa cells. Flow cytometry showed that MP induced G1 cell cycle arrest and apoptosis in a dose-dependent manner. Western blotting and real-time reverse transcription-polymerase chain reaction were used to investigate protein and mRNA expression. MP caused significant cell cycle arrest by upregulating the cyclin-dependent kinase inhibitor p27(KIP1) protein and p21(CIP1) mRNA levels in HeLa cells. The expression of p73 protein was increased after treatment with various MP concentrations. mRNA expression of the cell cycle-related genes, p21(CIP1), p16(INK4a) and Gadd45α, was significantly upregulated and mRNA levels demonstrated significantly increased translation of p73, JunB, FKHR, and Bim. The results indicate that MP may be a potential treatment for cervical cancer.

A novel bioinformatics method for efficient knowledge discovery by BLSOM from big genomic sequence data.

PubMed

Bai, Yu; Iwasaki, Yuki; Kanaya, Shigehiko; Zhao, Yue; Ikemura, Toshimichi

2014-01-01

With remarkable increase of genomic sequence data of a wide range of species, novel tools are needed for comprehensive analyses of the big sequence data. Self-Organizing Map (SOM) is an effective tool for clustering and visualizing high-dimensional data such as oligonucleotide composition on one map. By modifying the conventional SOM, we have previously developed Batch-Learning SOM (BLSOM), which allows classification of sequence fragments according to species, solely depending on the oligonucleotide composition. In the present study, we introduce the oligonucleotide BLSOM used for characterization of vertebrate genome sequences. We first analyzed pentanucleotide compositions in 100 kb sequences derived from a wide range of vertebrate genomes and then the compositions in the human and mouse genomes in order to investigate an efficient method for detecting differences between the closely related genomes. BLSOM can recognize the species-specific key combination of oligonucleotide frequencies in each genome, which is called a "genome signature," and the specific regions specifically enriched in transcription-factor-binding sequences. Because the classification and visualization power is very high, BLSOM is an efficient powerful tool for extracting a wide range of information from massive amounts of genomic sequences (i.e., big sequence data).

Molecular cloning and expression of an encoding galactinol synthase gene (AnGolS1) in seedling of Ammopiptanthus nanus.

PubMed

Liu, YuDong; Zhang, Li; Chen, LiJing; Ma, Hui; Ruan, YanYe; Xu, Tao; Xu, ChuanQiang; He, Yi; Qi, MingFang

2016-10-27

Based on the galactinol synthase (AnGolS1) fragment sequence from a cold-induced Suppression Subtractive Hybridization (SSH) library derived from Ammopiptanthus nanus (A. nanus) seedlings, AnGolS1 mRNA (including the 5' UTR and 3' UTR) (GenBank accession number: GU942748) was isolated and characterized by rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR). A substrate reaction test revealed that AnGolS1 possessed galactinol synthase activity in vitro and could potentially be an early-responsive gene. Furthermore, quantitative real-time PCR (qRT-PCR) indicated that AnGolS1 was responded to cold, salts and drought stresses, however, significantly up-regulated in all origans by low temperatures, especially in plant stems. In addition, the hybridization signals in the fascicular cambium were strongest in all cells under low temperature. Thus, we propose that AnGolS1 plays critical roles in A. nanus low-temperature stress resistance and that fascicular cambium cells could be involved in AnGolS1 mRNA transcription, galactinol transportation and coordination under low-temperature stress.

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

DNA Fragmentation Factor 45 (DFF45) Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line1

PubMed Central

Yang, Hong Wei; Chen, Ying Zhang; Piao, Hui Ying; Takita, Junko; Soeda, Eiichi; Hayashi, Yasuhide

2001-01-01

Abstract Recently, loss of heterozygosity (LOH) studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p) in neuroblastoma (NB). To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45) gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT)-polymerase chain reaction (PCR) and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region. PMID:11420752

Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.

PubMed

Koebnik, Ralf; Krüger, Antje; Thieme, Frank; Urban, Alexander; Bonas, Ulla

2006-11-01

The pathogenicity of the plant-pathogenic bacterium Xanthomonas campestris pv. vesicatoria depends on a type III secretion system which is encoded by the 23-kb hrp (hypersensitive response and pathogenicity) gene cluster. Expression of the hrp operons is strongly induced in planta and in a special minimal medium and depends on two regulatory proteins, HrpG and HrpX. In this study, DNA affinity enrichment was used to demonstrate that the AraC-type transcriptional activator HrpX binds to a conserved cis-regulatory element, the plant-inducible promoter (PIP) box (TTCGC-N(15)-TTCGC), present in the promoter regions of four hrp operons. No binding of HrpX was observed when DNA fragments lacking a PIP box were used. HrpX also bound to a DNA fragment containing an imperfect PIP box (TTCGC-N(8)-TTCGT). Dinucleotide replacements in each half-site of the PIP box strongly decreased binding of HrpX, while simultaneous dinucleotide replacements in both half-sites completely abolished binding. Based on the complete genome sequence of Xanthomonas campestris pv. vesicatoria, putative plant-inducible promoters consisting of a PIP box and a -10 promoter motif were identified in the promoter regions of almost all HrpX-activated genes. Bioinformatic analyses and reverse transcription-PCR experiments revealed novel HrpX-dependent genes, among them a NUDIX hydrolase gene and several genes with a predicted role in the degradation of the plant cell wall. We conclude that HrpX is the most downstream component of the hrp regulatory cascade, which is proposed to directly activate most genes of the hrpX regulon via binding to corresponding PIP boxes.

The Functional SNPs in the 5’ Regulatory Region of the Porcine PPARD Gene Have Significant Association with Fat Deposition Traits

PubMed Central

Hu, Shanyao; Lin, Bin; Yan, Dechao; Xu, Zaiyan; Zhang, Zijun; Mao, Yuanliang; Mao, Huimin; Wang, Litong; Wang, Guoshui; Xiong, Yuanzhu; Zuo, Bo

2015-01-01

Peroxisome proliferator-activated receptor delta (PPARD) is a key regulator of lipid metabolism, insulin sensitivity, cell proliferation and differentiation. In this study, we identified two Single Nucleotide Polymorphisms (SNPs, g.1015 A>G and g.1018 T>C) constituting four haplotypes (GT, GC, AC and AT) in the 5’ regulatory region of porcine PPARD gene. Functional analysis of the four haplotypes showed that the transcriptional activity of the PPARD promoter fragment carrying haplotype AC was significantly lower than that of the other haplotypes in 3T3-L1, C2C12 and PK-15 cells, and haplotype AC had the lowest binding capacities to the nuclear extracts. Transcription factor 7-like 2 (TCF7L2) enhanced the transcription activities of promoter fragments of PPARD gene carrying haplotypes GT, GC and AT in C2C12 and 3T3-L1 cells, and increased the protein expression of PPARD gene in C2C12 myoblasts. TCF7L2 differentially bound to the four haplotypes, and the binding capacity of TCF7L2 to haplotype AC was the lowest. There were significant associations between -655A/G and fat deposition traits in three pig populations including the Large White × Meishan F2 pigs, France and American Large White pigs. Pigs with genotype GG had significantly higher expression of PPARD at both mRNA and protein level than those with genotype AG. These results strongly suggested that the SNPs in 5’ regulatory region of PPARD genes had significant impact on pig fat deposition traits. PMID:26599230

Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

PubMed

Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

2017-10-01

PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Pancreatic imaging using an antibody fragment targeting the zinc transporter type 8: a direct comparison with radio-iodinated Exendin-4.

PubMed

Eriksson, Olof; Korsgren, Olle; Selvaraju, Ram Kumar; Mollaret, Marjorie; de Boysson, Yann; Chimienti, Fabrice; Altai, Mohamed

2018-01-01

The zinc transporter 8 (ZnT8) has been suggested as a suitable target for non-invasive visualization of the functional pancreatic beta cell mass, due to both its pancreatic beta cell restricted expression and tight involvement in insulin secretion. In order to examine the potential of ZnT8 as a surrogate target for beta cell mass, we performed mRNA transcription analysis in pancreatic compartments. A novel ZnT8 targeting antibody fragment Ab31 was radiolabeled with iodine-125, and evaluated by in vitro autoradiography in insulinoma and pancreas as well as by in vivo biodistribution. The evaluation was performed in a direct comparison with radio-iodinated Exendin-4. Transcription of the ZnT8 mRNA was higher in islets of Langerhans compared to exocrine tissue. Ab31 targeted ZnT8 in the cytosol and on the plasma membrane with 108 nM affinity. Ab31 was successfully radiolabeled with iodine-125 with high yield and > 95% purity. [ 125 I]Ab31 binding to insulinoma and pancreas was higher than for [ 125 I]Exendin-4, but could only by partially competed away by 200 nM Ab31 in excess. The in vivo uptake of [ 125 I]Ab31 was higher than [ 125 I]Exendin-4 in most tissues, mainly due to slower clearance from blood. We report a first-in-class ZnT8 imaging ligand for pancreatic imaging. Development with respect to ligand miniaturization and radionuclide selection is required for further progress. Transcription analysis indicates ZnT8 as a suitable target for visualization of the human endocrine pancreas.

Characterization of two nisin-producing Lactococcus lactis subsp. lactis strains isolated from a commercial sauerkraut fermentation.

PubMed Central

Harris, L J; Fleming, H P; Klaenhammer, T R

1992-01-01

Two Lactococcus lactis subsp. lactis strains, NCK400 and LJH80, isolated from a commercial sauerkraut fermentation were shown to produce nisin. LJH80 was morphologically unstable and gave rise to two stable, nisin-producing (Nip+) derivatives, NCK318-2 and NCK318-3. NCK400 and derivatives of LJH80 exhibited identical morphological and metabolic characteristics, but could be distinguished on the basis of plasmid profiles and genomic hybridization patterns to a DNA probe specific for the iso-ISS1 element, IS946. NCK318-2 and NCK318-3 harbored two and three plasmids, respectively, which hybridized with IS946. Plasmid DNA was not detected in NCK400, and DNA from this strain failed to hybridize with IS946. Despite the absence of detectable plasmid DNA in NCK400, nisin-negative derivatives (NCK402 and NCK403) were isolated after repeated transfer in broth at 37 degrees C. Nisin-negative derivatives concurrently lost the ability to ferment sucrose and became sensitive to nisin. A 4-kbp HindIII fragment containing the structural gene for nisin (spaN), cloned from L. lactis subsp. lactis ATCC 11454, was used to probe genomic DNA of NCK318-2, NCK318-3, NCK400, and NCK402 digested with EcoRI or HindIII. The spaN probe hybridized to an 8.8-kbp EcoRI fragment and a 10-kbp HindIII fragment in the Nip+ sauerkraut isolates, but did not hybridize to the Nip- derivative, NCK402. A different hybridization pattern was observed when the same probe was used against Nip+ L. lactis subsp. lactis ATCC 11454 and ATCC 7962. These phenotypic and genetic data confirmed that unique Nip+ L. lactis subsp. lactis strains were isolated from fermenting sauerkraut. Images PMID:1622214

Small-interfering RNAs from natural antisense transcripts derived from a cellulose synthase gene modulate cell wall biosynthesis in barley

PubMed Central

Held, Michael A.; Penning, Bryan; Brandt, Amanda S.; Kessans, Sarah A.; Yong, Weidong; Scofield, Steven R.; Carpita, Nicholas C.

2008-01-01

Small-interfering RNAs (siRNAs) from natural cis-antisense pairs derived from the 3′-coding region of the barley (Hordeum vulgare) CesA6 cellulose synthase gene substantially increase in abundance during leaf elongation. Strand-specific RT-PCR confirmed the presence of an antisense transcript of HvCesA6 that extends ≥1230 bp from the 3′ end of the CesA-coding sequence. The increases in abundance of the CesA6 antisense transcript and the 21-nt and 24-nt siRNAs derived from the transcript are coincident with the down-regulation of primary wall CesAs, several Csl genes, and GT8 glycosyl transferase genes, and are correlated with the reduction in rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Virus induced gene silencing using unique target sequences derived from HvCesA genes attenuated expression not only of the HvCesA6 gene, but also of numerous nontarget Csls and the distantly related GT8 genes and reduced the incorporation of D-14C-Glc into cellulose and into mixed-linkage (1 → 3),(1 → 4)-β-D-glucans of the developing leaves. Unique target sequences for CslF and CslH conversely silenced the same genes and lowered rates of cellulose and (1 → 3),(1 → 4)-β-D-glucan synthesis. Our results indicate that the expression of individual members of the CesA/Csl superfamily and glycosyl transferases share common regulatory control points, and siRNAs from natural cis-antisense pairs derived from the CesA/Csl superfamily could function in this global regulation of cell-wall synthesis. PMID:19075248

The caspase-generated cleavage product of Ets-1 p51 and Ets-1 p27, Cp17, induces apoptosis.

PubMed

Choul-Li, Souhaila; Tulasne, David; Aumercier, Marc

2016-11-04

The transcription factor Ets-1 is involved in various physiological processes and invasive pathologies. Human Ets-1 exists under three isoforms: p51, the predominant full-length isoform, p42 and p27, shorter alternatively spliced isoforms. We have previously demonstrated that Ets-1 p51, but not the spliced variant Ets-1 p42, is processed by caspases in vitro and during apoptosis. However, the caspase cleavage of the second spliced variant Ets-1 p27 remains to investigate. In the present study, we demonstrate that Ets-1 p27 is a cleavage substrate of caspases. We show that Ets-1 p27 is processed in vitro by caspase-3, resulting in three C-terminal fragments Cp20, Cp17 and Cp14. Similarly, Ets-1 p27 was cleaved during apoptotic cell death induced by anisomycin, producing fragments consistent with those observed in in vitro cleavage assay. These fragments are generated by cleavage at three sites located in the exon VII-encoded region of Ets-1 p27. As a functional consequences, Cp17 fragment, the major cleavage product generated during apoptosis, induced itself apoptosis when transfected into cells. Our results show that Ets-1 p27 is cleaved in the same manner as Ets-1 p51 within the exon VII-encoded region, thus generating a stable C-terminal fragment that induces cell death by initiating apoptosis. Copyright © 2016 Elsevier Inc. All rights reserved.

Transactivation of involucrin, a marker of differentiation in keratinocytes, by lens epithelium-derived growth factor (LEDGF).

PubMed

Kubo, E; Fatma, N; Sharma, P; Shinohara, T; Chylack, L T; Akagi, Y; Singh, D P

2002-07-26

Human involucrin (hINV), first appears in the cytosol of keratinocytes and ultimately cross-linked to membrane proteins via transglutaminase and forms a protective barrier as an insoluble envelope beneath the plasma membrane. Although the function and evolution of involucrin is known, the regulation of its gene expression is not well understood. An analysis of the hINV gene sequence, upstream of the transcription start site (-534 to +1 nt) revealed the presence of potential sites for binding of lens epithelium-derived growth factor (LEDGF); stress response element (STRE; A/TGGGGA/T) and heat shock element (HSE; nGAAn). We reported earlier that LEDGF activates stress-associated genes by binding to these elements and elevates cellular resistance to various stresses. Here, gel-shift and super-shift assays confirm the binding of LEDGF to the DNA fragments containing HSEs and STREs that are present in the involucrin gene promoter. Furthermore, hINV promoter linked to CAT reporter gene, cotransfected in human corneal simian virus 40-transformed keratinocytes (HCK), was transactivated by LEDGF significantly. In contrast, the activity of hINV promoter bearing mutations at the WT1 (containing HSE and STRE), WT2 (containing STRE) and WT3 (containing STRE) binding sites was diminished. In addition, in HCK cell over-expressing LEDGF, the levels of hINV mRNA and hINV protein are increased by four to five-fold. LEDGF is inducible to oxidants. Cells treated with 12-O-tetradecanoyl-phorbol-13-acetate (TPA), known to stimulate production of H(2)O(2), showed higher levels of LEDGF mRNA. Furthermore, our immunohistochemical studies revealed that hINV protein is found in the cytoplasm of HCK cells over-expressing LEDGF, but not detectable in the normal HCK cells or HCK cells transfected with vector. This regulation appears to be physiologically important, as over-expression of HCK with LEDGF increases the expression of the endogenous hINV gene and may provide new insight to understand the molecular mechanism of transcriptional regulation of this gene. LEDGF may play an important role in establishing an important barrier in corneal keratinocytes by maintaining epidermal turn-over rate, and protecting HCKs against stress.

The Enzyme-Like Domain of Arabidopsis Nuclear β-Amylases Is Critical for DNA Sequence Recognition and Transcriptional Activation.

PubMed

Soyk, Sebastian; Simková, Klára; Zürcher, Evelyne; Luginbühl, Leonie; Brand, Luise H; Vaughan, Cara K; Wanke, Dierk; Zeeman, Samuel C

2014-04-01

Plant BZR1-BAM transcription factors contain a β-amylase (BAM)-like domain, characteristic of proteins involved in starch breakdown. The enzyme-derived domains appear to be noncatalytic, but they determine the function of the two Arabidopsis thaliana BZR1-BAM isoforms (BAM7 and BAM8) during transcriptional initiation. Removal or swapping of the BAM domains demonstrates that the BAM7 BAM domain restricts DNA binding and transcriptional activation, while the BAM8 BAM domain allows both activities. Furthermore, we demonstrate that BAM7 and BAM8 interact on the protein level and cooperate during transcriptional regulation. Site-directed mutagenesis of residues in the BAM domain of BAM8 shows that its function as a transcriptional activator is independent of catalysis but requires an intact substrate binding site, suggesting it may bind a ligand. Microarray experiments with plants overexpressing truncated versions lacking the BAM domain indicate that the pseudo-enzymatic domain increases selectivity for the preferred cis-regulatory element BBRE (BZR1-BAM Responsive Element). Side specificity toward the G-box may allow crosstalk to other signaling networks. This work highlights the importance of the enzyme-derived domain of BZR1-BAMs, supporting their potential role as metabolic sensors. © 2014 American Society of Plant Biologists. All rights reserved.

Astrometric and Photometric Analysis of the September 2008 ATV-1 Re-Entry Event

NASA Technical Reports Server (NTRS)

Mulrooney, Mark K.; Barker, Edwin S.; Maley, Paul D.; Beaulieu, Kevin R.; Stokely, Christopher L.

2008-01-01

NASA utilized Image Intensified Video Cameras for ATV data acquisition from a jet flying at 12.8 km. Afterwards the video was digitized and then analyzed with a modified commercial software package, Image Systems Trackeye. Astrometric results were limited by saturation, plate scale, and imposed linear plate solution based on field reference stars. Time-dependent fragment angular trajectories, velocities, accelerations, and luminosities were derived in each video segment. It was evident that individual fragments behave differently. Photometric accuracy was insufficient to confidently assess correlations between luminosity and fragment spatial behavior (velocity, deceleration). Use of high resolution digital video cameras in future should remedy this shortcoming.

Identification of Mycoparasitism-Related Genes in Trichoderma atroviride ▿ † ‡

PubMed Central

Reithner, Barbara; Ibarra-Laclette, Enrique; Mach, Robert L.; Herrera-Estrella, Alfredo

2011-01-01

A high-throughput sequencing approach was utilized to carry out a comparative transcriptome analysis of Trichoderma atroviride IMI206040 during mycoparasitic interactions with the plant-pathogenic fungus Rhizoctonia solani. In this study, transcript fragments of 7,797 Trichoderma genes were sequenced, 175 of which were host responsive. According to the functional annotation of these genes by KOG (eukaryotic orthologous groups), the most abundant group during direct contact was “metabolism.” Quantitative reverse transcription (RT)-PCR confirmed the differential transcription of 13 genes (including swo1, encoding an expansin-like protein; axe1, coding for an acetyl xylan esterase; and homologs of genes encoding the aspartyl protease papA and a trypsin-like protease, pra1) in the presence of R. solani. An additional relative gene expression analysis of these genes, conducted at different stages of mycoparasitism against Botrytis cinerea and Phytophthora capsici, revealed a synergistic transcription of various genes involved in cell wall degradation. The similarities in expression patterns and the occurrence of regulatory binding sites in the corresponding promoter regions suggest a possible analog regulation of these genes during the mycoparasitism of T. atroviride. Furthermore, a chitin- and distance-dependent induction of pra1 was demonstrated. PMID:21531825

Data on regulation of the gene for the adipocyte-enriched micropeptide Adig/Smaf1 by qPCR analysis and luciferase reporter assay.

PubMed

Ren, Gang; Cairl, Nicholas; Kim, Ji Young; Smas, Cynthia M

2016-12-01

This article describes qPCR analysis for the Adig/Smaf1 gene in multiple in vitro adipocyte differentiation models including white and brown adipogenesis, cell lines and primary cultures. The article also contains qPCR data for transcript levels of Adig/Smaf1 in a wide panel of murine tissues. Expression of Adig/Smaf1 transcript in white and brown adipose tissue in fasted and refed mice is reported and also data for Adig/Smaf1 transcript expression in genetically obese ob/ob mice. Data on the effects of siRNA-mediated knockdown of Srebp1c on Adig/Smaf1 transcript levels in 3T3-L1 adipocytes are shown. Luciferase reporter assays provide data for regulation of an ~ 2 kb fragment of the 5' flanking region of Adig/Smaf1 gene by PPARγ/RXRα. This data is related to a research article describing Adig/Smaf1 protein expression, "Expression, regulation and functional assessment of the 80 amino acid Small Adipocyte Factor 1 (Smaf1) protein in adipocytes" (G. Ren, P. Eskandari, S. Wang, C.M. Smas, 2016) [1].

Structural insight into the TFIIE–TFIIH interaction: TFIIE and p53 share the binding region on TFIIH

PubMed Central

Okuda, Masahiko; Tanaka, Aki; Satoh, Manami; Mizuta, Shoko; Takazawa, Manabu; Ohkuma, Yoshiaki; Nishimura, Yoshifumi

2008-01-01

RNA polymerase II and general transcription factors (GTFs) assemble on a promoter to form a transcription preinitiation complex (PIC). Among the GTFs, TFIIE recruits TFIIH to complete the PIC formation and regulates enzymatic activities of TFIIH. However, the mode of binding between TFIIE and TFIIH is poorly understood. Here, we demonstrate the specific binding of the C-terminal acidic domain (AC-D) of the human TFIIEα subunit to the pleckstrin homology domain (PH-D) of the human TFIIH p62 subunit and describe the solution structures of the free and PH-D-bound forms of AC-D. Although the flexible N-terminal acidic tail from AC-D wraps around PH-D, the core domain of AC-D also interacts with PH-D. AC-D employs an entirely novel binding mode, which differs from the amphipathic helix method used by many transcriptional activators. So the binding surface between PH-D and AC-D is much broader than the specific binding surface between PH-D and the p53 acidic fragments. From our in vitro studies, we demonstrate that this interaction could be a switch to replace p53 with TFIIE on TFIIH in transcription. PMID:18354501

In silico modelling of thiazolidine derivatives with antioxidant potency: Models quantify the degree of contribution of molecular fragments towards the free radical scavenging ability

NASA Astrophysics Data System (ADS)

De, Biplab; Adhikari, Indrani; Nandy, Ashis; Saha, Achintya; Goswami, Binoy Behari

2017-06-01

Design and development of antioxidant supplements constitute an essential aspect of research in order to derive molecules that would help to combat the free radical invasion to the human body and curb oxidative stress related diseases. The present work deals with the development of in silico models for a series of thiazolidine derivatives having antioxidant potential. The objective of the work is to obtain models that would help to design new thazolidine derivatives based on substituent modification and thereby predict their activity profile. The QSAR model thus developed helps in quantification of the extent of contribution of the various molecular fragments towards the activity of the molecules, while the 3D pharmacophore model provides a brief idea of the essential molecular features that help the molecules to interact with the neighbouring free radicals. Both the models have been extensively validated which ensures their predictive ability as well the potential to search molecular databases for selection of thiazolidine derivatives with potent antioxidant activity. The models can thus be utilised effectively for database searching with the aim to isolate active antioxidants belonging to the thiazolidine group.

Structural insights into binding of inhibitors to soluble epoxide hydrolase gained by fragment screening and X-ray crystallography.

PubMed

Amano, Yasushi; Yamaguchi, Tomohiko; Tanabe, Eiki

2014-04-15

Soluble epoxide hydrolase (sEH) is a component of the arachidonic acid cascade and is a candidate target for therapies for hypertension or inflammation. Although many sEH inhibitors are available, their scaffolds are not structurally diverse, and knowledge of their specific interactions with sEH is limited. To obtain detailed structural information about protein-ligand interactions, we conducted fragment screening of sEH, analyzed the fragments using high-throughput X-ray crystallography, and determined 126 fragment-bound structures at high resolution. Aminothiazole and benzimidazole derivatives were identified as novel scaffolds that bind to the catalytic triad of sEH with good ligand efficiency. We further identified fragment hits that bound to subpockets of sEH called the short and long branches. The water molecule conserved in the structure plays an important role in binding to the long branch, whereas Asp496 and the main chain of Phe497 form hydrogen bonds with fragment hits in the short branch. Fragment hits and their crystal structures provide structural insights into ligand binding to sEH that will facilitate the discovery of novel and potent inhibitors of sEH. Copyright © 2014 Elsevier Ltd. All rights reserved.

Discovery of novel dengue virus NS5 methyltransferase non-nucleoside inhibitors by fragment-based drug design.

PubMed

Benmansour, Fatiha; Trist, Iuni; Coutard, Bruno; Decroly, Etienne; Querat, Gilles; Brancale, Andrea; Barral, Karine

2017-01-05

With the aim to help drug discovery against dengue virus (DENV), a fragment-based drug design approach was applied to identify ligands targeting a main component of DENV replication complex: the NS5 AdoMet-dependent mRNA methyltransferase (MTase) domain, playing an essential role in the RNA capping process. Herein, we describe the identification of new inhibitors developed using fragment-based, structure-guided linking and optimization techniques. Thermal-shift assay followed by a fragment-based X-ray crystallographic screening lead to the identification of three fragment hits binding DENV MTase. We considered linking two of them, which bind to proximal sites of the AdoMet binding pocket, in order to improve their potency. X-ray crystallographic structures and computational docking were used to guide the fragment linking, ultimately leading to novel series of non-nucleoside inhibitors of flavivirus MTase, respectively N-phenyl-[(phenylcarbamoyl)amino]benzene-1-sulfonamide and phenyl [(phenylcarbamoyl)amino]benzene-1-sulfonate derivatives, that show a 10-100-fold stronger inhibition of 2'-O-MTase activity compared to the initial fragments. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Biophysical modeling of fragment length distributions of DNA plasmids after X and heavy-ion irradiation analyzed by atomic force microscopy.

PubMed

Elsässer, Thilo; Brons, Stephan; Psonka, Katarzyna; Scholz, Michael; Gudowska-Nowak, Ewa; Taucher-Scholz, Gisela

2008-06-01

The investigation of fragment length distributions of plasmid DNA gives insight into the influence of localized energy distribution on the induction of DNA damage, particularly the clustering of double-strand breaks. We present an approach that determines the fragment length distributions of plasmid DNA after heavy-ion irradiation by using the Local Effect Model. We find a good agreement of our simulations with experimental fragment distributions derived from atomic force microscopy (AFM) studies by including experimental constraints typical for AFM. Our calculations reveal that by comparing the fragmentation in terms of fluence, we can uniquely distinguish the effect of different radiation qualities. For very high-LET irradiation using nickel or uranium ions, no difference between their fragment distributions can be expected for the same dose level. However, for carbon ions with an intermediate LET, the fragmentation pattern differs from the distribution for very high-LET particles. The results of the model calculations can be used to determine the optimal experimental parameters for a demonstration of the influence of track structure on primary radiation damage. Additionally, we compare the results of our model for two different plasmid geometries.

Gas-Phase Chemistry of Arylimido-Functionalized Hexamolybdates [Mo6O19]2-

NASA Astrophysics Data System (ADS)

Cao, Jie; Wang, QianQian; Liu, Chang; An, ShuQi

2018-04-01

The gas-phase fragmentations of a series of arylimido derivatives of hexamolybdate [Mo6O18(NC6H5-n R n )]2- (2-10, where R = CH3, i-C3H7, OCH3, NO2; n = 1 or 2) versus the parent species [Mo6O19]2- (1) were systematically studied using electrospray tandem mass spectrometry (ESI). Fragmentation of 1 generates two molybdate fragments only, [Mo3O10]2- and [Mo4O13]2-, whereas decomposition of 2-10 went through two dissociation pathways in which path A generates a variety of molybdate fragments via breaking the Mo-N bond followed by the cleavages of the multiple Mo-O bonds, whereas path B produces a range of molybdate fragments with arylimido group via breaking the multiple Mo-O bonds on POM framework. Moreover, the presences of mixed-oxidation-state molybdate fragments are characteristic for the fragmentation. The gas-phase stability order obtained by energy-variable collision-induced dissociation (CID) experiment reveals that 2-10 are generally less stable than 1 and substitution on the benzene ring exerts a considerable effect on the stabilization of the hybrid clusters. [Figure not available: see fulltext.

Multiprimer PCR system for differential identification of mycobacteria in clinical samples.

PubMed Central

Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M

1996-01-01

A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008

Scaling invariance of spherical projectile fragmentation upon high-velocity impact on a thin continuous shield

DOE Office of Scientific and Technical Information (OSTI.GOV)

Myagkov, N. N., E-mail: nn-myagkov@mail.ru

The problem of aluminum projectile fragmentation upon high-velocity impact on a thin aluminum shield is considered. A distinctive feature of this description is that the fragmentation has been numerically simulated using the complete system of equations of deformed solid mechanics by a method of smoothed particle hydrodynamics in three-dimensional setting. The transition from damage to fragmentation is analyzed and scaling relations are derived in terms of the impact velocity (V), ratio of shield thickness to projectile diameter (h/D), and ultimate strength (σ{sub p}) in the criterion of projectile and shield fracture. Analysis shows that the critical impact velocity V{sub c}more » (separating the damage and fragmentation regions) is a power function of σ{sub p} and h/D. In the supercritical region (V > V{sub c}), the weight-average fragment mass asymptotically tends to a power function of the impact velocity with exponent independent of h/D and σ{sub p}. Mean cumulative fragment mass distributions at the critical point are scale-invariant with respect to parameters h/D and σ{sub p}. Average masses of the largest fragments are also scale-invariant at V > V{sub c}, but only with respect to variable parameter σ{sub p}.« less

Direct Interaction between Scaffolding Proteins RACK1 and 14-3-3ζ Regulates Brain-derived Neurotrophic Factor (BDNF) Transcription*

PubMed Central

Neasta, Jérémie; Kiely, Patrick A.; He, Dao-Yao; Adams, David R.; O'Connor, Rosemary; Ron, Dorit

2012-01-01

RACK1 is a scaffolding protein that spatially and temporally regulates numerous signaling cascades. We previously found that activation of the cAMP signaling pathway induces the translocation of RACK1 to the nucleus. We further showed that nuclear RACK1 is required to promote the transcription of the brain-derived neurotrophic factor (BDNF). Here, we set out to elucidate the mechanism underlying cAMP-dependent RACK1 nuclear translocation and BDNF transcription. We identified the scaffolding protein 14-3-3ζ as a direct binding partner of RACK1. Moreover, we found that 14-3-3ζ was necessary for the cAMP-dependent translocation of RACK1 to the nucleus. We further observed that the disruption of RACK1/14-3-3ζ interaction with a peptide derived from the RACK1/14-3-3ζ binding site or shRNA-mediated 14-3-3ζ knockdown inhibited cAMP induction of BDNF transcription. Together, these data reveal that the function of nuclear RACK1 is mediated through its interaction with 14-3-3ζ. As RACK1 and 14-3-3ζ are two multifunctional scaffolding proteins that coordinate a wide variety of signaling events, their interaction is likely to regulate other essential cellular functions. PMID:22069327

Biomarker responses in zebrafish (Danio rerio) larvae exposed to pristine low-density polyethylene fragments.

PubMed

Karami, Ali; Groman, David B; Wilson, Scott P; Ismail, Patimah; Neela, Vasantha K

2017-04-01

There are serious concerns over the adverse impacts of microplastics (MPs) on living organisms. The main objective of this study was to test the effects of MPs on the total length, weight, condition factor (CF), transcriptional level of antioxidant, anti and pro-apoptotic, and neurotransmitter genes, and the histopathology of the gill, liver, brain, kidney, and intestine in the larvae of zebrafish (Danio rerio). Fish were exposed to one of three levels of pristine low-density polyethylene (LDPE) fragments (5, 50, or 500 μg/L) for 10 or 20 days. No significant changes were observed in any of the selected biomarkers across MP concentrations at days 10 or 20. The expression of casp9 (caspase 9, apoptosis-related cysteine protease), casp3a (caspase 3, apoptosis-related cysteine protease a) and cat (catalase), however, were significantly lower in the larvae sampled at day 20 than day 10. We provide evidence that virgin short-term exposure to LDPE fragments has minimal impact on biomarker responses in D. rerio larvae. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development and Validation of an Immuno-PET Tracer as a Companion Diagnostic Agent for Antibody-Drug Conjugate Therapy to Target the CA6 Epitope.

PubMed

Ilovich, Ohad; Natarajan, Arutselvan; Hori, Sharon; Sathirachinda, Ataya; Kimura, Richard; Srinivasan, Ananth; Gebauer, Mathias; Kruip, Jochen; Focken, Ingo; Lange, Christian; Carrez, Chantal; Sassoon, Ingrid; Blanc, Veronique; Sarkar, Susanta K; Gambhir, Sanjiv S

2015-07-01

To develop and compare three copper 64 ((64)Cu)-labeled antibody fragments derived from a CA6-targeting antibody (huDS6) as immuno-positron emission tomography (immuno-PET)-based companion diagnostic agents for an antibody-drug conjugate by using huDS6. Three antibody fragments derived from huDS6 were produced, purified, conjugated to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), and evaluated in the following ways: (a) the affinity of the fragments and the DOTA conjugates was measured via flow cytometry, (b) the stability of the labeled fragments was determined ex vivo in human serum over 24 hours, and (c) comparison of the in vivo imaging potential of the fragments was evaluated in mice bearing subcutaneous CA6-positive and CA6-negative xenografts by using serial PET imaging and biodistribution. Isotype controls with antilysozyme and anti-DM4 B-Fabs and blocking experiments with an excess of either B-Fab or huDS6 were used to determine the extent of the antibody fragment (64)Cu-DOTA-B-Fab binding specificity. Immunoreactivity and tracer kinetics were evaluated by using cellular uptake and 48-hour imaging experiments, respectively. Statistical analyses were performed by using t tests, one-way analysis of variance, and Wilcoxon and Mann-Whitney tests. The antibody fragment (64)Cu-DOTA-B-Fab was more than 95% stable after 24 hours in human serum, had an immunoreactivity of more than 70%, and allowed differentiation between CA6-positive and CA6-negative tumors in vivo as early as 6 hours after injection, with a 1.7-fold uptake ratio between tumors. Isotype and blocking studies experiments showed tracer-specific uptake in antigen-positive tumors, despite some nonspecific uptake in both tumor models. Three antibody fragments were produced and examined as potential companion diagnostic agents. (64)Cu-DOTA-B-Fab is a stable and effective immuno-PET tracer for CA6 imaging in vivo.

Development and Validation of an Immuno-PET Tracer as a Companion Diagnostic Agent for Antibody-Drug Conjugate Therapy to Target the CA6 Epitope

PubMed Central

Ilovich, Ohad; Natarajan, Arutselvan; Hori, Sharon; Sathirachinda, Ataya; Kimura, Richard; Srinivasan, Ananth; Gebauer, Mathias; Kruip, Jochen; Focken, Ingo; Lange, Christian; Carrez, Chantal; Sassoon, Ingrid; Blanc, Veronique; Sarkar, Susanta K.

2015-01-01

Purpose To develop and compare three copper 64 (64Cu)–labeled antibody fragments derived from a CA6-targeting antibody (huDS6) as immuno-positron emission tomography (immuno-PET)–based companion diagnostic agents for an antibody-drug conjugate by using huDS6. Materials and Methods Three antibody fragments derived from huDS6 were produced, purified, conjugated to 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid (DOTA), and evaluated in the following ways: (a) the affinity of the fragments and the DOTA conjugates was measured via flow cytometry, (b) the stability of the labeled fragments was determined ex vivo in human serum over 24 hours, and (c) comparison of the in vivo imaging potential of the fragments was evaluated in mice bearing subcutaneous CA6-positive and CA6-negative xenografts by using serial PET imaging and biodistribution. Isotype controls with antilysozyme and anti-DM4 B-Fabs and blocking experiments with an excess of either B-Fab or huDS6 were used to determine the extent of the antibody fragment 64Cu-DOTA-B-Fab binding specificity. Immunoreactivity and tracer kinetics were evaluated by using cellular uptake and 48-hour imaging experiments, respectively. Statistical analyses were performed by using t tests, one-way analysis of variance, and Wilcoxon and Mann-Whitney tests. Results The antibody fragment 64Cu-DOTA-B-Fab was more than 95% stable after 24 hours in human serum, had an immunoreactivity of more than 70%, and allowed differentiation between CA6-positive and CA6-negative tumors in vivo as early as 6 hours after injection, with a 1.7-fold uptake ratio between tumors. Isotype and blocking studies experiments showed tracer-specific uptake in antigen-positive tumors, despite some nonspecific uptake in both tumor models. Conclusion Three antibody fragments were produced and examined as potential companion diagnostic agents. 64Cu-DOTA-B-Fab is a stable and effective immuno-PET tracer for CA6 imaging in vivo. © RSNA, 2015 Online supplemental material is available for this article. PMID:25734548

Gene transcription ontogeny of hypothalamic-pituitary-thyroid axis development in early-life stage fathead minnow and zebrafish.

PubMed

Vergauwen, Lucia; Cavallin, Jenna E; Ankley, Gerald T; Bars, Chloé; Gabriëls, Isabelle J; Michiels, Ellen D G; Fitzpatrick, Krysta R; Periz-Stanacev, Jelena; Randolph, Eric C; Robinson, Serina L; Saari, Travis W; Schroeder, Anthony L; Stinckens, Evelyn; Swintek, Joe; Van Cruchten, Steven J; Verbueken, Evy; Villeneuve, Daniel L; Knapen, Dries

2018-05-04

The hypothalamic-pituitary-thyroid (HPT) axis is known to play a crucial role in the development of teleost fish. However, knowledge of endogenous transcription profiles of thyroid-related genes in developing teleosts remains fragmented. We selected two model teleost species, the fathead minnow (Pimephales promelas) and the zebrafish (Danio rerio), to compare the gene transcription ontogeny of the HPT axis. Control organisms were sampled at several time points during embryonic and larval development until 33 days post-fertilization. Total RNA was extracted from pooled, whole fish, and thyroid-related mRNA expression was evaluated using quantitative polymerase chain reaction. Gene transcripts examined included: thyrotropin-releasing hormone receptor (trhr), thyroid-stimulating hormone receptor (tshr), sodium-iodide symporter (nis), thyroid peroxidase (tpo), thyroglobulin (tg), transthyretin (ttr), deiodinases 1, 2, 3a, and 3b (dio1, dio2, dio3a and 3b), and thyroid hormone receptors alpha and beta (thrα and β). A loess regression method was successful in identifying maxima and minima of transcriptional expression during early development of both species. Overall, we observed great similarities between the species, including maternal transfer, at least to some extent, of almost all transcripts (confirmed in unfertilized eggs), increasing expression of most transcripts during hatching and embryo-larval transition, and indications of a fully functional HPT axis in larvae. These data will aid in the development of hypotheses on the role of certain genes and pathways during development. Furthermore, this provides a background reference dataset for designing and interpreting targeted transcriptional expression studies both for fundamental research and for applications such as toxicology. Copyright © 2018 Elsevier Inc. All rights reserved.