Chang, D D; Clayton, D A
1986-01-01
Transcription of the heavy strand of mouse mitochondrial DNA starts from two closely spaced, distinct sites located in the displacement loop region of the genome. We report here an analysis of regulatory sequences required for faithful transcription from these two sites. Data obtained from in vitro assays demonstrated that a 51-base-pair region, encompassing nucleotides -40 to +11 of the downstream start site, contains sufficient information for accurate transcription from both start sites. Deletion of the 3' flanking sequences, including one or both start sites to -17, resulted in the initiation of transcription by the mitochondrial RNA polymerase from alternative sites within vector DNA sequences. This feature places the mouse heavy-strand promoter uniquely among other known mitochondrial promoters, all of which absolutely require cognate start sites for transcription. Comparison of the heavy-strand promoter with those of other vertebrate mitochondrial DNAs revealed a remarkably high rate of sequence divergence among species. Images PMID:3785226
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
Genome-wide transcription start site profiling in biofilm-grown Burkholderia cenocepacia J2315.
Sass, Andrea M; Van Acker, Heleen; Förstner, Konrad U; Van Nieuwerburgh, Filip; Deforce, Dieter; Vogel, Jörg; Coenye, Tom
2015-10-13
Burkholderia cenocepacia is a soil-dwelling Gram-negative Betaproteobacterium with an important role as opportunistic pathogen in humans. Infections with B. cenocepacia are very difficult to treat due to their high intrinsic resistance to most antibiotics. Biofilm formation further adds to their antibiotic resistance. B. cenocepacia harbours a large, multi-replicon genome with a high GC-content, the reference genome of strain J2315 includes 7374 annotated genes. This study aims to annotate transcription start sites and identify novel transcripts on a whole genome scale. RNA extracted from B. cenocepacia J2315 biofilms was analysed by differential RNA-sequencing and the resulting dataset compared to data derived from conventional, global RNA-sequencing. Transcription start sites were annotated and further analysed according to their position relative to annotated genes. Four thousand ten transcription start sites were mapped over the whole B. cenocepacia genome and the primary transcription start site of 2089 genes expressed in B. cenocepacia biofilms were defined. For 64 genes a start codon alternative to the annotated one was proposed. Substantial antisense transcription for 105 genes and two novel protein coding sequences were identified. The distribution of internal transcription start sites can be used to identify genomic islands in B. cenocepacia. A potassium pump strongly induced only under biofilm conditions was found and 15 non-coding small RNAs highly expressed in biofilms were discovered. Mapping transcription start sites across the B. cenocepacia genome added relevant information to the J2315 annotation. Genes and novel regulatory RNAs putatively involved in B. cenocepacia biofilm formation were identified. These findings will help in understanding regulation of B. cenocepacia biofilm formation.
Jenks, M Harley; O'Rourke, Thomas W; Reines, Daniel
2008-06-01
The IMD2 gene in Saccharomyces cerevisiae is regulated by intracellular guanine nucleotides. Regulation is exerted through the choice of alternative transcription start sites that results in synthesis of either an unstable short transcript terminating upstream of the start codon or a full-length productive IMD2 mRNA. Start site selection is dictated by the intracellular guanine nucleotide levels. Here we have mapped the polyadenylation sites of the upstream, unstable short transcripts that form a heterogeneous family of RNAs of approximately 200 nucleotides. The switch from the upstream to downstream start sites required the Rpb9 subunit of RNA polymerase II. The enzyme's ability to locate the downstream initiation site decreased exponentially as the start was moved downstream from the TATA box. This suggests that RNA polymerase II's pincer grip is important as it slides on DNA in search of a start site. Exosome degradation of the upstream transcripts was highly dependent upon the distance between the terminator and promoter. Similarly, termination was dependent upon the Sen1 helicase when close to the promoter. These findings extend the emerging concept that distinct modes of termination by RNA polymerase II exist and that the distance of the terminator from the promoter, as well as its sequence, is important for the pathway chosen.
Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred
2014-11-20
Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Xin; Huang, Danping; Jia, Xiwei; Zou, Zhihua; Wang, Yilei; Zhang, Ziping
2018-04-01
In this study, the 5'-flanking region of molt-inhibiting hormone (MIH) gene was cloned by Tail-PCR. It is 2024 bp starting from the translation initiation site, and 1818 bp starting from the predicted transcription start site. Forecast analysis results by the bioinformatics software showed that the transcription start site is located at 207 bp upstream of the start codon ATG, and TATA box is located at 240 bp upstream of the start codon ATG. Potential transcription factor binding sites include Sp1, NF-1, Oct-1, Sox-2, RAP1, and so on. There are two CpG islands, located at -25- +183 bp and -1451- -1316 bp respectively. The transfection results of luciferase reporter constructs showed that the core promoter region was located in the fragment -308 bp to -26 bp. NF-kappaB and RAP1 were essential for mih basal transcriptional activity. There are three kinds of polymorphism CA in the 5'-flanking sequence, and they can influence mih promoter activity. These findings provide a genetic foundation of the further research of mih transcription regulation. Copyright © 2017 Elsevier Inc. All rights reserved.
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
Komatsu, Ken; Hirata, Hisae; Fukagawa, Takako; Yamaji, Yasuyuki; Okano, Yukari; Ishikawa, Kazuya; Adachi, Tatsushi; Maejima, Kensaku; Hashimoto, Masayoshi; Namba, Shigetou
2012-07-01
The first open-reading frame (ORF) of apple stem grooving virus (ASGV), of the genus Capillovirus, encodes an apparently chimeric polyprotein containing conserved regions for replicase (Rep) and coat protein (CP). However, our previous study revealed that ASGV mutants with distinct and discontinuous Rep- and CP-coding regions successfully infect plants, indicating that CP expressed via a subgenomic RNA (sgRNA) is sufficient for viability of the virus. Here we identified a transcription start site of the CP sgRNA and revealed that CP translated from the sgRNA is essential for ASGV infection. We mapped the transcription start sites of both the CP and the movement protein (MP) sgRNAs of ASGV and found a hexanucleotide motif, UUAGGU, conserved upstream from both sgRNA transcription start sites. Mutational analysis of the putative CP initiation codon and of the UUAGGU sequence upstream from the transcription start site of CP sgRNA demonstrated their importance for ASGV accumulation. Our results also demonstrated that potato virus T (PVT), an unassigned species closely related to ASGV, produces two sgRNAs putatively deployed for the CP and MP expression and that the same hexanucleotide motif as found in ASGV is located upstream from the transcription start sites of both sgRNAs. This motif, which constituted putative core elements of the sgRNA promoter, is broadly conserved among viruses in the families Alphaflexiviridae and Betaflexiviridae, suggesting that the gene expression strategy of the viruses in both families has been conserved throughout evolution. Copyright © 2012 Elsevier B.V. All rights reserved.
Identification of candidate transcription factor binding sites in the cattle genome
USDA-ARS?s Scientific Manuscript database
A resource that provides candidate transcription factor binding sites does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future 'omics studies to develop transcriptional regulation hypotheses. In order to generate this resour...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Lei
2008-01-01
Open reading frame 11 (ORF11) of Kaposi's sarcoma-associated herpesvirus belongs to a herpesviral homologous protein family shared by some members of the gamma- herpesvirus subfamily. Little is known about this ORF11 homologous protein family. We have characterized an unknown open reading frame, ORF11, located adjacent and in the opposite orientation to a well-characterized viral IL-6 gene. Northern blot analysis reveals that ORF11 is expressed during the KSHV lytic cycle with delayed-early transcription kinetics. We have determined the 5{prime} and 3{prime} untranslated region of the unspliced ORF11 transcript and identified both the transcription start site and the transcription termination site. Coremore » promoter region, representing ORF11 promoter activity, was mapped to a 159nt fragment 5{prime} most proximal to the transcription start site. A functional TATA box was identified in the core promoter region. Interestingly, we found that ORF11 transcriptional activation is not responsive to Rta, the KSHV lytic switch protein. We also discovered that part of the ORF11 promoter region, the 209nt fragment upstream of the transcription start site, was repressed by phorbol esters. Our data help to understand transcription regulation of ORF11 and to elucidate roles of ORF11 in KSHV pathogenesis and life cycle.« less
You, Qi; Yan, Hengyu; Liu, Yue; Yi, Xin; Zhang, Kang; Xu, Wenying; Su, Zhen
2017-05-01
The 22-nucleotide non-coding microRNAs (miRNAs) are mostly transcribed by RNA polymerase II and are similar to protein-coding genes. Unlike the clear process from stem-loop precursors to mature miRNAs, the primary transcriptional regulation of miRNA, especially in plants, still needs to be further clarified, including the original transcription start site, functional cis-elements and primary transcript structures. Due to several well-characterized transcription signals in the promoter region, we proposed a systemic approach integrating multidimensional "omics" (including genomics, transcriptomics, and epigenomics) data to improve the genome-wide identification of primary miRNA transcripts. Here, we used the model plant Arabidopsis thaliana to improve the ability to identify candidate promoter locations in intergenic miRNAs and to determine rules for identifying primary transcription start sites of miRNAs by integrating high-throughput omics data, such as the DNase I hypersensitive sites, chromatin immunoprecipitation-sequencing of polymerase II and H3K4me3, as well as high throughput transcriptomic data. As a result, 93% of refined primary transcripts could be confirmed by the primer pairs from a previous study. Cis-element and secondary structure analyses also supported the feasibility of our results. This work will contribute to the primary transcriptional regulatory analysis of miRNAs, and the conserved regulatory pattern may be a suitable miRNA characteristic in other plant species.
Thomason, Maureen K.; Bischler, Thorsten; Eisenbart, Sara K.; Förstner, Konrad U.; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay
2014-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. PMID:25266388
Dissecting transcription-coupled and global genomic repair in the chromatin of yeast GAL1-10 genes.
Li, Shisheng; Smerdon, Michael J
2004-04-02
Transcription-coupled repair (TCR) and global genomic repair (GGR) of UV-induced cyclobutane pyrimidine dimers were investigated in the yeast GAL1-10 genes. Both Rpb9- and Rad26-mediated TCR are confined to the transcribed strands, initiating at upstream sites approximately 100 nucleotides from the upstream activating sequence shared by the two genes. However, TCR initiation sites do not correlate with either transcription start sites or TATA boxes. Rad16-mediated GGR tightly correlates with nucleosome positioning when the genes are repressed and are slow in the nucleosome core and fast in linker DNA. Induction of transcription enhanced GGR in nucleosome core DNA, especially in the nucleosomes around and upstream of the transcription start sites. Furthermore, when the genes were induced, GGR was slower in the transcribed regions than in the upstream regions. Finally, simultaneous deletion of RAD16, RAD26, and RPB9 resulted in no detectable repair in all sites along the region analyzed. Our results suggest that (a). TCR may be initiated by a transcription activator, presumably through the loading of RNA polymerase II, rather than by transcription initiation or elongation per se; (b). TCR and nucleosome disruption-enhanced GGR are the major causes of rapid repair in regions around and upstream of transcription start sites; (c). transcription machinery may hinder access of NER factors to a DNA lesion in the absence of a transcription-repair coupling factor; and (d). other than GGR mediated by Rad16 and TCR mediated by Rad26 and Rpb9, no other nucleotide excision repair pathway exists in these RNA polymerase II-transcribed genes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farajzadeh, Leila; Hornshøj, Henrik; Momeni, Jamal
Highlights: •Transcriptome sequencing yielded 223 mill porcine RNA-seq reads, and 59,000 transcribed locations. •Establishment of unique transcription profiles for ten porcine tissues including four brain tissues. •Comparison of transcription profiles at gene, isoform, promoter and transcription start site level. •Highlights a high level of regulation of neuro-related genes at both gene, isoform, and TSS level. •Our results emphasize the pig as a valuable animal model with respect to human biological issues. -- Abstract: The transcriptome is the absolute set of transcripts in a tissue or cell at the time of sampling. In this study RNA-Seq is employed to enable themore » differential analysis of the transcriptome profile for ten porcine tissues in order to evaluate differences between the tissues at the gene and isoform expression level, together with an analysis of variation in transcription start sites, promoter usage, and splicing. Totally, 223 million RNA fragments were sequenced leading to the identification of 59,930 transcribed gene locations and 290,936 transcript variants using Cufflinks with similarity to approximately 13,899 annotated human genes. Pairwise analysis of tissues for differential expression at the gene level showed that the smallest differences were between tissues originating from the porcine brain. Interestingly, the relative level of differential expression at the isoform level did generally not vary between tissue contrasts. Furthermore, analysis of differential promoter usage between tissues, revealed a proportionally higher variation between cerebellum (CBE) versus frontal cortex and cerebellum versus hypothalamus (HYP) than in the remaining comparisons. In addition, the comparison of differential transcription start sites showed that the number of these sites is generally increased in comparisons including hypothalamus in contrast to other pairwise assessments. A comprehensive analysis of one of the tissue contrasts, i.e. cerebellum versus heart for differential variation at the gene, isoform, and transcription start site (TSS), and promoter level showed that several of the genes differed at all four levels. Interestingly, these genes were mainly annotated to the “electron transport chain” and neuronal differentiation, emphasizing that “tissue important” genes are regulated at several levels. Furthermore, our analysis shows that the “across tissue approach” has a promising potential when screening for possible explanations for variations, such as those observed at the gene expression levels.« less
Grichnik, J M; French, B A; Schwartz, R J
1988-01-01
The chicken skeletal alpha-actin gene promoter region (-202 to -12) provides myogenic transcriptional specificity. This promoter contains partial dyad symmetry about an axis at nucleotide -108 and in transfection experiments is capable of directing transcription in a bidirectional manner. At least three different transcription initiation start sites, oriented toward upstream sequences, were mapped 25 to 30 base pairs from TATA-like regions. The opposing transcriptional activity was potentiated upon the deletion of sequences proximal to the alpha-actin transcription start site. Thus, sequences which serve to position RNA polymerase for alpha-actin transcription may allow, in their absence, the selection of alternative and reverse-oriented start sites. Nuclear runoff transcription assays of embryonic muscle indicated that divergent transcription may occur in vivo but with rapid turnover of nuclear transcripts. Divergent transcriptional activity enabled us to define the 3' regulatory boundary of the skeletal alpha-actin promoter which retains a high level of myogenic transcriptional activity. The 3' regulatory border was detected when serial 3' deletions bisected the element (-91 CCAAA TATGG -82) which reduced transcriptional activity by 80%. Previously we showed that disruption of its upstream counterpart (-127 CCAAAGAAGG -136) resulted in about a 90% decrease in activity. These element pairs, which we describe as CCAAT box-associated repeats, are conserved in all sequenced vertebrate sarcomeric actin genes and may act in a cooperative manner to facilitate transcription in myogenic cells. Images PMID:3211124
Thomason, Maureen K; Bischler, Thorsten; Eisenbart, Sara K; Förstner, Konrad U; Zhang, Aixia; Herbig, Alexander; Nieselt, Kay; Sharma, Cynthia M; Storz, Gisela
2015-01-01
While the model organism Escherichia coli has been the subject of intense study for decades, the full complement of its RNAs is only now being examined. Here we describe a survey of the E. coli transcriptome carried out using a differential RNA sequencing (dRNA-seq) approach, which can distinguish between primary and processed transcripts, and an automated prediction algorithm for transcriptional start sites (TSS). With the criterion of expression under at least one of three growth conditions examined, we predicted 14,868 TSS candidates, including 5,574 internal to annotated genes (iTSS) and 5,495 TSS corresponding to potential antisense RNAs (asRNAs). We examined expression of 14 candidate asRNAs by Northern analysis using RNA from wild-type E. coli and from strains defective for RNases III and E, two RNases reported to be involved in asRNA processing. Interestingly, nine asRNAs detected as distinct bands by Northern analysis were differentially affected by the rnc and rne mutations. We also compared our asRNA candidates with previously published asRNA annotations from RNA-seq data and discuss the challenges associated with these cross-comparisons. Our global transcriptional start site map represents a valuable resource for identification of transcription start sites, promoters, and novel transcripts in E. coli and is easily accessible, together with the cDNA coverage plots, in an online genome browser. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Chromatin potentiates transcription
Nagai, Shigeki; Davis, Ralph E.; Mattei, Pierre Jean; Eagen, Kyle Patrick; Kornberg, Roger D.
2017-01-01
Chromatin isolated from the chromosomal locus of the PHO5 gene of yeast in a transcriptionally repressed state was transcribed with 12 pure proteins (80 polypeptides): RNA polymerase II, six general transcription factors, TFIIS, the Pho4 gene activator protein, and the SAGA, SWI/SNF, and Mediator complexes. Contrary to expectation, a nucleosome occluding the TATA box and transcription start sites did not impede transcription but rather, enhanced it: the level of chromatin transcription was at least sevenfold greater than that of naked DNA, and chromatin gave patterns of transcription start sites closely similar to those occurring in vivo, whereas naked DNA gave many aberrant transcripts. Both histone acetylation and trimethylation of H3K4 (H3K4me3) were important for chromatin transcription. The nucleosome, long known to serve as a general gene repressor, thus also performs an important positive role in transcription. PMID:28137832
Renovell, Agueda; Gago, Selma; Ruiz-Ruiz, Susana; Velázquez, Karelia; Navarro, Luis; Moreno, Pedro; Vives, Mari Carmen; Guerri, José
2010-10-25
Citrus leaf blotch virus has a single-stranded positive-sense genomic RNA (gRNA) of 8747 nt organized in three open reading frames (ORFs). The ORF1, encoding a polyprotein involved in replication, is translated directly from the gRNA, whereas ORFs encoding the movement (MP) and coat (CP) proteins are expressed via 3' coterminal subgenomic RNAs (sgRNAs). We characterized the minimal promoter region critical for the CP-sgRNA expression in infected cells by deletion analyses using Agrobacterium-mediated infection of Nicotiana benthamiana plants. The minimal CP-sgRNA promoter was mapped between nucleotides -67 and +50 nt around the transcription start site. Surprisingly, larger deletions in the region between the CP-sgRNA transcription start site and the CP translation initiation codon resulted in increased CP-sgRNA accumulation, suggesting that this sequence could modulate the CP-sgRNA transcription. Site-specific mutational analysis of the transcription start site revealed that the +1 guanylate and the +2 adenylate are important for CP-sgRNA synthesis. Copyright © 2010 Elsevier Inc. All rights reserved.
Qiao, Huan; May, James M.
2012-01-01
Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872
Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A
1990-01-01
Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322
Takaoka, N; Fukuzawa, M; Saito, T; Sakaitani, T; Ochiai, H
1999-10-28
We cloned a genomic fragment of the membrane protein gp64 gene of the cellular slime mold Polysphondylium pallidum by inverse PCR. Primer extension analysis identified a major transcription start site 65 bp upstream of the translation start codon. The promoter region of the gp64 gene contains sequences homologous to a TATA box at position -47 to -37 and to an initiator (Inr, PyPyCAPyPyPyPy) at position -3 to +5 from the transcription start site. Successively truncated segments of the promoter were tested for their ability to drive expression of the beta-galactosidase reporter gene in transformed cells; also the difference in activity between growth conditions was compared. The results indicated that there are two positive vegetative regulatory elements extending between -187 and -62 bp from the transcription start site of the gp64 promoter; also their activity was two to three times higher in the cells grown with bacteria in shaken suspension than in the cells grown in an axenic medium.
Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée
1998-01-01
The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142
Bochkareva, Aleksandra; Zenkin, Nikolay
2013-01-01
The mechanisms of abortive synthesis and promoter escape during initiation of transcription are poorly understood. Here, we show that, after initiation of RNA synthesis, non-specific interaction of σ70 region 1.2, present in all σ70 family factors, with the non-template strand around position −4 relative to the transcription start site facilitates unwinding of the DNA duplex downstream of the transcription start site. This leads to stabilization of short RNA products and allows their extension, i.e. promoter escape. We show that this activity of σ70 region 1.2 is assisted by the β-lobe domain, but does not involve the β′-rudder or the β′-switch-2, earlier proposed to participate in promoter escape. DNA sequence independence of this function of σ70 region 1.2 suggests that it may be conserved in all σ70 family factors. Our results indicate that the abortive nature of initial synthesis is caused, at least in part, by failure to open the downstream DNA by the β-lobe and σ region 1.2. PMID:23430153
Genomic structure and chromosomal mapping of the human CD22 gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilson, G.L.; Kozlow, E.; Kehrl, J.H.
1993-06-01
The human CD22 gene is expressed specifically in B lymphocytes and likely has an important function in cell-cell interactions. A nearly full length human CD22 cDNA clone was used to isolate genomic clones that span the CD22 gene. The CD22 gene is spread over 22 kb of DNA and is composed of 15 exons. The first exon contains the major transcriptional start sites. The translation initiation codon is located in exon 3, which also encodes a portion of the signal peptide. Exons 4 to 10 encode the seven Ig domains of CD22, exon 11 encodes the transmembrane domain, exons 12more » to 15 encode the intracytoplasmic domain of CD22, and exon 15 also contains the 3' untranslated region. A minor form of CD22 mRNA likely results from splicing of exon 5 to exon 8, skipping exons 6 and 7. A 4.6-kb Xbal fragment of the CD22 gene was used to map the chromosomal location of CD22 by fluorescence in situ hybridization. The hybridization locus was identified by combining fluorescent images of the probe with the chromosomal banding pattern generated by an Alu probe. The results demonstrate the CD22 is located within the band region q13.1 of chromosome 19. Two closely clustered major transcription start sites and several minor start sites were mapped by primer extension. Similarly to many other lymphoid-specific genes, the CD22 promoter lacks an obvious TATA box. Approximately 4 kb of DNA 5' of the transcription start sites were sequenced and found to contain multiple Alu elements. Potential binding sites for the transcriptional factors NF-kB, AP-1, and Oct-2 are located within 300 bp 5' of the major transcription start sites. A 400-bp fragment (bp -339 through +71) of the CD22 promoter region was subcloned into a pGEM-chloramphenicol acetyltransferase vector and after transfection into B and T cells was found to be active in both B and T cells. 45 refs., 7 figs., 2 tabs.« less
Transcription start site associated RNAs (TSSaRNAs) are ubiquitous in all domains of life.
Zaramela, Livia S; Vêncio, Ricardo Z N; ten-Caten, Felipe; Baliga, Nitin S; Koide, Tie
2014-01-01
A plethora of non-coding RNAs has been discovered using high-resolution transcriptomics tools, indicating that transcriptional and post-transcriptional regulation is much more complex than previously appreciated. Small RNAs associated with transcription start sites of annotated coding regions (TSSaRNAs) are pervasive in both eukaryotes and bacteria. Here, we provide evidence for existence of TSSaRNAs in several archaeal transcriptomes including: Halobacterium salinarum, Pyrococcus furiosus, Methanococcus maripaludis, and Sulfolobus solfataricus. We validated TSSaRNAs from the model archaeon Halobacterium salinarum NRC-1 by deep sequencing two independent small-RNA enriched (RNA-seq) and a primary-transcript enriched (dRNA-seq) strand-specific libraries. We identified 652 transcripts, of which 179 were shown to be primary transcripts (∼7% of the annotated genome). Distinct growth-associated expression patterns between TSSaRNAs and their cognate genes were observed, indicating a possible role in environmental responses that may result from RNA polymerase with varying pausing rhythms. This work shows that TSSaRNAs are ubiquitous across all domains of life.
Yukawa, Yasushi; Akama, Kazuhito; Noguchi, Kanta; Komiya, Masaaki; Sugiura, Masahiro
2013-01-10
Nuclear tRNA genes are transcribed by RNA polymerase III. The A- and B-boxes located within the transcribed regions are essential promoter elements for nuclear tRNA gene transcription. The Arabidopsis genome contains ten annotated genes encoding identical tRNA(Lys)(UUU) molecules, which are scattered on the five chromosomes. In this study, we prepared ten tDNA constructs including each of the tRNA(Lys)(UUU) coding sequences with their individual 5' and 3' flanking sequences, and assayed tRNA expression using an in vitro RNA polymerase III-dependent transcription system. Transcription levels differed significantly among the ten genes and two of the tRNA genes were transcribed at a very low level, despite possessing A- and B-boxes identical to those of the other tRNA genes. To examine whether the in vitro results were reproducible in vivo, the 5' flanking sequence of an amber suppressor tRNA gene was then replaced with those of the ten tRNA(Lys) genes. An in vivo experiment based on an amber suppressor tRNA that mediates suppression of a premature amber codon in a β-glucuronidase (GUS) reporter gene in plant tissues generated nearly identical results to those obtained in vitro. Analysis of mutated versions of the amber suppressor tRNA gene, which contained base substitutions around the transcription start site (TSS), showed that the context around the transcription start sites is a crucial determinant for transcription of plant tRNA(Lys)(UUU) both in vitro and in vivo. The above transcription regulation by context around TSS differed between tRNA genes and other Pol III-dependent genes. Copyright © 2012 Elsevier B.V. All rights reserved.
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Wu, C J; Janssen, G R
1996-10-01
The Streptomyces vinaceus viomycin phosphotransferase (vph) mRNA contains an untranslated leader with a conventional Shine-Dalgarno homology. The vph leader was removed by ligation of the vph coding sequence to the transcriptional start site of a Streptomyces or an Escherichia coli promoter, such that transcription would initiate at the first position of the vph start codon. Analysis of mRNA demonstrated that transcription initiated primarily at the A of the vph AUG translational start codon in both Streptomyces lividans and E. coli; cells expressing the unleadered vph mRNA were resistant to viomycin indicating that the Shine-Dalgarno sequence, or other features contained within the leader, was not necessary for vph translation. Addition of four nucleotides (5'-AUGC-3') onto the 5' end of the unleadered vph mRNA resulted in translation initiation from the vph start codon and the AUG triplet contained within the added sequence. Translational fusions of vph sequence to a Tn5 neo reporter gene indicated that the first 16 codons of vph coding sequence were sufficient to specify the translational start site and reading frame for expression of neomycin resistance in both E. coli and S. lividans.
Kinetic Competition between Elongation Rate and Binding of NELF Controls Promoter Proximal Pausing
Li, Jian; Liu, Yingyun; Rhee, Ho Sung; Ghosh, Saikat Kumar B.; Bai, Lu; Pugh, B. Franklin; Gilmour, David S.
2013-01-01
Summary Pausing of RNA polymerase II (Pol II) 20-60 bp downstream of transcription start sites is a major checkpoint during transcription in animal cells. Mechanisms that control pausing are largely unknown. We developed permanganate-ChIP-seq to evaluate the state of Pol II at promoters throughout the Drosophila genome, and a biochemical system that reconstitutes promoter-proximal pausing to define pausing mechanisms. Stable open complexes of Pol II are largely absent from the transcription start sites of most mRNA genes, but are present at snRNA genes and the highly transcribed heat shock genes following their induction. The location of the pause is influenced by the timing between when NELF loads onto Pol II and how fast Pol II escapes the promoter region. Our biochemical analysis reveals that the sequence-specific transcription factor, GAF, orchestrates efficient pausing by recruiting NELF to promoters before transcription initiation and by assisting in loading NELF onto Pol II after initiation. PMID:23746353
2013-01-01
Background The ACVR1 gene encodes a type I receptor for bone morphogenetic proteins (BMPs). Mutations in the ACVR1 gene are associated with Fibrodysplasia Ossificans Progressiva (FOP), a rare and extremely disabling disorder characterized by congenital malformation of the great toes and progressive heterotopic endochondral ossification in muscles and other non-skeletal tissues. Several aspects of FOP pathophysiology are still poorly understood, including mechanisms regulating ACVR1 expression. This work aimed to identify regulatory elements that control ACVR1 gene transcription. Methods and results We first characterized the structure and composition of human ACVR1 gene transcripts by identifying the transcription start site, and then characterized a 2.9 kb upstream region. This region showed strong activating activity when tested by reporter gene assays in transfected cells. We identified specific elements within the 2.9 kb region that are important for transcription factor binding using deletion constructs, co-transfection experiments with plasmids expressing selected transcription factors, site-directed mutagenesis of consensus binding-site sequences, and by protein/DNA binding assays. We also characterized a GC-rich minimal promoter region containing binding sites for the Sp1 transcription factor. Conclusions Our results showed that several transcription factors such as Egr-1, Egr-2, ZBTB7A/LRF, and Hey1, regulate the ACVR1 promoter by binding to the -762/-308 region, which is essential to confer maximal transcriptional activity. The Sp1 transcription factor acts at the most proximal promoter segment upstream of the transcription start site. We observed significant differences in different cell types suggesting tissue specificity of transcriptional regulation. These findings provide novel insights into the molecular mechanisms that regulate expression of the ACVR1 gene and that could be targets of new strategies for future therapeutic treatments. PMID:24047559
Urano, Y; Kominami, R; Mishima, Y; Muramatsu, M
1980-01-01
Approximately one kilobase pairs surrounding and upstream the transcription initiation site of a cloned ribosomal DNA (rDNA) of the mouse were sequenced. The putative transcription initiation site was determined by two independent methods: one nuclease S1 protection and the other reverse transcriptase elongation mapping using isolated 45S ribosomal RNA precursor (45S RNA) and appropriate restriction fragments of rDNA. Both methods gave an identical result; 45S RNA had a structure starting from ACTCTTAG---. Characteristically, mouse rDNA had many T clusters (greater than or equal to 5) upstream the initiation site, the longest being 21 consecutive T's. A pentadecanucleotide, TGCCTCCCGAGTGCA, appeared twice within 260 nucleotides upstream the putative initiation site. No such characteristic sequences were found downstream this site. Little similarity was found in the upstream of the transcription initiation site between the mouse, Xenopus laevis and Saccharomyces cerevisiae rDNA. Images PMID:6162156
Suetomi, Yuta; Matsuda, Fuko; Uenoyama, Yoshihisa; Maeda, Kei-ichiro; Tsukamura, Hiroko; Ohkura, Satoshi
2013-10-01
Neurokinin B (NKB), encoded by TAC3, is thought to be an important accelerator of pulsatile gonadotropin-releasing hormone release. This study aimed to clarify the transcriptional regulatory mechanism of goat TAC3. First, we determined the full-length mRNA sequence of goat TAC3 from the hypothalamus to be 820 b, including a 381 b coding region, with the putative transcription start site located 143-b upstream of the start codon. The deduced amino acid sequence of NKB, which is produced from preproNKB, was completely conserved among goat, cattle, and human. Next, we cloned 5'-upstream region of goat TAC3 up to 3400 b from the translation initiation site, and this region was highly homologous with cattle TAC3 (89%). We used this goat TAC3 5'-upstream region to perform luciferase assays. We created a luciferase reporter vector containing DNA constructs from -2706, -1837, -834, -335, or -197 to +166 bp (the putative transcription start site was designated as +1) of goat TAC3 and these were transiently transfected into mouse hypothalamus-derived N7 cells and human neuroblastoma-derived SK-N-AS cells. The luciferase activity gradually increased with the deletion of the 5'-upstream region, suggesting that the transcriptional suppressive region is located between -2706 and -336 bp and that the core promoter exists downstream of -197 bp. Estradiol treatment did not lead to significant suppression of luciferase activity of any constructs, suggesting the existence of other factor(s) that regulate goat TAC3 transcription.
Regulation of transcription of the cell division gene ftsA during sporulation of Bacillus subtilis.
Gholamhoseinian, A; Shen, Z; Wu, J J; Piggot, P
1992-01-01
Three distinct 5' ends of ftsA mRNA were identified by S1 mapping and by primer extension analysis. These are thought to represent three transcription start sites. The transcripts from the downstream and upstream sites were detected throughout growth. The transcript from the middle site was not detected during exponential growth but was detected within 30 min of the start of sporulation, when it was the predominant transcript. Insertion of a cat cassette in the middle promoter, ftsAp2 (p2), did not affect vegetative growth but prevented postexponential symmetrical division and spore formation. Transcription from p2 was dependent on RNA polymerase containing sigma H, and promoter p2 resembled the consensus sigma H promoter. Transcription from p2 did not require expression of the spo0A, spo0B, spo0E, spo0F, or spo0K loci. Northern (RNA) blot analysis indicated that ftsA is cotranscribed with the adjacent ftsZ gene. Multiple promoters provide a mechanism by which essential vegetative genes can be subjected to sporulation control independent of control during vegetative growth. In the case of ftsA,Z, the promoters provide a mechanism to permit septum formation in conditions of nutrient depletion that might be expected to shut down the vegetative division machinery. Images PMID:1624452
Su, S Y; Dodson, M V; Li, X B; Li, Q F; Wang, H W; Xie, Z
2009-11-01
We evaluated the effects of betaine supplementation on liver weight, liver/body weight, serum parameters and morphological changes. Compared with the control and overfed groups, the geese that were fed the betaine diet showed increased liver weight and decreased abdominal adipose tissue weight compared with the overfeeding groups. Betaine treatment also significantly increased ChE, HDL, LDH and ALT levels (P<0.01 or P<0.05). Decreased macrovesicular steatosis and increased microvesicular steatosis were observed in the betaine-treated group, and the lipid was well-distributed in the betaine supplement group. The expression of S14alpha mRNA in the livers of the betaine-treated geese was higher than that in the control or the overfed geese. We performed sodium bisulfite sequencing of the individual alleles of this region (between +374 and -8 base pairs relative to the transcription start site), containing 33 CpG dinucleotides. In the overfed group expressing higher S14alpha transcripts, the average methylation at the 33 CpGs sites was 87.9%. This contrasted with 69.6% in the control group that showed lower expression of the S14alpha gene (P<0.01). However, no significant change in methylation in the transcription start site was found between the betaine-treated geese (82.6%) and the overfed geese (87.9%). These results indicate that the DNA methylation pattern in the S14alpha gene transcription start site may not be related to the expression of S14alpha transcript in response to betaine supplementation.
Harraghy, Niamh; Homerova, Dagmar; Herrmann, Mathias; Kormanec, Jan
2008-01-01
Mapping the transcription start points of the eap, emp, and vwb promoters revealed a conserved octanucleotide sequence (COS). Deleting this sequence abolished the expression of eap, emp, and vwb. However, electrophoretic mobility shift assays gave no evidence that this sequence was a binding site for SarA or SaeR, known regulators of eap and emp.
In vitro transcription of a cloned mouse ribosomal RNA gene.
Mishima, Y; Yamamoto, O; Kominami, R; Muramatsu, M
1981-01-01
An in vitro transcription system which utilizes cloned mouse ribosomal RNA gene (rDNA) fragments and a mouse cell extract has been developed. RNA polymerases I is apparently responsible for this transcription as evidenced by the complete resistance to a high concentration (200 micrograms/ml) of alpha-amanitin. Run-off products obtained with three different truncated rDNA fragments indicated that RNA was transcribed from a unique site of rDNA. The S1 nuclease protection mapping of the in vitro product and of in vivo 45S RNA confirmed this site, indicating that, in this in vitro system, transcription of rDNA started from the same site as in vivo. This site is located at several hundred nucleotides upstream from the putative initiation site reported by us (1) and by others (2). Some sequence homology surrounding this region was noted among mouse, Xenopus laevis and Drosophila melanogaster. The data also suggest that some processing of the primary transcript occurs in this in vitro system. Images PMID:6278446
Suzuki, Harukazu; Forrest, Alistair R R; van Nimwegen, Erik; Daub, Carsten O; Balwierz, Piotr J; Irvine, Katharine M; Lassmann, Timo; Ravasi, Timothy; Hasegawa, Yuki; de Hoon, Michiel J L; Katayama, Shintaro; Schroder, Kate; Carninci, Piero; Tomaru, Yasuhiro; Kanamori-Katayama, Mutsumi; Kubosaki, Atsutaka; Akalin, Altuna; Ando, Yoshinari; Arner, Erik; Asada, Maki; Asahara, Hiroshi; Bailey, Timothy; Bajic, Vladimir B; Bauer, Denis; Beckhouse, Anthony G; Bertin, Nicolas; Björkegren, Johan; Brombacher, Frank; Bulger, Erika; Chalk, Alistair M; Chiba, Joe; Cloonan, Nicole; Dawe, Adam; Dostie, Josee; Engström, Pär G; Essack, Magbubah; Faulkner, Geoffrey J; Fink, J Lynn; Fredman, David; Fujimori, Ko; Furuno, Masaaki; Gojobori, Takashi; Gough, Julian; Grimmond, Sean M; Gustafsson, Mika; Hashimoto, Megumi; Hashimoto, Takehiro; Hatakeyama, Mariko; Heinzel, Susanne; Hide, Winston; Hofmann, Oliver; Hörnquist, Michael; Huminiecki, Lukasz; Ikeo, Kazuho; Imamoto, Naoko; Inoue, Satoshi; Inoue, Yusuke; Ishihara, Ryoko; Iwayanagi, Takao; Jacobsen, Anders; Kaur, Mandeep; Kawaji, Hideya; Kerr, Markus C; Kimura, Ryuichiro; Kimura, Syuhei; Kimura, Yasumasa; Kitano, Hiroaki; Koga, Hisashi; Kojima, Toshio; Kondo, Shinji; Konno, Takeshi; Krogh, Anders; Kruger, Adele; Kumar, Ajit; Lenhard, Boris; Lennartsson, Andreas; Lindow, Morten; Lizio, Marina; Macpherson, Cameron; Maeda, Norihiro; Maher, Christopher A; Maqungo, Monique; Mar, Jessica; Matigian, Nicholas A; Matsuda, Hideo; Mattick, John S; Meier, Stuart; Miyamoto, Sei; Miyamoto-Sato, Etsuko; Nakabayashi, Kazuhiko; Nakachi, Yutaka; Nakano, Mika; Nygaard, Sanne; Okayama, Toshitsugu; Okazaki, Yasushi; Okuda-Yabukami, Haruka; Orlando, Valerio; Otomo, Jun; Pachkov, Mikhail; Petrovsky, Nikolai; Plessy, Charles; Quackenbush, John; Radovanovic, Aleksandar; Rehli, Michael; Saito, Rintaro; Sandelin, Albin; Schmeier, Sebastian; Schönbach, Christian; Schwartz, Ariel S; Semple, Colin A; Sera, Miho; Severin, Jessica; Shirahige, Katsuhiko; Simons, Cas; St Laurent, George; Suzuki, Masanori; Suzuki, Takahiro; Sweet, Matthew J; Taft, Ryan J; Takeda, Shizu; Takenaka, Yoichi; Tan, Kai; Taylor, Martin S; Teasdale, Rohan D; Tegnér, Jesper; Teichmann, Sarah; Valen, Eivind; Wahlestedt, Claes; Waki, Kazunori; Waterhouse, Andrew; Wells, Christine A; Winther, Ole; Wu, Linda; Yamaguchi, Kazumi; Yanagawa, Hiroshi; Yasuda, Jun; Zavolan, Mihaela; Hume, David A; Arakawa, Takahiro; Fukuda, Shiro; Imamura, Kengo; Kai, Chikatoshi; Kaiho, Ai; Kawashima, Tsugumi; Kawazu, Chika; Kitazume, Yayoi; Kojima, Miki; Miura, Hisashi; Murakami, Kayoko; Murata, Mitsuyoshi; Ninomiya, Noriko; Nishiyori, Hiromi; Noma, Shohei; Ogawa, Chihiro; Sano, Takuma; Simon, Christophe; Tagami, Michihira; Takahashi, Yukari; Kawai, Jun; Hayashizaki, Yoshihide
2009-05-01
Using deep sequencing (deepCAGE), the FANTOM4 study measured the genome-wide dynamics of transcription-start-site usage in the human monocytic cell line THP-1 throughout a time course of growth arrest and differentiation. Modeling the expression dynamics in terms of predicted cis-regulatory sites, we identified the key transcription regulators, their time-dependent activities and target genes. Systematic siRNA knockdown of 52 transcription factors confirmed the roles of individual factors in the regulatory network. Our results indicate that cellular states are constrained by complex networks involving both positive and negative regulatory interactions among substantial numbers of transcription factors and that no single transcription factor is both necessary and sufficient to drive the differentiation process.
DNA context represents transcription regulation of the gene in mouse embryonic stem cells
NASA Astrophysics Data System (ADS)
Ha, Misook; Hong, Soondo
2016-04-01
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
DNA context represents transcription regulation of the gene in mouse embryonic stem cells.
Ha, Misook; Hong, Soondo
2016-04-14
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
A unique H2A histone variant occupies the transcriptional start site of active genes.
Soboleva, Tatiana A; Nekrasov, Maxim; Pahwa, Anuj; Williams, Rohan; Huttley, Gavin A; Tremethick, David J
2011-12-04
Transcriptional activation is controlled by chromatin, which needs to be unfolded and remodeled to ensure access to the transcription start site (TSS). However, the mechanisms that yield such an 'open' chromatin structure, and how these processes are coordinately regulated during differentiation, are poorly understood. We identify the mouse (Mus musculus) H2A histone variant H2A.Lap1 as a previously undescribed component of the TSS of active genes expressed during specific stages of spermatogenesis. This unique chromatin landscape also includes a second histone variant, H2A.Z. In the later stages of round spermatid development, H2A.Lap1 dynamically loads onto the inactive X chromosome, enabling the transcriptional activation of previously repressed genes. Mechanistically, we show that H2A.Lap1 imparts unique unfolding properties to chromatin. We therefore propose that H2A.Lap1 coordinately regulates gene expression by directly opening the chromatin structure of the TSS at genes regulated during spermatogenesis.
Transcriptional Profiling Identifies Functional Interactions of TGFβ and PPARβ/δ Signaling
Kaddatz, Kerstin; Adhikary, Till; Finkernagel, Florian; Meissner, Wolfgang; Müller-Brüsselbach, Sabine; Müller, Rolf
2010-01-01
Peroxisome proliferator-activated receptors (PPARs) not only play a key role in regulating metabolic pathways but also modulate inflammatory processes, pointing to a functional interaction between PPAR and cytokine signaling pathways. In this study, we show by genome-wide transcriptional profiling that PPARβ/δ and transforming growth factor-β (TGFβ) pathways functionally interact in human myofibroblasts and that a subset of these genes is cooperatively activated by TGFβ and PPARβ/δ. Using the angiopoietin-like 4 (ANGPTL4) gene as a model, we demonstrate that two enhancer regions cooperate to mediate the observed synergistic response. A TGFβ-responsive enhancer located ∼8 kb upstream of the transcriptional start site is regulated by a mechanism involving SMAD3, ETS1, RUNX, and AP-1 transcription factors that interact with multiple contiguous binding sites. A second enhancer (PPAR-E) consisting of three juxtaposed PPAR response elements is located in the third intron ∼3.5 kb downstream of the transcriptional start site. The PPAR-E is strongly activated by all three PPAR subtypes, with a novel type of PPAR response element motif playing a central role. Although the PPAR-E is not regulated by TGFβ, it interacts with SMAD3, ETS1, RUNX2, and AP-1 in vivo, providing a possible mechanistic explanation for the observed synergism. PMID:20595396
Characterization of the human UDP-galactose:ceramide galactosyltransferase gene promoter.
Tencomnao, T; Yu, R K; Kapitonov, D
2001-02-16
UDP-galactose:ceramide galactosyltransferase (CGT, EC 2.4.1.45) is a key enzyme in the biosynthesis of galactocerebroside, the most abundant glycosphingolipid in the myelin sheath. An 8 kb fragment upstream from the transcription initiation site of CGT gene was isolated from a human genomic DNA library. Primer extension analysis revealed a single transcription initiation site 329 bp upstream from the ATG start codon. Neither a consensus TATA nor a CCAAT box was identified in the proximity to the transcription start site; however, this region contains a high GC content and multiple putative regulatory elements. To investigate the transcriptional regulation of CGT, a series of 5' deletion constructs of the 5'-flanking region were generated and cloned upstream from the luciferase reporter gene. By comparing promoter activity in the human oligodendroglioma (HOG) and human neuroblastoma (LAN-5) cell lines, we found that the CGT promoter functions in a cell type-specific manner. Three positive cis-acting regulatory regions were identified, including a proximal region at -292/-256 which contains the potential binding sites for known transcription factors (TFs) such as Ets and SP1 (GC box), a distal region at -747/-688 comprising a number of binding sites such as the ERE half-site, NF1-like, TGGCA-BP, and CRE, and a third positive cis-acting region distally localized at -1325/-1083 consisting of binding sites for TFs such as nitrogen regulatory, TCF-1, TGGCA-BP, NF-IL6, CF1, bHLH, NF1-like, GATA, and gamma-IRE. A negative cis-acting domain localized in a far distal region at -1594/-1326 was also identified. Our results suggest the presence of both positive and negative cis-regulatory regions essential for the cell-specific expression in the TATA-less promoter of the human CGT gene.
Castañeda, Miguel; Sánchez, Judith; Moreno, Soledad; Núñez, Cinthia; Espín, Guadalupe
2001-01-01
Transcription of the Azotobacter vinelandii algD gene, which encodes GDP-mannose dehydrogenase (the rate-limiting enzyme of alginate synthesis), starts from three sites: p1, p2, and p3. The sensor kinase GacS, a member of the two-component regulatory system, is required for transcription of algD from its three sites during the stationary phase. Here we show that algD is expressed constitutively throughout the growth cycle from the p2 and p3 sites and that transcription from p1 started at the transition between the exponential growth phase and stationary phase. We constructed A. vinelandii strains that carried mutations in gacA encoding the cognate response regulator of GacS and in rpoS coding for the stationary-phase ςS factor. The gacA mutation impaired alginate production and transcription of algD from its three promoters. Transcription of rpoS was also abolished by the gacA mutation. The rpoS mutation impaired transcription of algD from the p1 promoter and increased it from the p2 ςE promoter. The results of this study provide evidence for the predominant role of GacA in a regulatory cascade controlling alginate production and gene expression during the stationary phase in A. vinelandii. PMID:11698366
DeVry, C G; Tsai, W; Clarke, S
1996-11-15
The protein L-isoaspartyl/D-aspartyl O-methyltransferase (EC 2.1.1.77) catalyzes the first step in the repair of proteins damaged in the aging process by isomerization or racemization reactions at aspartyl and asparaginyl residues. A single gene has been localized to human chromosome 6 and multiple transcripts arising through alternative splicing have been identified. Restriction enzyme mapping, subcloning, and DNA sequence analysis of three overlapping clones from a human genomic library in bacteriophage P1 indicate that the gene spans approximately 60 kb and is composed of 8 exons interrupted by 7 introns. Analysis of intron/exon splice junctions reveals that all of the donor and acceptor splice sites are in agreement with the mammalian consensus splicing sequence. Determination of transcription initiation sites by primer extension analysis of poly(A)+ mRNA from human brain identifies multiple start sites, with a major site 159 nucleotides upstream from the ATG start codon. Sequence analysis of the 5'-untranslated region demonstrates several potential cis-acting DNA elements including SP1, ETF, AP1, AP2, ARE, XRE, CREB, MED-1, and half-palindromic ERE motifs. The promoter of this methyltransferase gene lacks an identifiable TATA box but is characterized by a CpG island which begins approximately 723 nucleotides upstream of the major transcriptional start site and extends through exon 1 and into the first intron. These features are characteristic of housekeeping genes and are consistent with the wide tissue distribution observed for this methyltransferase activity.
Hidalgo, Alejandro A.; Deeb, Kristin K.; Pike, J. Wesley; Johnson, Candace S.; Trump, Donald L.
2011-01-01
Calcitriol, the active form of vitamin D, in combination with the glucocorticoid dexamethasone (Dex) has been shown to increase the antitumor effects of calcitriol in squamous cell carcinoma. In this study we found that pretreatment with Dex potentiates calcitriol effects by inhibiting cell growth and increasing vitamin D receptor (VDR) and VDR-mediated transcription. Treatment with actinomycin D inhibits Vdr mRNA synthesis, indicating that Dex regulates VDR expression at transcriptional level. Real time PCR shows that treatment with Dex increases Vdr transcripts in a time- and a dose-dependent manner, indicating that Dex directly regulates expression of Vdr. RU486, an inhibitor of glucocorticoids, inhibits Dex-induced Vdr expression. In addition, the silencing of glucocorticoid receptor (GR) abolishes the induction of Vdr by Dex, indicating that Dex increases Vdr transcripts in a GR-dependent manner. A fragment located 5.2 kb upstream of Vdr transcription start site containing two putative glucocorticoid response elements (GREs) was evaluated using a luciferase-based reporter assay. Treatment with 100 nm Dex induces transcription of luciferase driven by the fragment. Deletion of the GRE distal to transcription start site was sufficient to abolish Dex induction of luciferase. Also, chromatin immunoprecipitation reveals recruitment of GR to distal GRE with Dex treatment. We conclude that Dex increases VDR and vitamin D effects by increasing Vdr de novo transcription in a GR-dependent manner. PMID:21868377
Kurose, Kouichi; Koyano, Satoru; Ikeda, Shinobu; Tohkin, Masahiro; Hasegawa, Ryuichi; Sawada, Jun-Ichi
2005-05-01
The human pregnane X receptor (PXR) is a crucial regulator of the genes encoding several major cytochrome P450 enzymes and transporters, such as CYP3A4 and MDR1, but its own transcriptional regulation remains unclear. To elucidate the transcriptional mechanisms of human PXR gene, we first endeavored to identify the transcription initiation site of human PXR using 5'-RACE. Five types of 5'-variable transcripts (a, b, c, d, and e) with common exon 2 sequence were found, and comparison of these sequences with the genomic sequence suggested that their 5' diversity is derived from initiation by alternative promoters and alternative splicing. None of the exons found in our study contain any new in-frame coding regions. Newly identified introns IVS-a and IVS-b were found to have CT-AC splice sites that do not follow the GT-AG rule of conventional donor and acceptor splice sites. Of the five types of 5' variable transcripts identified, RT-PCR showed that type-a was the major transcript type. Four transcription initiation sites (A-D) for type-a transcript were identified by 5'-RACE using GeneRacer RACE Ready cDNA (human liver) constructed by the oligo-capping method. Putative TATA boxes were located approximately 30 bp upstream from the transcriptional start sites of the major transcript (C) and the longest minor transcript (A) expressed in the human liver. These results indicate that the initiation of transcription of human PXR is more complex than previously reported.
NASA Technical Reports Server (NTRS)
Sharina, Iraida G.; Martin, Emil; Thomas, Anthony; Uray, Karen L.; Murad, Ferid
2003-01-01
Soluble guanylyl cyclase (sGC) is a cytosolic enzyme producing the intracellular messenger cyclic guanosine monophosphate (cGMP) on activation with nitric oxide (NO). sGC is an obligatory heterodimer composed of alpha and beta subunits. We investigated human beta1 sGC transcriptional regulation in BE2 human neuroblastoma cells. The 5' upstream region of the beta1 sGC gene was isolated and analyzed for promoter activity by using luciferase reporter constructs. The transcriptional start site of the beta1 sGC gene in BE2 cells was identified. The functional significance of consensus transcriptional factor binding sites proximal to the transcriptional start site was investigated by site deletions in the 800-bp promoter fragment. The elimination of CCAAT-binding factor (CBF) and growth factor independence 1 (GFI1) binding cores significantly diminished whereas deletion of the NF1 core elevated the transcription. Electrophoretic mobility-shift assay (EMSA) and Western analysis of proteins bound to biotinated EMSA probes confirmed the interaction of GFI1, CBF, and NF1 factors with the beta1 sGC promoter. Treatment of BE2 cells with genistein, known to inhibit the CBF binding to DNA, significantly reduced protein levels of beta1 sGC by inhibiting transcription. In summary, our study represents an analysis of the human beta1 sGC promoter regulation in human neuroblastoma BE2 cells and identifies CBF as a critically important factor in beta1 sGC expression.
The Global Regulatory Architecture of Transcription during the Caulobacter Cell Cycle
Zhou, Bo; Schrader, Jared M.; Kalogeraki, Virginia S.; Abeliuk, Eduardo; Dinh, Cong B.; Pham, James Q.; Cui, Zhongying Z.; Dill, David L.; McAdams, Harley H.; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5′ RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle. PMID:25569173
The global regulatory architecture of transcription during the Caulobacter cell cycle.
Zhou, Bo; Schrader, Jared M; Kalogeraki, Virginia S; Abeliuk, Eduardo; Dinh, Cong B; Pham, James Q; Cui, Zhongying Z; Dill, David L; McAdams, Harley H; Shapiro, Lucy
2015-01-01
Each Caulobacter cell cycle involves differentiation and an asymmetric cell division driven by a cyclical regulatory circuit comprised of four transcription factors (TFs) and a DNA methyltransferase. Using a modified global 5' RACE protocol, we globally mapped transcription start sites (TSSs) at base-pair resolution, measured their transcription levels at multiple times in the cell cycle, and identified their transcription factor binding sites. Out of 2726 TSSs, 586 were shown to be cell cycle-regulated and we identified 529 binding sites for the cell cycle master regulators. Twenty-three percent of the cell cycle-regulated promoters were found to be under the combinatorial control of two or more of the global regulators. Previously unknown features of the core cell cycle circuit were identified, including 107 antisense TSSs which exhibit cell cycle-control, and 241 genes with multiple TSSs whose transcription levels often exhibited different cell cycle timing. Cumulatively, this study uncovered novel new layers of transcriptional regulation mediating the bacterial cell cycle.
Kinchington, P R; Vergnes, J P; Defechereux, P; Piette, J; Turse, S E
1994-01-01
Four of the 68 varicella-zoster virus (VZV) unique open reading frames (ORFs), i.e., ORFs 4, 61, 62, and 63, encode proteins that influence viral transcription and are considered to be positional homologs of herpes simplex virus type 1 (HSV-1) immediate-early (IE) proteins. In order to identify the elements that regulate transcription of VZV ORFs 4 and 63, the encoded mRNAs were mapped in detail. For ORF 4, a major 1.8-kb and a minor 3.0-kb polyadenylated [poly(A)+] RNA were identified, whereas ORF 63-specific probes recognized 1.3- and 1.9-kb poly(A)+ RNAs. Probes specific for sequences adjacent to the ORFs and mapping of the RNA 3' ends indicated that the ORF 4 RNAs were 3' coterminal, whereas the RNAs for ORF 63 represented two different termination sites. S1 nuclease mapping and primer extension analyses indicated a single transcription initiation site for ORF 4 at 38 bp upstream of the ORF start codon. For ORF 63, multiple transcriptional start sites at 87 to 95, 151 to 153, and (tentatively) 238 to 243 bp upstream of the ORF start codon were identified. TATA box motifs at good positional locations were found upstream of all mapped transcription initiation sites. However, no sequences resembling the TAATGARAT motif, which confers IE regulation upon HSV-1 IE genes, were found. The finding of the absence of this motif was supported through analyses of the regulatory sequences of ORFs 4 and 63 in transient transfection assays alongside those of ORFs 61 and 62. Sequences representing the promoters for ORFs 4, 61, and 63 were all stimulated by VZV infection but failed to be stimulated by coexpression with the HSV-1 transactivator Vmw65. In contrast, the promoter for ORF 62, which contains TAATGARAT motifs, was activated by VZV infection and coexpression with Vmw65. These results extend the transcriptional knowledge for VZV and suggest that ORFs 4 and 63 contain regulatory signals different from those of the ORF 62 and HSV-1 IE genes. Images PMID:8189496
Means, A L; Farnham, P J
1990-02-01
We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).
Human renin 5'-flanking DNA to nucleotide-2750.
Smith, D L; Jeyapalan, S; Lang, J A; Guo, X H; Sigmund, C D; Morris, B J
1995-01-01
Renin is one of the most important factors in blood pressure and electrolyte regulation in mammals and the renin locus has been implicated in hypertension. To assist studies of promoter control we therefore determined the 5'-flanking sequence of the human gene (REN) to residue -2750 relative to the transcription start site (+1). Sites of homology to consensus sequences for binding of trans-acting factors involved in transcriptional control of other genes were identified, and functionality for two of these (a CRE and Pit-1 site) have so far been demonstrated.
Identification and characterization of Hoxa9 binding sites in hematopoietic cells
Huang, Yongsheng; Sitwala, Kajal; Bronstein, Joel; Sanders, Daniel; Dandekar, Monisha; Collins, Cailin; Robertson, Gordon; MacDonald, James; Cezard, Timothee; Bilenky, Misha; Thiessen, Nina; Zhao, Yongjun; Zeng, Thomas; Hirst, Martin; Hero, Alfred; Jones, Steven
2012-01-01
The clustered homeobox proteins play crucial roles in development, hematopoiesis, and leukemia, yet the targets they regulate and their mechanisms of action are poorly understood. Here, we identified the binding sites for Hoxa9 and the Hox cofactor Meis1 on a genome-wide level and profiled their associated epigenetic modifications and transcriptional targets. Hoxa9 and the Hox cofactor Meis1 cobind at hundreds of highly evolutionarily conserved sites, most of which are distant from transcription start sites. These sites show high levels of histone H3K4 monomethylation and CBP/P300 binding characteristic of enhancers. Furthermore, a subset of these sites shows enhancer activity in transient transfection assays. Many Hoxa9 and Meis1 binding sites are also bound by PU.1 and other lineage-restricted transcription factors previously implicated in establishment of myeloid enhancers. Conditional Hoxa9 activation is associated with CBP/P300 recruitment, histone acetylation, and transcriptional activation of a network of proto-oncogenes, including Erg, Flt3, Lmo2, Myb, and Sox4. Collectively, this work suggests that Hoxa9 regulates transcription by interacting with enhancers of genes important for hematopoiesis and leukemia. PMID:22072553
Zhukova, Anna; Fernandes, Luis Guilherme; Hugon, Perrine; Pappas, Christopher J.; Sismeiro, Odile; Coppée, Jean-Yves; Becavin, Christophe; Malabat, Christophe; Eshghi, Azad; Zhang, Jun-Jie; Yang, Frank X.; Picardeau, Mathieu
2017-01-01
Leptospira are emerging zoonotic pathogens transmitted from animals to humans typically through contaminated environmental sources of water and soil. Regulatory pathways of pathogenic Leptospira spp. underlying the adaptive response to different hosts and environmental conditions remains elusive. In this study, we provide the first global Transcriptional Start Site (TSS) map of a Leptospira species. RNA was obtained from the pathogen Leptospira interrogans grown at 30°C (optimal in vitro temperature) and 37°C (host temperature) and selectively enriched for 5′ ends of native transcripts. A total of 2865 and 2866 primary TSS (pTSS) were predicted in the genome of L. interrogans at 30 and 37°C, respectively. The majority of the pTSSs were located between 0 and 10 nucleotides from the translational start site, suggesting that leaderless transcripts are a common feature of the leptospiral translational landscape. Comparative differential RNA-sequencing (dRNA-seq) analysis revealed conservation of most pTSS at 30 and 37°C. Promoter prediction algorithms allow the identification of the binding sites of the alternative sigma factor sigma 54. However, other motifs were not identified indicating that Leptospira consensus promoter sequences are inherently different from the Escherichia coli model. RNA sequencing also identified 277 and 226 putative small regulatory RNAs (sRNAs) at 30 and 37°C, respectively, including eight validated sRNAs by Northern blots. These results provide the first global view of TSS and the repertoire of sRNAs in L. interrogans. These data will establish a foundation for future experimental work on gene regulation under various environmental conditions including those in the host. PMID:28154810
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open-source Java framework Jstacs and as a stand-alone application at http://www.jstacs.de/index.php/Dispom.
TSSi--an R package for transcription start site identification from 5' mRNA tag data.
Kreutz, C; Gehring, J S; Lang, D; Reski, R; Timmer, J; Rensing, S A
2012-06-15
High-throughput sequencing has become an essential experimental approach for the investigation of transcriptional mechanisms. For some applications like ChIP-seq, several approaches for the prediction of peak locations exist. However, these methods are not designed for the identification of transcription start sites (TSSs) because such datasets contain qualitatively different noise. In this application note, the R package TSSi is presented which provides a heuristic framework for the identification of TSSs based on 5' mRNA tag data. Probabilistic assumptions for the distribution of the data, i.e. for the observed positions of the mapped reads, as well as for systematic errors, i.e. for reads which map closely but not exactly to a real TSS, are made and can be adapted by the user. The framework also comprises a regularization procedure which can be applied as a preprocessing step to decrease the noise and thereby reduce the number of false predictions. The R package TSSi is available from the Bioconductor web site: www.bioconductor.org/packages/release/bioc/html/TSSi.html.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paule Roth, M.; Malfroy, L.; Offer, C.
1995-07-20
Human myelin oligodendrocyte glycoprotein (MOG), a myelin component of the central nervous system, is a candidate target antigen for autoimmune-mediated demyelination. We have isolated and sequenced part of a cosmid clone that contains the entire human MOG gene. The primary nuclear transcript, extending from the putative start of transcription to the site of poly(A) addition, is 15,561 nucleotides in length. The human MOG gene contains 8 exons, separated by 7 introns; canonical intron/exon boundary sites are observed at each junction. The introns vary in size from 242 to 6484 bp and contain numerous repetitive DNA elements, including 14 Alu sequencesmore » within 3 introns. Another Alu element is located in the 3{prime}-untranslated region of the gene. Alu sequences were classified with respect to subfamily assignment. Seven hundred sixty-three nucleotides 5{prime} of the transcription start and 1214 nucleotides 3{prime} of the poly(A) addition sites were also sequenced. The 5{prime}-flanking region revealed the presence of several consensus sequences that could be relevant in the transcription of the MOG gene, in particular binding sites in common with other myelin gene promoters. Two polymorphic intragenic dinucleotide (CA){sub n} and tetranucleotide (TAAA){sub n} repeats were identified and may provide genetic marker tools for association and linkage studies. 50 refs., 3 figs., 3 tabs.« less
Gomes, S L; Gober, J W; Shapiro, L
1990-01-01
Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134
Irla, Marta; Neshat, Armin; Brautaset, Trygve; Rückert, Christian; Kalinowski, Jörn; Wendisch, Volker F
2015-02-14
Bacillus methanolicus MGA3 is a thermophilic, facultative ribulose monophosphate (RuMP) cycle methylotroph. Together with its ability to produce high yields of amino acids, the relevance of this microorganism as a promising candidate for biotechnological applications is evident. The B. methanolicus MGA3 genome consists of a 3,337,035 nucleotides (nt) circular chromosome, the 19,174 nt plasmid pBM19 and the 68,999 nt plasmid pBM69. 3,218 protein-coding regions were annotated on the chromosome, 22 on pBM19 and 82 on pBM69. In the present study, the RNA-seq approach was used to comprehensively investigate the transcriptome of B. methanolicus MGA3 in order to improve the genome annotation, identify novel transcripts, analyze conserved sequence motifs involved in gene expression and reveal operon structures. For this aim, two different cDNA library preparation methods were applied: one which allows characterization of the whole transcriptome and another which includes enrichment of primary transcript 5'-ends. Analysis of the primary transcriptome data enabled the detection of 2,167 putative transcription start sites (TSSs) which were categorized into 1,642 TSSs located in the upstream region (5'-UTR) of known protein-coding genes and 525 TSSs of novel antisense, intragenic, or intergenic transcripts. Firstly, 14 wrongly annotated translation start sites (TLSs) were corrected based on primary transcriptome data. Further investigation of the identified 5'-UTRs resulted in the detailed characterization of their length distribution and the detection of 75 hitherto unknown cis-regulatory RNA elements. Moreover, the exact TSSs positions were utilized to define conserved sequence motifs for translation start sites, ribosome binding sites and promoters in B. methanolicus MGA3. Based on the whole transcriptome data set, novel transcripts, operon structures and mRNA abundances were determined. The analysis of the operon structures revealed that almost half of the genes are transcribed monocistronically (940), whereas 1,164 genes are organized in 381 operons. Several of the genes related to methylotrophy had highly abundant transcripts. The extensive insights into the transcriptional landscape of B. methanolicus MGA3, gained in this study, represent a valuable foundation for further comparative quantitative transcriptome analyses and possibly also for the development of molecular biology tools which at present are very limited for this organism.
A dual switch controls bacterial enhancer-dependent transcription
Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin
2012-01-01
Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125
Miller, Myrna M; Jarosinski, Keith W; Schat, Karel A
2008-12-01
Expression of enhanced green fluorescent protein (EGFP) under control of the promoter-enhancer of chicken infectious anemia virus (CAV) is increased in an oestrogen receptor-enhanced cell line when treated with oestrogen and the promoter-enhancer binds unidentified proteins that recognize a consensus oestrogen response element (ERE). Co-transfection assays with the CAV promoter and the nuclear receptor chicken ovalbumin upstream promoter transcription factor 1 (COUP-TF1) showed that expression of EGFP was decreased by 50 to 60 % in DF-1 and LMH cells. The CAV promoter that included sequences at and downstream of the transcription start point had less expression than a short promoter construct. Mutation of a putative E box at this site restored expression levels. Electromobility shift assays showed that the transcription regulator delta-EF1 (deltaEF1) binds to this E box region. These findings indicate that the CAV promoter activity can be affected directly or indirectly by COUP-TF1 and deltaEF1.
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Pu, Jiarui; Mei, Hong; Zhao, Jun; Huang, Kai; Zeng, Fuqing; Tong, Qiangsong
2012-01-01
Heparanase (HPA), an endo-h-D-glucuronidase that cleaves the heparan sulfate chain of heparan sulfate proteoglycans, is overexpressed in majority of human cancers. Recent evidence suggests that small interfering RNA (siRNA) induces transcriptional gene silencing (TGS) in human cells. In this study, transfection of siRNA against −9/+10 bp (siH3), but not −174/−155 bp (siH1) or −134/−115 bp (siH2) region relative to transcription start site (TSS) locating at 101 bp upstream of the translation start site, resulted in TGS of heparanase in human prostate cancer, bladder cancer, and gastric cancer cells in a sequence-specific manner. Methylation-specific PCR and bisulfite sequencing revealed no DNA methylation of CpG islands within heparanase promoter in siH3-transfected cells. The TGS of heparanase did not involve changes of epigenetic markers histone H3 lysine 9 dimethylation (H3K9me2), histone H3 lysine 27 trimethylation (H3K27me3) or active chromatin marker acetylated histone H3 (AcH3). The regulation of alternative splicing was not involved in siH3-mediated TGS. Instead, siH3 interfered with transcription initiation via decreasing the binding of both RNA polymerase II and transcription factor II B (TFIIB), but not the binding of transcription factors Sp1 or early growth response 1, on the heparanase promoter. Moreover, Argonaute 1 and Argonaute 2 facilitated the decreased binding of RNA polymerase II and TFIIB on heparanase promoter, and were necessary in siH3-induced TGS of heparanase. Stable transfection of the short hairpin RNA construct targeting heparanase TSS (−9/+10 bp) into cancer cells, resulted in decreased proliferation, invasion, metastasis and angiogenesis of cancer cells in vitro and in athymic mice models. These results suggest that small RNAs targeting TSS can induce TGS of heparanase via interference with transcription initiation, and significantly suppress the tumor growth, invasion, metastasis and angiogenesis of cancer cells. PMID:22363633
RNA-Seq-Based Transcript Structure Analysis with TrBorderExt.
Wang, Yejun; Sun, Ming-An; White, Aaron P
2018-01-01
RNA-Seq has become a routine strategy for genome-wide gene expression comparisons in bacteria. Despite lower resolution in transcript border parsing compared with dRNA-Seq, TSS-EMOTE, Cappable-seq, Term-seq, and others, directional RNA-Seq still illustrates its advantages: low cost, quantification and transcript border analysis with a medium resolution (±10-20 nt). To facilitate mining of directional RNA-Seq datasets especially with respect to transcript structure analysis, we developed a tool, TrBorderExt, which can parse transcript start sites and termination sites accurately in bacteria. A detailed protocol is described in this chapter for how to use the software package step by step to identify bacterial transcript borders from raw RNA-Seq data. The package was developed with Perl and R programming languages, and is accessible freely through the website: http://www.szu-bioinf.org/TrBorderExt .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Machlin, S.M.; Hanson, R.S.
The nucleotide sequence of a cloned 2.5-kilobase-pair SmaI fragment containing the methanol dehydrogenase (MDH) structural gene from Methylobacterium organophilum XX was determined. A single open reading frame with a coding capacity of 626 amino acids (molecular weight, 66,000) was identified on one stand, and N-terminal sequencing of purified MDH revealed that 27 of these residues constituted a putative signal peptide. Primer extension mapping of in vivo transcripts indicated that the start of mRNA synthesis was 160 to 170 base pairs upstream of the ATG codon. Northern (RNA) blot analysis further demonstrated that the transcript was 2.1 kilobase pairs in lengthmore » and therefore appeared to encode only MDH.« less
Constitutive turnover of histone H2A.Z at yeast promoters requires the preinitiation complex
Tramantano, Michael; Sun, Lu; Au, Christy; Labuz, Daniel; Liu, Zhimin; Chou, Mindy; Shen, Chen; Luk, Ed
2016-01-01
The assembly of the preinitiation complex (PIC) occurs upstream of the +1 nucleosome which, in yeast, obstructs the transcription start site and is frequently assembled with the histone variant H2A.Z. To understand the contribution of the transcription machinery in the disassembly of the +1 H2A.Z nucleosome, conditional mutants were used to block PIC assembly. A quantitative ChIP-seq approach, which allows detection of global occupancy change, was employed to measure H2A.Z occupancy. Blocking PIC assembly resulted in promoter-specific H2A.Z accumulation, indicating that the PIC is required to evict H2A.Z. By contrast, H2A.Z eviction was unaffected upon depletion of INO80, a remodeler previously reported to displace nucleosomal H2A.Z. Robust PIC-dependent H2A.Z eviction was observed at active and infrequently transcribed genes, indicating that constitutive H2A.Z turnover is a general phenomenon. Finally, sites with strong H2A.Z turnover precisely mark transcript starts, providing a new metric for identifying cryptic and alternative sites of initiation. DOI: http://dx.doi.org/10.7554/eLife.14243.001 PMID:27438412
SEASTAR: systematic evaluation of alternative transcription start sites in RNA.
Qin, Zhiyi; Stoilov, Peter; Zhang, Xuegong; Xing, Yi
2018-05-04
Alternative first exons diversify the transcriptomes of eukaryotes by producing variants of the 5' Untranslated Regions (5'UTRs) and N-terminal coding sequences. Accurate transcriptome-wide detection of alternative first exons typically requires specialized experimental approaches that are designed to identify the 5' ends of transcripts. We developed a computational pipeline SEASTAR that identifies first exons from RNA-seq data alone then quantifies and compares alternative first exon usage across multiple biological conditions. The exons inferred by SEASTAR coincide with transcription start sites identified directly by CAGE experiments and bear epigenetic hallmarks of active promoters. To determine if differential usage of alternative first exons can yield insights into the mechanism controlling gene expression, we applied SEASTAR to an RNA-seq dataset that tracked the reprogramming of mouse fibroblasts into induced pluripotent stem cells. We observed dynamic temporal changes in the usage of alternative first exons, along with correlated changes in transcription factor expression. Using a combined sequence motif and gene set enrichment analysis we identified N-Myc as a regulator of alternative first exon usage in the pluripotent state. Our results demonstrate that SEASTAR can leverage the available RNA-seq data to gain insights into the control of gene expression and alternative transcript variation in eukaryotic transcriptomes.
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Influenza Virus Mounts a Two-Pronged Attack on Host RNA Polymerase II Transcription.
Bauer, David L V; Tellier, Michael; Martínez-Alonso, Mónica; Nojima, Takayuki; Proudfoot, Nick J; Murphy, Shona; Fodor, Ervin
2018-05-15
Influenza virus intimately associates with host RNA polymerase II (Pol II) and mRNA processing machinery. Here, we use mammalian native elongating transcript sequencing (mNET-seq) to examine Pol II behavior during viral infection. We show that influenza virus executes a two-pronged attack on host transcription. First, viral infection causes decreased Pol II gene occupancy downstream of transcription start sites. Second, virus-induced cellular stress leads to a catastrophic failure of Pol II termination at poly(A) sites, with transcription often continuing for tens of kilobases. Defective Pol II termination occurs independently of the ability of the viral NS1 protein to interfere with host mRNA processing. Instead, this termination defect is a common effect of diverse cellular stresses and underlies the production of previously reported downstream-of-gene transcripts (DoGs). Our work has implications for understanding not only host-virus interactions but also fundamental aspects of mammalian transcription. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
Song, Lingyun; Zhang, Zhancheng; Grasfeder, Linda L.; Boyle, Alan P.; Giresi, Paul G.; Lee, Bum-Kyu; Sheffield, Nathan C.; Gräf, Stefan; Huss, Mikael; Keefe, Damian; Liu, Zheng; London, Darin; McDaniell, Ryan M.; Shibata, Yoichiro; Showers, Kimberly A.; Simon, Jeremy M.; Vales, Teresa; Wang, Tianyuan; Winter, Deborah; Zhang, Zhuzhu; Clarke, Neil D.; Birney, Ewan; Iyer, Vishwanath R.; Crawford, Gregory E.; Lieb, Jason D.; Furey, Terrence S.
2011-01-01
The human body contains thousands of unique cell types, each with specialized functions. Cell identity is governed in large part by gene transcription programs, which are determined by regulatory elements encoded in DNA. To identify regulatory elements active in seven cell lines representative of diverse human cell types, we used DNase-seq and FAIRE-seq (Formaldehyde Assisted Isolation of Regulatory Elements) to map “open chromatin.” Over 870,000 DNaseI or FAIRE sites, which correspond tightly to nucleosome-depleted regions, were identified across the seven cell lines, covering nearly 9% of the genome. The combination of DNaseI and FAIRE is more effective than either assay alone in identifying likely regulatory elements, as judged by coincidence with transcription factor binding locations determined in the same cells. Open chromatin common to all seven cell types tended to be at or near transcription start sites and to be coincident with CTCF binding sites, while open chromatin sites found in only one cell type were typically located away from transcription start sites and contained DNA motifs recognized by regulators of cell-type identity. We show that open chromatin regions bound by CTCF are potent insulators. We identified clusters of open regulatory elements (COREs) that were physically near each other and whose appearance was coordinated among one or more cell types. Gene expression and RNA Pol II binding data support the hypothesis that COREs control gene activity required for the maintenance of cell-type identity. This publicly available atlas of regulatory elements may prove valuable in identifying noncoding DNA sequence variants that are causally linked to human disease. PMID:21750106
Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P
2015-08-01
Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.
Martin, Elizabeth M.; Fry, Rebecca C.
2016-01-01
Abstract A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched ( P < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266
Kapoun, A. M.; Geer, B. W.; Heinstra, PWH.; Corbin, V.; McKechnie, S. W.
1990-01-01
The activity of alcohol dehydrogenase (ADH:EC 1.1.1.1), the initial enzyme in the major pathway for ethanol degradation, is induced in Drosophila melanogaster larvae by low concentrations of dietary ethanol. Two lines of evidence indicate that the metabolic products of the ADH pathway for ethanol degradation are not directly involved in the induction of Adh. First, the accumulation of the proximal transcript in Adh(n2) larvae was increased when the intracellular level of ethanol was elevated. In addition, the ADH activity, the proximal Adh mRNA, and the intracellular concentration of ethanol were elevated coordinately in wild-type larvae fed hexadeuterated-ethanol, which is metabolized more slowly than normal ethanol. An examination of P element transformant lines with specific deletions in the 5' regulatory DNA of the Adh gene showed that the DNA sequence between +604 and +634 of the start site of transcription from the distal promoter was essential for this induction. The DNA sequence between -660 and about -5000 of the distal transcript start site was important for the down-regulation of the induction response. PMID:2157627
Control site location and transcriptional regulation in Escherichia coli.
Collado-Vides, J; Magasanik, B; Gralla, J D
1991-01-01
The regulatory regions for 119 Escherichia coli promoters have been analyzed, and the locations of the regulatory sites have been cataloged. The following observations emerge. (i) More than 95% of promoters are coregulated with at least one other promoter. (ii) Virtually all sigma 70 promoters contain at least one regulatory site in a proximal position, touching at least position -65 with respect to the start point of transcription. There are not yet clear examples of upstream regulation in the absence of a proximal site. (iii) Operators within regulons appear in very variable proximal positions. By contrast, the proximal activation sites of regulons are much more fixed. (iv) There is a forbidden zone for activation elements downstream from approximately position -20 with respect to the start of transcription. By contrast, operators can occur throughout the proximal region. When activation elements appear in the forbidden zone, they repress. These latter examples usually involve autoregulation. (v) Approximately 40% of repressible promoters contain operator duplications. These occur either in certain regulons where duplication appears to be a requirement for repressor action or in promoters subject to complex regulation. (vi) Remote operator duplications occur in approximately 10% of repressible promoters. They generally appear when a multiple promoter region is coregulated by cyclic AMP receptor protein. (vii) Sigma 54 promoters do not require proximal or precisely positioned activator elements and are not generally subject to negative regulation. Rationales are presented for all of the above observations. PMID:1943993
Wang, Xiaohong; Zheng, Zhi-Ming
2016-01-01
Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map from each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in the genome structure, organization and gene expression among papillomaviruses. The focused methods are 5’- and 3’- rapid amplification of cDNA ends (RACE), which are the techniques commonly used in molecular biology to obtain the full length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281
Yu, Ming; Riva, Laura; Xie, Huafeng; Schindler, Yocheved; Moran, Tyler B.; Cheng, Yong; Yu, Duonan; Hardison, Ross; Weiss, Mitchell J; Orkin, Stuart H.; Bernstein, Bradley E.; Fraenkel, Ernest; Cantor, Alan B.
2009-01-01
Summary The transcription factor GATA-1 is required for terminal erythroid maturation and functions as an activator or repressor depending on gene context. Yet its in vivo site selectivity and ability to distinguish between activated versus repressed genes remain incompletely understood. In this study, we performed GATA-1 ChIP-seq in erythroid cells and compared it to GATA-1 induced gene expression changes. Bound and differentially expressed genes contain a greater number of GATA binding motifs, a higher frequency of palindromic GATA sites, and closer occupancy to the transcriptional start site versus non-differentially expressed genes. Moreover, we show that the transcription factor Zbtb7a occupies GATA-1 bound regions of some direct GATA-1 target genes, that the presence of SCL/TAL1 helps distinguish transcriptional activation versus repression, and that Polycomb Repressive Complex 2 (PRC2) is involved in epigenetic silencing of a subset of GATA-1 repressed genes. These data provide insights into GATA-1 mediated gene regulation in vivo. PMID:19941827
Transcriptional analysis of the bglP gene from Streptococcus mutans.
Cote, Christopher K; Honeyman, Allen L
2006-04-21
An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.
Transcriptional analysis of the bglP gene from Streptococcus mutans
Cote, Christopher K; Honeyman, Allen L
2006-01-01
Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357
GC-Rich DNA Elements Enable Replication Origin Activity in the Methylotrophic Yeast Pichia pastoris
Liachko, Ivan; Youngblood, Rachel A.; Tsui, Kyle; Bubb, Kerry L.; Queitsch, Christine; Raghuraman, M. K.; Nislow, Corey; Brewer, Bonita J.; Dunham, Maitreya J.
2014-01-01
The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins—a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation. PMID:24603708
GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.
Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J
2014-03-01
The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.
Wray, Lewis V.; Zalieckas, Jill M.; Ferson, Amy E.; Fisher, Susan H.
1998-01-01
Transcription of the Bacillus subtilis nrgAB promoter is activated during nitrogen-limited growth by the TnrA protein. A common inverted repeat, TGTNAN7TNACA (TnrA site), is centered 49 to 51 bp upstream of the transcriptional start sites for the TnrA-regulated nrgAB, gabP P2, and nas promoters. Oligonucleotide-directed mutagenesis of the nrgAB promoter region showed that conserved nucleotides within the TnrA site, the A+T-rich region between the two TnrA half-sites, and an upstream A tract are all required for high-level activation of nrgAB expression. Mutations that alter the relative distance between the two half-sites of the nrgAB TnrA site abolish nitrogen regulation of nrgAB expression. Spacer mutations that change the relative distance between the TnrA site and −35 region of the nrgAB promoter reveal that activation of nrgAB expression occurs only when the TnrA site is located 49 to 51 bp upstream of the transcriptional start site. Mutational analysis of the conserved nucleotides in the gabP P2 TnrA site showed that this sequence is also required for nitrogen-regulated gabP P2 expression. The TnrA protein, expressed in an overproducing Escherichia coli strain, had a 625-fold-higher affinity for the wild-type nrgAB promoter DNA than for a mutated nrgAB promoter DNA fragment that is unable to activate nrgAB expression in vivo. These results indicate that the proposed TnrA site functions as the binding site for the TnrA protein. TnrA was found to activate nrgAB expression during late exponential growth in nutrient sporulation medium containing glucose, suggesting that cells become nitrogen limited during growth in this medium. PMID:9603886
Moskvin, Oleg V; Bolotin, Dmitry; Wang, Andrew; Ivanov, Pavel S; Gomelsky, Mark
2011-02-01
We present Rhodobase, a web-based meta-analytical tool for analysis of transcriptional regulation in a model anoxygenic photosynthetic bacterium, Rhodobacter sphaeroides. The gene association meta-analysis is based on the pooled data from 100 of R. sphaeroides whole-genome DNA microarrays. Gene-centric regulatory networks were visualized using the StarNet approach (Jupiter, D.C., VanBuren, V., 2008. A visual data mining tool that facilitates reconstruction of transcription regulatory networks. PLoS ONE 3, e1717) with several modifications. We developed a means to identify and visualize operons and superoperons. We designed a framework for the cross-genome search for transcription factor binding sites that takes into account high GC-content and oligonucleotide usage profile characteristic of the R. sphaeroides genome. To facilitate reconstruction of directional relationships between co-regulated genes, we screened upstream sequences (-400 to +20bp from start codons) of all genes for putative binding sites of bacterial transcription factors using a self-optimizing search method developed here. To test performance of the meta-analysis tools and transcription factor site predictions, we reconstructed selected nodes of the R. sphaeroides transcription factor-centric regulatory matrix. The test revealed regulatory relationships that correlate well with the experimentally derived data. The database of transcriptional profile correlations, the network visualization engine and the optimized search engine for transcription factor binding sites analysis are available at http://rhodobase.org. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Epigenetics regulates transcription and pathogenesis in the parasite Trichomonas vaginalis.
Pachano, Tomas; Nievas, Yesica R; Lizarraga, Ayelen; Johnson, Patricia J; Strobl-Mazzulla, Pablo H; de Miguel, Natalia
2017-06-01
Trichomonas vaginalis is a common sexually transmitted parasite that colonizes the human urogenital tract. Infections range from asymptomatic to highly inflammatory, depending on the host and the parasite strain. Different T. vaginalis strains vary greatly in their adherence and cytolytic capacities. These phenotypic differences might be attributed to differentially expressed genes as a consequence of extra-genetic variation, such as epigenetic modifications. In this study, we explored the role of histone acetylation in regulating gene transcription and pathogenesis in T. vaginalis. Here, we show that histone 3 lysine acetylation (H3KAc) is enriched in nucleosomes positioned around the transcription start site of active genes (BAP1 and BAP2) in a highly adherent parasite strain; compared with the low acetylation abundance in contrast to that observed in a less-adherent strain that expresses these genes at low levels. Additionally, exposition of less-adherent strain with a specific histone deacetylases inhibitor, trichostatin A, upregulated the transcription of BAP1 and BAP2 genes in concomitance with an increase in H3KAc abundance and chromatin accessibility around their transcription start sites. Moreover, we demonstrated that the binding of initiator binding protein, the transcription factor responsible for the initiation of transcription of ~75% of known T. vaginalis genes, depends on the histone acetylation state around the metazoan-like initiator to which initiator binding protein binds. Finally, we found that trichostatin A treatment increased parasite aggregation and adherence to host cells. Our data demonstrated for the first time that H3KAc is a permissive histone modification that functions to mediate both transcription and pathogenesis of the parasite T. vaginalis. © 2017 John Wiley & Sons Ltd.
Ren, Wei; Zhu, Liang-Hua; Xu, Hua-Guo; Jin, Rui; Zhou, Guo-Ping
2012-06-01
Interferon regulatory factor 3 (IRF-3), an essential transcriptional regulator of the interferon genes, plays an important role in host defense against viral and microbial infection as well as in cell growth regulation. Promoter plays a crucial role in gene transcription. We have reported the characterization of the wide type of human IRF-3 promoter, but the characterization of the spliced variant of human IRF-3 Int2V1 promoter has not been systematically analyzed. To observe the spliced variant of human IRF-3 promoter, we have cloned the human IRF-3 gene promoter region containing 300 nucleotides upstream the transcription start site (TSS). Transient transfection of 5' deleted promoter-reporter constructs and luciferase assay illustrated the region -159/-100 relative to the TSS is sufficient for full promoter activity. This region contains GATA1 and specific protein-1 (Sp1) transcription factor binding sites. Interestingly, mutation of this Sp1 site reduced the promoter activity by 50%. However, overexpression of Sp1 increased the transcription activity by 2.4-fold. These results indicated that the spliced variant of human IRF-3 gene core promoter was located within the region -159/-100 relative to the TSS. Sp1 transcription factor upregulates the spliced variant of human IRF-3 gene promoter.
CisMapper: predicting regulatory interactions from transcription factor ChIP-seq data
O'Connor, Timothy; Bodén, Mikael
2017-01-01
Abstract Identifying the genomic regions and regulatory factors that control the transcription of genes is an important, unsolved problem. The current method of choice predicts transcription factor (TF) binding sites using chromatin immunoprecipitation followed by sequencing (ChIP-seq), and then links the binding sites to putative target genes solely on the basis of the genomic distance between them. Evidence from chromatin conformation capture experiments shows that this approach is inadequate due to long-distance regulation via chromatin looping. We present CisMapper, which predicts the regulatory targets of a TF using the correlation between a histone mark at the TF's bound sites and the expression of each gene across a panel of tissues. Using both chromatin conformation capture and differential expression data, we show that CisMapper is more accurate at predicting the target genes of a TF than the distance-based approaches currently used, and is particularly advantageous for predicting the long-range regulatory interactions typical of tissue-specific gene expression. CisMapper also predicts which TF binding sites regulate a given gene more accurately than using genomic distance. Unlike distance-based methods, CisMapper can predict which transcription start site of a gene is regulated by a particular binding site of the TF. PMID:28204599
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kolonko, Nadine; Bannach, Oliver; Aschermann, Katja
Viroids are single-stranded, circular RNAs of 250 to 400 bases, that replicate autonomously in their host plants but do not code for a protein. Viroids of the family Pospiviroidae, of which potato spindle tuber viroid (PSTVd) is the type strain, are replicated by the host's DNA-dependent RNA polymerase II in the nucleus. To analyze the initiation site of transcription from the (+)-stranded circles into (-)-stranded replication intermediates, we used a nuclear extract from a non-infected cell culture of the host plant S. tuberosum. The (-)-strands, which were de novo-synthesized in the extract upon addition of circular (+)-PSTVd, were purified bymore » affinity chromatography. This purification avoided contamination by host nucleic acids that had resulted in a misassignment of the start site in an earlier study. Primer-extension analysis of the de novo-synthesized (-)-strands revealed a single start site located in the hairpin loop of the left terminal region in circular PSTVd's secondary structure. This start site is supported further by analysis of the infectivity and replication behavior of site-directed mutants in planta.« less
Ras-Induced Changes in H3K27me3 Occur after Those in Transcriptional Activity
Hosogane, Masaki; Funayama, Ryo; Nishida, Yuichiro; Nagashima, Takeshi; Nakayama, Keiko
2013-01-01
Oncogenic signaling pathways regulate gene expression in part through epigenetic modification of chromatin including DNA methylation and histone modification. Trimethylation of histone H3 at lysine-27 (H3K27), which correlates with transcriptional repression, is regulated by an oncogenic form of the small GTPase Ras. Although accumulation of trimethylated H3K27 (H3K27me3) has been implicated in transcriptional regulation, it remains unclear whether Ras-induced changes in H3K27me3 are a trigger for or a consequence of changes in transcriptional activity. We have now examined the relation between H3K27 trimethylation and transcriptional regulation by Ras. Genome-wide analysis of H3K27me3 distribution and transcription at various times after expression of oncogenic Ras in mouse NIH 3T3 cells identified 115 genes for which H3K27me3 level at the gene body and transcription were both regulated by Ras. Similarly, 196 genes showed Ras-induced changes in transcription and H3K27me3 level in the region around the transcription start site. The Ras-induced changes in transcription occurred before those in H3K27me3 at the genome-wide level, a finding that was validated by analysis of individual genes. Depletion of H3K27me3 either before or after activation of Ras signaling did not affect the transcriptional regulation of these genes. Furthermore, given that H3K27me3 enrichment was dependent on Ras signaling, neither it nor transcriptional repression was maintained after inactivation of such signaling. Unexpectedly, we detected unannotated transcripts derived from intergenic regions at which the H3K27me3 level is regulated by Ras, with the changes in transcript abundance again preceding those in H3K27me3. Our results thus indicate that changes in H3K27me3 level in the gene body or in the region around the transcription start site are not a trigger for, but rather a consequence of, changes in transcriptional activity. PMID:24009517
López-Rubio, José Juan; Padmanabhan, S; Lázaro, Jose María; Salas, Margarita; Murillo, Francisco José; Elías-Arnanz, Montserrat
2004-07-09
The carB operon encodes all except one of the enzymes involved in light-induced carotenogenesis in Myxococcus xanthus. Expression of its promoter (P(B)) is repressed in the dark by sequence-specific DNA binding of CarA to a palindrome (pI) located between positions -47 and -64 relative to the transcription start site. This promotes subsequent binding of CarA to additional sites that remain to be defined. CarS, produced in the light, interacts physically with CarA, abrogates CarA-DNA binding, and thereby derepresses P(B). In this study, we delineate the operator design that exists for CarA by precisely mapping out the second operator element. For this, we examined how stepwise deletions and site-directed mutagenesis in the region between the palindrome and the transcription start site affect CarA binding around P(B) in vitro and expression of P(B) in vivo. These revealed the second operator element to be an imperfect interrupted palindrome (pII) spanning positions -26 to -40. In vitro assays using purified M. xanthus RNA polymerase showed that CarA abolishes P(B)-RNA polymerase binding and runoff transcription and that both were restored by CarS, thus rationalizing the observations in vivo. CarA binding to pII (after association with pI) effectively occludes RNA polymerase from P(B) and so provides the operative mechanism for the repression of the carB operon by CarA. The bipartite operator design, whereby transcription is blocked by the low affinity CarA-pII binding and is readily restored by CarS, may have evolved to match the needs for a rapid and an effective response to light.
Cai, Tao; Hirai, Hiroki; Xu, Huanyu; Notkins, Abner L
2015-06-01
IA-2 is a transmembrane protein found in the dense-core vesicles (DCV) of neuroendocrine cells and one of the major autoantigens in type 1 diabetes. DCV are involved in the secretion of hormones (e.g., insulin) and neurotransmitters. Stimulation of pancreatic β cells with glucose upregulates the expression of IA-2 and an increase in IA-2 results in an increase in the number of DCV. Little is known, however, about the promoter region of IA-2 or the transcriptional factors that regulate the expression of this gene. In the present study, we constructed eight deletion fragments from the upstream region of the IA-2 transcription start site and linked them to a luciferase reporter. By this approach, we have identified a short bp region (-216 to +115) that has strong promoter activity. We also identified a transcription factor, cAMP responsive element-binding protein (CREB), which binds to two CREB-related binding sites located in this region. The binding of CREB to these sites enhanced IA-2 transcription by more than fivefold. We confirmed these findings by site-directed mutagenesis, chromatin immunoprecipitation assays and RNAi inhibition. Based on these findings, we conclude that the PKA pathway is a critical, but not the exclusive signaling pathway involved in IA-2 gene expression.
Davis, Monica M.; Primrose, David A.; Hodgetts, Ross B.
2008-01-01
Drosophila innate immunity is controlled primarily by the activation of IMD (immune deficiency) or Toll signaling leading to the production of antimicrobial peptides (AMPs). IMD signaling also activates the JUN N-terminal kinase (JNK) cascade, which is responsible for immune induction of non-antimicrobial peptide immune gene transcription though the transcription factor AP-1. Transcription of the Dopa decarboxylase (Ddc) gene is induced in response to gram-negative and gram-positive septic injury, but not aseptic wounding. Transcription is induced throughout the epidermis and not specifically at the site of infection. Ddc transcripts are detectible within 2 h and remain high for several hours following infection with either gram-negative or gram-positive bacteria. Using Ddc-green fluorescent protein (GFP) reporter gene constructs, we show that a conserved consensus AP-1 binding site upstream of the Ddc transcription start site is required for induction. However, neither the Toll, IMD, nor JNK pathway is involved. Rather, Ddc transcription depends on a previously uncharacterized member of the p38 mitogen-activated protein kinase family, p38c. We propose that the involvement of DDC in a new pathway involved in Drosophila immunity increases the levels of dopamine, which is metabolized to produce reactive quinones that exert an antimicrobial effect on invading bacteria. PMID:18519585
Xiong, Jie; Gao, Shan; Dui, Wen; Yang, Wentao; Chen, Xiao; Taverna, Sean D; Pearlman, Ronald E; Ashlock, Wendy; Miao, Wei; Liu, Yifan
2016-12-01
The ciliate protozoan Tetrahymena thermophila contains two types of structurally and functionally differentiated nuclei: the transcriptionally active somatic macronucleus (MAC) and the transcriptionally silent germ-line micronucleus (MIC). Here, we demonstrate that MAC features well-positioned nucleosomes downstream of transcription start sites and flanking splice sites. Transcription-associated trans-determinants promote nucleosome positioning in MAC. By contrast, nucleosomes in MIC are dramatically delocalized. Nucleosome occupancy in MAC and MIC are nonetheless highly correlated with each other, as well as with in vitro reconstitution and predictions based upon DNA sequence features, revealing unexpectedly strong contributions from cis-determinants. In particular, well-positioned nucleosomes are often matched with GC content oscillations. As many nucleosomes are coordinately accommodated by both cis- and trans-determinants, we propose that their distribution is shaped by the impact of these nucleosomes on the mutational and transcriptional landscape, and driven by evolutionary selection. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Catteau, Aurélie; Rosewell, Ian; Solomon, Ellen; Taylor-Papadimitriou, Joyce
2004-07-01
The recently cloned gene PLU-1 shows restricted expression in adult tissues, with high expression being found in testis, and transiently in the pregnant mammary gland. However, both the gene and the protein product are specifically up-regulated in breast cancer. To investigate the control of expression of the PLU-1 gene, we have cloned and functionally characterised the 5' flanking region of the gene, which was found to contain another putative gene. Two transcription start sites of the PLU-1 gene were mapped by 5' RACE. A short proximal 249 bp region was defined using reporter gene assays, which encompasses the major transcription start site and exhibits a strong constitutive promoter activity in all cell lines tested. However, regions upstream of this sequence repress transcription more effectively in a non-malignant breast cell line as compared to breast cancer cell lines. The 249 bp region is GC-rich and includes consensus Sp1 sites, GC boxes, cAMP-responsive element (CRE) and other putative cis-elements. Mutational analysis showed that two intact conserved Sp1 binding sites (shown here to bind Sp1 and/or Sp3) are critical for constitutive promoter activity, while a negative role for a neighbouring GC box is indicated. The sequence of the core promoter is highly conserved in the mouse and Plu-1 expression in the mouse embryo has been documented. Using transgenesis, we therefore examined the ability of the 249 bp fragment to control expression of a reporter gene during embryogenesis. We found that not only is the core promoter sufficient to activate transcription in vivo, but that the expression of the reporter gene coincides both temporally and spatially with regions where endogenous Plu-1 is highly expressed. This suggests that tissue specific controlling elements are found within the short fragment and are functional in the embryonic environment.
Frädrich, Claudia; March, Anika; Fiege, Kerstin; Hartmann, Anja; Jahn, Dieter
2012-01-01
Bacillus subtilis forms acetoin under anaerobic fermentative growth conditions and as a product of the aerobic carbon overflow metabolism. Acetoin formation from pyruvate requires α-acetolactate synthase and acetolactate decarboxylase, both encoded by the alsSD operon. The alsR gene, encoding the LysR-type transcriptional regulator AlsR, was found to be essential for the in vivo expression of alsSD in response to anaerobic acetate accumulation, the addition of acetate, low pH, and the aerobic stationary phase. The expressions of the alsSD operon and the alsR regulatory gene were independent of other regulators of the anaerobic regulatory network, including ResDE, Fnr, and ArfM. A negative autoregulation of alsR was observed. In vitro transcription from the alsSD promoter using purified B. subtilis RNA polymerase required AlsR. DNA binding studies with purified recombinant AlsR in combination with promoter mutagenesis experiments identified a 19-bp high-affinity palindromic binding site (TAAT-N11-ATTA) at positions −76 to −58 (regulatory binding site [RBS]) and a low-affinity site (AT-N11-AT) at positions −41 to −27 (activator binding site [ABS]) upstream of the transcriptional start site of alsSD. The RBS and ABS were found to be essential for in vivo alsSD transcription. AlsR binding to both sites induced the formation of higher-order, transcription-competent complexes. The AlsR protein carrying the S100A substitution at the potential coinducer binding site still bound to the RBS and ABS. However, AlsR(S100A) failed to form the higher-order complex and to initiate in vivo and in vitro transcription. A model for AlsR promoter binding and transcriptional activation was deduced. PMID:22178965
Shiao, Yih-Horng; Lupascu, Sorin T; Gu, Yuhan D; Kasprzak, Wojciech; Hwang, Christopher J; Fields, Janet R; Leighty, Robert M; Quiñones, Octavio; Shapiro, Bruce A; Alvord, W Gregory; Anderson, Lucy M
2009-10-19
Ribosomal RNA (rRNA) is a central regulator of cell growth and may control cancer development. A cis noncoding rRNA (nc-rRNA) upstream from the 45S rRNA transcription start site has recently been implicated in control of rRNA transcription in mouse fibroblasts. We investigated whether a similar nc-rRNA might be expressed in human cancer epithelial cells, and related to any genomic characteristics. Using quantitative rRNA measurement, we demonstrated that a nc-rRNA is transcribed in human lung epithelial and lung cancer cells, starting from approximately -1000 nucleotides upstream of the rRNA transcription start site (+1) and extending at least to +203. This nc-rRNA was significantly more abundant in the majority of lung cancer cell lines, relative to a nontransformed lung epithelial cell line. Its abundance correlated negatively with total 45S rRNA in 12 of 13 cell lines (P = 0.014). During sequence analysis from -388 to +306, we observed diverse, frequent intercopy single nucleotide polymorphisms (SNPs) in rRNA, with a frequency greater than predicted by chance at 12 sites. A SNP at +139 (U/C) in the 5' leader sequence varied among the cell lines and correlated negatively with level of the nc-rRNA (P = 0.014). Modelling of the secondary structure of the rRNA 5'-leader sequence indicated a small increase in structural stability due to the +139 U/C SNP and a minor shift in local configuration occurrences. The results demonstrate occurrence of a sense nc-rRNA in human lung epithelial and cancer cells, and imply a role in regulation of the rRNA gene, which may be affected by a +139 SNP in the 5' leader sequence of the primary rRNA transcript.
Gilbert, Kathleen M.; Blossom, Sarah J.; Reisfeld, Brad; Erickson, Stephen W.; Vyas, Kanan; Maher, Mary; Broadfoot, Brannon; West, Kirk; Bai, Shasha; Cooney, Craig A.; Bhattacharyya, Sudeepa
2017-01-01
Abstract Exposure to industrial solvent and water pollutant trichloroethylene (TCE) can promote autoimmunity, and expand effector/memory (CD62L) CD4+ T cells. In order to better understand etiology reduced representation bisulfite sequencing was used to study how a 40-week exposure to TCE in drinking water altered methylation of ∼337 770 CpG sites across the entire genome of effector/memory CD4+ T cells from MRL+/+ mice. Regardless of TCE exposure, 62% of CpG sites in autosomal chromosomes were hypomethylated (0–15% methylation), and 25% were hypermethylated (85–100% methylation). In contrast, only 6% of the CpGs on the X chromosome were hypomethylated, and 51% had mid-range methylation levels. In terms of TCE impact, TCE altered (≥ 10%) the methylation of 233 CpG sites in effector/memory CD4+ T cells. Approximately 31.7% of these differentially methylated sites occurred in regions known to bind one or more Polycomb group (PcG) proteins, namely Ezh2, Suz12, Mtf2 or Jarid2. In comparison, only 23.3% of CpG sites not differentially methylated by TCE were found in PcG protein binding regions. Transcriptomics revealed that TCE altered the expression of ∼560 genes in the same effector/memory CD4+ T cells. At least 80% of the immune genes altered by TCE had binding sites for PcG proteins flanking their transcription start site, or were regulated by other transcription factors that were in turn ordered by PcG proteins at their own transcription start site. Thus, PcG proteins, and the differential methylation of their binding sites, may represent a new mechanism by which TCE could alter the function of effector/memory CD4+ T cells. PMID:29129997
Localization of TFIIB binding regions using serial analysis of chromatin occupancy
Yochum, Gregory S; Rajaraman, Veena; Cleland, Ryan; McWeeney, Shannon
2007-01-01
Background: RNA Polymerase II (RNAP II) is recruited to core promoters by the pre-initiation complex (PIC) of general transcription factors. Within the PIC, transcription factor for RNA polymerase IIB (TFIIB) determines the start site of transcription. TFIIB binding has not been localized, genome-wide, in metazoans. Serial analysis of chromatin occupancy (SACO) is an unbiased methodology used to empirically identify transcription factor binding regions. In this report, we use TFIIB and SACO to localize TFIIB binding regions across the rat genome. Results: A sample of the TFIIB SACO library was sequenced and 12,968 TFIIB genomic signature tags (GSTs) were assigned to the rat genome. GSTs are 20–22 base pair fragments that are derived from TFIIB bound chromatin. TFIIB localized to both non-protein coding and protein-coding loci. For 21% of the 1783 protein-coding genes in this sample of the SACO library, TFIIB binding mapped near the characterized 5' promoter that is upstream of the transcription start site (TSS). However, internal TFIIB binding positions were identified in 57% of the 1783 protein-coding genes. Internal positions are defined as those within an inclusive region greater than 2.5 kb downstream from the 5' TSS and 2.5 kb upstream from the transcription stop. We demonstrate that both TFIIB and TFIID (an additional component of PICs) bound to internal regions using chromatin immunoprecipitation (ChIP). The 5' cap of transcripts associated with internal TFIIB binding positions were identified using a cap-trapping assay. The 5' TSSs for internal transcripts were confirmed by primer extension. Additionally, an analysis of the functional annotation of mouse 3 (FANTOM3) databases indicates that internally initiated transcripts identified by TFIIB SACO in rat are conserved in mouse. Conclusion: Our findings that TFIIB binding is not restricted to the 5' upstream region indicates that the propensity for PIC to contribute to transcript diversity is far greater than previously appreciated. PMID:17997859
Conservation of Transcription Start Sites within Genes across a Bacterial Genus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shao, Wenjun; Price, Morgan N.; Deutschbauer, Adam M.
Transcription start sites (TSSs) lying inside annotated genes, on the same or opposite strand, have been observed in diverse bacteria, but the function of these unexpected transcripts is unclear. Here, we use the metal-reducing bacterium Shewanella oneidensis MR-1 and its relatives to study the evolutionary conservation of unexpected TSSs. Using high-resolution tiling microarrays and 5'-end RNA sequencing, we identified 2,531 TSSs in S. oneidensis MR-1, of which 18% were located inside coding sequences (CDSs). Comparative transcriptome analysis with seven additional Shewanella species revealed that the majority (76%) of the TSSs within the upstream regions of annotated genes (gTSSs) were conserved.more » Thirty percent of the TSSs that were inside genes and on the sense strand (iTSSs) were also conserved. Sequence analysis around these iTSSs showed conserved promoter motifs, suggesting that many iTSS are under purifying selection. Furthermore, conserved iTSSs are enriched for regulatory motifs, suggesting that they are regulated, and they tend to eliminate polar effects, which confirms that they are functional. In contrast, the transcription of antisense TSSs located inside CDSs (aTSSs) was significantly less likely to be conserved (22%). However, aTSSs whose transcription was conserved often have conserved promoter motifs and drive the expression of nearby genes. Overall, our findings demonstrate that some internal TSSs are conserved and drive protein expression despite their unusual locations, but the majority are not conserved and may reflect noisy initiation of transcription rather than a biological function.« less
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Bhattarai, Sunil; Aly, Ahmed; Garcia, Kristy; Ruiz, Diandra; Pontarelli, Fabrizio; Dharap, Ashutosh
2018-06-03
Gene expression in cerebral ischemia has been a subject of intense investigations for several years. Studies utilizing probe-based high-throughput methodologies such as microarrays have contributed significantly to our existing knowledge but lacked the capacity to dissect the transcriptome in detail. Genome-wide RNA-sequencing (RNA-seq) enables comprehensive examinations of transcriptomes for attributes such as strandedness, alternative splicing, alternative transcription start/stop sites, and sequence composition, thus providing a very detailed account of gene expression. Leveraging this capability, we conducted an in-depth, genome-wide evaluation of the protein-coding transcriptome of the adult mouse cortex after transient focal ischemia at 6, 12, or 24 h of reperfusion using RNA-seq. We identified a total of 1007 transcripts at 6 h, 1878 transcripts at 12 h, and 1618 transcripts at 24 h of reperfusion that were significantly altered as compared to sham controls. With isoform-level resolution, we identified 23 splice variants arising from 23 genes that were novel mRNA isoforms. For a subset of genes, we detected reperfusion time-point-dependent splice isoform switching, indicating an expression and/or functional switch for these genes. Finally, for 286 genes across all three reperfusion time-points, we discovered multiple, distinct, simultaneously expressed and differentially altered isoforms per gene that were generated via alternative transcription start/stop sites. Of these, 165 isoforms derived from 109 genes were novel mRNAs. Together, our data unravel the protein-coding transcriptome of the cerebral cortex at an unprecedented depth to provide several new insights into the flexibility and complexity of stroke-related gene transcription and transcript organization.
Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.
2014-01-01
Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565
Pessler, F; Pendergrast, P S; Hernandez, N
1997-07-01
The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes.
Muro-Pastor, Alicia M.; Valladares, Ana; Flores, Enrique; Herrero, Antonia
1999-01-01
The heterocyst is the site of nitrogen fixation in aerobically grown cultures of some filamentous cyanobacteria. Heterocyst development in Anabaena sp. strain PCC 7120 is dependent on the global nitrogen regulator NtcA and requires, among others, the products of the hetR and hetC genes. Expression of hetC, tested by RNA- DNA hybridization, was impaired in an ntcA mutant. A nitrogen-regulated, NtcA-dependent putative transcription start point was localized at nucleotide −571 with respect to the hetC translational start. Sequences upstream from this transcription start point exhibit the structure of the canonical cyanobacterial promoter activated by NtcA, and purified NtcA protein specifically bound to a DNA fragment containing this promoter. Activation of expression of hetC during heterocyst development appears thus to be directly operated by NtcA. NtcA-mediated activation of hetR expression was not impaired in a hetC mutant, indicating that HetC is not an NtcA-dependent element required for hetR induction. PMID:10542167
Aldosterone alters the chromatin structure of the murine endothelin-1 gene.
Welch, Amanda K; Jeanette Lynch, I; Gumz, Michelle L; Cain, Brian D; Wingo, Charles S
2016-08-15
Aldosterone increases sodium reabsorption in the renal collecting duct and systemic blood pressure. Paradoxically, aldosterone also induces transcription of the endothelin-1 (Edn1) gene to increase protein (ET-1) levels, which inhibits sodium reabsorption. Here we investigated changes in the chromatin structure of the Edn1 gene of collecting duct cell lines in response to aldosterone treatment. The Edn1 gene has a CpG island that encompasses the transcription start site and four sites in the 5' regulatory region previously linked to transcriptional regulation. The chromatin structure of the Edn1 gene was investigated using a quantitative PCR-based DNaseI hypersensitivity assay in murine hepatocyte (AML12), renal cortical collecting duct (mpkCCDC14), outer medullary collecting duct1 (OMCD1), and inner medullary collecting duct-3 (IMCD-3) cell lines. The CpG island was uniformly accessible. One calcium-responsive NFAT element remained at low chromatin accessibility in all cell lines under all conditions tested. However, the second calcium responsive NFAT element located at -1563bp upstream became markedly more accessible in IMCD-3 cells exposed to aldosterone. Importantly, one established aldosterone hormone response element HRE at -671bp relative to the transcription start site was highly accessible, and another HRE (-551bp) became more accessible in aldosterone-treated IMCD-3 and OMCD1 cells. The evidence supports a model in which aldosterone activation of the mineralocorticoid receptor (MR) results in the MR-hormone complex binding at HRE at -671bp to open chromatin structure around other regulatory elements in the Edn1 gene. Published by Elsevier Inc.
Jorjani, Hadi; Zavolan, Mihaela
2014-04-01
Accurate identification of transcription start sites (TSSs) is an essential step in the analysis of transcription regulatory networks. In higher eukaryotes, the capped analysis of gene expression technology enabled comprehensive annotation of TSSs in genomes such as those of mice and humans. In bacteria, an equivalent approach, termed differential RNA sequencing (dRNA-seq), has recently been proposed, but the application of this approach to a large number of genomes is hindered by the paucity of computational analysis methods. With few exceptions, when the method has been used, annotation of TSSs has been largely done manually. In this work, we present a computational method called 'TSSer' that enables the automatic inference of TSSs from dRNA-seq data. The method rests on a probabilistic framework for identifying both genomic positions that are preferentially enriched in the dRNA-seq data as well as preferentially captured relative to neighboring genomic regions. Evaluating our approach for TSS calling on several publicly available datasets, we find that TSSer achieves high consistency with the curated lists of annotated TSSs, but identifies many additional TSSs. Therefore, TSSer can accelerate genome-wide identification of TSSs in bacterial genomes and can aid in further characterization of bacterial transcription regulatory networks. TSSer is freely available under GPL license at http://www.clipz.unibas.ch/TSSer/index.php
Tn5Prime, a Tn5 based 5' capture method for single cell RNA-seq.
Cole, Charles; Byrne, Ashley; Beaudin, Anna E; Forsberg, E Camilla; Vollmers, Christopher
2018-06-01
RNA-sequencing (RNA-seq) is a powerful technique to investigate and quantify entire transcriptomes. Recent advances in the field have made it possible to explore the transcriptomes of single cells. However, most widely used RNA-seq protocols fail to provide crucial information regarding transcription start sites. Here we present a protocol, Tn5Prime, that takes advantage of the Tn5 transposase-based Smart-seq2 protocol to create RNA-seq libraries that capture the 5' end of transcripts. The Tn5Prime method dramatically streamlines the 5' capture process and is both cost effective and reliable. By applying Tn5Prime to bulk RNA and single cell samples, we were able to define transcription start sites as well as quantify transcriptomes at high accuracy and reproducibility. Additionally, similar to 3' end-based high-throughput methods like Drop-seq and 10× Genomics Chromium, the 5' capture Tn5Prime method allows the introduction of cellular identifiers during reverse transcription, simplifying the analysis of large numbers of single cells. In contrast to 3' end-based methods, Tn5Prime also enables the assembly of the variable 5' ends of the antibody sequences present in single B-cell data. Therefore, Tn5Prime presents a robust tool for both basic and applied research into the adaptive immune system and beyond.
Structural properties of prokaryotic promoter regions correlate with functional features.
Meysman, Pieter; Collado-Vides, Julio; Morett, Enrique; Viola, Roberto; Engelen, Kristof; Laukens, Kris
2014-01-01
The structural properties of the DNA molecule are known to play a critical role in transcription. In this paper, the structural profiles of promoter regions were studied within the context of their diversity and their function for eleven prokaryotic species; Escherichia coli, Klebsiella pneumoniae, Salmonella Typhimurium, Pseudomonas auroginosa, Geobacter sulfurreducens Helicobacter pylori, Chlamydophila pneumoniae, Synechocystis sp., Synechoccocus elongates, Bacillus anthracis, and the archaea Sulfolobus solfataricus. The main anchor point for these promoter regions were transcription start sites identified through high-throughput experiments or collected within large curated databases. Prokaryotic promoter regions were found to be less stable and less flexible than the genomic mean across all studied species. However, direct comparison between species revealed differences in their structural profiles that can not solely be explained by the difference in genomic GC content. In addition, comparison with functional data revealed that there are patterns in the promoter structural profiles that can be linked to specific functional loci, such as sigma factor regulation or transcription factor binding. Interestingly, a novel structural element clearly visible near the transcription start site was found in genes associated with essential cellular functions and growth in several species. Our analyses reveals the great diversity in promoter structural profiles both between and within prokaryotic species. We observed relationships between structural diversity and functional features that are interesting prospects for further research to yet uncharacterized functional loci defined by DNA structural properties.
Nascent Transcription Affected by RNA Polymerase IV in Zea mays
Erhard, Karl F.; Talbot, Joy-El R. B.; Deans, Natalie C.; McClish, Allison E.; Hollick, Jay B.
2015-01-01
All eukaryotes use three DNA-dependent RNA polymerases (RNAPs) to create cellular RNAs from DNA templates. Plants have additional RNAPs related to Pol II, but their evolutionary role(s) remain largely unknown. Zea mays (maize) RNA polymerase D1 (RPD1), the largest subunit of RNA polymerase IV (Pol IV), is required for normal plant development, paramutation, transcriptional repression of certain transposable elements (TEs), and transcriptional regulation of specific alleles. Here, we define the nascent transcriptomes of rpd1 mutant and wild-type (WT) seedlings using global run-on sequencing (GRO-seq) to identify the broader targets of RPD1-based regulation. Comparisons of WT and rpd1 mutant GRO-seq profiles indicate that Pol IV globally affects transcription at both transcriptional start sites and immediately downstream of polyadenylation addition sites. We found no evidence of divergent transcription from gene promoters as seen in mammalian GRO-seq profiles. Statistical comparisons identify genes and TEs whose transcription is affected by RPD1. Most examples of significant increases in genic antisense transcription appear to be initiated by 3ʹ-proximal long terminal repeat retrotransposons. These results indicate that maize Pol IV specifies Pol II-based transcriptional regulation for specific regions of the maize genome including genes having developmental significance. PMID:25653306
Sansó, Miriam; Fisher, Robert P
2013-01-01
Cyclin-dependent kinases (CDKs) play a central role in governing eukaryotic cell division. It is becoming clear that the transcription cycle of RNA polymerase II (RNAP II) is also regulated by CDKs; in metazoans, the cell cycle and transcriptional CDK networks even share an upstream activating kinase, which is itself a CDK. From recent chemical-genetic analyses we know that CDKs and their substrates control events both early in transcription (the transition from initiation to elongation) and late (3′ end formation and transcription termination). Moreover, mutual dependence on CDK activity might couple the “beginning” and “end” of the cycle, to ensure the fidelity of mRNA maturation and the efficient recycling of RNAP II from sites of termination to the transcription start site (TSS). As is the case for CDKs involved in cell cycle regulation, different transcriptional CDKs act in defined sequence on multiple substrates. These phosphorylations are likely to influence gene expression by several mechanisms, including direct, allosteric effects on the transcription machinery, co-transcriptional recruitment of proteins needed for mRNA-capping, splicing and 3′ end maturation, dependent on multisite phosphorylation of the RNAP II C-terminal domain (CTD) and, perhaps, direct regulation of RNA-processing or histone-modifying machinery. Here we review these recent advances, and preview the emerging challenges for transcription-cycle research. PMID:23756342
Human Promoters Are Intrinsically Directional
Duttke, Sascha H.C.; Lacadie, Scott A.; Ibrahim, Mahmoud M.; Glass, Christopher K.; Corcoran, David L.; Benner, Christopher; Heinz, Sven; Kadonaga, James T.; Ohler, Uwe
2015-01-01
Divergent transcription, in which reverse-oriented transcripts occur upstream of eukaryotic promoters in regions devoid of annotated genes, has been suggested to be a general property of active promoters. Here we show that the human basal RNA polymerase II transcriptional machinery and core promoter are inherently unidirectional, and that reverse-oriented transcripts originate from their own cognate reverse-directed core promoters. In vitro transcription analysis and mapping of nascent transcripts in cells revealed that sequences at reverse start sites are similar to those of their forward counterparts. The use of DNase I accessibility to define proximal promoter borders revealed that up to half of promoters are unidirectional and that unidirectional promoters are depleted at their upstream edges of reverse core promoter sequences and their associated chromatin features. Divergent transcription is thus not an inherent property of the transcription process, but rather the consequence of the presence of both forward- and reverse-directed core promoters. PMID:25639469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex
Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1)more » were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular transformation.« less
Croager, Emma J.; Gout, Alexander M.; Abraham, Lawrence J.
2000-01-01
CD30, as a member of the tumor necrosis factor (TNF) receptor family, is expressed on the surface of activated lymphoid cells. CD30 overexpression is a characteristic of lymphoproliferative diseases such as Hodgkin’s/non-Hodgkin’s lymphomas, embryonal carcinoma, and a number of Th2-associated diseases. The CD30 gene has been mapped to a region of the murine genome that is involved in susceptibility to systemic lupus erythematosus. Functionally, CD30 may play a role in the deletion of autoreactive T cells. We were interested in determining the molecular nature of CD30 overexpression. Sequence comparison has revealed significant identity between the TATA-less human and murine CD30 promoters; they share a number of common consensus binding motifs. Transfection assays identified three regions of transcriptional importance; the region between position −1.2 kb and −336 bp, containing a CCAT microsatellite sequence, a conserved Sp1 site at positions −43 to −38, and a downstream promoter element (DPE) at positions +24 to +29. EMSA and DNase I footprinting showed specific DNA-protein interactions of the CD30 promoter with the Sp1 site and the CCAT repeat region. The DPE element was shown to be essential for start site selection. We conclude that the conserved Sp1 site at −43 to −38 is associated with maximum reporter gene activity, the DPE element is required for start site selection, and the CCAT tetranucleotide repeats act to repress transcription. We also have shown that the microsatellite is multiallelic, when we screened a random healthy population. Further studies are required to determine whether microsatellite instability in the repressor predisposes susceptible individuals to CD30 overexpression. PMID:10793083
Scieglinska, D; Widłak, W; Konopka, W; Poutanen, M; Rahman, N; Huhtaniemi, I; Krawczyk, Z
2001-01-01
The rat Hst70 gene and its mouse counterpart Hsp70.2 belong to the family of Hsp70 heat shock genes and are specifically expressed in male germ cells. Previous studies regarding the structure of the 5' region of the transcription unit of these genes as well as localization of the 'cis' elements conferring their testis-specific expression gave contradictory results [Widlak, Markkula, Krawczyk, Kananen and Huhtaniemi (1995) Biochim. Biophys. Acta 1264, 191-200; Dix, Rosario-Herrle, Gotoh, Mori, Goulding, Barret and Eddy (1996) Dev. Biol. 174, 310-321]. In the present paper we solve these controversies and show that the 5' untranslated region (UTR) of the Hst70 gene contains an intron which is localized similar to that of the mouse Hsp70.2 gene. Reverse transcriptase-mediated PCR, Northern blotting and RNase protection analysis revealed that the transcription initiation of both genes starts at two main distant sites, and one of them is localized within the intron. As a result two populations of Hst70 gene transcripts with similar sizes but different 5' UTR structures can be detected in total testicular RNA. Functional analysis of the Hst70 gene promoter in transgenic mice and transient transfection assays proved that the DNA fragment of approx. 360 bp localized upstream of the ATG transcription start codon is the minimal promoter required for testis-specific expression of the HST70/chloramphenicol acetyltransferase transgene. These experiments also suggest that the expression of the gene may depend on 'cis' regulatory elements localized within exon 1 and the intron sequences. PMID:11563976
Identification of Conserved and Potentially Regulatory Small RNAs in Heterocystous Cyanobacteria.
Brenes-Álvarez, Manuel; Olmedo-Verd, Elvira; Vioque, Agustín; Muro-Pastor, Alicia M
2016-01-01
Small RNAs (sRNAs) are a growing class of non-protein-coding transcripts that participate in the regulation of virtually every aspect of bacterial physiology. Heterocystous cyanobacteria are a group of photosynthetic organisms that exhibit multicellular behavior and developmental alternatives involving specific transcriptomes exclusive of a given physiological condition or even a cell type. In the context of our ongoing effort to understand developmental decisions in these organisms we have undertaken an approach to the global identification of sRNAs. Using differential RNA-Seq we have previously identified transcriptional start sites for the model heterocystous cyanobacterium Nostoc sp. PCC 7120. Here we combine this dataset with a prediction of Rho-independent transcriptional terminators and an analysis of phylogenetic conservation of potential sRNAs among 89 available cyanobacterial genomes. In contrast to predictive genome-wide approaches, the use of an experimental dataset comprising all active transcriptional start sites (differential RNA-Seq) facilitates the identification of bona fide sRNAs. The output of our approach is a dataset of predicted potential sRNAs in Nostoc sp. PCC 7120, with different degrees of phylogenetic conservation across the 89 cyanobacterial genomes analyzed. Previously described sRNAs appear among the predicted sRNAs, demonstrating the performance of the algorithm. In addition, new predicted sRNAs are now identified that can be involved in regulation of different aspects of cyanobacterial physiology, including adaptation to nitrogen stress, the condition that triggers differentiation of heterocysts (specialized nitrogen-fixing cells). Transcription of several predicted sRNAs that appear exclusively in the genomes of heterocystous cyanobacteria is experimentally verified by Northern blot. Cell-specific transcription of one of these sRNAs, NsiR8 (nitrogen stress-induced RNA 8), in developing heterocysts is also demonstrated.
Promoters, toll like receptors and microRNAs: a strange association.
Korla, Kalyani; Arrigo, Patrizio; Mitra, Chanchal K
2013-06-01
Toll-like receptors (TLRs) are proteins that play key role in the innate immune system. In the present study, -1000 base pairs upstream are taken from the transcription start site of the various TLR genes (10 known) in human. About 40 microRNAs have been identified that share 12-19 nucleotide sequence similarity with the promoter regions of 10 TLRs. It is proposed that the microRNA performs potential role in identification of promoter sequence and initiation of transcription.
Identification of Candidate Transcription Factor Binding Sites in the Cattle Genome
Bickhart, Derek M.; Liu, George E.
2013-01-01
A resource that provides candidate transcription factor binding sites (TFBSs) does not currently exist for cattle. Such data is necessary, as predicted sites may serve as excellent starting locations for future omics studies to develop transcriptional regulation hypotheses. In order to generate this resource, we employed a phylogenetic footprinting approach—using sequence conservation across cattle, human and dog—and position-specific scoring matrices to identify 379,333 putative TFBSs upstream of nearly 8000 Mammalian Gene Collection (MGC) annotated genes within the cattle genome. Comparisons of our predictions to known binding site loci within the PCK1, ACTA1 and G6PC promoter regions revealed 75% sensitivity for our method of discovery. Additionally, we intersected our predictions with known cattle SNP variants in dbSNP and on the Illumina BovineHD 770k and Bos 1 SNP chips, finding 7534, 444 and 346 overlaps, respectively. Due to our stringent filtering criteria, these results represent high quality predictions of putative TFBSs within the cattle genome. All binding site predictions are freely available at http://bfgl.anri.barc.usda.gov/BovineTFBS/ or http://199.133.54.77/BovineTFBS. PMID:23433959
Transposon Tn10 contains two structural genes with opposite polarity between tetA and IS10R.
Schollmeier, K; Hillen, W
1984-01-01
The nucleotide sequence of the central part of Tn10 has been determined from the rightmost HindIII site to IS10R. This sequence contains two open reading frames with opposite polarity. The in vivo transcription start points in this sequence have been determined by S1 mapping. These results define one minor and two major promoters. The transcription starts of the two major promoters are only 18 base pairs apart, and the transcripts show different polarity and overlap by 18 base pairs. The nucleotide sequence reveals two regions with palindromic symmetry which may serve as operators. Their possible involvement in the regulation of transcription of both genes is discussed. Taken together these results allow for a maximal coding capacity of 138 amino acids directed toward IS10R and 197 amino acids directed toward tetA. The possible function of these gene products is discussed. The accompanying article (Braus et al., J. Bacteriol. 160:504-509, 1984) presents evidence that these genes are expressed. Images PMID:6094471
Pessler, F; Pendergrast, P S; Hernandez, N
1997-01-01
The human immunodeficiency virus (HIV-1) promoter directs the synthesis of two classes of RNA molecules, short transcripts and full-length transcripts. The synthesis of short transcripts depends on a bipartite DNA element, the inducer of short transcripts (IST), located in large part downstream of the HIV-1 start site of transcription. IST does not require any viral product for function and is thought to direct the assembly of transcription complexes that are incapable of efficient elongation. Nothing is known, however, about the biochemical mechanisms that mediate IST function. Here, we report the identification and purification of a factor that binds specifically to the IST. This factor, FBI-1, recognizes a large bipartite binding site that coincides with the bipartite IST element. It is constituted at least in part by an 86-kDa polypeptide that can be specifically cross-linked to IST. FBI-1 also binds to promoter and attenuation regions of a number of cellular and viral transcription units that are regulated by a transcription elongation block. This observation, together with the observation that the binding of FBI-1 to IST mutants correlates with the ability of these mutants to direct IST function, suggests that FBI-1 may be involved in the establishment of abortive transcription complexes. PMID:9199312
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
Nucleosome regulatory dynamics in response to TGFβ
Enroth, Stefan; Andersson, Robin; Bysani, Madhusudhan; Wallerman, Ola; Termén, Stefan; Tuch, Brian B.; De La Vega, Francisco M.; Heldin, Carl-Henrik; Moustakas, Aristidis; Komorowski, Jan; Wadelius, Claes
2014-01-01
Nucleosomes play important roles in a cell beyond their basal functionality in chromatin compaction. Their placement affects all steps in transcriptional regulation, from transcription factor (TF) binding to messenger ribonucleic acid (mRNA) synthesis. Careful profiling of their locations and dynamics in response to stimuli is important to further our understanding of transcriptional regulation by the state of chromatin. We measured nucleosome occupancy in human hepatic cells before and after treatment with transforming growth factor beta 1 (TGFβ1), using massively parallel sequencing. With a newly developed method, SuMMIt, for precise positioning of nucleosomes we inferred dynamics of the nucleosomal landscape. Distinct nucleosome positioning has previously been described at transcription start site and flanking TF binding sites. We found that the average pattern is present at very few sites and, in case of TF binding, the double peak surrounding the sites is just an artifact of averaging over many loci. We systematically searched for depleted nucleosomes in stimulated cells compared to unstimulated cells and identified 24 318 loci. Depending on genomic annotation, 44–78% of them were over-represented in binding motifs for TFs. Changes in binding affinity were verified for HNF4α by qPCR. Strikingly many of these loci were associated with expression changes, as measured by RNA sequencing. PMID:24771338
Effects of cytosine methylation on transcription factor binding sites
2014-01-01
Background DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important. Results We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines “traffic lights”. We observed a strong selection against CpG “traffic lights” within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions. Conclusions Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. PMID:24669864
Retrotransposon profiling of RNA polymerase III initiation sites.
Qi, Xiaojie; Daily, Kenneth; Nguyen, Kim; Wang, Haoyi; Mayhew, David; Rigor, Paul; Forouzan, Sholeh; Johnston, Mark; Mitra, Robi David; Baldi, Pierre; Sandmeyer, Suzanne
2012-04-01
Although retroviruses are relatively promiscuous in choice of integration sites, retrotransposons can display marked integration specificity. In yeast and slime mold, some retrotransposons are associated with tRNA genes (tDNAs). In the Saccharomyces cerevisiae genome, the long terminal repeat retrotransposon Ty3 is found at RNA polymerase III (Pol III) transcription start sites of tDNAs. Ty1, 2, and 4 elements also cluster in the upstream regions of these genes. To determine the extent to which other Pol III-transcribed genes serve as genomic targets for Ty3, a set of 10,000 Ty3 genomic retrotranspositions were mapped using high-throughput DNA sequencing. Integrations occurred at all known tDNAs, two tDNA relics (iYGR033c and ZOD1), and six non-tDNA, Pol III-transcribed types of genes (RDN5, SNR6, SNR52, RPR1, RNA170, and SCR1). Previous work in vitro demonstrated that the Pol III transcription factor (TF) IIIB is important for Ty3 targeting. However, seven loci that bind the TFIIIB loader, TFIIIC, were not targeted, underscoring the unexplained absence of TFIIIB at those sites. Ty3 integrations also occurred in two open reading frames not previously associated with Pol III transcription, suggesting the existence of a small number of additional sites in the yeast genome that interact with Pol III transcription complexes.
Co-regulation analysis of co-expressed modules under cold and pathogen stress conditions in tomato.
Abedini, Davar; Rashidi Monfared, Sajad
2018-06-01
A primary mechanism for controlling the development of multicellular organisms is transcriptional regulation, which carried out by transcription factors (TFs) that recognize and bind to their binding sites on promoter region. The distance from translation start site, order, orientation, and spacing between cis elements are key factors in the concentration of active nuclear TFs and transcriptional regulation of target genes. In this study, overrepresented motifs in cold and pathogenesis responsive genes were scanned via Gibbs sampling method, this method is based on detection of overrepresented motifs by means of a stochastic optimization strategy that searches for all possible sets of short DNA segments. Then, identified motifs were checked by TRANSFAC, PLACE and Soft Berry databases in order to identify putative TFs which, interact to the motifs. Several cis/trans regulatory elements were found using these databases. Moreover, cross-talk between cold and pathogenesis responsive genes were confirmed. Statistical analysis was used to determine distribution of identified motifs on promoter region. In addition, co-regulation analysis results, illustrated genes in pathogenesis responsive module are divided into two main groups. Also, promoter region was crunched to six subareas in order to draw the pattern of distribution of motifs in promoter subareas. The result showed the majority of motifs are concentrated on 700 nucleotides upstream of the translational start site (ATG). In contrast, this result isn't true in another group. In other words, there was no difference between total and compartmentalized regions in cold responsive genes.
Determinants of G quadruplex-induced epigenetic instability in REV1-deficient cells
Schiavone, Davide; Guilbaud, Guillaume; Murat, Pierre; Papadopoulou, Charikleia; Sarkies, Peter; Prioleau, Marie-Noëlle; Balasubramanian, Shankar; Sale, Julian E
2014-01-01
REV1-deficient chicken DT40 cells are compromised in replicating G quadruplex (G4)-forming DNA. This results in localised, stochastic loss of parental chromatin marks and changes in gene expression. We previously proposed that this epigenetic instability arises from G4-induced replication fork stalls disrupting the accurate propagation of chromatin structure through replication. Here, we test this model by showing that a single G4 motif is responsible for the epigenetic instability of the BU-1 locus in REV1-deficient cells, despite its location 3.5 kb from the transcription start site (TSS). The effect of the G4 is dependent on it residing on the leading strand template, but is independent of its in vitro thermal stability. Moving the motif to more than 4 kb from the TSS stabilises expression of the gene. However, loss of histone modifications (H3K4me3 and H3K9/14ac) around the transcription start site correlates with the position of the G4 motif, expression being lost only when the promoter is affected. This supports the idea that processive replication is required to maintain the histone modification pattern and full transcription of this model locus. PMID:25190518
1994-01-01
Elevation of cAMP can cause gene-specific inhibition of interleukin 2 (IL-2) expression. To investigate the mechanism of this effect, we have combined electrophoretic mobility shift assays and in vivo genomic footprinting to assess both the availability of putative IL-2 transcription factors in forskolin-treated cells and the functional capacity of these factors to engage their sites in vivo. All observed effects of forskolin depended upon protein kinase A, for they were blocked by introduction of a dominant negative mutant subunit of protein kinase A. In the EL4.E1 cell line, we report specific inhibitory effects of cAMP elevation both on NF-kappa B/Rel family factors binding at -200 bp, and on a novel, biochemically distinct "TGGGC" factor binding at -225 bp with respect to the IL-2 transcriptional start site. Neither NF-AT nor AP-1 binding activities are detectably inhibited in gel mobility shift assays. Elevation of cAMP inhibits NF-kappa B activity with delayed kinetics in association with a delayed inhibition of IL-2 RNA accumulation. Activation of cells in the presence of forskolin prevents the maintenance of stable protein- DNA interactions in vivo, not only at the NF-kappa B and TGGGC sites of the IL-2 enhancer, but also at the NF-AT, AP-1, and other sites. This result, and similar results in cyclosporin A-treated cells, imply that individual IL-2 transcription factors cannot stably bind their target sequences in vivo without coengagement of all other distinct factors at neighboring sites. It is proposed that nonhierarchical, cooperative enhancement of binding is a structural basis of combinatorial transcription factor action at the IL-2 locus. PMID:8113685
Physical signals for protein-DNA recognition
NASA Astrophysics Data System (ADS)
Cao, Xiao-Qin; Zeng, Jia; Yan, Hong
2009-09-01
This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.
Wolf, Timo; Schneiker-Bekel, Susanne; Neshat, Armin; Ortseifen, Vera; Wibberg, Daniel; Zemke, Till; Pühler, Alfred; Kalinowski, Jörn
2017-06-10
Actinoplanes sp. SE50/110 is the natural producer of acarbose, which is used in the treatment of diabetes mellitus type II. However, until now the transcriptional organization and regulation of the acarbose biosynthesis are only understood rudimentarily. The genome sequence of Actinoplanes sp. SE50/110 was known before, but was resequenced in this study to remove assembly artifacts and incorrect base callings. The annotation of the genome was refined in a multi-step approach, including modern bioinformatic pipelines, transcriptome and proteome data. A whole transcriptome RNA-seq library as well as an RNA-seq library enriched for primary 5'-ends were used for the detection of transcription start sites, to correct tRNA predictions, to identify novel transcripts like small RNAs and to improve the annotation through the correction of falsely annotated translation start sites. The transcriptome data sets were also applied to identify 31 cis-regulatory RNA structures, such as riboswitches or RNA thermometers as well as three leaderless transcribed short peptides found in putative attenuators upstream of genes for amino acid biosynthesis. The transcriptional organization of the acarbose biosynthetic gene cluster was elucidated in detail and fourteen novel biosynthetic gene clusters were suggested. The accurate genome sequence and precise annotation of the Actinoplanes sp. SE50/110 genome will be the foundation for future genetic engineering and systems biology studies. Copyright © 2017 Elsevier B.V. All rights reserved.
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burkhardt E.; Adham, I.M.; Brosig, B.
1994-03-01
Leydig insulin-like protein (LEY I-L) is a member of the insulin-like hormone superfamily. The LEY I-L gene (designated INSL3) is expressed exclusively in prenatal and postnatal Leydig cells. The authors report here the cloning and nucleotide sequence of porcine and human LEY I-L genes including the 5[prime] regions. Both genes consist of two exons and one intron. The organization of the LEY I-L gene is similar to that of insulin and relaxin. The transcription start site in the porcine and human LEY I-L gene is localized 13 and 14 bp upstream of the translation start site, respectively. Alignment of themore » 5[prime] flanking regions of both genes reveals that the first 107 nucleotides upstream of the transcription start site exhibit an overall sequence similarity of 80%. This conserved region contains a consensus TATAA box, a CAAT-like element (GAAT), and a consensus SP1 sequence (GGGCGG) at equivalent positions in both genes and therefore may play a role in regulation of expression of the LEY I-L gene. The porcine and human genome contains a single copy of the LEY I-L gene. By in situ hybridization, the human gene was assigned to bands p13.2-p12 of the short arm of chromosome 19. 25 refs., 6 figs.« less
Real-time observation of the initiation of RNA polymerase II transcription.
Fazal, Furqan M; Meng, Cong A; Murakami, Kenji; Kornberg, Roger D; Block, Steven M
2015-09-10
Biochemical and structural studies have shown that the initiation of RNA polymerase II transcription proceeds in the following stages: assembly of the polymerase with general transcription factors and promoter DNA in a 'closed' preinitiation complex (PIC); unwinding of about 15 base pairs of the promoter DNA to form an 'open' complex; scanning downstream to a transcription start site; synthesis of a short transcript, thought to be about 10 nucleotides long; and promoter escape. Here we have assembled a 32-protein, 1.5-megadalton PIC derived from Saccharomyces cerevisiae, and observe subsequent initiation processes in real time with optical tweezers. Contrary to expectation, scanning driven by the transcription factor IIH involved the rapid opening of an extended transcription bubble, averaging 85 base pairs, accompanied by the synthesis of a transcript up to the entire length of the extended bubble, followed by promoter escape. PICs that failed to achieve promoter escape nevertheless formed open complexes and extended bubbles, which collapsed back to closed or open complexes, resulting in repeated futile scanning.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sollome, James; Martin, Elizabeth
MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database,more » genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.« less
Acevedo-Luna, Natalia; Mariño-Ramírez, Leonardo; Halbert, Armand; Hansen, Ulla; Landsman, David; Spouge, John L
2016-11-21
Transcription factors (TFs) form complexes that bind regulatory modules (RMs) within DNA, to control specific sets of genes. Some transcription factor binding sites (TFBSs) near the transcription start site (TSS) display tight positional preferences relative to the TSS. Furthermore, near the TSS, RMs can co-localize TFBSs with each other and the TSS. The proportion of TFBS positional preferences due to TFBS co-localization within RMs is unknown, however. ChIP experiments confirm co-localization of some TFBSs genome-wide, including near the TSS, but they typically examine only a few TFs at a time, using non-physiological conditions that can vary from lab to lab. In contrast, sequence analysis can examine many TFs uniformly and methodically, broadly surveying the co-localization of TFBSs with tight positional preferences relative to the TSS. Our statistics found 43 significant sets of human motifs in the JASPAR TF Database with positional preferences relative to the TSS, with 38 preferences tight (±5 bp). Each set of motifs corresponded to a gene group of 135 to 3304 genes, with 42/43 (98%) gene groups independently validated by DAVID, a gene ontology database, with FDR < 0.05. Motifs corresponding to two TFBSs in a RM should co-occur more than by chance alone, enriching the intersection of the gene groups corresponding to the two TFs. Thus, a gene-group intersection systematically enriched beyond chance alone provides evidence that the two TFs participate in an RM. Of the 903 = 43*42/2 intersections of the 43 significant gene groups, we found 768/903 (85%) pairs of gene groups with significantly enriched intersections, with 564/768 (73%) intersections independently validated by DAVID with FDR < 0.05. A user-friendly web site at http://go.usa.gov/3kjsH permits biologists to explore the interaction network of our TFBSs to identify candidate subunit RMs. Gene duplication and convergent evolution within a genome provide obvious biological mechanisms for replicating an RM near the TSS that binds a particular TF subunit. Of all intersections of our 43 significant gene groups, 85% were significantly enriched, with 73% of the significant enrichments independently validated by gene ontology. The co-localization of TFBSs within RMs therefore likely explains much of the tight TFBS positional preferences near the TSS.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Neymotin, Benjamin; Ettorre, Victoria; Gresham, David
2016-01-01
Degradation of mRNA contributes to variation in transcript abundance. Studies of individual mRNAs have shown that both cis and trans factors affect mRNA degradation rates. However, the factors underlying transcriptome-wide variation in mRNA degradation rates are poorly understood. We investigated the contribution of different transcript properties to transcriptome-wide degradation rate variation in the budding yeast, Saccharomyces cerevisiae, using multiple regression analysis. We find that multiple transcript properties are significantly associated with variation in mRNA degradation rates, and that a model incorporating these properties explains ∼50% of the genome-wide variance. Predictors of mRNA degradation rates include transcript length, ribosome density, biased codon usage, and GC content of the third position in codons. To experimentally validate these factors, we studied individual transcripts expressed from identical promoters. We find that decreasing ribosome density by mutating the first translational start site of a transcript increases its degradation rate. Using coding sequence variants of green fluorescent protein (GFP) that differ only at synonymous sites, we show that increased GC content of the third position of codons results in decreased rates of mRNA degradation. Thus, in steady-state conditions, a large fraction of genome-wide variation in mRNA degradation rates is determined by inherent properties of transcripts, many of which are related to translation, rather than specific regulatory mechanisms. PMID:27633789
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter.
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-03-12
ZmbZIP25 ( Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5' RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from -2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from -2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5'-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5'-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5'-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5'-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from -1117 to -957 that were responsible for the specificity of the ZmbZIP25 5'-flanking sequence.
Functional Analysis of Maize Silk-Specific ZmbZIP25 Promoter
Li, Wanying; Yu, Dan; Yu, Jingjuan; Zhu, Dengyun; Zhao, Qian
2018-01-01
ZmbZIP25 (Zea mays bZIP (basic leucine zipper) transcription factor 25) is a function-unknown protein that belongs to the D group of the bZIP transcription factor family. RNA-seq data showed that the expression of ZmbZIP25 was tissue-specific in maize silks, and this specificity was confirmed by RT-PCR (reverse transcription-polymerase chain reaction). In situ RNA hybridization showed that ZmbZIP25 was expressed exclusively in the xylem of maize silks. A 5′ RACE (rapid amplification of cDNA ends) assay identified an adenine residue as the transcription start site of the ZmbZIP25 gene. To characterize this silk-specific promoter, we isolated and analyzed a 2450 bp (from −2083 to +367) and a 2600 bp sequence of ZmbZIP25 (from −2083 to +517, the transcription start site was denoted +1). Stable expression assays in Arabidopsis showed that the expression of the reporter gene GUS driven by the 2450 bp ZmbZIP25 5′-flanking fragment occurred exclusively in the papillae of Arabidopsis stigmas. Furthermore, transient expression assays in maize indicated that GUS and GFP expression driven by the 2450 bp ZmbZIP25 5′-flanking sequences occurred only in maize silks and not in other tissues. However, no GUS or GFP expression was driven by the 2600 bp ZmbZIP25 5′-flanking sequences in either stable or transient expression assays. A series of deletion analyses of the 2450 bp ZmbZIP25 5′-flanking sequence was performed in transgenic Arabidopsis plants, and probable elements prediction analysis revealed the possible presence of negative regulatory elements within the 161 bp region from −1117 to −957 that were responsible for the specificity of the ZmbZIP25 5′-flanking sequence. PMID:29534529
2009-06-01
Osman, F. The human glutathione S-transferase P1 ( GSTP1 ) gene is transactivated by cyclic AMP (cAMP) via a cAMP response element (CRE) proximal to the...transcription start site. Chem-Biol. Interactions 133, 320-321, 2001. 4. Lo, H.-W. and Ali-Osman, F. Cyclic AMP mediated GSTP1 gene activation in...tumor cells involves the interaction of activated CREB-1 with the GSTP1 CRE: a novel mechanism of cellular GSTP1 gene regulation. Journal of Cellular
Landini, P; Volkert, M R
1995-04-07
The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.
Malhotra, Sanandan; Justice, James; Morgan, Robin
2017-01-01
Avian leukosis virus (ALV) is a simple retrovirus that causes a wide range of tumors in chickens, the most common of which are B-cell lymphomas. The viral genome integrates into the host genome and uses its strong promoter and enhancer sequences to alter the expression of nearby genes, frequently inducing tumors. In this study, we compare the preferences for ALV integration sites in cultured cells and in tumors, by analysis of over 87,000 unique integration sites. In tissue culture we observed integration was relatively random with slight preferences for genes, transcription start sites and CpG islands. We also observed a preference for integrations in or near expressed and spliced genes. The integration pattern in cultured cells changed over the course of selection for oncogenic characteristics in tumors. In comparison to tissue culture, ALV integrations are more highly selected for proximity to transcription start sites in tumors. There is also a significant selection of ALV integrations away from CpG islands in the highly clonally expanded cells in tumors. Additionally, we utilized a high throughput method to quantify the magnitude of clonality in different stages of tumorigenesis. An ALV-induced tumor carries between 700 and 3000 unique integrations, with an average of 2.3 to 4 copies of proviral DNA per infected cell. We observed increasing tumor clonality during progression of B-cell lymphomas and identified gene players (especially TERT and MYB) and biological processes involved in tumor progression. PMID:29099869
Cistrome of the aldosterone-activated mineralocorticoid receptor in human renal cells.
Le Billan, Florian; Khan, Junaid A; Lamribet, Khadija; Viengchareun, Say; Bouligand, Jérôme; Fagart, Jérôme; Lombès, Marc
2015-09-01
Aldosterone exerts its effects mainly by activating the mineralocorticoid receptor (MR), a transcription factor that regulates gene expression through complex and dynamic interactions with coregulators and transcriptional machinery, leading to fine-tuned control of vectorial ionic transport in the distal nephron. To identify genome-wide aldosterone-regulated MR targets in human renal cells, we set up a chromatin immunoprecipitation (ChIP) assay by using a specific anti-MR antibody in a differentiated human renal cell line expressing green fluorescent protein (GFP)-MR. This approach, coupled with high-throughput sequencing, allowed identification of 974 genomic MR targets. Computational analysis identified an MR response element (MRE) including single or multiple half-sites and palindromic motifs in which the AGtACAgxatGTtCt sequence was the most prevalent motif. Most genomic MR-binding sites (MBSs) are located >10 kb from the transcriptional start sites of target genes (84%). Specific aldosterone-induced recruitment of MR on the first most relevant genomic sequences was further validated by ChIP-quantitative (q)PCR and correlated with concomitant and positive aldosterone-activated transcriptional regulation of the corresponding gene, as assayed by RT-qPCR. It was notable that most MBSs lacked MREs but harbored DNA recognition motifs for other transcription factors (FOX, EGR1, AP1, PAX5) suggesting functional interaction. This work provides new insights into aldosterone MR-mediated renal signaling and opens relevant perspectives for mineralocorticoid-related pathophysiology. © FASEB.
Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S
2012-05-01
The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.
Lan, Susan; Kamel, Wael; Punga, Tanel; Akusjärvi, Göran
2017-02-28
The adenovirus L4-22K protein both activates and suppresses transcription from the adenovirus major late promoter (MLP) by binding to DNA elements located downstream of the MLP transcriptional start site: the so-called DE element (positive) and the R1 region (negative). Here we show that L4-22K preferentially binds to the RNA form of the R1 region, both to the double-stranded RNA and the single-stranded RNA of the same polarity as the nascent MLP transcript. Further, L4-22K binds to a 5΄-CAAA-3΄ motif in the single-stranded RNA, which is identical to the sequence motif characterized for L4-22K DNA binding. L4-22K binding to single-stranded RNA results in an enhancement of U1 snRNA recruitment to the major late first leader 5΄ splice site. This increase in U1 snRNA binding results in a suppression of MLP transcription and a concurrent stimulation of major late first intron splicing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Osato, Naoki
2018-01-19
Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.
Nakagawa, C W; Yamada, K; Mutoh, N
2000-02-01
We examined the induction of the catalase gene (ctt1(+)) of fission yeast Schizosaccharomyces pombe in response to several stresses by using mutants of transcription factors (Atf1 and Pap1) and a series of deletion mutants of the ctt1(+) promoter region. A transcription factor, Atf1, and its binding site are necessary for the induction of ctt1(+) by osmotic stress, UV irradiation, and heat shock. Induction by menadione treatment, which produces superoxide anion, required element A, the region from -111 to -90 (numbered with the transcription start site as +1). The factor responsible for the induction of the gene by oxidative stress via element A was identified as the transcription factor Pap1. We also found that Atf1 is activated by menadione treatment in pap1 mutant cells, although it is not activated by menadione treatment in pap1(+) cells. The activity of catalase is not increased in pap1 cells by several stresses, despite mRNA induction, suggesting that Pap1 plays some role in the expression of catalase activity.
Rapid activity-induced transcription of arc and other IEGs relies on poised RNA polymerase II
Saha, Ramendra N.; Wissink, Erin M.; Bailey, Emma R.; Zhao, Meilan; Fargo, David C.; Hwang, Ji-yeon; Daigle, Kelly R.; Fenn, J. Daniel; Adelman, Karen; Dudek, Serena M.
2011-01-01
Summary Transcription of immediate early genes (IEGs) in neurons is exquisitely sensitive to neuronal activity, but the mechanism underlying these early transcription events is largely unknown. We demonstrate that several IEGs such as arc/arg3.1 are poised for near-instantaneous transcription by the stalling of RNA Polymerase II (Pol II) just downstream of the transcription start site in rat neurons. RNAi-depletion of Negative Elongation Factor, a mediator of Pol II stalling, reduces the Pol II occupancy of the arc promoter and compromises the rapid induction of arc and other IEGs. In contrast, reduction of Pol II stalling did not prevent transcription of IEGs that are expressed later and largely lack promoter proximal Pol II stalling. Together, our data strongly indicate that rapid induction of neuronal IEGs requires poised Pol II and suggest a role for this mechanism in a wide variety of transcription-dependent processes, including learning and memory. PMID:21623364
Molecular identification and transcriptional regulation of porcine IFIT2 gene.
Yang, Xiuqin; Jing, Xiaoyan; Song, Yanfang; Zhang, Caixia; Liu, Di
2018-04-06
IFN-induced protein with tetratricopeptide repeats 2 (IFIT2) plays important roles in host defense against viral infection as revealed by studies in humans and mice. However, little is known on porcine IFIT2 (pIFIT2). Here, we performed molecular cloning, expression profile, and transcriptional regulation analysis of pIFIT2. pIFIT2 gene, located on chromosome 14, is composed of two exons and have a complete coding sequence of 1407 bp. The encoded polypeptide, 468 aa in length, has three tetratricopeptide repeat motifs. pIFIT2 gene was unevenly distributed in all eleven tissues studied with the most abundance in spleen. Poly(I:C) treatment notably strongly upregulated the mRNA level and promoter activity of pIFIT2 gene. Upstream sequence of 1759 bp from the start codon which was assigned +1 here has promoter activity, and deltaEF1 acts as transcription repressor through binding to sequences at position - 1774 to - 1764. Minimal promoter region exists within nucleotide position - 162 and - 126. Two adjacent interferon-stimulated response elements (ISREs) and two nuclear factor (NF)-κB binding sites were identified within position - 310 and - 126. The ISRE elements act alone and in synergy with the one closer to start codon having more strength, so do the NF-κB binding sites. Synergistic effect was also found between the ISRE and NF-κB binding sites. Additionally, a third ISRE element was identified within position - 1661 to - 1579. These findings will contribute to clarifying the antiviral effect and underlying mechanisms of pIFIT2.
Anish, Ramakrishnan; Hossain, Mohammad B.; Jacobson, Raymond H.; Takada, Shinako
2009-01-01
Background More than 80% of mammalian protein-coding genes are driven by TATA-less promoters which often show multiple transcriptional start sites (TSSs). However, little is known about the core promoter DNA sequences or mechanisms of transcriptional initiation for this class of promoters. Methodology/Principal Findings Here we identify a new core promoter element XCPE2 (X core promoter element 2) (consensus sequence: A/C/G-C-C/T-C-G/A-T-T-G/A-C-C/A+1-C/T) that can direct specific transcription from the second TSS of hepatitis B virus X gene mRNA. XCPE2 sequences can also be found in human promoter regions and typically appear to drive one of the start sites within multiple TSS-containing TATA-less promoters. To gain insight into mechanisms of transcriptional initiation from this class of promoters, we examined requirements of several general transcription factors by in vitro transcription experiments using immunodepleted nuclear extracts and purified factors. Our results show that XCPE2-driven transcription uses at least TFIIB, either TFIID or free TBP, RNA polymerase II (RNA pol II) and the MED26-containing mediator complex but not Gcn5. Therefore, XCPE2-driven transcription can be carried out by a mechanism which differs from previously described TAF-dependent mechanisms for initiator (Inr)- or downstream promoter element (DPE)-containing promoters, the TBP- and SAGA (Spt-Ada-Gcn5-acetyltransferase)-dependent mechanism for yeast TATA-containing promoters, or the TFTC (TBP-free-TAF-containing complex)-dependent mechanism for certain Inr-containing TATA-less promoters. EMSA assays using XCPE2 promoter and purified factors further suggest that XCPE2 promoter recognition requires a set of factors different from those for TATA box, Inr, or DPE promoter recognition. Conclusions/Significance We identified a new core promoter element XCPE2 that are found in multiple TSS-containing TATA-less promoters. Mechanisms of promoter recognition and transcriptional initiation for XCPE2-driven promoters appear different from previously shown mechanisms for classical promoters that show single “focused” TSSs. Our studies provide insight into novel mechanisms of RNA Pol II transcription from multiple TSS-containing TATA-less promoters. PMID:19337366
Genomic dissection of conserved transcriptional regulation in intestinal epithelial cells
Camp, J. Gray; Weiser, Matthew; Cocchiaro, Jordan L.; Kingsley, David M.; Furey, Terrence S.; Sheikh, Shehzad Z.; Rawls, John F.
2017-01-01
The intestinal epithelium serves critical physiologic functions that are shared among all vertebrates. However, it is unknown how the transcriptional regulatory mechanisms underlying these functions have changed over the course of vertebrate evolution. We generated genome-wide mRNA and accessible chromatin data from adult intestinal epithelial cells (IECs) in zebrafish, stickleback, mouse, and human species to determine if conserved IEC functions are achieved through common transcriptional regulation. We found evidence for substantial common regulation and conservation of gene expression regionally along the length of the intestine from fish to mammals and identified a core set of genes comprising a vertebrate IEC signature. We also identified transcriptional start sites and other putative regulatory regions that are differentially accessible in IECs in all 4 species. Although these sites rarely showed sequence conservation from fish to mammals, surprisingly, they drove highly conserved IEC expression in a zebrafish reporter assay. Common putative transcription factor binding sites (TFBS) found at these sites in multiple species indicate that sequence conservation alone is insufficient to identify much of the functionally conserved IEC regulatory information. Among the rare, highly sequence-conserved, IEC-specific regulatory regions, we discovered an ancient enhancer upstream from her6/HES1 that is active in a distinct population of Notch-positive cells in the intestinal epithelium. Together, these results show how combining accessible chromatin and mRNA datasets with TFBS prediction and in vivo reporter assays can reveal tissue-specific regulatory information conserved across 420 million years of vertebrate evolution. We define an IEC transcriptional regulatory network that is shared between fish and mammals and establish an experimental platform for studying how evolutionarily distilled regulatory information commonly controls IEC development and physiology. PMID:28850571
Flexible DNA binding of the BTB/POZ-domain protein FBI-1.
Pessler, Frank; Hernandez, Nouria
2003-08-01
POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.
DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus
Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...
2014-08-23
Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less
Common Viral Integration Sites Identified in Avian Leukosis Virus-Induced B-Cell Lymphomas
Justice, James F.; Morgan, Robin W.
2015-01-01
ABSTRACT Avian leukosis virus (ALV) induces B-cell lymphoma and other neoplasms in chickens by integrating within or near cancer genes and perturbing their expression. Four genes—MYC, MYB, Mir-155, and TERT—have previously been identified as common integration sites in these virus-induced lymphomas and are thought to play a causal role in tumorigenesis. In this study, we employ high-throughput sequencing to identify additional genes driving tumorigenesis in ALV-induced B-cell lymphomas. In addition to the four genes implicated previously, we identify other genes as common integration sites, including TNFRSF1A, MEF2C, CTDSPL, TAB2, RUNX1, MLL5, CXorf57, and BACH2. We also analyze the genome-wide ALV integration landscape in vivo and find increased frequency of ALV integration near transcriptional start sites and within transcripts. Previous work has shown ALV prefers a weak consensus sequence for integration in cultured human cells. We confirm this consensus sequence for ALV integration in vivo in the chicken genome. PMID:26670384
Adam, Cécile; Cyr, Daniel G
2016-06-01
In prepubertal rats, connexin 26 (GJB2) is expressed between adjacent columnar cells of the epididymis. At 28 days of age, when columnar cells differentiate into adult epithelial cell types, Gjb2 mRNA levels decrease to barely detectable levels. There is no information on the regulation of GJB2 in the epididymis. The present study characterized regulation of the Gjb2 gene promoter in the epididymis. A single transcription start site at position -3829 bp relative to the ATG was identified. Computational analysis revealed several TFAP2A, SP1, and KLF4 putative binding sites. A 1.5-kb fragment of the Gjb2 promoter was cloned into a vector containing a luciferase reporter gene. Transfection of the construct into immortalized rat caput epididymal (RCE-1) cells indicated that the promoter contained sufficient information to drive expression of the reporter gene. Deletion constructs showed that the basal activity of the promoter resides in the first -230 bp of the transcriptional start site. Two response elements necessary for GJB2 expression were identified: an overlapping TFAP2A/SP1 site (-136 to -126 bp) and an SP1 site (-50 bp). Chromatin immunoprecipitation (ChIP) and electrophoretic mobility shift assays confirmed that SP1 and TFAP2A were bound to the promoter. ChIP analysis of chromatin from young and pubertal rats indicated that TFAP2A and SP1 binding decreased with age. SP1 and TFAP2A knockdown indicated that SP1 is necessary for Gjb2 expression. DNA methylation did not appear to be involved in the regulation of Gjb2 expression. Results indicate that SP1 and TFAP2A regulate Gjb2 promoter activity during epididymal differentiation in rat. © 2016 by the Society for the Study of Reproduction, Inc.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Nash, Claire; Boufaied, Nadia; Mills, Ian G; Franco, Omar E; Hayward, Simon W; Thomson, Axel A
2017-05-05
The androgen receptor (AR) is a transcription factor, and key regulator of prostate development and cancer, which has discrete functions in stromal versus epithelial cells. AR expressed in mesenchyme is necessary and sufficient for prostate development while loss of stromal AR is predictive of prostate cancer progression. Many studies have characterized genome-wide binding of AR in prostate tumour cells but none have used primary mesenchyme or stroma. We applied ChIPseq to identify genomic AR binding sites in primary human fetal prostate fibroblasts and patient derived cancer associated fibroblasts, as well as the WPMY1 cell line overexpressing AR. We identified AR binding sites that were specific to fetal prostate fibroblasts (7534), cancer fibroblasts (629), WPMY1-AR (2561) as well as those common among all (783). Primary fibroblasts had a distinct AR binding profile versus prostate cancer cell lines and tissue, and showed a localisation to gene promoter binding sites 1 kb upstream of the transcriptional start site, as well as non-classical AR binding sequence motifs. We used RNAseq to define transcribed genes associated with AR binding sites and derived cistromes for embryonic and cancer fibroblasts as well as a cistrome common to both. These were compared to several in vivo ChIPseq and transcript expression datasets; which identified subsets of AR targets that were expressed in vivo and regulated by androgens. This analysis enabled us to deconvolute stromal AR targets active in stroma within tumour samples. Taken together, our data suggest that the AR shows significantly different genomic binding site locations in primary prostate fibroblasts compared to that observed in tumour cells. Validation of our AR binding site data with transcript expression in vitro and in vivo suggests that the AR target genes we have identified in primary fibroblasts may contribute to clinically significant and biologically important AR-regulated changes in prostate tissue. Copyright © 2017. Published by Elsevier B.V.
Daughter-Specific Transcription Factors Regulate Cell Size Control in Budding Yeast
Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M.; Rosebrock, Adam P.; Futcher, Bruce; Cross, Frederick R.
2009-01-01
In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle. PMID:19841732
Recent Advancements in DNA Damage-Transcription Crosstalk and High-Resolution Mapping of DNA Breaks.
Vitelli, Valerio; Galbiati, Alessandro; Iannelli, Fabio; Pessina, Fabio; Sharma, Sheetal; d'Adda di Fagagna, Fabrizio
2017-08-31
Until recently, DNA damage arising from physiological DNA metabolism was considered a detrimental by-product for cells. However, an increasing amount of evidence has shown that DNA damage could have a positive role in transcription activation. In particular, DNA damage has been detected in transcriptional elements following different stimuli. These physiological DNA breaks are thought to be instrumental for the correct expression of genomic loci through different mechanisms. In this regard, although a plethora of methods are available to precisely map transcribed regions and transcription start sites, commonly used techniques for mapping DNA breaks lack sufficient resolution and sensitivity to draw a robust correlation between DNA damage generation and transcription. Recently, however, several methods have been developed to map DNA damage at single-nucleotide resolution, thus providing a new set of tools to correlate DNA damage and transcription. Here, we review how DNA damage can positively regulate transcription initiation, the current techniques for mapping DNA breaks at high resolution, and how these techniques can benefit future studies of DNA damage and transcription.
Near-atomic resolution visualization of human transcription promoter opening
He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva
2016-01-01
In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA–RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682
Molecular Structure and Transformation of the Glucose Dehydrogenase Gene in Drosophila Melanogaster
Whetten, R.; Organ, E.; Krasney, P.; Cox-Foster, D.; Cavener, D.
1988-01-01
We have precisely mapped and sequenced the three 5' exons of the Drosophila melanogaster Gld gene and have identified the start sites for transcription and translation. The first exon is composed of 335 nucleotides and does not contain any putative translation start codons. The second exon is separated from the first exon by 8 kb and contains the Gld translation start codon. The inferred amino acid sequence of the amino terminus contains two unusual features: three tandem repeats of serine-alanine, and a relatively high density of cysteine residues. P element-mediated transformation experiments demonstrated that a 17.5-kb genomic fragment contains the functional and regulatory components of the Gld gene. PMID:3143620
Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R.; Pyle, Margaret M.; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A.; Ioerger, Thomas R.; Fortune, Sarah M.; Derbyshire, Keith M.; Wade, Joseph T.; Gray, Todd A.
2015-01-01
RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5’ untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5’ end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5’ ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5’ UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression. PMID:26536359
Shell, Scarlet S; Wang, Jing; Lapierre, Pascal; Mir, Mushtaq; Chase, Michael R; Pyle, Margaret M; Gawande, Richa; Ahmad, Rushdy; Sarracino, David A; Ioerger, Thomas R; Fortune, Sarah M; Derbyshire, Keith M; Wade, Joseph T; Gray, Todd A
2015-11-01
RNA-seq technologies have provided significant insight into the transcription networks of mycobacteria. However, such studies provide no definitive information on the translational landscape. Here, we use a combination of high-throughput transcriptome and proteome-profiling approaches to more rigorously understand protein expression in two mycobacterial species. RNA-seq and ribosome profiling in Mycobacterium smegmatis, and transcription start site (TSS) mapping and N-terminal peptide mass spectrometry in Mycobacterium tuberculosis, provide complementary, empirical datasets to examine the congruence of transcription and translation in the Mycobacterium genus. We find that nearly one-quarter of mycobacterial transcripts are leaderless, lacking a 5' untranslated region (UTR) and Shine-Dalgarno ribosome-binding site. Our data indicate that leaderless translation is a major feature of mycobacterial genomes and is comparably robust to leadered initiation. Using translational reporters to systematically probe the cis-sequence requirements of leaderless translation initiation in mycobacteria, we find that an ATG or GTG at the mRNA 5' end is both necessary and sufficient. This criterion, together with our ribosome occupancy data, suggests that mycobacteria encode hundreds of small, unannotated proteins at the 5' ends of transcripts. The conservation of small proteins in both mycobacterial species tested suggests that some play important roles in mycobacterial physiology. Our translational-reporter system further indicates that mycobacterial leadered translation initiation requires a Shine Dalgarno site in the 5' UTR and that ATG, GTG, TTG, and ATT codons can robustly initiate translation. Our combined approaches provide the first comprehensive view of mycobacterial gene structures and their non-canonical mechanisms of protein expression.
A large-scale full-length cDNA analysis to explore the budding yeast transcriptome
Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi
2006-01-01
We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987
Jennings, Barbara H.
2014-01-01
Gene expression is regulated by the complex interaction between transcriptional activators and repressors, which function in part by recruiting histone-modifying enzymes to control accessibility of DNA to RNA polymerase. The evolutionarily conserved family of Groucho/Transducin-Like Enhancer of split (Gro/TLE) proteins act as co-repressors for numerous transcription factors. Gro/TLE proteins act in several key pathways during development (including Notch and Wnt signaling), and are implicated in the pathogenesis of several human cancers. Gro/TLE proteins form oligomers and it has been proposed that their ability to exert long-range repression on target genes involves oligomerization over broad regions of chromatin. However, analysis of an endogenous gro mutation in Drosophila revealed that oligomerization of Gro is not always obligatory for repression in vivo. We have used chromatin immunoprecipitation followed by DNA sequencing (ChIP-seq) to profile Gro recruitment in two Drosophila cell lines. We find that Gro predominantly binds at discrete peaks (<1 kilobase). We also demonstrate that blocking Gro oligomerization does not reduce peak width as would be expected if Gro oligomerization induced spreading along the chromatin from the site of recruitment. Gro recruitment is enriched in “active” chromatin containing developmentally regulated genes. However, Gro binding is associated with local regions containing hypoacetylated histones H3 and H4, which is indicative of chromatin that is not fully open for efficient transcription. We also find that peaks of Gro binding frequently overlap the transcription start sites of expressed genes that exhibit strong RNA polymerase pausing and that depletion of Gro leads to release of polymerase pausing and increased transcription at a bona fide target gene. Our results demonstrate that Gro is recruited to local sites by transcription factors to attenuate rather than silence gene expression by promoting histone deacetylation and polymerase pausing. PMID:25165826
Bard-Chapeau, Emilie A.; Szumska, Dorota; Jacob, Bindya; Chua, Belinda Q. L.; Chatterjee, Gouri C.; Zhang, Yi; Ward, Jerrold M.; Urun, Fatma; Kinameri, Emi; Vincent, Stéphane D.; Ahmed, Sayadi; Bhattacharya, Shoumo; Osato, Motomi; Perkins, Archibald S.; Moore, Adrian W.; Jenkins, Nancy A.; Copeland, Neal G.
2014-01-01
The ecotropic viral integration site 1 (Evi1) oncogenic transcription factor is one of a number of alternative transcripts encoded by the Mds1 and Evi1 complex locus (Mecom). Overexpression of Evi1 has been observed in a number of myeloid disorders and is associated with poor patient survival. It is also amplified and/or overexpressed in many epithelial cancers including nasopharyngeal carcinoma, ovarian carcinoma, ependymomas, and lung and colorectal cancers. Two murine knockout models have also demonstrated Evi1's critical role in the maintenance of hematopoietic stem cell renewal with its absence resulting in the death of mutant embryos due to hematopoietic failure. Here we characterize a novel mouse model (designated Evi1fl3) in which Evi1 exon 3, which carries the ATG start, is flanked by loxP sites. Unexpectedly, we found that germline deletion of exon3 produces a hypomorphic allele due to the use of an alternative ATG start site located in exon 4, resulting in a minor Evi1 N-terminal truncation and a block in expression of the Mds1-Evi1 fusion transcript. Evi1δex3/δex3 mutant embryos showed only a mild non-lethal hematopoietic phenotype and bone marrow failure was only observed in adult Vav-iCre/+, Evi1fl3/fl3 mice in which exon 3 was specifically deleted in the hematopoietic system. Evi1δex3/δex3 knockout pups are born in normal numbers but die during the perinatal period from congenital heart defects. Database searches identified 143 genes with similar mutant heart phenotypes as those observed in Evi1δex3/δex3 mutant pups. Interestingly, 42 of these congenital heart defect genes contain known Evi1-binding sites, and expression of 18 of these genes are also effected by Evi1 siRNA knockdown. These results show a potential functional involvement of Evi1 target genes in heart development and indicate that Evi1 is part of a transcriptional program that regulates cardiac development in addition to the development of blood. PMID:24586749
Shows, Kathryn H; Shiang, Rita
2008-11-01
Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell-specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell-specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from -253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter.
Glenn, Denis J.; Wang, Feng; Chen, Songcang; Nishimoto, Minobu; Gardner, David G.
2009-01-01
Increased B-type natriuretic peptide (BNP) gene expression is regarded as one of the hallmarks of cardiac myocyte hypertrophy. Here we demonstrate that both basal and endothelin-1 (ET-1) -dependent stimulation of human (h) BNP gene transcription requires the presence of an intact Yin Yang 1 (YY1) binding site positioned at -62 bp relative to the transcription start site. Mutation of this site reduced both basal and stimulated hBNP promoter activity. This site was shown to bind YY1 both in vitro and within the context of the intact cell. The latter interaction increased following ET-1 treatment. Exposure to ET-1 also resulted in increased nuclear localization of YY1 and a reduction in acetylation of the YY1 protein. Overexpression of wild type YY1 increased both basal and endothelin-stimulated hBNP promoter activity, while a carboxy terminal deletion mutant of YY1 was devoid of activity. Treatment with the histone deacetylase inhibitor trichostatin A (TSA) resulted in decreased hBNP reporter activity. YY1 was shown to associate with histone deacetylase 2 (HDAC2), and HDAC2 was shown to associate directly with the hBNP promoter in the intact cell. Collectively these findings demonstrate that YY1 plays an important role in regulating the transcriptional activity of the hBNP gene promoter. These data suggest a model in which YY1 activates hBNP transcription through interaction with HDAC2. PMID:19139378
Transcriptional regulation of the human mitochondrial peptide deformylase (PDF).
Pereira-Castro, Isabel; Costa, Luís Teixeira da; Amorim, António; Azevedo, Luisa
2012-05-18
The last years of research have been particularly dynamic in establishing the importance of peptide deformylase (PDF), a protein of the N-terminal methionine excision (NME) pathway that removes formyl-methionine from mitochondrial-encoded proteins. The genomic sequence of the human PDF gene is shared with the COG8 gene, which encodes a component of the oligomeric golgi complex, a very unusual case in Eukaryotic genomes. Since PDF is crucial in maintaining mitochondrial function and given the atypical short distance between the end of COG8 coding sequence and the PDF initiation codon, we investigated whether the regulation of the human PDF is affected by the COG8 overlapping partner. Our data reveals that PDF has several transcription start sites, the most important of which only 18 bp from the initiation codon. Furthermore, luciferase-activation assays using differently-sized fragments defined a 97 bp minimal promoter region for human PDF, which is capable of very strong transcriptional activity. This fragment contains a potential Sp1 binding site highly conserved in mammalian species. We show that this binding site, whose mutation significantly reduces transcription activation, is a target for the Sp1 transcription factor, and possibly of other members of the Sp family. Importantly, the entire minimal promoter region is located after the end of COG8's coding region, strongly suggesting that the human PDF preserves an independent regulation from its overlapping partner. Copyright © 2012 Elsevier Inc. All rights reserved.
Cloning and function analysis of an alfalfa (Medicago sativa L.) zinc finger protein promoter MsZPP.
Li, Yan; Sun, Yan; Yang, Qingchuan; Kang, Junmei; Zhang, Tiejun; Gruber, Margaret Yvonne; Fang, Feng
2012-08-01
A 1272 bp upstream sequence of MsZFN gene was cloned from alfalfa, which was designed as MsZPP (Genbank accession number: FJ 161979.2) using an adaptor-mediated genome walking method. A sole transcription start site was located 69 bp upstream of the translation start site. Its pattern of expression included roots, stem vascular tissues, floral reproductive organs, and leaves, but the promoter did not express in seeds, petals or sepals. Transcription levels can be stimulated by dark, MeJA, and IAA. However, GUS fusion activities had no change by treatments of GA, ABA, drought and high salt for 3 days. Deletion analysis revealed that all sections of the promoter can drive gus gene expression in the root, stem, leaves and floral reproductive organs; however, only fragments longer than the -460 bp promoter can stimulate strong gus gene expression in these organs. In addition, the -460 bp promoter fragment can drive gus expression not only in the vascular tissue, but also in leaf guard cells. The results suggest that the promoter MsZPP plays roles in the regulation of transgene expression, particularly due to its darkness, MeJA, and IAA responsiveness.
Spatial Organization of the Core Region of Yeast TFIIIB-DNA Complexes
Persinger, Jim; Sengupta, Sarojini M.; Bartholomew, Blaine
1999-01-01
The interaction of yeast TFIIIB with the region upstream of the SUP4 tRNATyr gene was extensively probed by use of photoreactive phosphodiesters, deoxyuridines, and deoxycytidines that are site specifically incorporated into DNA. The TATA binding protein (TBP) was found to be in close proximity to the minor groove of a TATA-like DNA sequence that starts 30 nucleotides upstream of the start site of transcription. TBP was cross-linked to the phosphate backbone of DNA from bp −30 to −20 in the nontranscribed strand and from bp −28 to −24 in the transcribed strand (+1 denotes the start site of transcription). Most of the major groove of DNA in this region was shown not to be in close proximity to TBP, thus resembling the binding of TBP to the TATA box, with one notable exception. TBP was shown to interact with the major groove of DNA primarily at bp −23 and to a lesser degree at bp −25 in the transcribed strand. The stable interaction of TBP with the major groove at bp −23 was shown to require the B" subunit of TFIIIB. The S4 helix and flanking region of TBP were shown to be proximal to the major groove of DNA by peptide mapping of the region of TBP cross-linked at bp −23. Thus, TBP in the TFIIIB-SUP4 gene promoter region is bound in the same direction as TBP bound to the TATA box with respect to the transcription start site. The B" and TFIIB-related factor (BRF) subunits of TFIIIB are positioned on opposite sides of the TBP-DNA core of the TFIIIB complex, as indicated by correlation of cross-linking data to the crystal structure of the TBP-TATA box complex. Evidence is given for BRF binding near the C-terminal stirrup of TBP, similar to that of TFIIB near the TBP-TATA box complex. The protein clamp formed around the TBP-DNA complex by BRF and B" would help explain the long half-life of the TFIIIB-DNA complex and its resistance to polyanions and high salt. The path of DNA traversing the surface of TBP at the 3′ end of the TATA-like element in the SUP4 tRNA gene is not the same as that of TBP bound to a TATA box element, as shown by the cross-linking of TBP at bp −23. PMID:10373570
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-01-01
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). PMID:26220934
Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M; Lentes, K U
1999-11-19
As a member of the uncoupling protein family, UCP2 is ubiquitously expressed in rodents and humans, implicating a major role in thermogenesis. To analyze promoter function and regulatory motifs involved in the transcriptional regulation of UCP2 gene expression, 3.3 kb of 5'-flanking region of the human UCP2 (hUCP2) gene have been cloned. Sequence analysis showed that the promoter region of hUCP2 lacks a classical TATA or CAAT box, however, appeared GC-rich resulting in the presence of several Sp-1 motifs and Ap-1/-2 binding sites near the transcription initiation site. Functional characterization of human UCP2 promoter-CAT fusion constructs in transient expression assays showed that minimal promoter activity was observed within 65 bp upstream of the transcriptional start site (+1). 75 bp further upstream (from nt -141 to -66) a strong cis-acting regulatory element (or enhancer) was identified, which significantly enhanced basal promoter activity. The regulation of human UCP2 gene expression involves complex interactions among positive and negative regulatory elements distributed over a minimum of 3.3 kb of the promoter region. Copyright 1999 Academic Press.
Computational Predictions Provide Insights into the Biology of TAL Effector Target Sites
Grau, Jan; Wolf, Annett; Reschke, Maik; Bonas, Ulla; Posch, Stefan; Boch, Jens
2013-01-01
Transcription activator-like (TAL) effectors are injected into host plant cells by Xanthomonas bacteria to function as transcriptional activators for the benefit of the pathogen. The DNA binding domain of TAL effectors is composed of conserved amino acid repeat structures containing repeat-variable diresidues (RVDs) that determine DNA binding specificity. In this paper, we present TALgetter, a new approach for predicting TAL effector target sites based on a statistical model. In contrast to previous approaches, the parameters of TALgetter are estimated from training data computationally. We demonstrate that TALgetter successfully predicts known TAL effector target sites and often yields a greater number of predictions that are consistent with up-regulation in gene expression microarrays than an existing approach, Target Finder of the TALE-NT suite. We study the binding specificities estimated by TALgetter and approve that different RVDs are differently important for transcriptional activation. In subsequent studies, the predictions of TALgetter indicate a previously unreported positional preference of TAL effector target sites relative to the transcription start site. In addition, several TAL effectors are predicted to bind to the TATA-box, which might constitute one general mode of transcriptional activation by TAL effectors. Scrutinizing the predicted target sites of TALgetter, we propose several novel TAL effector virulence targets in rice and sweet orange. TAL-mediated induction of the candidates is supported by gene expression microarrays. Validity of these targets is also supported by functional analogy to known TAL effector targets, by an over-representation of TAL effector targets with similar function, or by a biological function related to pathogen infection. Hence, these predicted TAL effector virulence targets are promising candidates for studying the virulence function of TAL effectors. TALgetter is implemented as part of the open-source Java library Jstacs, and is freely available as a web-application and a command line program. PMID:23526890
DOE Office of Scientific and Technical Information (OSTI.GOV)
Daniels, C.J.
1993-06-01
We have established that a 100 bp DNA fragment from the Haloferax volcanii tRNALys gene directs transcription in vivo. This element served as the starting point for a detailed analysis of the requirements for in vivo transcription. Among several gene tentatively identified as reporter elements, we selected a eukaryotic intron-containing tRNAPro gene for when it is driven by the H. volcanii tRNALys promoter fragment, produces a single small transcript. Transcript analysis, by Sl mapping and primer extension, showed that this RNA initiated at the expected tRNALys BoxB sequence and terminated in the tRNAPro RNA Pol III termination element present onmore » the DNA fragment. In initial studies we determined that the 3 inches proximal region of this tRNALys promoter element was sufficient for transcription initiation in vivo. This 40 bp region contains only the BoxA and BoxB regions and short purine rich regions 5 inches to the BoxA and BoxB sequence. Using the tRNAPro gene as the reporter and this minimal promoter, we performed a comprehensive analysis of the BoxA region. Each position of the BoxA region was converted to an four possible nucleotides and the transcription of 36 mutants was quantitated. Among the sites analyzed, only five of the positions showed high levels of discrimination; the preferred BoxA element was 5 inches-TT({sub T}/A)({sup A}/T) ANNNN-3 inches. Mutational analysis demonstrated that a transition from T-rich to A-rich sequences in the BoxA element is essential and that there is some flexibility in the location of the ``TA`` sequence. Additionally the TA sequence appears to determine the location of the transcription start site. The BoxA element defined in this study is similar to those observed for Sulfolobus and the methanogen promoters, and supports the hypothesis that a similar core promoter element is used by all archaeal RNA polymerases.« less
GENCODE: the reference human genome annotation for The ENCODE Project.
Harrow, Jennifer; Frankish, Adam; Gonzalez, Jose M; Tapanari, Electra; Diekhans, Mark; Kokocinski, Felix; Aken, Bronwen L; Barrell, Daniel; Zadissa, Amonida; Searle, Stephen; Barnes, If; Bignell, Alexandra; Boychenko, Veronika; Hunt, Toby; Kay, Mike; Mukherjee, Gaurab; Rajan, Jeena; Despacio-Reyes, Gloria; Saunders, Gary; Steward, Charles; Harte, Rachel; Lin, Michael; Howald, Cédric; Tanzer, Andrea; Derrien, Thomas; Chrast, Jacqueline; Walters, Nathalie; Balasubramanian, Suganthi; Pei, Baikang; Tress, Michael; Rodriguez, Jose Manuel; Ezkurdia, Iakes; van Baren, Jeltje; Brent, Michael; Haussler, David; Kellis, Manolis; Valencia, Alfonso; Reymond, Alexandre; Gerstein, Mark; Guigó, Roderic; Hubbard, Tim J
2012-09-01
The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation data set, few new protein-coding loci have been added, yet the number of alternative splicing transcripts annotated has steadily increased. The GENCODE 7 release contains 20,687 protein-coding and 9640 long noncoding RNA loci and has 33,977 coding transcripts not represented in UCSC genes and RefSeq. It also has the most comprehensive annotation of long noncoding RNA (lncRNA) loci publicly available with the predominant transcript form consisting of two exons. We have examined the completeness of the transcript annotation and found that 35% of transcriptional start sites are supported by CAGE clusters and 62% of protein-coding genes have annotated polyA sites. Over one-third of GENCODE protein-coding genes are supported by peptide hits derived from mass spectrometry spectra submitted to Peptide Atlas. New models derived from the Illumina Body Map 2.0 RNA-seq data identify 3689 new loci not currently in GENCODE, of which 3127 consist of two exon models indicating that they are possibly unannotated long noncoding loci. GENCODE 7 is publicly available from gencodegenes.org and via the Ensembl and UCSC Genome Browsers.
Prieur, Xavier; Coste, Herve; Rodriguez, Joan C
2003-07-11
The newly identified apolipoprotein AV (apoAV) gene is a key player in determining plasma triglyceride concentrations. Because hypertriglyceridemia is a major independent risk factor in coronary artery disease, the understanding of the regulation of the expression of this gene is of considerable importance. We presently characterize the structure, the transcription start site, and the promoter of the human apoAV gene. Since the peroxisome proliferator-activated receptor-alpha (PPARalpha) and the farnesoid X-activated receptor (FXR) have been shown to modulate the expression of genes involved in triglyceride metabolism, we evaluated the potential role of these nuclear receptors in the regulation of apoAV transcription. Bile acids and FXR induced the apoAV gene promoter activity. 5'-Deletion, mutagenesis, and gel shift analysis identified a heretofore unknown element at positions -103/-84 consisting of an inverted repeat of two consensus receptor-binding hexads separated by 8 nucleotides (IR8), which was required for the response to bile acid-activated FXR. The isolated IR8 element conferred FXR responsiveness on a heterologous promoter. On the other hand, in apoAV-expressing human hepatic Hep3B cells, transfection of PPARalpha specifically enhanced apoAV promoter activity. By deletion, site-directed mutagenesis, and binding analysis, a PPARalpha response element located 271 bp upstream of the transcription start site was identified. Finally, treatment with a specific PPARalpha activator led to a significant induction of apoAV mRNA expression in hepatocytes. The identification of apoAV as a PPARalpha target gene has major implications with respect to mechanisms whereby pharmacological PPARalpha agonists may exert their beneficial hypotriglyceridemic actions.
Myh7b/miR-499 gene expression is transcriptionally regulated by MRFs and Eos
Yeung, Fan; Chung, Eunhee; Guess, Martin G.; Bell, Matthew L.; Leinwand, Leslie A.
2012-01-01
The sarcomeric myosin gene, Myh7b, encodes an intronic microRNA, miR-499, which regulates cardiac and skeletal muscle biology, yet little is known about its transcriptional regulation. To identify the transcription factors involved in regulating Myh7b/miR-499 gene expression, we have mapped the transcriptional start sites and identified an upstream 6.2 kb region of the mouse Myh7b gene whose activity mimics the expression pattern of the endogenous Myh7b gene both in vitro and in vivo. Through promoter deletion analysis, we have mapped a distal E-box element and a proximal Ikaros site that are essential for Myh7b promoter activity in muscle cells. We show that the myogenic regulatory factors, MyoD, Myf5 and Myogenin, bind to the E-box, while a lymphoid transcription factor, Ikaros 4 (Eos), binds to the Ikaros motif. Further, we show that through physical interaction, MyoD and Eos form an active transcriptional complex on the chromatin to regulate the expression of the endogenous Myh7b/miR-499 gene in muscle cells. We also provide the first evidence that Eos can regulate expression of additional myosin genes (Myosin 1 and β-Myosin) via the miR-499/Sox6 pathway. Therefore, our results indicate a novel role for Eos in the regulation of the myofiber gene program. PMID:22638570
Kravatsky, Yuri V; Chechetkin, Vladimir R; Tchurikov, Nikolai A; Kravatskaya, Galina I
2015-02-01
The broad class of tasks in genetics and epigenetics can be reduced to the study of various features that are distributed over the genome (genome tracks). The rapid and efficient processing of the huge amount of data stored in the genome-scale databases cannot be achieved without the software packages based on the analytical criteria. However, strong inhomogeneity of genome tracks hampers the development of relevant statistics. We developed the criteria for the assessment of genome track inhomogeneity and correlations between two genome tracks. We also developed a software package, Genome Track Analyzer, based on this theory. The theory and software were tested on simulated data and were applied to the study of correlations between CpG islands and transcription start sites in the Homo sapiens genome, between profiles of protein-binding sites in chromosomes of Drosophila melanogaster, and between DNA double-strand breaks and histone marks in the H. sapiens genome. Significant correlations between transcription start sites on the forward and the reverse strands were observed in genomes of D. melanogaster, Caenorhabditis elegans, Mus musculus, H. sapiens, and Danio rerio. The observed correlations may be related to the regulation of gene expression in eukaryotes. Genome Track Analyzer is freely available at http://ancorr.eimb.ru/. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
NASA Astrophysics Data System (ADS)
Yount, Boyd; Roberts, Rhonda S.; Lindesmith, Lisa; Baric, Ralph S.
2006-08-01
Live virus vaccines provide significant protection against many detrimental human and animal diseases, but reversion to virulence by mutation and recombination has reduced appeal. Using severe acute respiratory syndrome coronavirus as a model, we engineered a different transcription regulatory circuit and isolated recombinant viruses. The transcription network allowed for efficient expression of the viral transcripts and proteins, and the recombinant viruses replicated to WT levels. Recombinant genomes were then constructed that contained mixtures of the WT and mutant regulatory circuits, reflecting recombinant viruses that might occur in nature. Although viable viruses could readily be isolated from WT and recombinant genomes containing homogeneous transcription circuits, chimeras that contained mixed regulatory networks were invariantly lethal, because viable chimeric viruses were not isolated. Mechanistically, mixed regulatory circuits promoted inefficient subgenomic transcription from inappropriate start sites, resulting in truncated ORFs and effectively minimize viral structural protein expression. Engineering regulatory transcription circuits of intercommunicating alleles successfully introduces genetic traps into a viral genome that are lethal in RNA recombinant progeny viruses. regulation | systems biology | vaccine design
PAF Complex Plays Novel Subunit-Specific Roles in Alternative Cleavage and Polyadenylation
Yang, Yan; Li, Wencheng; Hoque, Mainul; Hou, Liming; Shen, Steven; Tian, Bin; Dynlacht, Brian D.
2016-01-01
The PAF complex (Paf1C) has been shown to regulate chromatin modifications, gene transcription, and RNA polymerase II (PolII) elongation. Here, we provide the first genome-wide profiles for the distribution of the entire complex in mammalian cells using chromatin immunoprecipitation and high throughput sequencing. We show that Paf1C is recruited not only to promoters and gene bodies, but also to regions downstream of cleavage/polyadenylation (pA) sites at 3’ ends, a profile that sharply contrasted with the yeast complex. Remarkably, we identified novel, subunit-specific links between Paf1C and regulation of alternative cleavage and polyadenylation (APA) and upstream antisense transcription using RNAi coupled with deep sequencing of the 3’ ends of transcripts. Moreover, we found that depletion of Paf1C subunits resulted in the accumulation of PolII over gene bodies, which coincided with APA. Depletion of specific Paf1C subunits led to global loss of histone H2B ubiquitylation, although there was little impact of Paf1C depletion on other histone modifications, including tri-methylation of histone H3 on lysines 4 and 36 (H3K4me3 and H3K36me3), previously associated with this complex. Our results provide surprising differences with yeast, while unifying observations that link Paf1C with PolII elongation and RNA processing, and indicate that Paf1C subunits could play roles in controlling transcript length through suppression of PolII accumulation at transcription start site (TSS)-proximal pA sites and regulating pA site choice in 3’UTRs. PMID:26765774
Uittenbogaard, Martine; Martinka, Debra L.; Johnson, Peter F.; Vinson, Charles; Chiaramello, Anne
2009-01-01
Expression of the bHLH transcription factor Nex1/MATH-2/NeuroD6, a member of the NeuroD subfamily, parallels overt neuronal differentiation and synaptogenesis during brain development. Our previous studies have shown that Nex1 is a critical effector of the NGF pathway and promotes neuronal differentiation and survival of PC12 cells in the absence of growth factors. In this study, we investigated the transcriptional regulation of the Nex1 gene during NGF-induced neuronal differentiation. We found that Nex1 expression is under the control of two conserved promoters, Nex1-P1 and Nex1-P2, located in two distinct non-coding exons. Both promoters are TATA-less with multiple transcription start sites, and are activated on NGF or cAMP exposure. Luciferase-reporter assays showed that the Nex1-P2 promoter activity is stronger than the Nex1-P1 promoter activity, which supports the previously reported differential expression levels of Nex1 transcripts throughout brain development. Using a combination of DNaseI footprinting, EMSA assays, and site-directed mutagenesis, we identified the essential regulatory elements within the first 2 kb of the Nex1 5′UTR. The Nex1-P1 promoter is mainly regulated by a conserved CRE element, whereas the Nex1-P2 promoter is under the control of a conserved C/EBP binding site. Overexpression of wild-type C/EBPβ resulted in increased Nex1-P2 promoter activity in NGF-differentiated PC12 cells. The fact that Nex1 is a target gene of C/EBPβ provides new insight into the C/EBP transcriptional cascade known to promote neurogenesis, while repressing gliogenesis. PMID:17075921
Huebert, Dana J.; Kuan, Pei-Fen; Keleş, Sündüz
2012-01-01
The response to stressful stimuli requires rapid, precise, and dynamic gene expression changes that must be coordinated across the genome. To gain insight into the temporal ordering of genome reorganization, we investigated dynamic relationships between changing nucleosome occupancy, transcription factor binding, and gene expression in Saccharomyces cerevisiae yeast responding to oxidative stress. We applied deep sequencing to nucleosomal DNA at six time points before and after hydrogen peroxide treatment and revealed many distinct dynamic patterns of nucleosome gain and loss. The timing of nucleosome repositioning was not predictive of the dynamics of downstream gene expression change but instead was linked to nucleosome position relative to transcription start sites and specific cis-regulatory elements. We measured genome-wide binding of the stress-activated transcription factor Msn2p over time and found that Msn2p binds different loci with different dynamics. Nucleosome eviction from Msn2p binding sites was common across the genome; however, we show that, contrary to expectation, nucleosome loss occurred after Msn2p binding and in fact required Msn2p. This negates the prevailing model that nucleosomes obscuring Msn2p sites regulate DNA access and must be lost before Msn2p can bind DNA. Together, these results highlight the complexities of stress-dependent chromatin changes and their effects on gene expression. PMID:22354995
Parzefall, Thomas; Lucas, Trevor; Koenighofer, Martin; Ramsebner, Reinhard; Frohne, Alexandra; Czeiger, Shelly; Baumgartner, Wolf-Dieter; Schoefer, Christian; Gstoettner, Wolfgang; Frei, Klemens
2017-04-01
Alterations within a novel putative Exon 1a within the gap junction beta 2 (GJB2) gene may play a role in the development of genetic hearing impairment in Austria. Mutations in the GJB2 gene are the most common cause of hereditary sensorineural deafness. Genome-wide screening for alternative transcriptional start sites in the human genome has revealed the presence of an additional GJB2 exon (E1a). This study tested the hypothesis of whether alternative GJB2 transcription involving E1a may play a role in the development of congenital sensorineural deafness in Austria. GJB2 E1a and flanking regions were sequenced in randomized normal hearing control subjects and three different patient groups with non-syndromic hearing impairment (NSHI), and bioinformatic analysis was performed. Statistical analysis of disease association was carried out using the Cochran-Armitage test for trend. A single change 2410 bp proximal to the translational start site (c.-2410T > C, rs7994748, NM_004004.5:c.-23 + 792T > C) was found to be significantly associated with the common c.35delG GJB2 mutation (p = .009). c.35delG in combination with c.-2410CC occurred at a 6.9-fold increased frequency compared to the control group. Additionally, one patient with idiopathic congenital hearing loss was found to be homozygous c.-2410CC.
Pai, Priya; Rachagani, Satyanarayana; Lakshmanan, Imayavaramban; Macha, Muzafar A; Sheinin, Yuri; Smith, Lynette M; Ponnusamy, Moorthy P; Batra, Surinder K
2016-02-01
Aberrant Wnt signaling frequently occurs in pancreatic cancer (PC) and contributes to disease progression/metastases. Likewise, the transmembrane-mucin MUC4 is expressed de novo in early pancreatic intraepithelial neoplasia (PanINs) and incrementally increases with PC progression, contributing to metastasis. To determine the mechanism of MUC4 upregulation in PC, we examined factors deregulated in early PC progression, such as Wnt/β-catenin signaling. MUC4 promoter analysis revealed the presence of three putative TCF/LEF-binding sites, leading us to hypothesize that MUC4 can be regulated by β-catenin. Immunohistochemical (IHC) analysis of rapid autopsy PC tissues showed a correlation between MUC4 and cytosolic/nuclear β-catenin expression. Knock down (KD) of β-catenin in CD18/HPAF and T3M4 cell lines resulted in decreased MUC4 transcript and protein. Three MUC4 promoter luciferase constructs, p3778, p3000, and p2700, were generated. The construct p3778, encompassing the entire MUC4 promoter, elicited increased luciferase activity in the presence of stabilized β-catenin. Mutation of the TCF/LEF site closest to the transcription start site (i.e., -2629/-2612) and furthest from the start site (i.e., -3425/-3408) reduced MUC4 promoter luciferase activity. Transfection with dominant negative TCF4 decreased MUC4 transcript and protein levels. Chromatin immunoprecipitation confirmed enrichment of β-catenin on -2629/-2612 and -3425/-3408 of the MUC4 promoter in CD18/HPAF. Functionally, CD18/HPAF and T3M4 β-catenin KD cells showed decreased migration and decreased Vimentin, N-cadherin, and pERK1/2 expression. Tumorigenicity studies in athymic nude mice showed CD18/HPAF β-catenin KD cells significantly reduced primary tumor sizes and metastases compared to scrambled control cells. We show for the first time that β-catenin directly governs MUC4 in PC. Published by Elsevier B.V.
Regulatory elements of Caenorhabditis elegans ribosomal protein genes
2012-01-01
Background Ribosomal protein genes (RPGs) are essential, tightly regulated, and highly expressed during embryonic development and cell growth. Even though their protein sequences are strongly conserved, their mechanism of regulation is not conserved across yeast, Drosophila, and vertebrates. A recent investigation of genomic sequences conserved across both nematode species and associated with different gene groups indicated the existence of several elements in the upstream regions of C. elegans RPGs, providing a new insight regarding the regulation of these genes in C. elegans. Results In this study, we performed an in-depth examination of C. elegans RPG regulation and found nine highly conserved motifs in the upstream regions of C. elegans RPGs using the motif discovery algorithm DME. Four motifs were partially similar to transcription factor binding sites from C. elegans, Drosophila, yeast, and human. One pair of these motifs was found to co-occur in the upstream regions of 250 transcripts including 22 RPGs. The distance between the two motifs displayed a complex frequency pattern that was related to their relative orientation. We tested the impact of three of these motifs on the expression of rpl-2 using a series of reporter gene constructs and showed that all three motifs are necessary to maintain the high natural expression level of this gene. One of the motifs was similar to the binding site of an orthologue of POP-1, and we showed that RNAi knockdown of pop-1 impacts the expression of rpl-2. We further determined the transcription start site of rpl-2 by 5’ RACE and found that the motifs lie 40–90 bases upstream of the start site. We also found evidence that a noncoding RNA, contained within the outron of rpl-2, is co-transcribed with rpl-2 and cleaved during trans-splicing. Conclusions Our results indicate that C. elegans RPGs are regulated by a complex novel series of regulatory elements that is evolutionarily distinct from those of all other species examined up until now. PMID:22928635
Wang, Yejun; MacKenzie, Keith D; White, Aaron P
2015-05-07
As sequencing costs are being lowered continuously, RNA-seq has gradually been adopted as the first choice for comparative transcriptome studies with bacteria. Unlike microarrays, RNA-seq can directly detect cDNA derived from mRNA transcripts at a single nucleotide resolution. Not only does this allow researchers to determine the absolute expression level of genes, but it also conveys information about transcript structure. Few automatic software tools have yet been established to investigate large-scale RNA-seq data for bacterial transcript structure analysis. In this study, 54 directional RNA-seq libraries from Salmonella serovar Typhimurium (S. Typhimurium) 14028s were examined for potential relationships between read mapping patterns and transcript structure. We developed an empirical method, combined with statistical tests, to automatically detect key transcript features, including transcriptional start sites (TSSs), transcriptional termination sites (TTSs) and operon organization. Using our method, we obtained 2,764 TSSs and 1,467 TTSs for 1331 and 844 different genes, respectively. Identification of TSSs facilitated further discrimination of 215 putative sigma 38 regulons and 863 potential sigma 70 regulons. Combining the TSSs and TTSs with intergenic distance and co-expression information, we comprehensively annotated the operon organization in S. Typhimurium 14028s. Our results show that directional RNA-seq can be used to detect transcriptional borders at an acceptable resolution of ±10-20 nucleotides. Technical limitations of the RNA-seq procedure may prevent single nucleotide resolution. The automatic transcript border detection methods, statistical models and operon organization pipeline that we have described could be widely applied to RNA-seq studies in other bacteria. Furthermore, the TSSs, TTSs, operons, promoters and unstranslated regions that we have defined for S. Typhimurium 14028s may constitute valuable resources that can be used for comparative analyses with other Salmonella serotypes.
Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S
1997-01-01
GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313
Kamalakaran, Sitharthan; Radhakrishnan, Senthil K; Beck, William T
2005-06-03
We developed a pipeline to identify novel genes regulated by the steroid hormone-dependent transcription factor, estrogen receptor, through a systematic analysis of upstream regions of all human and mouse genes. We built a data base of putative promoter regions for 23,077 human and 19,984 mouse transcripts from National Center for Biotechnology Information annotation and 8793 human and 6785 mouse promoters from the Data Base of Transcriptional Start Sites. We used this data base of putative promoters to identify potential targets of estrogen receptor by identifying estrogen response elements (EREs) in their promoters. Our program correctly identified EREs in genes known to be regulated by estrogen in addition to several new genes whose putative promoters contained EREs. We validated six genes (KIAA1243, NRIP1, MADH9, NME3, TPD52L, and ABCG2) to be estrogen-responsive in MCF7 cells using reverse transcription PCR. To allow for extensibility of our program in identifying targets of other transcription factors, we have built a Web interface to access our data base and programs. Our Web-based program for Promoter Analysis of Genome, PAGen@UIC, allows a user to identify putative target genes for vertebrate transcription factors through the analysis of their upstream sequences. The interface allows the user to search the human and mouse promoter data bases for potential target genes containing one or more listed transcription factor binding sites (TFBSs) in their upstream elements, using either regular expression-based consensus or position weight matrices. The data base can also be searched for promoters harboring user-defined TFBSs given as a consensus or a position weight matrix. Furthermore, the user can retrieve putative promoter sequences for any given gene together with identified TFBSs located on its promoter. Orthologous promoters are also analyzed to determine conserved elements.
Ma, AyeAye; Margolis, Mathew S.
2013-01-01
Herpes simplex virus 1 (HSV-1) and HSV-2 establish latency in different neuronal subtypes (A5+ and KH10+) in murine trigeminal ganglia, results which correlate with restricted productive infection in these neurons in vitro. HSV-2 latency-associated transcript (LAT) contains a cis-acting regulatory element near the transcription start site that promotes productive infection in A5+ neurons and a second element in exon 1 that inhibits productive infection in KH10+ neurons. HSV-1 contains no such regulatory sequences, demonstrating different mechanisms for regulating productive HSV infection in neurons. PMID:23514893
Apple skin patterning is associated with differential expression of MYB10
2011-01-01
Background Some apple (Malus × domestica Borkh.) varieties have attractive striping patterns, a quality attribute that is important for determining apple fruit market acceptance. Most apple cultivars (e.g. 'Royal Gala') produce fruit with a defined fruit pigment pattern, but in the case of 'Honeycrisp' apple, trees can produce fruits of two different kinds: striped and blushed. The causes of this phenomenon are unknown. Results Here we show that striped areas of 'Honeycrisp' and 'Royal Gala' are due to sectorial increases in anthocyanin concentration. Transcript levels of the major biosynthetic genes and MYB10, a transcription factor that upregulates apple anthocyanin production, correlated with increased anthocyanin concentration in stripes. However, nucleotide changes in the promoter and coding sequence of MYB10 do not correlate with skin pattern in 'Honeycrisp' and other cultivars differing in peel pigmentation patterns. A survey of methylation levels throughout the coding region of MYB10 and a 2.5 Kb region 5' of the ATG translation start site indicated that an area 900 bp long, starting 1400 bp upstream of the translation start site, is highly methylated. Cytosine methylation was present in all three contexts, with higher methylation levels observed for CHH and CHG (where H is A, C or T) than for CG. Comparisons of methylation levels of the MYB10 promoter in 'Honeycrisp' red and green stripes indicated that they correlate with peel phenotypes, with an enrichment of methylation observed in green stripes. Conclusions Differences in anthocyanin levels between red and green stripes can be explained by differential transcript accumulation of MYB10. Different levels of MYB10 transcript in red versus green stripes are inversely associated with methylation levels in the promoter region. Although observed methylation differences are modest, trends are consistent across years and differences are statistically significant. Methylation may be associated with the presence of a TRIM retrotransposon within the promoter region, but the presence of the TRIM element alone cannot explain the phenotypic variability observed in 'Honeycrisp'. We suggest that methylation in the MYB10 promoter is more variable in 'Honeycrisp' than in 'Royal Gala', leading to more variable color patterns in the peel of this cultivar. PMID:21599973
Voigt, Karsten; Sharma, Cynthia M; Mitschke, Jan; Joke Lambrecht, S; Voß, Björn; Hess, Wolfgang R; Steglich, Claudia
2014-01-01
Prochlorococcus is a genus of abundant and ecologically important marine cyanobacteria. Here, we present a comprehensive comparison of the structure and composition of the transcriptomes of two Prochlorococcus strains, which, despite their similarities, have adapted their gene pool to specific environmental constraints. We present genome-wide maps of transcriptional start sites (TSS) for both organisms, which are representatives of the two most diverse clades within the two major ecotypes adapted to high- and low-light conditions, respectively. Our data suggest antisense transcription for three-quarters of all genes, which is substantially more than that observed in other bacteria. We discovered hundreds of TSS within genes, most notably within 16 of the 29 prochlorosin genes, in strain MIT9313. A direct comparison revealed very little conservation in the location of TSS and the nature of non-coding transcripts between both strains. We detected extremely short 5′ untranslated regions with a median length of only 27 and 29 nt for MED4 and MIT9313, respectively, and for 8% of all protein-coding genes the median distance to the start codon is only 10 nt or even shorter. These findings and the absence of an obvious Shine–Dalgarno motif suggest that leaderless translation and ribosomal protein S1-dependent translation constitute alternative mechanisms for translation initiation in Prochlorococcus. We conclude that genome-wide antisense transcription is a major component of the transcriptional output from these relatively small genomes and that a hitherto unrecognized high degree of complexity and variability of gene expression exists in their transcriptional architecture. PMID:24739626
Shiang, Rita
2008-01-01
Treacher Collins syndrome is an autosomal-dominant mandibulofacial dysostosis caused by haploinsufficiency of the TCOF1 gene product treacle. Mouse Tcof1 protein is approximately 61% identical and 71% similar to treacle, and heterozygous knockout of Tcof1 causes craniofacial malformation. Tcof1 expression is high in developing neural crest, but much lower in other tissues. To investigate this dual regulation, highly conserved regions upstream of TCOF1 homologs were tested through deletion and mutation reporter assays, and conserved predicted transcription factor binding sites were assessed through chromatin binding studies. Assays were performed in mouse P19 embryonic carcinoma cells and in HEK293 cells to determine differential activation in cell types at different stages of differentiation. Binding of Cebpb, Zfp161, and Sp1 transcription factors was specific to the Tcof1 regulatory region in P19 cells. The Zfp161 binding site demonstrated P19 cell–specific repression, while the Sp1/Sp3 candidate site demonstrated HEK293 cell–specific activation. Moreover, presence of c-myb and Zfp161 transcripts was specific to P19 cells. A minimal promoter fragment from −253 to +43 bp directs constitutive expression in both cell types, and dual regulation of Tcof1 appears to be through differential repression of this minimal promoter. The CpG island at the transcription start site remains unmethylated in P19 cells, 11.5 dpc mouse embryonic tissue, and adult mouse ear, which supports constitutive activation of the Tcof1 promoter. PMID:18771418
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Growth hormone and Pit-1 expression in bovine fetal lymphoid cells.
Chen, H T; Schuler, L A; Schultz, R D
1997-11-01
Bovine fetal lymphoid cells were examined for growth hormone (GH) and the transcription factor Pit-1/GHF-1 mRNA. GH and Pit-1/GHF-1 transcripts were detected in thymocytes and splenocytes from fetuses at 60, 90, 120, and 270 d of gestation using reverse transcription-polymerase chain reaction (RT-PCR). Northern analysis indicated that the lymphoid GH mRNA was approximately 350 nucleotides larger than in the pituitary. RT-PCR analysis demonstrated that the coding regions as well as 3' untranslated region of the lymphocyte GH and pituitary transcripts were the same. Analysis of the 5'-untranslated region of the lymphocyte GH mRNA showed that transcription began upstream from the start site in the pituitary gland, suggesting differences in regulation in these tissues. Fetal thymocytes and splenocytes expressed Pit-1/GHF-1 mRNA; however, they contained only the 2.5-kb transcript. The GH and Pit-1/GHF-1 mRNA in fetal lymphoid cells supports the hypothesis that lymphocyte-derived GH may function as an autocrine and/or paracrine factor during the development and maturation of the bovine fetal immune system.
Kim, Jung-Hyun; Baddoo, Melody C.; Park, Eun Young; Stone, Joshua K.; Park, Hyeonsoo; Butler, Thomas W.; Huang, Gang; Yan, Xiaomei; Pauli-Behn, Florencia; Myers, Richard M.; Tan, Ming; Flemington, Erik K.; Lim, Ssang-Taek; Erin Ahn, Eun-Young
2016-01-01
SUMMARY Dysregulation of MLL complex-mediated histone methylation plays a pivotal role in gene expression associated with diseases, but little is known about cellular factors modulating MLL complex activity. Here, we report that SON, previously known as an RNA splicing factor, controls MLL complex-mediated transcriptional initiation. SON binds to DNA near transcription start sites, interacts with menin, and inhibits MLL complex assembly, resulting in decreased H3K4me3 and transcriptional repression. Importantly, alternatively spliced short isoforms of SON are markedly upregulated in acute myeloid leukemia. The short isoforms compete with full-length SON for chromatin occupancy, but lack the menin-binding ability, thereby antagonizing full-length SON function in transcriptional repression while not impairing full-length SON-mediated RNA splicing. Furthermore, overexpression of a short isoform of SON enhances replating potential of hematopoietic progenitors. Our findings define SON as a fine-tuner of the MLL-menin interaction and reveal short SON overexpression as a marker indicating aberrant transcriptional initiation in leukemia. PMID:26990989
Chen, Chih-Yu; Shi, Wenqiang; Balaton, Bradley P; Matthews, Allison M; Li, Yifeng; Arenillas, David J; Mathelier, Anthony; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R; Brown, Carolyn J; Wasserman, Wyeth W
2016-11-18
Sex differences in susceptibility and progression have been reported in numerous diseases. Female cells have two copies of the X chromosome with X-chromosome inactivation imparting mono-allelic gene silencing for dosage compensation. However, a subset of genes, named escapees, escape silencing and are transcribed bi-allelically resulting in sexual dimorphism. Here we conducted in silico analyses of the sexes using human datasets to gain perspectives into such regulation. We identified transcription start sites of escapees (escTSSs) based on higher transcription levels in female cells using FANTOM5 CAGE data. Significant over-representations of YY1 transcription factor binding motif and ChIP-seq peaks around escTSSs highlighted its positive association with escapees. Furthermore, YY1 occupancy is significantly biased towards the inactive X (Xi) at long non-coding RNA loci that are frequent contacts of Xi-specific superloops. Our study suggests a role for YY1 in transcriptional activity on Xi in general through sequence-specific binding, and its involvement at superloop anchors.
Chen, Chih-yu; Shi, Wenqiang; Balaton, Bradley P.; Matthews, Allison M.; Li, Yifeng; Arenillas, David J.; Mathelier, Anthony; Itoh, Masayoshi; Kawaji, Hideya; Lassmann, Timo; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.; Brown, Carolyn J.; Wasserman, Wyeth W.
2016-01-01
Sex differences in susceptibility and progression have been reported in numerous diseases. Female cells have two copies of the X chromosome with X-chromosome inactivation imparting mono-allelic gene silencing for dosage compensation. However, a subset of genes, named escapees, escape silencing and are transcribed bi-allelically resulting in sexual dimorphism. Here we conducted in silico analyses of the sexes using human datasets to gain perspectives into such regulation. We identified transcription start sites of escapees (escTSSs) based on higher transcription levels in female cells using FANTOM5 CAGE data. Significant over-representations of YY1 transcription factor binding motif and ChIP-seq peaks around escTSSs highlighted its positive association with escapees. Furthermore, YY1 occupancy is significantly biased towards the inactive X (Xi) at long non-coding RNA loci that are frequent contacts of Xi-specific superloops. Our study suggests a role for YY1 in transcriptional activity on Xi in general through sequence-specific binding, and its involvement at superloop anchors. PMID:27857184
Giresi, Paul G.; Kim, Jonghwan; McDaniell, Ryan M.; Iyer, Vishwanath R.; Lieb, Jason D.
2007-01-01
DNA segments that actively regulate transcription in vivo are typically characterized by eviction of nucleosomes from chromatin and are experimentally identified by their hypersensitivity to nucleases. Here we demonstrate a simple procedure for the isolation of nucleosome-depleted DNA from human chromatin, termed FAIRE (Formaldehyde-Assisted Isolation of Regulatory Elements). To perform FAIRE, chromatin is crosslinked with formaldehyde in vivo, sheared by sonication, and phenol-chloroform extracted. The DNA recovered in the aqueous phase is fluorescently labeled and hybridized to a DNA microarray. FAIRE performed in human cells strongly enriches DNA coincident with the location of DNaseI hypersensitive sites, transcriptional start sites, and active promoters. Evidence for cell-type–specific patterns of FAIRE enrichment is also presented. FAIRE has utility as a positive selection for genomic regions associated with regulatory activity, including regions traditionally detected by nuclease hypersensitivity assays. PMID:17179217
Origins of De Novo Genes in Human and Chimpanzee.
Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M Mar
2015-12-01
The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species--human, chimpanzee, macaque, and mouse--and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins.
Origins of De Novo Genes in Human and Chimpanzee
Ruiz-Orera, Jorge; Hernandez-Rodriguez, Jessica; Chiva, Cristina; Sabidó, Eduard; Kondova, Ivanela; Bontrop, Ronald; Marqués-Bonet, Tomàs; Albà, M.Mar
2015-01-01
The birth of new genes is an important motor of evolutionary innovation. Whereas many new genes arise by gene duplication, others originate at genomic regions that did not contain any genes or gene copies. Some of these newly expressed genes may acquire coding or non-coding functions and be preserved by natural selection. However, it is yet unclear which is the prevalence and underlying mechanisms of de novo gene emergence. In order to obtain a comprehensive view of this process, we have performed in-depth sequencing of the transcriptomes of four mammalian species—human, chimpanzee, macaque, and mouse—and subsequently compared the assembled transcripts and the corresponding syntenic genomic regions. This has resulted in the identification of over five thousand new multiexonic transcriptional events in human and/or chimpanzee that are not observed in the rest of species. Using comparative genomics, we show that the expression of these transcripts is associated with the gain of regulatory motifs upstream of the transcription start site (TSS) and of U1 snRNP sites downstream of the TSS. In general, these transcripts show little evidence of purifying selection, suggesting that many of them are not functional. However, we find signatures of selection in a subset of de novo genes which have evidence of protein translation. Taken together, the data support a model in which frequently-occurring new transcriptional events in the genome provide the raw material for the evolution of new proteins. PMID:26720152
Wang, Yewei; Fu, Lei; Sun, Ailian; Tang, Doudou; Xu, Yunxiao; Li, Zheyuan; Chen, Mingjie; Zhang, Guangsen
2018-05-05
Emerging evidences have shown that long non-coding RNAs (lncRNAs) play critical roles in cancer development and cancer therapy. LncRNA Nuclear Enriched Abundant Transcript 1 (NEAT1) is indispensable during acute promyelocytic leukemia (APL) cell differentiation induced by all-trans retinoic acid (ATRA). However, the precise mechanism of NEAT1 upregulation has not been fully understood. In this study, we performed chromatin immunoprecipitation and luciferase reporter assays to demonstrate that C/EBP family transcription factor C/EBPβ bind to and transactivate the promoter of lncRNA NEAT1 through the C/EBPβ binding sites both around -54 bp and -1453 bp upstream of the transcription start site. Moreover, the expression of C/EBPβ was increased after ATRA treatment, and the binding of C/EBPβ in the NEAT1 promoter was also dramatically increased. Finally, knockdown of C/EBPβ significantly reduced the ATRA-induced upregulation of NEAT1. In conclusion, C/EBPβ directly activates the expression of NEAT1 through binding to the promoter of NEAT1. Knockdown of C/EBPβ impairs ATRA-induced transcriptional activation of NEAT1. Our data indicate that C/EBPβ contributes to ATRA-induced activation of NEAT1 during APL cell differentiation. Our results enrich our knowledge on the regulation of lncRNAs and the regulatory role of C/EBPβ in APL cell differentiation. Copyright © 2017. Published by Elsevier Inc.
Ewulonu, U K; Snyder, L; Silver, L M; Schimenti, J C
1996-03-01
Transgenic mice were generated to localize essential promoter elements in the mouse testis-expressed Tcp-10 genes. These genes are expressed exclusively in male germ cells, and exhibit a diffuse range of transcriptional start sites, possibly due to the absence of a TATA box. A series of transgene constructs containing different amounts of 5' flanking DNA revealed that all sequences necessary for appropriate temporal and tissue-specific transcription of Tcp-10 reside between positions -1 to -973. All transgenic animals containing these sequences expressed a chimeric transgene at high levels, in a pattern that paralleled the endogenous genes. These experiments further defined a 227 bp fragment from -746 to -973 that was absolutely essential for expression. In a gel-shift assay, this 227-bp fragment bound nuclear protein from testis, but not other tissues, to yield two retarded bands. Sequence analysis of this fragment revealed a half-site for the AP-2 transcription factor recognition sequence. Gel shift assays using native or mutant oligonucleotides demonstrated that the putative AP-2 recognition sequence was essential for generating the retarded bands. Since the binding activity is testis-specific, but AP-2 expression is not exclusive to male germ cells, it is possible that transcription of Tcp-10 requires interaction between AP-2 and a germ cell-specific transcription factor.
Molecular and functional characterization of the promoter of ETS2, the human c-ets-2 gene.
Mavrothalassitis, G J; Watson, D K; Papas, T S
1990-01-01
The 5' end of the human c-ets-2 gene, ETS2, was cloned and characterized. The major transcription initiation start sites were identified, and the pertinent sequences surrounding the ETS2 promoter were determined. The promoter region of ETS2 does not possess typical "TATA" and "CAAT" elements. However, this promoter contains several repeat regions, as well as two consensus AP2 binding sites and three putative Sp1 sites. There is also a palindromic region similar to the serum response element of the c-fos gene, located 1400 base pairs (bp) upstream from the first major transcription initiation site. A G + C-rich sequence (GC element) with dyad symmetry can be seen in the ETS2 promoter, immediately following an unusually long (approximately 250-bp) polypurine-polypyrimidine tract. A series of deletion fragments from the putative promoter region were ligated in front of the bacterial chloramphenicol acetyltransferase gene and tested for activity following transfection into HeLa cells. The 5' boundary of the region needed for maximum promoter activity was found to be 159 bp upstream of the major initiation site. This region of 159 bp contains putative binding sites for transcription factors Sp1 and AP2 (one for each), the GC element, one small forward repeat, one inverted repeat, and half of the polypurine-pyrimidine tract. The promoter of ETS2 (within the polypyrimidine tract) serves to illustrate an alternative structure that may be present in genes with "TATA-less" promoters. Images PMID:2405393
Schaefke, Bernhard; Wang, Tzi-Yuan; Wang, Chuen-Yi; Li, Wen-Hsiung
2015-07-27
Gene expression evolution occurs through changes in cis- or trans-regulatory elements or both. Interactions between transcription factors (TFs) and their binding sites (TFBSs) constitute one of the most important points where these two regulatory components intersect. In this study, we investigated the evolution of TFBSs in the promoter regions of different Saccharomyces strains and species. We divided the promoter of a gene into the proximal region and the distal region, which are defined, respectively, as the 200-bp region upstream of the transcription starting site and as the 200-bp region upstream of the proximal region. We found that the predicted TFBSs in the proximal promoter regions tend to be evolutionarily more conserved than those in the distal promoter regions. Additionally, Saccharomyces cerevisiae strains used in the fermentation of alcoholic drinks have experienced more TFBS losses than gains compared with strains from other environments (wild strains, laboratory strains, and clinical strains). We also showed that differences in TFBSs correlate with the cis component of gene expression evolution between species (comparing S. cerevisiae and its sister species Saccharomyces paradoxus) and within species (comparing two closely related S. cerevisiae strains). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Role of Setbp1 in Myeloid Leukemia Development
2014-09-05
CTC ACT GTG GAG ACG ATT C 3’ 5’ TTC TTA TCC AGC ACA CCA AGC TT 3’ Hoxa9 5’ TGT CTC CTC TCC CCC AAA CC 3’ 5’ GAG ATG AGG CCT GGG ATTTAG A 3’ Hoxa10...highlighted in yellow and noncoding exons in gray . Arrows indicate transcription start sites. The location and orientation of viral integrations are
Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.
Behrens, R; Hayles, J; Nurse, P
2000-12-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.
Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames
Behrens, Ralf; Hayles, Jacky; Nurse, Paul
2000-01-01
Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681
Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: prediction and validation.
Datta, Moumita; Choudhury, Ananyo; Lahiri, Ansuman; Bhattacharyya, Nitai P
2011-09-26
HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD.
Genome wide gene expression regulation by HIP1 Protein Interactor, HIPPI: Prediction and validation
2011-01-01
Background HIP1 Protein Interactor (HIPPI) is a pro-apoptotic protein that induces Caspase8 mediated apoptosis in cell. We have shown earlier that HIPPI could interact with a specific 9 bp sequence motif, defined as the HIPPI binding site (HBS), present in the upstream promoter of Caspase1 gene and regulate its expression. We also have shown that HIPPI, without any known nuclear localization signal, could be transported to the nucleus by HIP1, a NLS containing nucleo-cytoplasmic shuttling protein. Thus our present work aims at the investigation of the role of HIPPI as a global transcription regulator. Results We carried out genome wide search for the presence of HBS in the upstream sequences of genes. Our result suggests that HBS was predominantly located within 2 Kb upstream from transcription start site. Transcription factors like CREBP1, TBP, OCT1, EVI1 and P53 half site were significantly enriched in the 100 bp vicinity of HBS indicating that they might co-operate with HIPPI for transcription regulation. To illustrate the role of HIPPI on transcriptome, we performed gene expression profiling by microarray. Exogenous expression of HIPPI in HeLa cells resulted in up-regulation of 580 genes (p < 0.05) while 457 genes were down-regulated. Several transcription factors including CBP, REST, C/EBP beta were altered by HIPPI in this study. HIPPI also interacted with P53 in the protein level. This interaction occurred exclusively in the nuclear compartment and was absent in cells where HIP1 was knocked down. HIPPI-P53 interaction was necessary for HIPPI mediated up-regulation of Caspase1 gene. Finally, we analyzed published microarray data obtained with post mortem brains of Huntington's disease (HD) patients to investigate the possible involvement of HIPPI in HD pathogenesis. We observed that along with the transcription factors like CREB, P300, SREBP1, Sp1 etc. which are already known to be involved in HD, HIPPI binding site was also significantly over-represented in the upstream sequences of genes altered in HD. Conclusions Taken together, the results suggest that HIPPI could act as an important transcription regulator in cell regulating a vast array of genes, particularly transcription factors and at least, in part, play a role in transcription deregulation observed in HD. PMID:21943362
Bm65 is essential for the propagation of Bombyx mori nucleopolyhedrovirus.
Tang, Qi; Li, Guohui; Yao, Qin; Chen, Liang; Feng, Fan; Yuan, Yi; Chen, Keping
2013-01-01
Orf65 (Bm65) of Bombyx mori nucleopolyhedrovirus (BmNPV) is a highly conserved gene that encodes an unknown 104-amino acid protein. In the present study, we have shown the role of Bm65 in the baculovirus life cycle. 5'-RACE analysis showed that the transcription start site of Bm65 was 14 nucleotides upstream of the start codon ATG. The transcription profile of Bm65 was detected from 6 to 72 h postinfection (p. i.) by RT-PCR. A Bm65-knockout bacmid was constructed by homologous recombination to characterize the role of Bm65 in viral life cycle. Fluorescence microscopy showed that Bm65-knockout virus was unable to generate infectious budded virus in BmN cells. Furthermore, quantitative real-time PCR analysis demonstrated that Bm65 deletion did not affect the viral DNA replication. To conclude, Bm65 is essential for the propagation of BmNPV, but is unnecessary for the replication of viral DNA.
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators. PMID:28301511
Streubel, Jana; Baum, Heidi; Grau, Jan; Stuttman, Johannes; Boch, Jens
2017-01-01
Plant-pathogenic Xanthomonas bacteria inject transcription activator-like effector proteins (TALEs) into host cells to specifically induce transcription of plant genes and enhance susceptibility. Although the DNA-binding mode is well-understood it is still ambiguous how TALEs initiate transcription and whether additional promoter elements are needed to support this. To systematically dissect prerequisites for transcriptional initiation the activity of one TALE was compared on different synthetic Bs4 promoter fragments. In addition, a large collection of artificial TALEs spanning the OsSWEET14 promoter was compared. We show that the presence of a TALE alone is not sufficient to initiate transcription suggesting the requirement of additional supporting promoter elements. At the OsSWEET14 promoter TALEs can initiate transcription from various positions, in a synergistic manner of multiple TALEs binding in parallel to the promoter, and even by binding in reverse orientation. TALEs are known to shift the transcriptional start site, but our data show that this shift depends on the individual position of a TALE within a promoter context. Our results implicate that TALEs function like classical enhancer-binding proteins and initiate transcription in both orientations which has consequences for in planta target gene prediction and design of artificial activators.
Kasahara, Koji; Ohyama, Yoshifumi; Kokubo, Tetsuro
2011-01-01
Saccharomyces cerevisiae Hmo1 binds to the promoters of ∼70% of ribosomal protein genes (RPGs) at high occupancy, but is observed at lower occupancy on the remaining RPG promoters. In Δhmo1 cells, the transcription start site (TSS) of the Hmo1-enriched RPS5 promoter shifted upstream, while the TSS of the Hmo1-limited RPL10 promoter did not shift. Analyses of chimeric RPS5/RPL10 promoters revealed a region between the RPS5 upstream activating sequence (UAS) and core promoter, termed the intervening region (IVR), responsible for strong Hmo1 binding and an upstream TSS shift in Δhmo1 cells. Chromatin immunoprecipitation analyses showed that the RPS5-IVR resides within a nucleosome-free region and that pre-initiation complex (PIC) assembly occurs at a site between the IVR and a nucleosome overlapping the TSS (+1 nucleosome). The PIC assembly site was shifted upstream in Δhmo1 cells on this promoter, indicating that Hmo1 normally masks the RPS5-IVR to prevent PIC assembly at inappropriate site(s). This novel mechanism ensures accurate transcriptional initiation by delineating the 5′- and 3′-boundaries of the PIC assembly zone. PMID:21288884
Pierard, Valérie; Guiguen, Allan; Colin, Laurence; Wijmeersch, Gaëlle; Vanhulle, Caroline; Van Driessche, Benoît; Dekoninck, Ann; Blazkova, Jana; Cardona, Christelle; Merimi, Makram; Vierendeel, Valérie; Calomme, Claire; Nguyên, Thi Liên-Anh; Nuttinck, Michèle; Twizere, Jean-Claude; Kettmann, Richard; Portetelle, Daniel; Burny, Arsène; Hirsch, Ivan; Rohr, Olivier; Van Lint, Carine
2010-06-18
Bovine leukemia virus (BLV) proviral latency represents a viral strategy to escape the host immune system and allow tumor development. Besides the previously demonstrated role of histone deacetylation in the epigenetic repression of BLV expression, we showed here that BLV promoter activity was induced by several DNA methylation inhibitors (such as 5-aza-2'-deoxycytidine) and that overexpressed DNMT1 and DNMT3A, but not DNMT3B, down-regulated BLV promoter activity. Importantly, cytosine hypermethylation in the 5'-long terminal repeat (LTR) U3 and R regions was associated with true latency in the lymphoma-derived B-cell line L267 but not with defective latency in YR2 cells. Moreover, the virus-encoded transactivator Tax(BLV) decreased DNA methyltransferase expression levels, which could explain the lower level of cytosine methylation observed in the L267(LTaxSN) 5'-LTR compared with the L267 5'-LTR. Interestingly, DNA methylation inhibitors and Tax(BLV) synergistically activated BLV promoter transcriptional activity in a cAMP-responsive element (CRE)-dependent manner. Mechanistically, methylation at the -154 or -129 CpG position (relative to the transcription start site) impaired in vitro binding of CRE-binding protein (CREB) transcription factors to their respective CRE sites. Methylation at -129 CpG alone was sufficient to decrease BLV promoter-driven reporter gene expression by 2-fold. We demonstrated in vivo the recruitment of CREB/CRE modulator (CREM) and to a lesser extent activating transcription factor-1 (ATF-1) to the hypomethylated CRE region of the YR2 5'-LTR, whereas we detected no CREB/CREM/ATF recruitment to the hypermethylated corresponding region in the L267 cells. Altogether, these findings suggest that site-specific DNA methylation of the BLV promoter represses viral transcription by directly inhibiting transcription factor binding, thereby contributing to true proviral latency.
Transcription factor Sp1 regulates T-type Ca(2+) channel CaV 3.1 gene expression.
González-Ramírez, Ricardo; Martínez-Hernández, Elizabeth; Sandoval, Alejandro; Felix, Ricardo
2014-05-01
Voltage-gated T-type Ca(2+) (CaV 3) channels mediate a number of physiological events in developing and mature cells, and are implicated in neurological and cardiovascular diseases. In mammals, there are three distinct T-channel genes (CACNA1G, CACNA1H, and CACNA1I) encoding proteins (CaV 3.1-CaV 3.3) that differ in their localization as well as in molecular, biophysical, and pharmacological properties. The CACNA1G is a large gene that contains 38 exons and is localized in chromosome 17q22. Only basic characteristics of the CACNA1G gene promoter region have been investigated classifying it as a TATA-less sequence containing several potential transcription factor-binding motifs. Here, we cloned and characterized a proximal promoter region and initiated the analysis of transcription factors that control CaV 3.1 channel expression using the murine Cacna1g gene as a model. We isolated a ∼1.5 kb 5'-upstream region of Cacna1g and verified its transcriptional activity in the mouse neuroblastoma N1E-115 cell line. In silico analysis revealed that this region possesses a TATA-less minimal promoter that includes two potential transcription start sites and four binding sites for the transcription factor Sp1. The ability of one of these sites to interact with the transcription factor was confirmed by electrophoretic mobility shift assays. Consistent with this, Sp1 over-expression enhanced promoter activity while siRNA-mediated Sp1 silencing significantly decreased the level of CaV 3.1 protein and reduced the amplitude of whole-cell T-type Ca(2+) currents expressed in the N1E-115 cells. These results provide new insights into the molecular mechanisms that control CaV 3.1 channel expression. © 2013 Wiley Periodicals, Inc.
Baculovirus p35 gene is oppositely regulated by P53 and AP-1 like factors in Spodoptera frugiperda
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mohareer, Krishnaveni; Institute of Life Sciences, University of Hyderabad Campus, Prof. C.R. Rao Road, Gachibowli, Hyderabad 500046; Sahdev, Sudhir
2011-11-04
Highlights: Black-Right-Pointing-Pointer Baculovirus p35 is regulated by both viral and host factors. Black-Right-Pointing-Pointer Baculovirus p35 is negatively regulated by SfP53-like factor. Black-Right-Pointing-Pointer Baculovirus p35 is positively regulated by SfAP-1-like factor. -- Abstract: Baculovirus p35 belongs to the early class of genes of AcMNPV and requires viral factors like Immediate Early protein-1 for its transcription. To investigate the role of host factors in regulating p35 gene expression, the putative transcription factor binding sites were examined in silico and the role of these factors in influencing the transcription of p35 gene was assessed. We focused our studies on AP-1 and P53-like factors,more » which are activated under oxidative stress conditions. The AP-1 motif is located at -1401 while P53 motif is at -1912 relative to p35 translation start site. The predicted AP-1 and P53 elements formed specific complexes with Spodoptera frugiperda nuclear extracts. Both AP-1 and P53 motif binding proteins were down regulated as a function of AcMNPV infection in Spodoptera cells. To address the question whether during an oxidative outburst, the p35 transcription is enhanced; we investigated the role of these oxidative stress induced host transcription factors in influencing p35 gene transcription. Reporter assays revealed that AP-1 element enhances the transcription of p35 by a factor of two. Interestingly, P53 element appears to repress the transcription of p35 gene.« less
Mechanisms and consequences of alternative polyadenylation
Di Giammartino, Dafne Campigli; Nishida, Kensei; Manley, James L.
2011-01-01
Summary Alternative polyadenylation (APA) is emerging as a widespread mechanism used to control gene expression. Like alternative splicing, usage of alternative poly(A) sites allows a single gene to encode multiple mRNA transcripts. In some cases, this changes the mRNA coding potential; in other cases, the code remains unchanged but the 3’UTR length is altered, influencing the fate of mRNAs in several ways, for example, by altering the availability of RNA binding protein sites and microRNA binding sites. The mechansims governing both global and gene-specific APA are only starting to be deciphered. Here we review what is known about these mechanisms and the functional consequences of alternative polyadenlyation. PMID:21925375
TFIIIC bound DNA elements in nuclear organization and insulation.
Kirkland, Jacob G; Raab, Jesse R; Kamakaka, Rohinton T
2013-01-01
tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short interspersed nuclear elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer - blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vice versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. This article is part of a Special Issue entitled: Transcription by Odd Pols. Copyright © 2012 Elsevier B.V. All rights reserved.
2010-01-01
Background The Eight-Twenty-One (ETO) nuclear co-repressor gene belongs to the ETO homologue family also containing Myeloid Translocation Gene on chromosome 16 (MTG16) and myeloid translocation Gene-Related protein 1 (MTGR1). By chromosomal translocations ETO and MTG16 become parts of fusion proteins characteristic of morphological variants of acute myeloid leukemia. Normal functions of ETO homologues have as yet not been examined. The goal of this work was to identify structural and functional promoter elements upstream of the coding sequence of the ETO gene in order to explore lineage-specific hematopoietic expression and get hints to function. Results A putative proximal ETO promoter was identified within 411 bp upstream of the transcription start site. Strong ETO promoter activity was specifically observed upon transfection of a promoter reporter construct into erythroid/megakaryocytic cells, which have endogeneous ETO gene activity. An evolutionary conserved region of 228 bp revealed potential cis-elements involved in transcription of ETO. Disruption of the evolutionary conserved GATA -636 consensus binding site repressed transactivation and disruption of the ETS1 -705 consensus binding site enhanced activity of the ETO promoter. The promoter was stimulated by overexpression of GATA-1 into erythroid/megakaryocytic cells. Electrophoretic mobility shift assay with erythroid/megakaryocytic cells showed specific binding of GATA-1 to the GATA -636 site. Furthermore, results from chromatin immunoprecipitation showed GATA-1 binding in vivo to the conserved region of the ETO promoter containing the -636 site. The results suggest that the GATA -636 site may have a role in activation of the ETO gene activity in cells with erythroid/megakaryocytic potential. Leukemia associated AML1-ETO strongly suppressed an ETO promoter reporter in erythroid/megakaryocytic cells. Conclusions We demonstrate that the GATA-1 transcription factor binds and transactivates the ETO proximal promoter in an erythroid/megakaryocytic-specific manner. Thus, trans-acting factors that are essential in erythroid/megakaryocytic differentiation govern ETO expression. PMID:20487545
Wang, Y L; Beach, M J; Rodwell, V W
1989-01-01
We have cloned and sequenced a 505-base-pair (bp) segment of DNA situated upstream of mvaA, the structural gene for (S)-3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.88) of Pseudomonas mevalonii. The DNA segment that we characterized includes the promoter region for the mva operon. Nuclease S1 mapping and primer extension analysis showed that mvaA is the promoter-proximal gene of the mva operon. Transcription initiates at -56 bp relative to the first A (+1) of the translation start site. Transcription in vivo was induced by mevalonate. Structural features of the mva promoter region include an 80-bp A + T-rich region, and -12, -24 consensus sequences that resemble sequences of sigma 54 promoters in enteric organisms. The relative amplitudes of catalytic activity, enzyme protein, and mvaA mRNA are consistent with a model of regulation of this operon at the transcriptional level. Images PMID:2477360
TERRA Promotes Telomere Shortening through Exonuclease 1–Mediated Resection of Chromosome Ends
Pfeiffer, Verena; Lingner, Joachim
2012-01-01
The long noncoding telomeric repeat containing RNA (TERRA) is expressed at chromosome ends. TERRA upregulation upon experimental manipulation or in ICF (immunodeficiency, centromeric instability, facial anomalies) patients correlates with short telomeres. To study the mechanism of telomere length control by TERRA in Saccharomyces cerevisiae, we mapped the transcriptional start site of TERRA at telomere 1L and inserted a doxycycline regulatable promoter upstream. Induction of TERRA transcription led to telomere shortening of 1L but not of other chromosome ends. TERRA interacts with the Exo1-inhibiting Ku70/80 complex, and deletion of EXO1 but not MRE11 fully suppressed the TERRA–mediated short telomere phenotype in presence and absence of telomerase. Thus TERRA transcription facilitates the 5′-3′ nuclease activity of Exo1 at chromosome ends, providing a means to regulate the telomere shortening rate. Thereby, telomere transcription can regulate cellular lifespan through modulation of chromosome end processing activities. PMID:22719262
Computational characterization of chromatin domain boundary-associated genomic elements
Hong, Seungpyo
2017-01-01
Abstract Topologically associated domains (TADs) are 3D genomic structures with high internal interactions that play important roles in genome compaction and gene regulation. Their genomic locations and their association with CCCTC-binding factor (CTCF)-binding sites and transcription start sites (TSSs) were recently reported. However, the relationship between TADs and other genomic elements has not been systematically evaluated. This was addressed in the present study, with a focus on the enrichment of these genomic elements and their ability to predict the TAD boundary region. We found that consensus CTCF-binding sites were strongly associated with TAD boundaries as well as with the transcription factors (TFs) Zinc finger protein (ZNF)143 and Yin Yang (YY)1. TAD boundary-associated genomic elements include DNase I-hypersensitive sites, H3K36 trimethylation, TSSs, RNA polymerase II, and TFs such as Specificity protein 1, ZNF274 and SIX homeobox 5. Computational modeling with these genomic elements suggests that they have distinct roles in TAD boundary formation. We propose a structural model of TAD boundaries based on these findings that provides a basis for studying the mechanism of chromatin structure formation and gene regulation. PMID:28977568
Uchida, Akira; Murugesapillai, Divakaran; Kastner, Markus; Wang, Yao; Lodeiro, Maria F; Prabhakar, Shaan; Oliver, Guinevere V; Arnold, Jamie J; Maher, L James; Williams, Mark C; Cameron, Craig E
2017-01-01
Human mtDNA contains three promoters, suggesting a need for differential expression of the mitochondrial genome. Studies of mitochondrial transcription have used a reductionist approach, perhaps masking differential regulation. Here we evaluate transcription from light-strand (LSP) and heavy-strand (HSP1) promoters using templates that mimic their natural context. These studies reveal sequences upstream, hypervariable in the human population (HVR3), and downstream of the HSP1 transcription start site required for maximal yield. The carboxy-terminal tail of TFAM is essential for activation of HSP1 but not LSP. Images of the template obtained by atomic force microscopy show that TFAM creates loops in a discrete region, the formation of which correlates with activation of HSP1; looping is lost in tail-deleted TFAM. Identification of HVR3 as a transcriptional regulatory element may contribute to between-individual variability in mitochondrial gene expression. The unique requirement of HSP1 for the TFAM tail may enable its regulation by post-translational modifications. DOI: http://dx.doi.org/10.7554/eLife.27283.001 PMID:28745586
RNA Polymerase II Regulates Topoisomerase 1 Activity to Favor Efficient Transcription.
Baranello, Laura; Wojtowicz, Damian; Cui, Kairong; Devaiah, Ballachanda N; Chung, Hye-Jung; Chan-Salis, Ka Yim; Guha, Rajarshi; Wilson, Kelli; Zhang, Xiaohu; Zhang, Hongliang; Piotrowski, Jason; Thomas, Craig J; Singer, Dinah S; Pugh, B Franklin; Pommier, Yves; Przytycka, Teresa M; Kouzine, Fedor; Lewis, Brian A; Zhao, Keji; Levens, David
2016-04-07
We report a mechanism through which the transcription machinery directly controls topoisomerase 1 (TOP1) activity to adjust DNA topology throughout the transcription cycle. By comparing TOP1 occupancy using chromatin immunoprecipitation sequencing (ChIP-seq) versus TOP1 activity using topoisomerase 1 sequencing (TOP1-seq), a method reported here to map catalytically engaged TOP1, TOP1 bound at promoters was discovered to become fully active only after pause-release. This transition coupled the phosphorylation of the carboxyl-terminal-domain (CTD) of RNA polymerase II (RNAPII) with stimulation of TOP1 above its basal rate, enhancing its processivity. TOP1 stimulation is strongly dependent on the kinase activity of BRD4, a protein that phosphorylates Ser2-CTD and regulates RNAPII pause-release. Thus the coordinated action of BRD4 and TOP1 overcame the torsional stress opposing transcription as RNAPII commenced elongation but preserved negative supercoiling that assists promoter melting at start sites. This nexus between transcription and DNA topology promises to elicit new strategies to intercept pathological gene expression. Copyright © 2016 Elsevier Inc. All rights reserved.
Kruesi, William S; Core, Leighton J; Waters, Colin T; Lis, John T; Meyer, Barbara J
2013-01-01
The X-chromosome gene regulatory process called dosage compensation ensures that males (1X) and females (2X) express equal levels of X-chromosome transcripts. The mechanism in Caenorhabditis elegans has been elusive due to improperly annotated transcription start sites (TSSs). Here we define TSSs and the distribution of transcriptionally engaged RNA polymerase II (Pol II) genome-wide in wild-type and dosage-compensation-defective animals to dissect this regulatory mechanism. Our TSS-mapping strategy integrates GRO-seq, which tracks nascent transcription, with a new derivative of this method, called GRO-cap, which recovers nascent RNAs with 5′ caps prior to their removal by co-transcriptional processing. Our analyses reveal that promoter-proximal pausing is rare, unlike in other metazoans, and promoters are unexpectedly far upstream from the 5′ ends of mature mRNAs. We find that C. elegans equalizes X-chromosome expression between the sexes, to a level equivalent to autosomes, by reducing Pol II recruitment to promoters of hermaphrodite X-linked genes using a chromosome-restructuring condensin complex. DOI: http://dx.doi.org/10.7554/eLife.00808.001 PMID:23795297
Intergenic disease-associated regions are abundant in novel transcripts.
Bartonicek, N; Clark, M B; Quek, X C; Torpy, J R; Pritchard, A L; Maag, J L V; Gloss, B S; Crawford, J; Taft, R J; Hayward, N K; Montgomery, G W; Mattick, J S; Mercer, T R; Dinger, M E
2017-12-28
Genotyping of large populations through genome-wide association studies (GWAS) has successfully identified many genomic variants associated with traits or disease risk. Unexpectedly, a large proportion of GWAS single nucleotide polymorphisms (SNPs) and associated haplotype blocks are in intronic and intergenic regions, hindering their functional evaluation. While some of these risk-susceptibility regions encompass cis-regulatory sites, their transcriptional potential has never been systematically explored. To detect rare tissue-specific expression, we employed the transcript-enrichment method CaptureSeq on 21 human tissues to identify 1775 multi-exonic transcripts from 561 intronic and intergenic haploblocks associated with 392 traits and diseases, covering 73.9 Mb (2.2%) of the human genome. We show that a large proportion (85%) of disease-associated haploblocks express novel multi-exonic non-coding transcripts that are tissue-specific and enriched for GWAS SNPs as well as epigenetic markers of active transcription and enhancer activity. Similarly, we captured transcriptomes from 13 melanomas, targeting nine melanoma-associated haploblocks, and characterized 31 novel melanoma-specific transcripts that include fusion proteins, novel exons and non-coding RNAs, one-third of which showed allelically imbalanced expression. This resource of previously unreported transcripts in disease-associated regions ( http://gwas-captureseq.dingerlab.org ) should provide an important starting point for the translational community in search of novel biomarkers, disease mechanisms, and drug targets.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity.
Zheng, Min; Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-08-16
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2-4 and CpG 17-18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2-4 and CpG 17-18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2-4 were correlated negatively with the percentage of neutrophils ( β = -0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity.
Association between Promoter Methylation of Gene ERCC3 and Benzene Hematotoxicity
Lin, Feiliang; Hou, Fenxia; Li, Guilan; Zhu, Caiying; Xu, Peiyu; Xing, Caihong; Wang, Qianfei
2017-01-01
Benzene is a primary industrial chemical and a ubiquitous environmental pollutant. ERCC3 is a key player in nucleotide excision repair. Recent studies suggested that site-specific methylation is a possible mechanism of the transcriptional dysregulation by blocking transcription factors binding. We previously found that the average promoter methylation level of ERCC3 was increased in benzene-exposed workers. In order to test whether specific CpG sites of ERCC3 play an important role in benzene-induced epigenetic changes and whether the specific methylation patterns are associated with benzene hematotoxicity, we analyzed the promoter methylation levels of individual CpG sites, transcription factor binding motif and the correlation between aberrant CpG methylation and hematotoxicity in 76 benzene-exposed workers and 24 unexposed controls in China. Out of all the CpGs analyzed, two CpG units located 43 bp upstream and 99 bp downstream of the transcription start site of ERCC3 (CpG 2–4 and CpG 17–18, respectively), showed the most pronounced increase in methylation levels in benzene-exposed workers, compared with unexposed controls (Mean ± SD: 5.86 ± 2.77% vs. 4.92 ± 1.53%, p = 0.032; 8.45 ± 4.09% vs. 6.79 ± 2.50%, p = 0.024, respectively). Using the JASPAR CORE Database, we found that CpG 2–4 and CpG 17–18 were bound by three putative transcription factors (TFAP2A, E2F4 and MZF1). Furthermore, the methylation levels for CpG 2–4 were correlated negatively with the percentage of neutrophils (β = −0.676, p = 0.005) in benzene-exposed workers. This study demonstrates that CpG-specific DNA methylation in the ERCC3 promoter region may be involved in benzene-induced epigenetic modification and it may contribute to benzene-induced hematotoxicity. PMID:28813025
FBI-1, a factor that binds to the HIV-1 inducer of short transcripts (IST), is a POZ domain protein.
Morrison, D J; Pendergrast, P S; Stavropoulos, P; Colmenares, S U; Kobayashi, R; Hernandez, N
1999-01-01
The HIV-1 promoter directs the synthesis of two classes of transcripts, short, non-polyadenylated transcripts and full-length, polyadenylated transcripts. The synthesis of short transcripts is activated by a bipartite DNA element, the inducer of short transcripts or IST, located downstream of the HIV-1 transcriptional start site, while the synthesis of full-length transcripts is activated by the viral activator Tat. Tat binds to the RNA element TAR, which is encoded largely between the two IST half-elements. Upon activation by Tat, the synthesis of short RNAs is repressed. We have previously purified a factor called FBI-1 (for factor that binds to IST) whose binding to wild-type and mutated ISTs correlated well with the abilities of these ISTs to direct the synthesis of short transcripts. Here, we report the cloning of cDNAs encoding FBI-1. FBI-1 contains a POZ domain at its N-terminus and four Krüppel-type zinc fingers at its C-terminus. The C-terminus is sufficient for specific binding, and FBI-1 can form homomers through its POZ domain and, in vivo, through its zinc finger domain as well. In addition, FBI-1 associates with Tat, suggesting that repression of the short transcripts by Tat may be mediated through interactions between the two factors. PMID:9973611
FBI-1, a factor that binds to the HIV-1 inducer of short transcripts (IST), is a POZ domain protein.
Morrison, D J; Pendergrast, P S; Stavropoulos, P; Colmenares, S U; Kobayashi, R; Hernandez, N
1999-03-01
The HIV-1 promoter directs the synthesis of two classes of transcripts, short, non-polyadenylated transcripts and full-length, polyadenylated transcripts. The synthesis of short transcripts is activated by a bipartite DNA element, the inducer of short transcripts or IST, located downstream of the HIV-1 transcriptional start site, while the synthesis of full-length transcripts is activated by the viral activator Tat. Tat binds to the RNA element TAR, which is encoded largely between the two IST half-elements. Upon activation by Tat, the synthesis of short RNAs is repressed. We have previously purified a factor called FBI-1 (for factor that binds to IST) whose binding to wild-type and mutated ISTs correlated well with the abilities of these ISTs to direct the synthesis of short transcripts. Here, we report the cloning of cDNAs encoding FBI-1. FBI-1 contains a POZ domain at its N-terminus and four Krüppel-type zinc fingers at its C-terminus. The C-terminus is sufficient for specific binding, and FBI-1 can form homomers through its POZ domain and, in vivo, through its zinc finger domain as well. In addition, FBI-1 associates with Tat, suggesting that repression of the short transcripts by Tat may be mediated through interactions between the two factors.
Alternate SlyA and H-NS nucleoprotein complexes control hlyE expression in Escherichia coli K-12
Lithgow, James K; Haider, Fouzia; Roberts, Ian S; Green, Jeffrey
2007-01-01
Haemolysin E is a cytolytic pore-forming toxin found in several Escherichia coli and Salmonella enterica strains. Expression of hlyE is repressed by the global regulator H-NS (histone-like nucleoid structuring protein), but can be activated by the regulator SlyA. Expression of a chromosomal hlyE–lacZ fusion in an E. coli slyA mutant was reduced to 60% of the wild-type level confirming a positive role for SlyA. DNase I footprint analysis revealed the presence of two separate SlyA binding sites, one located upstream, the other downstream of the hlyE transcriptional start site. These sites overlap AT-rich H-NS binding sites. Footprint and gel shift data showed that whereas H-NS prevented binding of RNA polymerase (RNAP) at the hlyE promoter (PhlyE), SlyA allowed binding of RNAP, but inhibited binding of H-NS. Accordingly, in vitro transcription analyses showed that addition of SlyA protein relieved H-NS-mediated repression of hlyE. Based on these observations a model for SlyA/H-NS regulation of hlyE expression is proposed in which the relative concentrations of SlyA and H-NS govern the nature of the nucleoprotein complexes formed at PhlyE. When H-NS is dominant RNAP binding is inhibited and hlyE expression is silenced; when SlyA is dominant H-NS binding is inhibited allowing RNAP access to the promoter facilitating hlyE transcription. PMID:17892462
Jelinic, Petar; Pellegrino, Jessica; David, Gregory
2011-01-01
Transcription requires the progression of RNA polymerase II (RNAP II) through a permissive chromatin structure. Recent studies of Saccharomyces cerevisiae have demonstrated that the yeast Sin3 protein contributes to the restoration of the repressed chromatin structure at actively transcribed loci. Yet, the mechanisms underlying the restoration of the repressive chromatin structure at transcribed loci and its significance in gene expression have not been investigated in mammals. We report here the identification of a mammalian complex containing the corepressor Sin3B, the histone deacetylase HDAC1, Mrg15, and the PHD finger-containing Pf1 and show that this complex plays important roles in regulation of transcription. We demonstrate that this complex localizes at discrete loci approximately 1 kb downstream of the transcription start site of transcribed genes, and this localization requires both Pf1's and Mrg15's interaction with chromatin. Inactivation of this mammalian complex promotes increased RNAP II progression within transcribed regions and subsequent increased transcription. Our results define a novel mammalian complex that contributes to the regulation of transcription and point to divergent uses of the Sin3 protein homologues throughout evolution in the modulation of transcription. PMID:21041482
Systematic analysis of transcription start sites in avian development.
Lizio, Marina; Deviatiiarov, Ruslan; Nagai, Hiroki; Galan, Laura; Arner, Erik; Itoh, Masayoshi; Lassmann, Timo; Kasukawa, Takeya; Hasegawa, Akira; Ros, Marian A; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R R; Kawaji, Hideya; Gusev, Oleg; Sheng, Guojun
2017-09-01
Cap Analysis of Gene Expression (CAGE) in combination with single-molecule sequencing technology allows precision mapping of transcription start sites (TSSs) and genome-wide capture of promoter activities in differentiated and steady state cell populations. Much less is known about whether TSS profiling can characterize diverse and non-steady state cell populations, such as the approximately 400 transitory and heterogeneous cell types that arise during ontogeny of vertebrate animals. To gain such insight, we used the chick model and performed CAGE-based TSS analysis on embryonic samples covering the full 3-week developmental period. In total, 31,863 robust TSS peaks (>1 tag per million [TPM]) were mapped to the latest chicken genome assembly, of which 34% to 46% were active in any given developmental stage. ZENBU, a web-based, open-source platform, was used for interactive data exploration. TSSs of genes critical for lineage differentiation could be precisely mapped and their activities tracked throughout development, suggesting that non-steady state and heterogeneous cell populations are amenable to CAGE-based transcriptional analysis. Our study also uncovered a large set of extremely stable housekeeping TSSs and many novel stage-specific ones. We furthermore demonstrated that TSS mapping could expedite motif-based promoter analysis for regulatory modules associated with stage-specific and housekeeping genes. Finally, using Brachyury as an example, we provide evidence that precise TSS mapping in combination with Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-on technology enables us, for the first time, to efficiently target endogenous avian genes for transcriptional activation. Taken together, our results represent the first report of genome-wide TSS mapping in birds and the first systematic developmental TSS analysis in any amniote species (birds and mammals). By facilitating promoter-based molecular analysis and genetic manipulation, our work also underscores the value of avian models in unravelling the complex regulatory mechanism of cell lineage specification during amniote development.
Characterization of a Maize Wip1 Promoter in Transgenic Plants
Zhang, Shengxue; Lian, Yun; Liu, Yan; Wang, Xiaoqing; Liu, Yunjun; Wang, Guoying
2013-01-01
The Maize Wip1 gene encodes a wound-induced Bowman-Birk inhibitor (BBI) protein which is a type of serine protease inhibitor, and its expression is induced by wounding or infection, conferring resistance against pathogens and pests. In this study, the maize Wip1 promoter was isolated and its function was analyzed. Different truncated Wip1 promoters were fused upstream of the GUS reporter gene and transformed into Arabidopsis, tobacco and rice plants. We found that (1) several truncated maize Wip1 promoters led to strong GUS activities in both transgenic Arabidopsis and tobacco leaves, whereas low GUS activity was detected in transgenic rice leaves; (2) the Wip1 promoter was not wound-induced in transgenic tobacco leaves, but was induced by wounding in transgenic rice leaves; (3) the truncated Wip1 promoter had different activity in different organs of transgenic tobacco plants; (4) the transgenic plant leaves containing different truncated Wip1 promoters had low GUS transcripts, even though high GUS protein level and GUS activities were observed; (5) there was one transcription start site of Wip1 gene in maize and two transcription start sites of GUS in Wip1::GUS transgenic lines; (6) the adjacent 35S promoter which is present in the transformation vectors enhanced the activity of the truncated Wip1 promoters in transgenic tobacco leaves, but did not influence the disability of truncated Wip1231 promoter to respond to wounding signals. We speculate that an ACAAAA hexamer, several CAA trimers and several elements similar to ACAATTAC octamer in the 5′-untranslated region might contribute to the strong GUS activity in Wip1231 transgenic lines, meanwhile, compared to the 5′-untranslated region from Wip1231 transgenic lines, the additional upstream open reading frames (uORFs) in the 5′-untranslated region from Wip1737 transgenic lines might contribute to the lower level of GUS transcript and GUS activity. PMID:24322445
Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin
2017-04-01
Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de
1994-04-01
The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less
Fougeroux, André; Petit, Fabien; Anselmo, Anna; Gorni, Chiara; Cucurachi, Marco; Cersini, Antonella; Granato, Anna; Cardeti, Giusy; Formato, Giovanni; Mutinelli, Franco; Giuffra, Elisabetta; Williams, John L.; Botti, Sara
2017-01-01
Honeybees (Apis mellifera) are constantly subjected to many biotic stressors including parasites. This study examined honeybees infected with Nosema ceranae (N. ceranae). N. ceranae infection increases the bees energy requirements and may contribute to their decreased survival. RNA-seq was used to investigate gene expression at days 5, 10 and 15 Post Infection (P.I) with N. ceranae. The expression levels of genes, isoforms, alternative transcription start sites (TSS) and differential promoter usage revealed a complex pattern of transcriptional and post-transcriptional gene regulation suggesting that bees use a range of tactics to cope with the stress of N. ceranae infection. N. ceranae infection may cause reduced immune function in the bees by: (i)disturbing the host amino acids metabolism (ii) down-regulating expression of antimicrobial peptides (iii) down-regulation of cuticle coatings and (iv) down-regulation of odorant binding proteins. PMID:28350872
Analysis of tissue-specific region in sericin 1 gene promoter of Bombyx mori
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Yan; Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031; Yu Lian
The gene encoding sericin 1 (Ser1) of silkworm (Bombyx mori) is specifically expressed in the middle silk gland cells. To identify element involved in this transcription-dependent spatial restriction, truncation of the 5' terminal from the sericin 1 (Ser1) promoter is studied in vivo. A 209 bp DNA sequence upstream of the transcriptional start site (-586 to -378) is found to be responsible for promoting tissue-specific transcription. Analysis of this 209 bp region by overlapping deletion studies showed that a 25 bp region (-500 to -476) suppresses the ectopic expression of the Ser1 promoter. An unknown factor abundant in fat bodymore » nuclear extracts is shown to bind to this 25 bp fragment. These results suggest that this 25 bp region and the unknown factor are necessary for determining the tissue-specificity of the Ser1 promoter.« less
Engineered TAL Effector modulators for the large-scale gain-of-function screening
Zhang, Hanshuo; Li, Juan; Hou, Sha; Wang, Gancheng; Jiang, Mingjun; Sun, Changhong; Hu, Xiongbing; Zhuang, Fengfeng; Dai, Zhifei; Dai, Junbiao; Xi, Jianzhong Jeff
2014-01-01
Recent effective use of TAL Effectors (TALEs) has provided an important approach to the design and synthesis of sequence-specific DNA-binding proteins. However, it is still a challenging task to design and manufacture effective TALE modulators because of the limited knowledge of TALE–DNA interactions. Here we synthesized more than 200 TALE modulators and identified two determining factors of transcription activity in vivo: chromatin accessibility and the distance from the transcription start site. The implementation of these modulators in a gain-of-function screen was successfully demonstrated for four cell lines in migration/invasion assays and thus has broad relevance in this field. Furthermore, a novel TALE–TALE modulator was developed to transcriptionally inhibit target genes. Together, these findings underscore the huge potential of these TALE modulators in the study of gene function, reprogramming of cellular behaviors, and even clinical investigation. PMID:24939900
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smirnova, Anna S.; Morgun, Andrey; Shulzhenko, Natalia
Two transcript variants (TV) of the T cell immune regulator gene 1 (TCIRG1) have already been characterized. TV1 encodes a subunit of the osteoclast vacuolar proton pump and TV2 encodes a T cell inhibitory receptor. Based on the search in dbEST, we validated by RT-PCR six new alternative splice events in TCIRG1 in most of the 28 human tissues studied. In addition, we observed that transcripts using the TV1 transcription start site and two splice forms previously described in a patient with infantile malignant osteopetrosis are also expressed in various tissues of healthy individuals. Studies of these nine splice formsmore » in cytoplasmic RNA of peripheral blood mononuclear cells showed that at least six of them could be efficiently exported from the nucleus. Since various products with nearly ubiquitous tissue distribution are generated from TCIRG1, this gene may be involved in other processes besides immune response and bone resorption.« less
Araki, Ryota; Nishida, Shoji; Hiraki, Yosuke; Matsumoto, Kinzo; Yabe, Takeshi
2015-10-08
The levels of allopregnanolone (ALLO), a neurosteroid, in brain and serum are related to severity of depression and anxiety. Steroid 5α-reductase type I is the rate-limiting enzyme in ALLO biosynthesis and plays an important role in control of the ALLO level in mammalian brain. In this study, we examined an epigenetic mechanism for transcriptional regulation of srd5a1, which codes for steroid 5α-reductase type I, using isolation-reared mice. The mRNA level of srd5a1 was decreased in the prefrontal cortex (PFC) in isolation-reared mice. Rearing in social isolation increased methylation of cytosines at -82 and -12 bp downstream of the transcription start site, which are located in a GC box element in the promoter region of srd5a1. Binding of Sp1, a ubiquitous transcription factor, to the GC box was decreased in the promoter region of srd5a1 in the PFC in isolation-reared mice. Site-specific methylation at cytosine -12 of a srd5a1 promoter-luciferase reporter construct, but not that of cytosine -82, downregulated the promoter activity of srd5a1. These findings suggest that transcription of srd5a1 in brain is regulated by environmental factor-induced cytosine methylation in the promoter region. This finding could contribute to development of antidepressant and anxiolytic agents. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
CAGEd-oPOSSUM: motif enrichment analysis from CAGE-derived TSSs.
Arenillas, David J; Forrest, Alistair R R; Kawaji, Hideya; Lassmann, Timo; Wasserman, Wyeth W; Mathelier, Anthony
2016-09-15
With the emergence of large-scale Cap Analysis of Gene Expression (CAGE) datasets from individual labs and the FANTOM consortium, one can now analyze the cis-regulatory regions associated with gene transcription at an unprecedented level of refinement. By coupling transcription factor binding site (TFBS) enrichment analysis with CAGE-derived genomic regions, CAGEd-oPOSSUM can identify TFs that act as key regulators of genes involved in specific mammalian cell and tissue types. The webtool allows for the analysis of CAGE-derived transcription start sites (TSSs) either provided by the user or selected from ∼1300 mammalian samples from the FANTOM5 project with pre-computed TFBS predicted with JASPAR TF binding profiles. The tool helps power insights into the regulation of genes through the study of the specific usage of TSSs within specific cell types and/or under specific conditions. The CAGEd-oPOSUM web tool is implemented in Perl, MySQL and Apache and is available at http://cagedop.cmmt.ubc.ca/CAGEd_oPOSSUM CONTACTS: anthony.mathelier@ncmm.uio.no or wyeth@cmmt.ubc.ca Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.
CAGEd-oPOSSUM: motif enrichment analysis from CAGE-derived TSSs
Arenillas, David J.; Forrest, Alistair R. R.; Kawaji, Hideya; Lassmann, Timo; Wasserman, Wyeth W.; Mathelier, Anthony
2016-01-01
With the emergence of large-scale Cap Analysis of Gene Expression (CAGE) datasets from individual labs and the FANTOM consortium, one can now analyze the cis-regulatory regions associated with gene transcription at an unprecedented level of refinement. By coupling transcription factor binding site (TFBS) enrichment analysis with CAGE-derived genomic regions, CAGEd-oPOSSUM can identify TFs that act as key regulators of genes involved in specific mammalian cell and tissue types. The webtool allows for the analysis of CAGE-derived transcription start sites (TSSs) either provided by the user or selected from ∼1300 mammalian samples from the FANTOM5 project with pre-computed TFBS predicted with JASPAR TF binding profiles. The tool helps power insights into the regulation of genes through the study of the specific usage of TSSs within specific cell types and/or under specific conditions. Availability and Implementation: The CAGEd-oPOSUM web tool is implemented in Perl, MySQL and Apache and is available at http://cagedop.cmmt.ubc.ca/CAGEd_oPOSSUM. Contacts: anthony.mathelier@ncmm.uio.no or wyeth@cmmt.ubc.ca Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27334471
Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya A; Mergny, Jean-Louis; Salgado, Gilmar F
2017-05-12
Non-canonical base pairing within guanine-rich DNA and RNA sequences can produce G-quartets, whose stacking leads to the formation of a G-quadruplex (G4). G4s can coexist with canonical duplex DNA in the human genome and have been suggested to suppress gene transcription, and much attention has therefore focused on studying G4s in promotor regions of disease-related genes. For example, the human KRAS proto-oncogene contains a nuclease-hypersensitive element located upstream of the major transcription start site. The KRAS nuclease-hypersensitive element (NHE) region contains a G-rich element (22RT; 5'-AGGGCGGTGTGGGAATAGGGAA-3') and encompasses a Myc-associated zinc finger-binding site that regulates KRAS transcription. The NEH region therefore has been proposed as a target for new drugs that control KRAS transcription, which requires detailed knowledge of the NHE structure. In this study, we report a high-resolution NMR structure of the G-rich element within the KRAS NHE. We found that the G-rich element forms a parallel structure with three G-quartets connected by a four-nucleotide loop and two short one-nucleotide double-chain reversal loops. In addition, a thymine bulge is found between G8 and G9. The loops of different lengths and the presence of a bulge between the G-quartets are structural elements that potentially can be targeted by small chemical ligands that would further stabilize the structure and interfere or block transcriptional regulators such as Myc-associated zinc finger from accessing their binding sites on the KRAS promoter. In conclusion, our work suggests a possible new route for the development of anticancer agents that could suppress KRAS expression. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
2013-01-01
Background METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. Methods We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Results Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Conclusion Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites. PMID:23937714
Cadet, Jean Lud; Jayanthi, Subramaniam; McCoy, Michael T; Ladenheim, Bruce; Saint-Preux, Fabienne; Lehrmann, Elin; De, Supriyo; Becker, Kevin G; Brannock, Christie
2013-08-12
METH is an illicit drug of abuse that influences gene expression in the rat striatum. Histone modifications regulate gene transcription. We therefore used microarray analysis and genome-scale approaches to examine potential relationships between the effects of METH on gene expression and on DNA binding of histone H4 acetylated at lysine 4 (H4K5Ac) in the rat dorsal striatum of METH-naïve and METH-pretreated rats. Acute and chronic METH administration caused differential changes in striatal gene expression. METH also increased H4K5Ac binding around the transcriptional start sites (TSSs) of genes in the rat striatum. In order to relate gene expression to histone acetylation, we binned genes of similar expression into groups of 100 genes and proceeded to relate gene expression to H4K5Ac binding. We found a positive correlation between gene expression and H4K5Ac binding in the striatum of control rats. Similar correlations were observed in METH-treated rats. Genes that showed acute METH-induced increased expression in saline-pretreated rats also showed METH-induced increased H4K5Ac binding. The acute METH injection caused similar increases in H4K5Ac binding in METH-pretreated rats, without affecting gene expression to the same degree. Finally, genes that showed METH-induced decreased expression exhibited either decreases or no changes in H4K5Ac binding. Acute METH injections caused increased gene expression of genes that showed increased H4K5Ac binding near their transcription start sites.
Exceptionally long 5' UTR short tandem repeats specifically linked to primates.
Namdar-Aligoodarzi, P; Mohammadparast, S; Zaker-Kandjani, B; Talebi Kakroodi, S; Jafari Vesiehsari, M; Ohadi, M
2015-09-10
We have previously reported genome-scale short tandem repeats (STRs) in the core promoter interval (i.e. -120 to +1 to the transcription start site) of protein-coding genes that have evolved identically in primates vs. non-primates. Those STRs may function as evolutionary switch codes for primate speciation. In the current study, we used the Ensembl database to analyze the 5' untranslated region (5' UTR) between +1 and +60 of the transcription start site of the entire human protein-coding genes annotated in the GeneCards database, in order to identify "exceptionally long" STRs (≥5-repeats), which may be of selective/adaptive advantage. The importance of this critical interval is its function as core promoter, and its effect on transcription and translation. In order to minimize ascertainment bias, we analyzed the evolutionary status of the human 5' UTR STRs of ≥5-repeats in several species encompassing six major orders and superorders across mammals, including primates, rodents, Scandentia, Laurasiatheria, Afrotheria, and Xenarthra. We introduce primate-specific STRs, and STRs which have expanded from mouse to primates. Identical co-occurrence of the identified STRs of rare average frequency between 0.006 and 0.0001 in primates supports a role for those motifs in processes that diverged primates from other mammals, such as neuronal differentiation (e.g. APOD and FGF4), and craniofacial development (e.g. FILIP1L). A number of the identified STRs of ≥5-repeats may be human-specific (e.g. ZMYM3 and DAZAP1). Future work is warranted to examine the importance of the listed genes in primate/human evolution, development, and disease. Copyright © 2015 Elsevier B.V. All rights reserved.
Effects of the adenovirus 2 late promoter on simian virus 40 transcription and replication.
Grass, D S; Manley, J L
1986-01-01
A 100-base-pair fragment of adenovirus 2 (Ad2) DNA encompassing the major late transcriptional promoter was inserted into the simian virus 40 (SV40) late promoter region at SV40 nucleotide 294 to study the effects of a strong TATA box-containing promoter on SV40 late transcription. pSVAdE contains the insert in an orientation such that it would promote transcription towards the origin and early region of SV40, while the insert is in the opposite orientation in pSVAdL. Nuclease S1 analysis with 5'-end-labeled probes showed that in cells transfected with pSVAdE, the late mRNA initiation sites are essentially the same as in wild type, demonstrating that an insert of 100 base pairs can have no effect on utilization of the SV40 late start sites. In pSVAdL-transfected cells, however, the major late viral initiation site is now in the insert at +1 with respect to the Ad2 major late cap site. However, all of the SV40 initiation sites are still utilized and with the same efficiency relative to each other as in wild type. Thus, it appears that the Ad2 late promoter and the SV40 late promoter can function independently on the same DNA molecule, even when one promoter is embedded within the other. By using cytosine arabinoside to block DNA replication and thereby inhibit the onset of late expression, it has been shown that both the Ad2 late promoter and the SV40 late promoter have similar requirement for DNA replication in this context. In addition, pSVAdL showed dramatically diminished virus viability and VPI expression compared with both wildtype and pSVAdE. Possible explanations for this unexpected finding are discussed. Images PMID:3001338
Molecular Targeting of Prostate Cancer During Androgen Ablation: Inhibition of CHES1/FOXN3
2013-05-01
the DNA sequences (~25^6 reads/sample) were mapped to the human genome reference sequence (hg19...tumor the AR has a genomic abnormality, placing the novel sequence 3’ of the transcriptional start site. However, it is unclear if a genomic alteration...exon/intron organization of the CHES1 gene was determined by BLAST analysis of the human genome using the 1,473-bp CHES1 cDNA sequence
H3K4me3 breadth is linked to cell identity and transcriptional consistency.
Benayoun, Bérénice A; Pollina, Elizabeth A; Ucar, Duygu; Mahmoudi, Salah; Karra, Kalpana; Wong, Edith D; Devarajan, Keerthana; Daugherty, Aaron C; Kundaje, Anshul B; Mancini, Elena; Hitz, Benjamin C; Gupta, Rakhi; Rando, Thomas A; Baker, Julie C; Snyder, Michael P; Cherry, J Michael; Brunet, Anne
2014-07-31
Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to mark the transcription start sites of active genes. Here, we show that H3K4me3 domains that spread more broadly over genes in a given cell type preferentially mark genes that are essential for the identity and function of that cell type. Using the broadest H3K4me3 domains as a discovery tool in neural progenitor cells, we identify novel regulators of these cells. Machine learning models reveal that the broadest H3K4me3 domains represent a distinct entity, characterized by increased marks of elongation. The broadest H3K4me3 domains also have more paused polymerase at their promoters, suggesting a unique transcriptional output. Indeed, genes marked by the broadest H3K4me3 domains exhibit enhanced transcriptional consistency and [corrected] increased transcriptional levels, and perturbation of H3K4me3 breadth leads to changes in transcriptional consistency. Thus, H3K4me3 breadth contains information that could ensure transcriptional precision at key cell identity/function genes. Copyright © 2014 Elsevier Inc. All rights reserved.
Mechanism and manipulation of DNA:RNA hybrid G-quadruplex formation in transcription of G-rich DNA.
Zhang, Jia-yu; Zheng, Ke-wei; Xiao, Shan; Hao, Yu-hua; Tan, Zheng
2014-01-29
We recently reported that a DNA:RNA hybrid G-quadruplex (HQ) forms during transcription of DNA that bears two or more tandem guanine tracts (G-tract) on the nontemplate strand. Putative HQ-forming sequences are enriched in the nearby 1000 nt region right downstream of transcription start sites in the nontemplate strand of warm-blooded animals, and HQ regulates transcription under both in vitro and in vivo conditions. Therefore, knowledge of the mechanism of HQ formation is important for understanding the biological function of HQ as well as for manipulating gene expression by targeting HQ. In this work, we studied the mechanism of HQ formation using an in vitro T7 transcription model. We show that RNA synthesis initially produces an R-loop, a DNA:RNA heteroduplex formed by a nascent RNA transcript and the template DNA strand. In the following round of transcription, the RNA in the R-loop is displaced, releasing the RNA in single-stranded form (ssRNA). Then the G-tracts in the RNA can jointly form HQ with those in the nontemplate DNA strand. We demonstrate that the structural cascade R-loop → ssRNA → HQ offers opportunities to intercept HQ formation, which may provide a potential method to manipulate gene expression.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Thomas, Maren; Lange-Grünweller, Kerstin; Hartmann, Dorothee; Golde, Lara; Schlereth, Julia; Streng, Dennis; Aigner, Achim; Grünweller, Arnold; Hartmann, Roland K.
2013-01-01
The human polycistronic miRNA cluster miR-17-92 is frequently overexpressed in hematopoietic malignancies and cancers. Its transcription is in part controlled by an E2F-regulated host gene promoter. An intronic A/T-rich region directly upstream of the miRNA coding region also contributes to cluster expression. Our deletion analysis of the A/T-rich region revealed a strong dependence on c-Myc binding to the functional E3 site. Yet, constructs lacking the 5′-proximal ~1.3 kb or 3′-distal ~0.1 kb of the 1.5 kb A/T-rich region still retained residual specific promoter activity, suggesting multiple transcription start sites (TSS) in this region. Furthermore, the protooncogenic kinase, Pim-1, its phosphorylation target HP1γ and c-Myc colocalize to the E3 region, as inferred from chromatin immunoprecipitation. Analysis of pri-miR-17-92 expression levels in K562 and HeLa cells revealed that silencing of E2F3, c-Myc or Pim-1 negatively affects cluster expression, with a synergistic effect caused by c-Myc/Pim-1 double knockdown in HeLa cells. Thus, we show, for the first time, that the protooncogene Pim-1 is part of the network that regulates transcription of the human miR-17-92 cluster. PMID:23749113
Wu, Kaifeng; Xu, Hongmei; Zheng, Yuqiang; Wang, Libin; Zhang, Xuemei; Yin, Yibing
2016-07-08
Transcriptional regulation of capsule expression is critical for pneumococcal transition from carriage to infection, yet the underlying mechanism remains incompletely understood. Here, we describe the regulation of capsular polysaccharide, one of the most important pneumococcal virulence factor by a GntR family regulator, CpsR. Electrophoretic mobility-shift assays have shown the direct interaction between CpsR and the cps promoter (cpsp), and their interaction could be competitively interfered by glucose. DNase I footprinting assays localized the binding site to a region -146 to -114 base pairs relative to the transcriptional start site of the cps locus in S. pneumoniae D39. We found that CpsR negatively controlled the transcription of the cps locus and hence CPS production, which was confirmed by fine-tuning expression of CpsR in a ΔcpsR complemented strain. Increased expression of CpsR in complemented strain led to a decreased resistance to the whole-blood-mediated killing, suggesting a protective role for CpsR-cpsp interaction in the establishment of invasive infection. Finally, animal experiments showed that CpsR-cpsp interaction was necessary for both pneumococcal colonization and invasive infection. Taken together, our results provide a thorough insight into the regulation of capsule production mediated by CpsR and its important roles in pneumococcal pathogenesis.
Lobel, Lior; Sigal, Nadejda; Borovok, Ilya; Belitsky, Boris R.; Sonenshein, Abraham L.; Herskovits, Anat A.
2015-01-01
Summary Metabolic adaptations are critical to the ability of bacterial pathogens to grow within host cells and are normally preceded by sensing of host-specific metabolic signals, which in turn can influence the pathogen's virulence state. Previously, we reported that the intracellular bacterial pathogen Listeria monocytogenes responds to low availability of branched-chain amino acids (BCAA) within mammalian cells by up-regulating both BCAA biosynthesis and virulence genes. The induction of virulence genes required the BCAA-responsive transcription regulator, CodY, but the molecular mechanism governing this mode of regulation was unclear. In this report, we demonstrate that CodY directly binds the coding sequence of the L. monocytogenes master virulence activator gene, prfA, 15 nt downstream of its start codon, and that this binding results in up-regulation of prfA transcription specifically under low concentrations of BCAA. Mutating this site abolished CodY binding and reduced prfA transcription in macrophages, and attenuated bacterial virulence in mice. Notably, the mutated binding site did not alter prfA transcription or PrfA activity under other conditions that are known to activate PrfA, such as during growth in the presence of glucose-1-phosphate. This study highlights the tight crosstalk between L. monocytogenes metabolism and virulence' while revealing novel features of CodY-mediated regulation. PMID:25430920
High-throughput detection of RNA processing in bacteria.
Gill, Erin E; Chan, Luisa S; Winsor, Geoffrey L; Dobson, Neil; Lo, Raymond; Ho Sui, Shannan J; Dhillon, Bhavjinder K; Taylor, Patrick K; Shrestha, Raunak; Spencer, Cory; Hancock, Robert E W; Unrau, Peter J; Brinkman, Fiona S L
2018-03-27
Understanding the RNA processing of an organism's transcriptome is an essential but challenging step in understanding its biology. Here we investigate with unprecedented detail the transcriptome of Pseudomonas aeruginosa PAO1, a medically important and innately multi-drug resistant bacterium. We systematically mapped RNA cleavage and dephosphorylation sites that result in 5'-monophosphate terminated RNA (pRNA) using monophosphate RNA-Seq (pRNA-Seq). Transcriptional start sites (TSS) were also mapped using differential RNA-Seq (dRNA-Seq) and both datasets were compared to conventional RNA-Seq performed in a variety of growth conditions. The pRNA-Seq library revealed known tRNA, rRNA and transfer-messenger RNA (tmRNA) processing sites, together with previously uncharacterized RNA cleavage events that were found disproportionately near the 5' ends of transcripts associated with basic bacterial functions such as oxidative phosphorylation and purine metabolism. The majority (97%) of the processed mRNAs were cleaved at precise codon positions within defined sequence motifs indicative of distinct endonucleolytic activities. The most abundant of these motifs corresponded closely to an E. coli RNase E site previously established in vitro. Using the dRNA-Seq library, we performed an operon analysis and predicted 3159 potential TSS. A correlation analysis uncovered 105 antiparallel pairs of TSS that were separated by 18 bp from each other and were centered on single palindromic TAT(A/T)ATA motifs (likely - 10 promoter elements), suggesting that, consistent with previous in vitro experimentation, these sites can initiate transcription bi-directionally and may thus provide a novel form of transcriptional regulation. TSS and RNA-Seq analysis allowed us to confirm expression of small non-coding RNAs (ncRNAs), many of which are differentially expressed in swarming and biofilm formation conditions. This study uses pRNA-Seq, a method that provides a genome-wide survey of RNA processing, to study the bacterium Pseudomonas aeruginosa and discover extensive transcript processing not previously appreciated. We have also gained novel insight into RNA maturation and turnover as well as a potential novel form of transcription regulation. NOTE: All sequence data has been submitted to the NCBI sequence read archive. Accession numbers are as follows: [NCBI sequence read archive: SRX156386, SRX157659, SRX157660, SRX157661, SRX157683 and SRX158075]. The sequence data is viewable using Jbrowse on www.pseudomonas.com .
Promoter classifier: software package for promoter database analysis.
Gershenzon, Naum I; Ioshikhes, Ilya P
2005-01-01
Promoter Classifier is a package of seven stand-alone Windows-based C++ programs allowing the following basic manipulations with a set of promoter sequences: (i) calculation of positional distributions of nucleotides averaged over all promoters of the dataset; (ii) calculation of the averaged occurrence frequencies of the transcription factor binding sites and their combinations; (iii) division of the dataset into subsets of sequences containing or lacking certain promoter elements or combinations; (iv) extraction of the promoter subsets containing or lacking CpG islands around the transcription start site; and (v) calculation of spatial distributions of the promoter DNA stacking energy and bending stiffness. All programs have a user-friendly interface and provide the results in a convenient graphical form. The Promoter Classifier package is an effective tool for various basic manipulations with eukaryotic promoter sequences that usually are necessary for analysis of large promoter datasets. The program Promoter Divider is described in more detail as a representative component of the package.
Akashi, A; Yoshida, Y; Nakagoshi, H; Kuroki, K; Hashimoto, T; Tagawa, K; Imamoto, F
1988-10-01
Stabilizing factor, a 9 kDa protein, stabilizes and facilitates formation of the complex between mitochondrial ATP synthase and its intrinsic inhibitor protein. A clone containing the gene encoding the 9 kDa protein was selected from a yeast genomic library to determine the structure of its precursor protein. As deduced from the nucleotide sequence, the precursor of the yeast 9 kDa stabilizing factor contains 86 amino acid residues and has a molecular weight of 10,062. From the predicted sequence we infer that the stabilizing factor precursor contains a presequence of 23 amino acid residues at its amino terminus. We also used S1 mapping to determine the initiation site of transcription under glucose-repressed or derepressed conditions. These experiments suggest that transcription of this gene starts at three different sites and that only one of them is not affected by the presence of glucose.
Dayeh, Tasnim; Volkov, Petr; Salö, Sofia; Hall, Elin; Nilsson, Emma; Olsson, Anders H.; Kirkpatrick, Clare L.; Wollheim, Claes B.; Eliasson, Lena; Rönn, Tina; Bacos, Karl; Ling, Charlotte
2014-01-01
Impaired insulin secretion is a hallmark of type 2 diabetes (T2D). Epigenetics may affect disease susceptibility. To describe the human methylome in pancreatic islets and determine the epigenetic basis of T2D, we analyzed DNA methylation of 479,927 CpG sites and the transcriptome in pancreatic islets from T2D and non-diabetic donors. We provide a detailed map of the global DNA methylation pattern in human islets, β- and α-cells. Genomic regions close to the transcription start site showed low degrees of methylation and regions further away from the transcription start site such as the gene body, 3′UTR and intergenic regions showed a higher degree of methylation. While CpG islands were hypomethylated, the surrounding 2 kb shores showed an intermediate degree of methylation, whereas regions further away (shelves and open sea) were hypermethylated in human islets, β- and α-cells. We identified 1,649 CpG sites and 853 genes, including TCF7L2, FTO and KCNQ1, with differential DNA methylation in T2D islets after correction for multiple testing. The majority of the differentially methylated CpG sites had an intermediate degree of methylation and were underrepresented in CpG islands (∼7%) and overrepresented in the open sea (∼60%). 102 of the differentially methylated genes, including CDKN1A, PDE7B, SEPT9 and EXOC3L2, were differentially expressed in T2D islets. Methylation of CDKN1A and PDE7B promoters in vitro suppressed their transcriptional activity. Functional analyses demonstrated that identified candidate genes affect pancreatic β- and α-cells as Exoc3l silencing reduced exocytosis and overexpression of Cdkn1a, Pde7b and Sept9 perturbed insulin and glucagon secretion in clonal β- and α-cells, respectively. Together, our data can serve as a reference methylome in human islets. We provide new target genes with altered DNA methylation and expression in human T2D islets that contribute to perturbed insulin and glucagon secretion. These results highlight the importance of epigenetics in the pathogenesis of T2D. PMID:24603685
The full transcription map of mouse papillomavirus type 1 (MmuPV1) in mouse wart tissues
Kim, Bong-Hyun; Gotte, Deanna; Chen, Xiongfong; Cam, Maggie; Lambert, Paul F.
2017-01-01
Mouse papillomavirus type 1 (MmuPV1) provides, for the first time, the opportunity to study infection and pathogenesis of papillomaviruses in the context of laboratory mice. In this report, we define the transcriptome of MmuPV1 genome present in papillomas arising in experimentally infected mice using a combination of RNA-seq, PacBio Iso-seq, 5’ RACE, 3’ RACE, primer-walking RT-PCR, RNase protection, Northern blot and in situ hybridization analyses. We demonstrate that the MmuPV1 genome is transcribed unidirectionally from five major promoters (P) or transcription start sites (TSS) and polyadenylates its transcripts at two major polyadenylation (pA) sites. We designate the P7503, P360 and P859 as “early” promoters because they give rise to transcripts mostly utilizing the polyadenylation signal at nt 3844 and therefore can only encode early genes, and P7107 and P533 as “late” promoters because they give rise to transcripts utilizing polyadenylation signals at either nt 3844 or nt 7047, the latter being able to encode late, capsid proteins. MmuPV1 genome contains five splice donor sites and three acceptor sites that produce thirty-six RNA isoforms deduced to express seven predicted early gene products (E6, E7, E1, E1^M1, E1^M2, E2 and E8^E2) and three predicted late gene products (E1^E4, L2 and L1). The majority of the viral early transcripts are spliced once from nt 757 to 3139, while viral late transcripts, which are predicted to encode L1, are spliced twice, first from nt 7243 to either nt 3139 (P7107) or nt 757 to 3139 (P533) and second from nt 3431 to nt 5372. Thirteen of these viral transcripts were detectable by Northern blot analysis, with the P533-derived late E1^E4 transcripts being the most abundant. The late transcripts could be detected in highly differentiated keratinocytes of MmuPV1-infected tissues as early as ten days after MmuPV1 inoculation and correlated with detection of L1 protein and viral DNA amplification. In mature warts, detection of L1 was also found in more poorly differentiated cells, as previously reported. Subclinical infections were also observed. The comprehensive transcription map of MmuPV1 generated in this study provides further evidence that MmuPV1 is similar to high-risk cutaneous beta human papillomaviruses. The knowledge revealed will facilitate the use of MmuPV1 as an animal virus model for understanding of human papillomavirus gene expression, pathogenesis and immunology. PMID:29176795
Expression of a non-coding RNA in ectromelia virus is required for normal plaque formation.
Esteban, David J; Upton, Chris; Bartow-McKenney, Casey; Buller, R Mark L; Chen, Nanhai G; Schriewer, Jill; Lefkowitz, Elliot J; Wang, Chunlin
2014-02-01
Poxviruses are dsDNA viruses with large genomes. Many genes in the genome remain uncharacterized, and recent studies have demonstrated that the poxvirus transcriptome includes numerous so-called anomalous transcripts not associated with open reading frames. Here, we characterize the expression and role of an apparently non-coding RNA in orthopoxviruses, which we call viral hairpin RNA (vhRNA). Using a bioinformatics approach, we predicted expression of a transcript not associated with an open reading frame that is likely to form a stem-loop structure due to the presence of a 21 nt palindromic sequence. Expression of the transcript as early as 2 h post-infection was confirmed by northern blot and analysis of publicly available vaccinia virus infected cell transcriptomes. The transcription start site was determined by RACE PCE and transcriptome analysis, and early and late promoter sequences were identified. Finally, to test the function of the transcript we generated an ectromelia virus knockout, which failed to form plaques in cell culture. The important role of the transcript in viral replication was further demonstrated using siRNA. Although the function of the transcript remains unknown, our work contributes to evidence of an increasingly complex poxvirus transcriptome, suggesting that transcripts such as vhRNA not associated with an annotated open reading frame can play an important role in viral replication.
Landini, P; Bown, J A; Volkert, M R; Busby, S J
1998-05-22
The methylated form of the Ada protein (meAda) binds the ada and aidB promoters between 60 and 40 base pairs upstream from the transcription start and activates transcription of the Escherichia coli ada and aidB genes. This region is also a binding site for the alpha subunit of RNA polymerase and resembles the rrnB P1 UP element in A/T content and location relative to the core promoter. In this report, we show that deletion of the C-terminal domain of the alpha subunit severely decreases meAda-independent binding of RNA polymerase to ada and aidB, affecting transcription initiation at these promoters. We provide evidence that meAda activates transcription by direct interaction with the C-terminal domain of RNA polymerase sigma70 subunit (amino acids 574-613). Several negatively charged residues in the sigma70 C-terminal domain are important for transcription activation by meAda; in particular, a glutamic acid to valine substitution at position 575 has a dramatic effect on meAda-dependent transcription. Based on these observations, we propose that the role of the alpha subunit at ada and aidB is to allow initial binding of RNA polymerase to the promoters. However, transcription initiation is dependent on meAda-sigma70 interaction.
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D; Castle, John C; Raymond, Christopher K; Lappala, Colin R; Schaefer, Amy L; Harwood, Caroline S; Greenberg, E Peter
2011-05-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His(6)-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon.
Warren, Curtis R.; Grindel, Brian J.; Francis, Lewis; Carson, Daniel D.; Farach-Carson, Mary C.
2014-01-01
Perlecan/HSPG2, a heparan sulfate proteoglycan typically found at tissue borders including those separating epithelia and connective tissue, increases near sites of invasion of primary prostatic tumors as previously shown for other proteins involved in desmoplastic tissue reaction. Studies of prostate cancer cells and stromal cells from both prostate and bone, the major site for prostate cancer metastasis, showed that cancer cells and a subset of stromal cells increased production of perlecan in response to cytokines present in the tumor microenvironment. In silico analysis of the HSPG2 promoter revealed two conserved NFκB binding sites, in addition to the previously reported SMAD3 binding sites. By systematically transfecting cells with a variety of reporter constructs including sequences up to 2.6 kb from the start site of transcription, we identified an active cis element in the distal region of the HSPG2 promoter, and showed that it functions in regulating transcription of HSPG2. Treatment with TNF-α and/or TGFβ1 identified TNF-α as a major cytokine regulator of perlecan production. TNF-α treatment also triggered p65 nuclear translocation and binding to the HSPG2 regulatory region in stromal cells and cancer cells. In addition to stromal induction of perlecan production in the prostate, we identified a matrix-secreting bone marrow stromal cell type that may represent the source for increases in perlecan in the metastatic bone marrow environment. These studies implicate perlecan in cytokine-mediated, innate tissue responses to cancer cell invasion, a process we suggest reflects a modified wound healing tissue response co-opted by prostate cancer cells. PMID:24700612
Brahma regulates a specific trans-splicing event at the mod(mdg4) locus of Drosophila melanogaster
Yu, Simei; Waldholm, Johan; Böhm, Stefanie; Visa, Neus
2014-01-01
The mod(mdg4) locus of Drosophila melanogaster contains several transcription units encoded on both DNA strands. The mod(mdg4) pre-mRNAs are alternatively spliced, and a very significant fraction of the mature mod(mdg4) mRNAs are formed by trans-splicing. We have studied the transcripts derived from one of the anti-sense regions within the mod(mdg4) locus in order to shed light on the expression of this complex locus. We have characterized the expression of anti-sense mod(mdg4) transcripts in S2 cells, mapped their transcription start sites and cleavage sites, identified and quantified alternatively spliced transcripts, and obtained insight into the regulation of the mod(mdg4) trans-splicing. In a previous study, we had shown that the alternative splicing of some mod(mdg4) transcripts was regulated by Brahma (BRM), the ATPase subunit of the SWI/SNF chromatin-remodeling complex. Here we show, using RNA interference and overexpression of recombinant BRM proteins, that the levels of BRM affect specifically the abundance of a trans-spliced mod(mdg4) mRNA isoform in both S2 cells and larvae. This specific effect on trans-splicing is accompanied by a local increase in the density of RNA polymerase II and by a change in the phosphorylation state of the C-terminal domain of the large subunit of RNA polymerase II. Interestingly, the regulation of the mod(mdg4) splicing by BRM is independent of the ATPase activity of BRM, which suggests that the mechanism by which BRM modulates trans-splicing is independent of its chromatin-remodeling activity. PMID:24526065
Matsumura, Ritsuko; Akashi, Makoto
2017-09-29
Cell-autonomous oscillation in clock gene expression drives circadian rhythms. The development of comprehensive analytical techniques, such as bioinformatics and ChIP-sequencing, has enabled the genome-wide identification of potential circadian transcriptional elements that regulate the transcriptional oscillation of clock genes. However, detailed analyses using traditional biochemical and molecular-biological approaches, such as binding and reporter assays, are still necessary to determine whether these potential circadian transcriptional elements are actually functional and how significantly they contribute to driving transcriptional oscillation. Here, we focused on the molecular mechanism of transcriptional oscillations in the mammalian clock gene Period3 ( Per3 ). The PER3 protein is essential for robust peripheral clocks and is a key component in circadian output processes. We found three E box-like elements located upstream of human Per3 transcription start sites that additively contributed to cell-autonomous transcriptional oscillation. However, we also found that Per3 is still expressed in a circadian manner when all three E box-like elements are functionally impaired. We noted that Per3 transcription was activated by the synergistic actions of two D box-like elements and the three E box-like elements, leading to a drastic increase in circadian amplitude. Interestingly, circadian expression of Per3 was completely disrupted only when all five transcriptional elements were functionally impaired. These results indicate that three E box-like and two D box-like elements cooperatively and redundantly regulate cell-autonomous transcriptional oscillation of Per3 . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeng, Yanli; Li, Hui; Zhang, Xiaoju
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G, A3G) exert antiviral defense as an important factor of innate immunity. A variety of cytokines such as IFN-γ,IL2,IL15,IL7 could induce the transcription of A3G. However, the regulation of other nuclear factor on the transcription of A3G have not been reported at the present. To gain new insights into the transcriptional regulation of this restriction factor, we cloned and characterized the promoter region of A3G and investigate the modulation of USF1 gene on the transcription of A3G. We identified a 232 bp region that was sufficient to regulate the activity of full promoter. Transcriptionalmore » start sites (TSS) were identified by the luciferase reporter assays of plasmids containing full or shorter fragments of the A3G promoter. The results demonstrated that the core promoter of A3G is located within the region -159/-84 relative to the TSS. Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position -91/-86 relative to the major TSS) and was abolished after mutation of this DNA element. USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte, and the identified E-box represented a binding site for the USF1. - Highlights: • The core promoter of A3G is located within the region −159/−84 relative to the TSS. • Transcriptional activity of A3G core promoter regulated by USF1 was dependent on an E-box (located at position −91/−86 relative to the major TSS). • USF1 gene can take part in basal transcription regulation of the human A3G gene in hepatocyte.« less
Mancio-Silva, Liliana; Lopez-Rubio, Jose Juan; Claes, Aurélie; Scherf, Artur
2013-01-01
The Plasmodium falciparum histone deacetylase Sir2a localizes at telomeric regions where it contributes to epigenetic silencing of clonally variant virulence genes. Apart from telomeres, PfSir2a also accumulates in the nucleolus, which harbours the developmentally regulated ribosomal RNA genes. Here we investigate the nucleolar function of PfSir2a and demonstrate that PfSir2a fine-tunes ribosomal RNA gene transcription. Using a parasite line in which PfSir2a has been disrupted, we observe that histones near the transcription start sites of all ribosomal RNA genes are hyperacetylated and that transcription of ribosomal RNA genes is upregulated. Complementation of the PfSir2a-disrupted parasites restores the ribosomal RNA levels, whereas PfSir2a overexpression in wild-type parasites decreases ribosomal RNA synthesis. Furthermore, we observe that PfSir2a modulation of ribosomal RNA synthesis is linked to an altered number of daughter merozoites and the parasite multiplication rate. These findings provide new insights into an epigenetic mechanism that controls malaria parasite proliferation and virulence. PMID:23443558
Najafova, Zeynab; Tirado-Magallanes, Roberto; Subramaniam, Malayannan; Hossan, Tareq; Schmidt, Geske; Nagarajan, Sankari; Baumgart, Simon J.; Mishra, Vivek Kumar; Bedi, Upasana; Hesse, Eric; Knapp, Stefan; Hawse, John R.; Johnsen, Steven A.
2017-01-01
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we examined the role of BRD4 in promoting lineage-specific gene expression and show that BRD4 is essential for osteoblast differentiation. Genome-wide analyses demonstrate that BRD4 is recruited to the transcriptional start site of differentiation-induced genes. Unexpectedly, while promoter-proximal BRD4 occupancy correlated with gene expression, genes which displayed moderate expression and promoter-proximal BRD4 occupancy were most highly regulated and sensitive to BRD4 inhibition. Therefore, we examined distal BRD4 occupancy and uncovered a specific co-localization of BRD4 with the transcription factors C/EBPb, TEAD1, FOSL2 and JUND at putative osteoblast-specific enhancers. These findings reveal the intricacies of lineage specification and provide new insight into the context-dependent functions of BRD4. PMID:27651452
Najafova, Zeynab; Tirado-Magallanes, Roberto; Subramaniam, Malayannan; Hossan, Tareq; Schmidt, Geske; Nagarajan, Sankari; Baumgart, Simon J; Mishra, Vivek Kumar; Bedi, Upasana; Hesse, Eric; Knapp, Stefan; Hawse, John R; Johnsen, Steven A
2017-01-09
Proper temporal epigenetic regulation of gene expression is essential for cell fate determination and tissue development. The Bromodomain-containing Protein-4 (BRD4) was previously shown to control the transcription of defined subsets of genes in various cell systems. In this study we examined the role of BRD4 in promoting lineage-specific gene expression and show that BRD4 is essential for osteoblast differentiation. Genome-wide analyses demonstrate that BRD4 is recruited to the transcriptional start site of differentiation-induced genes. Unexpectedly, while promoter-proximal BRD4 occupancy correlated with gene expression, genes which displayed moderate expression and promoter-proximal BRD4 occupancy were most highly regulated and sensitive to BRD4 inhibition. Therefore, we examined distal BRD4 occupancy and uncovered a specific co-localization of BRD4 with the transcription factors C/EBPb, TEAD1, FOSL2 and JUND at putative osteoblast-specific enhancers. These findings reveal the intricacies of lineage specification and provide new insight into the context-dependent functions of BRD4. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Benner, Christopher; Hutt, Kasey R.; Stunnenberg, Rieka; Garcia-Bassets, Ivan
2013-01-01
Genome-wide maps of DNase I hypersensitive sites (DHSs) reveal that most human promoters contain perpetually active cis-regulatory elements between −150 bp and +50 bp (−150/+50 bp) relative to the transcription start site (TSS). Transcription factors (TFs) recruit cofactors (chromatin remodelers, histone/protein-modifying enzymes, and scaffold proteins) to these elements in order to organize the local chromatin structure and coordinate the balance of post-translational modifications nearby, contributing to the overall regulation of transcription. However, the rules of TF-mediated cofactor recruitment to the −150/+50 bp promoter regions remain poorly understood. Here, we provide evidence for a general model in which a series of cis-regulatory elements (here termed ‘cardinal’ motifs) prefer acting individually, rather than in fixed combinations, within the −150/+50 bp regions to recruit TFs that dictate cofactor signatures distinctive of specific promoter subsets. Subsequently, human promoters can be subclassified based on the presence of cardinal elements and their associated cofactor signatures. In this study, furthermore, we have focused on promoters containing the nuclear respiratory factor 1 (NRF1) motif as the cardinal cis-regulatory element and have identified the pervasive association of NRF1 with the cofactor lysine-specific demethylase 1 (LSD1/KDM1A). This signature might be distinctive of promoters regulating nuclear-encoded mitochondrial and other particular genes in at least some cells. Together, we propose that decoding a signature-based, expanded model of control at proximal promoter regions should lead to a better understanding of coordinated regulation of gene transcription. PMID:24244184
Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale
Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li
2015-01-01
The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143
Revilla-i-Domingo, Roger; Bilic, Ivan; Vilagos, Bojan; Tagoh, Hiromi; Ebert, Anja; Tamir, Ido M; Smeenk, Leonie; Trupke, Johanna; Sommer, Andreas; Jaritz, Markus; Busslinger, Meinrad
2012-01-01
Pax5 controls the identity and development of B cells by repressing lineage-inappropriate genes and activating B-cell-specific genes. Here, we used genome-wide approaches to identify Pax5 target genes in pro-B and mature B cells. In these cell types, Pax5 bound to 40% of the cis-regulatory elements defined by mapping DNase I hypersensitive (DHS) sites, transcription start sites and histone modifications. Although Pax5 bound to 8000 target genes, it regulated only 4% of them in pro-B and mature B cells by inducing enhancers at activated genes and eliminating DHS sites at repressed genes. Pax5-regulated genes in pro-B cells account for 23% of all expression changes occurring between common lymphoid progenitors and committed pro-B cells, which identifies Pax5 as an important regulator of this developmental transition. Regulated Pax5 target genes minimally overlap in pro-B and mature B cells, which reflects massive expression changes between these cell types. Hence, Pax5 controls B-cell identity and function by regulating distinct target genes in early and late B lymphopoiesis. PMID:22669466
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-01-01
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs. PMID:9707446
Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L
1998-08-17
Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.
Kamboj, Atul; Hallwirth, Claus V; Alexander, Ian E; McCowage, Geoffrey B; Kramer, Belinda
2017-06-17
The analysis of viral vector genomic integration sites is an important component in assessing the safety and efficiency of patient treatment using gene therapy. Alongside this clinical application, integration site identification is a key step in the genetic mapping of viral elements in mutagenesis screens that aim to elucidate gene function. We have developed a UNIX-based vector integration site analysis pipeline (Ub-ISAP) that utilises a UNIX-based workflow for automated integration site identification and annotation of both single and paired-end sequencing reads. Reads that contain viral sequences of interest are selected and aligned to the host genome, and unique integration sites are then classified as transcription start site-proximal, intragenic or intergenic. Ub-ISAP provides a reliable and efficient pipeline to generate large datasets for assessing the safety and efficiency of integrating vectors in clinical settings, with broader applications in cancer research. Ub-ISAP is available as an open source software package at https://sourceforge.net/projects/ub-isap/ .
An APC/C-Cdh1 Biosensor Reveals the Dynamics of Cdh1 Inactivation at the G1/S Transition.
Ondracka, Andrej; Robbins, Jonathan A; Cross, Frederick R
2016-01-01
B-type cyclin-dependent kinase activity must be turned off for mitotic exit and G1 stabilization. B-type cyclin degradation is mediated by the anaphase-promoting complex/cyclosome (APC/C); during and after mitotic exit, APC/C is dependent on Cdh1. Cdh1 is in turn phosphorylated and inactivated by cyclin-CDK at the Start transition of the new cell cycle. We developed a biosensor to assess the cell cycle dynamics of APC/C-Cdh1. Nuclear exit of the G1 transcriptional repressor Whi5 is a known marker of Start; APC/C-Cdh1 is inactivated 12 min after Whi5 nuclear exit with little measurable cell-to-cell timing variability. Multiple phosphorylation sites on Cdh1 act in a redundant manner to repress its activity. Reducing the number of phosphorylation sites on Cdh1 can to some extent be tolerated for cell viability, but it increases variability in timing of APC/C-Cdh1 inactivation. Mutants with minimal subsets of phosphorylation sites required for viability exhibit striking stochasticity in multiple responses including budding, nuclear division, and APC/C-Cdh1 activity itself. Multiple cyclin-CDK complexes, as well as the stoichiometric inhibitor Acm1, contribute to APC/C-Cdh1 inactivation; this redundant control is likely to promote rapid and reliable APC/C-Cdh1 inactivation immediately following the Start transition.
Fanconi Anemia Core Complex Gene Promoters Harbor Conserved Transcription Regulatory Elements
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5′ region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3′ regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters. PMID:21826217
Fanconi anemia core complex gene promoters harbor conserved transcription regulatory elements.
Meier, Daniel; Schindler, Detlev
2011-01-01
The Fanconi anemia (FA) gene family is a recent addition to the complex network of proteins that respond to and repair certain types of DNA damage in the human genome. Since little is known about the regulation of this novel group of genes at the DNA level, we characterized the promoters of the eight genes (FANCA, B, C, E, F, G, L and M) that compose the FA core complex. The promoters of these genes show the characteristic attributes of housekeeping genes, such as a high GC content and CpG islands, a lack of TATA boxes and a low conservation. The promoters functioned in a monodirectional way and were, in their most active regions, comparable in strength to the SV40 promoter in our reporter plasmids. They were also marked by a distinctive transcriptional start site (TSS). In the 5' region of each promoter, we identified a region that was able to negatively regulate the promoter activity in HeLa and HEK 293 cells in isolation. The central and 3' regions of the promoter sequences harbor binding sites for several common and rare transcription factors, including STAT, SMAD, E2F, AP1 and YY1, which indicates that there may be cross-connections to several established regulatory pathways. Electrophoretic mobility shift assays and siRNA experiments confirmed the shared regulatory responses between the prominent members of the TGF-β and JAK/STAT pathways and members of the FA core complex. Although the promoters are not well conserved, they share region and sequence specific regulatory motifs and transcription factor binding sites (TBFs), and we identified a bi-partite nature to these promoters. These results support a hypothesis based on the co-evolution of the FA core complex genes that was expanded to include their promoters.
Rizzo, Francesca; Coffman, James A; Arnone, Maria Ina
2016-08-01
Elk proteins are Ets family transcription factors that regulate cell proliferation, survival, and differentiation in response to ERK (extracellular-signal regulated kinase)-mediated phosphorylation. Here we report the embryonic expression and function of Sp-Elk, the single Elk gene of the sea urchin Strongylocentrotus purpuratus. Sp-Elk is zygotically expressed throughout the embryo beginning at late cleavage stage, with peak expression occurring at blastula stage. Morpholino antisense-mediated knockdown of Sp-Elk causes blastula-stage developmental arrest and embryo disintegration due to apoptosis, a phenotype that is rescued by wild-type Elk mRNA. Development is also rescued by Elk mRNA encoding a serine to aspartic acid substitution (S402D) that mimics ERK-mediated phosphorylation of a conserved site that enhances DNA binding, but not by Elk mRNA encoding an alanine substitution at the same site (S402A). This demonstrates both that the apoptotic phenotype of the morphants is specifically caused by Elk depletion, and that phosphorylation of serine 402 of Sp-Elk is critical for its anti-apoptotic function. Knockdown of Sp-Elk results in under-expression of several regulatory genes involved in cell fate specification, cell cycle control, and survival signaling, including the transcriptional regulator Sp-Runt-1 and its target Sp-PKC1, both of which were shown previously to be required for cell survival during embryogenesis. Both Sp-Runt-1 and Sp-PKC1 have sequences upstream of their transcription start sites that specifically bind Sp-Elk. These results indicate that Sp-Elk is the signal-dependent activator of a feed-forward gene regulatory circuit, consisting also of Sp-Runt-1 and Sp-PKC1, which actively suppresses apoptosis in the early embryo. Copyright © 2016 Elsevier Inc. All rights reserved.
Tissue-Specific 5′ Heterogeneity of PPARα Transcripts and Their Differential Regulation by Leptin
Garratt, Emma S.; Vickers, Mark H.; Gluckman, Peter D.; Hanson, Mark A.
2013-01-01
The genes encoding nuclear receptors comprise multiple 5′untranslated exons, which give rise to several transcripts encoding the same protein, allowing tissue-specific regulation of expression. Both human and mouse peroxisome proliferator activated receptor (PPAR) α genes have multiple promoters, although their function is unknown. Here we have characterised the rat PPARα promoter region and have identified three alternative PPARα transcripts, which have different transcription start sites owing to the utilisation of distinct first exons. Moreover these alternative PPARα transcripts were differentially expressed between adipose tissue and liver. We show that while the major adipose (P1) and liver (P2) transcripts were both induced by dexamethasone, they were differentially regulated by the PPARα agonist, clofibric acid, and leptin. Leptin had no effect on the adipose-specific P1 transcript, but induced liver-specific P2 promoter activity via a STAT3/Sp1 mechanism. Moreover in Wistar rats, leptin treatment between postnatal day 3–13 led to an increase in P2 but not P1 transcription in adipose tissue which was sustained into adulthood. This suggests that the expression of the alternative PPARα transcripts are in part programmed by early life exposure to leptin leading to persistent change in adipose tissue fatty acid metabolism through specific activation of a quiescent PPARα promoter. Such complexity in the regulation of PPARα may allow the expression of PPARα to be finely regulated in response to environmental factors. PMID:23825665
Loya, Travis J; O'Rourke, Thomas W; Reines, Daniel
2012-08-01
The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 'tail' forms an α-helical multimerization domain that helps assemble it onto an RNA substrate.
Nair, Ramesh V.; Green, Edward M.; Watson, David E.; Bennett, George N.; Papoutsakis, Eleftherios T.
1999-01-01
A gene (orf1, now designated solR) previously identified upstream of the aldehyde/alcohol dehydrogenase gene aad (R. V. Nair, G. N. Bennett, and E. T. Papoutsakis, J. Bacteriol. 176:871–885, 1994) was found to encode a repressor of the sol locus (aad, ctfA, ctfB and adc) genes for butanol and acetone formation in Clostridium acetobutylicum ATCC 824. Primer extension analysis identified a transcriptional start site 35 bp upstream of the solR start codon. Amino acid comparisons of SolR identified a potential helix-turn-helix DNA-binding motif in the C-terminal half towards the center of the protein, suggesting a regulatory role. Overexpression of SolR in strain ATCC 824(pCO1) resulted in a solvent-negative phenotype owing to its deleterious effect on the transcription of the sol locus genes. Inactivation of solR in C. acetobutylicum via homologous recombination yielded mutants B and H (ATCC 824 solR::pO1X) which exhibited deregulated solvent production characterized by increased flux towards butanol and acetone formation, earlier induction of aad, lower overall acid production, markedly improved yields of solvents on glucose, a prolonged solvent production phase, and increased biomass accumulation compared to those of the wild-type strain. PMID:9864345
Sjöholm, Johannes; Oliveira, Paulo; Lindblad, Peter
2007-01-01
The filamentous, heterocystous cyanobacterium Nostoc sp. strain PCC 7120 (Anabaena sp. strain PCC 7120) possesses an uptake hydrogenase and a bidirectional enzyme, the latter being capable of catalyzing both H2 production and evolution. The completely sequenced genome of Nostoc sp. strain PCC 7120 reveals that the five structural genes encoding the bidirectional hydrogenase (hoxEFUYH) are separated in two clusters at a distance of approximately 8.8 kb. The transcription of the hox genes was examined under nitrogen-fixing conditions, and the results demonstrate that the cluster containing hoxE and hoxF can be transcribed as one polycistronic unit together with the open reading frame alr0750. The second cluster, containing hoxU, hoxY, and hoxH, is transcribed together with alr0763 and alr0765, located between the hox genes. Moreover, alr0760 and alr0761 form an additional larger operon. Nevertheless, Northern blot hybridizations revealed a rather complex transcription pattern in which the different hox genes are expressed differently. Transcriptional start points (TSPs) were identified 66 and 57 bp upstream from the start codon of alr0750 and hoxU, respectively. The transcriptions of the two clusters containing the hox genes are both induced under anaerobic conditions concomitantly with the induction of a higher level of hydrogenase activity. An additional TSP, within the annotated alr0760, 244 bp downstream from the suggested translation start codon, was identified. Electrophoretic mobility shift assays with purified LexA from Nostoc sp. strain PCC 7120 demonstrated specific interactions between the transcriptional regulator and both hox promoter regions. However, when LexA from Synechocystis sp. strain PCC 6803 was used, the purified protein interacted only with the promoter region of the alr0750-hoxE-hoxF operon. A search of the whole Nostoc sp. strain PCC 7120 genome demonstrated the presence of 216 putative LexA binding sites in total, including recA and recF. This indicates that, in addition to the bidirectional hydrogenase gene, a number of other genes, including open reading frames connected to DNA replication, recombination, and repair, may be part of the LexA regulatory network in Nostoc sp. strain PCC 7120. PMID:17630298
Comprehensive comparative analysis of 5'-end RNA-sequencing methods.
Adiconis, Xian; Haber, Adam L; Simmons, Sean K; Levy Moonshine, Ami; Ji, Zhe; Busby, Michele A; Shi, Xi; Jacques, Justin; Lancaster, Madeline A; Pan, Jen Q; Regev, Aviv; Levin, Joshua Z
2018-06-04
Specialized RNA-seq methods are required to identify the 5' ends of transcripts, which are critical for studies of gene regulation, but these methods have not been systematically benchmarked. We directly compared six such methods, including the performance of five methods on a single human cellular RNA sample and a new spike-in RNA assay that helps circumvent challenges resulting from uncertainties in annotation and RNA processing. We found that the 'cap analysis of gene expression' (CAGE) method performed best for mRNA and that most of its unannotated peaks were supported by evidence from other genomic methods. We applied CAGE to eight brain-related samples and determined sample-specific transcription start site (TSS) usage, as well as a transcriptome-wide shift in TSS usage between fetal and adult brain.
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells.
Vieille-Grosjean, I; Huber, P
1995-03-03
The human HOXB2 gene is a member of the vertebrate Hox gene family that contains genes coding for specific developmental stage DNA-binding proteins. Remarkably, within the hematopoietic compartment, genes of the HOXB complex are expressed specifically in erythromegakaryocytic cell lines and, for some of them, in hematopoietic progenitors. Here, we report the study of HOXB2 gene transcriptional regulation in hematopoietic cells, an initial step in understanding the lineage-specific expression of the whole HOXB complex in these cells. We have isolated the HOXB2 5'-flanking sequence and have characterized a promoter fragment extending 323 base pairs upstream from the transcriptional start site, which, in transfection experiments, was sufficient to direct the tissue-specific expression of HOXB2 in the erythroid cell line K562. In this fragment, we have identified a potential GATA-binding site that is essential to the promoter activity as demonstrated by point mutation experiments. Gel shift analysis revealed the formation of a specific complex in both erythroleukemic lines K562 and HEL that could be prevented by the addition of a specific antiserum raised against GATA-1 protein. These findings suggest a regulatory hierarchy in which GATA-1 is upstream of the HOXB2 gene in erythroid cells.
Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.
2017-01-01
Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111
Li, Guohui; Hu, Zhaoyang; Guo, Xuli; Li, Guangtian; Tang, Qi; Wang, Peng; Chen, Keping; Yao, Qin
2013-06-01
Bombyx mori bidensovirus (BmBDV) VD1-ORF4 (open reading frame 4, ORF4) consists of 3,318 nucleotides, which codes for a predicted 1,105-amino acid protein containing a conserved DNA polymerase motif. However, its functions in viral propagation remain unknown. In the current study, the transcription of VD1-ORF4 was examined from 6 to 96 h postinfection (p.i.) by RT-PCR, 5'-RACE revealed the transcription initiation site of BmBDV ORF4 to be -16 nucleotides upstream from the start codon, and 3'-RACE revealed the transcription termination site of VD1-ORF4 to be +7 nucleotides downstream from termination codon. Three different proteins were examined in the extracts of BmBDV-infected silkworms midguts by Western blot using raised antibodies against VD1-ORF4 deduced amino acid, and a specific protein band about 53 kDa was further detected in purified virions using the same antibodies. Taken together, BmBDV VD1-ORF4 codes for three or more proteins during the viral life cycle, one of which is a 53 kDa protein and confirmed to be a component of BmBDV virion.
Parra-Unda, Ricardo; Vaca-Paniagua, Felipe; Jiménez, Lucia; Landa, Abraham
2012-01-01
Cytosolic Cu,Zn superoxide dismutase (Cu,Zn-SOD) catalyzes the dismutation of superoxide (O(2)(-)) to oxygen and hydrogen peroxide (H(2)O(2)) and plays an important role in the establishment and survival of helminthes in their hosts. In this work, we describe the Taenia solium Cu,Zn-SOD gene (TsCu,Zn-SOD) and a Taenia crassiceps (TcCu,Zn-SOD) cDNA. TsCu,Zn-SOD gene that spans 2.841 kb, and has three exons and two introns; the splicing junctions follow the GT-AG rule. Analysis in silico of the gene revealed that the 5'-flanking region has three putative TATA and CCAAT boxes, and transcription factor binding sites for NF1 and AP1. The transcription start site was a C, located at 22 nucleotides upstream of the translation start codon (ATG). Southern blot analysis showed that TcCu,Zn-SOD and TsCu,Zn-SOD genes are encoded by a single copy. The deduced amino acid sequences of TsCu,Zn-SOD gene and TcCu,Zn-SOD cDNA reveal 98.47% of identity, and the characteristic motives, including the catalytic site and β-barrel structure of the Cu,Zn-SOD. Proteomic and immunohistochemical analysis indicated that Cu,Zn-SOD does not have isoforms, is distributed throughout the bladder wall and is concentrated in the tegument of T. solium and T. crassiceps cysticerci. Expression analysis revealed that TcCu,Zn-SOD mRNA and protein expression levels do not change in cysticerci, even upon exposure to O(2)(-) (0-3.8 nmol/min) and H(2)O(2) (0-2mM), suggesting that this gene is constitutively expressed in these parasites. Published by Elsevier Inc.
Influence of 5'-flanking sequence on 4.5SI RNA gene transcription by RNA polymerase III.
Gogolevskaya, Irina K; Stasenko, Danil V; Tatosyan, Karina A; Kramerov, Dmitri A
2018-05-01
Short nuclear 4.5SI RNA can be found in three related rodent families. Its function remains unknown. The genes of 4.5SI RNA contain an internal promoter of RNA polymerase III composed of the boxes A and B. Here, the effect of the sequence immediately upstream of the mouse 4.5SI RNA gene on its transcription was studied. The gene with deletions and substitutions in the 5'-flanking sequence was used to transfect HeLa cells and its transcriptional activity was evaluated from the cellular level of 4.5SI RNA. Single-nucleotide substitutions in the region adjacent to the transcription start site (positions -2 to -8) decreased the expression activity of the gene down to 40%-60% of the control. The substitution of the conserved pentanucleotide AGAAT (positions -14 to -18) could either decrease (43%-56%) or increase (134%) the gene expression. A TATA-like box (TACATGA) was found at positions -24 to -30 of the 4.5SI RNA gene. Its replacement with a polylinker fragment of the vector did not decrease the transcription level, while its replacement with a GC-rich sequence almost completely (down to 2%-5%) suppressed the transcription of the 4.5SI RNA gene. The effect of plasmid sequences bordering the gene on its transcription by RNA polymerase III is discussed.
Exploration of G-quadruplex function in c-Myb gene and its transcriptional regulation by topotecan.
Li, Fangyuan; Zhou, Jiang; Xu, Ming; Yuan, Gu
2018-02-01
Our bioinformatics research shows that there are four G-rich sequences (S1-S4) in the upstream region of the transcription start site of c-Myb gene, and we have proved that these sequences have the ability to form G-quadruplex structures. This work mainly focuses on G-quadruplex function, recognition and transcription regulation in c-Myb gene, revealing a novel regulatory element in c-Myb proximal promoter region, and its transcription regulation by G-quadruplex binder. The research has identified that the enhancer effect in c-Myb transcription was primarily affected by the G-quadruplex formed by S1 sequence, and the up-regulation effect may due to the removal of repressive progress of MZF-1 by stabilizing G-quadruplex. Attentions were being paid to the development of G-quadruplex binders for selective recognition, and topotecan was found to have high binding affinity in vitro and could effectively affect the c-Myb transcription activities in cells. The regulation of G-quadruplex with binders in transcriptional, translational levels by Q-RT-PCR and western blot was in expectation of providing a strategy for gene expression modulation. In conclusion, our study revealed a G-quadruplex structure in c-Myb proximal promoter region, which was of great importance in the regulation of c-Myb function. Copyright © 2017 Elsevier B.V. All rights reserved.
TAF(II)250: a transcription toolbox.
Wassarman, D A; Sauer, F
2001-08-01
Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.
Park, Hae Jeong; Lee, Soojung; Ju, Eunji; Jones, Jayre A; Choi, Inyeong
2017-03-01
Genome-wide association studies have identified the single nucleotide polymorphism (SNP) rs3278 in the human SLC4A7 gene as one of the marker loci for addiction vulnerability. This marker is located in an intron of the gene, and its genomic role has been unknown. In this study, we examined rs3278 and three adjacent SNPs prevalent in alcoholics for their effects on an alternative promoter that would lead to the production of the NH 2 -terminally truncated protein NBCn1ΔN450, missing the first 450 amino acids. Analysis of the transcription start site database and a promoter prediction algorithm identified a cluster of three promoters in intron 7 and two short CpG-rich sites in intron 6. The promoter closest to rs3278 showed strong transcription activity in luciferase reporter gene assays. Major-to-minor allele substitution at rs3278 resulted in increased transcription activity. Equivalent substitutions at adjacent rs3772723 (intron 7) and rs13077400 (exon 8) had negligible effect; however, the substitution at nonsynonymous rs3755652 (exon 8) increased the activity by more than twofold. The concomitant substitution at rs3278/rs3755652 produced an additive effect. The rs3755652 had more profound effects on the promoter than the upstream regulatory CpG sites. The amino acid change E326K caused by rs3755652 had negligible effect on transporter function. In HEK 293 cells, NBCn1ΔN450 was expressed in plasma membranes, but at significantly lower levels than the nontruncated NBCn1-E. The pH change mediated by NBCn1ΔN450 was also low. We conclude that rs3278 and rs3755652 stimulate an alternative transcription of the SLC4A7 gene, increasing the production of a defective transporter. Copyright © 2017 the American Physiological Society.
Lovewell, Thomas R J; McDonagh, Andrew J; Messenger, Andrew G; Azzouz, Mimoun; Tazi-Ahnini, Rachid
2015-01-01
The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions.
Walker, Amy K; Shi, Yang; Blackwell, T Keith
2004-04-09
The general transcription factor TFIID sets the mRNA start site and consists of TATA-binding protein and associated factors (TAF(II)s), some of which are also present in SPT-ADA-GCN5 (SAGA)-related complexes. In yeast, results of multiple studies indicate that TFIID-specific TAF(II)s are not required for the transcription of most genes, implying that intact TFIID may have a surprisingly specialized role in transcription. Relatively little is known about how TAF(II)s contribute to metazoan transcription in vivo, especially at developmental and tissue-specific genes. Previously, we investigated functions of four shared TFIID/SAGA TAF(II)s in Caenorhabditis elegans. Whereas TAF-4 was required for essentially all embryonic transcription, TAF-5, TAF-9, and TAF-10 were dispensable at multiple developmental and other metazoan-specific promoters. Here we show evidence that in C. elegans embryos transcription of most genes requires TFIID-specific TAF-1. TAF-1 is not as universally required as TAF-4, but it is essential for a greater proportion of transcription than TAF-5, -9, or -10 and is important for transcription of many developmental and other metazoan-specific genes. TAF-2, which binds core promoters with TAF-1, appears to be required for a similarly substantial proportion of transcription. C. elegans TAF-1 overlaps functionally with the coactivator p300/CBP (CBP-1), and at some genes it is required along with the TBP-like protein TLF(TRF2). We conclude that during C. elegans embryogenesis TAF-1 and TFIID have broad roles in transcription and development and that TFIID and TLF may act together at certain promoters. Our findings imply that in metazoans TFIID may be of widespread importance for transcription and for expression of tissue-specific genes.
Murray, Vincent; Chen, Jon K; Galea, Anne M
2014-04-01
The genome-wide pattern of DNA cleavage at transcription start sites (TSSs) for the anti-tumor drug bleomycin was examined in human HeLa cells using next-generation DNA sequencing. It was found that actively transcribed genes were preferentially cleaved compared with non-transcribed genes. The 143,600 identified human TSSs were split into non-transcribed genes (82,596) and transcribed genes (61,004) for HeLa cells. These transcribed genes were further split into quintiles of 12,201 genes comprising the top 20, 20-40, 40-60, 60-80, and 80-100 % of expressed genes. The bleomycin cleavage pattern at highly transcribed gene TSSs was greatly enhanced compared with purified DNA and non-transcribed gene TSSs. The top 20 and 20-40 % quintiles had a very similar enhanced cleavage pattern, the 40-60 % quintile was intermediate, while the 60-80 and 80-100 % quintiles were close to the non-transcribed and purified DNA profiles. The pattern of bleomycin enhanced cleavage had peaks that were approximately 200 bp apart, and this indicated that bleomycin was identifying the presence of phased nucleosomes at TSSs. Hence bleomycin can be utilized to detect chromatin structures that are present at actively transcribed genes. In this study, for the first time, the pattern of DNA damage by a clinically utilized cancer chemotherapeutic agent was performed on a human genome-wide scale at the nucleotide level.
Transcription Start Site Evolution in Drosophila
Main, Bradley J.; Smith, Andrew D.; Jang, Hyosik; Nuzhdin, Sergey V.
2013-01-01
Transcription start site (TSS) evolution remains largely undescribed in Drosophila, likely due to limited annotations in non-melanogaster species. In this study, we introduce a concise new method that selectively sequences from the 5′-end of mRNA and used it to identify TSS in four Drosophila species, including Drosophila melanogaster, D. simulans, D. sechellia, and D. pseudoobscura. For verification, we compared our results in D. melanogaster with known annotations, published 5′-rapid amplification of cDNA ends data, and with RNAseq from the same mRNA pool. Then, we paired 2,849 D. melanogaster TSS with its closest equivalent TSS in each species (likely to be its true ortholog) using the available multiple sequence alignments. Most of the D. melanogaster TSSs were successfully paired with an ortholog in each species (83%, 86%, and 55% for D. simulans, D. sechellia, and D. pseudoobscura, respectively). On the basis of the number and distribution of reads mapped at each TSS, we also estimated promoter-specific expression (PSE) and TSS peak shape, respectively. Among paired TSS orthologs, the location and promoter activity were largely conserved. TSS location appears important as PSE, and TSS peak shape was more frequently divergent among TSS that had moved. Unpaired TSS were surprisingly common in D. pseudoobscura. An increased mutation rate upstream of TSS might explain this pattern. We found an enrichment of ribosomal protein genes among diverged TSS, suggesting that TSS evolution is not uniform across the genome. PMID:23649539
Lumsden, Amanda L; Ma, Yuefang; Ashander, Liam M; Stempel, Andrew J; Keating, Damien J; Smith, Justine R; Appukuttan, Binoy
2018-05-09
Regulation of intercellular adhesion molecule (ICAM)-1 in retinal endothelial cells is a promising druggable target for retinal vascular diseases. The ICAM-1-related (ICR) long non-coding RNA stabilizes ICAM-1 transcript, increasing protein expression. However, studies of ICR involvement in disease have been limited as the promoter is uncharacterized. To address this issue, we undertook a comprehensive in silico analysis of the human ICR gene promoter region. We used genomic evolutionary rate profiling to identify a 115 base pair (bp) sequence within 500 bp upstream of the transcription start site of the annotated human ICR gene that was conserved across 25 eutherian genomes. A second constrained sequence upstream of the orthologous mouse gene (68 bp; conserved across 27 Eutherian genomes including human) was also discovered. Searching these elements identified 33 matrices predictive of binding sites for transcription factors known to be responsive to a broad range of pathological stimuli, including hypoxia, and metabolic and inflammatory proteins. Five phenotype-associated single nucleotide polymorphisms (SNPs) in the immediate vicinity of these elements included four SNPs (i.e. rs2569693, rs281439, rs281440 and rs11575074) predicted to impact binding motifs of transcription factors, and thus the expression of ICR and ICAM-1 genes, with potential to influence disease susceptibility. We verified that human retinal endothelial cells expressed ICR, and observed induction of expression by tumor necrosis factor-α.
Mymryk, J S; Berard, D; Hager, G L; Archer, T K
1995-01-01
We have stably introduced a reporter gene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat (LTR) into human T47D breast cancer cells to study the action of the progesterone receptor (PR) on transcription from a chromatin template. Unexpectedly, the chromatin organization of the MMTV LTR in these human breast cancer cells differed markedly from what we have observed previously. The region adjacent to the transcription start site (-221 to -75) was found to be constitutively hypersensitive to restriction enzyme cleavage in the absence of hormone. This region is normally encompassed within the second nucleosome of a phased array of six nucleosomes that is assembled when the MMTV LTR is stably maintained in mouse cells. Characteristically, in these rodent cells, the identical DNA sequences show increased restriction enzyme cleavage only in the presence of glucocorticoid. The increased access of restriction enzymes observed in the human PR+ cells was not observed in adjacent nucleosomes and was unaffected by treatment with the progesterone antagonist RU486. In addition, exonuclease III-dependent stops corresponding to the binding sites for nuclear factor 1 and the PR were observed before and after hormone treatment. These results indicate that MMTV chromatin replicated in these cells is organized into a constitutively open architecture and that this open chromatin state is accompanied by hormone-independent loading of a transcription factor complex that is normally excluded from uninduced chromatin. PMID:7799933
Mymryk, J S; Berard, D; Hager, G L; Archer, T K
1995-01-01
We have stably introduced a reporter gene under the control of the mouse mammary tumor virus (MMTV) long terminal repeat (LTR) into human T47D breast cancer cells to study the action of the progesterone receptor (PR) on transcription from a chromatin template. Unexpectedly, the chromatin organization of the MMTV LTR in these human breast cancer cells differed markedly from what we have observed previously. The region adjacent to the transcription start site (-221 to -75) was found to be constitutively hypersensitive to restriction enzyme cleavage in the absence of hormone. This region is normally encompassed within the second nucleosome of a phased array of six nucleosomes that is assembled when the MMTV LTR is stably maintained in mouse cells. Characteristically, in these rodent cells, the identical DNA sequences show increased restriction enzyme cleavage only in the presence of glucocorticoid. The increased access of restriction enzymes observed in the human PR+ cells was not observed in adjacent nucleosomes and was unaffected by treatment with the progesterone antagonist RU486. In addition, exonuclease III-dependent stops corresponding to the binding sites for nuclear factor 1 and the PR were observed before and after hormone treatment. These results indicate that MMTV chromatin replicated in these cells is organized into a constitutively open architecture and that this open chromatin state is accompanied by hormone-independent loading of a transcription factor complex that is normally excluded from uninduced chromatin.
Mariot, Roberta Fogliatto; de Oliveira, Luisa Abruzzi; Voorhuijzen, Marleen M; Staats, Martijn; Hutten, Ronald C B; van Dijk, Jeroen P; Kok, Esther J; Frazzon, Jeverson
2016-02-03
Before commercial release, new potato (Solanum tuberosum) varieties must be evaluated for content of toxic compounds such as glycoalkaloids (GAs), which are potent poisons. GA biosynthesis proceeds via the cholesterol pathway to α-chaconine and α-solanine. The goal of this study was to evaluate the relationship between total glycoalkaloid (TGA) content and the expression of GAME, SGT1, and SGT3 genes in potato tubers. TGA content was measured by HPLC-MS, and reverse transcription quantitative polymerase chain reactions were performed to determine the relative expression of GAME, SGT1, and SGT3 genes. We searched for cis-elements of the transcription start site using the PlantPAN database. There was a relationship between TGA content and the relative expression of GAME, SGT1, and SGT3 genes in potato tubers. Putative promoter regions showed the presence of several cis-elements related to biotic and abiotic stresses and light. These findings provide an important step toward understanding TGA regulation and variation in potato tubers.
Perspectives on the mechanism of transcriptional regulation by long non-coding RNAs.
Roberts, Thomas C; Morris, Kevin V; Weinberg, Marc S
2014-01-01
Long non-coding RNAs (lncRNAs) are increasingly being recognized as epigenetic regulators of gene transcription. The diversity and complexity of lncRNA genes means that they exert their regulatory effects by a variety of mechanisms. Although there is still much to be learned about the mechanism of lncRNA function, general principles are starting to emerge. In particular, the application of high throughput (deep) sequencing methodologies has greatly advanced our understanding of lncRNA gene function. lncRNAs function as adaptors that link specific chromatin loci with chromatin-remodeling complexes and transcription factors. lncRNAs can act in cis or trans to guide epigenetic-modifier complexes to distinct genomic sites, or act as scaffolds which recruit multiple proteins simultaneously, thereby coordinating their activities. In this review we discuss the genomic organization of lncRNAs, the importance of RNA secondary structure to lncRNA functionality, the multitude of ways in which they interact with the genome, and what evolutionary conservation tells us about their function.
Monitoring transcription initiation activities in rat and dog.
Lizio, Marina; Mukarram, Abdul Kadir; Ohno, Mizuho; Watanabe, Shoko; Itoh, Masayoshi; Hasegawa, Akira; Lassmann, Timo; Severin, Jessica; Harshbarger, Jayson; Abugessaisa, Imad; Kasukawa, Takeya; Hon, Chung Chau; Carninci, Piero; Hayashizaki, Yoshihide; Forrest, Alistair R R; Kawaji, Hideya
2017-11-28
The promoter landscape of several non-human model organisms is far from complete. As a part of FANTOM5 data collection, we generated 13 profiles of transcription initiation activities in dog and rat aortic smooth muscle cells, mesenchymal stem cells and hepatocytes by employing CAGE (Cap Analysis of Gene Expression) technology combined with single molecule sequencing. Our analyses show that the CAGE profiles recapitulate known transcription start sites (TSSs) consistently, in addition to uncover novel TSSs. Our dataset can be thus used with high confidence to support gene annotation in dog and rat species. We identified 28,497 and 23,147 CAGE peaks, or promoter regions, for rat and dog respectively, and associated them to known genes. This approach could be seen as a standard method for improvement of existing gene models, as well as discovery of novel genes. Given that the FANTOM5 data collection includes dog and rat matched cell types in human and mouse as well, this data would also be useful for cross-species studies.
Petit, F G; Métivier, R; Valotaire, Y; Pakdel, F
1999-01-01
In all oviparous, liver represents one of the main E2-target tissues where estrogen receptor (ER) constitutes the key mediator of estrogen action. The rainbow trout estrogen receptor (rtER) gene expression is markedly up-regulated by estrogens and the sequences responsible for this autoregulation have been located in a 0.2 kb upstream transcription start site within - 40/- 248 enhancer region. Absence of interference with steroid hormone receptors and tissue-specific factors and a conserved basal transcriptional machinery between yeast and higher eukaryotes, make yeast a simple assay system that will enable determination of important cis-acting regulatory sequences within rtER gene promoter and identification of transcription factors implicated in the regulation of this gene. Deletion analysis allowed to show a synergistic effect between an imperfect estrogen-responsive element (ERE) and a consensus half-ERE to achieve a high hormone-dependent transcriptional activation of the rtER gene promoter in the presence of stably expressed rtER. As in mammalian cells, here we observed a positive regulation of the rtER gene promoter by the chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) through enhancing autoregulation. Using a point mutation COUP-TFI mutant unable to bind DNA demonstrates that enhancement of rtER gene autoregulation requires the interaction of COUP-TFI to the DNA. Moreover, this enhancement of transcriptional activation by COUP-TFI requires specifically the AF-1 transactivation function of ER and can be observed in the presence of E2 or 4-hydroxytamoxifen but not ICI 164384. Thus, this paper describes the reconstitution of a hormone-responsive transcription unit in yeast in which the regulation of rtER gene promoter could be enhanced by the participation of cis-elements and/or trans-acting factors, such as ER itself or COUP-TF.
Hirakawa, Hidetada; Oda, Yasuhiro; Phattarasukol, Somsak; Armour, Christopher D.; Castle, John C.; Raymond, Christopher K.; Lappala, Colin R.; Schaefer, Amy L.; Harwood, Caroline S.; Greenberg, E. Peter
2011-01-01
The Rhodopseudomonas palustris transcriptional regulator RpaR responds to the RpaI-synthesized quorum-sensing signal p-coumaroyl-homoserine lactone (pC-HSL). Other characterized RpaR homologs respond to fatty acyl-HSLs. We show here that RpaR functions as a transcriptional activator, which binds directly to the rpaI promoter. We developed an RNAseq method that does not require a ribosome depletion step to define a set of transcripts regulated by pC-HSL and RpaR. The transcripts include several noncoding RNAs. A footprint analysis showed that purified His-tagged RpaR (His6-RpaR) binds to an inverted repeat element centered 48.5 bp upstream of the rpaI transcript start site, which we mapped by S1 nuclease protection and primer extension analyses. Although pC-HSL-RpaR bound to rpaI promoter DNA, it did not bind to the promoter regions of a number of RpaR-regulated genes not in the rpaI operon. This indicates that RpaR control of these other genes is indirect. Because the RNAseq analysis allowed us to track transcript strand specificity, we discovered that there is pC-HSL-RpaR-activated antisense transcription of rpaR. These data raise the possibility that this antisense RNA or other RpaR-activated noncoding RNAs mediate the indirect activation of genes in the RpaR-controlled regulon. PMID:21378182
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.
2013-01-01
Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm formation of the ΔlsrR, ΔlsrRK, and Δcrp mutants was significantly reduced relative to that of the wild type, indicating that proper regulation of the lsr locus is required for optimal biofilm growth by A. actinomycetemcomitans. PMID:23104800
Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dong, Hongyan, E-mail: hongyan_dong@hc-sc.gc.ca; Yauk, Carole L.; Wade, Michael G.
Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined withmore » chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism.« less
Cui, Ping; Jin, Huiyan; Vutukuru, Manjula Ramya; Kaplan, Craig D.
2016-01-01
The interplay between adjacent transcription units can result in transcription-dependent alterations in chromatin structure or recruitment of factors that determine transcription outcomes, including the generation of intragenic or other cryptic transcripts derived from cryptic promoters. Mutations in a number of genes in Saccharomyces cerevisiae confer both cryptic intragenic transcription and the Suppressor of Ty (Spt-) phenotype for the lys2-128∂ allele of the LYS2 gene. Mutants that suppress lys2-128∂ allow transcription from a normally inactive Ty1 ∂ promoter, conferring a LYS+ phenotype. The arrangement of transcription units at lys2-128∂ is reminiscent of genes containing cryptic promoters within their open reading frames. We set out to examine the relationship between RNA Polymerase II (Pol II) activity, functions of Spt elongation factors, and cryptic transcription because of the previous observation that increased-activity Pol II alleles confer an Spt- phenotype. We identify both cooperating and antagonistic genetic interactions between Pol II alleles and alleles of elongation factors SPT4, SPT5, and SPT6. We find that cryptic transcription at FLO8 and STE11 is distinct from that at lys2-128∂, though all show sensitivity to reduction in Pol II activity, especially the expression of lys2-128∂ found in Spt- mutants. We determine that the lys2-128∂ Spt- phenotypes for spt6-1004 and increased activity rpo21/rpb1 alleles each require transcription from the LYS2 promoter. Furthermore, we identify the Ty1 transcription start site (TSS) within the ∂ element as the position of Spt- transcription in tested Spt- mutants. PMID:27261007
Molecular Control of Polyene Macrolide Biosynthesis
Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.
2011-01-01
Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288
Yakhnin, Helen; Baker, Carol S.; Berezin, Igor; Evangelista, Michael A.; Rassin, Alisa; Romeo, Tony; Babitzke, Paul
2011-01-01
The RNA binding protein CsrA is the central component of a conserved global regulatory system that activates or represses gene expression posttranscriptionally. In every known example of CsrA-mediated translational control, CsrA binds to the 5′ untranslated region of target transcripts, thereby repressing translation initiation and/or altering the stability of the RNA. Furthermore, with few exceptions, repression by CsrA involves binding directly to the Shine-Dalgarno sequence and blocking ribosome binding. sdiA encodes the quorum-sensing receptor for N-acyl-l-homoserine lactone in Escherichia coli. Because sdiA indirectly stimulates transcription of csrB, which encodes a small RNA (sRNA) antagonist of CsrA, we further explored the relationship between sdiA and the Csr system. Primer extension analysis revealed four putative transcription start sites within 85 nucleotides of the sdiA initiation codon. Potential σ70-dependent promoters were identified for each of these primer extension products. In addition, two CsrA binding sites were predicted in the initially translated region of sdiA. Expression of chromosomally integrated sdiA′-′lacZ translational fusions containing the entire promoter and CsrA binding site regions indicates that CsrA represses sdiA expression. The results from gel shift and footprint studies demonstrate that tight binding of CsrA requires both of these sites. Furthermore, the results from toeprint and in vitro translation experiments indicate that CsrA represses translation of sdiA by directly competing with 30S ribosomal subunit binding. Thus, this represents the first example of CsrA preventing translation by interacting solely within the coding region of an mRNA target. PMID:21908661
Efficient activation of transcription in yeast by the BPV1 E2 protein.
Stanway, C A; Sowden, M P; Wilson, L E; Kingsman, A J; Kingsman, S M
1989-01-01
The full-length gene product encoded by the E2 open reading frame (ORF) of bovine papillomavirus type 1 (BPV1) is a transcriptional transactivator. It is believed to mediate its effect on the BPV1 long control region (LCR) by binding to motifs with the consensus sequence ACCN6GGT. The minimal functional cis active site, called the E2 response element (E2RE), in mammalian cells comprises two copies of this motif. Here we have shown that E2 can function in Saccharomyces cerevisiae by placing an E2RE upstream of a synthetic yeast assay promoter which consists of a TATA motif and an mRNA initiation site, spaced correctly. This E2RE-minimal promoter is only transcriptionally active in the presence of E2 protein and the resulting mRNA is initiated at the authentic start site. This is the first report of a mammalian viral transactivator functioning in yeast. The level of activation by E2 via the E2RE was the same as observed with the highly efficient authentic PGK promoter where the upstream activation sequence is composed of three distinct elements. Furthermore a single E2 motif which is insufficient in mammalian cells as an activation site was as efficiently utilized in yeast as the E2RE (2 motifs). Previous studies have shown that mammalian cellular activators can function in yeast and our data now extend this to viral-specific activators. Our data indicate however that while the mechanism of transactivation is broadly conserved there may be significant differences at the detailed level. Images PMID:2539584
TFIIIC Bound DNA Elements in Nuclear Organization and Insulation
Kirkland, Jacob G.; Raab, Jesse R.
2012-01-01
tRNA genes (tDNAs) have been known to have barrier insulator function in budding yeast, Saccharomyces cerevisiae, for over a decade. tDNAs also play a role in genome organization by clustering at sites in the nucleus and both of these functions are dependent on the transcription factor TFIIIC. More recently TFIIIC bound sites devoid of pol III, termed Extra-TFIIIC sites (ETC) have been identified in budding yeast and these sites also function as insulators and affect genome organization. Subsequent studies in Schizosaccharomyces pombe showed that TFIIIC bound sites were insulators and also functioned as Chromosome Organization Clamps (COC); tethering the sites to the nuclear periphery. Very recently studies have moved to mammalian systems where pol III genes and their associated factors have been investigated in both mouse and human cells. Short Interspersed Nuclear Elements (SINEs) that bind TFIIIC, function as insulator elements and tDNAs can also function as both enhancer -blocking and barrier insulators in these organisms. It was also recently shown that tDNAs cluster with other tDNAs and with ETCs but not with pol II transcribed genes. Intriguingly, TFIIIC is often found near pol II transcription start sites and it remains unclear what the consequences of TFIIIC based genomic organization are and what influence pol III factors have on pol II transcribed genes and vise versa. In this review we provide a comprehensive overview of the known data on pol III factors in insulation and genome organization and identify the many open questions that require further investigation. \\ PMID:23000638
ZNF750 is a p63 Target Gene that Induces KLF4 to Drive Terminal Epidermal Differentiation
Sen, George L.; Boxer, Lisa D.; Webster, Dan E.; Bussat, Rose T.; Qu, Kun; Zarnegar, Brian J.; Johnston, Danielle; Siprashvili, Zurab; Khavari, Paul A.
2012-01-01
SUMMARY Disrupted epidermal differentiation characterizes numerous diseases that impact >25% of the population. In a search for dominant mediators of differentiation, we defined a requirement for ZNF750 in terminal epidermal differentiation. ZNF750 controlled genes mutated in numerous human skin diseases, including FLG, LOR, LCE3B, ALOXE3, and SPINK5. ZNF750 induced progenitor differentiation via an evolutionarily conserved C2H2 zinc finger motif. The epidermal master regulator, p63, bound the ZNF750 promoter and was necessary for its induction. ZNF750 restored differentiation to p63-deficient tissue, suggesting it acts downstream of p63. A search for functionally important ZNF750 targets via analysis of ZNF750-regulated genes identified KLF4, a transcription factor that activates late epidermal differentiation. ZNF750 binds to KLF4 at multiple sites flanking the transcriptional start site and controls its expression. ZNF750 thus directly links a tissue-specifying factor, p63, to an effector of terminal differentiation, KLF4, and represents a potential future target for disorders of this process. PMID:22364861
Saturation analysis of ChIP-seq data for reproducible identification of binding peaks
Hansen, Peter; Hecht, Jochen; Ibrahim, Daniel M.; Krannich, Alexander; Truss, Matthias; Robinson, Peter N.
2015-01-01
Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) is a powerful technology to identify the genome-wide locations of transcription factors and other DNA binding proteins. Computational ChIP-seq peak calling infers the location of protein–DNA interactions based on various measures of enrichment of sequence reads. In this work, we introduce an algorithm, Q, that uses an assessment of the quadratic enrichment of reads to center candidate peaks followed by statistical analysis of saturation of candidate peaks by 5′ ends of reads. We show that our method not only is substantially faster than several competing methods but also demonstrates statistically significant advantages with respect to reproducibility of results and in its ability to identify peaks with reproducible binding site motifs. We show that Q has superior performance in the delineation of double RNAPII and H3K4me3 peaks surrounding transcription start sites related to a better ability to resolve individual peaks. The method is implemented in C+l+ and is freely available under an open source license. PMID:26163319
The Epstein-Barr Virus Regulome in Lymphoblastoid Cells.
Jiang, Sizun; Zhou, Hufeng; Liang, Jun; Gerdt, Catherine; Wang, Chong; Ke, Liangru; Schmidt, Stefanie C S; Narita, Yohei; Ma, Yijie; Wang, Shuangqi; Colson, Tyler; Gewurz, Benjamin; Li, Guoliang; Kieff, Elliott; Zhao, Bo
2017-10-11
Epstein-Barr virus (EBV) transforms B cells to continuously proliferating lymphoblastoid cell lines (LCLs), which represent an experimental model for EBV-associated cancers. EBV nuclear antigens (EBNAs) and LMP1 are EBV transcriptional regulators that are essential for LCL establishment, proliferation, and survival. Starting with the 3D genome organization map of LCL, we constructed a comprehensive EBV regulome encompassing 1,992 viral/cellular genes and enhancers. Approximately 30% of genes essential for LCL growth were linked to EBV enhancers. Deleting EBNA2 sites significantly reduced their target gene expression. Additional EBV super-enhancer (ESE) targets included MCL1, IRF4, and EBF. MYC ESE looping to the transcriptional stat site of MYC was dependent on EBNAs. Deleting MYC ESEs greatly reduced MYC expression and LCL growth. EBNA3A/3C altered CDKN2A/B spatial organization to suppress senescence. EZH2 inhibition decreased the looping at the CDKN2A/B loci and reduced LCL growth. This study provides a comprehensive view of the spatial organization of chromatin during EBV-driven cellular transformation. Copyright © 2017 Elsevier Inc. All rights reserved.
Dasgupta, Nirmalya; Thakur, Bhupesh Kumar; Ta, Atri; Das, Sayan; Banik, George; Das, Santasabuj
2017-07-01
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation of PLK1 expression in colorectal cells was never studied earlier and it is currently unknown if PLK1 regulates differentiation and apoptosis of CRC. PLK1 expression was analyzed by real-time PCR and western blotting. Transcriptional regulation was studied by reporter assay, gene knock-down, EMSA and ChIP. PLK1 expression was down-regulated during butyrate-induced differentiation of HT-29 and other CRC cells. Also, PLK1 down-regulation mediated the role of butyrate in CRC differentiation and apoptosis. We report here a novel transcriptional regulation of PLK1 by butyrate. Transcription factors CCAAT/enhancer-binding protein α (C/EBPα) and Oct-1 share an overlapping binding site over the PLK1 promoter. Elevated levels of C/EBPα by butyrate treatment of CRC cells competed out the activator protein Oct-1 from binding to the PLK1 promoter and sequestered it. Binding of C/EBPα was associated with increased deacetylation near the transcription start site (TSS) of the PLK1 promoter, which abrogated transcription through reduced recruitment of RNA polymerase II. We also found a synergistic role between the synthetic PLK1-inhibitor SBE13 and butyrate on the apoptosis of CRC cells. This study offered a novel p53-independent regulation of PLK1 during CRC differentiation and apoptosis. Down-regulation of PLK1 is one of the mechanisms underlying the anti-cancer role of dietary fibre-derived butyrate in CRC. Copyright © 2017 Elsevier B.V. All rights reserved.
Van Loo, Peter; Aerts, Stein; Thienpont, Bernard; De Moor, Bart; Moreau, Yves; Marynen, Peter
2008-01-01
We present ModuleMiner, a novel algorithm for computationally detecting cis-regulatory modules (CRMs) in a set of co-expressed genes. ModuleMiner outperforms other methods for CRM detection on benchmark data, and successfully detects CRMs in tissue-specific microarray clusters and in embryonic development gene sets. Interestingly, CRM predictions for differentiated tissues exhibit strong enrichment close to the transcription start site, whereas CRM predictions for embryonic development gene sets are depleted in this region. PMID:18394174
NASA Astrophysics Data System (ADS)
Guaraldo, Michela; Santambrogio, Paolo; Rovelli, Elisabetta; di Savino, Augusta; Saglio, Giuseppe; Cittaro, Davide; Roetto, Antonella; Levi, Sonia
2016-09-01
Mitochondrial ferritin (FtMt) is an iron storage protein belonging to the ferritin family but, unlike the cytosolic ferritin, it has an iron-unrelated restricted tissue expression. FtMt appears to be preferentially expressed in cell types characterized by high metabolic activity and oxygen consumption, suggesting a role in protecting mitochondria from iron-dependent oxidative damage. The human gene (FTMT) is intronless and its promoter region has not been described yet. To analyze the regulatory mechanisms controlling FTMT expression, we characterized the 5‧ flanking region upstream the transcriptional starting site of FTMT by in silico enquiry of sequences conservation, DNA deletion analysis, and ChIP assay. The data revealed a minimal promoter region and identified the presence of SP1, CREB and YY1 as positive regulators, and GATA2, FoxA1 and C/EBPβ as inhibitors of the transcriptional regulation. Furthermore, the FTMT transcription is increased by acetylating and de-methylating agent treatments in K562 and HeLa cells. These treatments up-regulate FtMt expression even in fibroblasts derived from a Friedreich ataxia patient, where it might exert a beneficial effect against mitochondrial oxidative damage. The expression of FTMT appears regulated by a complex mechanism involving epigenetic events and interplay between transcription factors.
Birney, Ewan; Stamatoyannopoulos, John A; Dutta, Anindya; Guigó, Roderic; Gingeras, Thomas R; Margulies, Elliott H; Weng, Zhiping; Snyder, Michael; Dermitzakis, Emmanouil T; Thurman, Robert E; Kuehn, Michael S; Taylor, Christopher M; Neph, Shane; Koch, Christoph M; Asthana, Saurabh; Malhotra, Ankit; Adzhubei, Ivan; Greenbaum, Jason A; Andrews, Robert M; Flicek, Paul; Boyle, Patrick J; Cao, Hua; Carter, Nigel P; Clelland, Gayle K; Davis, Sean; Day, Nathan; Dhami, Pawandeep; Dillon, Shane C; Dorschner, Michael O; Fiegler, Heike; Giresi, Paul G; Goldy, Jeff; Hawrylycz, Michael; Haydock, Andrew; Humbert, Richard; James, Keith D; Johnson, Brett E; Johnson, Ericka M; Frum, Tristan T; Rosenzweig, Elizabeth R; Karnani, Neerja; Lee, Kirsten; Lefebvre, Gregory C; Navas, Patrick A; Neri, Fidencio; Parker, Stephen C J; Sabo, Peter J; Sandstrom, Richard; Shafer, Anthony; Vetrie, David; Weaver, Molly; Wilcox, Sarah; Yu, Man; Collins, Francis S; Dekker, Job; Lieb, Jason D; Tullius, Thomas D; Crawford, Gregory E; Sunyaev, Shamil; Noble, William S; Dunham, Ian; Denoeud, France; Reymond, Alexandre; Kapranov, Philipp; Rozowsky, Joel; Zheng, Deyou; Castelo, Robert; Frankish, Adam; Harrow, Jennifer; Ghosh, Srinka; Sandelin, Albin; Hofacker, Ivo L; Baertsch, Robert; Keefe, Damian; Dike, Sujit; Cheng, Jill; Hirsch, Heather A; Sekinger, Edward A; Lagarde, Julien; Abril, Josep F; Shahab, Atif; Flamm, Christoph; Fried, Claudia; Hackermüller, Jörg; Hertel, Jana; Lindemeyer, Manja; Missal, Kristin; Tanzer, Andrea; Washietl, Stefan; Korbel, Jan; Emanuelsson, Olof; Pedersen, Jakob S; Holroyd, Nancy; Taylor, Ruth; Swarbreck, David; Matthews, Nicholas; Dickson, Mark C; Thomas, Daryl J; Weirauch, Matthew T; Gilbert, James; Drenkow, Jorg; Bell, Ian; Zhao, XiaoDong; Srinivasan, K G; Sung, Wing-Kin; Ooi, Hong Sain; Chiu, Kuo Ping; Foissac, Sylvain; Alioto, Tyler; Brent, Michael; Pachter, Lior; Tress, Michael L; Valencia, Alfonso; Choo, Siew Woh; Choo, Chiou Yu; Ucla, Catherine; Manzano, Caroline; Wyss, Carine; Cheung, Evelyn; Clark, Taane G; Brown, James B; Ganesh, Madhavan; Patel, Sandeep; Tammana, Hari; Chrast, Jacqueline; Henrichsen, Charlotte N; Kai, Chikatoshi; Kawai, Jun; Nagalakshmi, Ugrappa; Wu, Jiaqian; Lian, Zheng; Lian, Jin; Newburger, Peter; Zhang, Xueqing; Bickel, Peter; Mattick, John S; Carninci, Piero; Hayashizaki, Yoshihide; Weissman, Sherman; Hubbard, Tim; Myers, Richard M; Rogers, Jane; Stadler, Peter F; Lowe, Todd M; Wei, Chia-Lin; Ruan, Yijun; Struhl, Kevin; Gerstein, Mark; Antonarakis, Stylianos E; Fu, Yutao; Green, Eric D; Karaöz, Ulaş; Siepel, Adam; Taylor, James; Liefer, Laura A; Wetterstrand, Kris A; Good, Peter J; Feingold, Elise A; Guyer, Mark S; Cooper, Gregory M; Asimenos, George; Dewey, Colin N; Hou, Minmei; Nikolaev, Sergey; Montoya-Burgos, Juan I; Löytynoja, Ari; Whelan, Simon; Pardi, Fabio; Massingham, Tim; Huang, Haiyan; Zhang, Nancy R; Holmes, Ian; Mullikin, James C; Ureta-Vidal, Abel; Paten, Benedict; Seringhaus, Michael; Church, Deanna; Rosenbloom, Kate; Kent, W James; Stone, Eric A; Batzoglou, Serafim; Goldman, Nick; Hardison, Ross C; Haussler, David; Miller, Webb; Sidow, Arend; Trinklein, Nathan D; Zhang, Zhengdong D; Barrera, Leah; Stuart, Rhona; King, David C; Ameur, Adam; Enroth, Stefan; Bieda, Mark C; Kim, Jonghwan; Bhinge, Akshay A; Jiang, Nan; Liu, Jun; Yao, Fei; Vega, Vinsensius B; Lee, Charlie W H; Ng, Patrick; Shahab, Atif; Yang, Annie; Moqtaderi, Zarmik; Zhu, Zhou; Xu, Xiaoqin; Squazzo, Sharon; Oberley, Matthew J; Inman, David; Singer, Michael A; Richmond, Todd A; Munn, Kyle J; Rada-Iglesias, Alvaro; Wallerman, Ola; Komorowski, Jan; Fowler, Joanna C; Couttet, Phillippe; Bruce, Alexander W; Dovey, Oliver M; Ellis, Peter D; Langford, Cordelia F; Nix, David A; Euskirchen, Ghia; Hartman, Stephen; Urban, Alexander E; Kraus, Peter; Van Calcar, Sara; Heintzman, Nate; Kim, Tae Hoon; Wang, Kun; Qu, Chunxu; Hon, Gary; Luna, Rosa; Glass, Christopher K; Rosenfeld, M Geoff; Aldred, Shelley Force; Cooper, Sara J; Halees, Anason; Lin, Jane M; Shulha, Hennady P; Zhang, Xiaoling; Xu, Mousheng; Haidar, Jaafar N S; Yu, Yong; Ruan, Yijun; Iyer, Vishwanath R; Green, Roland D; Wadelius, Claes; Farnham, Peggy J; Ren, Bing; Harte, Rachel A; Hinrichs, Angie S; Trumbower, Heather; Clawson, Hiram; Hillman-Jackson, Jennifer; Zweig, Ann S; Smith, Kayla; Thakkapallayil, Archana; Barber, Galt; Kuhn, Robert M; Karolchik, Donna; Armengol, Lluis; Bird, Christine P; de Bakker, Paul I W; Kern, Andrew D; Lopez-Bigas, Nuria; Martin, Joel D; Stranger, Barbara E; Woodroffe, Abigail; Davydov, Eugene; Dimas, Antigone; Eyras, Eduardo; Hallgrímsdóttir, Ingileif B; Huppert, Julian; Zody, Michael C; Abecasis, Gonçalo R; Estivill, Xavier; Bouffard, Gerard G; Guan, Xiaobin; Hansen, Nancy F; Idol, Jacquelyn R; Maduro, Valerie V B; Maskeri, Baishali; McDowell, Jennifer C; Park, Morgan; Thomas, Pamela J; Young, Alice C; Blakesley, Robert W; Muzny, Donna M; Sodergren, Erica; Wheeler, David A; Worley, Kim C; Jiang, Huaiyang; Weinstock, George M; Gibbs, Richard A; Graves, Tina; Fulton, Robert; Mardis, Elaine R; Wilson, Richard K; Clamp, Michele; Cuff, James; Gnerre, Sante; Jaffe, David B; Chang, Jean L; Lindblad-Toh, Kerstin; Lander, Eric S; Koriabine, Maxim; Nefedov, Mikhail; Osoegawa, Kazutoyo; Yoshinaga, Yuko; Zhu, Baoli; de Jong, Pieter J
2007-06-14
We report the generation and analysis of functional data from multiple, diverse experiments performed on a targeted 1% of the human genome as part of the pilot phase of the ENCODE Project. These data have been further integrated and augmented by a number of evolutionary and computational analyses. Together, our results advance the collective knowledge about human genome function in several major areas. First, our studies provide convincing evidence that the genome is pervasively transcribed, such that the majority of its bases can be found in primary transcripts, including non-protein-coding transcripts, and those that extensively overlap one another. Second, systematic examination of transcriptional regulation has yielded new understanding about transcription start sites, including their relationship to specific regulatory sequences and features of chromatin accessibility and histone modification. Third, a more sophisticated view of chromatin structure has emerged, including its inter-relationship with DNA replication and transcriptional regulation. Finally, integration of these new sources of information, in particular with respect to mammalian evolution based on inter- and intra-species sequence comparisons, has yielded new mechanistic and evolutionary insights concerning the functional landscape of the human genome. Together, these studies are defining a path for pursuit of a more comprehensive characterization of human genome function.
Zuchegna, Candida; Aceto, Fabiana; Bertoni, Alessandra; Romano, Antonella; Perillo, Bruno; Laccetti, Paolo; Gottesman, Max E; Avvedimento, Enrico V; Porcellini, Antonio
2014-01-01
Histone methylation changes and formation of chromatin loops involving enhancers, promoters and 3' end regions of genes have been variously associated with active transcription in eukaryotes. We have studied the effect of activation of the retinoic A receptor, at the RARE-promoter chromatin of CASP9 and CYP26A1 genes, 15 and 45 min following RA exposure, and we found that histone H3 lysines 4 and 9 are demethylated by the lysine-specific demethylase, LSD1 and by the JMJ-domain containing demethylase, D2A. The action of the oxidase (LSD1) and a dioxygenase (JMJD2A) in the presence of Fe++ elicits an oxidation wave that locally modifies the DNA and recruits the enzymes involved in base and nucleotide excision repair (BER and NER). These events are essential for the formation of chromatin loop(s) that juxtapose the RARE element with the 5' transcription start site and the 3' end of the genes. The RARE bound-receptor governs the 5' and 3' end selection and directs the productive transcription cycle of RNA polymerase. These data mechanistically link chromatin loops, histone methylation changes and localized DNA repair with transcription. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites
Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot
2013-01-01
Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958
[Development, physiology, and cell activity of bone].
de Baat, P; Heijboer, M P; de Baat, C
2005-07-01
Bones are of crucial importance for the human body, providing skeletal support, serving as a home for the formation of haematopoietic cells, and reservoiring calcium and phosphate. Long bones develop by endochondral ossification. Flat bones develop by intramembranous ossification. Bone tissue contains hydroxyapatite and various extracellular proteins, producing bone matrix. Two biological mechanisms, determining the strength of bone, are modelling and remodelling. Modelling can change bone shape and size through bone formation by osteoblasts at some sites and through bone destruction by osteoclasts at other sites. Remodelling is bone turnover, also performed by osteoclasts and osteoblasts. The processes of modelling and remodelling are induced by mechanical loads, predominantly muscle loads. Osteoblasts develop from mesenchymal stem cells. Many stimulating factors are known to activate the differentiation. Mature osteoblasts synthesize bone matrix and may further differentiate into osteocytes. Osteocytes maintain structural bone integrity and allow bone to adapt to any mechanical and chemical stimulus. Osteoclasts derive from haematopoietic stem cells. A number of transcription and growth factors have been identified essential for osteoclast differentiation and function. Finally, there is a complex interaction between osteoblasts and osteoclasts. Bone destruction starts by attachment of osteoclasts to the bone surface. Following this, osteoclasts undergo specific morphological changes. The process of bone destruction starts by acid dissolution of hydroxyapatite. After that osteoclasts start to destruct the organic matrix.
Katoh, Hiroto; Qin, Zhaohui S.; Liu, Runhua; Wang, Lizhong; Li, Weiquan; Li, Xiangzhi; Wu, Lipeng; Du, Zhanwen; Lyons, Robert; Liu, Chang-Gong; Liu, Xiuping; Dou, Yali; Zheng, Pan; Liu, Yang
2011-01-01
SUMMARY Both H4K16 acetylation and H3K4 tri-methylation are required for gene activation. However, it is still largely unclear how these modifications are orchestrated by transcriptional factors. Here we analyzed the mechanism of the transcriptional activation by FOXP3, an X-linked suppressor of autoimmune diseases and cancers. FOXP3 binds near transcriptional start sites of its target genes. By recruiting MOF and displacing histone H3K4 demethylase PLU-1, FOXP3 increases both H4K16 acetylation and H3K4 tri-methylation at the FOXP3-associated chromatins of multiple FOXP3-activated genes. RNAi-mediated silencing of MOF reduced both gene activation and tumor suppression by FOXP3, while both somatic mutations in clinical cancer samples and targeted mutation of FOXP3 in mouse prostate epithelial disrupted nuclear localization of MOF. Our data demonstrate a pull-push model in which a single transcription factor orchestrates two epigenetic alterations necessary for gene activation and provide a mechanism for somatic inactivation of the FOXP3 protein function in cancer cells. PMID:22152480
Evolution of transcriptional enhancers and animal diversity
Rubinstein, Marcelo; de Souza, Flávio S. J.
2013-01-01
Deciphering the genetic bases that drive animal diversity is one of the major challenges of modern biology. Although four decades ago it was proposed that animal evolution was mainly driven by changes in cis-regulatory DNA elements controlling gene expression rather than in protein-coding sequences, only now are powerful bioinformatics and experimental approaches available to accelerate studies into how the evolution of transcriptional enhancers contributes to novel forms and functions. In the introduction to this Theme Issue, we start by defining the general properties of transcriptional enhancers, such as modularity and the coexistence of tight sequence conservation with transcription factor-binding site shuffling as different mechanisms that maintain the enhancer grammar over evolutionary time. We discuss past and current methods used to identify cell-type-specific enhancers and provide examples of how enhancers originate de novo, change and are lost in particular lineages. We then focus in the central part of this Theme Issue on analysing examples of how the molecular evolution of enhancers may change form and function. Throughout this introduction, we present the main findings of the articles, reviews and perspectives contributed to this Theme Issue that together illustrate some of the great advances and current frontiers in the field. PMID:24218630
Characterization of Equine Infectious Anemia Virus Integration in the Horse Genome.
Liu, Qiang; Wang, Xue-Feng; Ma, Jian; He, Xi-Jun; Wang, Xiao-Jun; Zhou, Jian-Hua
2015-06-19
Human immunodeficiency virus (HIV)-1 has a unique integration profile in the human genome relative to murine and avian retroviruses. Equine infectious anemia virus (EIAV) is another well-studied lentivirus that can also be used as a promising retro-transfection vector, but its integration into its native host has not been characterized. In this study, we mapped 477 integration sites of the EIAV strain EIAVFDDV13 in fetal equine dermal (FED) cells during in vitro infection. Published integration sites of EIAV and HIV-1 in the human genome were also analyzed as references. Our results demonstrated that EIAVFDDV13 tended to integrate into genes and AT-rich regions, and it avoided integrating into transcription start sites (TSS), which is consistent with EIAV and HIV-1 integration in the human genome. Notably, the integration of EIAVFDDV13 favored long interspersed elements (LINEs) and DNA transposons in the horse genome, whereas the integration of HIV-1 favored short interspersed elements (SINEs) in the human genome. The chromosomal environment near LINEs or DNA transposons potentially influences viral transcription and may be related to the unique EIAV latency states in equids. The data on EIAV integration in its natural host will facilitate studies on lentiviral infection and lentivirus-based therapeutic vectors.
Phosphate assimilation in Rhizobium (Sinorhizobium) meliloti: identification of a pit-like gene.
Bardin, S D; Voegele, R T; Finan, T M
1998-08-01
Rhizobium meliloti mutants defective in the phoCDET-encoded phosphate transport system form root nodules on alfalfa plants that fail to fix nitrogen (Fix-). We have previously reported that two classes of second-site mutations can suppress the Fix- phenotype of phoCDET mutants to Fix+. Here we show that one of these suppressor loci (sfx1) contains two genes, orfA and pit, which appear to form an operon transcribed in the order orfA-pit. The Pit protein is homologous to various phosphate transporters, and we present evidence that three suppressor mutations arose from a single thymidine deletion in a hepta-thymidine sequence centered 54 nucleotides upstream of the orfA transcription start site. This mutation increased the level of orfA-pit transcription. These data, together with previous biochemical evidence, show that the orfA-pit genes encode a Pi transport system that is expressed in wild-type cells grown with excess Pi but repressed in cells under conditions of Pi limitation. In phoCDET mutant cells, orfA-pit expression is repressed, but this repression is alleviated by the second-site suppressor mutations. Suppression increases orfA-pit expression compensating for the deficiencies in phosphate assimilation and symbiosis of the phoCDET mutants.
Characterization of Equine Infectious Anemia Virus Integration in the Horse Genome
Liu, Qiang; Wang, Xue-Feng; Ma, Jian; He, Xi-Jun; Wang, Xiao-Jun; Zhou, Jian-Hua
2015-01-01
Human immunodeficiency virus (HIV)-1 has a unique integration profile in the human genome relative to murine and avian retroviruses. Equine infectious anemia virus (EIAV) is another well-studied lentivirus that can also be used as a promising retro-transfection vector, but its integration into its native host has not been characterized. In this study, we mapped 477 integration sites of the EIAV strain EIAVFDDV13 in fetal equine dermal (FED) cells during in vitro infection. Published integration sites of EIAV and HIV-1 in the human genome were also analyzed as references. Our results demonstrated that EIAVFDDV13 tended to integrate into genes and AT-rich regions, and it avoided integrating into transcription start sites (TSS), which is consistent with EIAV and HIV-1 integration in the human genome. Notably, the integration of EIAVFDDV13 favored long interspersed elements (LINEs) and DNA transposons in the horse genome, whereas the integration of HIV-1 favored short interspersed elements (SINEs) in the human genome. The chromosomal environment near LINEs or DNA transposons potentially influences viral transcription and may be related to the unique EIAV latency states in equids. The data on EIAV integration in its natural host will facilitate studies on lentiviral infection and lentivirus-based therapeutic vectors. PMID:26102582
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Loya, Travis J.; O’Rourke, Thomas W.; Reines, Daniel
2012-01-01
The yeast IMD2 gene encodes an enzyme involved in GTP synthesis. Its expression is controlled by guanine nucleotides through a set of alternate start sites and an intervening transcriptional terminator. In the off state, transcription results in a short non-coding RNA that starts upstream of the gene. Transcription terminates via the Nrd1-Nab3-Sen1 complex and is degraded by the nuclear exosome. Using a sensitive terminator read-through assay, we identified trans-acting Terminator Override (TOV) genes that operate this terminator. Four genes were identified: the RNA polymerase II phosphatase SSU72, the RNA polymerase II binding protein PCF11, the TRAMP subunit TRF4 and the hnRNP-like, NAB3. The TOV phenotype can be explained by the loss of function of these gene products as described in models in which termination and RNA degradation are coupled to the phosphorylation state of RNA polymerase II's repeat domain. The most interesting mutations were those found in NAB3, which led to the finding that the removal of merely three carboxy-terminal amino acids compromised Nab3's function. This region of previously unknown function is distant from the protein's well-known RNA binding and Nrd1 binding domains. Structural homology modeling suggests this Nab3 ‘tail’ forms an α-helical multimerization domain that helps assemble it onto an RNA substrate. PMID:22564898
Identification and expression analysis of cDNA encoding insulin-like growth factor 2 in horses
KIKUCHI, Kohta; SASAKI, Keisuke; AKIZAWA, Hiroki; TSUKAHARA, Hayato; BAI, Hanako; TAKAHASHI, Masashi; NAMBO, Yasuo; HATA, Hiroshi; KAWAHARA, Manabu
2017-01-01
Insulin-like growth factor 2 (IGF2) is responsible for a broad range of physiological processes during fetal development and adulthood, but genomic analyses of IGF2 containing the 5ʹ- and 3ʹ-untranslated regions (UTRs) in equines have been limited. In this study, we characterized the IGF2 mRNA containing the UTRs, and determined its expression pattern in the fetal tissues of horses. The complete equine IGF2 mRNA sequence harboring another exon approximately 2.8 kb upstream from the canonical transcription start site was identified as a new transcript variant. As this upstream exon did not contain the start codon, the amino acid sequence was identical to the canonical variant. Analysis of the deduced amino acid sequence revealed that the protein possessed two major domains, IlGF and IGF2_C, and analysis of IGF2 sequence polymorphism in fetal tissues of Hokkaido native horse and Thoroughbreds revealed a single nucleotide polymorphism (T to C transition) at position 398 in Thoroughbreds, which caused an amino acid substitution at position 133 in the IGF2 sequence. Furthermore, the expression pattern of the IGF2 mRNA in the fetal tissues of horses was determined for the first time, and was found to be consistent with those of other species. Taken together, these results suggested that the transcriptional and translational products of the IGF2 gene have conserved functions in the fetal development of mammals, including horses. PMID:29151450
Brierley, I; Hoggett, J G
1992-07-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.
Harju-Baker, Susanna; Costa, Flávia C; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R
2008-05-01
Autonomous silencing of gamma-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the (A)gamma-globin gene was identified between -730 and -378 relative to the mRNA start site. A marked copy of the (A)gamma-globin gene inserted between locus control region 5' DNase I-hypersensitive site 1 and the epsilon-globin gene was transcriptionally silenced in adult beta-globin locus yeast artificial chromosome (beta-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the -566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low gamma-globin levels, whereas only a weak signal was detected when gamma-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from beta-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the (A)gamma-globin -566 or (G)gamma-globin -567 GATA site when gamma-globin expression was low (day 18) but not when gamma-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, gamma-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the -566/-567 GATA sites of the proximal gamma-globin promoters.
Methylation of HPA axis related genes in men with hypersexual disorder.
Jokinen, Jussi; Boström, Adrian E; Chatzittofis, Andreas; Ciuculete, Diana M; Öberg, Katarina Görts; Flanagan, John N; Arver, Stefan; Schiöth, Helgi B
2017-06-01
Hypersexual Disorder (HD) defined as non-paraphilic sexual desire disorder with components of compulsivity, impulsivity and behavioral addiction, and proposed as a diagnosis in the DSM 5, shares some overlapping features with substance use disorder including common neurotransmitter systems and dysregulated hypothalamic-pituitary-adrenal (HPA) axis function. In this study, comprising 67 HD male patients and 39 male healthy volunteers, we aimed to identify HPA-axis coupled CpG-sites, in which modifications of the epigenetic profile are associated with hypersexuality. The genome-wide methylation pattern was measured in whole blood using the Illumina Infinium Methylation EPIC BeadChip, measuring the methylation state of over 850K CpG sites. Prior to analysis, the global DNA methylation pattern was pre-processed according to standard protocols and adjusted for white blood cell type heterogeneity. We included CpG sites located within 2000bp of the transcriptional start site of the following HPA-axis coupled genes: Corticotropin releasing hormone (CRH), corticotropin releasing hormone binding protein (CRHBP), corticotropin releasing hormone receptor 1 (CRHR1), corticotropin releasing hormone receptor 2 (CRHR2), FKBP5 and the glucocorticoid receptor (NR3C1). We performed multiple linear regression models of methylation M-values to a categorical variable of hypersexuality, adjusting for depression, dexamethasone non-suppression status, Childhood Trauma Questionnaire total score and plasma levels of TNF-alpha and IL-6. Of 76 tested individual CpG sites, four were nominally significant (p<0.05), associated with the genes CRH, CRHR2 and NR3C1. Cg23409074-located 48bp upstream of the transcription start site of the CRH gene - was significantly hypomethylated in hypersexual patients after corrections for multiple testing using the FDR-method. Methylation levels of cg23409074 were positively correlated with gene expression of the CRH gene in an independent cohort of 11 healthy male subjects. The methylation levels at the identified CRH site, cg23409074, were significantly correlated between blood and four different brain regions. CRH is an important integrator of neuroendocrine stress responses in the brain, with a key role in the addiction processes. Our results show epigenetic changes in the CRH gene related to hypersexual disorder in men. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zhu, Zaihua; Meng, Weida; Liu, Peiru; Zhu, Xiaoxia; Liu, Yun; Zou, Hejian
2017-01-01
Genome-wide association studies (GWASs) have identified dozens of loci associated with gout, but for most cases, the risk genes and the underlying molecular mechanisms contributing to these associations are unknown. This study sought to understand the molecular mechanism of a common genetic variant, rs780093, in the development of gout, both in vitro and in vivo. Nuclear receptor binding protein 1 ( NRBP1 ), as a gout risk gene, and its regulatory region, 72 bp upstream of the transcription start site, designated as B1, were identified through integrative analyses of genome-wide genotype and DNA methylation data. We observed elevated NRBP1 expression in human peripheral blood mononuclear cells (PBMCs) from gout patients. In vitro luciferase reporter and protein pulldown assay results showed that DNA methylation could increase the binding of the transcription factor TFAP2A to B1, leading to suppressed gene expression. There results were further confirmed by in vivo bisulfite pyrosequencing showing that hypomethylation on B1 is associated with increased NRBP1 expression in gout patients. Hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which might contribute to the development of gout.
Qian, Jiang; Esumi, Noriko; Chen, Yangjian; Wang, Qingliang; Chowers, Itay; Zack, Donald J.
2005-01-01
Identification of tissue-specific gene regulatory networks can yield insights into the molecular basis of a tissue's development, function and pathology. Here, we present a computational approach designed to identify potential regulatory target genes of photoreceptor cell-specific transcription factors (TFs). The approach is based on the hypothesis that genes related to the retina in terms of expression, disease and/or function are more likely to be the targets of retina-specific TFs than other genes. A list of genes that are preferentially expressed in retina was obtained by integrating expressed sequence tag, SAGE and microarray datasets. The regulatory targets of retina-specific TFs are enriched in this set of retina-related genes. A Bayesian approach was employed to integrate information about binding site location relative to a gene's transcription start site. Our method was applied to three retina-specific TFs, CRX, NRL and NR2E3, and a number of potential targets were predicted. To experimentally assess the validity of the bioinformatic predictions, mobility shift, transient transfection and chromatin immunoprecipitation assays were performed with five predicted CRX targets, and the results were suggestive of CRX regulation in 5/5, 3/5 and 4/5 cases, respectively. Together, these experiments strongly suggest that RP1, GUCY2D, ABCA4 are novel targets of CRX. PMID:15967807
Lloyd, G S; Busby, S J; Savery, N J
1998-01-01
During transcription initiation at bacterial promoters, the C-terminal domain of the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence elements (known as UP elements) and with activator proteins. We have constructed a series of semi-synthetic promoters carrying both an UP element and a consensus DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor that activates transcription by making direct contacts with alphaCTD). At these promoters, the UP element was located at a variety of distances upstream of the CRP-binding site, which was fixed at position -41.5 bp upstream of the transcript start. At some positions, the UP element caused enhanced promoter activity whereas, at other positions, it had very little effect. In no case was the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical footprinting were used to study ternary RNA polymerase-CRP-promoter complexes formed at two of the most active of these promoters, and co-operativity between the binding of CRP and purified alpha subunits was studied. The footprints show that alphaCTD binds to the UP element as it is displaced upstream but that this displacement does not prevent alphaCTD from being contacted by CRP. Models to account for this are discussed. PMID:9461538
Qi, Jie; Liu, Xudong; Liu, Jinxiang; Yu, Haiyang; Wang, Wenji; Wang, Zhigang; Zhang, Quanqi
2014-08-01
Ambient temperature is one of the major abiotic environmental factors determining the main parameters of fish vital activity. HSP70 plays an essential role in heat response. In this investigation, the promoter and structure of Paralichthys olivaceus hsp70 (Pohsp70) gene was cloned and predicted. 2558 bp upstream regulatory region of Pohsp70 was annotated with four potential promoter elements and four putative binding sites of transcription factors heat shock elements (HSE, nGAAn) in the upstream of the transcription start site. In addition, one intron with 454 bp in the 5'-noncoding region was found. Quantitative Real Time PCR analysis indicated that the transcript level of Pohsp70 was raised markedly after 1 h by heat shocked. Furthermore, 25 SNPs were identified in Pohsp70 by resequencing, seven of which was associated with heat resistance. In addition, two of the seven SNPs, namely SNP14 and SNP16, were observed in strong linkage disequilibrium. The haplotype with association analysis showed TAGGAG haplotype was more represented in heat susceptible group while (DEL/T) GAATA haplotype was more frequent in heat resistant group. The heat resistant SNPs and haplotype could be candidate markers potentially serving for selective breeding programs of Japanese flounder aimed at improving anti-stress and production. Copyright © 2014 Elsevier Ltd. All rights reserved.
Lomsadze, Alexandre; Gemayel, Karl; Tang, Shiyuyun; Borodovsky, Mark
2018-05-17
In a conventional view of the prokaryotic genome organization, promoters precede operons and ribosome binding sites (RBSs) with Shine-Dalgarno consensus precede genes. However, recent experimental research suggesting a more diverse view motivated us to develop an algorithm with improved gene-finding accuracy. We describe GeneMarkS-2, an ab initio algorithm that uses a model derived by self-training for finding species-specific (native) genes, along with an array of precomputed "heuristic" models designed to identify harder-to-detect genes (likely horizontally transferred). Importantly, we designed GeneMarkS-2 to identify several types of distinct sequence patterns (signals) involved in gene expression control, among them the patterns characteristic for leaderless transcription as well as noncanonical RBS patterns. To assess the accuracy of GeneMarkS-2, we used genes validated by COG (Clusters of Orthologous Groups) annotation, proteomics experiments, and N-terminal protein sequencing. We observed that GeneMarkS-2 performed better on average in all accuracy measures when compared with the current state-of-the-art gene prediction tools. Furthermore, the screening of ∼5000 representative prokaryotic genomes made by GeneMarkS-2 predicted frequent leaderless transcription in both archaea and bacteria. We also observed that the RBS sites in some species with leadered transcription did not necessarily exhibit the Shine-Dalgarno consensus. The modeling of different types of sequence motifs regulating gene expression prompted a division of prokaryotic genomes into five categories with distinct sequence patterns around the gene starts. © 2018 Lomsadze et al.; Published by Cold Spring Harbor Laboratory Press.
Puhl, Henry L.; Ikeda, Stephen R.
2008-01-01
Voltage-gated sodium channels (VGSC) are critical membrane components that participate in the electrical activity of excitable cells. The type one VGSC family includes the tetrodotoxin insensitive sodium channel, Nav1.8, encoded by the Scn10a gene. Nav1.8 expression is restricted to small and medium diameter nociceptive sensory neurons of the dorsal root (DRG) and cranial sensory ganglia. In order to understand the stringent transcriptional regulation of the Scn10a gene, the sensory neuron specific promoter was functionally identified. While identifying the mRNA 5’ end, alternative splicing within the 5’ UTR was observed to create heterogeneity in the RNA transcript. Four kilobases of upstream genomic DNA was cloned and the presence of tissue specific promoter activity was tested by microinjection and adenoviral infection of fluorescent protein reporter constructs into primary mouse and rat neurons, and cell lines. The region contained many putative transcription factor binding sites and strong homology with the predicted rat ortholog. Homology to the predicted human ortholog was limited to the proximal end and several conserved cis elements were noted. Two regulatory modules were identified by microinjection of reporter constructs into DRG and superior cervical ganglia neurons: a neuron specific proximal promoter region between −1.6 and −0.2kb of the transcription start site cluster, and a distal sensory neuron switch region beyond −1.6kb that restricted fluorescent protein expression to a subset of primary sensory neurons. PMID:18466327
Heidari, N; Miller, A V; Hicks, M A; Marking, C B; Harada, H
2012-01-01
Glucocorticoids (GCs) are common components of many chemotherapeutic regimens for lymphoid malignancies. GC-induced apoptosis involves an intrinsic mitochondria-dependent pathway. BIM (BCL-2-interacting mediator of cell death), a BCL-2 homology 3-only pro-apoptotic protein, is upregulated by dexamethasone (Dex) treatment in acute lymphoblastic leukemia cells and has an essential role in Dex-induced apoptosis. It has been indicated that Dex-induced BIM is regulated mainly by transcription, however, the molecular mechanisms including responsible transcription factors are unclear. In this study, we found that Dex treatment induced transcription factor Runx2 and c-Jun in parallel with BIM induction. Dex-induced BIM and apoptosis were decreased in cells harboring dominant-negative c-Jun and were increased in cells with c-Jun overexpression. Cells harboring short hairpin RNA for Runx2 also decreased BIM induction and apoptosis. On the Bim promoter, c-Jun bound to and activated the AP-1-binding site at about −2.7 kb from the transcription start site. Treatment with RU486, a GC receptor antagonist, blocked Dex-induced Runx2, c-Jun and BIM induction, as well as apoptosis. Furthermore, pretreatment with SB203580, a p38-mitogen-activated protein kinase (MAPK) inhibitor, decreased Dex-induced Runx2, c-Jun and BIM, suggesting that p38-MAPK activation is upstream of the induction of these molecules. In conclusion, we identified the critical signaling pathway for GC-induced apoptosis, and targeting these molecules may be an alternative approach to overcome GC-resistance in leukemia treatment. PMID:22825467
Intrinsic DNA curvature in trypanosomes.
Smircich, Pablo; El-Sayed, Najib M; Garat, Beatriz
2017-11-09
Trypanosoma cruzi and Trypanosoma brucei are protozoan parasites causing Chagas disease and African sleeping sickness, displaying unique features of cellular and molecular biology. Remarkably, no canonical signals for RNA polymerase II promoters, which drive protein coding genes transcription, have been identified so far. The secondary structure of DNA has long been recognized as a signal in biological processes and more recently, its involvement in transcription initiation in Leishmania was proposed. In order to study whether this feature is conserved in trypanosomatids, we undertook a genome wide search for intrinsic DNA curvature in T. cruzi and T. brucei. Using a region integrated intrinsic curvature (RIIC) scoring that we previously developed, a non-random distribution of sequence-dependent curvature was observed. High RIIC scores were found to be significantly correlated with transcription start sites in T. cruzi, which have been mapped in divergent switch regions, whereas in T. brucei, the high RIIC scores correlated with sites that have been involved not only in RNA polymerase II initiation but also in termination. In addition, we observed regions with high RIIC score presenting in-phase tracts of Adenines, in the subtelomeric regions of the T. brucei chromosomes that harbor the variable surface glycoproteins genes. In both T. cruzi and T. brucei genomes, a link between DNA conformational signals and gene expression was found. High sequence dependent curvature is associated with transcriptional regulation regions. High intrinsic curvature also occurs at the T. brucei chromosome subtelomeric regions where the recombination processes involved in the evasion of the immune host system take place. These findings underscore the relevance of indirect DNA readout in these ancient eukaryotes.
Regulation of the angiopoietin-2 gene by hCG in ovarian cancer cell line OVCAR-3.
Pietrowski, D; Wiehle, P; Sator, M; Just, A; Keck, C
2010-05-01
Angiogenesis is a crucial step in growing tissues including many tumors. It is regulated by pro- and antiangiogenic factors including the family of angiopoietins and their corresponding receptors. In previous work we have shown that in human ovarian cells the expression of angiopoietin 2 (ANG2) is regulated by human chorionic gonadotropin (hCG). To better understand the mechanisms of hCG-dependent regulation of the ANG2-gene we have now investigated upstream regulatory active elements of the ANG2-promoter in the ovarian carcinoma cell line OVCAR-3. We cloned several ANG2-promoter-fragments of different lengths into a luciferase reporter-gene-vector and analyzed the corresponding ANG2 expression before and after hCG stimulation. We identified regions of the ANG2-promoter between 1 048 bp and 613 bp upstream of the transcriptional start site where hCG-dependent pathways promote a significant downregulation of gene expression. By sequence analysis of this area we found several potential binding sites for transcription factors that are involved in regulation of ANG2-expression, vascular development and ovarian function. These encompass the forkhead family transcription factors FOXC2 and FOXO1 as well as the CCAAT/enhancer binding protein family (C/EBP). In conclusion, we have demonstrated that the regulation of ANG2-expression in ovarian cancer cells is hCG-dependent and we suggest that forkhead transcription factor and C/EBP-dependent pathways are involved in the regulation of ANG2-expression in ovarian cancer cells. Georg Thieme Verlag KG Stuttgart-New York.
Staniforth, Vanisree; Wang, Sheng-Yang; Shyur, Lie-Fen; Yang, Ning-Sun
2004-02-13
Tumor necrosis factor alpha (TNF-alpha) contributes to the pathogenesis of both acute and chronic inflammatory diseases and has been a target for the development of new anti-inflammatory drugs. Shikonins, the naphthoquinone pigments present in the root tissues of Lithospermum erythrorhizon Sieb. et Zucc. (Boraginaceae), have been reported to exert anti-inflammatory effects both in vitro and in vivo. In this study, we evaluated the effects of shikonin and its derivatives on the transcriptional activation of human TNF-alpha promoter in a gene gun-transfected mouse skin system by using a luciferase reporter gene assay. The crude plant extract of L. erythrorhizon as well as derived individual compounds shikonin, isobutyryl shikonin, acetyl shikonin, dimethylacryl shikonin and isovaleryl shikonin showed significant dose-dependent inhibition of TNF-alpha promoter activation. Among the tested compounds, shikonin and isobutyryl shikonin exhibited the highest inhibition of TNF-alpha promoter activation and also showed significant suppression of transgenic human TNF-alpha mRNA expression and protein production. We demonstrated that shikonin-inhibitory response was retained in the core TNF-alpha promoter region containing the TATA box and a 48-bp downstream sequence relative to the transcription start site. Further our results indicated that shikonin suppressed the basal transcription and activator-regulated transcription of TNF-alpha by inhibiting the binding of transcription factor IID protein complex (TATA box-binding protein) to TATA box. These in vivo results suggest that shikonins inhibit the transcriptional activation of the human TNF-alpha promoter through interference with the basal transcription machinery. Thus, shikonins may have clinical potential as anti-inflammatory therapeutics.
2011-01-01
Background Mounting evidence suggests a major role for epigenetic feedback in Plasmodium falciparum transcriptional regulation. Long non-coding RNAs (lncRNAs) have recently emerged as a new paradigm in epigenetic remodeling. We therefore set out to investigate putative roles for lncRNAs in P. falciparum transcriptional regulation. Results We used a high-resolution DNA tiling microarray to survey transcriptional activity across 22.6% of the P. falciparum strain 3D7 genome. We identified 872 protein-coding genes and 60 putative P. falciparum lncRNAs under developmental regulation during the parasite's pathogenic human blood stage. Further characterization of lncRNA candidates led to the discovery of an intriguing family of lncRNA telomere-associated repetitive element transcripts, termed lncRNA-TARE. We have quantified lncRNA-TARE expression at 15 distinct chromosome ends and mapped putative transcriptional start and termination sites of lncRNA-TARE loci. Remarkably, we observed coordinated and stage-specific expression of lncRNA-TARE on all chromosome ends tested, and two dominant transcripts of approximately 1.5 kb and 3.1 kb transcribed towards the telomere. Conclusions We have characterized a family of 22 telomere-associated lncRNAs in P. falciparum. Homologous lncRNA-TARE loci are coordinately expressed after parasite DNA replication, and are poised to play an important role in P. falciparum telomere maintenance, virulence gene regulation, and potentially other processes of parasite chromosome end biology. Further study of lncRNA-TARE and other promising lncRNA candidates may provide mechanistic insight into P. falciparum transcriptional regulation. PMID:21689454
Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors
Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo
2014-01-01
The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around −120 to −80 bp, while highly effective sgRNAs targeted from −147 to −89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells. PMID:24500196
Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo
2014-04-01
The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.
Wen, Zhensong; Sertil, Odeniel; Cheng, Yongxin; Zhang, Shanshan; Liu, Xue; Wang, Wen-Ching
2015-01-01
Streptococcus pneumoniae is a major bacterial pathogen in humans. Its polysaccharide capsule is a key virulence factor that promotes bacterial evasion of human phagocytic killing. While S. pneumoniae produces at least 94 antigenically different types of capsule, the genes for biosynthesis of almost all capsular types are arranged in the same locus. The transcription of the capsular polysaccharide (cps) locus is not well understood. This study determined the transcriptional features of the cps locus in the type 2 virulent strain D39. The initial analysis revealed that the cps genes are cotranscribed from a major transcription start site at the −25 nucleotide (G) upstream of cps2A, the first gene in the locus. Using unmarked chromosomal truncations and a luciferase-based transcriptional reporter, we showed that the full transcription of the cps genes not only depends on the core promoter immediately upstream of cps2A, but also requires additional elements upstream of the core promoter, particularly a 59-bp sequence immediately upstream of the core promoter. Unmarked deletions of these promoter elements in the D39 genome also led to significant reduction in CPS production and virulence in mice. Lastly, common cps gene (cps2ABCD) mutants did not show significant abnormality in cps transcription, although they produced significantly less CPS, indicating that the CpsABCD proteins are involved in the encapsulation of S. pneumoniae in a posttranscriptional manner. This study has yielded important information on the transcriptional characteristics of the cps locus in S. pneumoniae. PMID:25733517
Ahmed, Mumdooh A M; Bamm, Vladimir V; Harauz, George; Ladizhansky, Vladimir
2007-08-28
The genes of the oligodendrocyte lineage (Golli) encode a family of developmentally regulated isoforms of myelin basic protein. The "classic" MBP isoforms arise from transcription start site 3, whereas Golli-specific isoforms arise from transcription start site 1, and comprise both Golli-specific and classic MBP sequences. The Golli isoform BG21 has been suggested to play roles in myelination and T cell activation pathways. It is an intrinsically disordered protein, thereby presenting a large effective surface area for interaction with other proteins such as Golli-interacting protein. We have used multidimensional heteronuclear NMR spectroscopy to achieve sequence-specific resonance assignments of the recombinant murine BG21 in physiologically relevant buffer, to analyze its secondary structure using chemical shift indexing (CSI), and to investigate its backbone dynamics using 15N spin relaxation measurements. We have assigned 184 out of 199 residues unambiguously. The CSI analysis revealed little ordered secondary structure under these conditions, with only some small fragments having a slight tendency toward alpha-helicity, which may represent putative recognition motifs. The 15N relaxation and NOE measurements confirmed the general behavior of the protein as an extended polypeptide chain, with the N-terminal Golli-specific portion (residues S5-T69) being exceptionally flexible, even in comparison to other intrinsically disordered proteins that have been studied this way. The high degree of flexibility of this N-terminal region may be to provide additional plasticity, or conformational adaptability, in protein-protein interactions. Another highly mobile segment, A126-S127-G128-G129, may function as a hinge.
Genome-wide mapping of 5-hydroxymethylcytosine in embryonic stem cells.
Pastor, William A; Pape, Utz J; Huang, Yun; Henderson, Hope R; Lister, Ryan; Ko, Myunggon; McLoughlin, Erin M; Brudno, Yevgeny; Mahapatra, Sahasransu; Kapranov, Philipp; Tahiliani, Mamta; Daley, George Q; Liu, X Shirley; Ecker, Joseph R; Milos, Patrice M; Agarwal, Suneet; Rao, Anjana
2011-05-19
5-hydroxymethylcytosine (5hmC) is a modified base present at low levels in diverse cell types in mammals. 5hmC is generated by the TET family of Fe(II) and 2-oxoglutarate-dependent enzymes through oxidation of 5-methylcytosine (5mC). 5hmC and TET proteins have been implicated in stem cell biology and cancer, but information on the genome-wide distribution of 5hmC is limited. Here we describe two novel and specific approaches to profile the genomic localization of 5hmC. The first approach, termed GLIB (glucosylation, periodate oxidation, biotinylation) uses a combination of enzymatic and chemical steps to isolate DNA fragments containing as few as a single 5hmC. The second approach involves conversion of 5hmC to cytosine 5-methylenesulphonate (CMS) by treatment of genomic DNA with sodium bisulphite, followed by immunoprecipitation of CMS-containing DNA with a specific antiserum to CMS. High-throughput sequencing of 5hmC-containing DNA from mouse embryonic stem (ES) cells showed strong enrichment within exons and near transcriptional start sites. 5hmC was especially enriched at the start sites of genes whose promoters bear dual histone 3 lysine 27 trimethylation (H3K27me3) and histone 3 lysine 4 trimethylation (H3K4me3) marks. Our results indicate that 5hmC has a probable role in transcriptional regulation, and suggest a model in which 5hmC contributes to the 'poised' chromatin signature found at developmentally-regulated genes in ES cells.
Deep sequencing reveals distinct patterns of DNA methylation in prostate cancer.
Kim, Jung H; Dhanasekaran, Saravana M; Prensner, John R; Cao, Xuhong; Robinson, Daniel; Kalyana-Sundaram, Shanker; Huang, Christina; Shankar, Sunita; Jing, Xiaojun; Iyer, Matthew; Hu, Ming; Sam, Lee; Grasso, Catherine; Maher, Christopher A; Palanisamy, Nallasivam; Mehra, Rohit; Kominsky, Hal D; Siddiqui, Javed; Yu, Jindan; Qin, Zhaohui S; Chinnaiyan, Arul M
2011-07-01
Beginning with precursor lesions, aberrant DNA methylation marks the entire spectrum of prostate cancer progression. We mapped the global DNA methylation patterns in select prostate tissues and cell lines using MethylPlex-next-generation sequencing (M-NGS). Hidden Markov model-based next-generation sequence analysis identified ∼68,000 methylated regions per sample. While global CpG island (CGI) methylation was not differential between benign adjacent and cancer samples, overall promoter CGI methylation significantly increased from ~12.6% in benign samples to 19.3% and 21.8% in localized and metastatic cancer tissues, respectively (P-value < 2 × 10(-16)). We found distinct patterns of promoter methylation around transcription start sites, where methylation occurred not only on the CGIs, but also on flanking regions and CGI sparse promoters. Among the 6691 methylated promoters in prostate tissues, 2481 differentially methylated regions (DMRs) are cancer-specific, including numerous novel DMRs. A novel cancer-specific DMR in the WFDC2 promoter showed frequent methylation in cancer (17/22 tissues, 6/6 cell lines), but not in the benign tissues (0/10) and normal PrEC cells. Integration of LNCaP DNA methylation and H3K4me3 data suggested an epigenetic mechanism for alternate transcription start site utilization, and these modifications segregated into distinct regions when present on the same promoter. Finally, we observed differences in repeat element methylation, particularly LINE-1, between ERG gene fusion-positive and -negative cancers, and we confirmed this observation using pyrosequencing on a tissue panel. This comprehensive methylome map will further our understanding of epigenetic regulation in prostate cancer progression.
Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC
2008-01-01
Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135
Tamarkin-Ben-Harush, Ana; Vasseur, Jean-Jacques; Debart, Françoise; Ulitsky, Igor; Dikstein, Rivka
2017-02-08
Transcription start-site (TSS) selection and alternative promoter (AP) usage contribute to gene expression complexity but little is known about their impact on translation. Here we performed TSS mapping of the translatome following energy stress. Assessing the contribution of cap-proximal TSS nucleotides, we found dramatic effect on translation only upon stress. As eIF4E levels were reduced, we determined its binding to capped-RNAs with different initiating nucleotides and found the lowest affinity to 5'cytidine in correlation with the translational stress-response. In addition, the number of differentially translated APs was elevated following stress. These include novel glucose starvation-induced downstream transcripts for the translation regulators eIF4A and Pabp, which are also translationally-induced despite general translational inhibition. The resultant eIF4A protein is N-terminally truncated and acts as eIF4A inhibitor. The induced Pabp isoform has shorter 5'UTR removing an auto-inhibitory element. Our findings uncovered several levels of coordination of transcription and translation responses to energy stress.
Mitochondrial genes are altered in blood early in Alzheimer's disease.
Lunnon, Katie; Keohane, Aoife; Pidsley, Ruth; Newhouse, Stephen; Riddoch-Contreras, Joanna; Thubron, Elisabeth B; Devall, Matthew; Soininen, Hikka; Kłoszewska, Iwona; Mecocci, Patrizia; Tsolaki, Magda; Vellas, Bruno; Schalkwyk, Leonard; Dobson, Richard; Malik, Afshan N; Powell, John; Lovestone, Simon; Hodges, Angela
2017-05-01
Although mitochondrial dysfunction is a consistent feature of Alzheimer's disease in the brain and blood, the molecular mechanisms behind these phenomena are unknown. Here we have replicated our previous findings demonstrating reduced expression of nuclear-encoded oxidative phosphorylation (OXPHOS) subunits and subunits required for the translation of mitochondrial-encoded OXPHOS genes in blood from people with Alzheimer's disease and mild cognitive impairment. Interestingly this was accompanied by increased expression of some mitochondrial-encoded OXPHOS genes, namely those residing closest to the transcription start site of the polycistronic heavy chain mitochondrial transcript (MT-ND1, MT-ND2, MT-ATP6, MT-CO1, MT-CO2, MT-C03) and MT-ND6 transcribed from the light chain. Further we show that mitochondrial DNA copy number was unchanged suggesting no change in steady-state numbers of mitochondria. We suggest that an imbalance in nuclear and mitochondrial genome-encoded OXPHOS transcripts may drive a negative feedback loop reducing mitochondrial translation and compromising OXPHOS efficiency, which is likely to generate damaging reactive oxygen species. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
Mahajan, Kiran; Malla, Pavani; Lawrence, Harshani R; Chen, Zhihua; Kumar-Sinha, Chandan; Malik, Rohit; Shukla, Sudhanshu; Kim, Jongphil; Coppola, Domenico; Lawrence, Nicholas J; Mahajan, Nupam P
2017-06-12
The androgen receptor (AR) is critical for the progression of prostate cancer to a castration-resistant (CRPC) state. AR antagonists are ineffective due to their inability to repress the expression of AR or its splice variant, AR-V7. Here, we report that the tyrosine kinase ACK1 (TNK2) phosphorylates histone H4 at tyrosine 88 upstream of the AR transcription start site. The WDR5/MLL2 complex reads the H4-Y88-phosphorylation marks and deposits the transcriptionally activating H3K4-trimethyl marks promoting AR transcription. Reversal of the pY88-H4 epigenetic marks by the ACK1 inhibitor (R)-9bMS-sensitized naive and enzalutamide-resistant prostate cancer cells and reduced AR and AR-V7 levels to mitigate CRPC tumor growth. Thus, a feedforward ACK1/pY88-H4/WDR5/MLL2/AR epigenetic circuit drives CRPC and is necessary for maintenance of the malignant state. Copyright © 2017 Elsevier Inc. All rights reserved.
Strakova, Zuzana; Reed, Jennifer; Ihnatovych, Ivanna
2010-06-01
Transcriptional coactivator with PDZ-binding motif (TAZ) is known to bind to a variety of transcription factors to control cell differentiation and organ development. However, its role in uterine physiology has not yet been described. To study its regulation during the unique process of differentiation of fibroblasts into decidual cells (decidualization), we utilized the human uterine fibroblast (HuF) in vitro cell model. Immunocytochemistry data demonstrated that the majority of the TAZ protein is localized in the nucleus. Treatment of HuF cells with the embryonic stimulus cytokine interleukin 1 beta in the presence of steroid hormones (estradiol-17 beta and medroxyprogesterone acetate) for 13 days did not cause any apparent TAZ mRNA changes but resulted in a significant TAZ protein decline (approximately 62%) in total cell lysates. Analysis of cytosolic and nuclear extracts revealed that the decline of total TAZ was caused primarily by a drop of TAZ protein levels in the nucleus. TAZ was localized on the peroxisome proliferator-activated receptor response element site (located at position -1200 bp relative to the transcription start site) of the genomic region of decidualization marker insulin-like growth factor-binding protein 1 (IGFBP1) in HuF cells as detected by chromatin immunoprecipitation. TAZ is also present in human endometrium tissue as confirmed by immunohistochemistry. During the secretory phase of the menstrual cycle, specific TAZ staining particularly diminishes in the stroma, suggesting its participation during the decidualization process, as well as implantation. During early baboon pregnancy, TAZ protein expression remains minimal in the endometrium close to the implantation site. In summary, the presented evidence shows for the first time to date TAZ protein in the human uterine tract, its downregulation during in vitro decidualization, and its localization on the IGFBP1 promoter region, all of which indicate its presence in the uterine differentiation program during pregnancy.
Uittenbogaard, Martine; Martinka, Debra L.; Chiaramello, Anne
2006-01-01
Nex1/MATH-2 is a neurogenic basic Helix-Loop-Helix (bHLH) transcription factor that belongs to the NeuroD subfamily. Its expression parallels that of the GAP-43 gene and peaks during brain development, when neurite outgrowth and synaptogenesis are highly active. We previously observed a direct correlation between the levels of expression of Nex1 and GAP-43 proteins, which resulted in extensive neurite outgrowth and neuronal differentiation of PC12 cells in the absence of nerve growth factor. Since the GAP-43 gene is a target for bHLH regulation, we investigated whether Nex1 could regulate the activity of the GAP-43 promoter. We found that among the members of the NeuroD subfamily, Nex1 promoted maximal activity of the GAP-43 promoter. The Nex1-mediated activity is restricted to the conserved E1–E2 cluster located near the major transcription start sites. By electrophoretic mobility shift assay and site-directed mutagenesis, we showed that Nex1 binds as homodimers and that the E1 E-box is a high affinity binding site. We further found that Nex1 released the ME1 E-protein-mediated repression in a concentration dependent manner. Thus, the E1–E2 cluster has a dual function: it can mediate activation or repression depending on the interacting bHLH proteins. Finally, a series of N-terminal and C-terminal deletions revealed that Nex1 transcriptional activity is linked to two distinct transactivation domains, TAD1 and TAD2, with TAD1 being unique to Nex1. Together, our results suggest that Nex1 may engage in selective interactions with components of the core transcriptional machinery whose assembly is dictated by the architecture of the GAP-43 promoter and cellular environment. PMID:12562512
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurilla, M.G.; Stone, H.O.; Keene, J.D.
The 3' end of the genomic RNA of Newcastle disease virus (NDV) has been sequenced and the leader RNA defined. Using hybridization to a 3'-end-labeled genome, leader RNA species from in vitro transcription reactions and from infected cell extracts were found to be 47 and 53 nucleotides long. In addition, the start site of the 3'-proximal mRNA was determined by sequence analysis of in vitro (beta-32P)GTP-labeled transcription products. The genomic sequence extending beyond the leader region demonstrated an open reading frame for at least 42 amino acids and probably represents the amino terminus of the nucleocapsid protein (NP). The terminalmore » 8 nucleotides of the NDV genome were identical to those of measles virus and Sendai virus while the sequence of the distal half of the leader region was more similar to that of vesicular stomatitis virus. These data argue for strong evolutionary relatedness between the paramyxovirus and rhabdovirus groups.« less
Properties of promoters cloned randomly from the Saccharomyces cerevisiae genome.
Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K
1988-01-01
Promoters were isolated at random from the genome of Saccharomyces cerevisiae by using a plasmid that contains a divergently arrayed pair of promoterless reporter genes. A comprehensive library was constructed by inserting random (DNase I-generated) fragments into the intergenic region upstream from the reporter genes. Simple in vivo assays for either reporter gene product (alcohol dehydrogenase or beta-galactosidase) allowed the rapid identification of promoters from among these random fragments. Poly(dA-dT) homopolymer tracts were present in three of five randomly cloned promoters. With two exceptions, each RNA start site detected was 40 to 100 base pairs downstream from a TATA element. All of the randomly cloned promoters were capable of activating reporter gene transcription bidirectionally. Interestingly, one of the promoter fragments originated in a region of the S. cerevisiae rDNA spacer; regulated divergent transcription (presumably by RNA polymerase II) initiated in the same region. Images PMID:2847031
Lovewell, Thomas R. J.; McDonagh, Andrew J.; Messenger, Andrew G.; Azzouz, Mimoun; Tazi-Ahnini, Rachid
2015-01-01
Background The autoimmune regulator (AIRE) is expressed in the thymus, particularly in thymic medullary epithelial cells (mTECs), and is required for the ectopic expression of a diverse range of peripheral tissue antigens by mTECs, facilitating their ability to perform negative selection of auto-reactive immature T-cells. The expression profile of peripheral tissue antigens is affected not only by AIRE deficiency but also with variation of AIRE activity in the thymus. Method and Results Therefore we screened 591bp upstream of the AIRE transcription start site including AIRE minimal promoter for single nucleotide polymorphism (SNPs) and identified two SNPs -655R (rs117557896) and -230Y (rs751032) respectively. To study the effect of these variations on AIRE promoter activity we generated a Flp-In host cell line which was stably transfected with a single copy of the reporter vector. Relative promoter activity was estimated by comparing the luciferase specific activity for lysates of the different reporter AIRE promoter-reporter gene constructs including AIRE-655G AIRE-230C, AIRE-655G AIRE-230T and AIRE-655A AIRE-230C. The analysis showed that the commonest haplotype AIRE-655G AIRE-230C has the highest luciferase specific activity (p<0.001). Whereas AIRE-655G AIRE-230T has a luciferase specific activity value that approaches null. Both AIRE promoter polymorphic sites have one allele that forms a CpG methylation site which we determined can be methylated in methylation assays using the M.SssI CpG methyltransferase. Conclusion AIRE-230Y is in a conserved region of the promoter and is adjacent to a predicted WT1 transcription factor binding site, suggesting that AIRE-230Y affects AIRE expression by influencing the binding of biochemical factors to this region. Our findings show that AIRE-655GAIRE-230T haplotype could dramatically alter AIRE transcription and so have an effect on the process of negative selection and affect susceptibility to autoimmune conditions. PMID:25978041
Role of SRC-3delta4 in the Progression and Metastasis of Castration-Resistant Prostate Cancer
2013-10-01
Expression of SRC-3∆4, GAPDH, and AR target genes including PSA, KLK2, IGFBP5, Cyclin A2, and UBE2C was determined by RT-qPCR analysis . Data are...Expression of AR (B), GAPDH, and TMPRSS2- ERG (C) was determined by RT-qPCR analysis . Data are presented using the comparative Ct method, in which GAPDH...input. An irrelevant region (1800 bp downstream of transcription start site) was served as a negative control. (E) and (F). ChIP analysis of SRC-3∆4’s
2011-07-27
domain (type 2 phosphatidic acid phosphatase) and may be a PAP2 like superfamily member. In order to localize the promoter(s) for these three genes...Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 which amino acid residue(s) was critical for the enzyme activity. This enzyme possesses a...analyzed the role of eight conserved amino acid residues. The amino acids to be mutated were chosen based on the sequence alignment of several class C
Distance between RBS and AUG plays an important role in overexpression of recombinant proteins.
Berwal, Sunil K; Sreejith, R K; Pal, Jayanta K
2010-10-15
The spacing between ribosome binding site (RBS) and AUG is crucial for efficient overexpression of genes when cloned in prokaryotic expression vectors. We undertook a brief study on the overexpression of genes cloned in Escherichia coli expression vectors, wherein the spacing between the RBS and the start codon was varied. SDS-PAGE and Western blot analysis indicated a high level of protein expression only in constructs where the spacing between RBS and AUG was approximately 40 nucleotides or more, despite the synthesis of the transcripts in the representative cases investigated. Copyright 2010 Elsevier Inc. All rights reserved.
Schwer, Bjoern; Wei, Pei-Chi; Chang, Amelia N; Kao, Jennifer; Du, Zhou; Meyers, Robin M; Alt, Frederick W
2016-02-23
High-throughput, genome-wide translocation sequencing (HTGTS) studies of activated B cells have revealed that DNA double-strand breaks (DSBs) capable of translocating to defined bait DSBs are enriched around the transcription start sites (TSSs) of active genes. We used the HTGTS approach to investigate whether a similar phenomenon occurs in primary neural stem/progenitor cells (NSPCs). We report that breakpoint junctions indeed are enriched around TSSs that were determined to be active by global run-on sequencing analyses of NSPCs. Comparative analyses of transcription profiles in NSPCs and B cells revealed that the great majority of TSS-proximal junctions occurred in genes commonly expressed in both cell types, possibly because this common set has higher transcription levels on average than genes transcribed in only one or the other cell type. In the latter context, among all actively transcribed genes containing translocation junctions in NSPCs, those with junctions located within 2 kb of the TSS show a significantly higher transcription rate on average than genes with junctions in the gene body located at distances greater than 2 kb from the TSS. Finally, analysis of repair junction signatures of TSS-associated translocations in wild-type versus classical nonhomologous end-joining (C-NHEJ)-deficient NSPCs reveals that both C-NHEJ and alternative end-joining pathways can generate translocations by joining TSS-proximal DSBs to DSBs on other chromosomes. Our studies show that the generation of transcription-associated DSBs is conserved across divergent cell types.
Cogoi, Susanna; Paramasivam, Manikandan; Membrino, Alexandro; Yokoyama, Kazunari K.; Xodo, Luigi E.
2010-01-01
The murine KRAS promoter contains a G-rich nuclease hypersensitive element (GA-element) upstream of the transcription start site that is essential for transcription. Pulldown and chromatin immunoprecipitation assays demonstrate that this GA-element is bound by the Myc-associated zinc finger (MAZ) and poly(ADP-ribose) polymerase 1 (PARP-1) proteins. These proteins are crucial for transcription, because when they are knocked down by short hairpin RNA, transcription is down-regulated. This is also the case when the poly(ADP-ribosyl)ation activity of PARP-1 is inhibited by 3,4-dihydro-5-[4-(1-piperidinyl) butoxyl]-1(2H) isoquinolinone. We found that MAZ specifically binds to the duplex and quadruplex conformations of the GA-element, whereas PARP-1 shows specificity only for the G-quadruplex. On the basis of fluorescence resonance energy transfer melting and polymerase stop assays we saw that MAZ stabilizes the KRAS quadruplex. When the capacity of folding in the GA-element is abrogated by specific G → T or G → A point mutations, KRAS transcription is down-regulated. Conversely, guanidine-modified phthalocyanines, which specifically interact with and stabilize the KRAS G-quadruplex, push the promoter activity up to more than double. Collectively, our data support a transcription mechanism for murine KRAS that involves MAZ, PARP-1 and duplex-quadruplex conformational changes in the promoter GA-element. PMID:20457603
Zipper plot: visualizing transcriptional activity of genomic regions.
Avila Cobos, Francisco; Anckaert, Jasper; Volders, Pieter-Jan; Everaert, Celine; Rombaut, Dries; Vandesompele, Jo; De Preter, Katleen; Mestdagh, Pieter
2017-05-02
Reconstructing transcript models from RNA-sequencing (RNA-seq) data and establishing these as independent transcriptional units can be a challenging task. Current state-of-the-art tools for long non-coding RNA (lncRNA) annotation are mainly based on evolutionary constraints, which may result in false negatives due to the overall limited conservation of lncRNAs. To tackle this problem we have developed the Zipper plot, a novel visualization and analysis method that enables users to simultaneously interrogate thousands of human putative transcription start sites (TSSs) in relation to various features that are indicative for transcriptional activity. These include publicly available CAGE-sequencing, ChIP-sequencing and DNase-sequencing datasets. Our method only requires three tab-separated fields (chromosome, genomic coordinate of the TSS and strand) as input and generates a report that includes a detailed summary table, a Zipper plot and several statistics derived from this plot. Using the Zipper plot, we found evidence of transcription for a set of well-characterized lncRNAs and observed that fewer mono-exonic lncRNAs have CAGE peaks overlapping with their TSSs compared to multi-exonic lncRNAs. Using publicly available RNA-seq data, we found more than one hundred cases where junction reads connected protein-coding gene exons with a downstream mono-exonic lncRNA, revealing the need for a careful evaluation of lncRNA 5'-boundaries. Our method is implemented using the statistical programming language R and is freely available as a webtool.
Ares, Miguel A; Fernández-Vázquez, José L; Pacheco, Sabino; Martínez-Santos, Verónica I; Jarillo-Quijada, Ma Dolores; Torres, Javier; Alcántar-Curiel, María D; González-Y-Merchand, Jorge A; De la Cruz, Miguel A
2017-01-01
Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae.
Ares, Miguel A.; Fernández-Vázquez, José L.; Pacheco, Sabino; Martínez-Santos, Verónica I.; Jarillo-Quijada, Ma. Dolores; Torres, Javier; Alcántar-Curiel, María D.; González-y-Merchand, Jorge A.; De la Cruz, Miguel A.
2017-01-01
Klebsiella pneumoniae is a common opportunistic pathogen causing nosocomial infections. One of the main virulence determinants of K. pneumoniae is the type 3 pilus (T3P). T3P helps the bacterial interaction to both abiotic and biotic surfaces and it is crucial for the biofilm formation. T3P is genetically organized in three transcriptional units: the mrkABCDF polycistronic operon, the mrkHI bicistronic operon and the mrkJ gene. MrkH is a regulatory protein encoded in the mrkHI operon, which positively regulates the mrkA pilin gene and its own expression. In contrast, the H-NS nucleoid protein represses the transcriptional expression of T3P. Here we reported that MrkH and H-NS positively and negatively regulate mrkJ expression, respectively, by binding to the promoter of mrkJ. MrkH protein recognized a sequence located at position -63.5 relative to the transcriptional start site of mrkJ gene. Interestingly, our results show that, in addition to its known function as classic transcriptional activator, MrkH also positively controls the expression of mrk genes by acting as an anti-repressor of H-NS; moreover, our results support the notion that high levels of MrkH repress T3P expression. Our data provide new insights about the complex regulatory role of the MrkH protein on the transcriptional control of T3P in K. pneumoniae. PMID:28278272
Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong
2015-01-01
Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.
Opposite GC skews at the 5' and 3' ends of genes in unicellular fungi
2011-01-01
Background GC-skews have previously been linked to transcription in some eukaryotes. They have been associated with transcription start sites, with the coding strand G-biased in mammals and C-biased in fungi and invertebrates. Results We show a consistent and highly significant pattern of GC-skew within genes of almost all unicellular fungi. The pattern of GC-skew is asymmetrical: the coding strand of genes is typically C-biased at the 5' ends but G-biased at the 3' ends, with intermediate skews at the middle of genes. Thus, the initiation, elongation, and termination phases of transcription are associated with different skews. This pattern influences the encoded proteins by generating differential usage of amino acids at the 5' and 3' ends of genes. These biases also affect fourfold-degenerate positions and extend into promoters and 3' UTRs, indicating that skews cannot be accounted by selection for protein function or translation. Conclusions We propose two explanations, the mutational pressure hypothesis, and the adaptive hypothesis. The mutational pressure hypothesis is that different co-factors bind to RNA pol II at different phases of transcription, producing different mutational regimes. The adaptive hypothesis is that cytidine triphosphate deficiency may lead to C-avoidance at the 3' ends of transcripts to control the flow of RNA pol II molecules and reduce their frequency of collisions. PMID:22208287
Al-Khouri, Anna Maria; Paule, Marvin R.
2002-01-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE. PMID:11784852
Al-Khouri, Anna Maria; Paule, Marvin R
2002-02-01
In the small, free-living amoeba Acanthamoeba castellanii, rRNA transcription requires, in addition to RNA polymerase I, a single DNA-binding factor, transcription initiation factor IB (TIF-IB). TIF-IB is a multimeric protein that contains TATA-binding protein (TBP) and four TBP-associated factors that are specific for polymerase I transcription. TIF-IB is required for accurate and promoter-specific initiation of rRNA transcription, recruiting and positioning the polymerase on the start site by protein-protein interaction. In A. castellanii, partially purified TIF-IB can form a persistent complex with the ribosomal DNA (rDNA) promoter while homogeneous TIF-IB cannot. An additional factor, TIF-IE, is required along with homogeneous TIF-IB for the formation of a stable complex on the rDNA core promoter. We show that TIF-IE by itself, however, does not bind to the rDNA promoter and thus differs in its mechanism from the upstream binding factor and upstream activating factor, which carry out similar complex-stabilizing functions in vertebrates and yeast, respectively. In addition to its presence in impure TIF-IB, TIF-IE is found in highly purified fractions of polymerase I, with which it associates. Renaturation of polypeptides excised from sodium dodecyl sulfate-polyacrylamide gels showed that a 141-kDa polypeptide possesses all the known activities of TIF-IE.
Kopf, Matthias; Klähn, Stephan; Scholz, Ingeborg; Hess, Wolfgang R; Voß, Björn
2015-04-22
In all studied organisms, a substantial portion of the transcriptome consists of non-coding RNAs that frequently execute regulatory functions. Here, we have compared the primary transcriptomes of the cyanobacteria Synechocystis sp. PCC 6714 and PCC 6803 under 10 different conditions. These strains share 2854 protein-coding genes and a 16S rRNA identity of 99.4%, indicating their close relatedness. Conserved major transcriptional start sites (TSSs) give rise to non-coding transcripts within the sigB gene, from the 5'UTRs of cmpA and isiA, and 168 loci in antisense orientation. Distinct differences include single nucleotide polymorphisms rendering promoters inactive in one of the strains, e.g., for cmpR and for the asRNA PsbA2R. Based on the genome-wide mapped location, regulation and classification of TSSs, non-coding transcripts were identified as the most dynamic component of the transcriptome. We identified a class of mRNAs that originate by read-through from an sRNA that accumulates as a discrete and abundant transcript while also serving as the 5'UTR. Such an sRNA/mRNA structure, which we name 'actuaton', represents another way for bacteria to remodel their transcriptional network. Our findings support the hypothesis that variations in the non-coding transcriptome constitute a major evolutionary element of inter-strain divergence and capability for physiological adaptation.
Harju-Baker, Susanna; Costa, Flávia C.; Fedosyuk, Halyna; Neades, Renee; Peterson, Kenneth R.
2008-01-01
Autonomous silencing of γ-globin transcription is an important developmental regulatory mechanism controlling globin gene switching. An adult stage-specific silencer of the Aγ-globin gene was identified between −730 and −378 relative to the mRNA start site. A marked copy of the Aγ-globin gene inserted between locus control region 5′ DNase I-hypersensitive site 1 and the ɛ-globin gene was transcriptionally silenced in adult β-globin locus yeast artificial chromosome (β-YAC) transgenic mice, but deletion of the 352-bp region restored expression. This fragment reduced reporter gene expression in K562 cells, and GATA-1 was shown to bind within this sequence at the −566 GATA site. Further, the Mi2 protein, a component of the NuRD complex, was observed in erythroid cells with low γ-globin levels, whereas only a weak signal was detected when γ-globin was expressed. Chromatin immunoprecipitation of fetal liver tissue from β-YAC transgenic mice demonstrated that GATA-1, FOG-1, and Mi2 were recruited to the Aγ-globin −566 or Gγ-globin −567 GATA site when γ-globin expression was low (day 18) but not when γ-globin was expressed (day 12). These data suggest that during definitive erythropoiesis, γ-globin gene expression is silenced, in part, by binding a protein complex containing GATA-1, FOG-1, and Mi2 at the −566/−567 GATA sites of the proximal γ-globin promoters. PMID:18347053
van Ooij, C; Snyder, R C; Paeper, B W; Duester, G
1992-01-01
The human class I alcohol dehydrogenase (ADH) gene family consists of ADH1, ADH2, and ADH3, which are sequentially activated in early fetal, late fetal, and postnatal liver, respectively. Analysis of ADH promoters revealed differential activation by several factors previously shown to control liver transcription. In cotransfection assays, the ADH1 promoter, but not the ADH2 or ADH3 promoter, was shown to respond to hepatocyte nuclear factor 1 (HNF-1), which has previously been shown to regulate transcription in early liver development. The ADH2 promoter, but not the ADH1 or ADH3 promoter, was shown to respond to CCAAT/enhancer-binding protein alpha (C/EBP alpha), a transcription factor particularly active during late fetal liver and early postnatal liver development. The ADH1, ADH2, and ADH3 promoters all responded to the liver transcription factors liver activator protein (LAP) and D-element-binding protein (DBP), which are most active in postnatal liver. For all three promoters, the activation by LAP or DBP was higher than that seen by HNF-1 or C/EBP alpha, and a significant synergism between C/EBP alpha and LAP was noticed for the ADH2 and ADH3 promoters when both factors were simultaneously cotransfected. A hierarchy of ADH promoter responsiveness to C/EBP alpha and LAP homo- and heterodimers is suggested. In all three ADH genes, LAP bound to the same four sites previously reported for C/EBP alpha (i.e., -160, -120, -40, and -20 bp), but DBP bound strongly only to the site located at -40 bp relative to the transcriptional start. Mutational analysis of ADH2 indicated that the -40 bp element accounts for most of the promoter regulation by the bZIP factors analyzed. These studies suggest that HNF-1 and C/EBP alpha help establish ADH gene family transcription in fetal liver and that LAP and DBP help maintain high-level ADH gene family transcription in postnatal liver. Images PMID:1620113
Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G
2012-04-01
Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.
GBshape: a genome browser database for DNA shape annotations
Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo
2015-01-01
Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329
Lasp1 misexpression influences chondrocyte differentiation in the vertebral column.
Hermann-Kleiter, Natascha; Ghaffari-Tabrizi, Nassim; Blumer, Michael J F; Schwarzer, Christoph; Mazur, Magdalena A; Artner, Isabella
2009-01-01
The mouse mutant wavy tail Tg(Col1a1-lacZ)304ng was created through transgene insertion and exhibits defects of the vertebral column. Homozygous mutant animals have compressed tail vertebrae and wedge-shaped intervertebral discs, resulting in a meandering tail. Delayed closure of lumbar neural arches and lack of processus spinosi have been observed; these defects become most prominent during the transition from cartilage to bone. The spina bifida was resistant to folic acid treatment, while retinoic acid administration caused severe skeletal defects in the mutant, but none in wild type control animals. The transgene integrated at chromosome 11 band D, in an area of high gene density. The insertion site was located between the transcription start sites of the Rpl23 and Lasp1 genes. LASP1 (an actin binding protein involved in cell migration and survival) was found to be produced in resting and hypertrophic chondrocytes in the vertebrae. In mutant vertebrae, temporal and spatial misexpression of Lasp1 was observed, indicating that alterations in Lasp1 transcription are most likely responsible for the observed phenotype. These data reveal a yet unappreciated role of Lasp1 in chondrocyte differentiation during cartilage to bone transition.
Tetramethylpyrazine-Inducible Promoter Region from Rhodococcus jostii TMP1.
Stanislauskienė, Rūta; Kutanovas, Simonas; Kalinienė, Laura; Bratchikov, Maksim; Meškys, Rolandas
2018-06-25
An inducible promoter region, P TTMP (tetramethylpyrazine [TTMP]), has been identified upstream of the tpdABC operon, which contains the genes required for the initial degradation of 2,3,5,6-tetramethylpyrazine in Rhodococcus jostii TMP1 bacteria. In this work, the promoter region was fused with the gene for the enhanced green fluorescent protein (EGFP) to investigate the activity of P TTMP by measuring the fluorescence of bacteria. The highest promoter activity was observed when bacteria were grown in a nutrient broth (NB) medium supplemented with 5 mM 2,3,5,6-tetramethylpyrazine for 48 h. Using a primer extension reaction, two transcriptional start sites for tpdA were identified, and the putative −35 and −10 promoter motifs were determined. The minimal promoter along with two 15 bp long direct repeats and two 7 bp inverted sequences were identified. Also, the influence of the promoter elements on the activity of P TTMP were determined using site-directed mutagenesis. Furthermore, P TTMP was shown to be induced by pyrazine derivatives containing methyl groups in the 2- and 5-positions of the heterocyclic ring, in the presence of the LuxR family transcriptional activator TpdR.
Genome and epigenome analysis of monozygotic twins discordant for congenital heart disease.
Lyu, Guoliang; Zhang, Chao; Ling, Te; Liu, Rui; Zong, Le; Guan, Yiting; Huang, Xiaoke; Sun, Lei; Zhang, Lijun; Li, Cheng; Nie, Yu; Tao, Wei
2018-06-04
Congenital heart disease (CHD) is the leading non-infectious cause of death in infants. Monozygotic (MZ) twins share nearly all of their genetic variants before and after birth. Nevertheless, MZ twins are sometimes discordant for common complex diseases. The goal of this study is to identify genomic and epigenomic differences between a pair of twins discordant for a form of congenital heart disease, double outlet right ventricle (DORV). A monoamniotic monozygotic (MZ) twin pair discordant for DORV were subjected to genome-wide sequencing and methylation analysis. We identified few genomic differences but 1566 differentially methylated regions (DMRs) between the MZ twins. Twenty percent (312/1566) of the DMRs are located within 2 kb upstream of transcription start sites (TSS), containing 121 binding sites of transcription factors. Particularly, ZIC3 and NR2F2 are found to have hypermethylated promoters in both the diseased twin and additional patients suffering from DORV. The results showed a high correlation between hypermethylated promoters at ZIC3 and NR2F2 and down-regulated gene expression levels of these two genes in patients with DORV compared to normal controls, providing new insight into the potential mechanism of this rare form of CHD.
Saccharomyces cerevisiae RNA Polymerase I Terminates Transcription at the Reb1 Terminator In Vivo
Reeder, Ronald H.; Guevara, Palmira; Roan, Judith G.
1999-01-01
We have mapped transcription termination sites for RNA polymerase I in the yeast Saccharomyces cerevisiae. S1 nuclease mapping shows that the primary terminator is the Reb1p terminator located at +93 downstream of the 3′ end of 25S rRNA. Reverse transcription coupled with quantitative PCR shows that approximately 90% of all transcripts terminate at this site. Transcripts which read through the +93 site quantitatively terminate at a fail-safe terminator located further downstream at +250. Inactivation of Rnt1p (an RNase III involved in processing the 3′ end of 25S rRNA) greatly stabilizes transcripts extending to both sites and increases readthrough at the +93 site. In vivo assay of mutants of the Reb1p terminator shows that this site operates in vivo by the same mechanism as has previously been delineated through in vitro studies. PMID:10523625
Santos-Aberturas, Javier; Vicente, Cláudia M.; Payero, Tamara D.; Martín-Sánchez, Lara; Cañibano, Carmen; Martín, Juan F.; Aparicio, Jesús F.
2012-01-01
Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimR. This regulator combines an N-terminal domain corresponding to the Streptomyces antibiotic regulatory protein (SARP) family of transcriptional activators with a C-terminal half homologous to guanylate cyclases and large ATP-binding regulators of the LuxR family. The PimR SARP domain (PimRSARP) was expressed in Escherichia coli as a glutathione S-transferase (GST)–fused protein. Electrophoretic mobility shift assays showed that GST-PimRSARP binds a single target, the intergenic region between the regulatory genes pimR and pimMs in the pimaricin cluster. The PimRSARP-binding site was investigated by DNaseI protection studies, revealing that it contains three heptameric direct repeats adjusting to the consensus 5′-CGGCAAG-3′. Transcription start points of pimM and pimR promoters were identified by 5′-RACE, revealing that unlike other SARPs, PimRSARP does not interact with the -35 region of its target promoter. Quantitative transcriptional analysis of these regulatory genes on mutants on each of them has allowed the identification of the pimM promoter as the transcriptional target for PimR. Furthermore, the constitutive expression of pimM restored pimaricin production in a pimaricin-deficient strain carrying a deletion mutant of pimR. These results reveal that PimR exerts its positive effect on pimaricin production by controlling pimM expression level, a regulator whose gene product activates transcription from eight different promoters of pimaricin structural genes directly. PMID:22693644
Schnapp, A; Clos, J; Hädelt, W; Schreck, R; Cvekl, A; Grummt, I
1990-03-25
The murine ribosomal gene promoter contains two cis-acting control elements which operate in concert to promote efficient and accurate transcription initiation by RNA polymerase I. The start site proximal core element which is indispensable for promoter recognition by RNA polymerase I (pol I) encompasses sequences from position -39 to -1. An upstream control element (UCE) which is located between nucleotides -142 and -112 stimulates the efficiency of transcription initiation both in vivo and in vitro. Here we report the isolation and functional characterization of a specific rDNA binding protein, the transcription initiation factor TIF-IB, which specifically interacts with the core region of the mouse ribosomal RNA gene promoter. Highly purified TIF-IB complements transcriptional activity in the presence of two other essential initiation factors TIF-IA and TIF-IC. We demonstrate that the binding efficiency of purified TIF-IB to the core promoter is strongly enhanced by the presence in cis of the UCE. This positive effect of upstream sequences on TIF-IB binding is observed throughout the purification procedure suggesting that the synergistic action of the two distant promoter elements is not mediated by a protein different from TIF-IB. Increasing the distance between both control elements still facilitates stable factor binding but eliminates transcriptional activation. The results demonstrate that TIF-IB binding to the rDNA promoter is an essential early step in the assembly of a functional transcription initiation complex. The subsequent interaction of TIF-IB with other auxiliary transcription initiation factors, however, requires the correct spacing between the UCE and the core promoter element.
Reavey, Caitlin T; Hickman, Mark J; Dobi, Krista C; Botstein, David; Winston, Fred
2015-10-01
Studies of natural populations of many organisms have shown that traits are often complex, caused by contributions of mutations in multiple genes. In contrast, genetic studies in the laboratory primarily focus on studying the phenotypes caused by mutations in a single gene. However, the single mutation approach may be limited with respect to the breadth and degree of new phenotypes that can be found. We have taken the approach of isolating complex, or polygenic mutants in the lab to study the regulation of transcriptional activation distance in yeast. While most aspects of eukaryotic transcription are conserved from yeast to human, transcriptional activation distance is not. In Saccharomyces cerevisiae, the upstream activating sequence (UAS) is generally found within 450 base pairs of the transcription start site (TSS) and when the UAS is moved too far away, activation no longer occurs. In contrast, metazoan enhancers can activate from as far as several hundred kilobases from the TSS. Previously, we identified single mutations that allow transcription activation to occur at a greater-than-normal distance from the GAL1 UAS. As the single mutant phenotypes were weak, we have now isolated polygenic mutants that possess strong long-distance phenotypes. By identification of the causative mutations we have accounted for most of the heritability of the phenotype in each strain and have provided evidence that the Mediator coactivator complex plays both positive and negative roles in the regulation of transcription activation distance. Copyright © 2015 by the Genetics Society of America.
Novel expression of the stanniocalcin gene in fish.
McCudden, C R; Kogon, M R; DiMattia, G E; Wagner, G F
2001-10-01
It is currently accepted that the fish stanniocalcin (STC) gene is expressed exclusively in the corpuscles of Stannius (CS), unique endocrine glands on the kidneys of bony fishes. In this study, we have re-examined the pattern of fish STC gene expression in the light of the recent evidence for widespread expression of the gene in mammals. Surprisingly, we found by Northern blotting that the fish gene was also expressed in the kidneys and gonads, in addition to the CS glands. Moreover, Southern blotting of RT-PCR products revealed STC mRNA transcripts in all tissues assayed, including brain, heart, gill, muscle and intestine. In situ hybridization studies using digoxigenin-labeled riboprobes localized STC mRNA to chondrocytes, and both mature and developing nephritic tubules. Immunocytochemical staining indicated that the STC protein was widespread in cells of the gill, kidney, brain, eye, pseudobranch and skin. We also characterized the salmon STC gene, establishing that it was comprised of five exons as opposed to four in mammals. A single transcription start site was identified by primer extension 99 bp upstream of the start codon. This is the first evidence of STC gene expression in fish tissues other than the CS glands and suggests that, as in mammals, fish STC operates via both local and endocrine pathways.
2013-01-01
Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691
Comprehensive human transcription factor binding site map for combinatory binding motifs discovery.
Müller-Molina, Arnoldo J; Schöler, Hans R; Araúzo-Bravo, Marcos J
2012-01-01
To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%-20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory "DNA words." From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%-far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of "DNA words," newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters.
Comprehensive Human Transcription Factor Binding Site Map for Combinatory Binding Motifs Discovery
Müller-Molina, Arnoldo J.; Schöler, Hans R.; Araúzo-Bravo, Marcos J.
2012-01-01
To know the map between transcription factors (TFs) and their binding sites is essential to reverse engineer the regulation process. Only about 10%–20% of the transcription factor binding motifs (TFBMs) have been reported. This lack of data hinders understanding gene regulation. To address this drawback, we propose a computational method that exploits never used TF properties to discover the missing TFBMs and their sites in all human gene promoters. The method starts by predicting a dictionary of regulatory “DNA words.” From this dictionary, it distills 4098 novel predictions. To disclose the crosstalk between motifs, an additional algorithm extracts TF combinatorial binding patterns creating a collection of TF regulatory syntactic rules. Using these rules, we narrowed down a list of 504 novel motifs that appear frequently in syntax patterns. We tested the predictions against 509 known motifs confirming that our system can reliably predict ab initio motifs with an accuracy of 81%—far higher than previous approaches. We found that on average, 90% of the discovered combinatorial binding patterns target at least 10 genes, suggesting that to control in an independent manner smaller gene sets, supplementary regulatory mechanisms are required. Additionally, we discovered that the new TFBMs and their combinatorial patterns convey biological meaning, targeting TFs and genes related to developmental functions. Thus, among all the possible available targets in the genome, the TFs tend to regulate other TFs and genes involved in developmental functions. We provide a comprehensive resource for regulation analysis that includes a dictionary of “DNA words,” newly predicted motifs and their corresponding combinatorial patterns. Combinatorial patterns are a useful filter to discover TFBMs that play a major role in orchestrating other factors and thus, are likely to lock/unlock cellular functional clusters. PMID:23209563
PPARγ and NF-κB regulate the gene promoter activity of their shared repressor, TNIP1
Gurevich, Igor; Zhang, Carmen; Encarnacao, Priscilla C.; Struzynski, Charles P.; Livings, Sarah E.; Aneskievich, Brian J.
2011-01-01
Human TNFAIP3 interacting protein 1 (TNIP1) has diverse functions including support of HIV replication through its interaction with viral Nef and matrix proteins, reduction of TNFα-induced signaling through its interaction with NF-κB pathway proteins, and corepression of agonist-bound retinoic acid receptors and peroxisome proliferator-activated receptors (PPAR). The wide tissue distribution of TNIP1 provides the opportunity to influence numerous cellular responses in these roles and defining control of TNIP1 expression would be central to improved understanding of its impact on cell function. We cloned 6kb of the human TNIP1 promoter and performed predictive and functional analyses to identify regulatory elements. The promoter region proximal to the transcription start site is GC-rich without a recognizable TATA box. In contrast to this proximal ~500bp region, 6kb of the promoter increased reporter construct constitutive activity over five-fold. Throughout the 6kb length, in silico analysis identified several potential binding sites for both constitutive and inducible transcription factors; among the latter were candidate NF-κB binding sequences and peroxisome proliferator response elements (PPREs). We tested NF-κB and PPAR regulation of the endogenous TNIP1 gene and cloned promoter by expression studies, electrophoretic mobility shift assays, and chromatin immunoprecipitations. We validated NF-κB sites in the TNIP1 promoter proximal and distal regions as well as one PPRE in the distal region. The ultimate control of the TNIP1 promoter is likely to be a combination of constitutive transcription factors and those subject to activation such as NF-κB and PPAR. PMID:22001530
Zubo, Yan O.; Blakley, Ivory Clabaugh; Yamburenko, Maria V.; Worthen, Jennifer M.; Street, Ian H.; Franco-Zorrilla, José M.; Zhang, Wenjing; Raines, Tracy; Kieber, Joseph J.; Loraine, Ann E.
2017-01-01
The plant hormone cytokinin affects a diverse array of growth and development processes and responses to the environment. How a signaling molecule mediates such a diverse array of outputs and how these response pathways are integrated with other inputs remain fundamental questions in plant biology. To this end, we characterized the transcriptional network initiated by the type-B ARABIDOPSIS RESPONSE REGULATORs (ARRs) that mediate the cytokinin primary response, making use of chromatin immunoprecipitation sequencing (ChIP-seq), protein-binding microarrays, and transcriptomic approaches. By ectopic overexpression of ARR10, Arabidopsis lines hypersensitive to cytokinin were generated and used to clarify the role of cytokinin in regulation of various physiological responses. ChIP-seq was used to identify the cytokinin-dependent targets for ARR10, thereby defining a crucial link between the cytokinin primary-response pathway and the transcriptional changes that mediate physiological responses to this phytohormone. Binding of ARR10 was induced by cytokinin with binding sites enriched toward the transcriptional start sites for both induced and repressed genes. Three type-B ARR DNA-binding motifs, determined by use of protein-binding microarrays, were enriched at ARR10 binding sites, confirming their physiological relevance. WUSCHEL was identified as a direct target of ARR10, with its cytokinin-enhanced expression resulting in enhanced shooting in tissue culture. Results from our analyses shed light on the physiological role of the type-B ARRs in regulating the cytokinin response, mechanism of type-B ARR activation, and basis by which cytokinin regulates diverse aspects of growth and development as well as responses to biotic and abiotic factors. PMID:28673986
Rombel, I T; McMorran, B J; Lamont, I L
1995-02-20
Many bacteria respond to a lack of iron in the environment by synthesizing siderophores, which act as iron-scavenging compounds. Fluorescent pseudomonads synthesize strain-specific but chemically related siderophores called pyoverdines or pseudobactins. We have investigated the mechanisms by which iron controls expression of genes involved in pyoverdine metabolism in Pseudomonas aeruginosa. Transcription of these genes is repressed by the presence of iron in the growth medium. Three promoters from these genes were cloned and the activities of the promoters were dependent on the amounts of iron in the growth media. Two of the promoters were sequenced and the transcriptional start site were identified by S1 nuclease analysis. Sequences similar to the consensus binding site for the Fur repressor protein, which controls expression of iron-repressible genes in several gram-negative species, were not present in the promoters, suggesting that they are unlikely to have a high affinity for Fur. However, comparison of the promoter sequences with those of iron-regulated genes from other Pseudomonas species and also the iron-regulated exotoxin gene of P. aeruginosa allowed identification of a shared sequence element, with the consensus sequence (G/C)CTAAAT-CCC, which is likely to act as a binding site for a transcriptional activator protein. Mutations in this sequence greatly reduced the activities of the promoters characterized here as well as those of other iron-regulated promoters. The requirement for this motif in the promoters of iron-regulated genes of different Pseudomonas species indicates that similar mechanisms are likely to be involved in controlling expression of a range of iron-regulated genes in pseudomonads.
Shir-Shapira, Hila; Sharabany, Julia; Filderman, Matan; Ideses, Diana; Ovadia-Shochat, Avital; Mannervik, Mattias; Juven-Gershon, Tamar
2015-07-10
Regulation of RNA polymerase II transcription is critical for the proper development, differentiation, and growth of an organism. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters encompass the RNA start site and consist of functional elements such as the TATA box, initiator, and downstream core promoter element (DPE), which confer specific properties to the core promoter. We have previously discovered that Drosophila Caudal, which is a master regulator of genes involved in development and differentiation, is a DPE-specific transcriptional activator. Here, we show that the mouse Caudal-related homeobox (Cdx) proteins (mCdx1, mCdx2, and mCdx4) are also preferential core promoter transcriptional activators. To elucidate the mechanism that enables Caudal to preferentially activate DPE transcription, we performed structure-function analysis. Using a systematic series of deletion mutants (all containing the intact DNA-binding homeodomain) we discovered that the C-terminal region of Caudal contributes to the preferential activation of the fushi tarazu (ftz) Caudal target gene. Furthermore, the region containing both the homeodomain and the C terminus of Caudal was sufficient to confer core promoter-preferential activation to the heterologous GAL4 DNA-binding domain. Importantly, we discovered that Drosophila CREB-binding protein (dCBP) is a co-activator for Caudal-regulated activation of ftz. Strikingly, dCBP conferred the ability to preferentially activate the DPE-dependent ftz reporter to mini-Caudal proteins that were unable to preferentially activate ftz transcription themselves. Taken together, it is the unique combination of dCBP and Caudal that enables the co-activation of ftz in a core promoter-preferential manner. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zambon, Alexander C.; Zhang, Lingzhi; Minovitsky, Simon
Although a substantial number of hormones and drugs increase cellular cAMP levels, the global impact of cAMP and its major effector mechanism, protein kinase A (PKA), on gene expression is not known. Here we show that treatment of murine wild-type S49 lymphoma cells for 24 h with 8-(4-chlorophenylthio)-cAMP (8-CPTcAMP), a PKA-selective cAMP analog, alters the expression of approx equal to 4,500 of approx. equal to 13,600 unique genes. By contrast, gene expression was unaltered in Kin- S49 cells (that lack PKA) incubated with 8-CPTcAMP. Changes in mRNA and protein expression of several cell cycle regulators accompanied cAMP-induced G1-phase cell-cycle arrestmore » of wild-type S49 cells. Within 2h, 8-CPT-cAMP altered expression of 152 genes that contain evolutionarily conserved cAMP-response elements within 5 kb of transcriptional start sites, including the circadian clock gene Per1. Thus, cAMP through its activation of PKA produces extensive transcriptional regulation in eukaryotic cells. These transcriptional networks include a primary group of cAMP-response element-containing genes and secondary networks that include the circadian clock.« less
Hafemeister, Christoph; Nicotra, Adrienne B.; Jagadish, S.V. Krishna; Bonneau, Richard; Purugganan, Michael
2016-01-01
Environmental gene regulatory influence networks (EGRINs) coordinate the timing and rate of gene expression in response to environmental signals. EGRINs encompass many layers of regulation, which culminate in changes in accumulated transcript levels. Here, we inferred EGRINs for the response of five tropical Asian rice (Oryza sativa) cultivars to high temperatures, water deficit, and agricultural field conditions by systematically integrating time-series transcriptome data, patterns of nucleosome-free chromatin, and the occurrence of known cis-regulatory elements. First, we identified 5447 putative target genes for 445 transcription factors (TFs) by connecting TFs with genes harboring known cis-regulatory motifs in nucleosome-free regions proximal to their transcriptional start sites. We then used network component analysis to estimate the regulatory activity for each TF based on the expression of its putative target genes. Finally, we inferred an EGRIN using the estimated transcription factor activity (TFA) as the regulator. The EGRINs include regulatory interactions between 4052 target genes regulated by 113 TFs. We resolved distinct regulatory roles for members of the heat shock factor family, including a putative regulatory connection between abiotic stress and the circadian clock. TFA estimation using network component analysis is an effective way of incorporating multiple genome-scale measurements into network inference. PMID:27655842
Behnam, Babak; Iuchi, Satoshi; Fujita, Miki; Fujita, Yasunari; Takasaki, Hironori; Osakabe, Yuriko; Yamaguchi-Shinozaki, Kazuko; Kobayashi, Masatomo; Shinozaki, Kazuo
2013-01-01
Plants respond to dehydration stress and tolerate water-deficit status through complex physiological and cellular processes. Many genes are induced by water deficit. Abscisic acid (ABA) plays important roles in tolerance to dehydration stress by inducing many stress genes. ABA is synthesized de novo in response to dehydration. Most of the genes involved in ABA biosynthesis have been identified, and they are expressed mainly in leaf vascular tissues. Of the products of such genes, 9-cis-epoxycarotenoid dioxygenase (NCED) is a key enzyme in ABA biosynthesis. One of the five NCED genes in Arabidopsis, AtNCED3, is significantly induced by dehydration. To understand the regulatory mechanism of the early stages of the dehydration stress response, it is important to analyse the transcriptional regulatory systems of AtNCED3. In the present study, we found that an overlapping G-box recognition sequence (5′-CACGTG-3′) at −2248 bp from the transcriptional start site of AtNCED3 is an important cis-acting element in the induction of the dehydration response. We discuss the possible transcriptional regulatory system of dehydration-responsive AtNCED3 expression, and how this may control the level of ABA under water-deficit conditions. PMID:23604098
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-01-01
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest. PMID:26512957
P53-dependent upregulation of neutral sphingomyelinase-2: role in doxorubicin-induced growth arrest.
Shamseddine, A A; Clarke, C J; Carroll, B; Airola, M V; Mohammed, S; Rella, A; Obeid, L M; Hannun, Y A
2015-10-29
Neutral sphingomyelinase-2 (nSMase2) is a ceramide-generating enzyme that has been implicated in growth arrest, apoptosis and exosome secretion. Although previous studies have reported transcriptional upregulation of nSMase2 in response to daunorubicin, through Sp1 and Sp3 transcription factors, the role of the DNA damage pathway in regulating nSMase2 remains unclear. In this study, we show that doxorubicin induces a dose-dependent induction of nSMase2 mRNA and protein with concomitant increases in nSMase activity and ceramide levels. Upregulation of nSMase2 was dependent on ATR, Chk1 and p53, thus placing it downstream of the DNA damage pathway. Moreover, overexpression of p53 was sufficient to transcriptionally induce nSMase2, without the need for DNA damage. DNA-binding mutants as well as acetylation mutants of p53 were unable to induce nSMase2, suggesting a role of nSMase2 in growth arrest. Moreover, knockdown of nSMase2 prevented doxorubicin-induced growth arrest. Finally, p53-induced nSMase2 upregulation appears to occur via a novel transcription start site upstream of exon 3. These results identify nSMase2 as a novel p53 target gene, regulated by the DNA damage pathway to induce cell growth arrest.
Ehlers, Claudia; Veit, Katharina; Gottschalk, Gerhard; Schmitz, Ruth A.
2002-01-01
The mesophilic methanogenic archaeon Methanosarcina mazei strain Gö1 is able to utilize molecular nitrogen (N2) as its sole nitrogen source. We have identified and characterized a single nitrogen fixation (nif) gene cluster in M. mazei Gö1 with an approximate length of 9 kbp. Sequence analysis revealed seven genes with sequence similarities to nifH, nifI1, nifI2, nifD, nifK, nifE and nifN, similar to other diazotrophic methanogens and certain bacteria such as Clostridium acetobutylicum, with the two glnB-like genes (nifI1 and nifI2) located between nifH and nifD. Phylogenetic analysis of deduced amino acid sequences for the nitrogenase structural genes of M. mazei Gö1 showed that they are most closely related to Methanosarcina barkeri nif2 genes, and also closely resemble those for the corresponding nif products of the gram-positive bacterium C. acetobutylicum. Northern blot analysis and reverse transcription PCR analysis demonstrated that the M. mazei nif genes constitute an operon transcribed only under nitrogen starvation as a single 8 kb transcript. Sequence analysis revealed a palindromic sequence at the transcriptional start site in front of the M. mazei nifH gene, which may have a function in transcriptional regulation of the nif operon. PMID:15803652
Distortion in the spacer region of Pm during activation of middle transcription of phage Mu.
Artsimovitch, I; Kahmeyer-Gabbe, M; Howe, M M
1996-01-01
Transcription from the middle promoter, Pm, of phage Mu is initiated by Escherichia coli RNA polymerase holoenzyme (E sigma 70; RNAP) and the phage-encoded activator, Mor. Point mutations in the spacer region between the -10 hexamer and the Mor binding site result in changes of promoter activity in vivo. These mutations are located at the junction between a rigid T-tract and adjacent, potentially deformable G + C-rich DNA segment, suggesting that deformation of the spacer region may play a role in the transcriptional activation of Pm. This prediction was tested by using dimethyl sulfate and potassium permanganate footprinting analyses. Helical distortion involving strand separation was detected at positions -32 to -34, close to the predicted interface between Mor and RNAP. Promoter mutants in which this distortion was not detected exhibited a lack of melting in the -12 to -1 region and reduced promoter activity in vivo. We propose that complexes containing the distortion represent stressed intermediates rather than stable open complexes and thus can be envisaged as a transition state in the kinetic pathway of Pm activation in which stored torsional energy could be used to facilitate melting around the transcription start point. Images Fig. 2 Fig. 3 Fig. 4 PMID:8790343
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schriner, J.E.; Yi, W.; Hofmann, S.L.
Palmitoyl-protein thioesterase (PPT) is a small glycoprotein that removes palmitate groups from cysteine residues in lipid-modified proteins. We recently reported mutations in PPT in patients with infantile neuronal ceroid lipofuscinosis (INCL), a severe neurodegenerative disorder. INCL is characterized by the accumulation of proteolipid storage material in brain and other tissues, suggesting that the disease is a consequence of abnormal catabolism of acylated proteins. In the current paper, we report the sequence of the human PPT cDNA and the structure of the human PPT gene. The cDNA predicts a protein of 306 amino acids that contains a 25-amino-acid signal peptide, threemore » N-linked glycosylation sites, and consensus motifs characteristic of thioesterases. Northern analysis of a human tissue blot revealed ubiquitous expression of a single 2.5-kb mRNA, with highest expression in lung, brain, and heart. The human PPT gene spans 25 kb and is composed of seven coding exons and a large eighth exon, containing the entire 3{prime}-untranslated region of 1388 bp. An Alu repeat and promoter elements corresponding to putative binding sites for several general transcription factors were identified in the 1060 nucleotides upstream of the transcription start site. The human PPT cDNA sequence and gene structure will provide the means for the identification of further causative mutations in INCL and facilitate genetic screening in selected high-risk populations. 31 refs., 5 figs., 1 tab.« less
The genomic structure of the human UFO receptor.
Schulz, A S; Schleithoff, L; Faust, M; Bartram, C R; Janssen, J W
1993-02-01
Using a DNA transfection-tumorigenicity assay we have recently identified the UFO oncogene. It encodes a tyrosine kinase receptor characterized by the juxtaposition of two immunoglobulin-like and two fibronectin type III repeats in its extracellular domain. Here we describe the genomic organization of the human UFO locus. The UFO receptor is encoded by 20 exons that are distributed over a region of 44 kb. Different isoforms of UFO mRNA are generated by alternative splicing of exon 10 and differential usage of two imperfect polyadenylation sites resulting in the presence or absence of 1.5-kb 3' untranslated sequences. Primer extension and S1 nuclease analyses revealed multiple transcriptional initiation sites including a major site 169 bp upstream of the translation start site. The promoter region is GC rich, lacks TATA and CAAT boxes, but contains potential recognition sites for a variety of trans-acting factors, including Sp1, AP-2 and the cyclic AMP response element-binding protein. Proto-UFO and its oncogenic counterpart exhibit identical cDNA and promoter regions sequences. Possible modes of UFO activation are discussed.
Brierley, I; Hoggett, J G
1992-01-01
The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site. Images Fig. 1. Fig. 3. Fig. 4. PMID:1322129
Acosta-MontesdeOca, Adriana; Zariñán, Teresa; Macías, Héctor; Pérez-Solís, Marco A; Ulloa-Aguirre, Alfredo; Gutiérrez-Sagal, Rubén
2012-05-01
To gain further insight on the estrogen-dependent transcriptional regulation of the uteroglobin (UG) gene, we cloned the 5'-flanking region of the UG gene from the phylogenetically ancient volcano rabbit (Romerolagus diazi; Rd). The cloned region spans 812 base pairs (bp; -812/-1) and contains a noncanonical TATA box (TACA). The translation start site is 48 bp downstream from the putative transcription initiation site (AGA), and is preceded by a consensus Kozak box. Comparison of the Rd-UG gene with that previously isolated from rabbits (Oryctolagus cuniculus) showed 93% in sequence identity as well as a number of conserved cis-acting elements, including the estrogen-response element (ERE; -265/-251), which differs from the consensus by two nucleotides. In MCF-7 cells, 17β-estradiol (E(2)) induced transcription of a luciferase reporter driven by the Rd-UG promoter in a similar manner as in an equivalent rabbit UG reporter; the Rd-UG promoter was 30% more responsive to E(2) than the rabbit promoter. Mutagenesis studies on the Rd-ERE confirmed this cis-element as a target of E(2) as two luciferase mutant reporters of the Rd-promoter, one with the rabbit and the other with the consensus ERE, were more responsive to the hormone than the wild-type reporter. Gel shift and super-shift assays showed that estrogen receptor-α indeed binds to the imperfect palindromic sequence of the Rd-ERE. Copyright © 2012 Wiley Periodicals, Inc.
Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho
2009-03-01
Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40 degrees C compared to cells grown at 30 degrees C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter P(hupA), and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection.
Oh, Man Hwan; Lee, Sung Min; Lee, Dong Hwan; Choi, Sang Ho
2009-01-01
Availability of free iron is extremely limited in the mammalian host, and the acquisition of iron in the host is essential for successful infection by pathogenic bacteria. Expression of many genes involved in acquiring iron is regulated in response to the level of iron availability, and iron regulation is mediated by Fur. In this study, cellular levels of Vibrio vulnificus HupA, a heme receptor protein, and the hupA transcript were found to increase in cells grown at 40°C compared to cells grown at 30°C. The results suggested that change in growth temperature, in addition to iron availability, is an environmental cue controlling the expression of the hupA gene. The influence of global regulatory proteins on the expression of hupA was examined, and the cyclic AMP receptor protein (CRP) was found to activate the expression of hupA at the transcriptional level. CRP exerts its effects by directly binding to DNA upstream of the hupA promoter PhupA, and a CRP binding site, centered at 174 bp upstream of the transcription start site, was identified by a DNase I protection assay. Finally, a hupA mutant showed reduced virulence in mice and in tissue cultures, in which growth of the hupA mutant was impaired, indicating that HupA of V. vulnificus is essential for survival and multiplication during infection. PMID:19139193
Leal, María C.; Surace, Ezequiel I.; Holgado, María P.; Ferrari, Carina C.; Tarelli, Rodolfo; Pitossi, Fernando; Wisniewski, Thomas; Castaño, Eduardo M.; Morelli, Laura
2012-01-01
Cerebral amyloid β (Aβ) accumulation is pathogenically associated with sporadic Alzheimer’s disease (SAD). BACE-1 is involved in Aβ generation while insulin-degrading enzyme (IDE) partakes in Aβ proteolytic clearance. Vulnerable regions in AD brains show increased BACE-1 protein levels and enzymatic activity while the opposite occurs with IDE. Another common feature in SAD brains is Notch1 overexpression. Here we demonstrate an increase in mRNA levels of Hey-1, a Notch target gene, and a decrease of IDE transcripts in the hippocampus of SAD brains as compared to controls. Transient transfection of Notch intracellular domain (NICD) in N2aSW cells, mouse neuroblastoma cells (N2a) stably expressing human amyloid precursor protein (APP) Swedish mutation, reduce IDE mRNA levels, promoting extracellular Aβ accumulation. Also, NICD, HES-1 and Hey-1 overexpression result in decreased IDE proximal promoter activity. This effect was mediated by 2 functional sites located at −379/−372 and −310 −303 from the first translation start site in the −575/−19 (556 bp) fragment of IDE proximal promoter. By site-directed mutagenesis of the IDE promoter region we reverted the inhibitory effect mediated by NICD transfection suggesting that these sites are indeed responsible for the Notch-mediated inhibition of the IDE gene expression. Intracranial injection of the Notch ligand JAG-1 in Tg2576 mice, expressing the Swedish mutation in human APP, induced overexpression of HES-1 and Hey-1 and reduction of IDE mRNA levels, respectively. Our results support our theory that a Notch-dependent IDE transcriptional modulation may impact on Aβ metabolism providing a functional link between Notch signaling and the amyloidogenic pathway in SAD. PMID:22036964
Human-Specific Histone Methylation Signatures at Transcription Start Sites in Prefrontal Neurons
Cheung, Iris; Bharadwaj, Rahul; Chou, Hsin-Jung; Houston, Isaac B.; Peter, Cyril J.; Mitchell, Amanda C.; Yao, Wei-Dong; Myers, Richard H.; Chen, Jiang-fan; Preuss, Todd M.; Rogaev, Evgeny I.; Jensen, Jeffrey D.; Weng, Zhiping; Akbarian, Schahram
2012-01-01
Cognitive abilities and disorders unique to humans are thought to result from adaptively driven changes in brain transcriptomes, but little is known about the role of cis-regulatory changes affecting transcription start sites (TSS). Here, we mapped in human, chimpanzee, and macaque prefrontal cortex the genome-wide distribution of histone H3 trimethylated at lysine 4 (H3K4me3), an epigenetic mark sharply regulated at TSS, and identified 471 sequences with human-specific enrichment or depletion. Among these were 33 loci selectively methylated in neuronal but not non-neuronal chromatin from children and adults, including TSS at DPP10 (2q14.1), CNTN4 and CHL1 (3p26.3), and other neuropsychiatric susceptibility genes. Regulatory sequences at DPP10 and additional loci carried a strong footprint of hominid adaptation, including elevated nucleotide substitution rates and regulatory motifs absent in other primates (including archaic hominins), with evidence for selective pressures during more recent evolution and adaptive fixations in modern populations. Chromosome conformation capture at two neurodevelopmental disease loci, 2q14.1 and 16p11.2, revealed higher order chromatin structures resulting in physical contact of multiple human-specific H3K4me3 peaks spaced 0.5–1 Mb apart, in conjunction with a novel cis-bound antisense RNA linked to Polycomb repressor proteins and downregulated DPP10 expression. Therefore, coordinated epigenetic regulation via newly derived TSS chromatin could play an important role in the emergence of human-specific gene expression networks in brain that contribute to cognitive functions and neurological disease susceptibility in modern day humans. PMID:23185133
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-01-01
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were “DNA methylation-sensitive” genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A. The other half were “DNA methylation-resistant” genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site. PMID:28903418
Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi
2017-08-15
Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-04-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA.
Burden, S; Lin, Y-X; Zhang, R
2005-03-01
Although a great deal of research has been undertaken in the area of promoter prediction, prediction techniques are still not fully developed. Many algorithms tend to exhibit poor specificity, generating many false positives, or poor sensitivity. The neural network prediction program NNPP2.2 is one such example. To improve the NNPP2.2 prediction technique, the distance between the transcription start site (TSS) associated with the promoter and the translation start site (TLS) of the subsequent gene coding region has been studied for Escherichia coli K12 bacteria. An empirical probability distribution that is consistent for all E.coli promoters has been established. This information is combined with the results from NNPP2.2 to create a new technique called TLS-NNPP, which improves the specificity of promoter prediction. The technique is shown to be effective using E.coli DNA sequences, however, it is applicable to any organism for which a set of promoters has been experimentally defined. The data used in this project and the prediction results for the tested sequences can be obtained from http://www.uow.edu.au/~yanxia/E_Coli_paper/SBurden_Results.xls alh98@uow.edu.au.
Quantifying the Effect of DNA Packaging on Gene Expression Level
NASA Astrophysics Data System (ADS)
Kim, Harold
2010-10-01
Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.
Pombo, A; Jackson, D A; Hollinshead, M; Wang, Z; Roeder, R G; Cook, P R
1999-01-01
Mammalian nuclei contain three different RNA polymerases defined by their characteristic locations and drug sensitivities; polymerase I is found in nucleoli, and polymerases II and III in the nucleoplasm. As nascent transcripts made by polymerases I and II are concentrated in discrete sites, the locations of those made by polymerase III were investigated. HeLa cells were lysed with saponin in an improved 'physiological' buffer that preserves transcriptional activity and nuclear ultrastructure; then, engaged polymerases were allowed to extend nascent transcripts in Br-UTP, before the resulting Br-RNA was immunolabelled indirectly with fluorochromes or gold particles. Biochemical analysis showed that approximately 10 000 transcripts were being made by polymerase III at the moment of lysis, while confocal and electron microscopy showed that these transcripts were concentrated in only approximately 2000 sites (diameter approximately 40 nm). Therefore, each site contains approximately five active polymerases. These sites contain specific subunits of polymerase III, but not the hyperphosphorylated form of the largest subunit of polymerase II. The results indicate that the active forms of all three nuclear polymerases are concentrated in their own dedicated transcription sites or 'factories', suggesting that different regions of the nucleus specialize in the transcription of different types of gene. PMID:10205177
Problem-Solving Test: Attenuation--A Mechanism to Regulate Bacterial Tryptophan Biosynthesis
ERIC Educational Resources Information Center
Szeberenyi, Jozsef
2010-01-01
Terms to be familiar with before you start to solve the test: tryptophan, transcription unit, operon, "trp" repressor, corepressor, operator, promoter, palindrome, initiation, elongation, and termination of transcription, open reading frame, coupled transcription/translation, chromosome-polysome complex. (Contains 2 figures and 1 footnote.)
Cooper, James; Ding, Yi; Song, Jiuzhou; Zhao, Keji
2017-11-01
Increased chromatin accessibility is a feature of cell-type-specific cis-regulatory elements; therefore, mapping of DNase I hypersensitive sites (DHSs) enables the detection of active regulatory elements of transcription, including promoters, enhancers, insulators and locus-control regions. Single-cell DNase sequencing (scDNase-seq) is a method of detecting genome-wide DHSs when starting with either single cells or <1,000 cells from primary cell sources. This technique enables genome-wide mapping of hypersensitive sites in a wide range of cell populations that cannot be analyzed using conventional DNase I sequencing because of the requirement for millions of starting cells. Fresh cells, formaldehyde-cross-linked cells or cells recovered from formalin-fixed paraffin-embedded (FFPE) tissue slides are suitable for scDNase-seq assays. To generate scDNase-seq libraries, cells are lysed and then digested with DNase I. Circular carrier plasmid DNA is included during subsequent DNA purification and library preparation steps to prevent loss of the small quantity of DHS DNA. Libraries are generated for high-throughput sequencing on the Illumina platform using standard methods. Preparation of scDNase-seq libraries requires only 2 d. The materials and molecular biology techniques described in this protocol should be accessible to any general molecular biology laboratory. Processing of high-throughput sequencing data requires basic bioinformatics skills and uses publicly available bioinformatics software.
Vavouri, Tanya; Lehner, Ben
2011-04-01
Chromatin in sperm is different from that in other cells, with most of the genome packaged by protamines not nucleosomes. Nucleosomes are, however, retained at some genomic sites, where they have the potential to transmit paternal epigenetic information. It is not understood how this retention is specified. Here we show that base composition is the major determinant of nucleosome retention in human sperm, predicting retention very well in both genic and non-genic regions of the genome. The retention of nucleosomes at GC-rich sequences with high intrinsic nucleosome affinity accounts for the previously reported retention at transcription start sites and at genes that regulate development. It also means that nucleosomes are retained at the start sites of most housekeeping genes. We also report a striking link between the retention of nucleosomes in sperm and the establishment of DNA methylation-free regions in the early embryo. Taken together, this suggests that paternal nucleosome transmission may facilitate robust gene regulation in the early embryo. We propose that chromatin organization in the male germline, rather than in somatic cells, is the major functional consequence of fine-scale base composition variation in the human genome. The selective pressure driving base composition evolution in mammals could, therefore, be the need to transmit paternal epigenetic information to the zygote.
Hirakawa, Hidetada; Hirakawa, Yuko; Greenberg, E. Peter
2015-01-01
The bacterium Rhodopseudomonas palustris grows with the aromatic acid benzoate and the alicyclic acid cyclohexanecarboxylate (CHC) as sole carbon sources. The enzymatic steps in an oxygen-independent pathway for CHC degradation have been elucidated, but it was unknown how the CHC operon (badHI aliAB badK) encoding the enzymes for CHC degradation was regulated. aliA and aliB encode enzymes for the conversion of CHC to cyclohex-1-enecarboxyl–coenzyme A (CHene-CoA). At this point, the pathway for CHC degradation merges with the pathway for anaerobic benzoate degradation, as CHene-CoA is an intermediate in both degradation pathways. Three enzymes, encoded by badK, badH, and badI, prepare and cleave the alicyclic ring of CHene-CoA to yield pimelyl-CoA. Here, we show that the MarR transcription factor family member, BadR, represses transcription of the CHC operon by binding near the transcription start site of badH. 2-Ketocyclohexane-1-carboxyl–CoA, an intermediate of CHC and benzoate degradation, interacts with BadR to abrogate repression. We also present evidence that the transcription factor BadM binds to the promoter of the badDEFGAB (Bad) operon for the anaerobic conversion of benzoate to CHene-CoA to repress its expression. Contrary to previous reports, BadR does not appear to control expression of the Bad operon. These data enhance our view of the transcriptional regulation of anaerobic benzoate degradation by R. palustris. PMID:25888170
U6 small nuclear RNA is transcribed by RNA polymerase III.
Kunkel, G R; Maser, R L; Calvet, J P; Pederson, T
1986-01-01
A DNA fragment homologous to U6 small nuclear RNA was isolated from a human genomic library and sequenced. The immediate 5'-flanking region of the U6 DNA clone had significant homology with a potential mouse U6 gene, including a "TATA box" at a position 26-29 nucleotides upstream from the transcription start site. Although this sequence element is characteristic of RNA polymerase II promoters, the U6 gene also contained a polymerase III "box A" intragenic control region and a typical run of five thymines at the 3' terminus (noncoding strand). The human U6 DNA clone was accurately transcribed in a HeLa cell S100 extract lacking polymerase II activity. U6 RNA transcription in the S100 extract was resistant to alpha-amanitin at 1 microgram/ml but was completely inhibited at 200 micrograms/ml. A comparison of fingerprints of the in vitro transcript and of U6 RNA synthesized in vivo revealed sequence congruence. U6 RNA synthesis in isolated HeLa cell nuclei also displayed low sensitivity to alpha-amanitin, in contrast to U1 and U2 RNA transcription, which was inhibited greater than 90% at 1 microgram/ml. In addition, U6 RNA synthesized in isolated nuclei was efficiently immunoprecipitated by an antibody against the La antigen, a protein known to bind most other RNA polymerase III transcripts. These results establish that, in contrast to the polymerase II-directed transcription of mammalian genes for U1-U5 small nuclear RNAs, human U6 RNA is transcribed by RNA polymerase III. Images PMID:3464970
Environmental regulation of the long polar fimbriae 2 of enterohemorrhagic Escherichia coli O157:H7
Arenas-Hernández, Margarita M.P.; Rojas-López, Maricarmen; Medrano-López, Abraham; Nuñez-Reza, Karen J.; Puente, José Luis; Martínez-Laguna, Ygnacio; Torres, Alfredo G.
2014-01-01
The molecular mechanisms controlling expression of the Long Polar Fimbriae 2 (Lpf2) of enterohemorrhagic E. coli (EHEC) O157:H7 were evaluated. Primer extension was used to locate the lpfA2 transcriptional start site in EHEC strain EDL933 at 171 bp upstream of the lpfA2 start codon. Semi-quantitative RT-PCR demonstrated that the highest lpfA2 expression occurs between an OD600 of 1.0 and 1.2 in DMEM at pH 6.5 and 37°C. The level of lpfA2 transcription at OD600 1.2 and pH 6.5 was 4-times greater than that at pH 7.2. Although lpfA2 expression was decreased under iron-depleted conditions, its expression was increased in a Ferric-uptake-regulator (Fur) mutant strain. The lpfA2 transcript was 0.7 and 2-times more abundant in wt EHEC grown in DMEM pH 6.5 plus iron and MacConkey broth at 25°C, respectively, than in DMEM at pH 6.5. The lpf2 expression in DMEM pH 6.5 plus iron and bile salts was 2.7-times more abundant and similar to MacConkey. Further, transcription in the EDL933Δfur was 0.6 and 0.8-times higher as compared to the wt strain grown in DMEM pH 6.5 plus iron and MacConkey broth, respectively. Electrophoretic mobility shift assays (EMSA) showed that purified Fur interacts with the lpf2 regulatory region, indicating that Fur-repression is exerted by direct binding to the promoter region. In summary, we demonstrated that the EHEC lpf2 operon is regulated in response to temperature, pH, bile salts and iron, during exponential phase of growth, and controlled by Fur. PMID:24966050
Venkataramanan, Keerthi P; Min, Lie; Hou, Shuyu; Jones, Shawn W; Ralston, Matthew T; Lee, Kelvin H; Papoutsakis, E Terry
2015-01-01
Clostridium acetobutylicum is a model organism for both clostridial biology and solvent production. The organism is exposed to its own toxic metabolites butyrate and butanol, which trigger an adaptive stress response. Integrative analysis of proteomic and RNAseq data may provide novel insights into post-transcriptional regulation. The identified iTRAQ-based quantitative stress proteome is made up of 616 proteins with a 15 % genome coverage. The differentially expressed proteome correlated poorly with the corresponding differential RNAseq transcriptome. Up to 31 % of the differentially expressed proteins under stress displayed patterns opposite to those of the transcriptome, thus suggesting significant post-transcriptional regulation. The differential proteome of the translation machinery suggests that cells employ a different subset of ribosomal proteins under stress. Several highly upregulated proteins but with low mRNA levels possessed mRNAs with long 5'UTRs and strong RBS scores, thus supporting the argument that regulatory elements on the long 5'UTRs control their translation. For example, the oxidative stress response rubrerythrin was upregulated only at the protein level up to 40-fold without significant mRNA changes. We also identified many leaderless transcripts, several displaying different transcriptional start sites, thus suggesting mRNA-trimming mechanisms under stress. Downregulation of Rho and partner proteins pointed to changes in transcriptional elongation and termination under stress. The integrative proteomic-transcriptomic analysis demonstrated complex expression patterns of a large fraction of the proteome. Such patterns could not have been detected with one or the other omic analyses. Our analysis proposes the involvement of specific molecular mechanisms of post-transcriptional regulation to explain the observed complex stress response.
Transcription boundaries of U1 small nuclear RNA.
Kunkel, G R; Pederson, T
1985-01-01
Transcription-proximal stages of U1 small nuclear RNA biosynthesis were studied by 32P labeling of nascent chains in isolated HeLa cell nuclei. Labeled RNA was hybridized to nitrocellulose-immobilized, single-stranded M13 DNA clones corresponding to regions within or flanking a human U1 RNA gene. Transcription of U1 RNA was inhibited by greater than 95% by alpha-amanitin at 1 microgram/ml, consistent with previous evidence that it is synthesized by RNA polymerase II. No hybridization to DNA immediately adjacent to the 5' end of mature U1 RNA (-6 to -105 nucleotides) was detected, indicating that, like all studied polymerase II initiation, transcription of U1 RNA starts at or very near the cap site. However, in contrast to previously described transcription units for mRNA, in which equimolar transcription occurs for hundreds or thousands of nucleotides beyond the mature 3' end of the mRNA, labeled U1 RNA hybridization dropped off sharply within a very short region (approximately 60 nucleotides) immediately downstream from the 3' end of mature U1 RNA. Also in contrast to pre-mRNA, which is assembled into ribonucleoprotein (RNP) particles while still nascent RNA chains, the U1 RNA transcribed in isolated nuclei did not form RNP complexes by the criterion of reaction with a monoclonal antibody for the small nuclear RNP Sm proteins. This suggests that, unlike pre-mRNA-RNP particle formation, U1 small nuclear RNP assembly does not occur until after the completion of transcription. These results show that, despite their common synthesis by RNA polymerase II, mRNA and U1 small nuclear RNA differ markedly both in their extents of 3' processing and their temporal patterns of RNP assembly. Images PMID:2942763
Pu, Jian; Sun, Haina; Wang, Jinda; Wu, Min; Wang, Kangxu; Denholm, Ian; Han, Zhaojun
2016-11-01
As well as arising from single point mutations in binding sites or detoxifying enzymes, it is likely that insecticide resistance mechanisms are frequently controlled by multiple genetic factors, resulting in resistance being inherited as a quantitative trait. However, empirical evidence for this is still rare. Here we analyse the causes of up-regulation of CYP6FU1, a monoxygenase implicated in resistance to deltamethrin in the rice pest Laodelphax striatellus. The 5'-flanking region of this gene was cloned and sequenced from individuals of a susceptible and a resistant strain. A luminescent reporter assay was used to evaluate different 5'-flanking regions and their fragments for promoter activity. Mutations enhancing promoter activity in various fragments were characterized, singly and in combination, by site mutation recovery. Nucleotide diversity in flanking sequences was greatly reduced in deltamethrin-resistant insects compared to susceptible ones. Phylogenetic sequence analysis found that CYP6FU1 had five different types of 5'-flanking region. All five types were present in a susceptible strain but only a single type showing the highest promoter activity was present in a resistant strain. Four cis-acting elements were identified whose influence on up-regulation was much more pronounced in combination than when present singly. Of these, two were new transcription factor (TF) binding sites produced by mutations, another one was also a new TF binding site alternated from an existing one, and the fourth was a unique transcription start site. These results demonstrate that multiple cis-acting elements are involved in up-regulating CYP6FU1 to generate a resistance phenotype. Copyright © 2016 Elsevier Ltd. All rights reserved.
Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben
2017-03-28
Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less
Bode, Nadine J.; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen
2015-01-01
The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. PMID:25847961
Mühlberger, Elke; Lötfering, Beate; Klenk, Hans-Dieter; Becker, Stephan
1998-01-01
This paper describes the first reconstituted replication system established for a member of the Filoviridae, Marburg virus (MBGV). MBGV minigenomes containing the leader and trailer regions of the MBGV genome and the chloramphenicol acetyltransferase (CAT) gene were constructed. In MBGV-infected cells, these minigenomes were replicated and encapsidated and could be passaged. Unlike most other members of the order Mononegavirales, filoviruses possess four proteins presumed to be components of the nucleocapsid (NP, VP35, VP30, and L). To determine the protein requirements for replication and transcription, a reverse genetic system was established for MBGV based on the vaccinia virus T7 expression system. Northern blot analysis of viral RNA revealed that three nucleocapsid proteins (NP, VP35, and L) were essential and sufficient for transcription as well as replication and encapsidation. These data indicate that VP35, rather than VP30, is the functional homologue of rhabdo- and paramyxovirus P proteins. The reconstituted replication system was profoundly affected by the NP-to-VP35 expression ratio. To investigate whether CAT gene expression was achieved entirely by mRNA or in part by full-length plus-strand minigenomes, a copy-back minireplicon containing the CAT gene but lacking MBGV-specific transcriptional start sites was employed in the artificial replication system. This construct was replicated without accompanying CAT activity. It was concluded that the CAT activity reflected MBGV-specific transcription and not replication. PMID:9765419
The mechanism of RNA 5' capping with NAD +, NADH and desphospho-CoA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bird, Jeremy G.; Zhang, Yu; Tian, Yuan
The chemical nature of the 5' end of RNA is a key determinant of RNA stability, processing, localization and translation efficiency and has been proposed to provide a layer of ‘epitranscriptomic’ gene regulation. Recently it has been shown that some bacterial RNA species carry a 5'-end structure reminiscent of the 5' 7-methylguanylate ‘cap’ in eukaryotic RNA. In particular, RNA species containing a 5'-end nicotinamide adenine dinucleotide (NAD+) or 3'-desphospho-coenzyme A (dpCoA) have been identified in both Gram-negative and Gram-positive bacteria. It has been proposed that NAD+, reduced NAD+ (NADH) and dpCoA caps are added to RNA after transcription initiation, inmore » a manner analogous to the addition of 7-methylguanylate caps. Here we show instead that NAD+, NADH and dpCoA are incorporated into RNA during transcription initiation, by serving as non-canonical initiating nucleotides (NCINs) for de novo transcription initiation by cellular RNA polymerase (RNAP). We further show that both bacterial RNAP and eukaryotic RNAP II incorporate NCIN caps, that promoter DNA sequences at and upstream of the transcription start site determine the efficiency of NCIN capping, that NCIN capping occurs in vivo, and that NCIN capping has functional consequences. We report crystal structures of transcription initiation complexes containing NCIN-capped RNA products. Our results define the mechanism and structural basis of NCIN capping, and suggest that NCIN-mediated ‘ab initio capping’ may occur in all organisms.« less
Nguyen, Dinh-Duc; Lee, Dong Gyu; Kim, Sinae; Kang, Keunsoo; Rhee, Je-Keun; Chang, Suhwan
2018-05-14
BRCA1 is a multifunctional tumor suppressor involved in several essential cellular processes. Although many of these functions are driven by or related to its transcriptional/epigenetic regulator activity, there has been no genome-wide study to reveal the transcriptional/epigenetic targets of BRCA1. Therefore, we conducted a comprehensive analysis of genomics/transcriptomics data to identify novel BRCA1 target genes. We first analyzed ENCODE data with BRCA1 chromatin immunoprecipitation (ChIP)-sequencing results and identified a set of genes with a promoter occupied by BRCA1. We collected 3085 loci with a BRCA1 ChIP signal from four cell lines and calculated the distance between the loci and the nearest gene transcription start site (TSS). Overall, 66.5% of the BRCA1-bound loci fell into a 2-kb region around the TSS, suggesting a role in transcriptional regulation. We selected 45 candidate genes based on gene expression correlation data, obtained from two GEO (Gene Expression Omnibus) datasets and TCGA data of human breast cancer, compared to BRCA1 expression levels. Among them, we further tested three genes ( MEIS2 , CKS1B and FADD ) and verified FADD as a novel direct target of BRCA1 by ChIP, RT-PCR, and a luciferase reporter assay. Collectively, our data demonstrate genome-wide transcriptional regulation by BRCA1 and suggest target genes as biomarker candidates for BRCA1-associated breast cancer.
VEGFR2 Translocates to the Nucleus to Regulate Its Own Transcription
Domingues, Inês; Rino, José; Demmers, Jeroen A. A.; de Lanerolle, Primal; Santos, Susana Constantino Rosa
2011-01-01
Vascular Endothelial Growth Factor Receptor-2 (VEGFR2) is the major mediator of the angiogenic effects of VEGF. In addition to its well known role as a membrane receptor that activates multiple signaling pathways, VEGFR2 also has a nuclear localization. However, what VEGFR2 does in the nucleus is still unknown. In the present report we show that, in endothelial cells, nuclear VEGFR2 interacts with several nuclear proteins, including the Sp1, a transcription factor that has been implicated in the regulation of genes needed for angiogenesis. By in vivo chromatin immunoprecipitation (ChIP) assays, we found that VEGFR2 binds to the Sp1-responsive region of the VEGFR2 proximal promoter. These results were confirmed by EMSA assays, using the same region of the VEGFR2 promoter. Importantly, we show that the VEGFR2 DNA binding is directly linked to the transcriptional activation of the VEGFR2 promoter. By reporter assays, we found that the region between -300/-116 relative to the transcription start site is essential to confer VEGFR2-dependent transcriptional activity. It was previously described that nuclear translocation of the VEGFR2 is dependent on its activation by VEGF. In agreement, we observed that the binding of VEGFR2 to DNA requires VEGF activation, being blocked by Bevacizumab and Sunitinib, two anti-angiogenic agents that inhibit VEGFR2 activation. Our findings demonstrate a new mechanism by which VEGFR2 activates its own promoter that could be involved in amplifying the angiogenic response. PMID:21980525
Kopf, Matthias; Klähn, Stephan; Scholz, Ingeborg; Hess, Wolfgang R.; Voß, Björn
2015-01-01
In all studied organisms, a substantial portion of the transcriptome consists of non-coding RNAs that frequently execute regulatory functions. Here, we have compared the primary transcriptomes of the cyanobacteria Synechocystis sp. PCC 6714 and PCC 6803 under 10 different conditions. These strains share 2854 protein-coding genes and a 16S rRNA identity of 99.4%, indicating their close relatedness. Conserved major transcriptional start sites (TSSs) give rise to non-coding transcripts within the sigB gene, from the 5′UTRs of cmpA and isiA, and 168 loci in antisense orientation. Distinct differences include single nucleotide polymorphisms rendering promoters inactive in one of the strains, e.g., for cmpR and for the asRNA PsbA2R. Based on the genome-wide mapped location, regulation and classification of TSSs, non-coding transcripts were identified as the most dynamic component of the transcriptome. We identified a class of mRNAs that originate by read-through from an sRNA that accumulates as a discrete and abundant transcript while also serving as the 5′UTR. Such an sRNA/mRNA structure, which we name ‘actuaton’, represents another way for bacteria to remodel their transcriptional network. Our findings support the hypothesis that variations in the non-coding transcriptome constitute a major evolutionary element of inter-strain divergence and capability for physiological adaptation. PMID:25902393
NFATc1 regulation of the human β3 integrin promoter in osteoclast differentiation
Crotti, Tania N.; Flannery, Merrilee; Walsh, Nicole C.; Fleming, Joseph D.; Goldring, Steven R.; McHugh, Kevin P.
2006-01-01
The transcription factor NFATc1 plays an essential role in transducing signals from RANKL in osteoclast differentiation. To date, however, the specific transcriptional targets of NFATc1 are unknown. Expression of the β3 integrin is required for normal osteoclast function. We therefore examined the role of NFATc1 in human β3 integrin expression in osteoclast differentiation. Analysis of the mouse and human β3 gene promoters revealed considerable sequence homology across a 1.3 kb region upstream of the transcription start site (TSS), with conserved NFAT binding elements present. The region −1242 to +29 (relative to the TSS) was cloned as a luciferase reporter construct (pB3-1.3) and a deletion construct removing to −997 (pB3-1) made. The deletion of 245 bp 5′ removed three conserved NFAT sites including a consensus NFAT:AP-1 site. The pB3-1.3 reporter construct was induced by treatment with RANKL in the range 2.5–40 ng/ml and dose-dependently induced by co-transfection with human NFATc1 in RAW264.7 cells. The pB3-1 deletion construct was minimally induced with RANKL treatment and unresponsive to co-transfected NFATc1. Direct NFAT binding to two of the consensus NFAT sites within this 245 bp 5′ region was demonstrated by EMSA and supershift with anti-NFAT antibodies. Mutation of two of the conserved NFAT sites in the −1242 to −997 fragment was required to prevent binding. The double NFAT mutant, in the context of the full-length promoter was unresponsive to RANKL treatment or co-transfected NFATc1. We generated cell-permeable TAT-dominant-negative (dn)NFATc1 fusion proteins to assess the effect of blockade of NFAT signaling. Transduction with dnNFAT inhibited RANKL induction of the human β3 integrin promoter. Involvement of the NFATc1-calcineurin pathway in regulating the human β3 integrin promoter was further confirmed using the calcineurin pathway inhibitory peptide 11R-VIVIT. Together these results establish the β3 gene as a direct target of NFATc1 in RANKL-dependent osteoclast formation. PMID:16513293
The primary transcriptome of the marine diazotroph Trichodesmium erythraeum IMS101
NASA Astrophysics Data System (ADS)
Pfreundt, Ulrike; Kopf, Matthias; Belkin, Natalia; Berman-Frank, Ilana; Hess, Wolfgang R.
2014-08-01
Blooms of the dinitrogen-fixing marine cyanobacterium Trichodesmium considerably contribute to new nitrogen inputs into tropical oceans. Intriguingly, only 60% of the Trichodesmium erythraeum IMS101 genome sequence codes for protein, compared with ~85% in other sequenced cyanobacterial genomes. The extensive non-coding genome fraction suggests space for an unusually high number of unidentified, potentially regulatory non-protein-coding RNAs (ncRNAs). To identify the transcribed fraction of the genome, here we present a genome-wide map of transcriptional start sites (TSS) at single nucleotide resolution, revealing the activity of 6,080 promoters. We demonstrate that T. erythraeum has the highest number of actively splicing group II introns and the highest percentage of TSS yielding ncRNAs of any bacterium examined to date. We identified a highly transcribed retroelement that serves as template repeat for the targeted mutation of at least 12 different genes by mutagenic homing. Our findings explain the non-coding portion of the T. erythraeum genome by the transcription of an unusually high number of non-coding transcripts in addition to the known high incidence of transposable elements. We conclude that riboregulation and RNA maturation-dependent processes constitute a major part of the Trichodesmium regulatory apparatus.
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M. L.; Sérandour, Aurélien A.; Carroll, Jason S.; Beaudoin, Claude; Vanacker, Jean-Marc
2017-01-01
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion. PMID:28348226
ERRα induces H3K9 demethylation by LSD1 to promote cell invasion.
Carnesecchi, Julie; Forcet, Christelle; Zhang, Ling; Tribollet, Violaine; Barenton, Bruno; Boudra, Rafik; Cerutti, Catherine; Billas, Isabelle M L; Sérandour, Aurélien A; Carroll, Jason S; Beaudoin, Claude; Vanacker, Jean-Marc
2017-04-11
Lysine Specific Demethylase 1 (LSD1) removes mono- and dimethyl groups from lysine 4 of histone H3 (H3K4) or H3K9, resulting in repressive or activating (respectively) transcriptional histone marks. The mechanisms that control the balance between these two antagonist activities are not understood. We here show that LSD1 and the orphan nuclear receptor estrogen-related receptor α (ERRα) display commonly activated genes. Transcriptional activation by LSD1 and ERRα involves H3K9 demethylation at the transcriptional start site (TSS). Strikingly, ERRα is sufficient to induce LSD1 to demethylate H3K9 in vitro. The relevance of this mechanism is highlighted by functional data. LSD1 and ERRα coregulate several target genes involved in cell migration, including the MMP1 matrix metallo-protease, also activated through H3K9 demethylation at the TSS. Depletion of LSD1 or ERRα reduces the cellular capacity to invade the extracellular matrix, a phenomenon that is rescued by MMP1 reexpression. Altogether our results identify a regulatory network involving a direct switch in the biochemical activities of a histone demethylase, leading to increased cell invasion.
Nucleosome Positioning and NDR Structure at RNA Polymerase III Promoters
NASA Astrophysics Data System (ADS)
Helbo, Alexandra Søgaard; Lay, Fides D.; Jones, Peter A.; Liang, Gangning; Grønbæk, Kirsten
2017-02-01
Chromatin is structurally involved in the transcriptional regulation of all genes. While the nucleosome positioning at RNA polymerase II (pol II) promoters has been extensively studied, less is known about the chromatin structure at pol III promoters in human cells. We use a high-resolution analysis to show substantial differences in chromatin structure of pol II and pol III promoters, and between subtypes of pol III genes. Notably, the nucleosome depleted region at the transcription start site of pol III genes extends past the termination sequences, resulting in nucleosome free gene bodies. The +1 nucleosome is located further downstream than at pol II genes and furthermore displays weak positioning. The variable position of the +1 location is seen not only within individual cell populations and between cell types, but also between different pol III promoter subtypes, suggesting that the +1 nucleosome may be involved in the transcriptional regulation of pol III genes. We find that expression and DNA methylation patterns correlate with distinct accessibility patterns, where DNA methylation associates with the silencing and inaccessibility at promoters. Taken together, this study provides the first high-resolution map of nucleosome positioning and occupancy at human pol III promoters at specific loci and genome wide.
Nucleosome architecture throughout the cell cycle
Deniz, Özgen; Flores, Oscar; Aldea, Martí; Soler-López, Montserrat; Orozco, Modesto
2016-01-01
Nucleosomes provide additional regulatory mechanisms to transcription and DNA replication by mediating the access of proteins to DNA. During the cell cycle chromatin undergoes several conformational changes, however the functional significance of these changes to cellular processes are largely unexplored. Here, we present the first comprehensive genome-wide study of nucleosome plasticity at single base-pair resolution along the cell cycle in Saccharomyces cerevisiae. We determined nucleosome organization with a specific focus on two regulatory regions: transcription start sites (TSSs) and replication origins (ORIs). During the cell cycle, nucleosomes around TSSs display rearrangements in a cyclic manner. In contrast to gap (G1 and G2) phases, nucleosomes have a fuzzier organization during S and M phases, Moreover, the choreography of nucleosome rearrangements correlate with changes in gene expression during the cell cycle, indicating a strong association between nucleosomes and cell cycle-dependent gene functionality. On the other hand, nucleosomes are more dynamic around ORIs along the cell cycle, albeit with tighter regulation in early firing origins, implying the functional role of nucleosomes on replication origins. Our study provides a dynamic picture of nucleosome organization throughout the cell cycle and highlights the subsequent impact on transcription and replication activity. PMID:26818620
Hu, Xiaolong; Shen, Yunwang; Zheng, Qin; Wang, Guobao; Wu, Xiaofeng; Gong, Chengliang
2016-02-01
Bombyx mori nucleopolyhedrovirus (BmNPV) is a major pathogen that specifically infects the domestic silkworm and causes serious economic loss to sericulture around the world. The function of BmNPV Bm59 gene in the viral life cycle is inconclusive. To investigate the role of Bm59 during viral infection, the transcription initiation site and temporal expression of Bm59 were analyzed, and Bm59-knockout virus was generated through homologous recombination in Escherichia coli. The results showed that Bm59 is an early transcription gene with an atypia early transcriptional start motif. Budded virion (BV) production and DNA replication in the BmN cells transfected with the Bm59-knockout virus bacmid were similar to those in the cells transfected with the wild-type virus. Electron microscopy revealed that the occlusion-derived virus can be produced in cells infected with the Bm59-knockout virus. These results indicated that Bm59 is an early gene and is not essential for viral replication or assembly of BmNPV. These findings suggested that non-essential gene (Bm59) remained in the viral genome, which may interact with other viral/host genes in a certain situation.
de Castro, Minique Hilda; de Klerk, Daniel; Pienaar, Ronel; Rees, D Jasper G; Mans, Ben J
2017-08-10
Ticks secrete a diverse mixture of secretory proteins into the host to evade its immune response and facilitate blood-feeding, making secretory proteins attractive targets for the production of recombinant anti-tick vaccines. The largely neglected tick species, Rhipicephalus zambeziensis, is an efficient vector of Theileria parva in southern Africa but its available sequence information is limited. Next generation sequencing has advanced sequence availability for ticks in recent years and has assisted the characterisation of secretory proteins. This study focused on the de novo assembly and annotation of the salivary gland transcriptome of R. zambeziensis and the temporal expression of secretory protein transcripts in female and male ticks, before the onset of feeding and during early and late feeding. The sialotranscriptome of R. zambeziensis yielded 23,631 transcripts from which 13,584 non-redundant proteins were predicted. Eighty-six percent of these contained a predicted start and stop codon and were estimated to be putatively full-length proteins. A fifth (2569) of the predicted proteins were annotated as putative secretory proteins and explained 52% of the expression in the transcriptome. Expression analyses revealed that 2832 transcripts were differentially expressed among feeding time points and 1209 between the tick sexes. The expression analyses further indicated that 57% of the annotated secretory protein transcripts were differentially expressed. Dynamic expression profiles of secretory protein transcripts were observed during feeding of female ticks. Whereby a number of transcripts were upregulated during early feeding, presumably for feeding site establishment and then during late feeding, 52% of these were downregulated, indicating that transcripts were required at specific feeding stages. This suggested that secretory proteins are under stringent transcriptional regulation that fine-tunes their expression in salivary glands during feeding. No open reading frames were predicted for 7947 transcripts. This class represented 17% of the differentially expressed transcripts, suggesting a potential transcriptional regulatory function of long non-coding RNA in tick blood-feeding. The assembled sialotranscriptome greatly expands the sequence availability of R. zambeziensis, assists in our understanding of the transcription of secretory proteins during blood-feeding and will be a valuable resource for future vaccine candidate selection.
Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R
1996-03-01
In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.
Kusakabe, Rie; Tani, Saori; Nishitsuji, Koki; Shindo, Miyuki; Okamura, Kohji; Miyamoto, Yuki; Nakai, Kenta; Suzuki, Yutaka; Kusakabe, Takehiro G; Inoue, Kunio
2013-01-01
Muscle-specific miR-1/206 and miR-133 families have been suggested to play fundamental roles in skeletal and cardiac myogenesis in vertebrates. To gain insights into the relationships between the divergence of these miRs and muscular tissue types, we investigated the expression patterns of miR-1 and miR-133 in two ascidian Ciona species and compared their genomic structures with those of other chordates. We found that Ciona intestinalis and Ciona savignyi each possess a single copy of the miR-1/miR-133 cluster, which is only 350 nucleotide long. During embryogenesis, Ciona miR-1 and miR-133 are generated as a single continuous primary transcript accumulated in the nuclei of the tail muscle cells, starting at the gastrula stage. In adults, mature miR-133 and miR-1 are differentially expressed in the heart and body wall muscle. Expression of the reporter gene linked to the 850-bp upstream region of the predicted transcription start site confirmed that this region drives the muscle-specific expression of the primary transcript of miR-1/miR-133. In many deuterostome lineages, including that of Ciona, the miR-1/133 cluster is located in the same intron of the mind bomb (mib) gene in reverse orientation. Our results suggest that the origin of genomic organization and muscle-specific regulation of miR-1/133 can be traced back to the ancestor of chordates. Duplication of this miR cluster might have led to the remarkable elaboration in the morphology and function of skeletal muscles in the vertebrate lineage. Copyright © 2012 Elsevier B.V. All rights reserved.
GBshape: a genome browser database for DNA shape annotations.
Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo
2015-01-01
Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Veyrieras, Jean-Baptiste; Gaffney, Daniel J.; Pickrell, Joseph K.; Gilad, Yoav; Stephens, Matthew; Pritchard, Jonathan K.
2012-01-01
Mapping of expression quantitative trait loci (eQTLs) is an important technique for studying how genetic variation affects gene regulation in natural populations. In a previous study using Illumina expression data from human lymphoblastoid cell lines, we reported that cis-eQTLs are especially enriched around transcription start sites (TSSs) and immediately upstream of transcription end sites (TESs). In this paper, we revisit the distribution of eQTLs using additional data from Affymetrix exon arrays and from RNA sequencing. We confirm that most eQTLs lie close to the target genes; that transcribed regions are generally enriched for eQTLs; that eQTLs are more abundant in exons than introns; and that the peak density of eQTLs occurs at the TSS. However, we find that the intriguing TES peak is greatly reduced or absent in the Affymetrix and RNA-seq data. Instead our data suggest that the TES peak observed in the Illumina data is mainly due to exon-specific QTLs that affect 3′ untranslated regions, where most of the Illumina probes are positioned. Nonetheless, we do observe an overall enrichment of eQTLs in exons versus introns in all three data sets, consistent with an important role for exonic sequences in gene regulation. PMID:22359548
FANTOM5 CAGE profiles of human and mouse reprocessed for GRCh38 and GRCm38 genome assemblies.
Abugessaisa, Imad; Noguchi, Shuhei; Hasegawa, Akira; Harshbarger, Jayson; Kondo, Atsushi; Lizio, Marina; Severin, Jessica; Carninci, Piero; Kawaji, Hideya; Kasukawa, Takeya
2017-08-29
The FANTOM5 consortium described the promoter-level expression atlas of human and mouse by using CAGE (Cap Analysis of Gene Expression) with single molecule sequencing. In the original publications, GRCh37/hg19 and NCBI37/mm9 assemblies were used as the reference genomes of human and mouse respectively; later, the Genome Reference Consortium released newer genome assemblies GRCh38/hg38 and GRCm38/mm10. To increase the utility of the atlas in forthcoming researches, we reprocessed the data to make them available on the recent genome assemblies. The data include observed frequencies of transcription starting sites (TSSs) based on the realignment of CAGE reads, and TSS peaks that are converted from those based on the previous reference. Annotations of the peak names were also updated based on the latest public databases. The reprocessed results enable us to examine frequencies of transcription initiations on the recent genome assemblies and to refer promoters with updated information across the genome assemblies consistently.
ElemeNT: a computational tool for detecting core promoter elements.
Sloutskin, Anna; Danino, Yehuda M; Orenstein, Yaron; Zehavi, Yonathan; Doniger, Tirza; Shamir, Ron; Juven-Gershon, Tamar
2015-01-01
Core promoter elements play a pivotal role in the transcriptional output, yet they are often detected manually within sequences of interest. Here, we present 2 contributions to the detection and curation of core promoter elements within given sequences. First, the Elements Navigation Tool (ElemeNT) is a user-friendly web-based, interactive tool for prediction and display of putative core promoter elements and their biologically-relevant combinations. Second, the CORE database summarizes ElemeNT-predicted core promoter elements near CAGE and RNA-seq-defined Drosophila melanogaster transcription start sites (TSSs). ElemeNT's predictions are based on biologically-functional core promoter elements, and can be used to infer core promoter compositions. ElemeNT does not assume prior knowledge of the actual TSS position, and can therefore assist in annotation of any given sequence. These resources, freely accessible at http://lifefaculty.biu.ac.il/gershon-tamar/index.php/resources, facilitate the identification of core promoter elements as active contributors to gene expression.
High-resolution mapping of transcription factor binding sites on native chromatin
Kasinathan, Sivakanthan; Orsi, Guillermo A.; Zentner, Gabriel E.; Ahmad, Kami; Henikoff, Steven
2014-01-01
Sequence-specific DNA-binding proteins including transcription factors (TFs) are key determinants of gene regulation and chromatin architecture. Formaldehyde cross-linking and sonication followed by Chromatin ImmunoPrecipitation (X-ChIP) is widely used for profiling of TF binding, but is limited by low resolution and poor specificity and sensitivity. We present a simple protocol that starts with micrococcal nuclease-digested uncross-linked chromatin and is followed by affinity purification of TFs and paired-end sequencing. The resulting ORGANIC (Occupied Regions of Genomes from Affinity-purified Naturally Isolated Chromatin) profiles of Saccharomyces cerevisiae Abf1 and Reb1 provide highly accurate base-pair resolution maps that are not biased toward accessible chromatin, and do not require input normalization. We also demonstrate the high specificity of our method when applied to larger genomes by profiling Drosophila melanogaster GAGA Factor and Pipsqueak. Our results suggest that ORGANIC profiling is a widely applicable high-resolution method for sensitive and specific profiling of direct protein-DNA interactions. PMID:24336359
Neuhaus, H; Link, G
1987-01-01
The trnK gene endocing the tRNALys(UUU) has been located on mustard (Sinapis alba) chloroplast DNA, 263 bp upstream of the psbA gene on the same strand. The nucleotide sequence of the trnK gene and its flanking regions as well as the putative transcription start and termination sites are shown. The 5' end of the transcript lies 121 bp upstream of the 5' tRNA coding region and is preceded by procaryotic-type "-10" and "-35" sequence elements, while the 3' end maps 2.77 kb downstream to a DNA region with possible stemloop secondary structure. The anticodon loop of the tRNALys is interrupted by a 2,574 bp intron containing a long open reading frame, which codes for 524 amino acids. Based on conserved stem and loop structures, this intron has characteristic features of a class II intron. A region near the carboxyl terminus of the derived polypeptide appears structurally related to maturases.
Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.
Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G
1992-01-01
opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590
Gall, BJ; Wilson, A; Schroer, AB; Gross, JD; Stoilov, P; Setola, V; Watkins, CM; Siderovski, DP
2015-01-01
G protein signaling modulator 3 (GPSM3) is a regulator of G protein-coupled receptor signaling, with expression restricted to leukocytes and lymphoid organs. Previous genome-wide association studies have highlighted single-nucleotide polymorphisms (SNPs rs204989, rs204991) in a region upstream of the GPSM3 transcription start site as being inversely correlated to the prevalence of rheumatoid arthritis (RA) -- this association is supported by the protection afforded to Gpsm3-deficient mice in models of inflammatory arthritis. Here, we assessed the functional consequences of these polymorphisms. We collected biospecimens from 50 volunteers with RA diagnoses, 50 RA-free volunteers matched to the aforementioned group, and 100 unmatched healthy young volunteers. We genotyped these individuals for GPSM3 (rs204989, rs204991), CCL21 (rs2812378), and HLA gene region (rs6457620) polymorphisms, and found no significant differences in minor allele frequencies between the RA and disease-free cohorts. However, we identified that individuals homozygous for SNPs rs204989 and rs204991 had decreased GPSM3 transcript abundance relative to individuals homozygous for the major allele. In vitro promoter activity studies suggest that SNP rs204989 is the primary cause of this decrease in transcript levels. Knockdown of GPSM3 in THP-1 cells, a human monocytic cell line, was found to disrupt ex vivo migration to the chemokine MCP-1. PMID:26821282
Dissecting protein:protein interactions between transcription factors with an RNA aptamer.
Tian, Y; Adya, N; Wagner, S; Giam, C Z; Green, M R; Ellington, A D
1995-01-01
Nucleic acid aptamers isolated from random sequence pools have generally proven useful at inhibiting the interactions of nucleic acid binding proteins with their cognate nucleic acids. In order to develop reagents that could also be used to study protein:protein interactions, we have used in vitro selection to search for RNA aptamers that could interact with the transactivating protein Tax from human T-cell leukemia virus. Tax does not normally bind to nucleic acids, but instead stimulates transcription by interacting with a variety of cellular transcription factors, including the cyclic AMP-response element binding protein (CREB), NF-kappa B, and the serum response factor (SRF). Starting from a pool of greater than 10(13) different RNAs with a core of 120 random sequence positions, RNAs were selected for their ability to be co-retained on nitrocellulose filters with Tax. After five cycles of selection and amplification, a single nucleic acid species remained. This aptamer was found to bind Tax with high affinity and specificity, and could disrupt complex formation between Tax and NF-kappa B, but not with SRF. The differential effects of our aptamer probe on protein:protein interactions suggest a model for how the transcription factor binding sites on the surface of the Tax protein are organized. This model is consistent with data from a variety of other studies. PMID:7489503
Gall, B J; Wilson, A; Schroer, A B; Gross, J D; Stoilov, P; Setola, V; Watkins, C M; Siderovski, D P
2016-03-01
G protein signaling modulator 3 (GPSM3) is a regulator of G protein-coupled receptor signaling, with expression restricted to leukocytes and lymphoid organs. Previous genome-wide association studies have highlighted single-nucleotide polymorphisms (SNPs; rs204989 and rs204991) in a region upstream of the GPSM3 transcription start site as being inversely correlated to the prevalence of rheumatoid arthritis (RA)-this association is supported by the protection afforded to Gpsm3-deficient mice in models of inflammatory arthritis. Here, we assessed the functional consequences of these polymorphisms. We collected biospecimens from 50 volunteers with RA diagnoses, 50 RA-free volunteers matched to the aforementioned group and 100 unmatched healthy young volunteers. We genotyped these individuals for GPSM3 (rs204989, rs204991), CCL21 (rs2812378) and HLA gene region (rs6457620) polymorphisms, and found no significant differences in minor allele frequencies between the RA and disease-free cohorts. However, we identified that individuals homozygous for SNPs rs204989 and rs204991 had decreased GPSM3 transcript abundance relative to individuals homozygous for the major allele. In vitro promoter activity studies suggest that SNP rs204989 is the primary cause of this decrease in transcript levels. Knockdown of GPSM3 in THP-1 cells, a human monocytic cell line, was found to disrupt ex vivo migration to the chemokine MCP-1.
Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.
Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W
2006-02-01
A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.
An internal regulatory element controls troponin I gene expression
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yutzey, K.E.; Kline, R.L.; Konieczmy, S.F.
1989-04-01
During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein genemore » has not been identified. In contrast to the results of these earlier studies, the authors have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene.« less
An internal regulatory element controls troponin I gene expression.
Yutzey, K E; Kline, R L; Konieczny, S F
1989-01-01
During skeletal myogenesis, approximately 20 contractile proteins and related gene products temporally accumulate as the cells fuse to form multinucleated muscle fibers. In most instances, the contractile protein genes are regulated transcriptionally, which suggests that a common molecular mechanism may coordinate the expression of this diverse and evolutionarily unrelated gene set. Recent studies have examined the muscle-specific cis-acting elements associated with numerous contractile protein genes. All of the identified regulatory elements are positioned in the 5'-flanking regions, usually within 1,500 base pairs of the transcription start site. Surprisingly, a DNA consensus sequence that is common to each contractile protein gene has not been identified. In contrast to the results of these earlier studies, we have found that the 5'-flanking region of the quail troponin I (TnI) gene is not sufficient to permit the normal myofiber transcriptional activation of the gene. Instead, the TnI gene utilizes a unique internal regulatory element that is responsible for the correct myofiber-specific expression pattern associated with the TnI gene. This is the first example in which a contractile protein gene has been shown to rely primarily on an internal regulatory element to elicit transcriptional activation during myogenesis. The diversity of regulatory elements associated with the contractile protein genes suggests that the temporal expression of the genes may involve individual cis-trans regulatory components specific for each gene. Images PMID:2725509
Kuo, Yi-Zih; Fang, Wei-Yu; Huang, Cheng-Chih; Tsai, Sen-Tien; Wang, Yi-Ching; Yang, Chih-Li; Wu, Li-Wha
2017-01-01
Hyaluronan (HA) is a major extracellular matrix component. However, its role and mediation in oral cancer remains elusive. Hyaluronan synthase 3 (HAS3), involved in pro-inflammatory short chain HA synthesis, was the predominant synthase in oral cancer cells and tissues. HAS3 overexpression significantly increased oral cancer cell migration, invasion and xenograft tumorigenesis accompanied with the increased expression of tumor necrosis factor alpha (TNF-α) and monocyte chemoattractant protein 1 (MCP-1). Conversely, HAS3 depletion abrogated HAS3-mediated stimulation. HAS3 induced oncogenic actions partly through activating EGFR-SRC signaling. HAS3-derived HA release into extracellular milieu enhanced transendothelial monocyte migration and MCP-1 expression, which was attenuated by anti-HAS3 antibodies or a HAS inhibitor, 4-Methylumbelliferone (4-MU). The NF-κB-binding site III at -1692 to -1682 bp upstream from the transcript 1 start site in HAS3 proximal promoter was the most responsive to TNF-α-stimulated transcription. ChIP-qPCR analysis confirmed the highest NF-κB-p65 enrichment on site III. Increased HAS3 mRNA expression was negatively correlated with the overall survival of oral cancer patients. A concomitant increase of TNF-α, a stimulus for HAS3 expression, with HAS3 expression was not only associated with lymph node metastasis but also negated clinical outcome. Together, HAS3 and TNF-α formed an inter-regulation loop to enhance tumorigenesis in oral cancer. PMID:28107185
Lefèvre, L; Omeiri, H; Drougat, L; Hantel, C; Giraud, M; Val, P; Rodriguez, S; Perlemoine, K; Blugeon, C; Beuschlein, F; de Reyniès, A; Rizk-Rabin, M; Bertherat, J; Ragazzon, B
2015-01-01
Adrenocortical cancer (ACC) is a very aggressive tumor, and genomics studies demonstrate that the most frequent alterations of driver genes in these cancers activate the Wnt/β-catenin signaling pathway. However, the adrenal-specific targets of oncogenic β-catenin-mediating tumorigenesis have not being established. A combined transcriptomic analysis from two series of human tumors and the human ACC cell line H295R harboring a spontaneous β-catenin activating mutation was done to identify the Wnt/β-catenin targets. Seven genes were consistently identified in the three studies. Among these genes, we found that AFF3 mediates the oncogenic effects of β-catenin in ACC. The Wnt response element site located at nucleotide position −1408 of the AFF3 transcriptional start sites (TSS) mediates the regulation by the Wnt/β-catenin signaling pathway. AFF3 silencing decreases cell proliferation and increases apoptosis in the ACC cell line H295R. AFF3 is located in nuclear speckles, which play an important role in RNA splicing. AFF3 overexpression in adrenocortical cells interferes with the organization and/or biogenesis of these nuclear speckles and alters the distribution of CDK9 and cyclin T1 such that they accumulate at the sites of AFF3/speckles. We demonstrate that AFF3 is a new target of Wnt/β-catenin pathway involved in ACC, acting on transcription and RNA splicing. PMID:26214578
Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene.
Dale, Rodney M; Topczewski, Jacek
2011-09-15
Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5' of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. Copyright © 2011 Elsevier Inc. All rights reserved.
Identification of an evolutionarily conserved regulatory element of the zebrafish col2a1a gene
Dale, Rodney M.; Topczewski, Jacek
2011-01-01
Zebrafish (Danio rerio) is an excellent model organism for the study of vertebrate development including skeletogenesis. Studies of mammalian cartilage formation were greatly advanced through the use of a cartilage specific regulatory element of the Collagen type II alpha 1 (Col2a1) gene. In an effort to isolate such an element in zebrafish, we compared the expression of two col2a1 homologues and found that expression of col2a1b, a previously uncharacterized zebrafish homologue, only partially overlaps with col2a1a. We focused our analysis on col2a1a, as it is expressed in both the stacked chondrocytes and the perichondrium. By comparing the genomic sequence surrounding the predicted transcriptional start site of col2a1a among several species of teleosts we identified a small highly conserved sequence (R2) located 1.7 kb upstream of the presumptive transcriptional initiation site. Interestingly, neither the sequence nor location of this element is conserved between teleost and mammalian Col2a1. We generated transient and stable transgenic lines with just the R2 element or the entire 1.7 kb fragment 5’ of the transcriptional initiation site. The identified regulatory elements enable the tracking of cellular development in various tissues by driving robust reporter expression in craniofacial cartilage, ear, notochord, floor plate, hypochord and fins in a pattern similar to the expression of endogenous col2a1a. Using a reporter gene driven by the R2 regulatory element, we analyzed the morphogenesis of the notochord sheath cells as they withdraw from the stack of initially uniform cells and encase the inflating vacuolated notochord cells. Finally, we show that like endogenous col2a1a, craniofacial expression of these reporter constructs depends on Sox9a transcription factor activity. At the same time, notochord expression is maintained after Sox9a knockdown, suggesting that other factors can activate expression through the identified regulatory element in this tissue. PMID:21723274
Deciphering the Regulatory Logic of an Ancient, Ultraconserved Nuclear Receptor Enhancer Module
Bagamasbad, Pia D.; Bonett, Ronald M.; Sachs, Laurent; Buisine, Nicolas; Raj, Samhitha; Knoedler, Joseph R.; Kyono, Yasuhiro; Ruan, Yijun; Ruan, Xiaoan
2015-01-01
Cooperative, synergistic gene regulation by nuclear hormone receptors can increase sensitivity and amplify cellular responses to hormones. We investigated thyroid hormone (TH) and glucocorticoid (GC) synergy on the Krüppel-like factor 9 (Klf9) gene, which codes for a zinc finger transcription factor involved in development and homeostasis of diverse tissues. We identified regions of the Xenopus and mouse Klf9 genes 5–6 kb upstream of the transcription start sites that supported synergistic transactivation by TH plus GC. Within these regions, we found an orthologous sequence of approximately 180 bp that is highly conserved among tetrapods, but absent in other chordates, and possesses chromatin marks characteristic of an enhancer element. The Xenopus and mouse approximately 180-bp DNA element conferred synergistic transactivation by hormones in transient transfection assays, so we designate this the Klf9 synergy module (KSM). We identified binding sites within the mouse KSM for TH receptor, GC receptor, and nuclear factor κB. TH strongly increased recruitment of liganded GC receptor and serine 5 phosphorylated (initiating) RNA polymerase II to chromatin at the KSM, suggesting a mechanism for transcriptional synergy. The KSM is transcribed to generate long noncoding RNAs, which are also synergistically induced by combined hormone treatment, and the KSM interacts with the Klf9 promoter and a far upstream region through chromosomal looping. Our findings support that the KSM plays a central role in hormone regulation of vertebrate Klf9 genes, it evolved in the tetrapod lineage, and has been maintained by strong stabilizing selection. PMID:25866873
NASA Astrophysics Data System (ADS)
Chenge, Jude; Kavanagh, Madeline E.; Driscoll, Max D.; McLean, Kirsty J.; Young, Douglas B.; Cortes, Teresa; Matak-Vinkovic, Dijana; Levy, Colin W.; Rigby, Stephen E. J.; Leys, David; Abell, Chris; Munro, Andrew W.
2016-05-01
Mycobacterium tuberculosis (Mtb) causes the disease tuberculosis (TB). The virulent Mtb H37Rv strain encodes 20 cytochrome P450 (CYP) enzymes, many of which are implicated in Mtb survival and pathogenicity in the human host. Bioinformatics analysis revealed that CYP144A1 is retained exclusively within the Mycobacterium genus, particularly in species causing human and animal disease. Transcriptomic annotation revealed two possible CYP144A1 start codons, leading to expression of (i) a “full-length” 434 amino acid version (CYP144A1-FLV) and (ii) a “truncated” 404 amino acid version (CYP144A1-TRV). Computational analysis predicted that the extended N-terminal region of CYP144A1-FLV is largely unstructured. CYP144A1 FLV and TRV forms were purified in heme-bound states. Mass spectrometry confirmed production of intact, His6-tagged forms of CYP144A1-FLV and -TRV, with EPR demonstrating cysteine thiolate coordination of heme iron in both cases. Hydrodynamic analysis indicated that both CYP144A1 forms are monomeric. CYP144A1-TRV was crystallized and the first structure of a CYP144 family P450 protein determined. CYP144A1-TRV has an open structure primed for substrate binding, with a large active site cavity. Our data provide the first evidence that Mtb produces two different forms of CYP144A1 from alternative transcripts, with CYP144A1-TRV generated from a leaderless transcript lacking a 5‧-untranslated region and Shine-Dalgarno ribosome binding site.
The groESL Chaperone Operon of Lactobacillus johnsonii†
Walker, D. Carey; Girgis, Hany S.; Klaenhammer, Todd R.
1999-01-01
The Lactobacillus johnsonii VPI 11088 groESL operon was localized on the chromosome near the insertion element IS1223. The operon was initially cloned as a series of three overlapping PCR fragments, which were sequenced and used to design primers to amplify the entire operon. The amplified fragment was used as a probe to recover the chromosomal copy of the groESL operon from a partial library of L. johnsonii VPI 11088 (NCK88) DNA, cloned in the shuttle vector pTRKH2. The 2,253-bp groESL fragment contained three putative open reading frames, two of which encoded the ubiquitous GroES and GroEL chaperone proteins. Analysis of the groESL promoter region revealed three transcription initiation sites, as well as three sets of inverted repeats (IR) positioned between the transcription and translation start sites. Two of the three IR sets bore significant homology to the CIRCE elements, implicated in negative regulation of the heat shock response in many bacteria. Northern analysis and primer extension revealed that multiple temperature-sensitive promoters preceded the groESL chaperone operon, suggesting that stress protein production in L. johnsonii is strongly regulated. Maximum groESL transcription activity was observed following a shift to 55°C, and a 15 to 30-min exposure of log-phase cells to this temperature increased the recovery of freeze-thawed L. johnsonii VPI 11088. These results suggest that a brief, preconditioning heat shock can be used to trigger increased chaperone production and provide significant cross-protection from the stresses imposed during the production of frozen culture concentrates. PMID:10388700
Yoshisue, H; Ihara, K; Nishimoto, T; Sakai, H; Komano, T
1995-03-15
To investigate the mechanism of transcriptional regulation of cryIVA and cryIVB, encoding 130-kDa dipteran-active crystal proteins, in Bacillus thuringiensis subsp. israelensis, we introduced each gene into several sporulation mutants of Bacillus subtilis. A spoIIG mutation, the wild-type gene of which encodes sigma E precursor, completely blocked the cryIVB transcription. In contrast, low but detectable transcription of cryIVA was observed in the spoIIG mutant. In the wild-type B. subtilis, no transcription of cryIVB was detected before T2 (2 h after the onset of stationary phase), while the cryIVA transcription started at the late exponential phase at low levels. Furthermore, in a wild-type strain of B. thuringiensis subsp. israelensis, transcription of cryIVA began earlier than that of genes encoding other crystal components, cryIVB and cytA. A consensus sequence recognized by an RNA polymerase containing sigma H of B. subtilis was found upstream of the transcription start point of cryIVA, which overlapped with that recognized by sigma E.
Promoter for Sindbis virus RNA-dependent subgenomic RNA transcription.
Levis, R; Schlesinger, S; Huang, H V
1990-01-01
Sindbis virus is a positive-strand RNA enveloped virus, a member of the Alphavirus genus of the Togaviridae family. Two species of mRNA are synthesized in cells infected with Sindbis virus; one, the 49S RNA, is the genomic RNA; the other, the 26S RNA, is a subgenomic RNA that is identical in sequence to the 3' one-third of the genomic RNA. Ou et al. (J.-H. Ou, C. M. Rice, L. Dalgarno, E. G. Strauss, and J. H. Strauss, Proc. Natl. Acad. Sci. USA 79:5235-5239, 1982) identified a highly conserved region 19 nucleotides upstream and 2 nucleotides downstream from the start of the 26S RNA and proposed that in the negative-strand template, these nucleotides compose the promoter for directing the synthesis of the subgenomic RNA. Defective interfering (DI) RNAs of Sindbis virus were used to test this proposal. A 227-nucleotide sequence encompassing 98 nucleotides upstream and 117 nucleotides downstream from the start site of the Sindbis virus subgenomic RNA was inserted into a DI genome. The DI RNA containing the insert was replicated and packaged in the presence of helper virus, and cells infected with these DI particles produced a subgenomic RNA of the size and sequence expected if the promoter was functional. The initiating nucleotide was identical to that used for Sindbis virus subgenomic mRNA synthesis. Deletion analysis showed that the minimal region required to detect transcription of a subgenomic RNA from the negative-strand template of a DI RNA was 18 or 19 nucleotides upstream and 5 nucleotides downstream from the start of the subgenomic RNA. Images PMID:2319651
Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T
1987-01-01
The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486
Capturing Structural Heterogeneity in Chromatin Fibers.
Ekundayo, Babatunde; Richmond, Timothy J; Schalch, Thomas
2017-10-13
Chromatin fiber organization is implicated in processes such as transcription, DNA repair and chromosome segregation, but how nucleosomes interact to form higher-order structure remains poorly understood. We solved two crystal structures of tetranucleosomes with approximately 11-bp DNA linker length at 5.8 and 6.7 Å resolution. Minimal intramolecular nucleosome-nucleosome interactions result in a fiber model resembling a flat ribbon that is compatible with a two-start helical architecture, and that exposes histone and DNA surfaces to the environment. The differences in the two structures combined with electron microscopy reveal heterogeneous structural states, and we used site-specific chemical crosslinking to assess the diversity of nucleosome-nucleosome interactions through identification of structure-sensitive crosslink sites that provide a means to characterize fibers in solution. The chromatin fiber architectures observed here provide a basis for understanding heterogeneous chromatin higher-order structures as they occur in a genomic context. Copyright © 2017 Elsevier Ltd. All rights reserved.
O'Sullivan, D J; O'Gara, F
1991-08-01
An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.
Jiang, Peng; Singh, Mona; Coller, Hilary A
2013-01-01
Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.
Koch, Robin; Kupczok, Anne; Stucken, Karina; Ilhan, Judith; Hammerschmidt, Katrin; Dagan, Tal
2017-08-31
Filamentous cyanobacteria that differentiate multiple cell types are considered the peak of prokaryotic complexity and their evolution has been studied in the context of multicellularity origins. Species that form true-branching filaments exemplify the most complex cyanobacteria. However, the mechanisms underlying the true-branching morphology remain poorly understood despite of several investigations that focused on the identification of novel genes or pathways. An alternative route for the evolution of novel traits is based on existing phenotypic plasticity. According to that scenario - termed genetic assimilation - the fixation of a novel phenotype precedes the fixation of the genotype. Here we show that the evolution of transcriptional regulatory elements constitutes a major mechanism for the evolution of new traits. We found that supplementation with sucrose reconstitutes the ancestral branchless phenotype of two true-branching Fischerella species and compared the transcription start sites (TSSs) between the two phenotypic states. Our analysis uncovers several orthologous TSSs whose transcription level is correlated with the true-branching phenotype. These TSSs are found in genes that encode components of the septosome and elongasome (e.g., fraC and mreB). The concept of genetic assimilation supplies a tenable explanation for the evolution of novel traits but testing its feasibility is hindered by the inability to recreate and study the evolution of present-day traits. We present a novel approach to examine transcription data for the plasticity first route and provide evidence for its occurrence during the evolution of complex colony morphology in true-branching cyanobacteria. Our results reveal a route for evolution of the true-branching phenotype in cyanobacteria via modification of the transcription level of pre-existing genes. Our study supplies evidence for the 'plasticity-first' hypothesis and highlights the importance of transcriptional regulation in the evolution of novel traits.
Chen, Fanfan; Zhang, Guoqiang; Yu, Ling; Feng, Yanye; Li, Xianghui; Zhang, Zhijun; Wang, Yongting; Sun, Dapeng; Pradhan, Sriharsa
2016-07-30
Induced pluripotent mesenchymal stem cells (iPMSCs) are novel candidates for drug screening, regenerative medicine, and cell therapy. However, introduction of transcription factor encoding genes for induced pluripotent stem cell (iPSC) generation which could be used to generate mesenchymal stem cells is accompanied by the risk of insertional mutations in the target cell genome. We demonstrate a novel method using an inactivated viral particle to package and deliver four purified recombinant Yamanaka transcription factors (Sox2, Oct4, Klf4, and c-Myc) resulting in reprogramming of human primary fibroblasts. Whole genome bisulfite sequencing was used to analyze genome-wide CpG methylation of human iPMSCs. Western blot, quantitative PCR, immunofluorescence, and in-vitro differentiation were used to assess the pluripotency of iPMSCs. The resulting reprogrammed fibroblasts show high-level expression of stem cell markers. The human fibroblast-derived iPMSC genome showed gains in DNA methylation in low to medium methylated regions and concurrent loss of methylation in previously hypermethylated regions. Most of the differentially methylated regions are close to transcription start sites and many of these genes are pluripotent pathway associated. We found that DNA methylation of these genes is regulated by the four iPSC transcription factors, which functions as an epigenetic switch during somatic reprogramming as reported previously. These iPMSCs successfully differentiate into three embryonic germ layer cells, both in vitro and in vivo. Following multipotency induction in our study, the delivered transcription factors were degraded, leading to an improved efficiency of subsequent programmed differentiation. Recombinant transcription factor based reprogramming and derivatization of iPMSC offers a novel high-efficiency approach for regenerative medicine from patient-derived cells.
Wang, Jiajing; Hmadcha, Abdelkrim; Zakarian, Vaagn; Song, Fei; Loeb, Jeffrey A
2015-09-01
The neuregulins (NRGs) are a family of alternatively spliced factors that play important roles in nervous system development and disease. In motor neurons, NRG1 expression is regulated by activity and neurotrophic factors, however, little is known about what controls isoform-specific transcription. Here we show that NRG1 expression in the chick embryo increases in motor neurons that have extended their axons and that limb bud ablation before motor axon outgrowth prevents this induction, suggesting a trophic role from the developing limb. Consistently, NRG1 induction after limb bud ablation can be rescued by adding back the neurotrophic factors BDNF and GDNF. Mechanistically, BDNF induces a rapid and transient increase in type I and type III NRG1 mRNAs that peak at 4h in rat embryonic ventral spinal cord cultures. Blocking MAPK or PI3K signaling or blocking transcription with Actinomycin D blocks BDNF induced NRG1 gene induction. BDNF had no effect on mRNA degradation, suggesting that transcriptional activation rather than message stability is important. Furthermore, BDNF activates a reporter construct that includes 700bp upstream of the type I NRG1 start site. Protein synthesis is also required for type I NRG1 mRNA transcription as cycloheximide produced a super-induction of type I, but not type III NRG1 mRNA, possibly through a mechanism involving sustained activation of MAPK and PI3K. These results reveal the existence of highly responsive, transient transcriptional regulatory mechanisms that differentially modulate NRG1 isoform expression as a function of extracellular and intracellular signaling cascades and mediated by neurotrophic factors and axon-target interactions. Copyright © 2015 Elsevier Inc. All rights reserved.
Boj, Sylvia F.; Servitja, Joan Marc; Martin, David; Rios, Martin; Talianidis, Iannis; Guigo, Roderic; Ferrer, Jorge
2009-01-01
OBJECTIVE The evolutionary conservation of transcriptional mechanisms has been widely exploited to understand human biology and disease. Recent findings, however, unexpectedly showed that the transcriptional regulators hepatocyte nuclear factor (HNF)-1α and -4α rarely bind to the same genes in mice and humans, leading to the proposal that tissue-specific transcriptional regulation has undergone extensive divergence in the two species. Such observations have major implications for the use of mouse models to understand HNF-1α– and HNF-4α–deficient diabetes. However, the significance of studies that assess binding without considering regulatory function is poorly understood. RESEARCH DESIGN AND METHODS We compared previously reported mouse and human HNF-1α and HNF-4α binding studies with independent binding experiments. We also integrated binding studies with mouse and human loss-of-function gene expression datasets. RESULTS First, we confirmed the existence of species-specific HNF-1α and -4α binding, yet observed incomplete detection of binding in the different datasets, causing an underestimation of binding conservation. Second, only a minor fraction of HNF-1α– and HNF-4α–bound genes were downregulated in the absence of these regulators. This subset of functional targets did not show evidence for evolutionary divergence of binding or binding sequence motifs. Finally, we observed differences between conserved and species-specific binding properties. For example, conserved binding was more frequently located near transcriptional start sites and was more likely to involve multiple binding events in the same gene. CONCLUSIONS Despite evolutionary changes in binding, essential direct transcriptional functions of HNF-1α and -4α are largely conserved between mice and humans. PMID:19188435
Sylvestersen, Kathrine B.; Horn, Heiko; Jungmichel, Stephanie; Jensen, Lars J.; Nielsen, Michael L.
2014-01-01
The covalent attachment of methyl groups to the side-chain of arginine residues is known to play essential roles in regulation of transcription, protein function, and RNA metabolism. The specific N-methylation of arginine residues is catalyzed by a small family of gene products known as protein arginine methyltransferases; however, very little is known about which arginine residues become methylated on target substrates. Here we describe a proteomics methodology that combines single-step immunoenrichment of methylated peptides with high-resolution mass spectrometry to identify endogenous arginine mono-methylation (MMA) sites. We thereby identify 1027 site-specific MMA sites on 494 human proteins, discovering numerous novel mono-methylation targets and confirming the majority of currently known MMA substrates. Nuclear RNA-binding proteins involved in RNA processing, RNA localization, transcription, and chromatin remodeling are predominantly found modified with MMA. Despite this, MMA sites prominently are located outside RNA-binding domains as compared with the proteome-wide distribution of arginine residues. Quantification of arginine methylation in cells treated with Actinomycin D uncovers strong site-specific regulation of MMA sites during transcriptional arrest. Interestingly, several MMA sites are down-regulated after a few hours of transcriptional arrest. In contrast, the corresponding di-methylation or protein expression levels are not altered, confirming that MMA sites contain regulated functions on their own. Collectively, we present a site-specific MMA data set in human cells and demonstrate for the first time that MMA is a dynamic post-translational modification regulated during transcriptional arrest by a hitherto uncharacterized arginine demethylase. PMID:24563534
Searching for transcription factor binding sites in vector spaces
2012-01-01
Background Computational approaches to transcription factor binding site identification have been actively researched in the past decade. Learning from known binding sites, new binding sites of a transcription factor in unannotated sequences can be identified. A number of search methods have been introduced over the years. However, one can rarely find one single method that performs the best on all the transcription factors. Instead, to identify the best method for a particular transcription factor, one usually has to compare a handful of methods. Hence, it is highly desirable for a method to perform automatic optimization for individual transcription factors. Results We proposed to search for transcription factor binding sites in vector spaces. This framework allows us to identify the best method for each individual transcription factor. We further introduced two novel methods, the negative-to-positive vector (NPV) and optimal discriminating vector (ODV) methods, to construct query vectors to search for binding sites in vector spaces. Extensive cross-validation experiments showed that the proposed methods significantly outperformed the ungapped likelihood under positional background method, a state-of-the-art method, and the widely-used position-specific scoring matrix method. We further demonstrated that motif subtypes of a TF can be readily identified in this framework and two variants called the k NPV and k ODV methods benefited significantly from motif subtype identification. Finally, independent validation on ChIP-seq data showed that the ODV and NPV methods significantly outperformed the other compared methods. Conclusions We conclude that the proposed framework is highly flexible. It enables the two novel methods to automatically identify a TF-specific subspace to search for binding sites. Implementations are available as source code at: http://biogrid.engr.uconn.edu/tfbs_search/. PMID:23244338
Ionic modulation of QPX stability as a nano-switch regulating gene expression in neurons
NASA Astrophysics Data System (ADS)
Baghaee Ravari, Soodeh
G-quadruplexes (G-QPX) have been the subject of intense research due to their unique structural configuration and potential applications, particularly their functionality in biological process as a novel type of nano--switch. They have been found in critical regions of the human genome such as telomeres, promoter regions, and untranslated regions of RNA. About 50% of human DNA in promoters has G-rich regions with the potential to form G-QPX structures. A G-QPX might act mechanistically as an ON/OFF switch, regulating gene expression, meaning that the formation of G-QPX in a single strand of DNA disrupts double stranded DNA, prevents the binding of transcription factors (TF) to their recognition sites, resulting in gene down-regulation. Although there are numerous studies on biological roles of G-QPXs in oncogenes, their potential formation in neuronal cells, in particular upstream of transcription start sites, is poorly investigated. The main focus of this research is to identify stable G-QPXs in the 97bp active promoter region of the choline acetyltransferase (ChAT) gene, the terminal enzyme involved in synthesis of the neurotransmitter acetylcholine, and to clarify ionic modulation of G-QPX nanostructures through the mechanism of neural action potentials. Different bioinformatics analyses (in silico), including the QGRS, quadparser and G4-Calculator programs, have been used to predict stable G-QPX in the active promoter region of the human ChAT gene, located 1000bp upstream from the TATA box. The results of computational studies (using those three different algorithms) led to the identification of three consecutive intramolecular G-QPX structures in the negative strand (ChAT G17-2, ChAT G17, and ChAT G29) and one intramolecular G-QPX structure in the positive strand (ChAT G30). Also, the results suggest the possibility that nearby G-runs in opposed DNA strands with a short distance of each other may be able to form a stable intermolecular G-QPX involving two DNA complementary strands (ds ChAT G21). Formation of G-QPX structures, by blocking the availability of the transcription factor binding site (TFBS) on double stranded DNA, can interfere with transcriptional activation. This suggests that there is competition between TFBS binding to dsDNA and the conversion to high order non-B form secondary structures (G-QPXs) in the active promoter region. TFBS mapping analysis of the active promoter region of the human ChAT gene revealed that it contains multiple consensus AP-2alpha and Sp1 binding sites and consensus sites for other TF, including multiple sites for GR-alpha, Pax-5, p53 and GC box proteins. (Abstract shortened by ProQuest.).
c-rel activates but v-rel suppresses transcription from kappa B sites.
Inoue, J; Kerr, L D; Ransone, L J; Bengal, E; Hunter, T; Verma, I M
1991-01-01
We show that the product of the protooncogene c-rel is a constituent of an NF-kappa B-like complex that binds to the kappa B site originally identified in the enhancer of immunoglobulin kappa light chain gene. c-rel protein synthesized in bacteria binds to the kappa B site in a sequence-specific manner. The rel-kappa B complex can be disrupted by incubation with anti-rel antibodies. The rel protein can form oligomers. The c-rel protein can activate transcription from promoters containing kappa B sites; v-rel, on the other hand, suppresses the transcription of genes linked to kappa B sites. Thus, v-rel may interfere with the normal transcriptional machinery of the cell by acting as a dominant negative mutant. Images PMID:2023921
p21 as a Transcriptional Co-Repressor of S-Phase and Mitotic Control Genes
Ferrándiz, Nuria; Caraballo, Juan M.; García-Gutierrez, Lucía; Devgan, Vikram; Rodriguez-Paredes, Manuel; Lafita, M. Carmen; Bretones, Gabriel; Quintanilla, Andrea; Muñoz-Alonso, M. Jose; Blanco, Rosa; Reyes, Jose C.; Agell, Neus; Delgado, M. Dolores; Dotto, G. Paolo; León, Javier
2012-01-01
It has been previously described that p21 functions not only as a CDK inhibitor but also as a transcriptional co-repressor in some systems. To investigate the roles of p21 in transcriptional control, we studied the gene expression changes in two human cell systems. Using a human leukemia cell line (K562) with inducible p21 expression and human primary keratinocytes with adenoviral-mediated p21 expression, we carried out microarray-based gene expression profiling. We found that p21 rapidly and strongly repressed the mRNA levels of a number of genes involved in cell cycle and mitosis. One of the most strongly down-regulated genes was CCNE2 (cyclin E2 gene). Mutational analysis in K562 cells showed that the N-terminal region of p21 is required for repression of gene expression of CCNE2 and other genes. Chromatin immunoprecipitation assays indicated that p21 was bound to human CCNE2 and other p21-repressed genes gene in the vicinity of the transcription start site. Moreover, p21 repressed human CCNE2 promoter-luciferase constructs in K562 cells. Bioinformatic analysis revealed that the CDE motif is present in most of the promoters of the p21-regulated genes. Altogether, the results suggest that p21 exerts a repressive effect on a relevant number of genes controlling S phase and mitosis. Thus, p21 activity as inhibitor of cell cycle progression would be mediated not only by the inhibition of CDKs but also by the transcriptional down-regulation of key genes. PMID:22662213
Zhou, Hui; Hussain, Syed Sarfraz; Hackenberg, Michael; Bazanova, Natalia; Eini, Omid; Li, Jie; Gustafson, Perry; Shi, Bujun
2018-04-22
Drought is the most serious abiotic stress, which causes crop losses on worldwide scale. The present study identified a previously unknown microRNA (designated as hvu-miRX) of 21 nucleotides (nt) in barley. Its precursor (designated pre-miRX) and primary transcript (designated pri-miRX) were also identified, with lengths of 73 nt and 559 nt, respectively. The identified upstream sequence of pri-miRX contains both the TATA box and the CAAT box, which are both required for transcription initiation. Transient promoter activation assays showed that the core promoter region of pri-miRX ranged 500 nt from the transcription start site. In transgenic barley over-expressing the wheat DREB3 transcription factor (TaDREB3) caused hvu-miRX to be highly expressed as compared to the same miRNA in non-transgenic barley. However, the high expression was not directly associated with TaDREB3. Genomic analysis revealed that the hvu-miRX gene was a single copy located on the short arm of chromosome 2 and appeared to be only conserved in Triticeae, but not in other plant species. Notably, transgenic barley overexpressing hvu-miRX showed drought tolerance. Degradome library analysis and other tests showed that hvu-miRX targeted various genes including transcription factors via the cleavage mode. Our data open an excellent opportunity to develop drought stress tolerant cereals with hvu-miRX. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Ventura, Marco; Zink, Ralf; Fitzgerald, Gerald F; van Sinderen, Douwe
2005-01-01
The incorporation and delivery of bifidobacterial strains as probiotic components in many food preparations expose these microorganisms to a multitude of environmental insults, including heat and osmotic stresses. We characterized the dnaK gene region of Bifidobacterium breve UCC 2003. Sequence analysis of the dnaK locus revealed four genes with the organization dnaK-grpE-dnaJ-ORF1, whose deduced protein products display significant similarity to corresponding chaperones found in other bacteria. Northern hybridization and real-time LightCycler PCR analysis revealed that the transcription of the dnaK operon was strongly induced by osmotic shock but was not induced significantly by heat stress. A 4.4-kb polycistronic mRNA, which represented the transcript of the complete dnaK gene region, was detected. Many other small transcripts, which were assumed to have resulted from intensive processing or degradation of this polycistronic mRNA, were identified. The transcription start site of the dnaK operon was determined by primer extension. Phylogenetic analysis of the available bifidobacterial grpE and dnaK genes suggested that the evolutionary development of these genes has been similar. The phylogeny derived from the various bifidobacterial grpE and dnaK sequences is consistent with that derived from 16S rRNA. The use of these genes in bifidobacterial species as an alternative or complement to the 16S rRNA gene marker provides sequence signatures that allow a high level of discrimination between closely related species of this genus.
Bode, Nadine J; Debnath, Irina; Kuan, Lisa; Schulfer, Anjelique; Ty, Maureen; Pearson, Melanie M
2015-06-01
The enteric bacterium Proteus mirabilis is associated with a significant number of catheter-associated urinary tract infections (UTIs). Strict regulation of the antagonistic processes of adhesion and motility, mediated by fimbriae and flagella, respectively, is essential for disease progression. Previously, the transcriptional regulator MrpJ, which is encoded by the mrp fimbrial operon, has been shown to repress both swimming and swarming motility. Here we show that MrpJ affects an array of cellular processes beyond adherence and motility. Microarray analysis found that expression of mrpJ mimicking levels observed during UTIs leads to differential expression of 217 genes related to, among other functions, bacterial virulence, type VI secretion, and metabolism. We probed the molecular mechanism of transcriptional regulation by MrpJ using transcriptional reporters and chromatin immunoprecipitation (ChIP). Binding of MrpJ to two virulence-associated target gene promoters, the promoters of the flagellar master regulator flhDC and mrp itself, appears to be affected by the condensation state of the native chromosome, although both targets share a direct MrpJ binding site proximal to the transcriptional start. Furthermore, an mrpJ deletion mutant colonized the bladders of mice at significantly lower levels in a transurethral model of infection. Additionally, we observed that mrpJ is widely conserved in a collection of recent clinical isolates. Altogether, these findings support a role of MrpJ as a global regulator of P. mirabilis virulence. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
AtmiRNET: a web-based resource for reconstructing regulatory networks of Arabidopsis microRNAs.
Chien, Chia-Hung; Chiang-Hsieh, Yi-Fan; Chen, Yi-An; Chow, Chi-Nga; Wu, Nai-Yun; Hou, Ping-Fu; Chang, Wen-Chi
2015-01-01
Compared with animal microRNAs (miRNAs), our limited knowledge of how miRNAs involve in significant biological processes in plants is still unclear. AtmiRNET is a novel resource geared toward plant scientists for reconstructing regulatory networks of Arabidopsis miRNAs. By means of highlighted miRNA studies in target recognition, functional enrichment of target genes, promoter identification and detection of cis- and trans-elements, AtmiRNET allows users to explore mechanisms of transcriptional regulation and miRNA functions in Arabidopsis thaliana, which are rarely investigated so far. High-throughput next-generation sequencing datasets from transcriptional start sites (TSSs)-relevant experiments as well as five core promoter elements were collected to establish the support vector machine-based prediction model for Arabidopsis miRNA TSSs. Then, high-confidence transcription factors participate in transcriptional regulation of Arabidopsis miRNAs are provided based on statistical approach. Furthermore, both experimentally verified and putative miRNA-target interactions, whose validity was supported by the correlations between the expression levels of miRNAs and their targets, are elucidated for functional enrichment analysis. The inferred regulatory networks give users an intuitive insight into the pivotal roles of Arabidopsis miRNAs through the crosstalk between miRNA transcriptional regulation (upstream) and miRNA-mediate (downstream) gene circuits. The valuable information that is visually oriented in AtmiRNET recruits the scant understanding of plant miRNAs and will be useful (e.g. ABA-miR167c-auxin signaling pathway) for further research. Database URL: http://AtmiRNET.itps.ncku.edu.tw/ © The Author(s) 2015. Published by Oxford University Press.
A novel isoform of TET1 that lacks a CXXC domain is overexpressed in cancer
Good, Charly R.; Madzo, Jozef; Patel, Bela; Maegawa, Shinji; Engel, Nora; Jelinek, Jaroslav
2017-01-01
Abstract TET1 oxidizes methylated cytosine into 5-hydroxymethylcytosine (5hmC), resulting in regulation of DNA methylation and gene expression. Full length TET1 (TET1FL) has a CXXC domain that binds to unmethylated CpG islands (CGIs). This CXXC domain allows TET1 to protect CGIs from aberrant methylation, but it also limits its ability to regulate genes outside of CGIs. Here, we report a novel isoform of TET1 (TET1ALT) that has a unique transcription start site from an alternate promoter in intron 2, yielding a protein with a unique translation start site. Importantly, TET1ALT lacks the CXXC domain but retains the catalytic domain. TET1ALT is repressed in embryonic stem cells (ESCs) but becomes activated in embryonic and adult tissues while TET1FL is expressed in ESCs, but repressed in adult tissues. Overexpression of TET1ALT shows production of 5hmC with distinct (and weaker) effects on DNA methylation or gene expression when compared to TET1FL. TET1ALT is aberrantly activated in multiple cancer types including breast, uterine and glioblastoma, and TET1 activation is associated with a worse overall survival in breast, uterine and ovarian cancers. Our data suggest that the predominantly activated isoform of TET1 in cancer cells does not protect from CGI methylation and likely mediates dynamic site-specific demethylation outside of CGIs. PMID:28531272
Daubas, Philippe; Buckingham, Margaret E
2013-04-15
The Myf5 gene plays an important role in myogenic determination during mouse embryo development. Multiple genomic regions of the Mrf4-Myf5 locus have been characterised as enhancer sequences responsible for the complex spatiotemporal expression of the Myf5 gene at the onset of myogenesis. These include an enhancer sequence, located at -111 kb upstream of the Myf5 transcription start site, which is responsible of Myf5 activation in ventral somitic domains (Ribas et al., 2011. Dev. Biol. 355, 372-380). We show that the -111 kb-Myf5 enhancer also directs transgene expression in some limb muscles, and is active at foetal as well as embryonic stages. We have carried out further characterisation of the regulation of this enhancer and show that the paired-box Pax3 transcription factor binds to it in vitro as in vivo, and that Pax binding sites are essential for its activity. This requirement is independent of the previously reported regulation by TEAD transcription factors. Six1/4 which, like Pax3, are important upstream regulators of myogenesis, also bind in vivo to sites in the -111 kb-Myf5 enhancer and modulate its activity. The -111 kb-Myf5 enhancer therefore shares common functional characteristics with another Myf5 regulatory sequence, the hypaxial and limb 145 bp-Myf5 enhancer, both being directly regulated in vivo by Pax3 and Six1/4 proteins. However, in the case of the -111 kb-Myf5 enhancer, Six has less effect and we conclude that Pax regulation plays a major role in controlling this aspect of the Myf5 gene expression at the onset of myogenesis in the embryo. Copyright © 2013 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sampaio, S.O.; Mei, C.; Butcher, E.C.
The mucosal addressin cell adhesion molecule-1 (MAdCAM-1) is expressed selectively at venular sites of lymphocyte extravasation into mucosal lymphoid tissues and lamina propria, where it directs local lymphocyte trafficking. MAdCAM-1 is a multifunctional type I transmembrane adhesion molecule comprising two distal Ig domains involved in {alpha}4{beta}7 integrin binding, a mucin-like region able to display L-selectin-binding carbohydrates, and a membrane-proximal Ig domain homologous to IgA. We show in this work that the MAdCAM-1 gene is located on chromosome 10 and contains five exons. The signal peptide and each one of the three Ig domains are encoded by a distinct exon, whereasmore » the transmembrane, cytoplasmic tail, and 3{prime}-untranslated region of MAdCAM-1 are combined on a single exon. The mucin-like region and the third Ig domain are encoded together on exon 4. An alternatively spliced MAdCAM-1 mRNA is identified that lacks the mucin/IgA-homologous exon 4-encoded sequences. This short variant of MAdCAM-1 may be specialized to support {alpha}4{beta}7-dependent adhesion strengthening, independent of carbohydrate-presenting function. Sequences 5{prime} of the transcription start site include tandem nuclear factor-KB sites; AP-1, AP-2, and signal peptide-1 binding sites; and an estrogen response element. Our findings reinforce the correspondence between the multidomain structure and versatile functions of this vascular addressin, and suggest an additional level of regulation of carbohydrate-presenting capability, and thus of its importance in lectin-mediated vs. {alpha}4{beta}7-dependent adhesive events in lymphocyte trafficking. 46 refs., 6 figs., 1 tab.« less
Transcription and DNA Damage: Holding Hands or Crossing Swords?
D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio
2017-10-27
Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wei, Leizhen; Nakajima, Satoshi; Böhm, Stefanie; Bernstein, Kara A; Shen, Zhiyuan; Tsang, Michael; Levine, Arthur S; Lan, Li
2015-07-07
Damage repair mechanisms at transcriptionally active sites during the G0/G1 phase are largely unknown. To elucidate these mechanisms, we introduced genome site-specific oxidative DNA damage and determined the role of transcription in repair factor assembly. We find that KU and NBS1 are recruited to damage sites independent of transcription. However, assembly of RPA1, RAD51C, RAD51, and RAD52 at such sites is strictly governed by active transcription and requires both wild-type Cockayne syndrome protein B (CSB) function and the presence of RNA in the G0/G1 phase. We show that the ATPase activity of CSB is indispensable for loading and binding of the recombination factors. CSB counters radiation-induced DNA damage in both cells and zebrafish models. Taken together, our results have uncovered a novel, RNA-based recombination mechanism by which CSB protects genome stability from strand breaks at transcriptionally active sites and may provide insight into the clinical manifestations of Cockayne syndrome.
Gonsalves, Sarah E.; Moses, Alan M.; Razak, Zak; Robert, Francois; Westwood, J. Timothy
2011-01-01
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions. PMID:21264254
Gonsalves, Sarah E; Moses, Alan M; Razak, Zak; Robert, Francois; Westwood, J Timothy
2011-01-14
During heat shock (HS) and other stresses, HS gene transcription in eukaryotes is up-regulated by the transcription factor heat shock factor (HSF). While the identities of the major HS genes have been known for more than 30 years, it has been suspected that HSF binds to numerous other genes and potentially regulates their transcription. In this study, we have used a chromatin immunoprecipitation and microarray (ChIP-chip) approach to identify 434 regions in the Drosophila genome that are bound by HSF. We have also performed a transcript analysis of heat shocked Kc167 cells and third instar larvae and compared them to HSF binding sites. The heat-induced transcription profiles were quite different between cells and larvae and surprisingly only about 10% of the genes associated with HSF binding sites show changed transcription. There were also genes that showed changes in transcript levels that did not appear to correlate with HSF binding sites. Analysis of the locations of the HSF binding sites revealed that 57% were contained within genes with approximately 2/3rds of these sites being in introns. We also found that the insulator protein, BEAF, has enriched binding prior to HS to promoters of genes that are bound by HSF upon HS but that are not transcriptionally induced during HS. When the genes associated with HSF binding sites in promoters were analyzed for gene ontology terms, categories such as stress response and transferase activity were enriched whereas analysis of genes having HSF binding sites in introns identified those categories plus ones related to developmental processes and reproduction. These results suggest that Drosophila HSF may be regulating many genes besides the known HS genes and that some of these genes may be regulated during non-stress conditions.
Eo, JungWoo; Lee, Hee-Eun; Nam, Gyu-Hwi; Kwon, Yun-Jeong; Choi, Yuri; Choi, Bong-Hwan; Huh, Jae-Won; Kim, Minkyu; Lee, Sang-Eun; Seo, Bohyun; Kim, Heui-Soo
2016-04-15
The monoamine oxidase A (MAOA) gene is an important candidate gene for human behavior that encodes an enzyme regulating the metabolism of key neurotransmitters. The regulatory mechanisms of the MAOA gene in dogs are yet to be elucidated. We measured MAOA gene transcription and analyzed the VNTR genotype and methylation status of the gene promoter region in different dog breeds to determine whether MAOA expression is correlated with the MAOA genotype or epigenetic modification in dogs. We found brain-specific expression of the MAOA gene and different transcription levels in different dog breeds including Beagle, Sapsaree, and German shepherd, and also a robust association of the DNA methylation of the gene promoter with mRNA levels. However, the 90 bp tandem repeats that we observed near the transcription start site were not variable, indicating no correlation with canine MAOA activity. These results show that differential DNA methylation in the MAOA promoter region may affect gene expression by modulating promoter activity. Moreover, the distinctive patterns of MAOA expression and DNA methylation may be involved in breed-specific or individual behavioral characteristics, such as aggression, because behavioral phenotypes are related to different physiological and neuroendocrine responses. Copyright © 2016 Elsevier B.V. All rights reserved.
Emerging roles for diverse intramembrane proteases in plant biology.
Adam, Zach
2013-12-01
Progress in the field of regulated intramembrane proteolysis (RIP) in recent years has made its impact on plant biology as well. Although this field within plant research is still in its infancy, some interesting observations have started to emerge. Gene encoding orthologs of rhomboid proteases, site-2 proteases (S2P), presenilin/γ-secretases, and signal peptide peptidases are found in plant genomes and some of these gene products were identified in different plant cell membranes. The lack of chloroplast-located rhomboid proteases was associated with reduced fertility and aberrations in flower morphology. Mutations in homologues of S2P resulted in chlorophyll deficiency and impaired chloroplast development. An S2P was also implicated in the response to ER stress through cleavage of ER-membrane bZIP transcription factors, allowing their migration to the nucleus and activation of the transcription of BiP chaperones. Other membrane-bound transcription factors of the NAC and PHD families were also demonstrated to undergo RIP and relocalization to the nucleus. These and other new data are expected to shed more light on the roles of intramembrane proteases in plant biology in the future. This article is part of a Special Issue entitled: Intramembrane Proteases. Copyright © 2013 Elsevier B.V. All rights reserved.
Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila.
Mlodzik, M; Baker, N E; Rubin, G M
1990-11-01
Mutations in the Drosophila scabrous (sca) gene affect eye and bristle development, leading to irregular spacing of ommatidia and bristle duplications in the adult fly. We have cloned the sca gene by P-element tagging. The sca transcription unit is 12 kb and consists of four exons that are joined in a 3.2-kb mRNA. In an enhancer trap screen we have isolated several P[lacZ] insertions close to the sca transcription start site. We have examined the expression pattern of sca by in situ hybridization to sca transcripts, by beta-galactosidase localization in the P[lacZ] lines, and by immunocytochemistry with an anti-sca antiserum. During embryogenesis, sca is expressed in a dynamic pattern associated with neural development. During imaginal development, sca is mainly expressed in the R8 photoreceptor precursor cells in the eye imaginal disc and in sensory organ precursor cells in other discs. In the wing disc, sca expression is coextensive with the anlagen for bristles and is controlled by genes of the achaete-scute complex. Based on its loss-of-function phenotype, expression pattern, and the predicted structure of its product, a secreted peptide with homology to the fibrinogen gene family, we propose that sca encodes a signal involved in lateral inhibition within individual domains of the developing nervous system.
Park, Sung Mi; Zhu, Lihua J.; Debily, Marie-anne; Kittler, Ellen L. W.; Zapp, Maria L.; Lapointe, David; Gobeil, Stephane; Virbasius, Ching-Man; Green, Michael R.
2012-01-01
Numerous genetic and epigenetic alterations render cancer cells selectively dependent on specific genes and regulatory pathways, and represent potential vulnerabilities that can be therapeutically exploited. Here we describe an RNA interference (RNAi)–based synthetic interaction screen to identify genes preferentially required for proliferation of p53-deficient (p53−) human cancer cells. We find that compared to p53-competent (p53+) human cancer cell lines, diverse p53− human cancer cell lines are preferentially sensitive to loss of the transcription factor ETV1 and the DNA damage kinase ATR. In p53− cells, RNAi–mediated knockdown of ETV1 or ATR results in decreased expression of the telomerase catalytic subunit TERT leading to growth arrest, which can be reversed by ectopic TERT expression. Chromatin immunoprecipitation analysis reveals that ETV1 binds to a region downstream of the TERT transcriptional start-site in p53− but not p53+ cells. We find that the role of ATR is to phosphorylate and thereby stabilize ETV1. Our collective results identify a regulatory pathway involving ETV1, ATR, and TERT that is preferentially important for proliferation of diverse p53− cancer cells. PMID:23284306
Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine
2006-07-01
Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.
Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.
2017-03-28
Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is needed to make predictions of transcript half-life and to design synthetic transcripts with optimal stability. RNase III does not have a conserved target sequence but instead recognizes RNA secondary structure. Prior to this study, only a few RNase III target sites in E. coli were known, so we used RNA sequencing to provide a more comprehensive list of cleavage sites and to examine the impact of RNase III on transcript degradation. Finally, with this added information on how RNase III participates in transcript regulation and recycling, a more complete picture of RNA turnover can be developed for E. coli. Similar approaches could be used to augment our understanding of RNA turnover in other bacteria.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gordon, Gina C.; Cameron, Jeffrey C.; Pfleger, Brian F.
Ribonucleases facilitate rapid turnover of RNA, providing cells with another mechanism to adjust transcript and protein levels in response to environmental conditions. While many examples have been documented, a comprehensive list of RNase targets is not available. To address this knowledge gap, we compared levels of RNA sequencing coverage of Escherichia coli and a corresponding RNase III mutant to expand the list of known RNase III targets. RNase III is a widespread endoribonuclease that binds and cleaves double-stranded RNA in many critical transcripts. RNase III cleavage at novel sites found in aceEF, proP, tnaC, dctA, pheM, sdhC, yhhQ, glpT, aceK,more » and gluQ accelerated RNA decay, consistent with previously described targets wherein RNase III cleavage initiates rapid degradation of secondary messages by other RNases. In contrast, cleavage at three novel sites in the ahpF, pflB, and yajQ transcripts led to stabilized secondary transcripts. Two other novel sites in hisL and pheM overlapped with transcriptional attenuators that likely serve to ensure turnover of these highly structured RNAs. Many of the new RNase III target sites are located on transcripts encoding metabolic enzymes. For instance, two novel RNase III sites are located within transcripts encoding enzymes near a key metabolic node connecting glycolysis and the tricarboxylic acid (TCA) cycle. Pyruvate dehydrogenase activity was increased in an rnc deletion mutant compared to the wild-type (WT) strain in early stationary phase, confirming the novel link between RNA turnover and regulation of pathway activity. Identification of these novel sites suggests that mRNA turnover may be an underappreciated mode of regulating metabolism. IMPORTANCE: The concerted action and overlapping functions of endoribonucleases, exoribonucleases, and RNA processing enzymes complicate the study of global RNA turnover and recycling of specific transcripts. More information about RNase specificity and activity is needed to make predictions of transcript half-life and to design synthetic transcripts with optimal stability. RNase III does not have a conserved target sequence but instead recognizes RNA secondary structure. Prior to this study, only a few RNase III target sites in E. coli were known, so we used RNA sequencing to provide a more comprehensive list of cleavage sites and to examine the impact of RNase III on transcript degradation. Finally, with this added information on how RNase III participates in transcript regulation and recycling, a more complete picture of RNA turnover can be developed for E. coli. Similar approaches could be used to augment our understanding of RNA turnover in other bacteria.« less
Zhang, Xu; Zhang, Wei
2016-06-01
Cytosine modification on DNA is variable among individuals, which could correlate with gene expression variation. The effect of cytosine modification on interindividual transcript isoform variation (TIV), however, remains unclear. In this study, we assessed the extent of cytosine modification-specific TIV in lymphoblastoid cell lines (LCLs) derived from unrelated individuals of European and African descent. Our study detected cytosine modification-specific TIVs for 17% of the analyzed genes at a 5% false discovery rate. Forty-five percent of the TIV-associated cytosine modifications correlated with the overall gene expression levels as well, with the corresponding CpG sites overrepresented in transcript initiation sites, transcription factor binding sites, and distinct histone modification peaks, suggesting that alternative isoform transcription underlies the TIVs. Our analysis also revealed 33% of the TIV-associated cytosine modifications that affected specific exons, with the corresponding CpG sites overrepresented in exon/intron junctions, splicing branching points, and transcript termination sites, implying that the TIVs are attributable to alternative splicing or transcription termination. Genetic and epigenetic regulation of TIV shared target preference but exerted independent effects on 61% of the common exon targets. Cytosine modification-specific TIVs detected from LCLs were differentially enriched in those detected from various tissues in The Cancer Genome Atlas, indicating their developmental dependency. Genes containing cytosine modification-specific TIVs were enriched in pathways of cancers and metabolic disorders. Our study demonstrated a prominent effect of cytosine modification variation on the transcript isoform spectrum over gross transcript abundance and revealed epigenetic contributions to diseases that were mediated through cytosine modification-specific TIV. Copyright © 2016 by the Genetics Society of America.
Tumour suppressor protein p53 regulates the stress activated bilirubin oxidase cytochrome P450 2A6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Hao, E-mail: hao.hu1@uqconnect.edu.au; Yu, Ting, E-mail: t.yu2@uq.edu.au; Arpiainen, Satu, E-mail: Satu.Juhila@orion.fi
2015-11-15
Human cytochrome P450 (CYP) 2A6 enzyme has been proposed to play a role in cellular defence against chemical-induced oxidative stress. The encoding gene is regulated by various stress activated transcription factors. This paper demonstrates that p53 is a novel transcriptional regulator of the gene. Sequence analysis of the CYP2A6 promoter revealed six putative p53 binding sites in a 3 kb proximate promoter region. The site closest to transcription start site (TSS) is highly homologous with the p53 consensus sequence. Transfection with various stepwise deletions of CYP2A6-5′-Luc constructs – down to − 160 bp from the TSS – showed p53 responsivenessmore » in p53 overexpressed C3A cells. However, a further deletion from − 160 to − 74 bp, including the putative p53 binding site, totally abolished the p53 responsiveness. Electrophoretic mobility shift assay with a probe containing the putative binding site showed specific binding of p53. A point mutation at the binding site abolished both the binding and responsiveness of the recombinant gene to p53. Up-regulation of the endogenous p53 with benzo[α]pyrene – a well-known p53 activator – increased the expression of the p53 responsive positive control and the CYP2A6-5′-Luc construct containing the intact p53 binding site but not the mutated CYP2A6-5′-Luc construct. Finally, inducibility of the native CYP2A6 gene by benzo[α]pyrene was demonstrated by dose-dependent increases in CYP2A6 mRNA and protein levels along with increased p53 levels in the nucleus. Collectively, the results indicate that p53 protein is a regulator of the CYP2A6 gene in C3A cells and further support the putative cytoprotective role of CYP2A6. - Highlights: • CYP2A6 is an immediate target gene of p53. • Six putative p53REs located on 3 kb proximate CYP2A6 promoter region. • The region − 160 bp from TSS is highly homologous with the p53 consensus sequence. • P53 specifically bind to the p53RE on the − 160 bp region. • HNF4α may interact with p53 in regulating CYP2A6 expression.« less
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
LEDGF/p75 interacts with mRNA splicing factors and targets HIV-1 integration to highly spliced genes
Singh, Parmit Kumar; Plumb, Matthew R.; Ferris, Andrea L.; Iben, James R.; Wu, Xiaolin; Fadel, Hind J.; Luke, Brian T.; Esnault, Caroline; Poeschla, Eric M.; Hughes, Stephen H.; Kvaratskhelia, Mamuka; Levin, Henry L.
2015-01-01
The host chromatin-binding factor LEDGF/p75 interacts with HIV-1 integrase and directs integration to active transcription units. To understand how LEDGF/p75 recognizes transcription units, we sequenced 1 million HIV-1 integration sites isolated from cultured HEK293T cells. Analysis of integration sites showed that cancer genes were preferentially targeted, raising concerns about using lentivirus vectors for gene therapy. Additional analysis led to the discovery that introns and alternative splicing contributed significantly to integration site selection. These correlations were independent of transcription levels, size of transcription units, and length of the introns. Multivariate analysis with five parameters previously found to predict integration sites showed that intron density is the strongest predictor of integration density in transcription units. Analysis of previously published HIV-1 integration site data showed that integration density in transcription units in mouse embryonic fibroblasts also correlated strongly with intron number, and this correlation was absent in cells lacking LEDGF. Affinity purification showed that LEDGF/p75 is associated with a number of splicing factors, and RNA sequencing (RNA-seq) analysis of HEK293T cells lacking LEDGF/p75 or the LEDGF/p75 integrase-binding domain (IBD) showed that LEDGF/p75 contributes to splicing patterns in half of the transcription units that have alternative isoforms. Thus, LEDGF/p75 interacts with splicing factors, contributes to exon choice, and directs HIV-1 integration to transcription units that are highly spliced. PMID:26545813
Gao, Yong-Gui; Suzuki, Hiroaki; Itou, Hiroshi; Zhou, Yong; Tanaka, Yoshikazu; Wachi, Masaaki; Watanabe, Nobuhisa; Tanaka, Isao; Yao, Min
2008-01-01
LldR (CGL2915) from Corynebacterium glutamicum is a transcription factor belonging to the GntR family, which is typically involved in the regulation of oxidized substrates associated with amino acid metabolism. In the present study, the crystal structure of LldR was determined at 2.05-Å resolution. The structure consists of N- and C-domains similar to those of FadR, but with distinct domain orientations. LldR and FadR dimers achieve similar structures by domain swapping, which was first observed in dimeric assembly of transcription factors. A structural feature of Zn2+ binding in the regulatory domain was also observed, as a difference from the FadR subfamily. DNA microarray and DNase I footprint analyses suggested that LldR acts as a repressor regulating cgl2917-lldD and cgl1934-fruK-ptsF operons, which are indispensable for l-lactate and fructose/sucrose utilization, respectively. Furthermore, the stoichiometries and affinities of LldR and DNAs were determined by isothermal titration calorimetry measurements. The transcriptional start site and repression of LldR on the cgl2917-lldD operon were analysed by primer extension assay. Mutation experiments showed that residues Lys4, Arg32, Arg42 and Gly63 are crucial for DNA binding. The location of the putative ligand binding cavity and the regulatory mechanism of LldR on its affinity for DNA were proposed. PMID:18988622
Single-Nucleosome Mapping of Histone Modifications in S. cerevisiae
Kim, Minkyu; Buratowski, Stephen; Schreiber, Stuart L; Friedman, Nir
2005-01-01
Covalent modification of histone proteins plays a role in virtually every process on eukaryotic DNA, from transcription to DNA repair. Many different residues can be covalently modified, and it has been suggested that these modifications occur in a great number of independent, meaningful combinations. Published low-resolution microarray studies on the combinatorial complexity of histone modification patterns suffer from confounding effects caused by the averaging of modification levels over multiple nucleosomes. To overcome this problem, we used a high-resolution tiled microarray with single-nucleosome resolution to investigate the occurrence of combinations of 12 histone modifications on thousands of nucleosomes in actively growing S. cerevisiae. We found that histone modifications do not occur independently; there are roughly two groups of co-occurring modifications. One group of lysine acetylations shows a sharply defined domain of two hypo-acetylated nucleosomes, adjacent to the transcriptional start site, whose occurrence does not correlate with transcription levels. The other group consists of modifications occurring in gradients through the coding regions of genes in a pattern associated with transcription. We found no evidence for a deterministic code of many discrete states, but instead we saw blended, continuous patterns that distinguish nucleosomes at one location (e.g., promoter nucleosomes) from those at another location (e.g., over the 3′ ends of coding regions). These results are consistent with the idea of a simple, redundant histone code, in which multiple modifications share the same role. PMID:16122352
Ochiai, Hiroshi; Miyamoto, Tatsuo; Kanai, Akinori; Hosoba, Kosuke; Sakuma, Tetsushi; Kudo, Yoshiki; Asami, Keiko; Ogawa, Atsushi; Watanabe, Akihiro; Kajii, Tadashi; Yamamoto, Takashi; Matsuura, Shinya
2014-01-01
Cancer-prone syndrome of premature chromatid separation with mosaic variegated aneuploidy [PCS (MVA) syndrome] is a rare autosomal recessive disorder characterized by constitutional aneuploidy and a high risk of childhood cancer. We previously reported monoallelic mutations in the BUB1B gene (encoding BUBR1) in seven Japanese families with the syndrome. No second mutation was found in the opposite allele of any of the families studied, although a conserved BUB1B haplotype and a decreased transcript were identified. To clarify the molecular pathology of the second allele, we extended our mutational search to a candidate region surrounding BUB1B. A unique single nucleotide substitution, G > A at ss802470619, was identified in an intergenic region 44 kb upstream of a BUB1B transcription start site, which cosegregated with the disorder. To examine whether this is the causal mutation, we designed a transcription activator-like effector nuclease–mediated two-step single-base pair editing strategy and biallelically introduced this substitution into cultured human cells. The cell clones showed reduced BUB1B transcripts, increased PCS frequency, and MVA, which are the hallmarks of the syndrome. We also encountered a case of a Japanese infant with PCS (MVA) syndrome carrying a homozygous single nucleotide substitution at ss802470619. These results suggested that the nucleotide substitution identified was the causal mutation of PCS (MVA) syndrome. PMID:24344301
Panesso, Diana; Abadía-Patiño, Lorena; Vanegas, Natasha; Reynolds, Peter E.; Courvalin, Patrice; Arias, Cesar A.
2005-01-01
The vanC glycopeptide resistance gene cluster encodes enzymes required for synthesis of peptidoglycan precursors ending in d-Ala-d-Ser. Enterococcus gallinarum BM4174 and SC1 are constitutively and inducibly resistant to vancomycin, respectively. Analysis of peptidoglycan precursors in both strains indicated that UDP-MurNAc-tetrapeptide and UDP-MurNAc-pentapeptide[d-Ser] were synthesized in E. gallinarum SC1 only in the presence of vancomycin (4 μg/ml), whereas the “resistance” precursors accumulated in the cytoplasm of BM4174 cells under both inducing and noninducing conditions. Northern hybridization and reverse transcription-PCR experiments revealed that all the genes from the cluster, vanC-1, vanXYC, vanT, vanRC, and vanSC, were transcribed from a single promoter. In the inducible SC1 isolate, transcriptional regulation appeared to be responsible for inducible expression of resistance. Promoter mapping in E. gallinarum BM4174 revealed that the transcriptional start site was located 30 nucleotides upstream from vanC-1 and that the −10 promoter consensus sequence had high identity with that of the vanA cluster. Comparison of the deduced sequence of the vanSC genes from isolates with constitutive and inducible resistance revealed several amino acid substitutions located in the X box (R200L) and in the region between the F and G2 boxes (D312N, D312A, and G320S) of the putative sensor kinase proteins from isolates with constitutive resistance. PMID:15728903