Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice.

PubMed

Huang, Chun; Li, Runqin; Zhang, Yinglin; Gong, Jianping

2017-10-01

Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells.

Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

PubMed Central

Li, Runqin; Zhang, Yinglin

2016-01-01

Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

The Chemical Chaperone, PBA, Reduces ER Stress and Autophagy and Increases Collagen IV α5 Expression in Cultured Fibroblasts From Men With X-Linked Alport Syndrome and Missense Mutations.

PubMed

Wang, Dongmao; Mohammad, Mardhiah; Wang, Yanyan; Tan, Rachel; Murray, Lydia S; Ricardo, Sharon; Dagher, Hayat; van Agtmael, Tom; Savige, Judy

2017-07-01

X-linked Alport syndrome (OMIM 301050) is caused by COL4A5 missense variants in 40% of families. This study examined the effects of chemical chaperone treatment (sodium 4-phenylbutyrate) on fibroblast cell lines derived from men with missense mutations. Dermal fibroblast cultures were established from 2 affected men and 3 normals. Proliferation rates were examined, the collagen IV α5 chain localized with immunostaining, and levels of the intra- and extracellular chains quantitated with an in-house enzyme-linked immunosorbent assay. COL4A5 mRNA was measured using quantitative reverse transcriptase polymerase chain reaction. Endoplasmic reticulum (ER) size was measured on electron micrographs and after HSP47 immunostaining. Markers of ER stress (ATF6, HSPA5, DDIT3), autophagy (ATG5, BECN1, ATG7), and apoptosis (CASP3, BAD, BCL 2 ) were also quantitated by quantitative reverse transcriptase polymerase chain reaction. Measurements were repeated after 48 hours of incubation with 10 mM sodium 4-phenylbutyrate acid. Both COL4A5 missense variants were associated with reduced proliferation rates on day 6 ( P  = 0.01 and P  = 0.03), ER enlargement, and increased mRNA for ER stress and autophagy (all P values < 0.05) when compared with normal. Sodium 4-phenylbutyrate treatment increased COL4A5 transcript levels ( P  < 0.01), and reduced ER size ( P  < 0.01 by EM and P  < 0.001 by immunostaining), ER stress (p HSPA5 and DDIT3, all P values < 0.01) and autophagy (ATG7, P  < 0.01). Extracellular collagen IV α5 chain was increased in the M1 line only ( P  = 0.06). Sodium 4-phenylbutyrate increases collagen IV α5 mRNA levels, reduces ER stress and autophagy, and possibly facilitates collagen IV α5 extracellular transport. Whether these actions delay end-stage renal failure in men with X-linked Alport syndrome and missense mutations will only be determined with clinical trials.

Fatal hemorrhagic fever caused by West Nile virus in the United States.

PubMed

Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

2006-06-01

Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

PubMed

Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

2017-06-16

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Two assays for measuring fibrosis: reverse transcriptase-polymerase chain reaction of collagen alpha(1) (III) mRNA is an early predictor of subsequent collagen deposition while a novel serum N-terminal procollagen (III) propeptide assay reflects manifest fibrosis in carbon tetrachloride-treated rats.

PubMed

Kauschke, S G; Knorr, A; Heke, M; Kohlmeyer, J; Schauer, M; Theiss, G; Waehler, R; Burchardt, E R

1999-11-15

Using a novel quantitative reverse transcriptase-polymerase chain reaction assay, we have determined the amount of specific mRNA for procollagen alpha(1) (III) (PIIIP) in the carbon tetrachloride (CCl(4)) model of liver fibrosis in rats. After a single week of CCl(4) application, the amount of PIIIP mRNA was increased approximately 10 times over the untreated control group and continued to increase to approximately 30 times after 7 weeks of intoxication. In this model substantial fibrosis was demonstrated by computer-aided morphometry after 5 to 7 weeks of treatment. Using recombinant murine N-terminal procollagen alpha(1) (III) propeptide (PIIINP), a novel sensitive immunoassay for the measurement of circulating PIIINP in rodent sera was established. An increase in PIIINP serum levels was observed after 5 to 7 weeks of CCl(4) intoxication. Our results suggest PIIIP gene expression is an early marker of tissue fibrosis. Early PIIIP gene expression is correlated with the extent of the subsequent fibrosis. PIIIP mRNA levels increase much earlier than conventional histological examination or PIIINP levels. PIIINP measurements with our new serum assay, on the other hand, are a good noninvasive marker of manifest fibrosis but are a poor marker of fibrogenesis. Copyright 1999 Academic Press.

Emergence of a replicating species from an in vitro RNA evolution reaction

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Joyce, G. F.

1994-01-01

The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

PubMed

Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

2008-03-01

Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

The Discovery of Reverse Transcriptase.

PubMed

Coffin, John M; Fan, Hung

2016-09-29

In 1970 the independent and simultaneous discovery of reverse transcriptase in retroviruses (then RNA tumor viruses) by David Baltimore and Howard Temin revolutionized molecular biology and laid the foundations for retrovirology and cancer biology. In this historical review we describe the formulation of the controversial provirus hypothesis by Temin, which ultimately was proven by his discovery of reverse transcriptase in Rous sarcoma virus virions. Baltimore arrived at the same discovery through his studies on replication of RNA-containing viruses, starting with poliovirus and then moving to vesicular stomatitis virus, where he discovered a virion RNA polymerase. Subsequent studies of reverse transcriptase led to the elucidation of the mechanism of retrovirus replication, the discovery of oncogenes, the advent of molecular cloning, the search for human cancer viruses, and the discovery and treatment of HIV/AIDS.

Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

Cancer.gov

Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).

Synthesis, Activity and Structural Analysis of Novel α-Hydroxytropolone Inhibitors of Human Immunodeficiency Virus Reverse Transcriptase-Associated Ribonuclease H

PubMed Central

Chung, Suhman; Himmel, Daniel M.; Jiang, Jian-Kang; Wojtak, Krzysztof; Bauman, Joseph D.; Rausch, Jason W.; Wilson, Jennifer A.; Beutler, John A.; Thomas, Craig J.; Arnold, Eddy; Le Grice, Stuart F.J.

2011-01-01

The α-hydroxytroplone, manicol (5,7-dihydroxy-2-isopropenyl-9-methyl-1,2,3,4-tetrahydro-benzocyclohepten-6-one) potently and specifically inhibits ribonuclease H (RNase H) activity of human immunodeficiency virus reverse transcriptase (HIV RT) in vitro. However, manicol was ineffective in reducing virus replication in culture. Ongoing efforts to improve the potency and specificity over the lead compound led us to synthesize 14 manicol derivatives that retain the divalent metal-chelating α-hydroxytropolone pharmacophore. These efforts were augmented by a high resolution structure of p66/p51 HIV-1 RT containing the nonnucleoside reverse transcriptase inhibitor (NNRTI), TMC278 and manicol in the DNA polymerase and RNase H active sites, respectively. We demonstrate here that several modified α-hydroxytropolones exhibit antiviral activity at non-cytotoxic concentrations. Inclusion of RNase H active site mutants indicated that manicol analogs can occupy an additional site in or around the DNA polymerase catalytic center. Collectively, our studies will promote future structure-based design of improved α-hydroxytropolones to complement the NRTI and NNRTI currently in clinical use. PMID:21568335

Extraordinary effects of specific monovalent cations on activation of reovirus transcriptase by chymotrypsin in vitro.

PubMed

Borsa, J; Sargent, M D; Long, D G; Chapman, J D

1973-02-01

Activation of reovirus transcriptase activity, latent in intact virions, by digestion of purified virions with chymotrypsin (CHT) in vitro shows a stringent requirement for specific monovalent cations. Cs(+), Rb(+), or K(+) ions are capable of facilitating activation by chymotryptic digestion. Na(+), Li(+), or NH(4) (+) ions are not capable of facilitating the CHT activation of polymerase activity and are antagonistic towards the effects of the facilitating ions. The data indicate that the effect of the cations is exerted on activation of the polymerase activity by CHT as opposed to an effect on polymerization per se. This effect may be important biologically in that it provides a mechanism whereby the virion can sense whether it is in an intracellular or an extracellular environment and thereby can avoid premature uncoating.

Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

USDA-ARS?s Scientific Manuscript database

Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

Use of Scented Sugar Bait Stations to Track Mosquito-Borne Arbovirus Transmission in California

PubMed Central

LOTHROP, HUGH D.; WHEELER, SARAH S.; FANG, YING; REISEN, WILLIAM K.

2012-01-01

Laboratory and field research was conducted to determine if Culex tarsalis Coquillett expectorated West Nile virus (WNV) during sugar feeding and if a lure or bait station could be developed to exploit this behavior for WNV surveillance. Experimentally infected Cx. tarsalis repeatedly expectorated WNV onto filter paper strips and into vials with wicks containing sucrose that was readily detectable by a quantitative reverse transcriptase-polymerase chain reaction assay. Few females (33%, n = 27) became infected by imbibing sugar solutions spiked with high concentrations (107 plaque forming units/ml) of WNV, indicating sugar feeding stations probably would not be a source of WNV infection. In nature, sugar bait stations scented with the floral attractant phenyl acetaldehyde tracked WNV transmission activity in desert but not urban or agricultural landscapes in California. When deployed in areas of the Coachella Valley with WNV activity during the summer of 2011, 27 of 400 weekly sugar samples (6.8%) tested positive for WNV RNA by reverse transcriptase-polymerase chain reaction. Prevalence of positives varied spatially, but positive sugar stations were detected before concurrent surveillance measures of infection (mosquito pools) or transmission (sentinel chicken seroconversions). In contrast, sugar bait stations deployed in urban settings in Los Angeles or agricultural habits near Bakersfield in Kern County supporting WNV activity produced 1 of 90 and 0 of 60 positive weekly sugar samples, respectively. These results with sugar bait stations will require additional research to enhance bait attractancy and to understand the relationship between positive sugar stations and standard metrics of arbovirus surveillance. PMID:23270177

Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

PubMed

Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

2010-09-01

This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

Reverse transcriptase activity and particles of retroviral density in cultured canine lymphosarcoma supernatants.

PubMed Central

Tomley, F. M.; Armstrong, S. J.; Mahy, B. W.; Owen, L. N.

1983-01-01

Lymphoid tissue from 43 cases of canine lymphosarcoma and from 40 clinically normal dogs have been examined for markers of retrovirus infection. From 69-76% of culture supernatants from lymphosarcomas were shown to contain particles of retroviral density and to possess poly rC-oligo dG templated polymerase (reverse transcriptase) activity compared with 17-24% of culture supernatants from normal canine lymphoid cells. In 6 culture supernatants from cases of lymphosarcoma, high molecular weight 60-70S RNA was detected and shown to be found in association with this particulate reverse transcriptase activity. No such RNA was detected in 6 culture supernatants from normal canine lymphoid cells. PMID:6186265

Carbocyclic nucleoside analogues: classification, target enzymes, mechanisms of action and synthesis

NASA Astrophysics Data System (ADS)

Matyugina, E. S.; Khandazhinskaya, A. P.; Kochetkov, Sergei N.

2012-08-01

Key biological targets (S-adenosyl-L-homocysteine hydrolase, telomerase, human immunodeficiency virus reverse transcriptase, herpes virus DNA polymerase and hepatitis B virus DNA polymerase) and the mechanisms of action of carbocyclic nucleoside analogues are considered. Structural types of analogues are discussed. Methods of synthesis for the most promising compounds and the spectrum of their biological activities are described. The bibliography includes 126 references.

Extraordinary Effects of Specific Monovalent Cations on Activation of Reovirus Transcriptase by Chymotrypsin In Vitro

PubMed Central

Borsa, J.; Sargent, M. D.; Long, D. G.; Chapman, J. D.

1973-01-01

Activation of reovirus transcriptase activity, latent in intact virions, by digestion of purified virions with chymotrypsin (CHT) in vitro shows a stringent requirement for specific monovalent cations. Cs+, Rb+, or K+ ions are capable of facilitating activation by chymotryptic digestion. Na+, Li+, or NH4+ ions are not capable of facilitating the CHT activation of polymerase activity and are antagonistic towards the effects of the facilitating ions. The data indicate that the effect of the cations is exerted on activation of the polymerase activity by CHT as opposed to an effect on polymerization per se. This effect may be important biologically in that it provides a mechanism whereby the virion can sense whether it is in an intracellular or an extracellular environment and thereby can avoid premature uncoating. PMID:4347424

Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

PubMed

Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

1996-03-01

Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

Structural basis for the D-stereoselectivity of human DNA polymerase β

PubMed Central

Vyas, Rajan; Reed, Andrew J.; Raper, Austin T.; Zahurancik, Walter J.; Wallenmeyer, Petra C.

2017-01-01

Abstract Nucleoside reverse transcriptase inhibitors (NRTIs) with L-stereochemistry have long been an effective treatment for viral infections because of the strong D-stereoselectivity exhibited by human DNA polymerases relative to viral reverse transcriptases. The D-stereoselectivity of DNA polymerases has only recently been explored structurally and all three DNA polymerases studied to date have demonstrated unique stereochemical selection mechanisms. Here, we have solved structures of human DNA polymerase β (hPolβ), in complex with single-nucleotide gapped DNA and L-nucleotides and performed pre-steady-state kinetic analysis to determine the D-stereoselectivity mechanism of hPolβ. Beyond a similar 180° rotation of the L-nucleotide ribose ring seen in other studies, the pre-catalytic ternary crystal structures of hPolβ, DNA and L-dCTP or the triphosphate forms of antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP) provide little structural evidence to suggest that hPolβ follows the previously characterized mechanisms of D-stereoselectivity. Instead, hPolβ discriminates against L-stereochemistry through accumulation of several active site rearrangements that lead to a decreased nucleotide binding affinity and incorporation rate. The two NRTIs escape some of the active site selection through the base and sugar modifications but are selected against through the inability of hPolβ to complete thumb domain closure. PMID:28402499

Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

PubMed

Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

2006-08-18

DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung

2008-01-05

Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate {sup 32}P-ribonucleotides, but not HBV coremore » particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems.« less

Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

PubMed

Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

2000-06-15

A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

PubMed

Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

2014-09-01

The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Identification of reference genes for RT-qPCR analysis in peach genotypes with contrasting chilling requirements.

PubMed

Marini, N; Bevilacqua, C B; Büttow, M V; Raseira, M C B; Bonow, S

2017-05-25

Selecting and validating reference genes are the first steps in studying gene expression by reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR). The present study aimed to evaluate the stability of five reference genes for the purpose of normalization when studying gene expression in various cultivars of Prunus persica with different chilling requirements. Flower bud tissues of nine peach genotypes from Embrapa's peach breeding program with different chilling requirements were used, and five candidate reference genes based on the RT-qPCR that were useful for studying the relative quantitative gene expression and stability were evaluated using geNorm, NormFinder, and bestKeeper software packages. The results indicated that among the genes tested, the most stable genes to be used as reference genes are Act and UBQ10. This study is the first survey of the stability of reference genes in peaches under chilling stress and provides guidelines for more accurate RT-qPCR results.

Induction of vascular endothelial growth factor expression in human pulp fibroblasts stimulated with black-pigmented Bacteroides.

PubMed

Yang, L-C; Tsai, C-H; Huang, F-M; Su, Y-F; Lai, C-C; Liu, C-M; Chang, Y-C

2004-09-01

To investigate the effect of black-pigmented Bacteroides on the expression of vascular endothelial growth factor (VEGF) gene in human pulp fibroblasts. The supernatants of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia were used to evaluate VEGF gene expression in human pulp fibroblasts. The levels of mRNAs were measured by the quantitative reverse-transcriptase polymerase chain reaction analysis. Black-pigmented Bacteroides induced significantly high levels of VEGF mRNA gene expression in human pulp fibroblasts (P < 0.05). In addition, the expression of VEGF depended on the bacteria tested. Black-pigmented Bacteroides may be involved in developing pulpal disease through the stimulation of VEGF production that would lead to the expansion of the vascular network coincident to progression of the inflammation.

An inducible HSP70 gene from the midge Chironomus dilutus: Characterization and transcription profile under environmental stress

USGS Publications Warehouse

Karouna-Renier, N. K.; Rao, K.R.

2009-01-01

In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.

Evaluating Fumonisin Gene Expression in Fusarium verticillioides.

PubMed

Scala, Valeria; Visentin, Ivan; Cardinale, Francesca

2017-01-01

Transcript levels of key genes in a biosynthetic pathway are often taken as a proxy for metabolite production. This is the case of FUM1, encoding the first dedicated enzyme in the metabolic pathway leading to the production of the mycotoxins Fumonisins by fungal species belonging to the genus Fusarium. FUM1 expression can be quantified by different methods; here, we detail a protocol based on quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), by which relative or absolute transcript abundance can be estimated in Fusaria grown in vitro or in planta. As very seldom commercial kits for RNA extraction and cDNA synthesis are optimized for fungal samples, we developed a protocol tailored for these organisms, which stands alone but can be also easily integrated with specific reagents and kits commercially available.

A full-coordinate model of the polymerase domain of HIV-1 reverse transcriptase and its interaction with a nucleic acid substrate

NASA Technical Reports Server (NTRS)

Setlik, R. F.; Meyer, D. J.; Shibata, M.; Roskwitalski, R.; Ornstein, R. L.; Rein, R.

1994-01-01

We present a full-coordinate model of residues 1-319 of the polymerase domain of HIV-I reverse transcriptase. This model was constructed from the x-ray crystallographic structure of Jacobo-Molina et al. (Jacobo-Molina et al., P.N.A.S. USA 90, 6320-6324 (1993)) which is currently available to the degree of C-coordinates. The backbone and side-chain atoms were constructed using the MAXSPROUT suite of programs (L. Holm and C. Sander, J. Mol. Biol. 218, 183-194 (1991)) and refined through molecular modeling. A seven base pair A-form dsDNA was positioned in the nucleic acid binding cleft to represent the template-primer complex. The orientation of the template-primer complex in the nucleic acid binding cleft was guided by the positions of phosphorus atoms in the crystal structure.

Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

PubMed

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

EPA Science Inventory

A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

PubMed

Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

2015-08-01

The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A modified single-tube one-step product-enhanced reverse transcriptase (mSTOS-PERT) assay with heparin as DNA polymerase inhibitor for specific detection of RTase activity.

PubMed

Fan, Xiao-Yong; Lü, Guo-Zhen; Wu, Li-Na; Chen, Jing-Hua; Xu, Wen-Qing; Zhao, Chun-Nü; Guo, Sheng-Qi

2006-12-01

Current regulations and recommendations proposed for the production of vaccines in continuous cell lines of any origin demand that these be free of exogenous viruses, particularly retroviruses. Recently, the ultra-sensitive product-enhanced reverse transcriptase (PERT) assay can be used to detect minute of reverse transcriptase (RTase) in single retroviral particle and is 10(6) times more sensitive than the conventional RTase assays. However, coincidental with this increase in sensitivity is an increase in false-positive reactions derived from contaminating cellular DNA polymerases, which are known to have RTase-like activities. To develop a modified single-tube one-step PERT (mSTOS-PERT) assay with improvements on decreasing significantly the level of false-positive reactions, and to evaluate the mSTOS-PERT assay for sensitivity and specificity. Ampliwaxtrade mark was used to compartmentalize the reverse transcription (RT) and PCR step in the same micro-tube with more efficiency and reproducibility, while maintaining the high sensitivity. The DNA amplification products were separated by 2% agarose gel electrophoresis, and then analyzed by non-isotopic Southern blot hybridization. A wide variety of cell lines used in biologicals production were detected to validate the improved mSTOS-PERT assay. The detection limit for the mSTOS-PERT assay was at least 10(-9)U, when using AMV-RTase as a positive control. Furthermore, heparin involvement in the RT step can eliminate completely the false-positive PERT signals which are exhibited by cellular polymerases such as DNA-dependent DNA polymerase alpha, gamma released by cell death. Most mammalian cells (MRC-5, Vero, WISH, 2BS, RK-13, MDCK, etc.) are PERT-negative in cell supernatants. Some PERT-positive signals in cell lysates were found to be introduced by the cellular DNA polymerases and could be inhibited specifically by heparin. Chick cells derived from either chick embryo fibroblasts (CEF) or allantoic fluid from SPF embryonated eggs, murine hybridoma cell SP2/0, etc., contained authentic RTase activities, which could not be inactivated by heparin. The improved mSTOS-PERT assay described here may distinguish the genuine RTase activity from cellular polymerases with high sensitivity and specificity, and is rapid and easy to perform to screen for the possible contamination of minute retroviruses in the cell substrates used in vaccine production.

Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

PubMed

Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

2015-02-01

In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

PubMed Central

Huang, M M; Arnheim, N; Goodman, M F

1992-01-01

Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

PubMed

Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

2018-03-01

One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Molecular Diagnostics in Colorectal Carcinoma: Advances and Applications for 2018.

PubMed

Bhalla, Amarpreet; Zulfiqar, Muhammad; Bluth, Martin H

2018-06-01

The molecular pathogenesis and classification of colorectal carcinoma are based on the traditional adenomaecarcinoma sequence, serrated polyp pathway, and microsatellite instability (MSI). The genetic basis for hereditary nonpolyposis colorectal cancer is the detection of mutations in the MLH1, MSH2, MSH6, PMS2, and EPCAM genes. Genetic testing for Lynch syndrome includes MSI testing, methylator phenotype testing, BRAF mutation testing, and molecular testing for germline mutations in MMR genes. Molecular makers with predictive and prognostic implications include quantitative multigene reverse transcriptase polymerase chain reaction assay and KRAS and BRAF mutation analysis. Mismatch repair-deficient tumors have higher rates of programmed death-ligand 1 expression. Cell-free DNA analysis in fluids are proving beneficial for diagnosis and prognosis in these disease states towards effective patient management. Copyright © 2018 Elsevier Inc. All rights reserved.

Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

PubMed

Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

2014-05-30

Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

Problem-Solving Test: Catalytic Activities of a Human Nuclear Enzyme

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2011-01-01

Terms to be familiar with before you start to solve the test: ion exchange chromatography, polynucleotides, oligonucleotides, radioactive labeling, template, primer, DNA polymerase, reverse transcriptase, helicase, nucleoside triphosphates, nucleoside diphosphates, nucleoside monophosphates, nucleosides, 5'-end and 3'-end, bacteriophage,…

Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

PubMed Central

2005-01-01

Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

Expression and characterization of a novel reverse transcriptase of the LTR retrotransposon Tf1.

PubMed

Kirshenboim, Noa; Hayouka, Zvi; Friedler, Assaf; Hizi, Amnon

2007-09-30

The LTR retrotransposon of Schizosacharomyces pombe, Tf1, has several distinctive properties that can be related to the unique properties of its reverse transcriptase (RT). Consequently, we expressed, purified and studied the recombinant Tf1 RT. This monomeric protein possesses all activities typical to RTs: DNA and RNA-dependent DNA polymerase as well as an inherent ribonuclease H. The DNA polymerase activity shows preference to Mn(+)(2) or Mg(+)(2), depending on the substrate used, whereas the ribonuclease H strongly prefers Mn(+)(2). The most outstanding feature of Tf1 RT is its capacity to add non-templated nucleotides to the 3'-ends of the nascent DNA. This is mainly apparent in the presence of Mn(+)(2), as is the noticeable low fidelity of DNA synthesis. In all, Tf1 RT has a marked infidelity in synthesizing DNA at template ends, a phenomenon that can explain, as discussed herein, some of the features of Tf1 replication in the host cells.

DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

PubMed

Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

2013-06-13

Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

Mutational analysis of the reverse transcriptase and ribonuclease H domains of the human foamy virus.

PubMed Central

Kögel, D; Aboud, M; Flügel, R M

1995-01-01

Human foamy or spuma virus (HFV) codes for a distinct set of pol gen products. To determine the minimal requirements for the HFV enzymatic activities, defined residues of the reverse transcriptase (RT) and ribo-nuclease H (RNase H) domain of the HFV pol gene were mutated by site-specific PCR mutagenesis. The mutant gene products were bacterially expressed, purified by Ni2+ chelate affinity chromatography and characterised by Western blotting. The enzymatic activities of the individual recombinant HFV pol mutant proteins were characterised by the situ RT, RNase H and RNase H assays. Two substitution mutants reached RT activity levels higher than that of the intact recombinant HFV RT-RH-His. When the catalytically essential D508 was substituted by A508, 5% of RNase H activity was retained while DNA polymerase activity increased 2-fold. A deletion of 11 amino acid residues in the hinge region completely abolished DNA polymerase while RNase H activity decreased 2-fold. A deletion mutant in the C-terminal RH domain showed no RNase H but retained RNase H activity indicating that the activities are genetically separable. The combined data reveal that the HFV DNA polymerase and RNase H activities are interdependent. Images PMID:7544460

Assessment Effects of Resveratrol on Human Telomerase Reverse Transcriptase Messenger Ribonucleic Acid Transcript in Human Glioblastoma.

PubMed

Mirzazadeh, Azin; Kheirollahi, Majid; Farashahi, Ehsan; Sadeghian-Nodoushan, Fatemeh; Sheikhha, Mohammad Hasan; Aflatoonian, Behrouz

2017-01-01

Glioblastoma (GBM) is the most common and aggressive brain tumor, which has a poor prognosis despite the advent of different therapeutic strategies. There are numerous molecular biomarkers to contribute diagnosis, prognosis, and prediction of response to the current therapy in GBM. One of the most important markers that are potentially valuable is immortalization-specific or immortalization-associated marker named "hTERT messenger ribonucleic acid (mRNA)" the key subunit of telomerase enzyme, which is expressed in more than 85% of cancer cells, in spite of the majority of normal somatic cells. In this study, we investigated the effects of resveratrol (RSV) on this mRNA marker level, leading to cancer progression. U-87MG cell line was obtained from Pasteur Institute of Iran and treated with various concentrations of 0-160 μg/mL of RSV and at different time points (24, 48, and 72 h). To evaluate viability of U-87MG cells, standard 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed. Real-time polymerase chain reaction (RT-PCR) was used for comparative and quantitative assessment of human telomerase reverse transcriptase (hTERT) mRNA copy number versus control-untreated group. The results of our investigation suggested that RSV effectively inhibited cell growth and caused cell death in dose-dependent ( P < 0.05) and not in time-dependent manner ( P > 0.05), in vitro . Interestingly, quantitative RT-PCR analysis demonstrated that at half inhibition concentration, RSV dramatically decreased mRNA expression of hTERT, the catalytic subunit of telomerase enzyme, which leads to prevention of cell division and tumor progression. With regard to downregulation of this immortalization-associated marker, RSV may potentially be used as a therapeutic agent against GBM.

Detection of EML4-ALK fusion gene in Chinese non-small cell lung cancer by using a sensitive quantitative real-time reverse transcriptase PCR technique.

PubMed

Fu, Sha; Wang, Fang; Shao, Qiong; Zhang, Xu; Duan, Li-Ping; Zhang, Xiao; Zhang, Li; Shao, Jian-Yong

2015-04-01

Anaplastic lymphoma kinase (ALK) rearrangement is present in approximately 5% of lung adenocarcinoma. Clinical trials on ALK inhibitor phase I to III have shown an interesting disease control rate and acceptable tolerability in ALK rearrangement patients. In clinical application, the precise diagnostic strategy for identifying ALK rearrangements remains to be determined. In this study, ALK rearrangement was screened by using quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR), direct sequencing, 2 fluorescence in situ hybridization (FISH) assays, and immunohistochemistry in 173 lung adenocarcinomas. We identified 18 cases (10.4%) with EML4-ALK fusion-positive by qRT-PCR, and all were positive for EML4-ALK fusion gene validated by direct sequencing. The result was consistent with that of other methods. Furthermore, of the 18 EML4-ALK fusion-positive cases, 16 (9.2%) were positive by using EML4-ALK fusion probe FISH, and 15 (8.7%) were positive by using ALK break-apart probe FISH and immunohistochemistry staining. Of the 18 ALK fusion-positive lung adenocarcinomas, 8 cases (44.4%) were histologically diagnosed as subtypes of cribriform adenocarcinoma, 7 cases (38.9%) as cribriform adenocarcinoma mixed with papillary and/or mucinous pattern, 2 cases (11.1%) as papillary adenocarcinoma, and 1 case (5.6%) as mucinous adenocarcinoma. In the present study, the ALK rearrangement frequency detected by qRT-PCR in Chinese NSCLC patients was higher than that in the western populations. QRT-PCR is a rapid, sensitive technology that could be used as a screening tool for identifying EML4-ALK fusion-positive NSCLC patients who would be sensitive for receiving ALK inhibitor therapy.

First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio

USDA-ARS?s Scientific Manuscript database

Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...

Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

Treesearch

Ningxia Du; Paula M. Pijut

2010-01-01

An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

Multiplex Hydrolysis Probe Real-Time PCR for Simultaneous Detection of Hepatitis A Virus and Hepatitis E Virus

PubMed Central

Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

2014-01-01

Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV. PMID:24886818

Effects of Trichostatin A on drug uptake transporters in primary rat hepatocyte cultures

PubMed Central

Ramboer, Eva; Rogiers, Vera; Vanhaecke, Tamara; Vinken, Mathieu

2015-01-01

The present study was set up to investigate the effects of Trichostatin A (TSA), a prototypical epigenetic modifier, on the expression and activity of hepatic drug uptake transporters in primary cultured rat hepatocytes. To this end, the expression of the sinusoidal transporters sodium-dependent taurocholate cotransporting polypeptide (Ntcp) and organic anion transporting polypeptide 4 (Oatp4) was monitored by real-time quantitative reverse transcriptase polymerase chain reaction analysis and immunoblotting. The activity of the uptake transporters was analyzed using radiolabeled substrates and chemical inhibitors. Downregulation of the expression and activity of Oatp4 and Ntcp was observed as a function of the cultivation time and could not be counteracted by TSA. In conclusion, the epigenetic modifier TSA does not seem to exert a positive effect on the expression and activity of the investigated uptake transporters in primary rat hepatocyte cultures. PMID:26648816

A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

PubMed

Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

2010-01-15

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography.

PubMed

Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

2016-08-22

Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same 'double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs.

Shared active site architecture between archaeal PolD and multi-subunit RNA polymerases revealed by X-ray crystallography

PubMed Central

Sauguet, Ludovic; Raia, Pierre; Henneke, Ghislaine; Delarue, Marc

2016-01-01

Archaeal replicative DNA polymerase D (PolD) constitute an atypical class of DNA polymerases made of a proofreading exonuclease subunit (DP1) and a larger polymerase catalytic subunit (DP2), both with unknown structures. We have determined the crystal structures of Pyrococcus abyssi DP1 and DP2 at 2.5 and 2.2 Å resolution, respectively, revealing a catalytic core strikingly different from all other known DNA polymerases (DNAPs). Rather, the PolD DP2 catalytic core has the same ‘double-psi β-barrel' architecture seen in the RNA polymerase (RNAP) superfamily, which includes multi-subunit transcriptases of all domains of life, homodimeric RNA-silencing pathway RNAPs and atypical viral RNAPs. This finding bridges together, in non-viral world, DNA transcription and DNA replication within the same protein superfamily. This study documents further the complex evolutionary history of the DNA replication apparatus in different domains of life and proposes a classification of all extant DNAPs. PMID:27548043

Dietary fat intake promotes the development of hepatic steatosis independently from excess caloric consumption in a murine model.

PubMed

de Meijer, Vincent E; Le, Hau D; Meisel, Jonathan A; Akhavan Sharif, M Reza; Pan, Amy; Nosé, Vânia; Puder, Mark

2010-08-01

Nonalcoholic fatty liver disease results from overconsumption and is a significant and increasing cause of liver failure. The type of diet that is conducive to the development of this disease has not been established, and evidence-based treatment options are currently lacking. We hypothesized that the onset of hepatic steatosis is linked to the consumption of a diet with a high fat content, rather than related to excess caloric intake. In addition, we also hypothesized that fully manifested hepatic steatosis could be reversed by reducing the fat percentage in the diet of obese mice. C57BL/6J male mice were fed either a purified rodent diet containing 10% fat or a diet with 60% of calories derived from fat. A pair-feeding design was used to distinguish the effects of dietary fat content and caloric intake on dietary-induced hepatic lipid accumulation and associated injury. Livers were analyzed by quantitative reverse transcriptase polymerase chain reaction for lipid metabolism-related gene expression. After 9 weeks, mice on the 60%-fat diet exhibited more weight gain, insulin resistance, and hepatic steatosis compared with mice on a 10%-fat diet with equal caloric intake. Furthermore, mice with established metabolic syndrome at 9 weeks showed reversal of hepatic steatosis, insulin resistance, and obesity when switched to a 10%-fat diet for an additional 9 weeks, independent of caloric intake. Quantitative reverse transcriptase polymerase chain reaction revealed that transcripts related to both de novo lipogenesis and increased uptake of free fatty acids were significantly up-regulated in mice pair-fed a 60%-fat diet compared with 10%-fat-fed animals. Dietary fat content, independent from caloric intake, is a crucial factor in the development of hepatic steatosis, obesity, and insulin resistance in the C57BL/6J diet-induced obesity model caused by increased uptake of free fatty acids and de novo lipogenesis. In addition, once established, all these features of the metabolic syndrome can be successfully reversed after switching obese mice to a diet low in fat. Low-fat diets deserve attention in the investigation of a potential treatment of patients with nonalcoholic fatty liver disease. Copyright 2010 Elsevier Inc. All rights reserved.

Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

PubMed

Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

1998-01-01

To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

Off-Target Effects of Drugs that Disrupt Human Mitochondrial DNA Maintenance

PubMed Central

Young, Matthew J.

2017-01-01

Nucleoside reverse transcriptase inhibitors (NRTIs) were the first drugs used to treat human immunodeficiency virus (HIV) the cause of acquired immunodeficiency syndrome. Development of severe mitochondrial toxicity has been well documented in patients infected with HIV and administered NRTIs. In vitro biochemical experiments have demonstrated that the replicative mitochondrial DNA (mtDNA) polymerase gamma, Polg, is a sensitive target for inhibition by metabolically active forms of NRTIs, nucleotide reverse transcriptase inhibitors (NtRTIs). Once incorporated into newly synthesized daughter strands NtRTIs block further DNA polymerization reactions. Human cell culture and animal studies have demonstrated that cell lines and mice exposed to NRTIs display mtDNA depletion. Further complicating NRTI off-target effects on mtDNA maintenance, two additional DNA polymerases, Pol beta and PrimPol, were recently reported to localize to mitochondria as well as the nucleus. Similar to Polg, in vitro work has demonstrated both Pol beta and PrimPol incorporate NtRTIs into nascent DNA. Cell culture and biochemical experiments have also demonstrated that antiviral ribonucleoside drugs developed to treat hepatitis C infection act as off-target substrates for POLRMT, the mitochondrial RNA polymerase and primase. Accompanying the above-mentioned topics, this review examines: (1) mtDNA maintenance in human health and disease, (2) reports of DNA polymerases theta and zeta (Rev3) localizing to mitochondria, and (3) additional drugs with off-target effects on mitochondrial function. Lastly, mtDNA damage may induce cell death; therefore, the possibility of utilizing compounds that disrupt mtDNA maintenance to kill cancer cells is discussed. PMID:29214156

Hsp90 is required for the activity of a hepatitis B virus reverse transcriptase.

PubMed Central

Hu, J; Seeger, C

1996-01-01

The heat shock protein Hsp90 is known as an essential component of several signal transduction pathways and has now been identified as an essential host factor for hepatitis B virus replication. Hsp90 interacts with the viral reverse transcriptase to facilitate the formation of a ribonucleoprotein (RNP) complex between the polymerase and an RNA ligand. This RNP complex is required early in replication for viral assembly and initiation of DNA synthesis through a protein-priming mechanism. These results thus invoke a role for the Hsp90 pathway in the formation of an RNP. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:8577714

Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

Bioinformatic analysis of variability of Newcastle disease virus diagnostic primers and probes and the potential for false negative detection

USDA-ARS?s Scientific Manuscript database

The use of reverse transcriptase polymerase chain reaction (RT-PCR) or other molecular diagnostic methods is commonly used for the primary diagnosis of Newcastle disease virus (NDV). However, NDV in nature has a range of virulence, and the low virulence viruses must be differentiated from virulent ...

Problem-solving test: catalytic activities of a human nuclear enzyme.

PubMed

Szeberényi, József

2011-01-01

Terms to be familiar with before you start to solve the test: ion exchange chromatography, polynucleotides, oligonucleotides, radioactive labeling, template, primer, DNA polymerase, reverse transcriptase, helicase, nucleoside triphosphates, nucleoside diphosphates, nucleoside monophosphates, nucleosides, 5′-end and 3′-end, bacteriophage, polyacrylamide gel electrophoresis, urea, autoradiography, proofreading, telomerase, endonucleases, exonucleases, primase, topoisomerases, and excinuclease.

Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza

USDA-ARS?s Scientific Manuscript database

The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...

Structure of the HIV-1 reverse transcriptase Q151M mutant: insights into the inhibitor resistance of HIV-1 reverse transcriptase and the structure of the nucleotide-binding pocket of Hepatitis B virus polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Akiyoshi; Tamura, Noriko; Yasutake, Yoshiaki, E-mail: y-yasutake@aist.go.jp

The structure of the HIV-1 reverse transcriptase Q151M mutant was determined at a resolution of 2.6 Å in space group P321. Hepatitis B virus polymerase (HBV Pol) is an important target for anti-HBV drug development; however, its low solubility and stability in vitro has hindered detailed structural studies. Certain nucleotide reverse transcriptase (RT) inhibitors (NRTIs) such as tenofovir and lamivudine can inhibit both HBV Pol and Human immunodeficiency virus 1 (HIV-1) RT, leading to speculation on structural and mechanistic analogies between the deoxynucleotide triphosphate (dNTP)-binding sites of these enzymes. The Q151M mutation in HIV-1 RT, located at the dNTP-binding site,more » confers resistance to various NRTIs, while maintaining sensitivity to tenofovir and lamivudine. The residue corresponding to Gln151 is strictly conserved as a methionine in HBV Pol. Therefore, the structure of the dNTP-binding pocket of the HIV-1 RT Q151M mutant may reflect that of HBV Pol. Here, the crystal structure of HIV-1 RT Q151M, determined at 2.6 Å resolution, in a new crystal form with space group P321 is presented. Although the structure of HIV-1 RT Q151M superimposes well onto that of HIV-1 RT in a closed conformation, a slight movement of the β-strands (β2–β3) that partially create the dNTP-binding pocket was observed. This movement might be caused by the introduction of the bulky thioether group of Met151. The structure also highlighted the possibility that the hydrogen-bonding network among amino acids and NRTIs is rearranged by the Q151M mutation, leading to a difference in the affinity of NRTIs for HIV-1 RT and HBV Pol.« less

Improving statistical inference on pathogen densities estimated by quantitative molecular methods: malaria gametocytaemia as a case study.

PubMed

Walker, Martin; Basáñez, María-Gloria; Ouédraogo, André Lin; Hermsen, Cornelus; Bousema, Teun; Churcher, Thomas S

2015-01-16

Quantitative molecular methods (QMMs) such as quantitative real-time polymerase chain reaction (q-PCR), reverse-transcriptase PCR (qRT-PCR) and quantitative nucleic acid sequence-based amplification (QT-NASBA) are increasingly used to estimate pathogen density in a variety of clinical and epidemiological contexts. These methods are often classified as semi-quantitative, yet estimates of reliability or sensitivity are seldom reported. Here, a statistical framework is developed for assessing the reliability (uncertainty) of pathogen densities estimated using QMMs and the associated diagnostic sensitivity. The method is illustrated with quantification of Plasmodium falciparum gametocytaemia by QT-NASBA. The reliability of pathogen (e.g. gametocyte) densities, and the accompanying diagnostic sensitivity, estimated by two contrasting statistical calibration techniques, are compared; a traditional method and a mixed model Bayesian approach. The latter accounts for statistical dependence of QMM assays run under identical laboratory protocols and permits structural modelling of experimental measurements, allowing precision to vary with pathogen density. Traditional calibration cannot account for inter-assay variability arising from imperfect QMMs and generates estimates of pathogen density that have poor reliability, are variable among assays and inaccurately reflect diagnostic sensitivity. The Bayesian mixed model approach assimilates information from replica QMM assays, improving reliability and inter-assay homogeneity, providing an accurate appraisal of quantitative and diagnostic performance. Bayesian mixed model statistical calibration supersedes traditional techniques in the context of QMM-derived estimates of pathogen density, offering the potential to improve substantially the depth and quality of clinical and epidemiological inference for a wide variety of pathogens.

The structure of unliganded reverse transcriptase from the human immunodeficiency virus type 1.

PubMed Central

Rodgers, D W; Gamblin, S J; Harris, B A; Ray, S; Culp, J S; Hellmig, B; Woolf, D J; Debouck, C; Harrison, S C

1995-01-01

The crystal structure of the reverse transcriptase (RT) from the type 1 human immunodeficiency virus has been determined at 3.2-A resolution. Comparison with complexes between RT and the polymerase inhibitor Nevirapine [Kohlstaedt, L.A., Wang, J., Friedman, J.M., Rice, P.A. & Steitz, T.A. (1992) Science 256, 1783-1790] and between RT and an oligonucleotide [Jacobo-Molina, A., Ding, J., Nanni, R., Clark, A. D., Lu, X., Tantillo, C., Williams, R. L., Kamer, G., Ferris, A. L., Clark, P., Hizi, A., Hughes, S. H. & Arnold, E. (1993) Proc. Natl. Acad. Sci. USA 90, 6320-6324] reveals changes associated with ligand binding. The enzyme is a heterodimer (p66/p51), with domains labeled "fingers," "thumb," "palm," and "connection" in both subunits, and a ribonuclease H domain in the larger subunit only. The most striking difference between RT and both complex structures is the change in orientation of the p66 thumb (approximately 33 degrees rotation). Smaller shifts relative to the core of the molecule were also found in other domains, including the p66 fingers and palm, which contain the polymerase active site. Within the polymerase catalytic region itself, there are no rearrangements between RT and the RT/DNA complex. In RT/Nevirapine, the drug binds in the p66 palm near the polymerase active site, a region that is well-packed hydrophobic core in the unliganded enzyme. Room for the drug is provided by movement of a small beta-sheet within the palm domain of the Nevirapine complex. The rearrangement within the palm and thumb, as well as domain shifts relative to the enzyme core, may prevent correct placement of the oligonucleotide substrate when the drug is bound. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7532306

Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction.

PubMed

Elhafi, G; Naylor, C J; Savage, C E; Jones, R C

2004-06-01

A method is described for enabling safe transit of denatured virus samples for polymerase chain reaction (PCR) identification without the risk of unwanted viable viruses. Cotton swabs dipped in avian infectious bronchitis virus (IBV) or avian pneumovirus (APV) were allowed to dry. Newcastle disease virus and avian influenza viruses were used as controls. Autoclaving and microwave treatment for as little as 20 sec destroyed the infectivity of all four viruses. However, both IBV and APV could be detected by reverse transcriptase (RT)-PCR after autoclaving and as long as 5 min microwave treatment (Newcastle disease virus and avian influenza viruses were not tested). Double microwave treatment of IBV and APV with an interval of 2 to 7 days between was tested. After the second treatment, RT-PCR products were readily detected in all samples. Swabs from the tracheas and cloacas of chicks infected with IBV shown to contain infectious virus were microwaved. Swabs from both sources were positive by RT-PCR. Microwave treatment appears to be a satisfactory method of inactivating virus while preserving nucleic acid for PCR identification.

SIRT3 functions as a tumor suppressor in hepatocellular carcinoma.

PubMed

Zeng, Xianchun; Wang, Nanzhu; Zhai, Hui; Wang, Rongpin; Wu, Jiahong; Pu, Wei

2017-03-01

Hepatocellular carcinoma is one of the leading causes for cancer-related mortality worldwide. SIRT3 may function as either oncogene or tumor suppressor in a panel of cancers; however, the role of SIRT3 in hepatocellular carcinoma remains unclear. In this study, we assayed the expression level of SIRT3 in hepatocellular carcinoma tissues by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. A loss-of-function approach was used to examine the effects of SIRT3 on biological activity, including cell proliferative activity and invasive potential. The results demonstrated that the expression levels of SIRT3 protein in hepatocellular carcinoma tissues were significantly downregulated compared with those in adjacent non-cancerous tissues. Furthermore, SIRT3 could decrease cell proliferation and inhibit cell migration/invasion in hepatocellular carcinoma cell line. Taken together, these results elucidated the function of SIRT3 in hepatocellular carcinoma development and suggested that SIRT3 might function as tumor suppressor in hepatocellular carcinoma by targeting PI3K/Akt pathway.

Advances in Developing HIV-1 Viral Load Assays for Resource-Limited Settings

PubMed Central

Wang, ShuQi; Xu, Feng; Demirci, Utkan

2010-01-01

Commercial HIV-1 RNA viral load assays have been routinely used in developed countries to monitor antiretroviral treatment (ART). However, these assays require expensive equipment and reagents, well-trained operators, and established laboratory infrastructure. These requirements restrict their use in resource-limited settings where people are most afflicted with the HIV-1 epidemic. Inexpensive alternatives such as the Ultrasensitive p24 assay, the Reverse Transcriptase (RT) assay and in-house reverse transcription quantitative polymerase chain reaction (RT-qPCR) have been developed. However, they are still time-consuming, technologically complex and inappropriate for decentralized laboratories as point-of-care (POC) tests. Recent advances in microfluidics and nanotechnology offer new strategies to develop low-cost, rapid, robust and simple HIV-1 viral load monitoring systems. We review state-of-the-art technologies used for HIV-1 viral load monitoring in both developed and developing settings. Emerging approaches based on microfluidics and nanotechnology, which have potential to be integrated into POC HIV-1 viral load assays, are also discussed. PMID:20600784

Gene expression in the rectus abdominus muscle of patients with and without pelvic organ prolapse.

PubMed

Hundley, Andrew F; Yuan, Lingwen; Visco, Anthony G

2008-02-01

The objective of the study was to compare gene expression in a group of actin and myosin-related proteins in the rectus muscle of 15 patients with pelvic organ prolapse and 13 controls. Six genes previously identified by microarray GeneChip analysis were examined using real-time quantitative reverse transcriptase-polymerase chain reaction analysis, including 2 genes showing differential expression in pubococcygeus muscle. Samples and controls were run in triplicate in multiplexed wells, and levels of gene expression were analyzed using the comparative critical threshold method. One gene, MYH3, was 3.2 times overexpressed in patients with prolapse (P = .032), but no significant differences in expression were seen for the other genes examined. An age-matched subset of 9 patients and controls showed that MYH3 gene expression was no longer significantly different (P = .058). Differential messenger ribonucleic acid levels of actin and myosin-related genes in patients with pelvic organ prolapse and controls may be limited to skeletal muscle from the pelvic floor.

Chronic myelogenous leukemia: laboratory diagnosis and monitoring.

PubMed

Wang, Y L; Bagg, A; Pear, W; Nowell, P C; Hess, J L

2001-10-01

Rapid developments have occurred both in laboratory medicine and in therapeutic interventions for the management of patients with chronic myelogenous leukemia (CML). With a wide array of laboratory tests available, selecting the appropriate test for a specific diagnostic or therapeutic setting has become increasingly difficult. In this review, we first discuss, from the point of view of laboratory medicine, the advantages and disadvantages of several commonly used laboratory assays, including cytogenetics, fluorescence in situ hybridization (FISH), and qualitative and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We then discuss, from the point of view of clinical care, the test(s) of choice for the most common clinical scenarios, including diagnosis and monitoring of the therapeutic response and minimal residual disease in patients treated with different therapies. The purpose of this review is to help clinicians and laboratory physicians select appropriate tests for the diagnosis and monitoring of CML, with the ultimate goal of improving the cost-effective usage of clinical laboratories and improving patient care. Copyright 2001 Wiley-Liss, Inc.

A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

2009-01-01

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

Pinhole Micro-SPECT/CT for Noninvasive Monitoring and Quantitation of Oncolytic Virus Dispersion and Percent Infection in Solid Tumors

PubMed Central

Penheiter, Alan R.; Griesmann, Guy E.; Federspiel, Mark J.; Dingli, David; Russell, Stephen J.; Carlson, Stephanie K.

2011-01-01

The purpose of our study was to validate the ability of pinhole micro-single-photon emission computed tomography/computed tomography (SPECT/CT) to 1) accurately resolve the intratumoral dispersion pattern and 2) quantify the infection percentage in solid tumors of an oncolytic measles virus encoding the human sodium iodide symporter (MV-NIS). NIS RNA level and dispersion pattern were determined in control and MV-NIS infected BxPC-3 pancreatic tumor cells and mouse xenografts using quantitative, real-time, reverse transcriptase, polymerase chain reaction, autoradiography, and immunohistochemistry (IHC). Mice with BxPC-3 xenografts were imaged with 123I or 99TcO4 micro-SPECT/CT. Tumor dimensions and radionuclide localization were determined with imaging software. Linear regression and correlation analyses were performed to determine the relationship between tumor infection percentage and radionuclide uptake (% injected dose per gram) above background and a highly significant correlation was observed (r2 = 0.947). A detection threshold of 1.5-fold above the control tumor uptake (background) yielded a sensitivity of 2.7% MV-NIS infected tumor cells. We reliably resolved multiple distinct intratumoral zones of infection from noninfected regions. Pinhole micro-SPECT/CT imaging using the NIS reporter demonstrated precise localization and quantitation of oncolytic MV-NIS infection and can replace more time-consuming and expensive analyses (eg, autoradiography and IHC) that require animal sacrifice. PMID:21753796

Assessment Effects of Resveratrol on Human Telomerase Reverse Transcriptase Messenger Ribonucleic Acid Transcript in Human Glioblastoma

PubMed Central

Mirzazadeh, Azin; Kheirollahi, Majid; Farashahi, Ehsan; Sadeghian-Nodoushan, Fatemeh; Sheikhha, Mohammad Hasan; Aflatoonian, Behrouz

2017-01-01

Background: Glioblastoma (GBM) is the most common and aggressive brain tumor, which has a poor prognosis despite the advent of different therapeutic strategies. There are numerous molecular biomarkers to contribute diagnosis, prognosis, and prediction of response to the current therapy in GBM. One of the most important markers that are potentially valuable is immortalization-specific or immortalization-associated marker named “hTERT messenger ribonucleic acid (mRNA)” the key subunit of telomerase enzyme, which is expressed in more than 85% of cancer cells, in spite of the majority of normal somatic cells. In this study, we investigated the effects of resveratrol (RSV) on this mRNA marker level, leading to cancer progression. Materials and Methods: U-87MG cell line was obtained from Pasteur Institute of Iran and treated with various concentrations of 0–160 μg/mL of RSV and at different time points (24, 48, and 72 h). To evaluate viability of U-87MG cells, standard 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed. Real-time polymerase chain reaction (RT-PCR) was used for comparative and quantitative assessment of human telomerase reverse transcriptase (hTERT) mRNA copy number versus control–untreated group. Results: The results of our investigation suggested that RSV effectively inhibited cell growth and caused cell death in dose-dependent (P < 0.05) and not in time-dependent manner (P > 0.05), in vitro. Interestingly, quantitative RT-PCR analysis demonstrated that at half inhibition concentration, RSV dramatically decreased mRNA expression of hTERT, the catalytic subunit of telomerase enzyme, which leads to prevention of cell division and tumor progression. Conclusion: With regard to downregulation of this immortalization-associated marker, RSV may potentially be used as a therapeutic agent against GBM. PMID:28706881

Clinical comparison of branched DNA and reverse transcriptase-PCR and nucleic acid sequence-based amplification assay for the quantitation of circulating recombinant form_BC HIV-1 RNA in plasma.

PubMed

Pan, Pinliang; Tao, Xiaoxia; Zhang, Qi; Xing, Wenge; Sun, Xianguang; Pei, Lijian; Jiang, Yan

2007-12-01

To investigate the correlation between three viral load assays for circulating recombinant form (CRF)_BC. Recent studies in HIV-1 molecular epidemiology, reveals that CRF_BC is the dominant subtype of HIV-1 virus in mainland China, representing over 45% of the HIV-1 infected population. The performances of nucleic acid sequence-based amplification (NASBA), branched DNA (bDNA) and reverse transcriptase polymerase chain reaction (RT-PCR) were compared for the HIV-1 viral load detection and quantitation of CRF_BC in China. Sixteen HIV-1 positive and three HIV-1 negative samples were collected. Sequencing of the positive samples in the gp41 region was conducted. The HIV-1 viral load values were determined using bDNA, RT-PCR and NASBA assays. Deming regression analysis with SPSS 12.0 (SPS Inc., Chicago, Illinois, USA) was performed for data analysis. Sequencing and phylogenetic analysis of env gene (gp41) region of the 16 HIV-1 positive clinical specimens from Guizhou Province in southwest China revealed the dominance of the subtype CRF_BC in that region. A good correlation of their viral load values was observed among three assays. Pearson's correlation between RT-PCR and bDNA is 0.969, Lg(VL)RT-PCR = 0.969 * Lg(VL)bDNA + 0.55; Pearson's correlation between RT-PCR and NASBA is 0.968, Lg(VL)RT-PCR = 0.968 * Lg(VL)NASBA + 0.937; Pearson's correlation between NASBA and bDNA is 0.980, Lg(VL)NASBA = 0.980 * Lg(VL)bDNA - 0.318. When testing with 3 different assays, RT-PCR, bDNA and NASBA, the group of 16 HIV-1 positive samples showed the viral load value was highest for RT-PCR, followed by bDNA then NASBA, which is consistent with the former results in subtype B. The three viral load assays are highly correlative for CRF_BC in China.

Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

PubMed

Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

2011-12-01

High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

PubMed

Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

2015-10-01

The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative <10.7, equivocal 10.7 to <11.5, and positive ≥11.5 log2 expression units). Cox regression was used to assess the association of HER2 expression with trastuzumab benefit in preventing distant recurrence. Median follow-up was 7.4 years. Of 1,940 total patients, 901 had consent and sufficient tissue. HER2 by reverse transcriptase polymerase chain reaction (RT-PCR) was negative in 130 (14 %), equivocal in 85 (9 %), and positive in 686 (76 %) patients. Concordance between HER2 assessments was 95 % for RT-PCR versus central immunohistochemistry (IHC) (>10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

Hepatotoxicity of nucleoside reverse transcriptase inhibitors.

PubMed

Montessori, Valentina; Harris, Marianne; Montaner, Julio S G

2003-05-01

Hepatotoxicity is an adverse effect of all available classes of antiretrovirals, including nucleoside reverse transcriptase inhibitors (NRTI). A syndrome of hepatic steatosis and lactic acidosis has been recognized as a rare, potentially fatal complication since the advent of NRTI monotherapy in the early 1990s. Today, NRTI remain the backbone of antiretroviral combination regimens, and, with the success of current treatment strategies, exposure to two or more of these agents may occur over a number of years. Hepatic steatosis and lactic acidosis are accordingly being observed more frequently, along with a more recently recognized syndrome of chronic hyperlactatemia. These as well as other adverse effects of NRTI are mediated by inhibition of human DNA polymerase gamma, resulting in mitochondrial dysfunction in the liver and other tissues. Early recognition and intervention are essential to avert serious outcomes.

West Nile virus in overwintering Culex mosquitoes, New York City, 2000.

PubMed Central

Nasci, R. S.; Savage, H. M.; White, D. J.; Miller, J. R.; Cropp, B. C.; Godsey, M. S.; Kerst, A. J.; Bennett, P.; Gottfried, K.; Lanciotti, R. S.

2001-01-01

After the 1999 West Nile (WN) encephalitis outbreak in New York, 2,300 overwintering adult mosquitoes were tested for WN virus by cell culture and reverse transcriptase-polymerase chain reaction. WN viral RNA and live virus were found in pools of Culex mosquitoes. Persistence in overwintering Cx. pipiens may be important in the maintenance of WN virus in the northeastern United States. PMID:11585542

Capsicum annum, a new host of watermelon mosaic virus.

PubMed

Hajizadeh, Mohammad; Mohammadi, Kazhal

2016-03-01

The occurrence of Watermelon mosaic virus (WMV) in sweet pepper (Capsicum annuum L.) in Kurdistan province, Iran was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and partial characterization of coat protein. To the best of our knowledge, this is the first report of WMV infecting C. annuum, adding a new host to list of more than 170 species infected by this virus.

Validation of Reference Genes for Real-Time Quantitative PCR (qPCR) Analysis of Avibacterium paragallinarum.

PubMed

Wen, Shuxiang; Chen, Xiaoling; Xu, Fuzhou; Sun, Huiling

2016-01-01

Real-time quantitative reverse transcription PCR (qRT-PCR) offers a robust method for measurement of gene expression levels. Selection of reliable reference gene(s) for gene expression study is conducive to reduce variations derived from different amounts of RNA and cDNA, the efficiency of the reverse transcriptase or polymerase enzymes. Until now reference genes identified for other members of the family Pasteurellaceae have not been validated for Avibacterium paragallinarum. The aim of this study was to validate nine reference genes of serovars A, B, and C strains of A. paragallinarum in different growth phase by qRT-PCR. Three of the most widely used statistical algorithms, geNorm, NormFinder and ΔCT method were used to evaluate the expression stability of reference genes. Data analyzed by overall rankings showed that in exponential and stationary phase of serovar A, the most stable reference genes were gyrA and atpD respectively; in exponential and stationary phase of serovar B, the most stable reference genes were atpD and recN respectively; in exponential and stationary phase of serovar C, the most stable reference genes were rpoB and recN respectively. This study provides recommendations for stable endogenous control genes for use in further studies involving measurement of gene expression levels.

From Cells to Virus Particles: Quantitative Methods to Monitor RNA Packaging

PubMed Central

Ferrer, Mireia; Henriet, Simon; Chamontin, Célia; Lainé, Sébastien; Mougel, Marylène

2016-01-01

In cells, positive strand RNA viruses, such as Retroviridae, must selectively recognize their full-length RNA genome among abundant cellular RNAs to assemble and release particles. How viruses coordinate the intracellular trafficking of both RNA and protein components to the assembly sites of infectious particles at the cell surface remains a long-standing question. The mechanisms ensuring packaging of genomic RNA are essential for viral infectivity. Since RNA packaging impacts on several essential functions of retroviral replication such as RNA dimerization, translation and recombination events, there are many studies that require the determination of RNA packaging efficiency and/or RNA packaging ability. Studies of RNA encapsidation rely upon techniques for the identification and quantification of RNA species packaged by the virus. This review focuses on the different approaches available to monitor RNA packaging: Northern blot analysis, ribonuclease protection assay and quantitative reverse transcriptase-coupled polymerase chain reaction as well as the most recent RNA imaging and sequencing technologies. Advantages, disadvantages and limitations of these approaches will be discussed in order to help the investigator to choose the most appropriate technique. Although the review was written with the prototypic simple murine leukemia virus (MLV) and complex human immunodeficiency virus type 1 (HIV-1) in mind, the techniques were described in order to benefit to a larger community. PMID:27556480

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Telomerase and its extracurricular activities.

PubMed

Jaiswal, Rishi Kumar; Kumar, Pramod; Yadava, Pramod Kumar

2013-12-01

The classical activity of telomerase is to synthesize telomeric repeats and thus maintain telomere length, which in turn ensures chromosome stability and cellular proliferation. However, there is growing evidence that implicates telomerase in many other functions that are independent of TERC being used as its template. Telomerase has an RNA-dependent RNA polymerase (RdRP) activity in the mitochondria. Other than viral RdRPs, it is the only RNA-dependent RNA polymerase that has been identified in mammals. It also plays a role in the Wnt signaling pathway by acting as a transcriptional modulator. Telomerase acts as a reverse transcriptase independent of its core subunit, TERC. Studies indicate that telomerase is also involved in apoptosis and DNA repair.

Performance of the Directigen EZ Flu A+B rapid influenza diagnostic test to detect pandemic influenza A/H1N1 2009.

PubMed

Boyanton, Bobby L; Almradi, Amro; Mehta, Tejal; Robinson-Dunn, Barbara

2014-04-01

The Directigen EZ Flu A+B rapid influenza diagnostic test, as compared to real-time reverse transcriptase polymerase chain reaction, demonstrated suboptimal performance to detect pandemic influenza A/H1N1 2009. Age- and viral load-stratified test sensitivity ranged from 33.3 to 84.6% and 0 to 100%, respectively. © 2013.

Possible Application of Biotechnology to the Development of Biological Agents by Potential Enemies

DTIC Science & Technology

1987-06-01

of enzyme catalyzed reactions. Although cloning techniques are directly applicable to the manipulation of proteinaceous toxins, they would be less...useful for nonproteinaceous toxins because the corresponding gene for each enzyme must be cloned and expressed in a coordinated manner. Effective...to produce a synthetic DNA. The enzyme reverse transcriptase (RNA dependent DNA polymerase), which is obtained from retroviruses, is the only enzyme

Approved Antiviral Drugs over the Past 50 Years

PubMed Central

2016-01-01

SUMMARY Since the first antiviral drug, idoxuridine, was approved in 1963, 90 antiviral drugs categorized into 13 functional groups have been formally approved for the treatment of the following 9 human infectious diseases: (i) HIV infections (protease inhibitors, integrase inhibitors, entry inhibitors, nucleoside reverse transcriptase inhibitors, nonnucleoside reverse transcriptase inhibitors, and acyclic nucleoside phosphonate analogues), (ii) hepatitis B virus (HBV) infections (lamivudine, interferons, nucleoside analogues, and acyclic nucleoside phosphonate analogues), (iii) hepatitis C virus (HCV) infections (ribavirin, interferons, NS3/4A protease inhibitors, NS5A inhibitors, and NS5B polymerase inhibitors), (iv) herpesvirus infections (5-substituted 2′-deoxyuridine analogues, entry inhibitors, nucleoside analogues, pyrophosphate analogues, and acyclic guanosine analogues), (v) influenza virus infections (ribavirin, matrix 2 protein inhibitors, RNA polymerase inhibitors, and neuraminidase inhibitors), (vi) human cytomegalovirus infections (acyclic guanosine analogues, acyclic nucleoside phosphonate analogues, pyrophosphate analogues, and oligonucleotides), (vii) varicella-zoster virus infections (acyclic guanosine analogues, nucleoside analogues, 5-substituted 2′-deoxyuridine analogues, and antibodies), (viii) respiratory syncytial virus infections (ribavirin and antibodies), and (ix) external anogenital warts caused by human papillomavirus infections (imiquimod, sinecatechins, and podofilox). Here, we present for the first time a comprehensive overview of antiviral drugs approved over the past 50 years, shedding light on the development of effective antiviral treatments against current and emerging infectious diseases worldwide. PMID:27281742

Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

PubMed

Amendola, R

1994-11-01

The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

PubMed

Spackman, Erica; Suarez, David L

2005-01-01

Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

The Role of eIF4E Activity in Breast Cancer

DTIC Science & Technology

2010-08-01

ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less product...have previously shown that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem

copia-like retrotransposons are ubiquitous among plants.

PubMed Central

Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

1992-01-01

Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

The Role of elF4E Activity in Breast Cancer

DTIC Science & Technology

2011-08-01

protein; ORF, open reading frame; qPCR, quantitative PCR; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase ; uORF, upstream ORF; UTR...Reactions were also performed using template lacking RT ( reverse transcriptase ): products were either undetectable or greatly reduced (>30000-fold less...that a 5’UTR expressed from the human AXIN2 gene contains a sixty nucleotide sequence that is predicted to form a stable stem-loop structure6. This

A Transient Kinetic Approach to Investigate Nucleoside Inhibitors of Mitochondrial DNA polymerase γ

PubMed Central

Anderson, Karen S.

2010-01-01

Nucleoside analogs play an essential role in treating human immunodeficiency virus (HIV) infection since the beginning of the AIDS epidemic and work by inhibition of HIV-1 reverse transcriptase (RT), a viral polymerase essential for DNA replication. Today, over 90% of all regimens for HIV treatment contain at least one nucleoside. Long-term use of nucleoside analogs has been associated with adverse effects including mitochondrial toxicity due to inhibition of the mitochondrial polymerase, DNA polymerase gamma (mtDNA pol ©). In this review, we describe our efforts to delineate the molecular mechanism of nucleoside inhibition of HIV-1 RT and mtDNA pol © based upon a transient kinetic approach using rapid chemical quench methodology. Using transient kinetic methods, the maximum rate of polymerization (kpol), the dissociation constant for the ground state binding (Kd), and the incorporation efficiency (kpol/Kd) can be determined for the nucleoside analogs and their natural substrates. This analysis allowed us to develop an understanding of the structure activity relationships that allow correlation between the structural and stereochemical features of the nucleoside analog drugs with their mechanistic behavior toward the viral polymerase, RT, and the host cell polymerase, mtDNA pol γ. An in-depth understanding of the mechanisms of inhibition of these enzymes is imperative in overcoming problems associated with toxicity. PMID:20573564

Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

PubMed

Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

2010-04-01

Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

Role of chicken astrovirus as a causative agent of gout in commercial broilers in India.

PubMed

Bulbule, N R; Mandakhalikar, K D; Kapgate, S S; Deshmukh, V V; Schat, K A; Chawak, M M

2013-01-01

Several outbreaks of gout were reported in commercial broilers in India during 2011 and 2012, causing up to 40% mortality in the birds. Gross and histopathological observations confirmed gout. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis from kidney samples of gout-affected birds indicated the presence of chicken astrovirus (CAstV) in 41.7% of cases and a mixed infection of CAstV and avian nephritis virus (ANV) in 36.4% of cases. CAstV isolated from gout-affected kidneys by inoculating embryonated specific pathogen free (SPF) eggs showed dwarfing in embryos and a cytopathic effect in chicken embryo kidney cells. Inoculation of 1-day-old SPF and broiler chicks with CAstVs caused gout and mortality between 4 and 10 days post inoculation. Virus isolation and qRT-PCR analysis showed the presence of only CAstV in inoculated chicks. Sequence analysis of capsid genes indicated a major group of Indian CAstVs that displayed 92.0 to 99.2% intergroup amino acid identity and 83.9 to 90.4% identity with subgroup Bi CAstVs of UK origin. We designated this group Indian Bi. Analysis of the partial polymerase amino acid sequences of our isolates indicated two groups of CAstVs (Indian 1 and 2) that displayed 90.2 to 95.5% amino acid identity between them. We thus report for the first time that, in addition to infectious bronchitis virus and ANV, CAstVs are a causative agent of gout.

A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

PubMed

Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

2015-03-01

A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

PubMed

Jiang, Z; Gui, S; Zhang, Y

2011-05-01

Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

Molecular cloning and expression profile analysis of porcine TCAP gene.

PubMed

Cheng, Hunjun; Xu, Xuewen; Zhao, Shuhong; Liu, Bang; Yu, Mei; Fan, Bin

2010-03-01

The gradually discovered sarcomeric proteins play important roles for structural integrity and signal transduction of sarcomere during myofibril genesis. TCAP (also described as telethonin, T-cap), one of the sarcomeric protein genes, is regulated developmentally. In this study, we reported the molecular characteristics of porcine TCAP gene. A 979 bp TCAP cDNA nucleotide sequence was obtained in pig and the deduced amino acid sequence had 92 and 91% identity to those of human and mouse homologous genes, respectively. One SNP was discovered and the allele frequency analysis showed that G allele frequency was low among 221 unrelated pigs from seven breeds. The tissue distribution patterns revealed that TCAP mRNA was expressed abundantly in skeletal and heart muscle tissue. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) results displayed TCAP mRNA was up-regulated in both Tongcheng and Landrace pigs during prenatal skeletal muscle development stages. This study suggested that TCAP gene might be a prospective candidate gene affecting muscle mass and meat quality traits in the pig, and also implicated the possible significance of TCAP on sarcomere assembly.

Garlic (Allium sativum) stimulates lipopolysaccharide-induced tumor necrosis factor-alpha production from J774A.1 murine macrophages.

PubMed

Sung, Jessica; Harfouche, Youssef; De La Cruz, Melissa; Zamora, Martha P; Liu, Yan; Rego, James A; Buckley, Nancy E

2015-02-01

Garlic (Allium sativum) is known to have many beneficial attributes such as antimicrobial, antiatherosclerotic, antitumorigenetic, and immunomodulatory properties. In the present study, we investigated the effects of an aqueous garlic extract on macrophage cytokine production by challenging the macrophage J774A.1 cell line with the garlic extract in the absence or presence of lipopolysaccharide (LPS) under different conditions. The effect of allicin, the major component of crushed garlic, was also investigated. Using enzyme-linked immunosorbent assay and reverse transcriptase-quantitative polymerase chain reaction, it was found that garlic and synthetic allicin greatly stimulated tumor necrosis factor-alpha (TNF-α) production in macrophages treated with LPS. The TNF-α secretion levels peaked earlier and were sustained for a longer time in cells treated with garlic and LPS compared with cells treated with LPS alone. Garlic acted in a time-dependent manner. We suggest that garlic, at least partially via its allicin component, acts downstream from LPS to stimulate macrophage TNF-α secretion. © 2014 The Authors. Phytotherapy Research published by John Wiley & Sons, Ltd.

MAEWEST expression in flower development of two petunia species.

PubMed

Segatto, Ana Lúcia A; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B; Monte-Bello, Carolina C; Dornelas, Marcelo C; Margis, Rogerio; Freitas, Loreta B

2013-07-03

Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription-quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.

PubMed

Miri-Moghaddam, E; Deezagi, A; Soheili, Z S

2009-12-01

Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.

Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

PubMed

Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

2016-10-01

Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

The citrus flavonone hesperetin attenuates the nuclear translocation of aryl hydrocarbon receptor.

PubMed

Tan, Yan Qin; Chiu-Leung, Leo Clement; Lin, Shu-Mei; Leung, Lai K

2018-08-01

The environmental polycyclic aromatic hydrocarbons (PAH) and dioxins are carcinogens and their adverse effects have been largely attributed to the activation of AhR. Hesperetin is a flavonone found abundantly in citrus fruits and has been shown to be a biologically active agent. In the present study, the effect of hesperetin on the nuclear translocation of AhR and the downstream gene expression was investigated in MCF-7 cells. Confocal microscopy indicated that 7, 12-dimethylbenz[α]anthracene (DMBA) or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) -induced nuclear translocation of AhR was deterred by hesperetin treatment. The reduced nuclear translocation could also be observed in Western analysis. Reporter-gene assay further illustrated that the induced XRE transactivation was weakened by the treatment of hesperetin. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay demonstrated that the gene expressions of CYP1A1, 1A2, and 1B1 followed the same pattern of AhR translocation. These results suggested that hesperetin counteracted AhR transactivation and suppressed the downstream gene expression. Copyright © 2018 Elsevier Inc. All rights reserved.

An immortalized goat mammary epithelial cell line induced with human telomerase reverse transcriptase (hTERT) gene transfer.

PubMed

He, Y L; Wu, Y H; He, X N; Liu, F J; He, X Y; Zhang, Y

2009-06-01

Although mammary epithelial cell lines can provide a rapid and reliable indicator of gene expression efficiency of transgenic animals, their short lifespan greatly limits this application. To provide stable and long lifespan cells, goat mammary epithelial cells (GMECs) were transduced with pLNCX2-hTERT by retrovirus-mediated gene transfer. Transduced GMECs were evaluated by reverse transcriptase polymerase chain reaction (RT-PCR), proliferation assays, karyotype analysis, telomerase activity assay, western blotting, soft agar assay, and injection into nude mice. Non-transduced GMECs were used as a control. The hTERT-GMECs had higher telomerase activity and extended proliferative lifespan compared to non-transfected GMECs; even after Passage 50, hTERT-GMECs had a near diploid complement of chromosomes. Furthermore, they did not gain the anchorage-independent growth property and were not associated with a malignant phenotype in vitro or in vivo.

Telomerase Mechanism of Telomere Synthesis

PubMed Central

Wu, R. Alex; Upton, Heather E.; Vogan, Jacob M.; Collins, Kathleen

2017-01-01

Telomerase is the essential reverse transcriptase required for linear chromosome maintenance in most eukaryotes. Telomerase supplements the tandem array of simple-sequence repeats at chromosome ends to compensate for the DNA erosion inherent in genome replication. The template for telomerase reverse transcriptase is within the RNA subunit of the ribonucleoprotein complex, which in cells contains additional telomerase holoenzyme proteins that assemble the active ribonucleoprotein and promote its function at telomeres. Telomerase is distinct among polymerases in its reiterative reuse of an internal template. The template is precisely defined, processively copied, and regenerated by release of single-stranded product DNA. New specificities of nucleic acid handling that underlie the catalytic cycle of repeat synthesis derive from both active site specialization and new motif elaborations in protein and RNA subunits. Studies of telomerase provide unique insights into cellular requirements for genome stability, tissue renewal, and tumorigenesis as well as new perspectives on dynamic ribonucleoprotein machines. PMID:28141967

Human telomerase reverse transcriptase is a promising target for cancer inhibition in squamous cell carcinomas.

PubMed

Park, Young-Jin; Kim, Eun-Kyoung; Moon, Sook; Hong, Doo-Pyo; Bae, Jung Yoon; Kim, Jin

2014-11-01

The present study aimed to investigate whether the down-regulation of human telomerase reverse transcriptase (hTERT) may induce an anti-invasive effect in oral squamous cell cancer cell lines. A genetically-engineered squamous carcinoma cell line overexpressing hTERT in immortalized oral keratinocytes transfected by human papilloma virus (HPV)-16 E6/E7 (IHOK) was used. In vivo tumorigenicity was examined using an orthotopic xenograft model of nude mice. For evaluating anti-invasive activity by knockdown of hTERT expression, transwell invasion assay and real-time polymerase chain reaction (PCR) for matrix metalloproteinases (MMP) were employed. The down-regulation of hTERT expression reduced the invasive activity and MMP expression. This result was re-confirmed in the HSC3 oral squamous carcinoma cell line. Targeting hTERT may lead to novel therapeutic approaches. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation.

PubMed

Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H; Yang, Rui; Killela, Patrick J; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Liang, Junbo; Wang, Sizhen; Jiao, Yuchen; Yan, Hai; Tao, Hou-Quan

2015-05-01

Several somatic mutation hotspots were recently identified in the telomerase reverse transcriptase (TERT) promoter region in human cancers. Large scale studies of these mutations in multiple tumour types are limited, in particular in Asian populations. This study aimed to: analyse TERT promoter mutations in multiple tumour types in a large Chinese patient cohort, investigate novel tumour types and assess the functional significance of the mutations. TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumour types and 799 tumour tissues from Chinese cancer patients. Thymic epithelial tumours, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR), telomerase activity by the telomeric repeat amplification protocol (TRAP) assay and promoter activity by the luciferase reporter assay. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

Distemper outbreak and its effect on African wild dog conservation.

PubMed

van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E

2002-02-01

In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

Determination of Clinical and Demographic Predictors of Laboratory-confirmed Influenza with Subtype Analysis

DTIC Science & Technology

2012-06-07

Advisory Committee on Immunization Practicies (ACIP). vol. 57th edition. Atlanta, GA: MMWR; 2008:1–59. 3. Cox NJ, Subbarao K : Influenza. Lancet 1999...to April 2008. Reverse-transcriptase polymerase chain reaction testing and viral culture for influenza A and B with subtyping were performed on all...REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 RESEARCH

Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

PubMed

Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

2018-04-01

Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

Disappearance of AML1-MTG8 transcript by reverse transcriptase polymerase chain reaction in a patient in remission of acute myeloid leukemia (M2) after low-dose cytosine arabinoside.

PubMed

Sawada, H; Serino, Y; Wake, A; Yamasaki, Y; Izumi, Y

1998-09-01

It is well-known that low dose cytosine arabinoside (LDAC) has activity in elderly patients with acute myeloid leukemia (AML). Several studies have shown that AML patients with t(8;21) in long term complete remission (CR) following intensive chemotherapy or allogeneic bone marrow transplantation (BMT) still have persistence of AML1-MTG8 transcripts by reverse transcriptase polymerase chain reaction (RT-PCR) method. We report here a patient who has no evidence of residual disease detectable by RT-PCR after LDAC. A 69-year-old patient did not obtain CR after two courses of intensive chemotherapy with behenoyl-ara-C, daunorubicin, 6-mercaptopurine and prednisolone. He received subcutaneous LDAC 10 mg every 12 h and granulocyte colony-stimulating factor (G-CSF) for 29 days and achieved CR. He continued on a 21 to 28-day course of LDAC without G-CSF every 2 or 3 months and has remained well and in CR for 5 years without chimeric AMLI-MTG8 transcript by RT-PCR. LDAC therapy seems to be effective in eradicating the leukemic clone as post-induction or maintenance therapy in this patient. This is the first case report of the disappearance of AML1-MTG8 transcript by RT-PCR in a patient with t(8;21) in long-term remission after LDAC.

Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors

PubMed Central

Kodama, Hiroaki; Hirotani, Takashi; Suzuki, Yusuke; Ogawa, Satoshi; Yamazaki, Kazuto

2002-01-01

We investigated five cases of cardiac myxoma and one case of cardiac undifferentiated sarcoma by light and electron microscopy, in situ hybridization, immunohistochemical staining, and reverse transcriptase-polymerase chain reaction for cardiomyocyte-specific transcription factors, Nkx2.5/Csx, GATA-4, MEF2, and eHAND. Conventional light microscopy revealed that cardiac myxoma and sarcoma cells presented variable cellular arrangements and different histological characteristics. Ultrastructurally, some of the myxoma cells exhibited endothelium-like or immature mesenchymal cell differentiation. Immunohistochemistry for Nkx2.5/Csx, GATA-4, and eHAND was slightly to intensely positive in all myxoma cases. MEF2 immunoreactivity was observed in all cases including the case of sarcoma, thus suggesting myogenic differentiation of myxoma or sarcoma cells. In situ hybridization for Nkx2.5/Csx also revealed that all myxoma cells, but not sarcoma cells, expressed mRNA of the cardiac homeobox gene, Nkx2.5/Csx. Furthermore, nested reverse transcriptase-polymerase chain reaction from formalin-fixed, paraffin-embedded tissue was performed and demonstrated that the Nkx2.5/Csx and eHAND gene product to be detected in all cases, and in three of six cases, respectively. In conclusion, cardiac myxoma cells were found to express various amounts of cardiomyocyte-specific transcription factor gene products at the mRNA and protein levels, thus suggesting cardiomyogenic differentiation. These results support the concept that cardiac myxoma might arise from mesenchymal cardiomyocyte progenitor cells. PMID:12163362

Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

PubMed

Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

2017-04-01

Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

Ferrate oxidation of murine leukemia virus reverse transcriptase: identification of the template-primer binding domain.

PubMed

Reddy, G; Nanduri, V B; Basu, A; Modak, M J

1991-08-20

Treatment of murine leukemia virus reverse transcriptase (MuLV RT) with potassium ferrate, an oxidizing agent known to oxidize amino acids involved in phosphate binding domains of proteins, results in the irreversible inactivation of both the DNA polymerase and the RNase H activities. Significant protection from ferrate-mediated inactivation is observed in the presence of template-primer but not in the presence of substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme loses template-primer binding activity as judged by UV-mediated cross-linking of radiolabeled DNA. Comparative tryptic peptide mapping by reverse-phase HPLC of native and ferrate-oxidized enzyme indicated the presence of two new peptides eluting at 38 and 57 min and a significant loss of a peptide eluting at 74 min. Purification, amino acid composition, and sequencing of these affected peptides revealed that they correspond to amino acid residues 285-295, 630-640, and 586-599, respectively, in the primary amino acid sequence of MuLV RT. These results indicate that the domains constituted by the above peptides are important for the template-primer binding function in MuLV RT. Peptide I is located in the polymerase domain whereas peptides II and III are located in the RNase H domain. Amino acid sequence analysis of peptides I and II suggested Lys-285 and Cys-635 as the probable sites of ferrate action.

Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

PubMed

Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

2010-10-01

The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT-PCR using Oncotype DX for HER2 status, and the assay warrants additional study in a trastuzumab-treated population.

Evidence of cardiac involvement in the fetal inflammatory response syndrome: disruption of gene networks programming cardiac development in nonhuman primates.

PubMed

Mitchell, Timothy; MacDonald, James W; Srinouanpranchanh, Sengkeo; Bammler, Theodor K; Merillat, Sean; Boldenow, Erica; Coleman, Michelle; Agnew, Kathy; Baldessari, Audrey; Stencel-Baerenwald, Jennifer E; Tisoncik-Go, Jennifer; Green, Richard R; Gale, Michael J; Rajagopal, Lakshmi; Adams Waldorf, Kristina M

2018-04-01

Most early preterm births are associated with intraamniotic infection and inflammation, which can lead to systemic inflammation in the fetus. The fetal inflammatory response syndrome describes elevations in the fetal interleukin-6 level, which is a marker for inflammation and fetal organ injury. An understanding of the effects of inflammation on fetal cardiac development may lead to insight into the fetal origins of adult cardiovascular disease. The purpose of this study was to determine whether the fetal inflammatory response syndrome is associated with disruptions in gene networks that program fetal cardiac development. We obtained fetal cardiac tissue after necropsy from a well-described pregnant nonhuman primate model (pigtail macaque, Macaca nemestrina) of intrauterine infection (n=5) and controls (n=5). Cases with the fetal inflammatory response syndrome (fetal plasma interleukin-6 >11 pg/mL) were induced by either choriodecidual inoculation of a hypervirulent group B streptococcus strain (n=4) or intraamniotic inoculation of Escherichia coli (n=1). RNA and protein were extracted from fetal hearts and profiled by microarray and Luminex (Millipore, Billerica, MA) for cytokine analysis, respectively. Results were validated by quantitative reverse transcriptase polymerase chain reaction. Statistical and bioinformatics analyses included single gene analysis, gene set analysis, Ingenuity Pathway Analysis (Qiagen, Valencia, CA), and Wilcoxon rank sum. Severe fetal inflammation developed in the context of intraamniotic infection and a disseminated bacterial infection in the fetus. Interleukin-6 and -8 in fetal cardiac tissues were elevated significantly in fetal inflammatory response syndrome cases vs controls (P<.05). A total of 609 probe sets were expressed differentially (>1.5-fold change, P<.05) in the fetal heart (analysis of variance). Altered expression of select genes was validated by quantitative reverse transcriptase polymerase chain reaction that included several with known functions in cardiac injury, morphogenesis, angiogenesis, and tissue remodeling (eg, angiotensin I converting enzyme 2, STEAP family member 4, natriuretic peptide A, and secreted frizzled-related protein 4; all P<.05). Multiple gene sets and pathways that are involved in cardiac morphogenesis and vasculogenesis were downregulated significantly by gene set and Ingenuity Pathway Analysis (hallmark transforming growth factor beta signaling, cellular morphogenesis during differentiation, morphology of cardiovascular system; all P<.05). Disruption of gene networks for cardiac morphogenesis and vasculogenesis occurred in the preterm fetal heart of nonhuman primates with preterm labor, intraamniotic infection, and severe fetal inflammation. Inflammatory injury to the fetal heart in utero may contribute to the development of heart disease later in life. Development of preterm labor therapeutics must also target fetal inflammation to lessen organ injury and potential long-term effects on cardiac function. Copyright © 2018 Elsevier Inc. All rights reserved.

Printed Flexible Plastic Microchip for Viral Load Measurement through Quantitative Detection of Viruses in Plasma and Saliva

PubMed Central

Shafiee, Hadi; Kanakasabapathy, Manoj Kumar; Juillard, Franceline; Keser, Mert; Sadasivam, Magesh; Yuksekkaya, Mehmet; Hanhauser, Emily; Henrich, Timothy J.; Kuritzkes, Daniel R.; Kaye, Kenneth M.; Demirci, Utkan

2015-01-01

We report a biosensing platform for viral load measurement through electrical sensing of viruses on a flexible plastic microchip with printed electrodes. Point-of-care (POC) viral load measurement is of paramount importance with significant impact on a broad range of applications, including infectious disease diagnostics and treatment monitoring specifically in resource-constrained settings. Here, we present a broadly applicable and inexpensive biosensing technology for accurate quantification of bioagents, including viruses in biological samples, such as plasma and artificial saliva, at clinically relevant concentrations. Our microchip fabrication is simple and mass-producible as we print microelectrodes on flexible plastic substrates using conductive inks. We evaluated the microchip technology by detecting and quantifying multiple Human Immunodeficiency Virus (HIV) subtypes (A, B, C, D, E, G, and panel), Epstein-Barr Virus (EBV), and Kaposi’s Sarcoma-associated Herpes Virus (KSHV) in a fingerprick volume (50 µL) of PBS, plasma, and artificial saliva samples for a broad range of virus concentrations between 102 copies/mL and 107 copies/mL. We have also evaluated the microchip platform with discarded, de-identified HIV-infected patient samples by comparing our microchip viral load measurement results with reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) as the gold standard method using Bland-Altman Analysis. PMID:26046668

Spliced RNA of woodchuck hepatitis virus.

PubMed

Ogston, C W; Razman, D G

1992-07-01

Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

Up-regulation of IL-23 expression in human dental pulp fibroblasts by IL-17 via activation of the NF-κB and MAPK pathways.

PubMed

Wei, L; Liu, M; Xiong, H; Peng, B

2017-11-06

To investigate the effects of the pro-inflammatory and Th17-polarizing mediator IL-17 on HDPFs-mediated IL-23 production and the molecular mechanism involved. Interleukin (IL)-17R expression was determined by semi-quantitative reverse transcriptase-polymerase chain reaction and Western blot in cultured human dental pulp fibroblasts (HDPFs). Quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay were used to determine IL-23 mRNA and protein levels in IL-17-stimulated HDPFs, respectively. The nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinases (MAPKs) signalling pathways that mediate the IL-17-stimulated production of IL-23 was investigated using Western blot and specific signalling inhibitor analyses. Statistical analyses were performed using Kruskal-Wallis tests followed by the Mann-Whitney U-test. Statistical significance was considered when the P value < 0.05. Primary HDPFs steadily expressed IL-17R mRNA and surface-bound protein. IL-17 stimulated the expression of IL-23 mRNA and protein in cultured human dental pulp fibroblasts, which was attenuated by IL-17 or IL-17R neutralizing antibodies. In accordance with the enhanced expression of IL-23, IL-17 stimulation resulted in rapid activation of p38 MAPK, extracellular signal-regulated kinase (ERK) 1/2, c-Jun-N-terminal kinase (JNK) and NF-κB in HDPFs. Inhibitors of p38 MAPK, ERK 1/2 or NF-κB significantly suppressed, whereas blocking JNK substantially augmented IL-23 production from IL-17-stimulated HDPFs. HDPFs expressed IL-17R and responded to IL-17 to produce IL-23 via the activation of the NF-κB and MAPK signalling pathways. The findings provide insights into the cellular mechanisms of the participation of IL-17 in the activation of HDPFs in inflamed pulp tissue. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Continuous in vitro evolution of bacteriophage RNA polymerase promoters

NASA Technical Reports Server (NTRS)

Breaker, R. R.; Banerji, A.; Joyce, G. F.

1994-01-01

Rapid in vitro evolution of bacteriophage T7, T3, and SP6 RNA polymerase promoters was achieved by a method that allows continuous enrichment of DNAs that contain functional promoter elements. This method exploits the ability of a special class of nucleic acid molecules to replicate continuously in the presence of both a reverse transcriptase and a DNA-dependent RNA polymerase. Replication involves the synthesis of both RNA and cDNA intermediates. The cDNA strand contains an embedded promoter sequence, which becomes converted to a functional double-stranded promoter element, leading to the production of RNA transcripts. Synthetic cDNAs, including those that contain randomized promoter sequences, can be used to initiate the amplification cycle. However, only those cDNAs that contain functional promoter sequences are able to produce RNA transcripts. Furthermore, each RNA transcript encodes the RNA polymerase promoter sequence that was responsible for initiation of its own transcription. Thus, the population of amplifying molecules quickly becomes enriched for those templates that encode functional promoters. Optimal promoter sequences for phage T7, T3, and SP6 RNA polymerase were identified after a 2-h amplification reaction, initiated in each case with a pool of synthetic cDNAs encoding greater than 10(10) promoter sequence variants.

Quantitative gene expression deregulation in mantle-cell lymphoma: correlation with clinical and biologic factors.

PubMed

Kienle, Dirk; Katzenberger, Tiemo; Ott, German; Saupe, Doreen; Benner, Axel; Kohlhammer, Holger; Barth, Thomas F E; Höller, Sylvia; Kalla, Jörg; Rosenwald, Andreas; Müller-Hermelink, Hans Konrad; Möller, Peter; Lichter, Peter; Döhner, Hartmut; Stilgenbauer, Stephan

2007-07-01

There is evidence for a direct role of quantitative gene expression deregulation in mantle-cell lymphoma (MCL) pathogenesis. Our aim was to investigate gene expression associations with other pathogenic factors and the significance of gene expression in a multivariate survival analysis. Quantitative expression of 20 genes of potential relevance for MCL prognosis and pathogenesis were analyzed using real-time reverse transcriptase polymerase chain reaction and correlated with clinical and genetic factors, tumor morphology, and Ki-67 index in 65 MCL samples. Genomic losses at the loci of TP53, RB1, and P16 were associated with reduced transcript levels of the respective genes, indicating a gene-dosage effect as the pathomechanism. Analysis of gene expression correlations between the candidate genes revealed a separation into two clusters, one dominated by proliferation activators, another by proliferation inhibitors and regulators of apoptosis. Whereas only weak associations were identified between gene expression and clinical parameters or blastoid morphology, several genes were correlated closely with the Ki-67 index, including the short CCND1 variant (positive correlation) and RB1, ATM, P27, and BMI (negative correlation). In multivariate survival analysis, expression levels of MYC, MDM2, EZH2, and CCND1 were the strongest prognostic factors independently of tumor proliferation and clinical factors. These results indicate a pathogenic contribution of several gene transcript levels to the biology and clinical course of MCL. Genes can be differentiated into factors contributing to proliferation deregulation, either by enhancement or loss of inhibition, and proliferation-independent factors potentially contributing to MCL pathogenesis by apoptosis impairment.

MZC Gel Inhibits SHIV-RT and HSV-2 in Macaque Vaginal Mucosa and SHIV-RT in Rectal Mucosa.

PubMed

Calenda, Giulia; Villegas, Guillermo; Barnable, Patrick; Litterst, Claudia; Levendosky, Keith; Gettie, Agegnehu; Cooney, Michael L; Blanchard, James; Fernández-Romero, José A; Zydowsky, Thomas M; Teleshova, Natalia

2017-03-01

The Population Council's microbicide gel MZC (also known as PC-1005) containing MIV-150 and zinc acetate dihydrate (ZA) in carrageenan (CG) has shown promise as a broad-spectrum microbicide against HIV, herpes simplex virus (HSV), and human papillomavirus. Previous data show antiviral activity against these viruses in cell-based assays, prevention of vaginal and rectal simian-human immunodeficiency virus reverse transcriptase (SHIV-RT) infection, and reduction of vaginal HSV shedding in rhesus macaques and also excellent antiviral activity against HSV and human papillomavirus in murine models. Recently, we demonstrated that MZC is safe and effective against SHIV-RT in macaque vaginal explants. Here we established models of ex vivo SHIV-RT/HSV-2 coinfection of vaginal mucosa and SHIV-RT infection of rectal mucosa in macaques (challenge of rectal mucosa with HSV-2 did not result in reproducible tissue infection), evaluated antiviral activity of MZC, and compared quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay readouts for monitoring SHIV-RT infection. MZC (at nontoxic dilutions) significantly inhibited SHIV-RT in vaginal and rectal mucosas and HSV-2 in vaginal mucosa when present during viral challenge. Analysis of SHIV-RT infection and MZC activity by 1-step simian immunodeficiency virus gag quantitative RT-PCR and p27 enzyme-linked immunosorbent assay demonstrated similar virus growth dynamics and MZC activity by both methods and higher sensitivity of quantitative RT-PCR. Our data provide more evidence that MZC is a promising dual compartment multipurpose prevention technology candidate.

Quantitative estimation of Nipah virus replication kinetics in vitro

PubMed Central

Chang, Li-Yen; Ali, AR Mohd; Hassan, Sharifah Syed; AbuBakar, Sazaly

2006-01-01

Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero) using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI). Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection. PMID:16784519

Pannus invasion and cartilage degradation in rheumatoid arthritis: involvement of MMP-3 and interleukin-1beta.

PubMed

Ainola, M M; Mandelin, J A; Liljeström, M P; Li, T F; Hukkanen, M V J; Konttinen, Y T

2005-01-01

Synovial inflammation in rheumatoid arthritis (RA) leads to pannus tissue invasion and destruction of cartilage/bone matrix by proteinases. Our intention was to analyze some of the key matrix metalloproteinases (MMPs) in pannus tissue overlying evolving cartilage erosions in RA. Frozen tissue samples of pannus and synovium from advanced RA and synovium from osteoarthritic patients were used for immunohistochemical, western blotting and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) analysis of MMP-1, -3, -13 and -14. Synovial fibroblast cultures, stimulated with tumour necrosis factor alpha (TNF-alpha) and interleukin-1 beta (IL-1beta), were analyzed with enzyme-linked immunosorbent assays (ELISA) and quantitative RT-PCR. MMP-3 was highly expressed in pannus tissue compared with significantly lower expression levels of MMP-1, -13 and -14. In fibroblast cultures IL-1beta was a potent stimulus for MMP-3, whereas TNF-alpha was more potent for MMP-1. This is the first study to demonstrate quantitatively in real time that MMP-3 mRNA expression is clearly higher in advanced RA pannus tissue compared to parallel RA or osteoarthritic synovium. MMP-3 mRNA levels were also clearly overexpressed in RA pannus compared to MMP-1, -13 and -14. Advanced RA has previously been found to overexpress IL-1beta. The high expression of MMP-3 in pannus and IL-1beta, mediated stimulation of MMP-3 suggest that MMP-3 plays a significant role in the progression of erosions through the proteoglycan-rich cartilage matrix.

Elucidating the Role of cAbl and the Abi-Family of cAbl Target Proteins in Cancer Development and Progression

DTIC Science & Technology

1999-07-01

patients with Ph’-positive leukemias also revealed loss of Abi proteins. We determined by RNase protection assay and reverse transcriptase polymerase...myelogenous leukemia . Abi protein levels also appeared unaltered by Western blot analysis of human lung, liver, colon, and breast carcinoma tissues as...generated in the presence of Bcr-Abl • Abi protein degradation was observed in Ph’+ leukemia -derived cells, but not in Ph1- leukemias or in human breast

Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

DTIC Science & Technology

2007-05-08

deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

Distemper Outbreak and Its Effect on African Wild Dog Conservation

PubMed Central

van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.

2002-01-01

In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078

Effects of ß-TCP scaffolds on neurogenic and osteogenic differentiation of human embryonic stem cells.

PubMed

Arpornmaeklong, Premjit; Pressler, Michael J

2018-01-01

Extracellular matrix (ECM) and adhesion molecules play crucial roles in regulating growth and differentiation of stem cells. The current study aimed to investigate the effects of beta-tricalcium phosphate (ß-TCP) scaffolds on differentiation and expression of ECM and adhesion molecules of human embryonic stem cells (hESCs). Undifferentiated hESCs were seeded on ß-TCP scaffolds and cell culture plates and cultured in growth and osteogenic medium for 21 days. Scanning electron microscopy (SEM) displayed adhesion and growth of hESCs on the porous ß-TCP scaffolds. Histological analysis, immunohistochemical staining and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) demonstrated that the scaffolds supported growth and differentiation of hESCs. Expression levels of neural crest related genes (AP2a, FoxD3, HNK1, P75, Sox1, Sox10) and osteoblast-related genes (Runx2, SPP1 and BGLA) on the scaffolds in osteogenic medium were significantly higher than on the scaffolds in growth and cell culture plates in osteogenic medium, respectively (p<0.05). Polymerase chain reaction array experiments demonstrated increased expression of ECM and adhesion molecule-related genes on the scaffolds. In conclusion, osteoconductive scaffolds such as ß-TCP scaffolds promoted differentiation of hESCs, particularly expression of genes related to neural crest stem cell and osteoblastic differentiations. Beta-TCP scaffolds could be an alternative cell culture substrate for neural crest and osteogenic differentiation of hESCs. Optimization of culture medium may be necessary to enhance lineage restriction of hESCs on the ß-TCP scaffolds. Copyright © 2017 Elsevier GmbH. All rights reserved.

Cloning and Expression Analysis of a PISTILLATA Homologous Gene from Pineapple (Ananas comosus L. Merr)

PubMed Central

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. PMID:22312303

Cloning and expression analysis of a PISTILLATA homologous gene from pineapple (Ananas comosus L. Merr).

PubMed

Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

2012-01-01

PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants.

A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

PubMed Central

2010-01-01

Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

PubMed

Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

2014-01-01

Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P < .0001, 11.36 ± 6.0 vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

A widespread class of reverse transcriptase-related cellular genes.

PubMed

Gladyshev, Eugene A; Arkhipova, Irina R

2011-12-20

Reverse transcriptases (RTs) polymerize DNA on RNA templates. They fall into several structurally related but distinct classes and form an assemblage of RT-like enzymes that, in addition to RTs, also includes certain viral RNA-dependent RNA polymerases (RdRP) synthesizing RNA on RNA templates. It is generally believed that most RT-like enzymes originate from retrotransposons or viruses and have no specific function in the host cell, with telomerases being the only notable exception. Here we report on the discovery and properties of a unique class of RT-related cellular genes collectively named rvt. We present evidence that rvts are not components of retrotransposons or viruses, but single-copy genes with a characteristic domain structure that may contain introns in evolutionarily conserved positions, occur in syntenic regions, and evolve under purifying selection. These genes can be found in all major taxonomic groups including protists, fungi, animals, plants, and even bacteria, although they exhibit patchy phylogenetic distribution in each kingdom. We also show that the RVT protein purified from one of its natural hosts, Neurospora crassa, exists in a multimeric form and has the ability to polymerize NTPs as well as dNTPs in vitro, with a strong preference for NTPs, using Mn(2+) as a cofactor. The existence of a previously unknown class of single-copy RT-related genes calls for reevaluation of the current views on evolution and functional roles of RNA-dependent polymerases in living cells.

Probing the structural and molecular basis of nucleotide selectivity by human mitochondrial DNA polymerase γ

PubMed Central

Sohl, Christal D.; Szymanski, Michal R.; Mislak, Andrea C.; Shumate, Christie K.; Amiralaei, Sheida; Schinazi, Raymond F.; Anderson, Karen S.; Yin, Y. Whitney

2015-01-01

Nucleoside analog reverse transcriptase inhibitors (NRTIs) are the essential components of highly active antiretroviral (HAART) therapy targeting HIV reverse transcriptase (RT). NRTI triphosphates (NRTI-TP), the biologically active forms, act as chain terminators of viral DNA synthesis. Unfortunately, NRTIs also inhibit human mitochondrial DNA polymerase (Pol γ), causing unwanted mitochondrial toxicity. Understanding the structural and mechanistic differences between Pol γ and RT in response to NRTIs will provide invaluable insight to aid in designing more effective drugs with lower toxicity. The NRTIs emtricitabine [(-)-2,3′-dideoxy-5-fluoro-3′-thiacytidine, (-)-FTC] and lamivudine, [(-)-2,3′-dideoxy-3′-thiacytidine, (-)-3TC] are both potent RT inhibitors, but Pol γ discriminates against (-)-FTC-TP by two orders of magnitude better than (-)-3TC-TP. Furthermore, although (-)-FTC-TP is only slightly more potent against HIV RT than its enantiomer (+)-FTC-TP, it is discriminated by human Pol γ four orders of magnitude more efficiently than (+)-FTC-TP. As a result, (-)-FTC is a much less toxic NRTI. Here, we present the structural and kinetic basis for this striking difference by identifying the discriminator residues of drug selectivity in both viral and human enzymes responsible for substrate selection and inhibitor specificity. For the first time, to our knowledge, this work illuminates the mechanism of (-)-FTC-TP differential selectivity and provides a structural scaffold for development of novel NRTIs with lower toxicity. PMID:26124101

Molecular Epidemiology of Norovirus Outbreaks in Norway during 2000 to 2005 and Comparison of Four Norovirus Real-Time Reverse Transcriptase PCR Assays

PubMed Central

Vainio, Kirsti; Myrmel, Mette

2006-01-01

During the period from January 2000 to August 2005 a total of 204 outbreaks of norovirus gastroenteritis were diagnosed at the Norwegian Institute of Public Health. A clear increase in the norovirus activity was seen in healthcare institutions during the winter seasons. Polymerase sequence analysis of norovirus strains from 122 outbreaks showed that 112 were caused by GII strains (91.8%). Two norovirus variants seen during the study period—GIIb and GII.4—were predominant between January 2000 and September 2002, whereas GII.4 was predominant from September 2002 onward. The highest norovirus activity was seen during the 2002-2003 and 2004-2005 seasons with the emergence of new GII.4 variants. This study describes the molecular epidemiology of norovirus strains circulating in Norway during the five previous seasons and compares four norovirus real-time reverse transcriptase PCR assays. A suitable assay for routine diagnostics is suggested. PMID:17021099

TOPICAL TENOFOVIR, A MICROBICIDE EFFECTIVE AGAINST HIV, INHIBITS HERPES SIMPLEX VIRUS-2 REPLICATION

PubMed Central

Andrei, Graciela; Lisco, Andrea; Vanpouille, Christophe; Introini, Andrea; Balestra, Emanuela; van den Oord, Joost; Cihlar, Tomas; Perno, Carlo-Federico; Snoeck, Robert; Margolis, Leonid; Balzarini, Jan

2011-01-01

SUMMARY The HIV reverse transcriptase inhibitor tenofovir, was recently formulated into a vaginal gel for use as a microbicide. In human trials, a 1% tenofovir gel inhibited HIV sexual transmission by 39% and surprisingly herpes simplex virus-2 (HSV-2) transmission by 51%. We demonstrate that the concentration achieved intravaginally with a 1% tenofovir topical gel has direct anti-herpetic activity. Tenofovir inhibits the replication of HSV clinical isolates in human embryonic fibroblasts, keratinocytes, and organotypic epithelial 3D-rafts, decreases HSV replication in human lymphoid and cervical tissues ex vivo, and delays HSV-induced lesions and death of topically treated HSV-infected mice. The active tenofovir metabolite inhibits HSV DNA-polymerase and HIV reverse transcriptase. Tenofovir must be topically administered to achieve concentrations, which are higher than systemic levels after oral treatment, that exert these dual antiviral effects. These findings indicate that a single topical treatment, like tenofovir, can inhibit the transmission of HIV and its co-pathogens. PMID:22018238

Consensus criteria for sensitive detection of minimal neuroblastoma cells in bone marrow, blood and stem cell preparations by immunocytology and QRT-PCR: recommendations by the International Neuroblastoma Risk Group Task Force

PubMed Central

Beiske, K; Burchill, S A; Cheung, I Y; Hiyama, E; Seeger, R C; Cohn, S L; Pearson, A D J; Matthay, K K

2009-01-01

Disseminating disease is a predictive and prognostic indicator of poor outcome in children with neuroblastoma. Its accurate and sensitive assessment can facilitate optimal treatment decisions. The International Neuroblastoma Risk Group (INRG) Task Force has defined standardised methods for the determination of minimal disease (MD) by immunocytology (IC) and quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR) using disialoganglioside GD2 and tyrosine hydroxylase mRNA respectively. The INRG standard operating procedures (SOPs) define methods for collecting, processing and evaluating bone marrow (BM), peripheral blood (PB) and peripheral blood stem cell harvest by IC and QRT-PCR. Sampling PB and BM is recommended at diagnosis, before and after myeloablative therapy and at the end of treatment. Peripheral blood stem cell products should be analysed at the time of harvest. Performing MD detection according to INRG SOPs will enable laboratories throughout the world to compare their results and thus facilitate quality-controlled multi-centre prospective trials to assess the clinical significance of MD and minimal residual disease in heterogeneous patient groups. PMID:19401690

Mechanism of Glucose Regulates the Fruiting Body Formation in the Beech Culinary-Medicinal Mushroom, Hypsizygus marmoreus (Agaricomycetes).

PubMed

Zhang, Jin-Jing; Chen, Hui; Xie, Min-Ying; Chen, Ming-Jie; Hao, Hai-Bo; Wang, Hong; Feng, Zhi-Yong

2017-01-01

To understand the fruiting process of Hypsizygus marmoreus, a synthetic liquid medium (SLM) was optimized to induce fruiting body initiation. Dependent on the SLM, the effect of a monofactor (glucose) on the fruiting bodies of H. marmoreus was studied at different concentrations (10 and 40 g/L). Primordia appeared approximately 10 days earlier in low-glucose media (LGM) than in high-glucose media (HGM), whereas mature fruiting bodies formed on mushrooms approximately 7 days earlier and more primordia developed into mature fruiting bodies when cultured in HGM. In addition, the morphogenesis of the primordia was clustered in HGM, which was different than what was observed in LGM. Furthermore, differentially expressed genes (DEGs) that encoded various proteins involved in cell structure, general metabolism, signal transduction, and transcription and translation were analyzed by transcriptome sequencing. Six DEGs were detected by quantitative reverse-transcriptase polymerase chain reaction, and the results were consistent with the altered patterns of gene expression revealed by the transcriptome. This study not only identifies new candidate genes involved in the development of H. marmoreus but also provides a new research platform for studying the development of other edible mushrooms.

ICI 182,780-Regulated Gene Expression in DU145 Prostate Cancer Cells Is Mediated by Estrogen Receptor-β/NFκB Crosstalk1

PubMed Central

Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

2006-01-01

Abstract Estrogen receptor (ER)-β is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-β-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 µM ICI. Semi-quantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12α chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-β antisense oligonucleotide reduced cellular ER-β mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFκB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-α and the NFκB signaling pathway, denoting a novel mechanism of ER-β-mediated ICI action. Therefore, combined therapies targeting ER-β and NFκB signaling may be synergistic as treatment for PCa. PMID:16756716

Gene signature based on degradome-related genes can predict distal metastasis in cervical cancer patients.

PubMed

Fernandez-Retana, Jorge; Zamudio-Meza, Horacio; Rodriguez-Morales, Miguel; Pedroza-Torres, Abraham; Isla-Ortiz, David; Herrera, Luis; Jacobo-Herrera, Nadia; Peralta-Zaragoza, Oscar; López-Camarillo, César; Morales-Gonzalez, Fermin; Cantu de Leon, David; Pérez-Plasencia, Carlos

2017-06-01

Cervical cancer is one of the leading causes of death in women worldwide, which mainly affects developing countries. The patients who suffer a recurrence and/or progression disease have a higher risk of developing distal metastases. Proteases comprising the degradome given its ability to promote cell growth, migration, and invasion of tissues play an important role during tumor development and progression. In this study, we used high-density microarrays and quantitative reverse transcriptase polymerase chain reaction to evaluate the degradome profile and their inhibitors in 112 samples of patients diagnosed with locally advanced cervical cancer. Clinical follow-up was done during a period of 3 years. Using a correlation analysis between the response to treatment and the development of metastasis, we established a molecular signature comprising eight degradome-related genes (FAM111B, FAM111A, CFB, PSMB8, PSMB9, CASP7, PRSS16, and CD74) with the ability to discriminate patients at risk of distal metastases. In conclusion, present results show that molecular signature obtained from degradome genes can predict the possibility of metastasis in patients with locally advanced cervical cancer.

Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

PubMed

Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

2010-11-01

Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

Biodistribution and safety of a live attenuated tetravalent dengue vaccine in the cynomolgus monkey.

PubMed

Ravel, Guillaume; Mantel, Nathalie; Silvano, Jeremy; Rogue, Alexandra; Guy, Bruno; Jackson, Nicholas; Burdin, Nicolas

2017-10-13

The first licensed dengue vaccine is a recombinant, live, attenuated, tetravalent dengue virus vaccine (CYD-TDV; Sanofi Pasteur). This study assessed the biodistribution, shedding, and toxicity of CYD-TDV in a non-human primate model as part of the nonclinical safety assessment program for the vaccine. Cynomolgus monkeys were given one subcutaneous injection of either one human dose (5log 10 CCID 50 /serotype) of CYD-TDV or saline control. Study endpoints included clinical observations, body temperature, body weight, food consumption, clinical pathology, immunogenicity, and post-mortem examinations including histopathology. Viral load, distribution, persistence, and shedding in tissues and body fluids were evaluated by quantitative reverse transcriptase polymerase chain reaction. The subcutaneous administration of CYD-TDV was well tolerated. There were no toxicological findings other than expected minor local reactions at the injection site. A transient low level of CYD-TDV viral RNA was detected in blood and the viral genome was identified primarily at the injection site and in the draining lymph nodes following immunization. These results, together with other data from repeat-dose toxicity and neurovirulence studies, confirm the absence of toxicological concern with CYD-TDV and corroborate clinical study observations. Copyright © 2017 Elsevier Ltd. All rights reserved.

Stable Reference Gene Selection for RT-qPCR Analysis in Nonviruliferous and Viruliferous Frankliniella occidentalis.

PubMed

Yang, Chunxiao; Li, Hui; Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong

2015-01-01

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔCt method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions.

MAEWEST Expression in Flower Development of Two Petunia Species

PubMed Central

Segatto, Ana Lúcia A.; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B.; Monte-Bello, Carolina C.; Dornelas, Marcelo C.; Margis, Rogerio; Freitas, Loreta B.

2013-01-01

Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription–quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions. PMID:23823801

Subglottic injury, gastric juice, corticosteroids, and peptide growth factors in a porcine model.

PubMed

Yellon, R F; Szeremeta, W; Grandis, J R; Diguisseppe, P; Dickman, P S

1998-06-01

To study the effects of mucosal injury, gastric juice, and corticosteroids and to determine the presence of peptide growth factors in the subglottic mucosa in a porcine model. Prospective cohort animal study. In this model of subglottic injury, five groups (n = 5 each) of piglets were used. Injury was induced by electrocautery (acute), electrocautery plus repeated saline application (chronic), electrocautery plus repeated gastric juice application (chronic plus gastric juice), or repeated gastric juice application (gastric). Control piglets had normal saline applied repeatedly. Histopathologic findings for the gastric juice group included basal cell hyperplasia (80%), squamous metaplasia (80%), and mucosal ulceration (40%). Control piglets showed squamous metaplasia (80%) but no basilar hyperplasia or ulceration. Immunohistochemistry detected peptide growth factors and epidermal growth factor receptor (EGFR) in all groups. Decreased staining was most frequent in the acute injury group. Quantitative reverse transcriptase polymerase chain reaction (RT-PCR) documented lower expression of EGFR in the gastric juice group (P = .01). These findings suggest that peptide growth factors and EGFR are part of normal subglottic mucosal turnover. Noxious stimuli decrease production of these factors. Gastric juice had adverse effects documented by histopathology and molecular techniques.

Simultaneous determination of the HIV nucleoside analogue reverse transcriptase inhibitors lamivudine, didanosine, stavudine, zidovudine and abacavir in human plasma by reversed phase high performance liquid chromatography.

PubMed

Verweij-van Wissen, C P W G M; Aarnoutse, R E; Burger, D M

2005-02-25

A reversed phase high performance liquid chromatography method was developed for the simultaneous quantitative determination of the nucleoside reverse transcriptase inhibitors (NRTIs) lamivudine, didanosine, stavudine, zidovudine and abacavir in plasma. The method involved solid-phase extraction with Oasis MAX cartridges from plasma, followed by high performance liquid chromatography with a SymmetryShield RP 18 column and ultraviolet detection set at a wavelength of 260 nm. The assay was validated over the concentration range of 0.015-5 mg/l for all five NRTIs. The average accuracies for the assay were 92-102%, inter- and intra-day coefficients of variation (CV) were <2.5% and extraction recoveries were higher than 97%. This method proved to be simple, accurate and precise, and is currently in use in our laboratory for the quantitative analysis of NRTIs in plasma.

The Reverse Transcriptase of the Tf1 Retrotransposon Has a Specific Novel Activity for Generating the RNA Self-Primer That Is Functional in cDNA Synthesis▿

PubMed Central

Hizi, Amnon

2008-01-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5′ end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3′ end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs. PMID:18753200

The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis.

PubMed

Hizi, Amnon

2008-11-01

The Tf1 retrotransposon of Schizosaccharomyces pombe represents a group of eukaryotic long terminal repeat (LTR) retroelements that, based on their sequences, were predicted to use an RNA self-primer for initiating reverse transcription while synthesizing the negative-sense DNA strand. This feature is substantially different from the one typical to retroviruses and other LTR retrotransposons that all exhibit a tRNA-dependent priming mechanism. Genetic studies have suggested that the self-primer of Tf1 can be generated by a cleavage between the 11th and 12th bases of the Tf1 RNA transcript. The in vitro data presented here show that recombinant Tf1 reverse transcriptase indeed introduces a nick at the end of a duplexed region at the 5' end of Tf1 genomic RNA, substantiating the prediction that this enzyme is responsible for generating this RNA self-primer. The 3' end of the primer, generated in this manner, can then be extended upon the addition of deoxynucleoside triphosphates by the DNA polymerase activity of the same enzyme, synthesizing the negative-sense DNA strand. This functional primer must have been generated by the RNase H activity of Tf1 reverse transcriptase, since a mutant enzyme lacking this activity has lost its ability to generate the self-primer. It was also found here that the reverse transcriptases of human immunodeficiency virus type 1 and of murine leukemia virus do not exhibit this specific cleavage activity. In all, it is likely that the observed unique mechanism of self-priming in Tf1 represents an early advantageous form of initiating reverse transcription in LTR retroelements without involving cellular tRNAs.

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

PubMed

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

PubMed

Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

1998-01-01

Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

Estrogen receptor-α, progesterone receptor, and c-erbB/HER-family receptor mRNA detection and phenotype analysis in spontaneous canine models of breast cancer

PubMed Central

Kabir, Farruk M. Lutful; DeInnocentes, Patricia; Agarwal, Payal; Mill, Christopher P.; Riese, David J.

2017-01-01

Well characterized, stable, p16-defective canine mammary cancer (CMT) cell lines and normal canine mammary epithelial cells were used to investigate expression of the major breast cancer-specific hormone receptors estrogen receptor alpha (ER1) and progesterone receptor (PR) as well as luminal epithelial-specific proto-oncogenes encoding c-erbB-1 (epidermal growth factor receptor/EGFr), c-erbB-2/HER2, c-erbB-3, and c-erbB-4 receptors. The investigation developed and validated quantitative reverse transcriptase polymerase chain reaction assays for each transcript to provide rapid assessment of breast cancer phenotypes for canine cancers, based on ER1, PR, and c-erbB-2/HER2 expressions, similar to those in human disease. Roles for relatively underexplored c-erbB-3 and c-erbB-4 receptor expressions in each of these breast cancer phenotypes were also evaluated. Each quantitative assay was validated by assessment of amplicon size and DNA sequencing following amplification. Differential expression of ER1, PR, and c-erbB-2 in CMT cell lines clearly defined distinct human-like breast cancer phenotypes for a selection of CMT-derived cell lines. Expression profiles for EGFr family genes c-erbB-3 and c-erbB-4 in CMT models also provided an enriched classification of canine breast cancer identifying new extended phenotypes beyond the conventional luminal-basal characterization used in human breast cancer. PMID:27515268

Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

PubMed Central

Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

2006-01-01

Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

Blastic natural killer cell leukaemia in a dog--a case report.

PubMed

Bonkobara, Makoto; Saito, Taro; Yamashita, Masahiro; Tamura, Kyoichi; Yagihara, Hiroko; Isotani, Mayu; Sato, Takashi; Washizu, Tsukimi

2007-11-01

A case of canine non-T, non-B lymphoid leukaemia was determined to be of natural killer (NK) cell lineage by detecting specific expression of canine CD56 mRNA by reverse transcriptase polymerase chain reaction analysis. Although NK cells are usually considered to be morphologically large granular lymphocytes, the malignant NK cells in this case were agranular and blast-like, resembling human blastic NK cell leukaemia. The prognosis of human NK cell leukaemia is usually poor. In this case, the dog died 10 days after initial presentation, despite chemotherapy.

Prospective and retrospective evaluation of the Cepheid Xpert® Flu/RSV XC assay for rapid detection of influenza A, influenza B, and respiratory syncytial virus.

PubMed

Salez, Nicolas; Nougairede, Antoine; Ninove, Laetitia; Zandotti, Christine; de Lamballerie, Xavier; Charrel, Remi N

2015-04-01

A total of 281 clinical specimens (nasal swabs and nasopharyngeal aspirates) were tested with the Xpert® Flu/RSV XC. The results were compared to those obtained with the real-time retro transcriptase-polymerase chain reaction assays routinely used in our laboratory. The Xpert® Flu/RSV XC showed sensitivity/specificity of 97.8%/100% and 97.9%/100% for flu and respiratory syncytial virus, respectively. Copyright © 2015 Elsevier Inc. All rights reserved.

Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA

PubMed Central

Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco

1974-01-01

Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714

Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

PubMed

Walker, J; Tait, A

1997-11-01

A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

Trends of drug-resistance-associated mutations in the reverse transcriptase gene of HIV type 1 isolates from North India.

PubMed

Azam, Mohd; Malik, Abida; Rizvi, Meher; Rai, Arvind

2014-04-01

A major cause of failure of antiretroviral therapy (ART) is the presence of drug-resistance-associated mutations in the polymerase gene of HIV-1. The paucity of data regarding potential drug resistance to reverse transcriptase inhibitors (RTIs) prompted us to carry out this study. This information will shed light on the extent of drug resistance already present in HIV strains and will give future directions in patient treatment and in drug design. Drug resistance genotyping of a partial reverse transcriptase gene was done in 103 HIV-1-infected patients, including the ART-naive and ART-experienced population. The drug resistance pattern was analyzed using the Stanford HIV-DR database, the IAS-USA mutation list and the REGA algorithm-v8.0. Subtyping was done using the REGA HIV-1 subtyping tool-v2.01. The majority of our sequences (96 %) were found to be subtype C, and four (3.8 %) were subtype A1. Significant prevalence of DR mutations (28 %) was observed in the RT gene. Major amino acid substitutions were seen at positions 41, 90, 98, 103, 106, 108, 138, 181, 184, 190, 215, and 219, which confer high/intermediate levels of resistance to most RTIs, independently or together. Our results show that there is an urgent need to tailor ART drug regimens to the individual to achieve optimum therapeutic outcome in North India.

Molecular epidemiology of human metapneumovirus in Ireland.

PubMed

Carr, Michael J; Waters, Allison; Fenwick, Fiona; Toms, Geoffrey L; Hall, William W; O'Kelly, Edwin

2008-03-01

Human metapneumovirus (hMPV) is a cause of respiratory illness ranging from wheezing to bronchiolitis and pneumonia in children. A quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) assay was developed for the detection of all four main genetic lineages of hMPV and employed to validate an indirect immunofluorescence (IF) assay to detect hMPV positive specimens. The IF assay detected 24 positives from a screen of 625 randomly selected pediatric respiratory specimens collected (3.8% prevalence). From this cohort of 625 specimens, 229 were also tested by real-time RT-PCR assay. This included the 24 IF positive specimens and 205 randomly selected specimens from both study periods. In addition to confirming all the IF positives, the real-time assay detected an additional six hMPV positive specimens giving rise to a combined prevalence of 4.8%. Phylogenetic analysis showed that hMPV subtypes A2b and B2 to be the most prevalent genotypes circulating in our population and surprisingly no hMPV subgroups A1 or B1 were detected during this study period. Based on this phylogenetic analysis, we propose the existence of sub-clusters of hMPV genotype B2 present in our population which we term subtypes B2a and B2b. The mean log 10 copies/ml of quantitative RT-PCR determinations from these 30 hMPV positive respiratory specimens was 6.35 (range = 4.44-8.15). Statistical analysis of quantitative RT-PCR determinations of viral load from these 30 respiratory specimens suggests that hMPV genotype B specimens have a higher viral load than hMPV genotype A isolates (P < 0.03).

DNA synthesis arrest sites at the right terminus of rat long interspersed repeated (LINE or L1Rn) DNA family members.

PubMed Central

d'Ambrosio, E; Furano, A V

1987-01-01

An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148

Detection and management of minimal residual disease in acute lymphoblastic leukemia.

PubMed

Schrappe, Martin

2014-12-05

The detection of minimal residual disease (MRD) has become part of the state-of-the-art diagnostics to guide treatment both in pediatric and adult acute lymphoblastic leukemia (ALL). This applies to the treatment of de novo and recurrent ALL. In high-risk ALL, MRD detection is considered an important tool to adjust therapy before and after hematopoietic stem cell transplantation. Precise quantification and quality control is instrumental to avoid false treatment assignment. A new methodological approach to analyzing MRD has become available and is based on next-generation sequencing. In principle, this technique will be able to detect a large number of leukemic subclones at a much higher speed than before. Carefully designed prospective studies need to demonstrate concordance or even superiority compared with those techniques in use right now: detection of aberrant expression of leukemia-specific antigens by flow cytometry of blood or bone marrow, or detection of specific rearrangements of the T-cell receptor or immunoglobulin genes by real-time quantitative polymerase chain reaction using DNA of leukemic cells. In some cases with known fusion genes, such as BCR/ABL, reverse transcriptase-polymerase chain reaction has been used as additional method to identify leukemic cells by analyzing RNA in patient samples. MRD detection may be used to modulate treatment intensity once it has been demonstrated at well-defined informative checkpoints that certain levels of MRD can reliably predict the risk of relapse. In addition, MRD is used as end point to determine the activity of a given agent or treatment protocol. If activity translates into antileukemic efficacy, MRD may be considered a surrogate clinical end point. © 2014 by The American Society of Hematology. All rights reserved.

Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

PubMed

Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

2015-01-01

Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

The role of phenylalanine-119 of the reverse transcriptase of mouse mammary tumour virus in DNA synthesis, ribose selection and drug resistance.

PubMed

Entin-Meer, Michal; Sevilya, Ziv; Hizi, Amnon

2002-10-15

Phe-119 in the reverse transcriptase (RT) of mouse mammary tumour virus (MMTV) is homologous with Tyr-115 in HIV type 1 (HIV-1) RT and to Phe-155 in murine leukaemia virus (MLV) RT. By mutating these residues in HIV-1 and MLV RTs (which are strict DNA polymerases) the enzymes were shown to function also as RNA polymerases. Owing to the uniqueness of MMTV as a type B retrovirus, we have generated a Phe-119-Val mutant of MMTV RT to study the involvement of this residue in affecting the catalytic features of this RT. The data presented here show that the mutant MMTV RT can incorporate both deoxyribonucleosides and ribonucleosides while copying either RNA or DNA. In addition, this mutant RT shows resistance to nucleoside analogues and an enhanced fidelity of DNA synthesis; all relative to the wild-type enzyme. The Phe-119-Val mutant is also different from the wild-type enzyme in its preference for most template primers tested and in its ability to synthesize DNA under non-processive and processive conditions. Overall, it is likely that the aromatic side chain of Phe-119 is located at the dNTP-binding site of MMTV RT and thus might be part of a putative "steric gate" that prevents the incorporation of nucleoside triphosphates. Since the only three-dimensional structures of RTs published so far are those of HIV-1 and MLV, it is likely that MMTV RT folds quite similarly to these RTs.

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

PubMed

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

PubMed

Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

2008-05-20

Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

PubMed

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Crystallographic Study of a Novel Sub-Nanomolar Inhibitor Provides Insight on the Binding Interactions of Alkenyldiarylmethanes with Human Immunodeficiency Virus-1 (HIV-1) Reverse Transcriptase†

PubMed Central

Cullen, Matthew D.; Ho, William C.; Bauman, Joseph D.; Das, Kalyan; Arnold, Eddy; Hartman, Tracy L.; Watson, Karen M.; Buckheit, Robert W.; Pannecouque, Christophe; De Clercq, Erik; Cushman, Mark

2009-01-01

Two crystal structures have been solved for separate complexes of alkenyldiarylmethane (ADAM) non-nucleoside reverse transcriptase inhibitors (NNRTI) 3 and 4 with HIV-1 reverse transcriptase (RT). The structures reveal inhibitor binding is exclusively hydrophobic in nature and the shape of the inhibitor-bound NNRTI binding pocket is unique among other reported inhibitor-RT crystal structures. Primarily, ADAMs 3 and 4 protrude from a large gap in the backside of the binding pocket, placing portions of the inhibitors unusually close to the polymerase active site and allowing 3 to form a weak hydrogen bond with Lys223. The lack of additional stabilizing interactions, beyond the observed hydrophobic surface contacts, between 4 and RT is quite perplexing given the extreme potency of the compound (IC50 ≤ nM). ADAM 4 was designed to be hydrolytically stable in blood plasma, and an investigation of its hydrolysis in rat plasma demonstrated it has a significantly prolonged half-life in comparison to ADAM lead compounds 1 and 2. PMID:19775161

Biofilms and Antifungal Susceptibility Testing.

PubMed

Simitsopoulou, Maria; Chatzimoschou, Athanasios; Roilides, Emmanuel

2016-01-01

Yeasts and filamentous fungi both exist as single cells and hyphal forms, two morphologies used by most fungal organisms to create a complex multilayered biofilm structure. In this chapter we describe the most widely used assays for the determination of biofilm production and assessment of susceptibility of biofilms to antifungal agents or host phagocytes as various methods, the most frequent of which are staining, confocal laser scanning microscopy, quantification of extracellular DNA and protein associated with extracellular matrix and XTT metabolic reduction assay. Pathway-focused biofilm gene expression profiling is assessed by real-time reverse transcriptase polymerase chain reaction.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

PubMed

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Structural Maturation of HIV-1 Reverse Transcriptase—A Metamorphic Solution to Genomic Instability

PubMed Central

London, Robert E.

2016-01-01

Human immunodeficiency virus 1 (HIV-1) reverse transcriptase (RT)—a critical enzyme of the viral life cycle—undergoes a complex maturation process, required so that a pair of p66 precursor proteins can develop conformationally along different pathways, one evolving to form active polymerase and ribonuclease H (RH) domains, while the second forms a non-functional polymerase and a proteolyzed RH domain. These parallel maturation pathways rely on the structural ambiguity of a metamorphic polymerase domain, for which the sequence–structure relationship is not unique. Recent nuclear magnetic resonance (NMR) studies utilizing selective labeling techniques, and structural characterization of the p66 monomer precursor have provided important insights into the details of this maturation pathway, revealing many aspects of the three major steps involved: (1) domain rearrangement; (2) dimerization; and (3) subunit-selective RH domain proteolysis. This review summarizes the major structural changes that occur during the maturation process. We also highlight how mutations, often viewed within the context of the mature RT heterodimer, can exert a major influence on maturation and dimerization. It is further suggested that several steps in the RT maturation pathway may provide attractive targets for drug development. PMID:27690082

Targeting FOXM1 Improves Cytotoxicity of Paclitaxel and Cisplatinum in Platinum-Resistant Ovarian Cancer.

PubMed

Westhoff, Gina L; Chen, Yi; Teng, Nelson N H

2017-10-01

Aberrantly activated FOXM1 (forkhead box protein M1) leading to uncontrolled cell proliferation and dysregulation of FOXM1 transcription network occurs in 84% of ovarian cancer cases. It was demonstrated that thiostrepton, a thiazole antibiotic, decreases FOXM1 expression. We aimed to determine if targeting the FOXM1 pathway with thiostrepton could improve the efficacy of paclitaxel and cisplatin in human ovarian cancer ascites cells ex vivo. Human ovarian cancer cell lines and patients' ascites cells were treated with paclitaxel, cisplatin, and thiostrepton or a combination for 48 hours, and cytotoxicity was assessed. Drug combination effects were determined by calculating the combination index values using the Chou and Talalay method. Quantitative reverse transcriptase-polymerase chain reaction was performed to determine changes in FOXM1 expression and its downstream targets. Ovarian cancer cell lines and the patients' ascites cancer cells had an overexpression of FOXM1 expression levels. Targeting FOXM1 with thiostrepton decreased FOXM1 mRNA expression and its downstream targets such as CCNB1 and CDC25B, leading to cell death in both cell lines and patients' ascites cancer cells. Furthermore, addition of thiostrepton to paclitaxel and cisplatin showed synergistic effects in chemoresistant ovarian cancer patients' ascites cells ex vivo. Targeting FOXM1 may lead to novel therapeutics for chemoresistant epithelial ovarian cancer.

Identification of Reference Genes and Analysis of Heat Shock Protein Gene Expression in Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum, after Exposure to Heat Stress.

PubMed

Liu, Yong-Nan; Lu, Xiao-Xiao; Ren, Ang; Shi, Liang; Jiang, Ai-Liang; Yu, Han-Shou; Zhao, Ming-Wen

2017-01-01

Ganoderma lucidum has been considered an emerging model species for studying how environmental factors regulate the growth, development, and secondary metabolism of Basidiomycetes. Heat stress, which is one of the most important environmental abiotic stresses, seriously affects the growth, development, and yield of microorganisms. Understanding the response to heat stress has gradually become a hotspot in microorganism research. But suitable reference genes for expression analysis under heat stress have not been reported in G. lucidum. In this study, we systematically identified 11 candidate reference genes that were measured using reverse transcriptase quantitative polymerase chain reaction, and the gene expression stability was analyzed under heat stress conditions using geNorm and NormFinder. The results show that 5 reference genes-CYP and TIF, followed by UCE2, ACTIN, and UBQ1-are the most stable genes under our experimental conditions. Moreover, the relative expression levels of 3 heat stress response genes (hsp17.4, hsp70, and hsp90) were analyzed under heat stress conditions with different normalization strategies. The results show that use of a gene with unstable expression (SAND) as the reference gene leads to biased data and misinterpretations of the target gene expression level under heat stress.

DNA Methylation Signatures of Early Childhood Malnutrition Associated With Impairments in Attention and Cognition.

PubMed

Peter, Cyril J; Fischer, Laura K; Kundakovic, Marija; Garg, Paras; Jakovcevski, Mira; Dincer, Aslihan; Amaral, Ana C; Ginns, Edward I; Galdzicka, Marzena; Bryce, Cyralene P; Ratner, Chana; Waber, Deborah P; Mokler, David; Medford, Gayle; Champagne, Frances A; Rosene, Douglas L; McGaughy, Jill A; Sharp, Andrew J; Galler, Janina R; Akbarian, Schahram

2016-11-15

Early childhood malnutrition affects 113 million children worldwide, impacting health and increasing vulnerability for cognitive and behavioral disorders later in life. Molecular signatures after childhood malnutrition, including the potential for intergenerational transmission, remain unexplored. We surveyed blood DNA methylomes (~483,000 individual CpG sites) in 168 subjects across two generations, including 50 generation 1 individuals hospitalized during the first year of life for moderate to severe protein-energy malnutrition, then followed up to 48 years in the Barbados Nutrition Study. Attention deficits and cognitive performance were evaluated with the Connors Adult Attention Rating Scale and Wechsler Abbreviated Scale of Intelligence. Expression of nutrition-sensitive genes was explored by quantitative reverse transcriptase polymerase chain reaction in rat prefrontal cortex. We identified 134 nutrition-sensitive, differentially methylated genomic regions, with most (87%) specific for generation 1. Multiple neuropsychiatric risk genes, including COMT, IFNG, MIR200B, SYNGAP1, and VIPR2 showed associations of specific methyl-CpGs with attention and IQ. IFNG expression was decreased in prefrontal cortex of rats showing attention deficits after developmental malnutrition. Early childhood malnutrition entails long-lasting epigenetic signatures associated with liability for attention and cognition, and limited potential for intergenerational transmission. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

Sepsis-Induced Coagulation in the Baboon Lung Is Associated with Decreased Tissue Factor Pathway Inhibitor

PubMed Central

Tang, Haiwang; Ivanciu, Lacramioara; Popescu, Narcis; Peer, Glenn; Hack, Erik; Lupu, Cristina; Taylor, Fletcher B.; Lupu, Florea

2007-01-01

Increased tissue factor (TF)-dependent procoagulant activity in sepsis may be partly due to decreased expression or function of tissue factor pathway inhibitor (TFPI). To test this hypothesis, baboons were infused with live Escherichia coli and sacrificed after 2, 8, or 24 hours. Confocal and electron microscopy revealed increased leukocyte infiltration and fibrin deposition in the intravascular and interstitial compartments. Large amounts of TF were detected by immunostaining in leukocytes and platelet-rich microthrombi. TF induction was documented by quantitative reverse transcriptase-polymerase chain reaction, enzyme-linked immunosorbent assay, and coagulation assays. Lung-associated TFPI antigen and mRNA decreased during sepsis, and TFPI activity diminished abruptly at 2 hours. Blocking antibodies against TFPI increased fibrin deposition in septic baboon lungs, suggesting that TF-dependent coagulation might be aggravated by reduced endothelial TFPI. Decreased TFPI activity coincided with the release of tissue plasminogen activator and the peak of plasmin generation, suggesting that TFPI could undergo proteolytic inactivation by plasmin. Enhanced plasmin produced in septic baboons by infusion of blocking antibodies against plasminogen activator inhibitor-1 led to decreased lung-associated TFPI and unforeseen massive fibrin deposition. We conclude that activation of TF-driven coagulation not adequately countered by TFPI may underlie the widespread thrombotic complications of sepsis. PMID:17640967

Polycyclic aromatic hydrocarbon-induced CYP1B1 activity is suppressed by perillyl alcohol in MCF-7 cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chan, Nelson L.S.; Wang Huan; Wang Yun

2006-06-01

Perillyl alcohol (POH) is a dietary monoterpene with potential applications in chemoprevention and chemotherapy. Although clinical trials are under way, POH's physiological and pharmacological properties are still unclear. In the present study, the effect of POH on polycyclic aromatic hydrocarbon (PAH)-induced genotoxicity, and the related expression were examined in MCF-7 cells. Exposure to environmental toxicant increases the risk of cancer. Many of these compounds are pro-carcinogens and are biotransformed into their ultimate genotoxic structures by xenobiotic metabolizing enzymes. CYP1A1 and 1B1 are enzymes that catalyze the biotransformation of dimethylbenz[a]anthracene (DMBA). Our data revealed that 0.5 {mu}M of POH was effectivemore » in blocking DMBA-DNA binding. Ethoxyresorufin-O-deethylase (EROD) assay indicated that the administration of POH inhibited the DMBA-induced enzyme activity in MCF-7 cells. Enzyme kinetic analysis revealed that POH inhibited CYP1B1 but not CYP1A1 activity. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay also demonstrated that the monoterpene reduced CYP1B1 mRNA abundance induced by DMBA. The present study illustrated that POH might inhibit and downregulate CYP1B1, which could protect against PAH-induced carcinogenesis.« less

Selection of reference genes for RT-qPCR analysis in a predatory biological control agent, Coleomegilla maculata (Coleoptera: Coccinellidae).

PubMed

Yang, Chunxiao; Pan, Huipeng; Noland, Jeffrey Edward; Zhang, Deyong; Zhang, Zhanhong; Liu, Yong; Zhou, Xuguo

2015-12-10

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for quantifying gene expression across various biological processes, of which requires a set of suited reference genes to normalize the expression data. Coleomegilla maculata (Coleoptera: Coccinellidae), is one of the most extensively used biological control agents in the field to manage arthropod pest species. In this study, expression profiles of 16 housekeeping genes selected from C. maculata were cloned and investigated. The performance of these candidates as endogenous controls under specific experimental conditions was evaluated by dedicated algorithms, including geNorm, Normfinder, BestKeeper, and ΔCt method. In addition, RefFinder, a comprehensive platform integrating all the above-mentioned algorithms, ranked the overall stability of these candidate genes. As a result, various sets of suitable reference genes were recommended specifically for experiments involving different tissues, developmental stages, sex, and C. maculate larvae treated with dietary double stranded RNA. This study represents the critical first step to establish a standardized RT-qPCR protocol for the functional genomics research in a ladybeetle C. maculate. Furthermore, it lays the foundation for conducting ecological risk assessment of RNAi-based gene silencing biotechnologies on non-target organisms; in this case, a key predatory biological control agent.

Enhancing acute myeloid leukemia therapy - monitoring response using residual disease testing as a guide to therapeutic decision-making.

PubMed

Tomlinson, Benjamin; Lazarus, Hillard M

2017-06-01

Current standards for monitoring the response of acute myeloid leukemia (AML) are based on morphologic assessments of the bone marrow and recovery of peripheral blood counts. A growing experience is being developed to enhance the detection of small amounts of AML, or minimal residual disease (MRD). Areas covered: Available techniques include multi-color flow cytometry (MFC) of leukemia associated immunophenotypes (LAIP), quantitative reverse transcriptase polymerase chain reaction (QRT-PCR) for detecting fusion and mutated genes (RUNX1-RUNX1T1, CBFB-MYH11, and NPM1), overexpression of genes such as WT1, and next generation sequencing (NGS) for MRD. Expert commentary: While MRD monitoring is standard of care in some leukemia subsets such as acute promyelocytic leukemia, this approach for the broader AML population does not universally predict outcomes as some patients may experience relapse in the setting of undetectable leukemia while others show no obvious disease progression despite MRD positivity. However, there are instances where MRD can identify patients at increased risk for relapse that may change recommended therapy. Currently, prospective investigations to define clinically relevant MRD thresholds are ongoing. Risk-adapted trials are needed to best define the use of MRD in the follow up of AML patients after initial induction therapy.

Particulate matter from indoor environments of classroom induced higher cytotoxicity and leakiness in human microvascular endothelial cells in comparison with those collected from corridor.

PubMed

Chua, M L; Setyawati, M I; Li, H; Fang, C H Y; Gurusamy, S; Teoh, F T L; Leong, D T; George, S

2017-05-01

We investigated the physicochemical properties (size, shape, elemental composition, and endotoxin) of size resolved particulate matter (PM) collected from the indoor and corridor environments of classrooms. A comparative hazard profiling of these PM was conducted using human microvascular endothelial cells (HMVEC). Oxidative stress-dependent cytotoxicity responses were assessed using quantitative reverse transcriptase polymerase chain reaction (RT-PCR) and high content screening (HCS), and disruption of monolayer cell integrity was assessed using fluorescence microscopy and transwell assay. Scanning electron microscopy (SEM) coupled with energy-dispersive X-ray spectroscopy (EDX) analysis showed differences in the morphology and elemental composition of PM of different sizes and origins. While the total mass of PM collected from indoor environment was lower in comparison with those collected from the corridor, the endotoxin content was substantially higher in indoor PM (e.g., ninefold higher endotoxin level in indoor PM 8.1-20 ). The ability to induce oxidative stress-mediated cytotoxicity and leakiness in cell monolayer were higher for indoor PM compared to those collected from the corridor. In conclusion, this comparative analysis suggested that indoor PM is relatively more hazardous to the endothelial system possibly because of higher endotoxin content. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae)

PubMed Central

Barandoc-Alviar, Karen; Ramirez, Girly M.; Rotenberg, Dorith; Whitfield, Anna E.

2016-01-01

The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. PMID:28076276

Elevation of macrophage-derived chemokine in eosinophilic pneumonia: a role of alveolar macrophages.

PubMed

Manabe, Kazuyoshi; Nishioka, Yasuhiko; Kishi, Jun; Inayama, Mami; Aono, Yoshinori; Nakamura, Yoichi; Ogushi, Fumitaka; Bando, Hiroyasu; Tani, Kenji; Sone, Saburo

2005-02-01

Macrophage-derived chemokine (MDC/CCL22) and thymus-and activation-regulated chemokine (TARC/CCL17) are ligands for CC chemokine receptor 4. Recently, TARC has been reported to play a role in the pathogenesis of idiopathic eosinophilic pneumonia (IEP). The purpose of this study was to evaluate the role of MDC in IEP and other interstitial lung diseases (ILDs). MDC and TARC in the bronchoalveolar lavage fluid (BALF) were measured by enzyme-linked immunosorbent assay in patients with ILDs and healthy volunteers (HV). We also examined the expression of MDC mRNA in alveolar macrophages (AM) by real-time quantitative reverse transcriptase-polymerase chain reaction. Both MDC and TARC were detected only in BALF obtained from IEP patients. The concentration of MDC was higher than that of TARC in all cases. The level of MDC in IEP correlated with that of TARC. AM from IEP patients expressed a significantly higher amount of MDC than that from HV at the levels of protein and mRNA. MDC in BALF from IEP dramatically decreased when patients achieved remission. These findings suggest that MDC, in addition to TARC, might be involved in the pathogenesis of IEP, and AM play a role in the elevation of MDC in IEP.

Comparative proteomic analysis of outer membrane protein 43 (omp43)-deficient Bartonella henselae.

PubMed

Kang, Jun-Gu; Lee, Hee-Woo; Ko, Sungjin; Chae, Joon-Seok

2018-01-31

Outer membrane proteins (OMPs) of Gram-negative bacteria constitute the first line of defense protecting cells against environmental stresses including chemical, biophysical, and biological attacks. Although the 43-kDa OMP (OMP43) is major porin protein among Bartonella henselae -derived OMPs, its function remains unreported. In this study, OMP43-deficient mutant B. henselae (Δomp43) was generated to investigate OMP43 function. Interestingly, Δ omp 43 exhibited weaker proliferative ability than that of wild-type (WT) B. henselae . To study the differences in proteomic expression between WT and Δ omp 43, two-dimensional gel electrophoresis-based proteomic analysis was performed. Based on Clusters of Orthologus Groups functional assignments, 12 proteins were associated with metabolism, 7 proteins associated with information storage and processing, and 3 proteins associated with cellular processing and signaling. By semi-quantitative reverse transcriptase polymerase chain reaction, increases in tld D, efp, ntr X, pdh A, pur B, and ATPA mRNA expression and decreases in Rho and yfe A mRNA expression were confirmed in Δ omp 43. In conclusion, this is the first report showing that a loss of OMP43 expression in B. henselae leads to retarded proliferation. Furthermore, our proteomic data provide useful information for the further investigation of mechanisms related to the growth of B. henselae.

Construction and analysis of the cDNA subtraction library of yeast and mycelial phases of Sporothrix globosa isolated in China: identification of differentially expressed genes*

PubMed Central

Hu, Qing-bi; He, Yu; Zhou, Xun

2015-01-01

Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182

Virus-Induced Gene Silencing in Cultivated Cotton (Gossypium spp.) Using Tobacco Rattle Virus.

PubMed

Mustafa, Roma; Shafiq, Muhammad; Mansoor, Shahid; Briddon, Rob W; Scheffler, Brian E; Scheffler, Jodi; Amin, Imran

2016-01-01

The study described here has optimized the conditions for virus-induced gene silencing (VIGS) in three cultivated cotton species (Gossypium hirsutum, G. arboreum, and G. herbaceum) using a Tobacco rattle virus (TRV) vector. The system was used to silence the homolog of the Arabidopsis thaliana chloroplastos alterados 1 (AtCLA1) gene, involved in chloroplast development, in G. herbaceum, G. arboreum, and six commercial G. hirsutum cultivars. All plants inoculated with the TRV vector to silence CLA1 developed a typical albino phenotype indicative of silencing this gene. Although silencing in G. herbaceum and G. arboreum was complete, silencing efficiency differed for each G. hirsutum cultivar. Reverse transcriptase polymerase chain reaction (PCR) and real-time quantitative PCR showed a reduction in mRNA levels of the CLA1 homolog in all three species, with the highest efficiency (lowest CLA1 mRNA levels) in G. arboreum followed by G. herbaceum and G. hirsutum. The results indicate that TRV is a useful vector for VIGS in Gossypium species. However, selection of host cultivar is important. With the genome sequences of several cotton species recently becoming publicly available, this system has the potential to provide a very powerful tool for the rapid, large-scale reverse-genetic analysis of genes in Gossypium spp.

Understanding of how Propionibacterium acidipropionici respond to propionic acid stress at the level of proteomics

PubMed Central

Guan, Ningzi; Shin, Hyun-dong; Chen, Rachel R.; Li, Jianghua; Liu, Long; Du, Guocheng; Chen, Jian

2014-01-01

Propionic acid (PA) is an important platform chemical in the food, agriculture, and pharmaceutical industries and is mainly biosynthesized by propionibacteria. Acid tolerance in PA-producing strains is crucial. In previous work, we investigated the acid tolerance mechanism of Propionibacterium acidipropionici at microenvironmental levels by analyzing physiological changes in the parental strain and three PA-tolerant mutants obtained by genome shuffling. However, the molecular mechanism of PA tolerance in P. acidipropionici remained unclear. Here, we performed a comparative proteomics study of P. acidipropionici CGMCC 1.2230 and the acid-tolerant mutant P. acidipropionici WSH1105; MALDI-TOF/MS identified 24 proteins that significantly differed between the parental and shuffled strains. The differentially expressed proteins were mainly categorized as key components of crucial biological processes and the acid stress response. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was used to confirm differential expression of nine key proteins. Overexpression of the secretory protein glyceraldehyde-3-phosphate dehydrogenase and ATP synthase subunit α in Escherichia coli BL21 improved PA and acetic acid tolerance; overexpression of NADH dehydrogenase and methylmalonyl-CoA epimerase improved PA tolerance. These results provide new insights into the acid tolerance of P. acidipropionici and will facilitate the development of PA production through fermentation by propionibacteria. PMID:25377721

A comparative gene expression analysis of iron-limited cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensis using newly developed iron assays

NASA Astrophysics Data System (ADS)

Abdala, Z. M.; Powell, K.; Cronin, D.; Chappell, D.

2016-02-01

A comparative gene expression analysis of iron-limited cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensisusing newly developed iron assays Zuzanna M. Abdala, Kimberly Powell, Dylan P. Cronin, P. Dreux Chappell Diatoms, accounting for about 40% of the primary production in marine ecosystems, play a vital role in the dynamics of marine systems. Iron availability is understood to be a driving factor controlling productivity of many marine phytoplankton, including diatoms, as it functions as a cofactor for many proteins including several involved with photosynthetic processes. Previous work examining transcriptomes of diatoms of the Thalassiosira genus grown in controlled laboratory settings has identified genes whose expression can be used as sensitive markers of iron status. Data mining publically available diatom transcriptome data for these genes enables development of additional iron status assays for environmentally-relevant diatoms. For the present study, gene expression analysis of iron-limited laboratory cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensis grown in continuous light was done using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). C. socialis and P. arenysensis serve as comparative models for analyzing gene expression in iron limitation in different ecological community assemblages. These data may ultimately assist to illuminate the function of iron in photosynthetic activity in diatoms.

Decreased cathepsin K levels in human atherosclerotic plaques are associated with plaque instability.

PubMed

Zhao, Huiying; Qin, Xiujiao; Wang, Shuai; Sun, Xiwei; Dong, Bin

2017-10-01

Investigating the determinants and dynamics of atherosclerotic plaque instability is a key area of current cardiovascular research. Extracellular matrix degradation from excessive proteolysis induced by enzymes such as cathepsin K (Cat K) is implicated in the pathogenesis of unstable plaques. The current study assessed the expression of Cat K in human unstable atherosclerotic plaques. Specimens of popliteal arteries with atherosclerotic plaques were classified as stable (<40% lipid core plaque area; n=6) or unstable (≥40% lipid core plaque area; n=14) based on histopathological examinations of hematoxylin and eosin stained sections. The expression of Cat K and cystatin C (Cys C) were assessed by immunohistochemical examination and levels of Cat K mRNA were detected by semi-quantitative reverse transcriptase polymerase chain reaction. Morphological changes including a larger lipid core, endothelial proliferation with foam cells and destruction of internal elastic lamina were observed in unstable atherosclerotic plaques. In unstable plaques, the expression of Cat K protein and mRNA was upregulated, whereas Cys C protein expression was downregulated. The interplay between Cat K and Cys C may underlie the progression of plaques from stable to unstable and the current study indicated that Cat K and Cys C are potential targets for preventing and treating vulnerable atherosclerotic plaque ruptures.

Submicroscopic malaria infections in pregnant women from six departments in Haiti.

PubMed

Elbadry, Maha A; Tagliamonte, Massimiliano S; Raccurt, Christian P; Lemoine, Jean F; Existe, Alexandre; Boncy, Jacques; Weppelmann, Thomas A; Dame, John B; Okech, Bernard A

2017-08-01

To describe the epidemiology of malaria in pregnancy in Haiti. Cross-sectional study among pregnant women in six departments of Haiti. After obtaining informed consent, whole blood samples and demographic surveys were collected to investigate malaria prevalence, anaemia and socio-behavioural risk factors for infection, respectively. A total of 311 pregnant women were screened for Plasmodium falciparum infection using a rapid diagnostic test (RDT), microscopy and a novel, quantitative reverse transcriptase polymerase chain reaction method (qRT-PCR). Overall, 1.2% (4/311) of pregnant women were tested positive for malaria infection by both microscopy and RDT. However, using the qRT-PCR, 16.4% (51/311) of pregnant women were positive. The prevalence of malaria infection varied with geographical locations ranging between 0% and 46.4%. Additionally, 53% of pregnant women had some form of anaemia; however, no significant association was found between anaemia and submicroscopic malaria infection. The socio-behavioural risk factors identified to be protective of malaria infection were marital status (P < 0.05) and travel within one month prior to screening (P < 0.05). This study is the first to document the high prevalence of submicroscopic malaria infections among pregnant women in Haiti and identify social and behavioural risk factors for disease transmission. © 2017 John Wiley & Sons Ltd.

Leptin influences estrogen metabolism and accelerates prostate cell proliferation.

PubMed

Habib, Christine N; Al-Abd, Ahmed M; Tolba, Mai F; Khalifa, Amani E; Khedr, Alaa; Mosli, Hisham A; Abdel-Naim, Ashraf B

2015-01-15

The present study was designed to investigate the effect of leptin on estrogen metabolism in prostatic cells. Malignant (PC-3) and benign (BPH-1) human prostate cells were treated with 17-β-hydroxyestradiol (1 μM) alone or in combination with leptin (0.4, 4, 40 ng/ml) for 72 h. Cell proliferation assay, immunocytochemical staining of estrogen receptor (ER), liquid chromatography-tandem mass spectrometry method (LC-MS) and semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) were used. Cell proliferation assay demonstrated that leptin caused significant growth potentiation in both cells. Immunocytochemical staining showed that leptin significantly increased the expression of ER-α and decreased that of ER-β in PC-3 cells. LC-MS method revealed that leptin increased the concentration 4-hydroxyestrone and/or decreased that of 2-methoxyestradiol, 4-methoxyestradiol and 2-methoxyestrone. Interestingly, RT-PCR showed that leptin significantly up-regulated the expression of aromatase and cytochrome P450 1B1 (CYP1B1) enzymes; however down-regulated the expression of catechol-o-methyltransferase (COMT) enzyme. These data indicate that leptin-induced proliferative effect in prostate cells might be partly attributed to estrogen metabolism. Thus, leptin might be a novel target for therapeutic intervention in prostatic disorders. Copyright © 2014 Elsevier Inc. All rights reserved.

The HGF Receptor c-Met Is Overexpressed in Esophageal Adenocarcinoma1

PubMed Central

Herrera, Luis J; El-Hefnawy, Talal; Queiroz de Oliveira, Pierre E; Raja, Siva; Finkelstein, Sydney; Gooding, William; Luketich, James D; Godfrey, Tony E; Hughes, Steven J

2005-01-01

Abstract The hepatocyte growth factor (HGF) receptor, Met, has established oncogenic properties; however, its expression and function in esophageal adenocarcinoma (EA) remain poorly understood. We aimed to determine the expression and potential alterations in Met expression in EA. Met expression was investigated in surgical specimens of EA, Barrett's esophagus (BE), and normal esophagus (NE) using immunohistochemistry (IHC) and quantitative reverse transcriptase polymerase chain reaction. Met expression, phosphorylation, and the effect of COX-2 inhibition on expression were examined in EA cell lines. IHC demonstrated intense Met immunoreactivity in all (100%) EA and dysplastic BE specimens. In contrast, minimal immunostaining was observed in BE without dysplasia or NE specimens. Met mRNA and protein levels were increased in three EA cell lines, and Met protein was phosphorylated in the absence of serum. Sequence analysis found the kinase domain of c-met to be wild type in all three EA cell lines. HGF mRNA expression was identified in two EA cell lines. In COX-2-overexpressing cells, COX-2 inhibition decreased Met expression. Met is consistently overexpressed in EA surgical specimens and in three EA cell lines. Met dysregulation occurs early in Barrett's dysplasia to adenocarcinoma sequence. Future study of Met inhibition as a potential biologic therapy for EA is warranted. PMID:15720819

Polycyclic aromatic hydrocarbon-induced CYP1B1 activity is suppressed by perillyl alcohol in MCF-7 cells.

PubMed

Chan, Nelson L S; Wang, Huan; Wang, Yun; Leung, Hau Yi; Leung, Lai K

2006-06-01

Perillyl alcohol (POH) is a dietary monoterpene with potential applications in chemoprevention and chemotherapy. Although clinical trials are under way, POH's physiological and pharmacological properties are still unclear. In the present study, the effect of POH on polycyclic aromatic hydrocarbon (PAH)-induced genotoxicity, and the related expression were examined in MCF-7 cells. Exposure to environmental toxicant increases the risk of cancer. Many of these compounds are pro-carcinogens and are biotransformed into their ultimate genotoxic structures by xenobiotic metabolizing enzymes. CYP1A1 and 1B1 are enzymes that catalyze the biotransformation of dimethylbenz[a]anthracene (DMBA). Our data revealed that 0.5 microM of POH was effective in blocking DMBA-DNA binding. Ethoxyresorufin-O-deethylase (EROD) assay indicated that the administration of POH inhibited the DMBA-induced enzyme activity in MCF-7 cells. Enzyme kinetic analysis revealed that POH inhibited CYP1B1 but not CYP1A1 activity. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay also demonstrated that the monoterpene reduced CYP1B1 mRNA abundance induced by DMBA. The present study illustrated that POH might inhibit and downregulate CYP1B1, which could protect against PAH-induced carcinogenesis.

Stable Reference Gene Selection for RT-qPCR Analysis in Nonviruliferous and Viruliferous Frankliniella occidentalis

PubMed Central

Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong

2015-01-01

Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔC t method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔC t method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions. PMID:26244556

Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

PubMed

Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

2012-09-01

FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*

PubMed Central

Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de

2014-01-01

1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221

Up-regulation of proproliferative genes and the ligand/receptor pair placental growth factor and vascular endothelial growth factor receptor 1 in hepatitis C cirrhosis.

PubMed

Huang, Xiao X; McCaughan, Geoffrey W; Shackel, Nicholas A; Gorrell, Mark D

2007-09-01

Cirrhosis can lead to hepatocellular carcinoma (HCC). Non-diseased liver and hepatitis C virus (HCV)-associated cirrhosis with or without HCC were compared. Proliferation pathway genes, immune response genes and oncogenes were analysed by a quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and immunostaining. Real-time RT-PCR showed up-regulation of genes in HCV cirrhosis including the proliferation-associated genes bone morphogenetic protein 3 (BMP3), placental growth factor 3 (PGF3), vascular endothelial growth factor receptor 1 (VEGFR1) and soluble VEGFR1, the oncogene FYN, and the immune response-associated genes toll-like receptor 9 (TLR9) and natural killer cell transcript 4 (NK4). Expressions of TLR2 and the oncogenes B-cell CLL/lymphoma 9 (BCL9) and PIM2 were decreased in HCV cirrhosis. In addition, PIM2 and TLR2 were increased in HCV cirrhosis with HCC compared with HCV cirrhosis. The ligand/receptor pair PGF and VEGFR1 was intensely expressed by the portal tract vascular endothelium. VEGFR1 was expressed in reactive biliary epithelial structures in fibrotic septum and in some stellate cells and macrophages. PGF and VEGFR1 may have an important role in the pathogenesis of the neovascular response in cirrhosis.

Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

PubMed

Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

2017-01-01

The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

PubMed

Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

2013-09-15

Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.

Peroxisome proliferator-activated receptor delta (PPARdelta) activation protects H9c2 cardiomyoblasts from oxidative stress-induced apoptosis.

PubMed

Pesant, Matthieu; Sueur, Stéphanie; Dutartre, Patrick; Tallandier, Mireille; Grimaldi, Paul A; Rochette, Luc; Connat, Jean-Louis

2006-02-01

Activation of peroxisome proliferator-activated receptor alpha (PPARalpha) and PPARgamma plays beneficial roles in cardiovascular disorders such as atherosclerosis and heart reperfusion. Although PPARalpha and gamma have been documented to reduce oxidative stress in the vasculature and the heart, the role of PPARdelta remains poorly studied. We focused on PPARdelta function in the regulation of oxidative stress-induced apoptosis in the rat cardiomyoblast cell line H9c2. Using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we showed that PPARdelta is the predominantly expressed isotype whereas PPARalpha was weakly detected. By performing cell viability assays, we also showed that the selective PPARdelta agonist GW501516 protected cells from H(2)O(2)-induced cell death. The protective effect of GW501516 was due to an inhibition of H(2)O(2)-triggered apoptosis as shown by annexin-V labeling, DNA fragmentation analysis, and caspase-3 activity measurement. We demonstrated by transient transfection of a dominant negative mutant of PPARdelta that the protection induced by GW501516 was totally dependent on PPARdelta. Semi-quantitative RT-PCR and Western blotting analysis demonstrated that GW501516 treatment upregulated catalase. Moreover, forced overexpression of catalase inhibited H(2)O(2)-triggered apoptosis, as evidenced by annexin-V labeling. Taken together, our results account for an important role of PPARdelta in inhibiting the onset of oxidative stress-induced apoptosis in H9c2 cells. PPARdelta appears to be a new therapeutic target for the regulation of heart reperfusion-associated oxidative stress and stimulation of enzymatic antioxidative defences.

INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

EPA Science Inventory

Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

Astrocyte- and endothelial-targeted CCL2 conditional knockout mice: critical tools for studying the pathogenesis of neuroinflammation.

PubMed

Ge, Shujun; Murugesan, Nivetha; Pachter, Joel S

2009-09-01

While the expression of the C-C chemokine ligand 2 (CCL2) in the central nervous system (CNS) is associated with numerous neuroinflammatory conditions, the critical cellular sources of this chemokine, which is responsible for disease processes-as well as associated pathogenic mechanisms, remain unresolved. As the potential for anti-CCL2 therapeutics in treating neuroinflammatory disease is likely to be contingent upon effective drug delivery to the source(s) and/or target(s) of CCL2 action in the CNS, tools to highlight the course of CCL2 action during neuroinflammation are imperative. In response to this need, we used the Cre/loxP and FLP-FRT recombination system to develop the first two, cell-conditional CCL2 knockout mice-separately targeting CCL2 gene elimination to astrocytes and endothelial cells, both of which have been considered to play crucial though undefined roles in neuroinflammatory disease. Specifically, mice containing a floxed CCL2 allele were intercrossed with GFAP-Cre or Tie2-Cre transgenic mice to generate mice with CCL2-deficient astrocytes (astrocyte KO) or endothelial cells (endothelial KO), respectively. Polymerase chain reaction, reverse transcription polymerase chain reaction/quantitative reverse transcriptase polymerase chain reaction, and enzyme-linked immunosorbent assay of CCL2 gene, RNA, and protein, respectively, from cultured astrocytes and brain microvascular endothelial cells (BMEC) established the efficiency and specificity of the CCL2 gene deletions and a CCL2 null phenotype in these CNS cells. Effective cell-conditional knockout of CCL2 was also confirmed in an in vivo setting, wherein astrocytes and BMEC were retrieved by immune-guided laser capture microdissection from their in situ positions in the brains of mice experiencing acute, lipopolysaccharide-mediated endotoxemia to induce CCL2 gene expression. In vivo analysis further revealed apparent cross-talk between BMEC and astrocytes regarding the regulation of astrocyte CCL2 expression. Use of astrocyte KO and endothelial KO mice should prove critical in elaborating the pathogenic mechanisms of and optimizing the treatments for neuroinflammatory disease.

Plasticity in Structural and Functional Interactions between the Phosphoprotein and Nucleoprotein of Measles Virus*

PubMed Central

Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

2012-01-01

The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (NTAIL). XD binding induces NTAIL α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced NTAIL folding, XD-NTAIL binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced NTAIL α-helical folding were created within Box-2 of Edmonston MeV NTAIL. Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-NTAIL binding affinity or reduction/loss of XD-induced NTAIL alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity. PMID:22318731

Plasticity in structural and functional interactions between the phosphoprotein and nucleoprotein of measles virus.

PubMed

Shu, Yaoling; Habchi, Johnny; Costanzo, Stéphanie; Padilla, André; Brunel, Joanna; Gerlier, Denis; Oglesbee, Michael; Longhi, Sonia

2012-04-06

The measles virus (MeV) phosphoprotein (P) tethers the polymerase to the nucleocapsid template for transcription and genome replication. Binding of P to nucleocapsid is mediated by the X domain of P (XD) and a conserved sequence (Box-2) within the C-terminal domain of the nucleoprotein (N(TAIL)). XD binding induces N(TAIL) α-helical folding, which in turn has been proposed to stabilize the polymerase-nucleocapsid complex, with cycles of binding and release required for transcription and genome replication. The current work directly assessed the relationships among XD-induced N(TAIL) folding, XD-N(TAIL) binding affinity, and polymerase activity. Amino acid substitutions that abolished XD-induced N(TAIL) α-helical folding were created within Box-2 of Edmonston MeV N(TAIL). Polymerase activity in minireplicons was maintained despite a 35-fold decrease in XD-N(TAIL) binding affinity or reduction/loss of XD-induced N(TAIL) alpha-helical folding. Recombinant infectious virus was recovered for all mutants, and transcriptase elongation rates remained within a 1.7-fold range of parent virus. Box-2 mutations did however impose a significant cost to infectivity, reflected in an increase in the amount of input genome required to match the infectivity of parent virus. Diminished infectivity could not be attributed to changes in virion protein composition or production of defective interfering particles, where changes from parent virus were within a 3-fold range. The results indicated that MeV polymerase activity, but not infectivity, tolerates amino acid changes in the XD-binding region of the nucleoprotein. Selectional pressure for conservation of the Box-2 sequence may thus reflect a role in assuring the fidelity of polymerase functions or the assembly of viral particles required for optimal infectivity.

Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

PubMed

Tirumalai, R S; Modak, M J

1991-07-02

We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

Low-grade sinonasal sarcoma with neural and myogenic features: a clinicopathologic analysis of 28 cases.

PubMed

Lewis, Jason T; Oliveira, Andre M; Nascimento, Antonio G; Schembri-Wismayer, David; Moore, Eric A; Olsen, Kerry D; Garcia, Joaquin G; Lonzo, Melissa L; Lewis, Jean E

2012-04-01

Sarcomas of the sinonasal region are rare. We describe a distinct spindle cell sarcoma of the sinonasal region characterized by concomitant neural and myogenic differentiation. Consultation files and surgical cases from Mayo Clinic were reviewed. Twenty-eight cases were identified that met the inclusion criteria. Clinical data were collected from medical records, consultation letters, and referring pathologists. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was performed on 18 cases. Cytogenetic studies were performed on 2 cases. The 21 female and 7 male patients ranged in age from 24 to 85 years (mean, 52 y). All cases showed a characteristic histology, which included a cellular spindle cell neoplasm with uniform, elongate nuclei and an infiltrative growth pattern. All tumors demonstrated expression of S-100 with actin positivity in 96% of cases tested. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was negative in all cases tested. Cytogenetic studies conducted on 2 cases demonstrated the chromosomal translocation t(2;4). The nasal cavity (54%) and ethmoid sinus (57%) were the most commonly involved areas, singly or in combination. Follow-up information was available for 57% (16/28) of cases, with a mean of 8.3 years. Of these, 44% (7/16) experienced at least 1 recurrence. No patient has developed metastases or died of disease. We describe a unique tumor with a characteristic morphologic, immunophenotypic, and cytogenetic profile. On the basis of the locally aggressive nature of this lesion we believe it is best considered a low-grade sarcoma and suggest the term low-grade sinonasal sarcoma with neural and myogenic features.

Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma

PubMed Central

Palmieri, Giuseppe; Satriano, Sabrina MR; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

2006-01-01

Background Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). Methods One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Results Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (≥2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Conclusion Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease. PMID:17107608

Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma.

PubMed

Palmieri, Giuseppe; Satriano, Sabrina M R; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

2006-11-15

Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (> or =2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease.

Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

PubMed

Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

2017-08-02

Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

PubMed

Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

2014-01-01

During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

Multiple nucleotide preferences determine cleavage-site recognition by the HIV-1 and M-MuLV RNases H.

PubMed

Schultz, Sharon J; Zhang, Miaohua; Champoux, James J

2010-03-19

The RNase H activity of reverse transcriptase is required during retroviral replication and represents a potential target in antiviral drug therapies. Sequence features flanking a cleavage site influence the three types of retroviral RNase H activity: internal, DNA 3'-end-directed, and RNA 5'-end-directed. Using the reverse transcriptases of HIV-1 (human immunodeficiency virus type 1) and Moloney murine leukemia virus (M-MuLV), we evaluated how individual base preferences at a cleavage site direct retroviral RNase H specificity. Strong test cleavage sites (designated as between nucleotide positions -1 and +1) for the HIV-1 and M-MuLV enzymes were introduced into model hybrid substrates designed to assay internal or DNA 3'-end-directed cleavage, and base substitutions were tested at specific nucleotide positions. For internal cleavage, positions +1, -2, -4, -5, -10, and -14 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV significantly affected RNase H cleavage efficiency, while positions -7 and -12 for HIV-1 and positions -4, -9, and -11 for M-MuLV had more modest effects. DNA 3'-end-directed cleavage was influenced substantially by positions +1, -2, -4, and -5 for HIV-1 and positions +1, -2, -6, and -7 for M-MuLV. Cleavage-site distance from the recessed end did not affect sequence preferences for M-MuLV reverse transcriptase. Based on the identified sequence preferences, a cleavage site recognized by both HIV-1 and M-MuLV enzymes was introduced into a sequence that was otherwise resistant to RNase H. The isolated RNase H domain of M-MuLV reverse transcriptase retained sequence preferences at positions +1 and -2 despite prolific cleavage in the absence of the polymerase domain. The sequence preferences of retroviral RNase H likely reflect structural features in the substrate that favor cleavage and represent a novel specificity determinant to consider in drug design. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

Quantitative Assessment of the Sensitivity of Various Commercial Reverse Transcriptases Based on Armored HIV RNA

PubMed Central

Okello, John B. A.; Rodriguez, Linda; Poinar, Debi; Bos, Kirsten; Okwi, Andrew L.; Bimenya, Gabriel S.; Sewankambo, Nelson K.; Henry, Kenneth R.; Kuch, Melanie; Poinar, Hendrik N.

2010-01-01

Background The in-vitro reverse transcription of RNA to its complementary DNA, catalyzed by the enzyme reverse transcriptase, is the most fundamental step in the quantitative RNA detection in genomic studies. As such, this step should be as analytically sensitive, efficient and reproducible as possible, especially when dealing with degraded or low copy RNA samples. While there are many reverse transcriptases in the market, all claiming to be highly sensitive, there is need for a systematic independent comparison of their applicability in quantification of rare RNA transcripts or low copy RNA, such as those obtained from archival tissues. Methodology/Principal Findings We performed RT-qPCR to assess the sensitivity and reproducibility of 11 commercially available reverse transcriptases in cDNA synthesis from low copy number RNA levels. As target RNA, we used a serially known number of Armored HIV RNA molecules, and observed that 9 enzymes we tested were consistently sensitive to ∼1,000 copies, seven of which were sensitive to ∼100 copies, while only 5 were sensitive to ∼10 RNA template copies across all replicates tested. Despite their demonstrated sensitivity, these five best performing enzymes (Accuscript, HIV-RT, M-MLV, Superscript III and Thermoscript) showed considerable variation in their reproducibility as well as their overall amplification efficiency. Accuscript and Superscript III were the most sensitive and consistent within runs, with Accuscript and Superscript II ranking as the most reproducible enzymes between assays. Conclusions/Significance We therefore recommend the use of Accuscript or Superscript III when dealing with low copy number RNA levels, and suggest purification of the RT reactions prior to downstream applications (eg qPCR) to augment detection. Although the results presented in this study were based on a viral RNA surrogate, and applied to nucleic acid lysates derived from archival formalin-fixed paraffin embedded tissue, their relative performance on RNA obtained from other tissue types may vary, and needs future evaluation. PMID:21085668

Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

EPA Science Inventory

The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

Molecular docking and 3D-QSAR studies on triazolinone and pyridazinone, non-nucleoside inhibitor of HIV-1 reverse transcriptase.

PubMed

Sivan, Sree Kanth; Manga, Vijjulatha

2010-06-01

Nonnucleoside reverse transcriptase inhibitors (NNRTIs) are allosteric inhibitors of the HIV-1 reverse transcriptase. Recently a series of Triazolinone and Pyridazinone were reported as potent inhibitors of HIV-1 wild type reverse transcriptase. In the present study, docking and 3D quantitative structure activity relationship (3D QSAR) studies involving comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) were performed on 31 molecules. Ligands were built and minimized using Tripos force field and applying Gasteiger-Hückel charges. These ligands were docked into protein active site using GLIDE 4.0. The docked poses were analyzed; the best docked poses were selected and aligned. CoMFA and CoMSIA fields were calculated using SYBYL6.9. The molecules were divided into training set and test set, a PLS analysis was performed and QSAR models were generated. The model showed good statistical reliability which is evident from the r2 nv, q2 loo and r2 pred values. The CoMFA model provides the most significant correlation of steric and electrostatic fields with biological activities. The CoMSIA model provides a correlation of steric, electrostatic, acceptor and hydrophobic fields with biological activities. The information rendered by 3D QSAR model initiated us to optimize the lead and design new potential inhibitors.

Effect of saliva stabilisers on detection of porcine reproductive and respiratory syndrome virus in oral fluid by quantitative reverse transcriptase real-time PCR.

PubMed

Decorte, Inge; Van der Stede, Yves; Nauwynck, Hans; De Regge, Nick; Cay, Ann Brigitte

2013-08-01

This study evaluated the effect of extraction-amplification methods, storage temperature and saliva stabilisers on detection of porcine reproductive and respiratory syndrome virus (PRRSV) RNA by quantitative reverse transcriptase real-time PCR (qRT-PCR) in porcine oral fluid. The diagnostic performance of different extraction-amplification methods was examined using a dilution series of oral fluid spiked with PRRSV. To determine RNA stability, porcine oral fluid, with or without commercially available saliva stabilisers, was spiked with PRRSV, stored at 4°C or room temperature and tested for the presence of PRRSV RNA by qRT-PCR. PRRSV RNA could be detected in oral fluid using all extraction-amplification combinations, but the limit of detection varied amongst different combinations. Storage temperature and saliva stabilisers had an effect on the stability of PRRSV RNA, which could only be detected for 7 days when PRRSV spiked oral fluid was kept at 4°C or stabilised at room temperature with a commercial mRNA stabiliser. Copyright © 2013 Elsevier Ltd. All rights reserved.

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

PubMed Central

Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

1977-01-01

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

Design, synthesis and biological evaluations of N-Hydroxy thienopyrimidine-2,4-diones as inhibitors of HIV reverse transcriptase-associated RNase H.

PubMed

Kankanala, Jayakanth; Kirby, Karen A; Huber, Andrew D; Casey, Mary C; Wilson, Daniel J; Sarafianos, Stefan G; Wang, Zhengqiang

2017-12-01

Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) is the only HIV enzymatic function not targeted by current antiviral drugs. Although various chemotypes have been reported to inhibit HIV RNase H, few have shown significant antiviral activities. We report herein the design, synthesis and biological evaluation of a novel N-hydroxy thienopyrimidine-2,3-dione chemotype (11) which potently and selectively inhibited RNase H with considerable potency against HIV-1 in cell culture. Current structure-activity-relationship (SAR) identified analogue 11d as a nanomolar inhibitor of RNase H (IC 50  = 0.04 μM) with decent antiviral potency (EC 50  = 7.4 μM) and no cytotoxicity (CC 50  > 100 μM). In extended biochemical assays compound 11d did not inhibit RT polymerase (pol) while inhibiting integrase strand transfer (INST) with 53 fold lower potency (IC 50  = 2.1 μM) than RNase H inhibition. Crystallographic and molecular modeling studies confirmed the RNase H active site binding mode. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

PubMed

Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

2017-09-01

It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

Expression of Functional Influenza Virus RNA Polymerase in the Methylotrophic Yeast Pichia pastoris

PubMed Central

Hwang, Jung-Shan; Yamada, Kazunori; Honda, Ayae; Nakade, Kohji; Ishihama, Akira

2000-01-01

Influenza virus RNA polymerase with the subunit composition PB1-PB2-PA is a multifunctional enzyme with the activities of both synthesis and cleavage of RNA and is involved in both transcription and replication of the viral genome. In order to produce large amounts of the functional viral RNA polymerase sufficient for analysis of its structure-function relationships, the cDNAs for RNA segments 1, 2, and 3 of influenza virus A/PR/8, each under independent control of the alcohol oxidase gene promoter, were integrated into the chromosome of the methylotrophic yeast Pichia pastoris. Simultaneous expression of all three P proteins in the yeast P. pastoris was achieved by the addition of methanol. To purify the P protein complexes, a sequence coding for a histidine tag was added to the PB2 protein gene at its N terminus. Starting from the induced P. pastoris cell lysate, we partially purified a 3P complex by Ni2+-agarose affinity column chromatography. The 3P complex showed influenza virus model RNA-directed and ApG-primed RNA synthesis in vitro but was virtually inactive without addition of template or primer. The kinetic properties of model template-directed RNA synthesis and the requirements for template sequence were analyzed using the 3P complex. Furthermore, the 3P complex showed capped RNA-primed RNA synthesis. Thus, we conclude that functional influenza virus RNA polymerase with the catalytic properties of a transcriptase is formed in the methylotrophic yeast P. pastoris. PMID:10756019

Analytical validation of a reverse transcriptase droplet digital PCR (RT-ddPCR) for quantitative detection of infectious hematopoietic necrosis virus

USGS Publications Warehouse

Jia, Peng; Purcell, Maureen; Pan, Guang; Wang, Jinjin; Kan, Shifu; Liu, Yin; Zheng, Xiaocong; SHi, Xiujie; He, Junqiang; Yu, Li; Hua, Qunyi; Lu, Tikang; Lan, Wensheng; Winton, James; Jin, Ningyi; Liu, Hong

2017-01-01

Infectious hematopoietic necrosis virus (IHNV) is an important pathogen of salmonid fishes. A validated universal reverse transcriptase quantitative PCR (RT-qPCR) assay that can quantify levels of IHNV in fish tissues has been previously reported. In the present study, we adapted the published set of IHNV primers and probe for use in a reverse-transcriptase droplet digital PCR (RT-ddPCR) assay for quantification of the virus in fish tissue samples. The RT-ddPCR and RT-qPCR assays detected 13 phylogenetically diverse IHNV strains, but neither assay produced detectable amplification when RNA from other fish viruses was used. The RT-ddPCR assay had a limit of detection (LOD) equating to 2.2 plaque forming units (PFU)/μl while the LOD for the RT-qPCR was 0.2 PFU/μl. Good agreement (69.4–100%) between assays was observed when used to detect IHNV RNA in cell culture supernatant and tissues from IHNV infected rainbow trout (Oncorhynchus mykiss) and arctic char (Salvelinus alpinus). Estimates of RNA copy number produced by the two assays were significantly correlated but the RT-qPCR consistently produced higher estimates than the RT-ddPCR. The analytical properties of the N gene RT-ddPCR test indicated that this method may be useful to assess IHNV RNA copy number for research and diagnostic purposes. Future work is needed to establish the within and between laboratory diagnostic performance of the RT-ddPCR assay.

Quantitation of CYP1A1 and 1B1 mRNA in polycyclic aromatic hydrocarbon-treated human T-47D and HepG2 cells by a modified bDNA assay using fluorescence detection.

PubMed

Wu, Susan J; Spink, David C; Spink, Barbara C; Kaminsky, Laurence S

2003-01-15

The quantitation of mRNA, essential for assessing mechanisms of enzyme regulation, is normally carried out using reverse transcriptase-polymerase chain reaction (RT-PCR). An alternative method uses a signal-amplification nucleic acid probe assay, which measures RNA directly by the QuantiGene Expression Kit and incorporates branched DNA technology from Bayer and luminometer-based readings of a chemilumigenic alkaline phosphatase substrate. To broaden the utility of this assay, we investigated substitution of a fluorescent substrate, 2'-(2-benzothiazol)-6'-hydroxybenzothiazole phosphate and a fluorometer, and applied the method to quantitation of CYP1A1 and 1B1 mRNA in human T-47D and HepG2 cells following induction by benzo[a]pyrene (B[a]P) and dibenzo[a,h]anthracene (DB[a,h]A). The fluorescence response increased linearly for 200 min without photobleaching and increased linearly (r2=0.997) up to at least 0.2 microg total RNA. The data revealed that at 0.5 and 1.0 microM inducing agent, the induction of CYP1A1 mRNA in HepG2 cells by DB[a,h]A exceeded that by B[a]P by 18- and 6-fold, respectively. In T-47D cells B[a]P induced CYP1A1 mRNA by 23-fold and CYP1B1 mRNA by 3.9-fold. A B[a]P cocontaminant in the environment, arsenite, did not affect B[a]P-induced levels of CYP1A1 or 1B1 mRNA in these cells. The modified analytical system provides a rapid-throughput, reproducible, and less labor-intensive method than RT-PCR for quantifying cellular mRNA levels.

Characterization of neuronal cell death in the spiral ganglia of a mouse model of endolymphatic hydrops.

PubMed

Semaan, Maroun T; Zheng, Qing Y; Han, Fengchan; Zheng, Yuxi; Yu, Heping; Heaphy, John C; Megerian, Cliff A

2013-04-01

Spiral ganglion neurons (SGN) in the Phex male mouse, a murine model of postnatal endolymphatic hydrops (ELH) undergo progressive deterioration reminiscent of human and other animal models of ELH with features suggesting apoptosis as an important mechanism. Histologic analysis of the mutant's cochlea demonstrates ELH by postnatal Day (P) 21 and SGN loss by P90. The SGN loss seems to occur in a consistent topographic pattern beginning at the cochlear apex. SGN were counted at P60, P90, and P120. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative PCR, and immunohistochemical analyses of activated caspase-3, caspase-8, and caspase-9 were performed on cochlear sections obtained from mutants and controls. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay (TUNEL) was carried out on 2 mutants and 2 controls. Corrected SGN counts in control mice were greater in the apical turn of the cochleae at P90 and P120, respectively (p < 0.01). Increased expression of activated caspase-3, caspase-8, and caspase-9 was seen in the mutant. At later time points, activated caspase expression gradually declined in the apical turns and increased in basal turns of the cochlea. Quantitative and semiquantitative PCR analysis confirmed increased expression of caspase-3, caspase-8, and caspase-9 at P21 and P40. TUNEL staining demonstrated apoptosis at P90 in the apical and basal turns of the mutant cochleae. SGN degeneration in the Phex /Y mouse seems to mimic patterns observed in other animals with ELH. Apoptosis plays an important role in the degeneration of the SGN in the Phex male mouse.

Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

PubMed Central

Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

2012-01-01

Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

Gene expression analysis in lymphoblasts derived from patients with autism spectrum disorder.

PubMed

Yasuda, Yuka; Hashimoto, Ryota; Yamamori, Hidenaga; Ohi, Kazutaka; Fukumoto, Motoyuki; Umeda-Yano, Satomi; Mohri, Ikuko; Ito, Akira; Taniike, Masako; Takeda, Masatoshi

2011-05-26

The autism spectrum disorders (ASDs) are complex neurodevelopmental disorders that result in severe and pervasive impairment in the development of reciprocal social interaction and verbal and nonverbal communication skills. In addition, individuals with ASD have stereotypical behavior, interests and activities. Rare mutations of some genes, such as neuroligin (NLGN) 3/4, neurexin (NRXN) 1, SHANK3, MeCP2 and NHE9, have been reported to be associated with ASD. In the present study, we investigated whether alterations in mRNA expression levels of these genes could be found in lymphoblastoid cell lines derived from patients with ASD. We measured mRNA expression levels of NLGN3/4, NRXN1, SHANK3, MeCP2, NHE9 and AKT1 in lymphoblastoid cells from 35 patients with ASD and 35 healthy controls, as well as from 45 patients with schizophrenia and 45 healthy controls, using real-time quantitative reverse transcriptase polymerase chain reaction assays. The mRNA expression levels of NLGN3 and SHANK3 normalized by β-actin or TBP were significantly decreased in the individuals with ASD compared to controls, whereas no difference was found in the mRNA expression level of MeCP2, NHE9 or AKT1. However, normalized NLGN3 and SHANK3 gene expression levels were not altered in patients with schizophrenia, and expression levels of NLGN4 and NRXN1 mRNA were not quantitatively measurable in lymphoblastoid cells. Our results provide evidence that the NLGN3 and SHANK3 genes may be differentially expressed in lymphoblastoid cell lines from individuals with ASD compared to those from controls. These findings suggest the possibility that decreased mRNA expression levels of these genes might be involved in the pathophysiology of ASD in a substantial population of ASD patients.

Biologic determinants of tumor recurrence in stage II colon cancer: validation study of the 12-gene recurrence score in cancer and leukemia group B (CALGB) 9581.

PubMed

Venook, Alan P; Niedzwiecki, Donna; Lopatin, Margarita; Ye, Xing; Lee, Mark; Friedman, Paula N; Frankel, Wendy; Clark-Langone, Kim; Millward, Carl; Shak, Steven; Goldberg, Richard M; Mahmoud, Najjia N; Warren, Robert S; Schilsky, Richard L; Bertagnolli, Monica M

2013-05-10

A greater understanding of the biology of tumor recurrence should improve adjuvant treatment decision making. We conducted a validation study of the 12-gene recurrence score (RS), a quantitative assay integrating stromal response and cell cycle gene expression, in tumor specimens from patients enrolled onto Cancer and Leukemia Group B (CALGB) 9581. CALGB 9581 randomly assigned 1,713 patients with stage II colon cancer to treatment with edrecolomab or observation and found no survival difference. The analysis reported here included all patients with available tissue and recurrence (n = 162) and a random (approximately 1:3) selection of nonrecurring patients. RS was assessed in 690 formalin-fixed paraffin-embedded tumor samples with quantitative reverse transcriptase polymerase chain reaction by using prespecified genes and a previously validated algorithm. Association of RS and recurrence was analyzed by weighted Cox proportional hazards regression. Continuous RS was significantly associated with risk of recurrence (P = .013) as was mismatch repair (MMR) gene deficiency (P = .044). In multivariate analyses, RS was the strongest predictor of recurrence (P = .004), independent of T stage, MMR, number of nodes examined, grade, and lymphovascular invasion. In T3 MMR-intact (MMR-I) patients, prespecified low and high RS groups had average 5-year recurrence risks of 13% (95% CI, 10% to 16%) and 21% (95% CI, 16% to 26%), respectively. The 12-gene RS predicts recurrence in stage II colon cancer in CALGB 9581. This is consistent with the importance of stromal response and cell cycle gene expression in colon tumor recurrence. RS appears to be most discerning for patients with T3 MMR-I tumors, although markers such as grade and lymphovascular invasion did not add value in this subset of patients.

Validation study of a quantitative multigene reverse transcriptase-polymerase chain reaction assay for assessment of recurrence risk in patients with stage II colon cancer.

PubMed

Gray, Richard G; Quirke, Philip; Handley, Kelly; Lopatin, Margarita; Magill, Laura; Baehner, Frederick L; Beaumont, Claire; Clark-Langone, Kim M; Yoshizawa, Carl N; Lee, Mark; Watson, Drew; Shak, Steven; Kerr, David J

2011-12-10

We developed quantitative gene expression assays to assess recurrence risk and benefits from chemotherapy in patients with stage II colon cancer. We sought validation by using RNA extracted from fixed paraffin-embedded primary colon tumor blocks from 1,436 patients with stage II colon cancer in the QUASAR (Quick and Simple and Reliable) study of adjuvant fluoropyrimidine chemotherapy versus surgery alone. A recurrence score (RS) and a treatment score (TS) were calculated from gene expression levels of 13 cancer-related genes (n = 7 recurrence genes and n = 6 treatment benefit genes) and from five reference genes with prespecified algorithms. Cox proportional hazards regression models and log-rank methods were used to analyze the relationship between the RS and risk of recurrence in patients treated with surgery alone and between TS and benefits of chemotherapy. Risk of recurrence was significantly associated with RS (hazard ratio [HR] per interquartile range, 1.38; 95% CI, 1.11 to 1.74; P = .004). Recurrence risks at 3 years were 12%, 18%, and 22% for predefined low, intermediate, and high recurrence risk groups, respectively. T stage (HR, 1.94; P < .001) and mismatch repair (MMR) status (HR, 0.31; P < .001) were the strongest histopathologic prognostic factors. The continuous RS was associated with risk of recurrence (P = .006) beyond these and other covariates. There was no trend for increased benefit from chemotherapy at higher TS (P = .95). The continuous 12-gene RS has been validated in a prospective study for assessment of recurrence risk in patients with stage II colon cancer after surgery and provides prognostic value that complements T stage and MMR. The TS was not predictive of chemotherapy benefit.

Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR).

PubMed

Jeong, Jae-Kyo; Kang, Min-Hee; Gurunathan, Sangiliyandi; Cho, Ssang-Goo; Park, Chankyu; Seo, Han Geuk; Kim, Jin-Hoi

2014-09-25

Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) is the most sensitive, and valuable technique for rare mRNA detection. However, the expression profiles of reference genes under different experimental conditions, such as different mouse strains, developmental stage, and culture conditions have been poorly studied. mRNA stability of the actb, gapdh, sdha, ablim, ywhaz, sptbn, h2afz, tgfb1, 18 s and wrnip genes was analyzed. Using the NormFinder program, the most stable genes are as follows: h2afz for the B6D2F-1 and C57BL/6 strains; sptbn for ICR; h2afz for KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos; wrnip for M16 culture of B6D2F-1 and C57BL/6 strain-derived embryos; ywhaz, tgfb1, 18 s, 18 s, ywhaz, and h2afz for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst embryonic stages cultured in KSOM medium, respectively; h2afz, wrnip, wrnip, h2afz, ywhaz, and ablim for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in CZB medium, respectively; 18 s, h2afz, h2afz, actb, h2afz, and wrnip for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in M16 medium, respectively. These results demonstrated that candidate reference genes for normalization of target gene expression using RT-qPCR should be selected according to mouse strains, developmental stage, and culture conditions.

Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

PubMed

Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

2014-09-01

Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

The Anti-Human Immunodeficiency Virus Drug Tenofovir, a Reverse Transcriptase Inhibitor, Also Targets the Herpes Simplex Virus DNA Polymerase.

PubMed

Andrei, Graciela; Gillemot, Sarah; Topalis, Dimitrios; Snoeck, Robert

2018-02-14

Genital herpes is an important cofactor for acquisition of human immunodeficiency virus (HIV) infection, and effective prophylaxis is a helpful strategy to halt both HIV and herpes simplex virus (HSV) transmission. The antiretroviral agent tenofovir, formulated as a vaginal microbicide gel, was shown to reduce the risk of HIV and HSV type 2 (HSV-2) acquisition. HSV type 1 (HSV-1) and HSV-2 mutants were selected for resistance to tenofovir and PMEO-DAPy (6-phosphonylmethoxyethoxy-2,4-diaminopyrimidine, an acyclic nucleoside phosphonate with dual anti-HSV and anti-HIV activity) by stepwise dose escalation. Several plaque-purified viruses were characterized phenotypically (drug resistance profiling) and genotypically (sequencing of the viral DNA polymerase gene). Tenofovir resistant and PMEO-DAPy-resistant viruses harbored specific amino acid substitutions associated with resistance not only to tenofovir and PMEO-DAPy but also to acyclovir and foscarnet. These amino acid changes (A719V, S724N, and L802F [HSV-1] and M789T and A724V [HSV-2]) were also found in clinical isolates recovered from patients refractory to acyclovir and/or foscarnet therapy or in laboratory-derived strains. A total of 10 (HSV-1) and 18 (HSV-2) well-characterized DNA polymerase mutants had decreased susceptibility to tenofovir and PMEO-DAPy. Tenofovir and PMEO-DAPy target the HSV DNA polymerase, and clinical isolates with DNA polymerase mutations emerging under acyclovir and/or foscarnet therapy showed cross-resistance to tenofovir and PMEO-DAPy. © The Author(s) 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail: journals.permissions@oup.com.

Determining Resistance of Toxoplasma gondii Oocysts to UV Disinfection Using Cell Culture and a Mouse Bioassay

USDA-ARS?s Scientific Manuscript database

The effect of UV exposure on Toxoplasma gondii oocysts has not been completely defined for use in water disinfection. This study evaluated irradiated oocysts by three assays: a SCID mouse biassay, an in vitro T. gondii oocyst plaque assay (TOP-assay), and a quantitative reverse-transcriptase real-t...

Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.

PubMed

Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

2017-02-06

Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

Aggressive melanoma cells escape from BMP7-mediated autocrine growth inhibition through coordinated Noggin upregulation

PubMed Central

Hsu, Mei-Yu; Rovinsky, Sherry; Lai, Chiou-Yan; Qasem, Shadi; Liu, Xiaoming; How, Joan; Engelhardt, John F.; Murphy, George F.

2009-01-01

Bone morphogenetic proteins (BMPs) are members of the TGF-β superfamily responsible for mediating a diverse array of cellular functions both during embryogenesis and in adult life. Previously, we reported that upregulation of BMP7 in human melanoma correlates with tumor progression. However, melanoma cells are either inhibited by or become resistant to BMP7 as a function of tumor progression, with normal melanocytes being most susceptible. Herein, real-time quantitative reverse transcriptase-polymerase chain reactions and Western blotting revealed that the expression of BMP antagonist, Noggin, correlates with resistance to BMP7 in advanced melanoma cells. To test the hypothesis that coordinated upregulation of Noggin protects advanced melanoma cells from autocrine inhibition by BMP7, functional expression of Noggin in susceptible melanoma cells was achieved by adenoviral gene transfer. The Noggin-overexpressing cells exhibited a growth advantage in response to subsequent BMP7 transduction in vitro under anchorage-dependent and -independent conditions, in three-dimensional skin reconstructs, as well as in vivo in severe combined immune-deficiency mice. In concordance, Noggin knockdown by lentiviral shRNA confers sensitivity to BMP7-induced growth inhibition in advanced melanoma cells. Our findings suggest that, like TGF-β, BMP7 acts as an autocrine growth inhibitor in melanocytic cells, and that advanced melanoma cells may escape from BMP7-induced inhibition through concomitant aberrant expression of Noggin. PMID:18560367

Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6

PubMed Central

Yuan, Jun; Zhang, Nan; Huang, Qiwei; Raza, Waseem; Li, Rong; Vivanco, Jorge M.; Shen, Qirong

2015-01-01

The successful colonization of plant growth promoting rhizobacteria (PGPR) in the rhizosphere is an initial and compulsory step in the protection of plants from soil-borne pathogens. Therefore, it is necessary to evaluate the role of root exudates in the colonization of PGPR. Banana root exudates were analyzed by high pressure liquid chromatography (HPLC) which revealed exudates contained several organic acids (OAs) including oxalic, malic and fumaric acid. The chemotactic response and biofilm formation of Bacillus amyloliquefaciens NJN-6 were investigated in response to OA’s found in banana root exudates. Furthermore, the transcriptional levels of genes involved in biofilm formation, yqxM and epsD, were evaluated in response to OAs via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Results suggested that root exudates containing the OAs both induced the chemotaxis and biofilm formation in NJN-6. In fact, the strongest chemotactic and biofilm response was found when 50 μM of OAs were applied. More specifically, malic acid showed the greatest chemotactic response whereas fumaric acid significantly induced biofilm formation by a 20.7–27.3% increase and therefore biofilm formation genes expression. The results showed banana root exudates, in particular the OAs released, play a crucial role in attracting and initiating PGPR colonization on the host roots. PMID:26299781

Specific Detection of CD56 (NCAM) Isoforms for the Identification of Aggressive Malignant Neoplasms with Progressive Development

PubMed Central

Gattenlöhner, Stefan; Stühmer, Thorsten; Leich, Ellen; Reinhard, Matthias; Etschmann, Benjamin; Völker, Hans-Ulrich; Rosenwald, Andreas; Serfling, Edgar; Christian Bargou, Ralf; Ertl, Georg; Einsele, Hermann; Müller-Hermelink, Hans-Konrad

2009-01-01

Alternative splicing of transcripts from many cancer-associated genes is believed to play a major role in carcinogenesis as well as in tumor progression. Alternative splicing of one such gene, the neural cell adhesion molecule CD56 (NCAM), impacts the progression, inadequate therapeutic response, and reduced total survival of patients who suffer from numerous malignant neoplasms. Although previous investigations have determined that CD56 exists in three major isoforms (CD56120kD, CD56140kD, and CD56180kD) with individual structural and functional properties, neither the expression profiles nor the functional relevance of these isoforms in malignant tumors have been consistently investigated. Using new quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) strategies and novel CD56 isoform-specific antibodies, CD56140kD was shown to be exclusively expressed in a number of highly malignant CD56+ neoplasms and was associated with the progression of CD56+ precursor lesions of unclear malignant potential. Moreover, only CD56140kD induced antiapoptotic/proliferative pathways and specifically phosphorylated calcium-dependent kinases that are relevant for tumorigenesis. We conclude, therefore, that the specific detection of CD56 isoforms will help to elucidate their individual functions in the pathogenesis and progression of malignant neoplasms and may have a positive impact on the development of CD56-based immunotherapeutic strategies. PMID:19246644

SGK is a primary glucocorticoid-induced gene in the human.

PubMed

Náray-Fejes-Tóth, A; Fejes-Tóth, G; Volk, K A; Stokes, J B

2000-12-01

Serum- and glucocorticoid-induced kinase (sgk) is transcriptionally regulated by corticosteroids in several cell types. Recent findings suggest that sgk is an important gene in the early action of corticosteroids on epithelial sodium reabsorption. Surprisingly, the human sgk was reported not to be transcriptionally regulated by corticosteroids in a hepatoma cell line, and thus far no glucocorticoid response element has been identified in the human SGK gene. Since humans clearly respond to both aldosterone and glucocorticoids in cells where sgk action seems to be important, in this study we determined sgk mRNA levels following dexamethasone treatment for various duration in five human cell lines. These cell lines included epithelial cells (H441, T84 and HT29) and lymphoid/monocyte (U937 and THP-1) lines. Using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we found that sgk mRNA levels are markedly induced by glucocorticoids in all of the five cell lines studied. Time course analyses revealed that sgk mRNA levels are elevated as early as 30 min after addition of the glucocorticoid, and remain elevated for several hours. Northern analysis in H441 cells confirmed that sgk is an early induced gene. The induction of sgk by dexamethasone was unaffected by cycloheximide, indicating that it does not require de novo protein synthesis. These results indicate that the human sgk, just like its counterparts in other species, is a primary glucocorticoid-induced gene.

Overexpression of PHRF1 attenuates the proliferation and tumorigenicity of non-small cell lung cancer cells.

PubMed

Wang, Yadong; Wang, Haiyu; Pan, Teng; Li, Li; Li, Jiangmin; Yang, Haiyan

2016-09-27

The aim of this study was to investigate the potential role of PHRF1 in lung tumorigenesis. Western blot analysis was used to detect the expression of proteins. Quantitative reverse transcriptase polymerase chain reaction, immunohistochemistry, soft agar assay and tumor formation assay in nude mice were applied. Cell cycle distribution was analyzed by flow cytometry. The lower level of PHRF1 mRNA was observed in human lung cancer tissues than that in paracancerous tissues. The decreased expression of PHRF1 protein was observed in H1299 and H1650 cell lines than that in 16HBE and BEAS-2B cell lines. The decreased expression of PHRF1 protein was observed in malignant 16HBE cells compared to control cells. The reduced expression of PHRF1 protein was observed in mice lung tissues treated with BaP than that in control group. Overexpression of PHRF1 inhibited H1299 cell proliferation, colony formation in vitro and growth of tumor xenograft in vivo, and arrested cell cycle in G1 phase. The decreased expression of TGIF and c-Myc proteins and the increased expression of p21 protein were observed in H1299-PHRF1 cells compared with H1299-pvoid cells. In conclusion, our findings suggest that overexpression of PHRF1 attenuated the proliferation and tumorigenicity of non-small cell lung cancer cell line of H1299.

Effect of miRNA-203 on cervical cancer cells and its underlying mechanism.

PubMed

Yin, X Z; Zhao, D M; Zhang, G X; Liu, L

2016-09-23

miRNA-203 is involved in the development and progression of various types of cancer. However, its role in cervical cancer remains unclear. The aim of this study was to investigate the effect of miRNA-203 on the proliferation and migration of HeLa cervical cancer cells, as well as survivin expression in these cells. A miRNA-203 primer probe was designed according to a sequence obtained from NCBI. The expression of miRNA-203 in cervical epithelial cells and cervical cancer cells was detected by quantitative reverse transcriptase-polymerase chain reaction. The miRNA-203 expression pattern was compared between these two cell lines. The cervical cancer cells were transfected with miRNA-203 mimic or inhibitor to determine their effects on proliferation and migration. The expression of the miRNA-203 target protein (survivin) was analyzed by western blot. Cervical cancer cells showed reduced miRNA-203 expression compared to cervical epithelial cells. Transfection of miRNA-203 mimic upregulated the expression of miRNA-203, suppressed cell proliferation and migration, and downregulated survivin expression (P < 0.05). However, downregulation of miRNA-203 expression did not affect proliferation, migration, and survivin expression in cervical cancer cells (P > 0.05). In conclusion, upregulation of miRNA-203 in cervical cancer cells inhibits the proliferative and migratory capacities of these cells by downregulating the expression of survivin.

Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae).

PubMed

Barandoc-Alviar, Karen; Ramirez, Girly M; Rotenberg, Dorith; Whitfield, Anna E

2016-01-01

The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

PubMed

Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

2012-10-01

Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

An investigation into the effect of surface roughness of stainless steel on human umbilical vein endothelial cell gene expression.

PubMed

McLucas, E; Moran, M T; Rochev, Y; Carroll, W M; Smith, T J

2006-01-01

The surface properties of vascular devices dictate the initial postimplantation reactions that occur and thus the efficacy of the implantation procedure. Over the last number of years, a number of different stent designs have emerged and stents are generally polished to a mirror finish during the manufacturing procedure. This study sought to investigate the effect of stainless steel surface roughness on endothelial cell gene expression using an appropriate cell culture in vitro assay system. Stainless steel discs were roughened by shot blasting or polished by mechanical polishing. The surface roughness of the treated and untreated discs was determined by atomic force microscopy (AFM). Cells were seeded on collagen type 1 gels and left to attach for 24 h. Stainless steel discs of varying roughness were then placed in contact with the cells and incubated for 24 h. RNA extractions and quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) was then performed to determine the expression levels of candidate genes in the treated cells compared to suitable control cells. E-selectin and vascular cellular adhesion molecule (VCAM-1) were found to be significantly up-regulated in cells incubated with polished and roughened samples, indicating endothelial cell activation and inflammation. This study indicates that the surface roughness of stainless steel is an important surface property in the development of vascular stents.

A distinct role of pectate lyases in the formation of feeding structures induced by cyst and root-knot nematodes.

PubMed

Wieczorek, K; Elashry, A; Quentin, M; Grundler, F M W; Favery, B; Seifert, G J; Bohlmann, H

2014-09-01

Pectin in the primary plant cell wall is thought to be responsible for its porosity, charge density, and microfibril spacing and is the main component of the middle lamella. Plant-parasitic nematodes secrete cell wall-degrading enzymes that macerate the plant tissue, facilitating the penetration and migration within the roots. In sedentary endoparasitic nematodes, these enzymes are released only during the migration of infective juveniles through the root. Later, nematodes manipulate the expression of host plant genes, including various cell wall enzymes, in order to induce specific feeding sites. In this study, we investigated expression of two Arabidopsis pectate lyase-like genes (PLL), PLL18 (At3g27400) and PLL19 (At4g24780), together with pectic epitopes with different degrees of methylesterification in both syncytia induced by the cyst nematode Heterodera schachtii and giant cells induced by the root-knot nematode Meloidogyne incognita. We confirmed upregulation of PLL18 and PLL19 in both types of feeding sites with quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Furthermore, the functional analysis of mutants demonstrated the important role of both PLL genes in the development and maintenance of syncytia but not giant cells. Our results show that both enzymes play distinct roles in different infected root tissues as well as during parasitism of different nematodes.

Low-level lasers alter mRNA levels from traditional reference genes used in breast cancer cells

NASA Astrophysics Data System (ADS)

Teixeira, A. F.; Canuto, K. S.; Rodrigues, J. A.; Fonseca, A. S.; Mencalha, A. L.

2017-07-01

Cancer is among the leading causes of mortality worldwide, increasing the importance of treatment development. Low-level lasers are used in several diseases, but some concerns remains on cancers. Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a technique used to understand cellular behavior through quantification of mRNA levels. Output data from target genes are commonly relative to a reference that cannot vary according to treatment. This study evaluated reference genes levels from MDA-MB-231 cells exposed to red or infrared lasers at different fluences. Cultures were exposed to red and infrared lasers, incubated (4 h, 37 °C), total RNA was extracted and cDNA synthesis was performed to evaluate mRNA levels from ACTB, GUSB and TRFC genes by RT-qPCR. Specific amplification was verified by melting curves and agarose gel electrophoresis. RefFinder enabled data analysis by geNorm, NormFinder and BestKeeper. Specific amplifications were obtained and, although mRNA levels from ACTB, GUSB or TRFC genes presented no significant variation through traditional statistical analysis, Excel-based tools revealed that the use of these reference genes are dependent of laser characteristics. Our data showed that exposure to low-level red and infrared lasers at different fluences alter the mRNA levels from ACTB, GUSB and TRFC in MDA-MB-231 cells.

Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots

PubMed Central

Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

2017-01-01

Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. ‘MAPK cascade’), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway’), reactive oxygen species (ROS) metabolic process (e.g. ‘hydrogen peroxide catabolic process’) and transcription factors (e.g., ‘MYB, ZFP and bZIP’) were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment. PMID:28165059

Presence of Human Herpesvirus 6B in the Pancreas of Subjects With and Without Type 1 Diabetes.

PubMed

Ericsson, Maja; Skog, Oskar

The aims of this study were to investigate the presence of human herpesvirus 6 (HHV6) A and B in human pancreata and to search for signs of active infection in this organ of subjects with and without type 1 diabetes (T1D). Pancreata from brain-dead organ donors with and without T1D were examined for the presence of HHV6 genomic sequences by polymerase chain reaction (PCR), transcripts by reverse transcriptase-PCR, and protein by immunohistochemistry. Quantitative PCR of isolated pancreatic islets and exocrine cell clusters was used to determine the intrapancreatic location of HHV6 DNA. Human herpesvirus 6B genomic sequences were present in 1 of 2 donors who died of acute-onset T1D, 4 of 6 donors with long-standing T1D, and 9 of 12 nondiabetic donors. Higher copy numbers of HHV6B DNA were present in isolated islets than in exocrine tissue from the same donors. No signs of active HHV6 transcription were found. Human herpesvirus 6A was not present in any tested pancreas. The herein presented data demonstrate, for the first time, the presence of a latent HHV6B infection in the pancreas and islets of Langerhans. Whether this virus can contribute to disease in the pancreas remains to be determined.

Role of deferoxamine on enzymatic stress markers in an animal model of Alzheimer's disease after chronic aluminum exposure.

PubMed

Esparza, José L; Garcia, Tania; Gómez, Mercedes; Nogués, M Rosa; Giralt, Montserrat; Domingo, José L

2011-06-01

The effect of the chelator deferoxamine (DFO) on the activity of enzymatic stress markers was assessed in amyloid beta peptide (AβPP) transgenic mice, an animal model of Alzheimer's disease, after oral aluminum (Al) exposure for 6 months. AβPP transgenic (Tg2576) and C57BL6/SJL wild-type mice of 5 months of age were fed a diet supplemented with Al lactate (1 mg of Al/g food). Four groups of Tg2576 and wild-type animals were used: control, Al only, DFO only, and Al plus DFO. Mice in the DFO-treated groups received also subcutaneous injections of 0.20 mmol/kg/d of this chelating agent twice a week until the end of the study at 11 months of age. The hippocampus, cerebellum, and cortex were removed and processed to examine a number of oxidative stress markers. Furthermore, the expression of Cu-Zn superoxide dismutase, glutathione reductase, and catalase was evaluated by quantitative reverse transcriptase polymerase chain reaction analysis. Aluminum levels in the hippocampus of Tg2576 mice were higher than those found in cerebellum and cortex, while the main oxidative effects were evidenced in the presence of DFO only. Oral Al exposure of AβPP transgenic mice would have some potential to promote pro-oxidant events, while DFO administration would not help in preventing these deleterious effects.

Increased expression and processing of caspase-12 after traumatic brain injury in rats.

PubMed

Larner, Stephen F; Hayes, Ronald L; McKinsey, Deborah M; Pike, Brian R; Wang, Kevin K W

2004-01-01

Traumatic brain injury (TBI) disrupts tissue homeostasis resulting in pathological apoptotic activation. Recently, caspase-12 was reported to be induced and activated by the unfolded protein response following excess endoplasmic reticulum (ER) stress. This study examined rat caspase-12 expression using the controlled cortical impact TBI model. Immunoblots of fractionalized cell lysates found elevated caspase-12 proform (approximately 60 kDa) and processed form (approximately 12 kDa), with peak induction observed within 24 h post-injury in the cortex (418% and 503%, respectively). Hippocampus caspase-12 proform induction peaked at 24 h post-injury (641%), while processed form induction peaked at 6 h (620%). Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis confirmed elevated caspase-12 mRNA levels after TBI. Injury severity (1.0, 1.2 or 1.6 mm compression) was associated with increased caspase-12 mRNA expression, peaking at 5 days in the cortex (657%, 651% and 1259%, respectively) and 6 h in the hippocampus (435%, 451% and 460%, respectively). Immunohistochemical analysis revealed caspase-12 induction in neurons in both the cortex and hippocampus as well as in astrocytes at the contusion site. This is the first report of increased expression of caspase-12 following TBI. Our results suggest that the caspase-12-mediated ER apoptotic pathway may play a role in rat TBI pathology independent of the receptor- or mitochondria-mediated apoptotic pathways.

RITA inhibits growth of human hepatocellular carcinoma through induction of apoptosis.

PubMed

Wang, Haihe; Chen, Guofu; Wang, Hongzhi; Liu, Chunbo

2013-01-01

RBP-J-interacting and tubulin-associated (RITA) is a novel RBP-J-interacting protein that downregulates Notch-mediated transcription. The current study focuses on the antitumor effect of RITA in human hepatocellular carcinoma (HCC) and aims to explore its molecular mechanism. Thirty paired HCC and adjacent non-tumoral liver samples were analyzed by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). RITA overexpression was induced by transfection of a pcDNA3.1-Flag-RITA plasmid into HepG2 cells. RITA knockdown was achieved by siRNA transfection. mRNA and protein expression of target genes were quantified by qRT-PCR and Western blotting, respectively. Cell proliferation and apoptosis were measured using MTT assay and flow cytometry. Our results demonstrate that adjacent nontumoral liver samples exhibited increased RITA expression compared to HCC tissues (p < 0.05); RITA levels were associated with tumor differentiation status. Overexpression of RITA suppressed cell proliferation and promoted early apoptosis, while its silencing promoted cell growth dramatically (p < 0.05). RITA overexpression upregulated p53 and reduced cyclin E levels, whereas silencing of RITA had the opposite effect on p53 and cyclin E expression. Our in vitro results represent the first evidence that RITA might suppress tumor growth and induce apoptosis in HCCs, and may be a potent antitumoral agent for HCC treatment that deserves further exploration.

Decreased expression of the APOA1-APOC3-APOA4 gene cluster is associated with risk of Alzheimer's disease.

PubMed

Lin, Qiao; Cao, Yunpeng; Gao, Jie

2015-01-01

Apolipoprotein is genetically associated with the risk of Alzheimer's disease (AD). The APOA1, APOC3, and APOA4 genes are closely linked and located on human chromosome 11. Therefore, this gene cluster may be related to the risk of AD. A total of 147 AD patients and 160 healthy controls were randomly recruited from June 2013 to August 2014. APOA1, APOC3, and APOA4 levels were measured using real-time quantitative reverse-transcriptase polymerase chain reaction and enzyme-linked immunosorbent assay. APOA1, APOC3 and APOA4 levels were significantly lower in AD patients than controls (P<0.01). APOA1, APOC3, and APOA4 levels were negatively related with the severities of AD determined by Clinical Dementia Rating scores (P<0.01). APOA1, APOC3, and APOA4 levels showed a negative relation with Montgomery-Åsberg Depression Rating Scale scores and a positive relation with RAND 36-item health-survey scores (P<0.01). There was a decreased trend for levels of APOA1, APOC3, and APOA4 in AD patients. Low levels of APOA1, APOC3, and APOA4 are associated with risk of AD. APOA1, APOC3, and APOA4 should be developed as combined drugs for the therapy of AD.

Decreased expression of the APOA1–APOC3–APOA4 gene cluster is associated with risk of Alzheimer’s disease

PubMed Central

Lin, Qiao; Cao, Yunpeng; Gao, Jie

2015-01-01

Background Apolipoprotein is genetically associated with the risk of Alzheimer’s disease (AD). The APOA1, APOC3, and APOA4 genes are closely linked and located on human chromosome 11. Therefore, this gene cluster may be related to the risk of AD. Patients and methods A total of 147 AD patients and 160 healthy controls were randomly recruited from June 2013 to August 2014. APOA1, APOC3, and APOA4 levels were measured using real-time quantitative reverse-transcriptase polymerase chain reaction and enzyme-linked immunosorbent assay. Results APOA1, APOC3 and APOA4 levels were significantly lower in AD patients than controls (P<0.01). APOA1, APOC3, and APOA4 levels were negatively related with the severities of AD determined by Clinical Dementia Rating scores (P<0.01). APOA1, APOC3, and APOA4 levels showed a negative relation with Montgomery–Åsberg Depression Rating Scale scores and a positive relation with RAND 36-item health-survey scores (P<0.01). There was a decreased trend for levels of APOA1, APOC3, and APOA4 in AD patients. Conclusion Low levels of APOA1, APOC3, and APOA4 are associated with risk of AD. APOA1, APOC3, and APOA4 should be developed as combined drugs for the therapy of AD. PMID:26491253

Identification of mRNA transcript and screening of amino acids in response to interaction of salinity and nitrate in aquatic fern Azolla caroliniana.

PubMed

Tammam, A A; Mostafa, E M

2012-06-01

The mechanisms by which Azolla caroliniana respond to salt stress in absence and presence of nitrate is investigated. Screening of amino acid and differential display is used to compare overall differences in gene expression between salinity-stressed and unstressed Azolla caroliniana by quantitative reverse transcriptase polymerase chain reaction (RT-PC R). Results showed that under saline conditions, aspartic acid, glutamic acid, alanine and leucine were the amino acids found to be abundant in Azolla caroliniana, accounting for 11.26%, 8.66%, 9.43%, and 12.36%, respectively. Following salinity stress, a decrease in free glutamate concomitant with a parallel decrease in free proline was indeed evident. Interaction between nitrate and salinity stress increased proline content significantly. By screening a cDNA library, we have identified protein products by homology with known proteins. The RNA transcripts encoding protein influencing secondary metabolites and vacuolar Na+/H+ antiporter that facilitate the transport system. The databasematched under interaction of nitrate and 50 mM NaCl were associated with wall biosynthesis, disease resistance, metabolite transport and protein regulator, other gene for metabolism of steroids and secondary transport. Results obtained from this research could represent a key step in understanding the molecular mechanism of salt tolerance of Azolla caroliniana in the presence and absence of nitrate.

A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

PubMed

Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

2007-01-01

Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

Difference in drug resistance patterns between minor HIV-1 populations in cerebrospinal fluid and plasma.

PubMed

Bergroth, T; Ekici, H; Gisslén, M; Hagberg, L; Sönnerborg, A

2009-02-01

The aim of the study was to determine to what extent unique drug resistance patterns appear in minor and major HIV-1 quasispecies in cerebrospinal fluid (CSF) as compared with blood. Forty-four plasma and CSF samples from 13 multi-treatment-experienced patients, seven of whom provided longitudinal samples, were included in the study. The subjects had failed antiretroviral therapy including lamivudine. The reverse transcriptase (RT) gene was examined by selective real-time polymerase chain reaction (SPCR), which can detect M184I/V mutants down to 0.2% of the viral population. SPCR revealed differences at amino acid position 184 in the plasma/CSF populations in 12 paired samples from eight patients. One plasma sample was positive by SPCR where direct sequencing showed wild-type M184. The other 11 paired samples showed quantitative differences in the mixed populations of the mutant or wild-type M184 quasispecies. Differences in other resistance-associated mutations between plasma and CSF viruses were also found by direct sequencing. In multi-treatment-experienced patients with therapy failure, differences in drug resistance patterns were found frequently between plasma and CSF in both minor and major viral populations. To what extent this was a true biological phenomenon remains to be established, and the clinical relevance of these findings is yet to be determined.

Shedding and transmission of novel influenza virus A/H1N1 infection in households--Germany, 2009.

PubMed

Suess, Thorsten; Buchholz, Udo; Dupke, Susann; Grunow, Roland; an der Heiden, Matthias; Heider, Alla; Biere, Barbara; Schweiger, Brunhilde; Haas, Walter; Krause, Gérard

2010-06-01

Essential epidemiologic and virologic parameters must be measured to provide evidence for policy/public health recommendations and mathematical modeling concerning novel influenza A/H1N1 virus (NIV) infections. Therefore, from April through August of 2009, the authors collected nasopharyngeal specimens and information on antiviral medication and symptoms from households with NIV infection on a daily basis in Germany. Specimens were analyzed quantitatively by using reverse transcriptase-polymerase chain reaction. In 36 households with 83 household contacts, 15 household contacts became laboratory-confirmed secondary cases of NIV. Among 47 contacts without antiviral prophylaxis, 12 became cases (secondary attack rate of 26%), and 1 (8%) of these was asymptomatic. The mean and median serial interval were 2.6 and 3 days, respectively (range: 1-3 days). On average, the authors detected viral RNA copies for 6.6 illness days (treated in time = 5.7 days, not treated in time = 7.1 days; P = 0.06), but they estimated that most patients cease to excrete viable virus by the fifth illness day. Shedding profiles were consistent with the number and severity of symptoms. Compared with other nasopharyngeal specimen types, nasal wash was the most sensitive. These results support the notion that epidemiologic and virologic characteristics of NIV are in many aspects similar to those of seasonal influenza.

Characterization and distribution of natriuretic peptide receptors in the rat uterus.

PubMed

Dos Reis, A M; Fujio, N; Dam, T V; Mukaddam-Daher, S; Jankowski, M; Tremblay, J; Gutkowska, J

1995-10-01

Atrial natriuretic peptide (ANP) receptors were characterized in rat uterus. The binding of [125I]ANP to uterine membranes was completely competed for by increasing concentrations of unlabeled ANP (Kd = 0.39 nM) and brain natriuretic peptide (Kd = 1.24 nM) and partially by C-type natriuretic peptide (CNP; Kd = 80.4 nM), but not by C-ANF. Also, [125I]Tyr-CNP bound to uterine membranes was completely competed by unlabeled CNP (Kd = 1.12 nM). Cross-linking of [125I]ANP to uterine membranes revealed the presence of one band of 130 kilodaltons, corresponding to the guanylyl cyclase (GC-A and/or GC-B) subtypes of natriuretic peptide receptors. The presence of messenger RNA coding for genes of both GC-A and GC-B receptors was shown by quantitative reverse transcriptase polymerase chain reaction. Furthermore, ANP and, to a lesser degree, CNP stimulated the production of cGMP in rat uterus. Autoradiographic studies localized the highest binding of [125I]ANP in the endometrium, whereas [125I]Tyr-CNP binding was distributed in the endometrium as well as in the myometrium. These results demonstrate that rat uterine ANP receptors are of the guanylyl cyclase-coupled subtypes. The uterus is a target of natriuretic peptides where ANP induces its biological effects through the production of cGMP.

Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

PubMed

Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

2013-12-23

At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

mRNA expression OF IFN-λs in the gingival tissue of chronic and aggressive periodontitis patients: A polymerase chain reaction study.

PubMed

Bilichodmath, Shivaprasad; Nair, Sruthi K; Bilichodmath, Rekha; Mangalekar, Sachin B

2018-05-01

Several studies have proven the existence of herpesviruses in periodontal pockets of chronic and aggressive periodontitis patients. Recently discovered interferon lambda (IFN-λ) has antiviral properties and is induced by herpesviruses. The present study was aimed at quantitative analysis of mRNA expression of IFN-λs (IFN-λ1, IFN-λ2, IFN-λ3) in the gingival tissues of chronic and aggressive periodontitis patients. A total of 90 participants (50 males and 40 females; age ranging from 19 to 50 years, mean age 31.50±7.8) were categorized into three groups as healthy participants, chronic periodontitis patients and aggressive periodontitis patients. mRNA expression of IFN-λs in gingival tissues was estimated using reverse transcriptase polymerase chain reaction and was correlated with clinical parameters such as gingival index (GI), probing pocket depth (PPD), and clinical attachment level (CAL). mRNA of IFN-λ1, IFN-λ2 and IFN-λ3 was expressed in gingival tissues of healthy participants, chronic and aggressive periodontitis patients. Highest level of IFN-λ1 was observed in aggressive periodontitis patients (3.049±9.793), whereas IFN-λ2 (4.322±11.310) and IFN-λ3 (11.932±27.479) were maximum in chronic periodontitis patients. The difference in the mRNA expression of IFN-λ1 (p = 0.008) and IFN-λ3 (p = 0.043) among three groups was statistically significant CONCLUSION: Increased quantity of IFN-λs in chronic and aggressive periodontitis patients suggests a role in periodontitis. Variation in the expression of IFN-λ1 and IFN-λ3 in periodontitis patients needs to be further evaluated. The mRNA expression of antiviral IFN-λs in gingival tissues might enhance our understanding related to viral pathogenesis of periodontal diseases. This article is protected by copyright. All rights reserved. © 2018 American Academy of Periodontology.

Antitumor effect of CXCR4 antagonist AMD3100 on the tumorigenic cell line of BHP10-3 papillary thyroid cancer cells.

PubMed

Jung, Young Ho; Lee, Doh Young; Cha, Wonjae; Kim, Bo Hae; Sung, Myung-Whun; Kim, Kwang Hyun; Ahn, Soon-Hyun

2016-10-01

A tumorigenic cell line (BHP10-3M) derived from nontumorigenic papillary thyroid carcinoma (PTC) cells (BHP10-3) having rearranged during transfection (RET)/PTC1 gene rearrangement might have a higher expression of CXCR4, either quantitatively or functionally. The authors also postulated that CXCR4-mediated invasion or tumorigenesis could be blocked by CXCR4 antagonists, including AMD3100. The expression of CXCR4 in BHP10-3 and BHP10-3M cells was assessed using immunoblot analysis, flow cytometry, and quantitative reverse-transcriptase polymerase chain reaction (RT-PCR). The effect of AMD3100 on BHP10-3 and BHP10-3M cell lines was evaluated using cell proliferation assay, invasion assay, and tumor growth experiment in nude mice. Immunoblotting, flow cytometry, and quantitative RT-PCR proved that BHP10-3M cells expressed a higher level of CXCR4 than BHP10-3 cells. Although blocking CXCR4 with AMD3100 did not suppress cell proliferation in both cell lines from 1 ng/mL to 100 ng/mL concentration, AMD3100 suppressed invasion of BHP10-3M cells in vitro in a dose-dependent manner. At higher concentrations from 10(3) ng/mL to 10(5) ng/mL, the proliferation of BHP10-3M cells was inhibited more strongly by AMD3100 than that of BHP10-3 cells. Intraperitoneal injection of AMD3100 inhibited tumor formation by BHP10-3M cells in the thyroid of nude mice. A tumorigenic cell line (BHP10-3M) of PTC showed higher expression of CXCR4 quantitatively and functionally than a nontumorigenic cell line (BHP10-3). The CXCR4 antagonist (AMD3100) showed a significant antitumor effect on the tumorigenic cell line of PTC BHP10-3 cells both in vitro and in vivo. CXCR4 antagonist can be expected to have an adjuvant role in the management of PTC. © 2016 Wiley Periodicals, Inc. Head Neck, 2016 © 2016 Wiley Periodicals, Inc. Head Neck 38: First-1486, 2016. © 2016 Wiley Periodicals, Inc.

Three cases of imported dengue virus infection from Madeira to Belgium, 2012.

PubMed

Cnops, Lieselotte; Franco, Leticia; Van Meensel, Britt; Van den Ende, Jef; Paz Sanchez-Seco, Maria; Van Esbroeck, Marjan

2014-01-01

We report three laboratory-confirmed dengue virus (DENV) infections imported to Belgium by travelers returning from Madeira (Portugal). Despite the use of a mosquito-repellent spray as reported by two patients, the infection could not be prevented. Diagnosis was made by antigen detection and real-time reverse transcriptase polymerase chain reaction (RT-PCR) in two cases and by serology 1 month after onset of symptoms in a third one. The responsible virus was identified as DENV serotype 1, American/African genotype (genotype V). The close relationship to isolates from Colombia supports the previous findings that a South American strain originated the outbreak in Madeira in 2012. © 2014 International Society of Travel Medicine.

Isolation of Ganjam virus from ticks collected off domestic animals around Pune, Maharashtra, India.

PubMed

Joshi, M V; Geevarghese, G; Joshi, G D; Ghodke, Y S; Mourya, D T; Mishra, A C

2005-03-01

Studies on viruses of zoonotic importance in certain villages around Pune were undertaken between December 2000 and January 2002. A total of 1,138 adult ticks belonging to six different species were collected off domestic animals and processed for virus isolation. Six virus isolates were obtained. All six isolates were identified as Ganjam virus by Quick Complement Fixation test and reverse transcriptase-polymerase chain reaction using RNA nucleocapsid gene amplification. Five isolates were from the pools of adult Hemaphysalis intermedia ticks, and one isolate was from a pool of adult Rhipecephalus hemaphysaloides. This is the first report of isolation of Ganjam virus from Maharashtra state of India.

Role of host protein Ebp1 in influenza virus growth: intracellular localization of Ebp1 in virus-infected and uninfected cells.

PubMed

Honda, Ayae

2008-01-20

The cellular protein Ebp1 was identified to interact with PB1 protein of influenza virus RNA polymerase, and inhibit both RNA synthesis in vitro and influenza virus replication in vivo [Honda, A., Okamoto, T., Ishihama, A., 2007. Host factor Ebp1: selective inhibitor of influenza virus transcriptase. Genes Cells 12, 133-142]. The intracellular localization of Ebp1 that is involved in cell proliferation control was analyzed by direct immunostaining of cells before and after influenza virus infection. Ebp1 was found to localize in the nuclear membrane of uninfected cells, and to form nuclear aggregates with viral P proteins in virus-infected cells.

Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

PubMed

Hussey, Richard S; Huang, Guozhong; Allen, Rex

2011-01-01

Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

Coronavirus 229E-related pneumonia in immunocompromised patients.

PubMed

Pene, Frédéric; Merlat, Annabelle; Vabret, Astrid; Rozenberg, Flore; Buzyn, Agnès; Dreyfus, François; Cariou, Alain; Freymuth, François; Lebon, Pierre

2003-10-01

Coronaviruses strains 229E and OC43 have been associated with various respiratory illnesses ranging from the self-resolving common cold to severe pneumonia. Although chronic underlying conditions are major determinants of severe respiratory virus infections, few data about coronavirus-related pneumonia in immunocompromised patients are available. Here we report 2 well-documented cases of pneumonia related to coronavirus 229E, each with a different clinical presentation. Diagnosis was made on the basis of viral culture and electron microscopy findings that exhibited typical crown-like particles and through amplification of the viral genome by reverse transcriptase-polymerase chain reaction. On the basis of this report, coronaviruses should be considered as potential causative microorganisms of pneumonia in immunocompromised patients.

West Nile Flavivirus Polioencephalomyelitis in a harbor seal (Phoca vitulina).

PubMed

Del Piero, F; Stremme, D W; Habecker, P L; Cantile, C

2006-01-01

A 12-year-old male harbor seal presented with progressive signs of neurologic dysfunction including head tremors, muzzle twitching, clonic spasms, and weakness. Lesions included polioencephalomyelitis with glial nodules, spheroids, neuronophagia, ring hemorrhages, and a few neutrophils. Neurons, fibers, and glial nodules were multifocally colonized with intracytoplasmic West Nile flavivirus antigens that were demonstrated using indirect immunohistochemical analysis. Flavivirus on cultured cells also was isolated and was identified by use of monoclonal antibodies and reverse transcriptase-polymerase chain reaction analysis. Clinical signs of disease and lesion morphology and distribution were similar to those of equine West Nile virus infection. Similar to horses, alpacas, humans, dogs, and reptiles, seals can be dead-end hosts of West Nile virus.

Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

EPA Science Inventory

The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

On the early emergence of reverse transcription: theoretical basis and experimental evidence

NASA Technical Reports Server (NTRS)

Lazcano, A.; Valverde, V.; Hernandez, G.; Gariglio, P.; Fox, G. E.; Oro, J.

1992-01-01

Reverse transcriptase (RT) was first discovered as an essential catalyst in the biological cycle of retroviruses. However, in the past years evidence has accumulated showing that RTs are involved in a surprisingly large number of RNA-mediated transpositional events that include both viral and nonviral genetic entities. Although it is probable that some RT-bearing genetic elements like the different types of AIDS viruses and the mammalian LINE family have arisen in recent geological times, the possibility that reverse transcription first took place in the early Archean is supported by (1) the hypothesis that RNA preceded DNA as cellular genetic material; (2) the existence of homologous regions of the subunit tau of the E. coli DNA polymerase III with the simian immunodeficiency virus RT, the hepatitis B virus RT, and the beta' subunit of the E. coli RNA polymerase (McHenry et al. 1988); (3) the presence of several conserved motifs, including a 14-amino-acid segment that consists of an Asp-Asp pair flanked by hydrophobic amino acids, which are found in all RTs and in most cellular and viral RNA polymerases. However, whether extant RTs descend from the primitive polymerase involved in the RNA-to-DNA transition remains unproven. Substrate specificity of the AMV and HIV-1 RTs can be modified in the presence of Mn2+, a cation which allows them to add ribonucleotides to an oligo (dG) primer in a template-dependent reaction. This change in specificity is comparable to that observed under similar conditions in other nucleic acid polymerases. This experimentally induced change in RT substrate specificity may explain previous observations on the misincorporation of ribonucleotides by the Maloney murine sarcoma virus RT in the minus and plus DNA of this retrovirus (Chen and Temin 1980). Our results also suggest that HIV-infected macrophages and T-cell cells may contain mixed polynucleotides containing both ribo- and deoxyribonucleotides. The evolutionary significance of these changes in substrate specificities of nucleic acid polymerases is also discussed.

Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents

PubMed Central

Euler, Milena; Wang, Yongjie; Heidenreich, Doris; Patel, Pranav; Strohmeier, Oliver; Hakenberg, Sydney; Niedrig, Matthias; Hufert, Frank T.

2013-01-01

Syndromic panels for infectious disease have been suggested to be of value in point-of-care diagnostics for developing countries and for biodefense. To test the performance of isothermal recombinase polymerase amplification (RPA) assays, we developed a panel of 10 RPAs for biothreat agents. The panel included RPAs for Francisella tularensis, Yersinia pestis, Bacillus anthracis, variola virus, and reverse transcriptase RPA (RT-RPA) assays for Rift Valley fever virus, Ebola virus, Sudan virus, and Marburg virus. Their analytical sensitivities ranged from 16 to 21 molecules detected (probit analysis) for the majority of RPA and RT-RPA assays. A magnetic bead-based total nucleic acid extraction method was combined with the RPAs and tested using inactivated whole organisms spiked into plasma. The RPA showed comparable sensitivities to real-time RCR assays in these extracts. The run times of the assays at 42°C ranged from 6 to 10 min, and they showed no cross-detection of any of the target genomes of the panel nor of the human genome. The RPAs therefore seem suitable for the implementation of syndromic panels onto microfluidic platforms. PMID:23345286

Development and evaluation of a simple and effective RT-qPCR inhibitory assay for detection of the efficacy of compounds towards HIV reverse transcriptase.

PubMed

Marino-Merlo, Francesca; Frezza, Caterina; Papaianni, Emanuela; Valletta, Elena; Mastino, Antonio; Macchi, Beatrice

2017-11-01

Assessing the actual efficacy of compounds to directly inhibit HIV reverse transcriptase (RT) activity is a main goal in preclinical antiretroviral studies. Our previous studies demonstrated that the effects of inhibitor compounds towards HIV-RT could be efficiently assessed through a simple cell-free assay based on conventional reverse transcription PCR. In the present study, we describe a modified variant of our assay, termed RT real-time quantitative PCR inhibitory assay (RT-qPCR-IA), in which the ability of compounds to restrict the complementary DNA (cDNA) generation by HIV-RT using a specific RNA template is performed by the real-time technique, in order to improve both accuracy and sensitivity of the method. As specific RNA template, RNA extracted from stable transfectants ectopically expressing the herpes simplex virus 1 glycoprotein D gene was utilized. HIV-RT, of both commercial or house-made viral lysate origin, was employed for the assay. To assess the reliability of RT-qPCR-IA, we performed a comparative, quantitative analysis of the dose-dependent effect exerted by known nucleotide and non-nucleotide reverse-transcriptase inhibitors, using the SYBR Green dye chemistry as detection system. The results obtained with RT-qPCR-IA were compared to that obtained using a one-step PicoGreen technology-based commercial kit. The outcome of our study indicates that the development of the novel RT-qPCR-IA will provide rapid and accurate evaluation of the inhibitory efficacy of compounds towards HIV-RT activity. This evaluation could be very useful for large-scale screening of potential new anti-HIV drugs.

Cystoviral polymerase complex protein P7 uses its acidic C-terminal tail to regulate the RNA-directed RNA polymerase P2.

PubMed

Alphonse, Sébastien; Arnold, Jamie J; Bhattacharya, Shibani; Wang, Hsin; Kloss, Brian; Cameron, Craig E; Ghose, Ranajeet

2014-07-15

In bacteriophages of the cystovirus family, the polymerase complex (PX) encodes a 75-kDa RNA-directed RNA polymerase (P2) that transcribes the double-stranded RNA genome. Also a constituent of the PX is the essential protein P7 that, in addition to accelerating PX assembly and facilitating genome packaging, plays a regulatory role in transcription. Deletion of P7 from the PX leads to aberrant plus-strand synthesis suggesting its influence on the transcriptase activity of P2. Here, using solution NMR techniques and the P2 and P7 proteins from cystovirus ϕ12, we demonstrate their largely electrostatic interaction in vitro. Chemical shift perturbations on P7 in the presence of P2 suggest that this interaction involves the dynamic C-terminal tail of P7, more specifically an acidic cluster therein. Patterns of chemical shift changes induced on P2 by the P7 C-terminus resemble those seen in the presence of single-stranded RNA suggesting similarities in binding. This association between P2 and P7 reduces the affinity of the former toward template RNA and results in its decreased activity both in de novo RNA synthesis and in extending a short primer. Given the presence of C-terminal acidic tracts on all cystoviral P7 proteins, the electrostatic nature of the P2/P7 interaction is likely conserved within the family and could constitute a mechanism through which P7 regulates transcription in cystoviruses. Copyright © 2014 Elsevier Ltd. All rights reserved.

Strand-specific real-time RT-PCR quantitation of Maize fine streak virus genomic and positive-sense RNAs using high temperature reverse transcription

USDA-ARS?s Scientific Manuscript database

Efforts to analyze the replicative RNA produced by Maize fine streak virus (MVSF) within maize tissue was complicated by the lack of specificity during cDNA generation using standard reverse transcriptase protocols. Real-time qRT-PCR using cDNA generated by priming with random hexamers does not dist...

Revealing the drug-resistant mechanism for diarylpyrimidine analogue inhibitors of HIV-1 reverse transcriptase.

PubMed

Zhang, Hao; Qin, Fang; Ye, Wei; Li, Zeng; Ma, Songyao; Xia, Yan; Jiang, Yi; Zhu, Jiayi; Li, Yixue; Zhang, Jian; Chen, Hai-Feng

2011-09-01

Diaryltriazine (DATA) and diarylpyrimidine (DAPY) were two category inhibitors with highly potent activity for wild type (wt) and four principal mutant types (L100I, K103N, Y181C and Y188L) of HIV-1 reverse transcriptase (RT). We had revealed the drug-resistant mechanism of DATA analogue inhibitors with molecular dynamics simulation and three-dimensional quantitative structure-activity relationship (3D-QSAR) methods. In this work, we investigated the drug-resistant mechanism of DAPY analogue inhibitors. It was found that DAPY analogue inhibitors form more hydrogen bonds and hydrophobic contacts with wild type and mutants of HIV-1 RT than DATA inhibitors. This could explain that DAPY analogue inhibitors are more potent than DATA for the wild type and mutants of HIV-1 RT. Then, 3D-QSAR models were constructed for these inhibitors of wild type and four principal mutant types HIV-1 RT and evaluated by test set compounds. These combined models can be used to design new chemical entities and make quantitative prediction of the bioactivities for HIV-1 RT inhibitors before resorting to in vitro and in vivo experiment. © 2011 John Wiley & Sons A/S.

Combined use of reverse transcriptase polymerase chain reaction and flow cytometry to study minimal residual disease in Philadelphia positive acute lymphoblastic leukemia.

PubMed

Muñoz, L; López, O; Martino, R; Brunet, S; Bellido, M; Rubiol, E; Sierra, J; Nomdedéu, J F

2000-07-01

The Philadelphia chromosome in acute lymphoblastic leukemia (Ph+ ALL) is associated with a poor prognosis given the high frequency of chemoresistance and leukemia relapse. Minimal residual disease (MRD) detection before cytogenetic and hematologic relapse could be useful in early therapy. The most suitable methods for detecting MRD in Ph+ ALL are flow cytometry (FC) and reverse transcriptase polymerase chain reaction (RT-PCR). However, since both techniques carry the risk of false-negative results the combined use of these two techniques could overcome this problem. We report our experience using this approach in 47 bone marrow samples obtained from 10 Ph+ ALL patients. Twenty-seven marrow aspirates were taken from patients in clinical remission (CR). The samples were considered positive for MRD by FC when two conditions were met: 1) detection of an abnormal B-cell differentiation pattern and 2) presence of more than 1x10(-3) cells coexpressing CD22/CD34/CD45 or CD66/CD34/CD10. After FC analysis, RNA was purified using standard methods. FC was positive in 23/27 samples in CR (sensitivity 85%). RT-PCR was successfully performed in 23 samples in CR. RT-PCR was positive in 18/23 samples (sensitivity 78%). There were 5 samples with discordant results. FC was positive in 3 samples with a negative RT-PCR and FC was negative in 2 samples with a positive RT. All the 10 patients relapsed and only 1 is currently alive after an allogeneic stem cell transplantation (alloSCT). The median (range) time from MRD detection to relapse in patients treated with chemotherapy was 42 (39-71) days. These data suggest that RT-PCR may be negative despite the presence of neoplastic cells identified by their immunophenotypic traits. We conclude that immunologic and molecular techniques can be used in tandem for monitoring MRD in Ph+ ALL.

Detection of PAX3-FKHR and PAX7-FKHR fusion transcripts in rhabdomyosarcoma by reverse transcriptase-polymerase chain reaction using paraffin-embedded tissue.

PubMed

Chen, B F; Chen, M L; Liang, D C; Huang, Y W; Liu, H C; Chen, S H

1999-02-01

Alveolar rhabdomyosarcoma (RMS) is associated with a characteristic chromosomal translocation t(2;13)(q35;q14). The genes involved in this translocation are paired box (PAX)3 on chromosome 2 and forkhead in RMS (FKHR) on chromosome 13. An occasional variant translocation t(1;13)(p36;q14) affecting PAX7 and FKHR on chromosomes 1 and 13, respectively, has also been described. Chromosomal translocations in RMS are detected using conventional cytogenetic analysis, fluorescence in situ hybridization (FISH) or reverse transcriptase-polymerase chain reaction (RT-PCR) on fresh or frozen tissue samples. We describe the results of RT-PCR analysis of PAX3-FKHR and PAX7-FKHR chimeric messages in formalin-fixed, paraffin-embedded tissue samples from 17 RMS cases. RNA was extracted from formalin-fixed, paraffin-embedded RMS tissue. Oligonucleotide primers corresponding to the regions of PAX3, PAX7 and FKHR were used for the detection of PAX3-FKHR and PAX7-FKHR chimeric messages. A seminested PCR of the PCR products was used to increase the sensitivity of detection. The amplified fragments were purified and directly sequenced to confirm the specificity of the methods. The PAX3-FKHR chimeric message was detected in all three cases of alveolar RMS but not in any of the 12 embryonal and two pleomorphic RMS cases. The PAX7-FKHR fusion transcript was detected in one case of embryonal RMS. The results indicate that the RT-PCR assay is a reliable method for the detection of the PAX3-FKHR fusion transcript of alveolar RMS in formalin-fixed, paraffin-embedded tissue. This simple method enables pathologists to identify chromosomal rearrangements in RMS as a diagnostic aid in cases where fresh or frozen tissue is not available.

Modified concentration method for the detection of enteric viruses on fruits and vegetables by reverse transcriptase-polymerase chain reaction or cell culture.

PubMed

Dubois, Eric; Agier, Cécilia; Traoré, Ousmane; Hennechart, Catherine; Merle, Ghislaine; Crucière, Catherine; Laveran, Henri

2002-12-01

Fruits and vegetables may act as a vehicle of human enteric virus if they are irrigated with sewage-contaminated water or prepared by infected food handlers. An elution-concentration method was modified to efficiently detect, by reverse transcriptase-polymerase chain reaction (RT-PCR) or by cell culture, contamination by poliovirus, hepatitis A virus (HAV), and Norwalk-like virus (NLV) of various fresh and frozen berries and fresh vegetables. The protocol included washing the fruit or vegetable surface with 100 mM Tris-HCl, 50 mM glycine, and 3% beef extract, pH 9.5 buffer, which favors viral elution from acid-releasing berries, supplemented with 50 mM MgCl2 to reduce the decrease in viral infectivity during the process. The viral concentration method was based on polyethylene glycol precipitation. Copurified RT-PCR inhibitors and cytotoxic compounds were removed from viral concentrates by chloroform-butanol extraction. Viruses from 100 g of vegetal products could be recovered in volumes of 3 to 5 ml. Viral RNAs were isolated by a spin column method before molecular detection or concentrates were filtered (0.22-microm porosity) and inoculated on cell culture for infectious virus detection. About 15% of infectious poliovirus and 20% of infectious HAV were recovered from frozen raspberry surfaces. The percentage of viral RNA recovery was estimated by RT-PCR to be about 13% for NLV, 17% for HAV, and 45 to 100% for poliovirus. By this method, poliovirus and HAV RNA were detected on products inoculated with a titer of about 5 x 10(1) 50% tissue culture infectious dose per 100 g. NLV RNA was detected at an initial inoculum of 1.2 x 10(3) RT-PCR amplifiable units. This method would be useful for the viral analysis of fruits or vegetables during an epidemiological investigation of foodborne diseases.

Two Novel Real-Time Reverse Transcriptase PCR Assays for Rapid Detection of Bacterial Contamination in Platelet Concentrates

PubMed Central

Dreier, Jens; Störmer, Melanie; Kleesiek, Knut

2004-01-01

The incidence of platelet bacterial contamination is approximately 1 per 2,000 units and has been acknowledged as the most frequent infectious risk from transfusion. In preliminary studies, the sterility of platelet concentrates (PCs) was tested with an automated bacterial blood culturing system and molecular genetic assays. Two real-time reverse transcriptase PCR (RT-PCR) assays performed in a LightCycler instrument were developed and compared regarding specificity and sensitivity by the use of different templates to detect the majority of the clinically important bacterial species in platelets. Primers and probes specific for the conserved regions of the eubacterial 23S rRNA gene or the groEL gene (encoding the 60-kDa heat shock protein Hsp60) were designed. During the development of the 23S rRNA RT-PCR, problems caused by the contamination of reagents with bacterial DNA were noted. Treatment with 8-methoxypsoralen and UV irradiation reduced the level of contaminating DNA. The sensitivity of the assays was greatly influenced by the enzyme system which was used. With rTth DNA polymerase in a one-enzyme system, we detected 500 CFU of Escherichia coli or Staphylococcus epidermidis/ml. With a two-enzyme system consisting of Moloney murine leukemia virus RT and Taq DNA polymerase, we detected 16 CFU/ml. With groEL mRNA as the target of RT-PCR under optimized conditions, we detected 125 CFU of E. coli/ml, and no problems with false-positive results caused by reagent contamination or a cross-reaction with human nucleic acids were found. Furthermore, the use of mRNA as an indicator of viability was demonstrated. Here we report the application of novel real-time RT-PCR assays for the detection of bacterial contamination of PCs that are appropriate for transfusion services. PMID:15472337

Reduction in the incidence of influenza A but not influenza B associated with use of hand sanitizer and cough hygiene in schools: a randomized controlled trial.

PubMed

Stebbins, Samuel; Cummings, Derek A T; Stark, James H; Vukotich, Chuck; Mitruka, Kiren; Thompson, William; Rinaldo, Charles; Roth, Loren; Wagner, Michael; Wisniewski, Stephen R; Dato, Virginia; Eng, Heather; Burke, Donald S

2011-11-01

Laboratory-based evidence is lacking regarding the efficacy of nonpharmaceutical interventions (NPIs) such as alcohol-based hand sanitizer and respiratory hygiene to reduce the spread of influenza. The Pittsburgh Influenza Prevention Project was a cluster-randomized trial conducted in 10 elementary schools in Pittsburgh, PA, during the 2007 to 2008 influenza season. Children in 5 intervention schools received training in hand and respiratory hygiene, and were provided and encouraged to use hand sanitizer regularly. Children in 5 schools acted as controls. Children with influenza-like illness were tested for influenza A and B by reverse-transcriptase polymerase chain reaction. A total of 3360 children participated in this study. Using reverse-transcriptase polymerase chain reaction, 54 cases of influenza A and 50 cases of influenza B were detected. We found no significant effect of the intervention on the primary study outcome of all laboratory-confirmed influenza cases (incidence rate ratio [IRR]: 0.81; 95% confidence interval [CI]: 0.54, 1.23). However, we did find statistically significant differences in protocol-specified ancillary outcomes. Children in intervention schools had significantly fewer laboratory-confirmed influenza A infections than children in control schools, with an adjusted IRR of 0.48 (95% CI: 0.26, 0.87). Total absent episodes were also significantly lower among the intervention group than among the control group; adjusted IRR 0.74 (95% CI: 0.56, 0.97). NPIs (respiratory hygiene education and the regular use of hand sanitizer) did not reduce total laboratory-confirmed influenza. However, the interventions did reduce school total absence episodes by 26% and laboratory-confirmed influenza A infections by 52%. Our results suggest that NPIs can be an important adjunct to influenza vaccination programs to reduce the number of influenza A infections among children.

In vivo cartilage formation using chondrogenic-differentiated human adipose-derived mesenchymal stem cells mixed with fibrin glue.

PubMed

Jung, Sung-No; Rhie, Jong Won; Kwon, Ho; Jun, Young Joon; Seo, Je-Won; Yoo, Gyeol; Oh, Deuk Young; Ahn, Sang Tae; Woo, Jihyoun; Oh, Jieun

2010-03-01

Human adipose-derived mesenchymal stem cells (MSCs) were differentiated into chondrogenic MSCs, and fibrin glue was used together to explore the feasibility of whether cartilages can be generated in vivo by injecting the differentiated cells. Mesenchymal stem cells extracted from human adipose were differentiated into chondrogenic MSCs, and such differentiated cells mixed with fibrin glue were injected subcutaneously into the back of the nude mouse. In addition to visual evaluation of the tissues formed after 4, 8, and 12 weeks, hematoxylin-eosin staining, Masson trichrome staining, measurement of glycosaminoglycan concentration using dimethylmethylene blue, agreecan through reverse transcriptase-polymerase chain reaction, type II collagen, and expression of SOX-9 were verified. Moreover, the results were compared with 2 groups of controls: 1 control group that received only injection of chondrogenic-differentiated MSC and the supporting control group that received only fibrin glue injection. For the experimental group, cartilage-like tissues were formed after 4, 8, and 12 weeks. Formation of cartilage tissues was not observed in any of 4, 8, and 12 weeks of the control group. The supporting control group had only a small structure formation after 4 weeks, but the formed structure was completely decomposed by the 8th and 12th weeks. The range of staining dramatically increased with time at 4, 8, and 12 weeks in Masson trichrome staining. The concentration of glycosaminoglycan also increased with time. The increased level was statistically significant with more than 3 times more after 8 weeks compared with 4 weeks and more than 2 times more after 12 weeks compared with 8 weeks. Also, in reverse transcriptase-polymerase chain reaction at 4, 8, and 12 weeks, all results expressed a cartilage-specific gene called aggrecan, type II collagen, and SOX-9. The study verified that the chondrogenic-differentiated MSCs derived from human adipose tissues with fibrin glue can proliferate and form new cartilage. Our findings suggest that formation of cartilages in vivo is possible.

One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

PubMed

Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

2016-06-01

Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

Solid-Phase Nucleic Acid Sequence-Based Amplification and Length-Scale Effects during RNA Amplification.

PubMed

Ma, Youlong; Teng, Feiyue; Libera, Matthew

2018-06-05

Solid-phase oligonucleotide amplification is of interest because of possible applications to next-generation sequencing, multiplexed microarray-based detection, and cell-free synthetic biology. Its efficiency is, however, less than that of traditional liquid-phase amplification involving unconstrained primers and enzymes, and understanding how to optimize the solid-phase amplification process remains challenging. Here, we demonstrate the concept of solid-phase nucleic acid sequence-based amplification (SP-NASBA) and use it to study the effect of tethering density on amplification efficiency. SP-NASBA involves two enzymes, avian myeloblastosis virus reverse transcriptase (AMV-RT) and RNase H, to convert tethered forward and reverse primers into tethered double-stranded DNA (ds-DNA) bridges from which RNA - amplicons can be generated by a third enzyme, T7 RNA polymerase. We create microgels on silicon surfaces using electron-beam patterning of thin-film blends of hydroxyl-terminated and biotin-terminated poly(ethylene glycol) (PEG-OH, PEG-B). The tethering density is linearly related to the PEG-B concentration, and biotinylated primers and molecular beacon detection probes are tethered to streptavidin-activated microgels. While SP-NASBA is very efficient at low tethering densities, the efficiency decreases dramatically with increasing tethering density due to three effects: (a) a reduced hybridization efficiency of tethered molecular beacon detection probes; (b) a decrease in T7 RNA polymerase efficiency; (c) inhibition of T7 RNA polymerase activity by AMV-RT.

Phleboviruses associated with sand flies in arid bio-geographical areas of Central Tunisia.

PubMed

Dachraoui, K; Fares, W; Bichaud, L; Barhoumi, W; Beier, J C; Derbali, M; Cherni, S; Lamballerie, X de; Chelbi, I; Charrel, R N; Zhioua, E

2016-06-01

An entomological investigation was carried out in 2014 at two sites located in Central Tunisia, one irrigated and another non-irrigated situated in arid bio-geographical areas. Sand flies of the subgenus Larroussius namely Phlebotomus perfiliewi, Phlebotomus perniciosus, and Phlebotomus longicuspis are the most abundant sand fly species in the irrigated site. However, in the non-irrigated site, Phlebotomus papatasi of the Phlebotomus genus is the most abundant species. A total of 3191 sand flies were collected and pooled with up to 30 specimens per pool based on sex, trapping location and collection date, were tested for the presence of phleboviruses by nested reverse transcriptase polymerase chain reaction in the polymerase gene and sequenced. Of a total of 117 pools, 4 were positive, yielding a minimum infection rate of sand flies with phleboviruses of 0.12%. Phylogenetic analysis performed using partial nucleotide and amino acid sequence in the polymerase gene showed that these phleboviruses belonged to four different clusters corresponding to Toscana virus (TOSV), Saddaguia virus (SADV), Sandfly Fever Sicilian Virus (SFSV) and Utique virus (UTIV). This study provides more evidence that the abundance of P. perfiliewi is associated with the development of irrigation in arid bio-geographical areas of Central Tunisia which may have led to the emergence of phleboviruses. We report the first detection of TOSV from sand flies collected from Central Tunisia. Copyright © 2016 Elsevier B.V. All rights reserved.

Imprint cytology of clear cell sarcoma-like tumor of the gastrointestinal tract in the small intestine: A case report.

PubMed

Kato, Takashi; Ichihara, Shin; Gotoda, Hiroko; Muraoka, Shunji; Kubo, Terufumi; Sugita, Shintaro; Hasegawa, Tadashi

2017-12-01

Clear cell sarcoma-like tumor of the gastrointestinal tract (CCSLGT) is an extremely rare malignant neoplasm in the digestive tract. Its cytomorphologic features have never previously been reported. Here, we describe a case of CCSLGT, including its cytologic examination findings. A 47-year-old woman presented with a mass in the small intestine, which was resected and sent for imprint cytology. Imprint smears revealed tumor cells with light eosinophilic or clear cytoplasm in a necrotic background. Many of the tumor cells were arranged in a perivascular growth with a pseudopapillary formation, and there were some non-neoplastic osteoclast-like giant cells. Histological examination revealed solid nests and a pseudopapillary pattern of the tumor cells with clear or pale eosinophilic cytoplasm and large nuclei with small nucleoli. Immunohistochemistry showed positive for vimentin, S-100, and SOX-10, and negative for SMA, c-KIT, cytokeratin, HMB-45, and MelanA. The EWSR1 gene split signal was detected by reverse transcriptase fluorescence in situ hybridization, and EWSR1-CREB1 gene fusion was indicated by reverse transcriptase polymerase chain reaction analysis. From these findings, we diagnosed the tumor as CCSLGT. To best of our knowledge, this is the first description of the imprint cytology features of CCSLGT. © 2017 Wiley Periodicals, Inc.

Hypersusceptibility to substrate analogs conferred by mutations in human immunodeficiency virus type 1 reverse transcriptase.

PubMed

Smith, Robert A; Anderson, Donovan J; Preston, Bradley D

2006-07-01

Human immunodeficiency virus type 1 (HIV-1) reverse transcriptase (RT) contains four structural motifs (A, B, C, and D) that are conserved in polymerases from diverse organisms. Motif B interacts with the incoming nucleotide, the template strand, and key active-site residues from other motifs, suggesting that motif B is an important determinant of substrate specificity. To examine the functional role of this region, we performed "random scanning mutagenesis" of 11 motif B residues and screened replication-competent mutants for altered substrate analog sensitivity in culture. Single amino acid replacements throughout the targeted region conferred resistance to lamivudine and/or hypersusceptibility to zidovudine (AZT). Substitutions at residue Q151 increased the sensitivity of HIV-1 to multiple nucleoside analogs, and a subset of these Q151 variants was also hypersusceptible to the pyrophosphate analog phosphonoformic acid (PFA). Other AZT-hypersusceptible mutants were resistant to PFA and are therefore phenotypically similar to PFA-resistant variants selected in vitro and in infected patients. Collectively, these data show that specific amino acid replacements in motif B confer broad-spectrum hypersusceptibility to substrate analog inhibitors. Our results suggest that motif B influences RT-deoxynucleoside triphosphate interactions at multiple steps in the catalytic cycle of polymerization.

Highly Reproducible Label Free Quantitative Proteomic Analysis of RNA Polymerase Complexes*

PubMed Central

Mosley, Amber L.; Sardiu, Mihaela E.; Pattenden, Samantha G.; Workman, Jerry L.; Florens, Laurence; Washburn, Michael P.

2011-01-01

The use of quantitative proteomics methods to study protein complexes has the potential to provide in-depth information on the abundance of different protein components as well as their modification state in various cellular conditions. To interrogate protein complex quantitation using shotgun proteomic methods, we have focused on the analysis of protein complexes using label-free multidimensional protein identification technology and studied the reproducibility of biological replicates. For these studies, we focused on three highly related and essential multi-protein enzymes, RNA polymerase I, II, and III from Saccharomyces cerevisiae. We found that label-free quantitation using spectral counting is highly reproducible at the protein and peptide level when analyzing RNA polymerase I, II, and III. In addition, we show that peptide sampling does not follow a random sampling model, and we show the need for advanced computational models to predict peptide detection probabilities. In order to address these issues, we used the APEX protocol to model the expected peptide detectability based on whole cell lysate acquired using the same multidimensional protein identification technology analysis used for the protein complexes. Neither method was able to predict the peptide sampling levels that we observed using replicate multidimensional protein identification technology analyses. In addition to the analysis of the RNA polymerase complexes, our analysis provides quantitative information about several RNAP associated proteins including the RNAPII elongation factor complexes DSIF and TFIIF. Our data shows that DSIF and TFIIF are the most highly enriched RNAP accessory factors in Rpb3-TAP purifications and demonstrate our ability to measure low level associated protein abundance across biological replicates. In addition, our quantitative data supports a model in which DSIF and TFIIF interact with RNAPII in a dynamic fashion in agreement with previously published reports. PMID:21048197

[The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

PubMed

Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

2014-04-01

The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

Treesearch

Tomas Johansson; Per Olof Nyman; Daniel Cullen

2002-01-01

A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

Yellow Fever Vaccination of a Primary Vaccinee During Adalimumab Therapy.

PubMed

Nash, Esther R; Brand, Myron; Chalkias, Spyridon

2015-01-01

In this case report, we describe a 63-year-old female with Crohn's disease since age 16 years, and on adalimumab therapy, who inadvertently received a yellow fever vaccine (YFV) 4 days before her next dose of adalimumab. She had never received YFV. Her next dose of tumor necrosis factor (TNF) antagonist was held. She did not report any adverse effects referable to the vaccine. Reverse transcriptase-polymerase chain reaction (RT-PCR) for yellow fever (YF) viral RNA on days 12 and 18 postvaccination was negative. Neutralizing antibody to YF virus vaccine was immunoprotective on day 18 following vaccination, which further increased by day 26. A neutralizing antibody obtained 2 years following vaccination also remained immunoprotective. © 2015 International Society of Travel Medicine.

Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

PubMed

Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

2003-12-01

A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

PubMed

Bridge, Julia A

2017-01-01

The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

Human Mitochondrial RNA Polymerase: Evaluation of the Single-Nucleotide-Addition Cycle on Synthetic RNA/DNA Scaffolds

PubMed Central

Smidansky, Eric D.; Arnold, Jamie J.; Reynolds, Shelley L.; Cameron, Craig E.

2013-01-01

The human mitochondrial RNA polymerase (h-mtRNAP) serves as both the transcriptase for expression and the primase for replication of mitochondrial DNA. As such, the enzyme is of fundamental importance to cellular energy metabolism, and defects in its function may be related to human disease states. Here we describe in vitro analysis of the h-mtRNAP kinetic mechanism for single, correct nucleotide incorporation. This was made possible by the development of efficient methods for expression and purification of h-mtRNAP using a bacterial system and by utilization of assays that rely on simple, synthetic RNA/DNA scaffolds without the need for mitochondrial transcription accessory proteins. We find that h-mtRNAP accomplishes single-nucleotide incorporation by using the same core steps, including conformational change steps before and after chemistry, that are prototypical for most types of nucleic acid polymerases. The polymerase binds to scaffolds via a two-step mechanism consisting of a fast initial-encounter step followed by a much slower isomerization that leads to catalytic competence. A substantial solvent deuterium kinetic isotope effect was observed for the forward reaction, but none was detectable for the reverse reaction, suggesting that chemistry is at least partially rate-limiting in the forward direction but not in the reverse. h-mtRNAP appears to exercise much more stringent surveillance over base than over sugar in determining the correctness of a nucleotide. The utility of developing the robust in vitro assays described here and of establishing a baseline of kinetic performance for the wild-type enzyme is that biological questions concerning h-mtRNAP may now begin to be addressed. PMID:21548588

Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

PubMed

Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

2017-12-30

Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

Methotrexate increases expression of cell cycle checkpoint genes via Jun-N-terminal kinase activation

PubMed Central

Spurlock, Charles F.; Tossberg, John T.; Fuchs, Howard A.; Olsen, Nancy J.; Aune, Thomas M.

2011-01-01

Objective To assess defects in expression of critical cell cycle checkpoint genes and proteins in subjects with rheumatoid arthritis relative to presence or absence of methotrexate medication and assess the role of Jun N-terminal kinase in methotrexate induction of these genes. Methods Flow cytometry analysis was used to quantify changes in intracellular proteins, measure reactive oxygen species (ROS), and determine apoptosis in different lymphoid populations. Quantitative reverse transcriptase polymerase chain reaction (Q-RT-PCR) was employed to determine changes in cell cycle checkpoint target genes. Results RA subjects express lower baseline levels of MAPK9, TP53, CDKN1A, CDKN1B, CHEK2, and RANGAP1 messenger RNA (mRNA) and total JNK protein. MAPK9, TP53, CDKN1A, and CDKN1B mRNA expression, but not CHEK2, and RANGAP1, is higher in patients on low-dose MTX therapy. Further, JNK levels inversely correlate with CRP levels in RA patients. In tissue culture, MTX induces expression of both p53 and p21 by JNK2 and JNK1-dependent mechanisms, respectively, while CHEK2 and RANGAP1 are not induced by MTX. MTX also induces ROS production, JNK activation, and sensitivity to apoptosis in activated T cells. Supplementation with tetrahydrobiopterin blocks these MTX-mediated effects. Conclusions Our findings support the notion that MTX restores some, but not all of the proteins contributing to cell cycle checkpoint deficiencies in RA T cells by a JNK dependent pathway. PMID:22183962

Viral shedding of 2009 pandemic H1N1 and evaluation of quarantine recommendations.

PubMed

Chin, Bum Sik; Chae, Yun Tae; Choi, Hee Kyung; Baek, Ji-Hyeon; Jin, Sung Joon; Shin, So Youn; Han, Sang Hoon; Choi, Jun Yong; Kim, Chang Oh; Song, Young Goo; Jeong, Seok Hoon; Kim, June Myung

2012-01-01

Public health authorities recommend that isolation precautions for influenza should be continued for 7 days after illness onset or until 24 h after the resolution of symptoms, whichever event lasts longer. However, little data are available regarding the duration of isolation for patients with 2009 pandemic H1N1 (pH1N1). We recruited patients with confirmed pH1N1 virus infection at a 2,000-bed tertiary care center. Influenza viral loads from oropharyngeal swab specimens were serially determined by reverse transcriptase quantitative polymerase chain reaction every other day, and the risk factors for prolonged viral shedding were investigated. To evaluate the current recommendations for isolation precautions, we measured the intervals between symptom onset and the last viral RNA detection, and that between the last viral RNA detection and the point at which the patient was symptom-free for 24 h. From November 2009 to January 2010, 26 patients were enrolled, and viral RNA was detected in more than half of the eligible patients (10 of 19, 52.6%) for ≥7 days after symptom onset. While evaluating the policy for lifting quarantine, we found that viral RNA was detected in 4 of 15 patients (26.7%) beyond the recommended duration of isolation. In conclusion, viral RNA was detected in a substantial proportion of hospitalized patients even when they fulfilled the recommended conditions for lifting quarantine, and we believe that more prudence is required in this aspect.

BIRC6/Apollon gene expression in childhood acute leukemia: impact on therapeutic response and prognosis.

PubMed

Ismail, Eman Abdel Rahman; Mahmoud, Hanan Mohamed; Tawfik, Lamis Mohamed; Habashy, Deena Mohamed; Adly, Amira Abdel Moneam; El-Sherif, Nayera Hazaa; Abdelwahab, Mahmoud Ahmed

2012-02-01

Although BIRC6/Apollon seems to play a critical role as an antiapoptotic regulator, its clinical relevance in acute leukemia remains largely elusive. Therefore, we aimed to investigate BIRC6 gene expression in childhood acute leukemia in relation to clinicopathological characteristics at presentation, therapeutic response, and prognosis. BIRC6 expression level was assessed in 75 children with acute leukemia; 30 patients with acute myeloblastic leukemia (AML) and 45 patients with acute lymphoblastic leukemia (ALL) using real-time quantitative reverse transcriptase-polymerase chain reaction. The median level of BIRC6 expression did not differ significantly between AML and ALL patients. BIRC6 expression level was higher in patients with AML and ALL with extramedullary involvement, white blood cell (WBC) count ≥ 10 × 10(9) /L, and unfavorable cytogenetics at diagnosis. BIRC6 gene expression was higher in patients with unfavorable response to therapy at day 14, those who developed relapse or died in both leukemic groups. The best cutoff value of BIRC6 to predict therapeutic response and disease outcome was determined. AML and ALL patients with BIRC6 overexpression had significantly shorter overall and disease free survivals. This is the first report to study BIRC6 gene in pediatric ALL. Our results suggested that BIRC6 gene expression could be considered as an adverse risk factor in childhood acute leukemia and, hence, could be used to guide therapeutic regimens. © 2012 John Wiley & Sons A/S.

Molecular Validation of Chondrogenic Differentiation and Hypoxia Responsiveness of Platelet-Lysate Expanded Adipose Tissue-Derived Human Mesenchymal Stromal Cells.

PubMed

Galeano-Garces, Catalina; Camilleri, Emily T; Riester, Scott M; Dudakovic, Amel; Larson, Dirk R; Qu, Wenchun; Smith, Jay; Dietz, Allan B; Im, Hee-Jeong; Krych, Aaron J; Larson, A Noelle; Karperien, Marcel; van Wijnen, Andre J

2017-07-01

To determine the optimal environmental conditions for chondrogenic differentiation of human adipose tissue-derived mesenchymal stromal/stem cells (AMSCs). In this investigation we specifically investigate the role of oxygen tension and 3-dimensional (3D) culture systems. Both AMSCs and primary human chondrocytes were cultured for 21 days in chondrogenic media under normoxic (21% oxygen) or hypoxic (2% oxygen) conditions using 2 distinct 3D culture methods (high-density pellets and poly-ε-caprolactone [PCL] scaffolds). Histologic analysis of chondro-pellets and the expression of chondrocyte-related genes as measured by reverse transcriptase quantitative polymerase chain reaction were used to evaluate the efficiency of differentiation. AMSCs are capable of expressing established cartilage markers including COL2A1, ACAN, and DCN when grown in chondrogenic differentiation media as determined by gene expression and histologic analysis of cartilage markers. Expression of several cartilage-related genes was enhanced by low oxygen tension, including ACAN and HAPLN1. The pellet culture environment also promoted the expression of hypoxia-inducible cartilage markers compared with cells grown on 3D scaffolds. Cell type-specific effects of low oxygen and 3D environments indicate that mesenchymal cell fate and differentiation potential is remarkably sensitive to oxygen. Genetic programming of AMSCs to a chondrocytic phenotype is effective under hypoxic conditions as evidenced by increased expression of cartilage-related biomarkers and biosynthesis of a glycosaminoglycan-positive matrix. Lower local oxygen levels within cartilage pellets may be a significant driver of chondrogenic differentiation.

Supervised Risk Predictor of Breast Cancer Based on Intrinsic Subtypes

PubMed Central

Parker, Joel S.; Mullins, Michael; Cheang, Maggie C.U.; Leung, Samuel; Voduc, David; Vickery, Tammi; Davies, Sherri; Fauron, Christiane; He, Xiaping; Hu, Zhiyuan; Quackenbush, John F.; Stijleman, Inge J.; Palazzo, Juan; Marron, J.S.; Nobel, Andrew B.; Mardis, Elaine; Nielsen, Torsten O.; Ellis, Matthew J.; Perou, Charles M.; Bernard, Philip S.

2009-01-01

Purpose To improve on current standards for breast cancer prognosis and prediction of chemotherapy benefit by developing a risk model that incorporates the gene expression–based “intrinsic” subtypes luminal A, luminal B, HER2-enriched, and basal-like. Methods A 50-gene subtype predictor was developed using microarray and quantitative reverse transcriptase polymerase chain reaction data from 189 prototype samples. Test sets from 761 patients (no systemic therapy) were evaluated for prognosis, and 133 patients were evaluated for prediction of pathologic complete response (pCR) to a taxane and anthracycline regimen. Results The intrinsic subtypes as discrete entities showed prognostic significance (P = 2.26E-12) and remained significant in multivariable analyses that incorporated standard parameters (estrogen receptor status, histologic grade, tumor size, and node status). A prognostic model for node-negative breast cancer was built using intrinsic subtype and clinical information. The C-index estimate for the combined model (subtype and tumor size) was a significant improvement on either the clinicopathologic model or subtype model alone. The intrinsic subtype model predicted neoadjuvant chemotherapy efficacy with a negative predictive value for pCR of 97%. Conclusion Diagnosis by intrinsic subtype adds significant prognostic and predictive information to standard parameters for patients with breast cancer. The prognostic properties of the continuous risk score will be of value for the management of node-negative breast cancers. The subtypes and risk score can also be used to assess the likelihood of efficacy from neoadjuvant chemotherapy. PMID:19204204

Pathological and immunological responses associated with differential survival of Chinook salmon following Renibacterium salmoninarum challenge

USGS Publications Warehouse

Metzger, David C.; Elliott, Diane G.; Wargo, Andrew; Park, Linda K.; Purcell, Maureen K.

2010-01-01

Chinook salmon Oncorhynchus tshawytscha are highly susceptible to Renibacterium salmoninarum, the causative agent of bacterial kidney disease (BKD). Previously we demonstrated that introduced Chinook salmon from Lake Michigan, Wisconsin (WI), USA, have higher survival following R. salmoninarum challenge relative to the progenitor stock from Green River, Washington, USA. In the present study, we investigated the pathological and immunological responses that are associated with differential survival in the 2 Chinook salmon stocks following intra-peritoneal R. salmoninarum challenge of 2 different cohort years (2003 and 2005). Histological evaluation revealed delayed appearance of severe granulomatous lesions in the kidney and lower overall prevalence of membranous glomerulopathy in the higher surviving WI stock. The higher survival WI stock had a lower bacterial load at 28 d post-infection, as measured by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR). However, at all other time points, bacterial load levels were similar despite higher mortality in the more susceptible Green River stock, suggesting the possibility that the stocks may differ in their tolerance to infection by the bacterium. Interferon-γ, inducible nitric oxide synthase (iNOS), Mx-1, and transferrin gene expression were up-regulated in both stocks following challenge. A trend of higher iNOS gene expression at later time points (≥28 d post-infection) was observed in the lower surviving Green River stock, suggesting the possibility that higher iNOS expression may contribute to greater pathology in that stock.

A novel TFF2 splice variant (ΔEX2TFF2) correlates with longer overall survival time in cholangiocarcinoma

PubMed Central

KAMLUA, SURASEE; PATRAKITKOMJORN, SIRIPORN; JEARANAIKOON, PATCHAREE; MENHENIOTT, TREVELYAN R.; GIRAUD, ANDREW S.; LIMPAIBOON, TEMDUANG

2012-01-01

Trefoil factor 2 (TFF2) is a member of trefoil factor family found to be overexpressed in many cancers including cholangiocarcinoma (CCA). The majority of studies have focused on wild-type TFF2 (wtTFF2) expression, but information regarding alternative splicing variants of TFF2 mRNA has not been reported. In this study, we aimed to identify and quantify a novel TFF2 splice variant in cholangiocarcinoma (CCA). Seventy-eight tumors and 15 normal adjacent tissues were quantified for the expression of the TFF2 splice variant relative to wild-type (wt) TFF2 mRNA using quantitative reverse transcriptase polymerase chain reaction (QRT-PCR). The ratio of TFF2 splice variant against wtTFF2 was analyzed for associations with clinical parameters. We found a novel TFF2 splice variant, exon 2 skipping (ΔEX2TFF2), resulting in a stop codon (TAG) at exon 1. The ΔEX2TFF2/wtTFF2 ratio in tumors was significantly higher than in normal tissue (P<0.01). Interestingly, high ΔEX2TFF2/wtTFF2 ratio was significantly associated with good prognosis compared with low ratio (P=0.017). In contrast, the presence of wtTFF2 protein was associated with poor survival of CCA patients (P=0.034). This is the first report of a trefoil factor splice variant and its potential application as a prognostic biomarker in CCA. PMID:22159958

Liarozole inhibits transforming growth factor-β3–mediated extracellular matrix formation in human three-dimensional leiomyoma cultures

PubMed Central

Levy, Gary; Malik, Minnie; Britten, Joy; Gilden, Melissa; Segars, James; Catherino, William H.

2014-01-01

Objective To investigate the impact of liarozole on transforming growth factor-β3 (TGF-β3) expression, TGF-β3 controlled profibrotic cytokines, and extracellular matrix formation in a three-dimensional (3D) leiomyoma model system. Design Molecular and immunohistochemical analysis in a cell line evaluated in a three-dimensional culture. Setting Laboratory study. Patient(s) None. Intervention(s) Treatment of leiomyoma and myometrial cells with liarozole and TGF-β3 in a three-dimensional culture system. Main Outcome Measure(s) Quantitative real-time reverse-transcriptase polymerase chain reaction and Western blotting to assess fold gene and protein expression of TGF-β3 and TGF-β3 regulated fibrotic cytokines: collagen 1A1 (COL1A1), fibronectin, and versican before and after treatment with liarozole, and confirmatory immunohistochemical stains of treated three-dimensional cultures. Result(s) Both TGF-β3 gene and protein expression were elevated in leiomyoma cells compared with myometrium in two-dimensional and 3D cultures. Treatment with liarozole decreased TGF-β3 gene and protein expression. Extracellular matrix components versican, COL1A1, and fibronectin were also decreased by liarozole treatment in 3D cultures. Treatment of 3D cultures with TGF-β3 increased gene expression and protein production of COL1A1, fibronectin, and versican. Conclusion(s) Liarozole decreased TGF-β3 and TGF-β3–mediated extracellular matrix expression in a 3D uterine leiomyoma culture system. PMID:24825427

Identification of testis-specific male contraceptive targets: insights from transcriptional profiling of the cycle of the rat seminiferous epithelium and purified testicular cells.

PubMed

Johnston, Daniel S; Jelinsky, Scott A; Zhi, Yu; Finger, Joshua N; Kopf, Gregory S; Wright, William W

2007-12-01

In an effort to identify novel targets for the development of nonhormonal male contraceptives, genome-wide transcriptional profiling of the rat testis was performed. Specifically, enzymatically purified spermatogonia plus early spermatocyctes, pachytene spermatocytes, round spermatids, and Sertoli cells was analyzed along with microdissected rat seminiferous tubules at stages I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX- XI, XII, XIII-XIV of the cycle of the seminiferous epithelium using RAE 230_2.0 microarrays. The combined analysis of these studies identified 16,971 expressed probe sets on the array. How these expression data, combined with additional bioinformatic data analysis and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis, led to the identification of 58 genes that have 1000-fold higher expression transcriptionally in the testis when compared to over 20 other nonreproductive tissues is described. The products of these genes may play important roles in testicular and/or sperm function, and further investigation on their utility as nonhormonal contraceptive targets is warranted. Moreover, these microarray data have been used to expedite the identification of a mutation in RIKEN cDNA 2410004F06 gene as likely being responsible for spermatogenic failure in a line of infertile mice generated by N-ethyl-N-nitrosourea (ENU) mutagenesis. The microarray data and the qRT-PCR data described are available in the Mammalian Reproductive Genetics database (http://mrg.genetics.washington.edu/).

Assessment of the U937 cell line for the detection of contact allergens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Python, Francois; Goebel, Carsten; Aeby, Pierre

2007-04-15

The human myeloid cell line U937 was evaluated as an in vitro test system to identify contact sensitizers in order to develop alternatives to animal tests for the cosmetic industry. Specific culture conditions (i.e., presence of interleukin-4, IL-4) were applied to obtain a dendritic cell-like phenotype. In the described test protocol, these cells were exposed to test chemicals and then analyzed by flow cytometry for CD86 expression and by quantitative real-time reverse transcriptase-polymerase chain reaction for IL-1{beta} and IL-8 gene expressions. Eight sensitizers, three non-sensitizers and five oxidative hair dye precursors were examined after 24-, 48- and 72-h exposure times.more » Test item-specific modulations of the chosen activation markers (CD86, IL-1{beta} and IL-8) suggest that this U937 activation test could discriminate test items classified as contact sensitizers or non-sensitizers in the local lymph node assay in mice (LLNA). More specifically, a test item can be considered as a potential sensitizer when it significantly induced the upregulation of the expression of at least two markers. Using this approach, we could correctly evaluate the dendritic cell (DC) activation potential for 15 out of 16 tested chemicals. We conclude that the U937 activation test may represent an useful tool in a future in vitro test battery for predicting sensitizing properties of chemicals.« less

Pluronic-based micelle encapsulation potentiates myricetin-induced cytotoxicity in human glioblastoma cells

PubMed Central

Tang, Xiang-Jun; Huang, Kuan-Ming; Gui, Hui; Wang, Jun-Jie; Lu, Jun-Ti; Dai, Long-Jun; Zhang, Li; Wang, Gang

2016-01-01

As one of the natural herbal flavonoids, myricetin has attracted much research interest, mainly owing to its remarkable anticancer properties and negligible side effects. It holds great potential to be developed as an ideal anticancer drug through improving its bioavailability. This study was performed to investigate the effects of Pluronic-based micelle encapsulation on myricetin-induced cytotoxicity and the mechanisms underlying its anticancer properties in human glioblastoma cells. Cell viability was assessed using a methylthiazol tetrazolium assay and a real-time cell analyzer. Immunoblotting and quantitative reverse transcriptase polymerase chain reaction techniques were used for determining the expression levels of related molecules in protein and mRNA. The results indicated that myricetin-induced cytotoxicity was highly potentiated by the encapsulation of myricetin. Mitochondrial apoptotic pathway was demonstrated to be involved in myricetin-induced glioblastoma cell death. The epidermal growth factor receptor (EGFR)/PI3K/Akt pathway located in the plasma membrane and cytosol and the RAS-ERK pathway located in mitochondria served as upstream and downstream targets, respectively, in myricetin-induced apoptosis. MiR-21 inhibitors interrupted the expression of EGFR, p-Akt, and K-Ras in the same fashion as myricetin-loaded mixed micelles (MYR-MCs) and miR-21 expression were dose-dependently inhibited by MYR-MCs, indicating the interaction of miR-21 with MYR-MCs. This study provided evidence supportive of further development of MYR-MC formulation for preferentially targeting mitochondria of glioblastoma cells. PMID:27757032

Gene expression profiling analysis of the effects of low-intensity pulsed ultrasound on induced pluripotent stem cell-derived neural crest stem cells.

PubMed

Xia, Bin; Zou, Yang; Xu, Zhiling; Lv, Yonggang

2017-11-01

Low-intensity pulsed ultrasound (LIPUS) is a noninvasive technique that has been shown to affect cell proliferation, migration, and differentiation and promote the regeneration of damaged peripheral nerve. Our previous studies had proved that LIPUS can significantly promote the neural differentiation of induced pluripotent stem cell-derived neural crest stem cells (iPSCs-NCSCs) and enhance the repair of rat-transected sciatic nerve. To further explore the underlying mechanisms of LIPUS treatment of iPSCs-NCSCs, this study reported the gene expression profiling analysis of iPSCs-NCSCs before and after LIPUS treatment using the RNA-sequencing (RNA-Seq) method. It was found that expression of 76 genes of iPSCs-NCSCs cultured in a serum-free neural induction medium and expression of 21 genes of iPSCs-NCSCs cultured in a neuronal differentiation medium were significantly changed by LIPUS treatment. The differentially expressed genes are related to angiogenesis, nervous system activity and functions, cell activities, and so on. The RNA-seq results were further verified by a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). High correlation was observed between the results obtained from qRT-PCR and RNA-Seq. This study presented new information on the global gene expression patterns of iPSCs-NCSCs after LIPUS treatment and may expand the understanding of the complex molecular mechanism of LIPUS treatment of iPSCs-NCSCs. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

A small noncoding RNA signature found in exosomes of GBM patient serum as a diagnostic tool.

PubMed

Manterola, Lorea; Guruceaga, Elizabeth; Gállego Pérez-Larraya, Jaime; González-Huarriz, Marisol; Jauregui, Patricia; Tejada, Sonia; Diez-Valle, Ricardo; Segura, Victor; Samprón, Nicolás; Barrena, Cristina; Ruiz, Irune; Agirre, Amaia; Ayuso, Angel; Rodríguez, Javier; González, Alvaro; Xipell, Enric; Matheu, Ander; López de Munain, Adolfo; Tuñón, Teresa; Zazpe, Idoya; García-Foncillas, Jesús; Paris, Sophie; Delattre, Jean Yves; Alonso, Marta M

2014-04-01

Glioblastoma multiforme (GBM) is the most frequent malignant brain tumor in adults, and its prognosis remains dismal despite intensive research and therapeutic advances. Diagnostic biomarkers would be clinically meaningful to allow for early detection of the tumor and for those cases in which surgery is contraindicated or biopsy results are inconclusive. Recent findings show that GBM cells release microvesicles that contain a select subset of cellular proteins and RNA. The aim of this hypothesis-generating study was to assess the diagnostic potential of miRNAs found in microvesicles isolated from the serum of GBM patients. To control disease heterogeneity, we used patients with newly diagnosed GBM. In the discovery stage, PCR-based TaqMan Low Density Arrays followed by individual quantitative reverse transcriptase polymerase chain reaction were used to test the differences in the miRNA expression levels of serum microvesicles among 25 GBM patients and healthy controls paired by age and sex. The detected noncoding RNAs were then validated in another 50 GBM patients. We found that the expression levels of 1 small noncoding RNA (RNU6-1) and 2 microRNAs (miR-320 and miR-574-3p) were significantly associated with a GBM diagnosis. In addition, RNU6-1 was consistently an independent predictor of a GBM diagnosis. Altogether our results uncovered a small noncoding RNA signature in microvesicles isolated from GBM patient serum that could be used as a fast and reliable differential diagnostic biomarker.

Characterization of xanthine dehydrogenase and aldehyde oxidase of Marsupenaeus japonicus and their response to microbial pathogen.

PubMed

Okamura, Yo; Inada, Mari; Elshopakey, Gehad Elsaid; Itami, Toshiaki

2018-05-16

Reactive oxygen species (ROS) play key roles in many physiological processes. In particular, the sterilization mechanism of bacteria using ROS in macrophages is a very important function for biological defense. Xanthine dehydrogenase (XDH) and aldehyde oxidase (AOX), members of the molybdo-flavoenzyme subfamily, are known to generate ROS. Although these enzymes occur in many vertebrates, some insects, and plants, little research has been conducted on XDHs and AOXs in crustaceans. Here, we cloned the entire cDNA sequences of XDH (MjXDH: 4328 bp) and AOX (MjAOX: 4425 bp) from Marsupenaeus japonicus (kuruma shrimp) using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). Quantitative real-time RT-PCR transcriptional analysis revealed that MjXDH mRNA is highly expressed in heart and stomach tissues, whereas MjAOX mRNA is highly expressed in the lymphoid organ and intestinal tissues. Furthermore, expression of MjAOX was determined to be up-regulated in the lymphoid organ in response to Vibrio penaeicida at 48 and 72 h after injection; in contrast, hydrogen peroxide (H 2 O 2 ) concentrations increased significantly at 6, 12, 48, and 72 h after injection with white spot syndrome virus (WSSV) and at 72 h after injection with V. penaeicida. To the best of our knowledge, this study is the first to have identified and cloned XDH and AOX from a crustacean species.

Yellow Fever Virus Modulates the Expression of Key Proteins Related to the microRNA Pathway in the Human Hepatocarcinoma Cell Line HepG2.

PubMed

Holanda, Gustavo Moraes; Casseb, Samir Mansour Moraes; Mello, Karla Fabiane Lopes; Vasconcelos, Pedro Fernando Costa; Cruz, Ana Cecília Ribeiro

2017-06-01

Yellow fever is a zoonotic disease caused by the yellow fever virus (YFV) and transmitted by mosquitoes of the family Culicidae. It is well known that cellular and viral microRNAs (miRNAs) are involved in modulation of viral and cellular gene expression, as well as immune response, and are considered by the scientific community as possible targets for an effective therapy against viral infections. This regulation may be involved in different levels of infection and clinical symptomatology. We used viral titration techniques, viral kinetics from 24 to 96 hours postinfection (hpi), and analyzed the expression of key proteins related to the miRNA pathway by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). The expression of Dicer was different when compared over the course of infection by the distinct YFV genotypes. Drosha expression was similar during infection by YFV genotype 1 or 2, with a decrease in their expression over time and a slight increase in 96 hpi. Ago1, Ago2, and Ago4 showed different levels of expression between the viral genotypes: for YFV genotype 1 infection, Ago1 presented a positive expression, while for YFV genotype 2, it showed a negative expression, when compared with negative controls. We conclude that YFV infection modulates the proteins involved in miRNA biogenesis, which can regulate both viral replication and cellular immune response.

In smokers, Sonic hedgehog modulates pulmonary endothelial function through vascular endothelial growth factor.

PubMed

Henno, Priscilla; Grassin-Delyle, Stanislas; Belle, Emeline; Brollo, Marion; Naline, Emmanuel; Sage, Edouard; Devillier, Philippe; Israël-Biet, Dominique

2017-05-23

Tobacco-induced pulmonary vascular disease is partly driven by endothelial dysfunction. The Sonic hedgehog (SHH) pathway is involved in vascular physiology. We sought to establish whether the SHH pathway has a role in pulmonary endothelial dysfunction in smokers. The ex vivo endothelium-dependent relaxation of pulmonary artery rings in response to acetylcholine (Ach) was compared in 34 current or ex-smokers and 8 never-smokers. The results were expressed as a percentage of the contraction with phenylephrine. We tested the effects of SHH inhibitors (GANT61 and cyclopamine), an SHH activator (SAG) and recombinant VEGF on the Ach-induced relaxation. The level of VEGF protein in the pulmonary artery ring was measured in an ELISA. SHH pathway gene expression was quantified in reverse transcriptase-quantitative polymerase chain reactions. Ach-induced relaxation was much less intense in smokers than in never-smokers (respectively 24 ± 6% and 50 ± 7% with 10 -4 M Ach; p = 0.028). All SHH pathway genes were expressed in pulmonary artery rings from smokers. SHH inhibition by GANT61 reduced Ach-induced relaxation and VEGF gene expression in the pulmonary artery ring. Recombinant VEGF restored the ring's endothelial function. VEGF gene and protein expression levels in the pulmonary artery rings were positively correlated with the degree of Ach-induced relaxation and negatively correlated with the number of pack-years. SHH pathway genes and proteins are expressed in pulmonary artery rings from smokers, where they modulate endothelial function through VEGF.

Cloning of an ADP-ribosylation factor gene from banana (Musa acuminata) and its expression patterns in postharvest ripening fruit.

PubMed

Wang, Yuan; Wu, Jing; Xu, Bi-Yu; Liu, Ju-Hua; Zhang, Jian-Bin; Jia, Cai-Hong; Jin, Zhi-Qiang

2010-08-15

A full-length cDNA encoding an ADP-ribosylation factor (ARF) from banana (Musa acuminata) fruit was cloned and named MaArf. It contains an open reading frame encoding a 181-amino-acid polypeptide. Sequence analysis showed that MaArf shared high similarity with ARF of other plant species. The genomic sequence of MaArf was also obtained using polymerase chain reaction (PCR). Sequence analysis showed that MaArf was a split gene containing five exons and four introns in genomic DNA. Reverse-transcriptase PCR was used to analyze the spatial expression of MaArf. The results showed that MaArf was expressed in all the organs examined: root, rhizome, leaf, flower and fruit. Real-time quantitative PCR was used to explore expression patterns of MaArf in postharvest banana. There was differential expression of MaArf associated with ethylene biosynthesis. In naturally ripened banana, expression of MaArf was in accordance with ethylene biosynthesis. However, in 1-methylcyclopropene-treated banana, the expression of MaArf was inhibited and changed little. When treated with ethylene, MaArf expression in banana fruit significantly increased in accordance with ethylene biosynthesis; the peak of MaArf was 3 d after harvest, 11 d earlier than for naturally ripened banana fruits. These results suggest that MaArf is induced by ethylene in regulating postharvest banana ripening. Finally, subcellular localization assays showed the MaArf protein in the cytoplasm. Copyright 2010 Elsevier GmbH. All rights reserved.

Low-level lasers and mRNA levels of reference genes used in Escherichia coli

NASA Astrophysics Data System (ADS)

Teixeira, A. F.; Machado, Y. L. R. C.; Fonseca, A. S.; Mencalha, A. L.

2016-11-01

Low-level lasers are widely used for the treatment of diseases and antimicrobial photodynamic therapy. Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is widely used to evaluate mRNA levels and output data from a target gene are commonly relative to a reference mRNA that cannot vary according to treatment. In this study, the level of reference genes from Escherichia coli exposed to red or infrared lasers at different fluences was evaluated. E. coli AB1157 cultures were exposed to red (660 nm) and infrared (808 nm) lasers, incubated (20 min, 37 °C), the total RNA was extracted, and cDNA synthesis was performed to evaluate mRNA levels from arcA, gyrA and rpoA genes by RT-qPCR. Melting curves and agarose gel electrophoresis were carried out to evaluate specific amplification. Data were analyzed by geNorm, NormFinder and BestKeeper. The melting curve and agarose gel electrophoresis showed specific amplification. Although mRNA levels from arcA, gyrA or rpoA genes presented no significant variations trough a traditional statistical analysis, Excel-based tools revealed that these reference genes are not suitable for E. coli cultures exposed to lasers. Our data showed that exposure to low-level red and infrared lasers at different fluences alter the mRNA levels from arcA, gyrA and rpoA in E. coli cells.

Selection of Reference Genes for RT-qPCR Analysis in Coccinella septempunctata to Assess Un-intended Effects of RNAi Transgenic Plants.

PubMed

Yang, Chunxiao; Preisser, Evan L; Zhang, Hongjun; Liu, Yong; Dai, Liangying; Pan, Huipeng; Zhou, Xuguo

2016-01-01

The development of genetically engineered plants that employ RNA interference (RNAi) to suppress invertebrate pests opens up new avenues for insect control. While this biotechnology shows tremendous promise, the potential for both non-target and off-target impacts, which likely manifest via altered mRNA expression in the exposed organisms, remains a major concern. One powerful tool for the analysis of these un-intended effects is reverse transcriptase-quantitative polymerase chain reaction, a technique for quantifying gene expression using a suite of reference genes for normalization. The seven-spotted ladybeetle Coccinella septempunctata , a commonly used predator in both classical and augmentative biological controls, is a model surrogate species used in the environmental risk assessment (ERA) of plant incorporated protectants (PIPs). Here, we assessed the suitability of eight reference gene candidates for the normalization and analysis of C. septempunctata v-ATPase A gene expression under both biotic and abiotic conditions. Five computational tools with distinct algorisms, geNorm, Normfinder, BestKeeper , the Δ C t method, and RefFinder , were used to evaluate the stability of these candidates. As a result, unique sets of reference genes were recommended, respectively, for experiments involving different developmental stages, tissues, and ingested dsRNAs. By providing a foundation for standardized RT-qPCR analysis in C. septempunctata , our work improves the accuracy and replicability of the ERA of PIPs involving RNAi transgenic plants.

Expression Patterns and Identified Protein-Protein Interactions Suggest That Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses.

PubMed

Mo, Chunyan; Wan, Shumin; Xia, Youquan; Ren, Ning; Zhou, Yang; Jiang, Xingyu

2018-01-01

Cassava is an energy crop that is tolerant of multiple abiotic stresses. It has been reported that the interaction between Calcineurin B-like (CBL) protein and CBL-interacting protein kinase (CIPK) is implicated in plant development and responses to various stresses. However, little is known about their functions in cassava. Herein, 8 CBL ( MeCBL ) and 26 CIPK ( MeCIPK ) genes were isolated from cassava by genome searching and cloning of cDNA sequences of Arabidopsis CBL s and CIPK s. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis showed that the expression levels of MeCBL and MeCIPK genes were different in different tissues throughout the life cycle. The expression patterns of 7 CBL and 26 CIPK genes in response to NaCl, PEG, heat and cold stresses were analyzed by quantitative real-time PCR (qRT-PCR), and it was found that the expression of each was induced by multiple stimuli. Furthermore, we found that many pairs of CBLs and CIPKs could interact with each other via investigating the interactions between 8 CBL and 25 CIPK proteins using a yeast two-hybrid system. Yeast cells co-transformed with cassava MeCIPK24, MeCBL10 , and Na + /H + antiporter MeSOS1 genes exhibited higher salt tolerance compared to those with one or two genes. These results suggest that the cassava CBL-CIPK signal network might play key roles in response to abiotic stresses.

Expression Patterns and Identified Protein-Protein Interactions Suggest That Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses

PubMed Central

Mo, Chunyan; Wan, Shumin; Xia, Youquan; Ren, Ning; Zhou, Yang; Jiang, Xingyu

2018-01-01

Cassava is an energy crop that is tolerant of multiple abiotic stresses. It has been reported that the interaction between Calcineurin B-like (CBL) protein and CBL-interacting protein kinase (CIPK) is implicated in plant development and responses to various stresses. However, little is known about their functions in cassava. Herein, 8 CBL (MeCBL) and 26 CIPK (MeCIPK) genes were isolated from cassava by genome searching and cloning of cDNA sequences of Arabidopsis CBLs and CIPKs. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis showed that the expression levels of MeCBL and MeCIPK genes were different in different tissues throughout the life cycle. The expression patterns of 7 CBL and 26 CIPK genes in response to NaCl, PEG, heat and cold stresses were analyzed by quantitative real-time PCR (qRT-PCR), and it was found that the expression of each was induced by multiple stimuli. Furthermore, we found that many pairs of CBLs and CIPKs could interact with each other via investigating the interactions between 8 CBL and 25 CIPK proteins using a yeast two-hybrid system. Yeast cells co-transformed with cassava MeCIPK24, MeCBL10, and Na+/H+ antiporter MeSOS1 genes exhibited higher salt tolerance compared to those with one or two genes. These results suggest that the cassava CBL-CIPK signal network might play key roles in response to abiotic stresses. PMID:29552024

Altered serum microRNAs as biomarkers for the early diagnosis of pulmonary tuberculosis infection

PubMed Central

2012-01-01

Background Pulmonary tuberculosis (TB) is a highly lethal infectious disease and early diagnosis of TB is critical for the control of disease progression. The objective of this study was to profile a panel of serum microRNAs (miRNAs) as potential biomarkers for the early diagnosis of pulmonary TB infection. Methods Using TaqMan Low-Density Array (TLDA) analysis followed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) validation, expression levels of miRNAs in serum samples from 30 patients with active tuberculosis and 60 patients with Bordetella pertussis (BP), varicella-zoster virus (VZV) and enterovirus (EV) were analyzed. Results The Low-Density Array data showed that 97 miRNAs were differentially expressed in pulmonary TB patient sera compared with healthy controls (90 up-regulated and 7 down-regulated). Following qRT-PCR confirmation and receiver operational curve (ROC) analysis, three miRNAs (miR-361-5p, miR-889 and miR-576-3p) were shown to distinguish TB infected patients from healthy controls and other microbial infections with moderate sensitivity and specificity (area under curve (AUC) value range, 0.711-0.848). Multiple logistic regression analysis of a combination of these three miRNAs showed an enhanced ability to discriminate between these two groups with an AUC value of 0.863. Conclusions Our study suggests that altered levels of serum miRNAs have great potential to serve as non-invasive biomarkers for early detection of pulmonary TB infection. PMID:23272999

MiR-221, a potential prognostic biomarker for recurrence in papillary thyroid cancer.

PubMed

Dai, Lei; Wang, Yaozong; Chen, Liangliang; Zheng, Jueru; Li, Jianjun; Wu, Xianjiang

2017-01-07

Many studies have reported several transcriptionally deregulated microRNAs (miRNAs) in papillary thyroid cancer (PTC) tissue in comparison with benign thyroid nodules and normal thyroid tissues. However, the correlation between miRNA expressions and PTC recurrence still remains unclear. The PTC patients who scheduled to undergo total thyroidectomy by the same surgical team in Ningbo NO.2 Hospital from March 1998 to March 2008 were enrolled in this study. The clinical and pathological characteristics of each patient were recorded in detail. The selected miRNA expressions were detected using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). Potential predictive factors for cancer recurrence were evaluated by univariate and multivariate Cox proportional hazard analysis. A total of 78 patients were enrolled with 49 females at a mean age of 45.8 years. Enrolled patients were divided into two groups: nonrecurrent group (n = 54) and recurrent group (n = 24). The results from the univariate Cox proportional hazard analysis revealed that primary tumor size, TNM stage, extrathyroid extension, miR-221, and miR-222 expressions were significantly associated with PTC recurrence (P < 0.05). The tissue expression of miR-221 was the only independent risk factor for PTC recurrence (HR 1.41; 95%CI 1.14-1.95, P = 0.007) by multiple Cox proportional hazard analysis. This study identified the potential role of miR-221 as a prognostic biomarker for the recurrence in PTC.

Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes.

PubMed

Balasubramaniam, Muthukumar; Davids, Benem; Addai, Amma B; Pandhare, Jui; Dash, Chandravanu

2017-02-22

HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3' ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

Grouping patients for masseter muscle genotype-phenotype studies.

PubMed

Moawad, Hadwah Abdelmatloub; Sinanan, Andrea C M; Lewis, Mark P; Hunt, Nigel P

2012-03-01

To use various facial classifications, including either/both vertical and horizontal facial criteria, to assess their effects on the interpretation of masseter muscle (MM) gene expression. Fresh MM biopsies were obtained from 29 patients (age, 16-36 years) with various facial phenotypes. Based on clinical and cephalometric analysis, patients were grouped using three different classifications: (1) basic vertical, (2) basic horizontal, and (3) combined vertical and horizontal. Gene expression levels of the myosin heavy chain genes MYH1, MYH2, MYH3, MYH6, MYH7, and MYH8 were recorded using quantitative reverse transcriptase polymerase chain reaction (RT-PCR) and were related to the various classifications. The significance level for statistical analysis was set at P ≤ .05. Using classification 1, none of the MYH genes were found to be significantly different between long face (LF) patients and the average vertical group. Using classification 2, MYH3, MYH6, and MYH7 genes were found to be significantly upregulated in retrognathic patients compared with prognathic and average horizontal groups. Using classification 3, only the MYH7 gene was found to be significantly upregulated in retrognathic LF compared with prognathic LF, prognathic average vertical faces, and average vertical and horizontal groups. The use of basic vertical or basic horizontal facial classifications may not be sufficient for genetics-based studies of facial phenotypes. Prognathic and retrognathic facial phenotypes have different MM gene expressions; therefore, it is not recommended to combine them into one single group, even though they may have a similar vertical facial phenotype.

Effects of virus dose and extrinsic incubation temperature on vector competence of Culex nigripalpus (Diptera: Culicidae) for St. Louis encephalitis virus.

PubMed

Richards, Stephanie L; Anderson, Sheri L; Lord, Cynthia C; Tabachnick, Walter J

2012-11-01

Culex nigripalpus Theobald is a primary vector of St. Louis encephalitis virus in the southeastern United States. Cx. nigripalpus females were fed blood containing a low (4.0 +/- 0.01 log10 plaque-forming unit equivalents (PFUeq) /ml) or high (4.7 +/- 0.1 log10 PFUeq/ml) St. Louis encephalitis virus dose and maintained at extrinsic incubation temperatures (EIT) of 25 or 28 degrees C for 12 d. Vector competence was measured via quantitative real-time reverse transcriptase polymerase chain reaction to estimate PFUeq using rates of infection, dissemination, and transmission. There were no differences in infection rates between the two EITs at either dose. The low dose had higher infection rates at both EITs. Dissemination rates were significantly higher at 28 degrees C compared with 25 degrees C at both doses. Virus transmission was observed (<7%) only at 28 degrees C for both doses. The virus titer in body tissues was greater at 28 degrees C compared with 25 degrees C at both doses. The difference between the EITs was greater at the low dose, resulting in a higher titer for the low dose than the high dose at 28 degrees C. Virus titers in leg tissues were greater in mosquitoes fed the high versus low dose, but were not influenced by EIT. Further investigations using a variety of environmental and biological factors would be useful in exploring the complexity of vector competence.

Effects of Virus Dose and Extrinsic Incubation Temperature on Vector Competence of Culex nigripalpus (Diptera: Culicidae) for St. Louis Encephalitis Virus

PubMed Central

RICHARDS, STEPHANIE L.; ANDERSON, SHERI L.; LORD, CYNTHIA C.; TABACHNICK, WALTER J.

2013-01-01

Culex nigripalpus Theobald is a primary vector of St. Louis encephalitis virus in the southeastern United States. Cx. nigripalpus females were fed blood containing a low (4.0 ± 0.01 log10 plaque-forming unit equivalents (PFUeq)/ml) or high (4.7 ± 0.1 log10 PFUeq/ml) St. Louis encephalitis virus dose and maintained at extrinsic incubation temperatures (EIT) of 25 or 28°C for 12 d. Vector competence was measured via quantitative real-time reverse transcriptase polymerase chain reaction to estimate PFUeq using rates of infection, dissemination, and transmission. There were no differences in infection rates between the two EITs at either dose. The low dose had higher infection rates at both EITs. Dissemination rates were significantly higher at 28°C compared with 25°C at both doses. Virus transmission was observed (<7%) only at 28°C for both doses. The virus titer in body tissues was greater at 28°C compared with 25°C at both doses. The difference between the EITs was greater at the low dose, resulting in a higher titer for the low dose than the high dose at 28°C. Virus titers in leg tissues were greater in mosquitoes fed the high versus low dose, but were not influenced by EIT. Further investigations using a variety of environmental and biological factors would be useful in exploring the complexity of vector competence. PMID:23270182

PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

PubMed

Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

2016-05-01

To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

Skeletal muscle myoblasts possess a stretch-responsive local angiotensin signalling system.

PubMed

Johnston, Adam P W; Baker, Jeff; De Lisio, Michael; Parise, Gianni

2011-06-01

A paucity of information exists regarding the presence of local renin-angiotensin systems (RASs) in skeletal muscle and associated muscle stem cells. Skeletal muscle and muscle stem cells were isolated from C57BL/6 mice and examined for the presence of a local RAS using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), immunohistochemistry (IHC), Western blotting and liquid chromatography-mass spectrometry (LC-MS). Furthermore, the effect of mechanical stimulation on RAS member gene expression was analysed. Whole skeletal muscle, primary myoblasts and C2C12 derived myoblasts and myotubes differentially expressed members of the RAS including angiotensinogen, angiotensin-converting enzyme (ACE), angiotensin II (Ang II) type 1 (AT(1)) and type 2 (AT(2)). Renin transcripts were never detected, however, mRNA for the 'renin-like' enzyme cathepsin D was observed and Ang I and Ang II were identified in cell culture supernatants from proliferating myoblasts. AT(1) appeared to co-localise with polymerised actin filaments in proliferating myoblasts and was primarily found in the nucleus of terminally differentiated myotubes. Furthermore, mechanical stretch of proliferating and differentiating C2C12 cells differentially induced mRNA expression of angiotensinogen, AT(1) and AT(2). Proliferating and differentiated muscle stem cells possess a local stress-responsive RAS in vitro. The precise function of a local RAS in myoblasts remains unknown. However, evidence presented here suggests that Ang II may be a regulator of skeletal muscle myoblasts.

Myofibroblasts in interstitial lung diseases show diverse electron microscopic and invasive features.

PubMed

Karvonen, Henna M; Lehtonen, Siri T; Sormunen, Raija T; Harju, Terttu H; Lappi-Blanco, Elisa; Bloigu, Risto S; Kaarteenaho, Riitta L

2012-09-01

The characteristic features of myofibroblasts in various lung disorders are poorly understood. We have evaluated the ultrastructure and invasive capacities of myofibroblasts cultured from small volumes of diagnostic bronchoalveolar lavage (BAL) fluid samples from patients with different types of lung diseases. Cells were cultured from samples of BAL fluid collected from 51 patients that had undergone bronchoscopy and BAL for diagnostic purposes. The cells were visualized by transmission electron microscopy and immunoelectron microscopy to achieve ultrastructural localization of alpha-smooth muscle actin (α-SMA) and fibronectin. The levels of α-SMA protein and mRNA and fibronectin mRNA were measured by western blot and quantitative real-time reverse transcriptase polymerase chain reaction. The invasive capacities of the cells were evaluated. The cultured cells were either fibroblasts or myofibroblasts. The structure of the fibronexus, and the amounts of intracellular actin, extracellular fibronectin and cell junctions of myofibroblasts varied in different diseases. In electron and immunoelectron microscopy, cells cultured from interstitial lung diseases (ILDs) expressed more actin filaments and α-SMA than normal lung. The invasive capacity of the cells obtained from patients with idiopathic pulmonary fibrosis was higher than that from patients with other type of ILDs. Cells expressing more actin filaments had a higher invasion capacity. It is concluded that electron and immunoelectron microscopic studies of myofibroblasts can reveal differential features in various diseases. An analysis of myofibroblasts cultured from diagnostic BAL fluid samples may represent a new kind of tool for diagnostics and research into lung diseases.

A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

PubMed

Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

PubMed Central

Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

2014-01-01

A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

Disappearance of Ph1 chromosome with intensive chemotherapy and detection of minimal residual disease by polymerase chain reaction in a patient with blast crisis of chronic myelogenous leukemia.

PubMed

Honda, H; Miyagawa, K; Endo, M; Takaku, F; Yazaki, Y; Hirai, H

1993-06-01

We diagnosed a patient with chronic myelogenous leukemia (CML) in chronic phase (CP) on the basis of clinical findings, Ph1 chromosome detected by cytogenetic analysis, and bcr-abl fusion mRNA detected by reverse transcriptase-dependent polymerase chain reaction (RT-PCR). One month after diagnosis, the patient developed extramedullary blast crisis in the lymph nodes, and then medullary blast crisis in the bone marrow, in which different surface markers were shown. Combination chemotherapy with BH-AC, VP16, and mitoxantrone was administered; this resulted in rapid disappearance of the lymphadenopathy, restoration of normal hematopoiesis, and no Ph1 chromosome being detected by cytogenetic analysis. RT-PCR performed to detect the residual Ph1 clone revealed that although the Ph1 clone was preferentially suppressed, it was still residual. The intensive chemotherapy regimen preferentially suppressed the Ph1-positive clone and led to both clinical and cytogenetic remission in this patient with BC of CML; we suggest that RT-PCR is a sensitive and useful method for detecting minimal residual disease during the clinical course of this disease.

A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

PubMed

Gadkar, Vijay J; Filion, Martin

2013-06-01

In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study.

PubMed

Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin

2015-03-01

A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

Antiretroviral therapy-induced mitochondrial toxicity: potential mechanisms beyond polymerase-γ inhibition.

PubMed

Selvaraj, S; Ghebremichael, M; Li, M; Foli, Y; Langs-Barlow, A; Ogbuagu, A; Barakat, L; Tubridy, E; Edifor, R; Lam, W; Cheng, Y-C; Paintsil, E

2014-07-01

We hypothesized that competition between nucleotide reverse-transcriptase inhibitor triphosphate and endogenous deoxyribonucleotide triphosphate (dNTP) may lead to depletion of dNTP pools and mitochondrial dysfunction independent of polymerase-γ (pol-γ) inhibition. We collected peripheral blood mononuclear cells from 75 adults (25 cases: HIV-infected patients with mitochondrial toxicity, 25 HIV-infected positive controls, and 25 HIV-negative controls). We observed statistically significant individual and group differences in ribonucleotide (RN) and deoxyribonucleotide (dRN) pools. The median values for the RN pools were 10,062 (interquartile range (IQR): 7,090-12,590), 4,360 (IQR: 3,058-6,838), and 2,968 (IQR: 2,538-4,436) pmol/10(6) cells for negative controls, positive controls, and cases, respectively. Cases had significantly higher absolute mitochondrial DNA copy number as compared with negative controls (P < 0.05). Moreover, cases had significantly higher expression levels of pol-γ, nucleotide transporters, cellular kinases, and adenosine triphosphate (ATP)-binding cassette (ABC) proteins as compared with controls. Antiretroviral therapy (ART) perturbs RN and dRN pools. Depletion of RN and dRN pools may be associated with ART-induced mitochondrial toxicity independent of pol-γ inhibition.

Targeted transgenic overexpression of mitochondrial thymidine kinase (TK2) alters mitochondrial DNA (mtDNA) and mitochondrial polypeptide abundance: transgenic TK2, mtDNA, and antiretrovirals.

PubMed

Hosseini, Seyed H; Kohler, James J; Haase, Chad P; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

2007-03-01

Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-gamma. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity.

Targeted Transgenic Overexpression of Mitochondrial Thymidine Kinase (TK2) Alters Mitochondrial DNA (mtDNA) and Mitochondrial Polypeptide Abundance

PubMed Central

Hosseini, Seyed H.; Kohler, James J.; Haase, Chad P.; Tioleco, Nina; Stuart, Tami; Keebaugh, Erin; Ludaway, Tomika; Russ, Rodney; Green, Elgin; Long, Robert; Wang, Liya; Eriksson, Staffan; Lewis, William

2007-01-01

Mitochondrial toxicity limits nucleoside reverse transcriptase inhibitors (NRTIs) for acquired immune deficiency syndrome. NRTI triphosphates, the active moieties, inhibit human immunodeficiency virus reverse transcriptase and eukaryotic mitochondrial DNA polymerase pol-γ. NRTI phosphorylation seems to correlate with mitochondrial toxicity, but experimental evidence is lacking. Transgenic mice (TGs) with cardiac overexpression of thymidine kinase isoforms (mitochondrial TK2 and cytoplasmic TK1) were used to study NRTI mitochondrial toxicity. Echocardiography and nuclear magnetic resonance imaging defined cardiac performance and structure. TK gene copy and enzyme activity, mitochondrial (mt) DNA and polypeptide abundance, succinate dehydrogenase and cytochrome oxidase histochemistry, and electron microscopy correlated with transgenesis, mitochondrial structure, and biogenesis. Antiretroviral combinations simulated therapy. Untreated hTK1 or TK2 TGs exhibited normal left ventricle mass. In TK2 TGs, cardiac TK2 gene copy doubled, activity increased 300-fold, and mtDNA abundance doubled. Abundance of the 17-kd subunit of complex I, succinate dehydrogenase histochemical activity, and cristae density increased. NRTIs increased left ventricle mass 20% in TK2 TGs. TK activity increased 3 logs in hTK1 TGs, but no cardiac phenotype resulted. NRTIs abrogated functional effects of transgenically increased TK2 activity but had no effect on TK2 mtDNA abundance. Thus, NRTI mitochondrial phosphorylation by TK2 is integral to clinical NRTI mitochondrial toxicity. PMID:17322372

Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine.

PubMed Central

Fitzgibbon, J E; Howell, R M; Haberzettl, C A; Sperber, S J; Gocke, D J; Dubin, D T

1992-01-01

To investigate whether human immunodeficiency virus type 1 pol gene mutations are selected during prolonged 2',3'-dideoxycytidine (ddC) therapy, we used the polymerase chain reaction to amplify a portion of the reverse transcriptase segment of the pol gene from the peripheral blood mononuclear cell DNA of a patient with AIDS before and after an 80-week course of ddC therapy. The consensus sequence from the second sample contained a unique double mutation (ACT to GAT) in the codon for reverse transcriptase amino acid 69, causing substitution of aspartic acid (Asp) for the wild-type threonine (Thr). A mutation (ACA to ATA) also occurred in the codon for position 165, causing substitution of isoleucine (Ile) for Thr. The GAT (Asp) codon was introduced into the pol gene of a molecular clone of human immunodeficiency virus via site-directed mutagenesis. Following transfection, mutant and wild-type viruses were tested for susceptibility to ddC by a plaque reduction assay. The mutant virus was fivefold less susceptible to ddC than the wild type; cross-resistance to 3'-azido-3'-deoxythymidine or 2'3'-dideoxyinosine was not found. The Ile-165 mutation did not confer additional ddC resistance. The Asp-69 substitution may have contributed to the generation of resistant virus in this patient. Images PMID:1317143

Genetic characterization and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China.

PubMed

Guo, Jinlei; Yan, Yong; Zhang, Jiafeng; Ji, Jimei; Ge, Zhijian; Ge, Rui; Zhang, Xiaofei; Wang, Henghui; Chen, Zhongwen; Luo, Jianyong

2017-03-14

The aim of this study was to characterize HIV-1 genotypes and antiretroviral resistance mutations among treatment-naive HIV-infected individuals in Jiaxing, China. The HIV-1 partial polymerase (pol) genes in 93 of the 99 plasma samples were successfully amplified and analyzed. Phylogenetic analysis revealed the existence of five HIV-1 genotypes, of which the most prevalent genotype was CRF01_AE (38.7%), followed by CRF07_BC (34.4%), CRF08_BC (16.1%), subtype B/B' (5.4%), and CRF55_01B (2.1%). Besides, three types of unique recombination forms (URFs) were also observed, including C/F2/A1, CRF01_AE/B, and CRF08_BC/CRF07_BC. Among 93 amplicons, 46.2% had drug resistance-associated mutations, including 23.7% for protease inhibitors (PIs) mutations, 1.1% for nucleoside reverse transcriptase inhibitors (NRTIs) mutations, and 20.4% for non-nucleoside reverse transcriptase inhibitors (NNRTIs) mutations. Six (6.5%) out of 93 treatment-naive subjects were identified to be resistant to one or more NNRTIs, while resistance to NRTIs or PIs was not observed. Our study showed the genetic diversity of HIV-1 strains circulating in Jiaxing and a relative high proportion of antiretroviral resistance mutations among treatment-naive patients, indicating a serious challenge for HIV prevention and treatment program.

Endogenous New World primate type C viruses isolated from owl monkey (Aotus trivirgatus) kidney cell line.

PubMed Central

Todaro, G J; Sherr, C J; Sen, A; King, N; Daniel, M D; Fleckenstein, B

1978-01-01

A type C virus (OMC-1) detected in a culture of owl monkey kidney cells resembled typical type C viruses morphologically, but was slightly larger than previously characterized mammalian type C viruses. OMC-1 can be transmitted to bat lung cells and cat embryo fibroblasts. The virions band at a density of 1.16 g/ml in isopycnic sucrose density gradients and contain reverse transcriptase and a 60-65S RNA genome composed of approximately 32S subunits. The reverse transcriptase is immunologically and biochemically distinct from the polymerases of othe retroviruses. Radioimmunoassays directed to the interspecies antigenic determinants of the major structure proteins of other type C viruses do not detect a related antigen in OMC-1. Nucleic acid hybridization experiments using labeled viral genomic RNA or proviral cDNA transcripts to normal cellular DNA of different species show that OMC-1 is an endogenous virus with multiple virogene copies (20-50 per haploid genome) present in normal owl monkey cells and is distinct from previously isolated type C and D viruses. Sequences related to the OMC-1 genome can be detected in other New World monkeys. Thus, similar to the Old World primates (e.g., baboons as a prototype), the New World monkeys contain endogenous type C viral genes that appear to have been transmitted in the primate germ line. Images PMID:76312

Unfolding the HIV-1 reverse transcriptase RNase H domain – how to lose a molecular tug-of-war

DOE PAGES

Zheng, Xunhai; Pedersen, Lars C.; Gabel, Scott A.; ...

2016-01-14

Formation of the mature HIV-1 reverse transcriptase (RT) p66/p51 heterodimer requires subunit-specific processing of the p66/p66' homodimer precursor. Since the ribonuclease H (RH) domain contains an occult cleavage site located near its center, cleavage must occur either prior to folding or subsequent to unfolding. Recent NMR studies have identified a slow, subunit-specific RH domain unfolding process proposed to result from a residue tug-of-war between the polymerase and RH domains on the functionally inactive, p66' subunit. Here, we describe a structural comparison of the isolated RH domain with a domain swapped RH dimer that reveals several intrinsically destabilizing characteristics of themore » isolated domain that facilitate excursions of Tyr427 from its binding pocket and separation of helices B and D. These studies provide independent support for the subunit-selective RH domain unfolding pathway in which instability of the Tyr427 binding pocket facilitates its release followed by domain transfer, acting as a trigger for further RH domain destabilization and subsequent unfolding. As further support for this pathway, NMR studies demonstrate that addition of an RH active site-directed isoquinolone ligand retards the subunit-selective RH' domain unfolding behavior of the p66/p66' homodimer. As a result, this study demonstrates the feasibility of directly targeting RT maturation with therapeutics.« less

Unfolding the HIV-1 reverse transcriptase RNase H domain – how to lose a molecular tug-of-war

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Xunhai; Pedersen, Lars C.; Gabel, Scott A.

Formation of the mature HIV-1 reverse transcriptase (RT) p66/p51 heterodimer requires subunit-specific processing of the p66/p66' homodimer precursor. Since the ribonuclease H (RH) domain contains an occult cleavage site located near its center, cleavage must occur either prior to folding or subsequent to unfolding. Recent NMR studies have identified a slow, subunit-specific RH domain unfolding process proposed to result from a residue tug-of-war between the polymerase and RH domains on the functionally inactive, p66' subunit. Here, we describe a structural comparison of the isolated RH domain with a domain swapped RH dimer that reveals several intrinsically destabilizing characteristics of themore » isolated domain that facilitate excursions of Tyr427 from its binding pocket and separation of helices B and D. These studies provide independent support for the subunit-selective RH domain unfolding pathway in which instability of the Tyr427 binding pocket facilitates its release followed by domain transfer, acting as a trigger for further RH domain destabilization and subsequent unfolding. As further support for this pathway, NMR studies demonstrate that addition of an RH active site-directed isoquinolone ligand retards the subunit-selective RH' domain unfolding behavior of the p66/p66' homodimer. As a result, this study demonstrates the feasibility of directly targeting RT maturation with therapeutics.« less

Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

PubMed

Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

2002-01-01

Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

Value of molecular monitoring during the treatment of chronic myeloid leukemia: a Cancer and Leukemia Group B study.

PubMed

Stock, W; Westbrook, C A; Peterson, B; Arthur, D C; Szatrowski, T P; Silver, R T; Sher, D A; Wu, D; Le Beau, M M; Schiffer, C A; Bloomfield, C D

1997-01-01

Disappearance of the Philadelphia chromosome during treatment for chronic myeloid leukemia (CML) has become an important therapeutic end point. To determine the additional value of molecular monitoring during treatment for CML, we performed a prospective, sequential analysis using quantitative Southern blot monitoring of BCR gene rearrangements of blood and marrow samples from Cancer and Leukemia Group B (CALGB) study 8761. Sixty-four previously untreated adults with chronic-phase CML who were enrolled onto CALGB 8761, a molecular-monitoring companion study to a treatment study for adults with chronic-phase CML (CALGB 9013). Treatment consisted of repetitive cycles of interferon alfa and low-dose subcutaneous cytarabine. Blood and marrow Southern blot quantitation of BCR gene rearrangements was compared with marrow cytogenetic analysis before the initiation of treatment and of specified points during therapy. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis was performed to detect residual disease in patients who achieved a complete response by Southern blot or cytogenetic analysis. Quantitative molecular monitoring by Southern blot analysis of blood samples was found to be equivalent to marrow monitoring at all time points. Twelve of 62 (19%) follow-up samples studied by Southern blot analysis had a complete loss of BCR gene rearrangement in matched marrow and blood specimens. Southern blot monitoring of blood samples was also found to be highly correlated to marrow cytogenetic evaluation at all points, although there were four discordant cases in which Southern blot analysis of blood showed no BCR gene rearrangement, yet demonstrated from 12% to 20% Philadelphia chromosome-positive metaphase cells in the marrow. RT-PCR analysis detected residual disease in five of six patients in whom no malignant cells were detected using Southern blot or cytogenetic analyses. Quantitative Southern blot analysis of blood samples may be substituted for bone marrow to monitor the response to therapy in CML and results in the need for fewer bone marrow examinations. To avoid overestimating the degree of response, marrow cytogenetic analysis should be performed when patients achieve a complete response by Southern blot monitoring. This approach provides a rational, cost-effective strategy to monitor the effect of treatment of individual patients, as well as to analyze large clinical trials in CML.

Successful Validation of Sample Processing and Quantitative Real-Time PCR Capabilities on the International Space Station

NASA Technical Reports Server (NTRS)

Parra, Macarena; Jung, Jimmy; Almeida, Eduardo; Boone, Travis; Schonfeld, Julie; Tran, Luan

2016-01-01

The WetLab-2 system was developed by NASA Ames Research Center to offer new capabilities to researchers. The system can lyse cells and extract RNA (Ribonucleic Acid) on-orbit from different sample types ranging from microbial cultures to animal tissues. The purified RNA can then either be stabilized for return to Earth or can be used to conduct on-orbit quantitative Reverse Transcriptase PCR (Polymerase Chain Reaction) (qRT-PCR) analysis without the need for sample return. The qRT-PCR results can be downlinked to the ground a few hours after the completion of the run. The validation flight of the WetLab-2 system launched on SpaceX-8 on April 8, 2016. On orbit operations started on April 15th with system setup and was followed by three quantitative PCR runs using an E. coli genomic DNA template pre-loaded at three different concentrations. These runs were designed to discern if quantitative PCR functions correctly in microgravity and if the data is comparable to that from the ground control runs. The flight data showed no significant differences compared to the ground data though there was more variability in the values, this was likely due to the numerous small bubbles observed. The capability of the system to process samples and purify RNA was then validated using frozen samples prepared on the ground. The flight data for both E. coli and mouse liver clearly shows that RNA was successfully purified by our system. The E. coli qRT-PCR run showed successful singleplex, duplex and triplex capability. Data showed high variability in the resulting Cts (Cycle Thresholds [for the PCR]) likely due to bubble formation and insufficient mixing during the procedure run. The mouse liver qRT-PCR run had successful singleplex and duplex reactions and the variability was slightly better as the mixing operation was improved. The ability to purify and stabilize RNA and to conduct qRT-PCR on-orbit is an important step towards utilizing the ISS as a National Laboratory facility. The ability to get on-orbit data will provide investigators with the opportunity to adjust experimental parameters in real time without the need for sample return and re-flight. The WetLab-2 Project is supported by the Research Integration Office in the ISS Program.

Molecular detection of mixed infections with multiple dengue virus serotypes in suspected dengue samples in Tamaulipas, Mexico.

PubMed

Requena-Castro, Rocío; Reyes-López, Miguel Ángel; Rodríguez-Reyna, Rosa Eminé; Palma-Nicolás, Prisco; Bocanegra-García, Virgilio

2017-07-01

This study aimed to detect dengue virus (DENV) serotypes in serum samples obtained in Matamoros Tamaulipas, Mexico, and to determine the concordance of conventional nested reverse transcriptase polymerase chain reaction (RT-PCR) and a serological test [enzyme-linked immunosorbent assay (ELISA NS1)]. Here, we detected mixed infections consisting of four serotypes of DENV. The most prevalent serotype was DENV-1, followed by DENV-4. This is the first report of DENV-4 in our region. Mixed infections were also detected in 21.5% of samples, and the predominant coinfection consisted of DENV-1 and DENV-2. Therefore, continuous epidemiological surveillance of DENV in this area is required to predict future forms of dengue heterologous infections and the effect of this on health care.

Prolonged excretion of a low-pathogenicity H5N2 avian influenza virus strain in the Pekin duck

PubMed Central

Carranza-Flores, José Manuel; Padilla-Noriega, Luis; Loza-Rubio, Elizabeth

2013-01-01

H5N2 strains of low-pathogenicity avian influenza virus (LPAIV) have been circulating for at least 17 years in some Mexican chicken farms. We measured the rate and duration of viral excretion from Pekin ducks that were experimentally inoculated with an H5N2 LPAIV that causes death in embryonated chicken eggs (A/chicken/Mexico/2007). Leghorn chickens were used as susceptible host controls. The degree of viral excretion was evaluated with real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) using samples from oropharyngeal and cloacal swabs. We observed prolonged excretion from both species of birds lasting for at least 21 days. Prolonged excretion of LPAIV A/chicken/Mexico/2007 is atypical. PMID:23820212

Investigation of the presence of human or bovine respiratory syncytial virus in the lungs of mink (Neovison vison) with hemorrhagic pneumonia due to Pseudomonas aeruginosa.

PubMed

Salomonsen, Charlotte M; Breum, Solvej Ø; Larsen, Lars E; Jakobsen, Jeanette; Høiby, Niels; Hammer, Anne S

2012-11-26

Hemorrhagic pneumonia is a disease of farmed mink (Neovison vison) caused by Pseudomonas aeruginosa. The disease is highly seasonal in Danish mink with outbreaks occurring almost exclusively in the autumn. Human respiratory syncytial virus (RSV) has been shown to augment infection with P. aeruginosa in mice and to promote adhesion of P. aeruginosa to human respiratory cells. We tested 50 lung specimens from mink with hemorrhagic pneumonia for bovine RSV by reverse transcriptase polymerase chain reaction (PCR) and for human RSV by a commercial real-time PCR. RSV was not found. This study indicates that human and bovine RSV is not a major co-factor for development of hemorrhagic pneumonia in Danish mink.

Modelling Hepatitis B Virus Antiviral Therapy and Drug Resistant Mutant Strains

NASA Astrophysics Data System (ADS)

Bernal, Julie; Dix, Trevor; Allison, Lloyd; Bartholomeusz, Angeline; Yuen, Lilly

Despite the existence of vaccines, the Hepatitis B virus (HBV) is still a serious global health concern. HBV targets liver cells. It has an unusual replication process involving an RNA pre-genome that the reverse transcriptase domain of the viral polymerase protein translates into viral DNA. The reverse transcription process is error prone and together with the high replication rates of the virus, allows the virus to exist as a heterogeneous population of mutants, known as a quasispecies, that can adapt and become resistant to antiviral therapy. This study presents an individual-based model of HBV inside an artificial liver, and associated blood serum, undergoing antiviral therapy. This model aims to provide insights into the evolution of the HBV quasispecies and the individual contribution of HBV mutations in the outcome of therapy.

Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

PubMed

Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

2016-07-02

Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

Detection of Anti-Hepatitis B Virus Drug Resistance Mutations Based on Multicolor Melting Curve Analysis.

PubMed

Mou, Yi; Athar, Muhammad Ammar; Wu, Yuzhen; Xu, Ye; Wu, Jianhua; Xu, Zhenxing; Hayder, Zulfiqar; Khan, Saeed; Idrees, Muhammad; Nasir, Muhammad Israr; Liao, Yiqun; Li, Qingge

2016-11-01

Detection of anti-hepatitis B virus (HBV) drug resistance mutations is critical for therapeutic decisions for chronic hepatitis B virus infection. We describe a real-time PCR-based assay using multicolor melting curve analysis (MMCA) that could accurately detect 24 HBV nucleotide mutations at 10 amino acid positions in the reverse transcriptase region of the HBV polymerase gene. The two-reaction assay had a limit of detection of 5 copies per reaction and could detect a minor mutant population (5% of the total population) with the reverse transcriptase M204V amino acid mutation in the presence of the major wild-type population when the overall concentration was 10 4 copies/μl. The assay could be finished within 3 h, and the cost of materials for each sample was less than $10. Clinical validation studies using three groups of samples from both nucleos(t)ide analog-treated and -untreated patients showed that the results for 99.3% (840/846) of the samples and 99.9% (8,454/8,460) of the amino acids were concordant with those of Sanger sequencing of the PCR amplicon from the HBV reverse transcriptase region (PCR Sanger sequencing). HBV DNA in six samples with mixed infections consisting of minor mutant subpopulations was undetected by the PCR Sanger sequencing method but was detected by MMCA, and the results were confirmed by coamplification at a lower denaturation temperature-PCR Sanger sequencing. Among the treated patients, 48.6% (103/212) harbored viruses that displayed lamivudine monoresistance, adefovir monoresistance, entecavir resistance, or lamivudine and adefovir resistance. Among the untreated patients, the Chinese group had more mutation-containing samples than did the Pakistani group (3.3% versus 0.56%). Because of its accuracy, rapidness, wide-range coverage, and cost-effectiveness, the real-time PCR assay could be a robust tool for the detection if anti-HBV drug resistance mutations in resource-limited countries. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Novel Method for Simultaneous Quantification of Phenotypic Resistance to Maturation, Protease, Reverse Transcriptase, and Integrase HIV Inhibitors Based on 3′Gag(p2/p7/p1/p6)/PR/RT/INT-Recombinant Viruses: a Useful Tool in the Multitarget Era of Antiretroviral Therapy▿†

PubMed Central

Weber, Jan; Vazquez, Ana C.; Winner, Dane; Rose, Justine D.; Wylie, Doug; Rhea, Ariel M.; Henry, Kenneth; Pappas, Jennifer; Wright, Alison; Mohamed, Nizar; Gibson, Richard; Rodriguez, Benigno; Soriano, Vicente; King, Kevin; Arts, Eric J.; Olivo, Paul D.; Quiñones-Mateu, Miguel E.

2011-01-01

Twenty-six antiretroviral drugs (ARVs), targeting five different steps in the life cycle of the human immunodeficiency virus type 1 (HIV-1), have been approved for the treatment of HIV-1 infection. Accordingly, HIV-1 phenotypic assays based on common cloning technology currently employ three, or possibly four, different recombinant viruses. Here, we describe a system to assess HIV-1 resistance to all drugs targeting the three viral enzymes as well as viral assembly using a single patient-derived, chimeric virus. Patient-derived p2-INT (gag-p2/NCp7/p1/p6/pol-PR/RT/IN) products were PCR amplified as a single fragment (3,428 bp) or two overlapping fragments (1,657 bp and 2,002 bp) and then recombined into a vector containing a near-full-length HIV-1 genome with the Saccharomyces cerevisiae uracil biosynthesis gene (URA3) replacing the 3,428 bp p2-INT segment (Dudley et al., Biotechniques 46:458–467, 2009). P2-INT-recombinant viruses were employed in drug susceptibility assays to test the activity of protease (PI), nucleoside/nucleotide reverse transcriptase (NRTI), nonnucleoside reverse transcriptase (NNRTI), and integrase strand-transfer (INSTI) inhibitors. Using a single standardized test (ViralARTS HIV), this new technology permits the rapid and automated quantification of phenotypic resistance for all known and candidate antiretroviral drugs targeting all viral enzymes (PR, RT, including polymerase and RNase H activities, and IN), some of the current and potential assembly inhibitors, and any drug targeting Pol or Gag precursor cleavage sites (relevant for PI and maturation inhibitors) This novel assay may be instrumental (i) in the development and clinical assessment of novel ARV drugs and (ii) to monitor patients failing prior complex treatment regimens. PMID:21628544

FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

EPA Science Inventory

Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

miR-20a inhibition using locked nucleic acid (LNA) technology and its effects on apoptosis of human macrophages infected by Toxoplasma gondii RH strain.

PubMed

Rezaei, Fatemeh; Daryani, Ahmad; Sharifi, Mohammadreza; Sarvi, Shahabeddin; Jafari, Narjes; Pagheh, Abdol Sattar; Hashemi, Nooshin; Hejazi, Seyed Hossein

2018-05-22

Toxoplasma gondii is a ubiquitous and infectious parasite that multiplies in any nucleated cell of warm-blooded animals and humans worldwide. This parasite has intricate mechanisms to reciprocate host-cell apoptosis to exist in the host cell. So far, the details of the parasite interactions with host cells are not well known. MicroRNAs (miRNAs) are one of the small noncoding RNAs that are now considered as a key mechanism of gene regulation. They are important in physiological and pathological processes such as apoptosis. In this study a Real Time quantitative PCR technique was used to evaluate the levels of miR-20a of miRNAs family in human macrophage during T. gondii infection to determine the role of miR-20a in apoptosis. Then, the inhibition of miR-20a function through interaction with transfection of Locked Nucleic Acid (LNA) antisense oligomer was studied. Furthermore, it was examined whether miR-20a is involved in apoptosis of human macrophages with T. gondii infected cells using flow cytometry. We found that miR-20a expression is up-regulated in human macrophages following T. gondii infection. After LNA anti miR-20a oligomer transfection, miR-20a inhibition was evaluated by quantitative reverse transcriptase polymerase chain reaction. Flow cytometry results showed that LNA anti-miR20a oligomer increased apoptosis. In agreement with this result, we found that specific LNA oligonucleotides prevent the functional activity of miR-20a and promotion of human macrophages apoptosis with T. gondii infection by inhibition of this miRNAs gene. Also, the results support the concept that LNA oligomer antisense may be used as a therapeutic implement for blocking detrimental miRNAs overexpressed in infections. Copyright © 2018 Elsevier Ltd. All rights reserved.

Gene expression analysis in lymphoblasts derived from patients with autism spectrum disorder

PubMed Central

2011-01-01

Background The autism spectrum disorders (ASDs) are complex neurodevelopmental disorders that result in severe and pervasive impairment in the development of reciprocal social interaction and verbal and nonverbal communication skills. In addition, individuals with ASD have stereotypical behavior, interests and activities. Rare mutations of some genes, such as neuroligin (NLGN) 3/4, neurexin (NRXN) 1, SHANK3, MeCP2 and NHE9, have been reported to be associated with ASD. In the present study, we investigated whether alterations in mRNA expression levels of these genes could be found in lymphoblastoid cell lines derived from patients with ASD. Methods We measured mRNA expression levels of NLGN3/4, NRXN1, SHANK3, MeCP2, NHE9 and AKT1 in lymphoblastoid cells from 35 patients with ASD and 35 healthy controls, as well as from 45 patients with schizophrenia and 45 healthy controls, using real-time quantitative reverse transcriptase polymerase chain reaction assays. Results The mRNA expression levels of NLGN3 and SHANK3 normalized by β-actin or TBP were significantly decreased in the individuals with ASD compared to controls, whereas no difference was found in the mRNA expression level of MeCP2, NHE9 or AKT1. However, normalized NLGN3 and SHANK3 gene expression levels were not altered in patients with schizophrenia, and expression levels of NLGN4 and NRXN1 mRNA were not quantitatively measurable in lymphoblastoid cells. Conclusions Our results provide evidence that the NLGN3 and SHANK3 genes may be differentially expressed in lymphoblastoid cell lines from individuals with ASD compared to those from controls. These findings suggest the possibility that decreased mRNA expression levels of these genes might be involved in the pathophysiology of ASD in a substantial population of ASD patients. PMID:21615902

Biologic Determinants of Tumor Recurrence in Stage II Colon Cancer: Validation Study of the 12-Gene Recurrence Score in Cancer and Leukemia Group B (CALGB) 9581

PubMed Central

Venook, Alan P.; Niedzwiecki, Donna; Lopatin, Margarita; Ye, Xing; Lee, Mark; Friedman, Paula N.; Frankel, Wendy; Clark-Langone, Kim; Millward, Carl; Shak, Steven; Goldberg, Richard M.; Mahmoud, Najjia N.; Warren, Robert S.; Schilsky, Richard L.; Bertagnolli, Monica M.

2013-01-01

Purpose A greater understanding of the biology of tumor recurrence should improve adjuvant treatment decision making. We conducted a validation study of the 12-gene recurrence score (RS), a quantitative assay integrating stromal response and cell cycle gene expression, in tumor specimens from patients enrolled onto Cancer and Leukemia Group B (CALGB) 9581. Patients and Methods CALGB 9581 randomly assigned 1,713 patients with stage II colon cancer to treatment with edrecolomab or observation and found no survival difference. The analysis reported here included all patients with available tissue and recurrence (n = 162) and a random (approximately 1:3) selection of nonrecurring patients. RS was assessed in 690 formalin-fixed paraffin-embedded tumor samples with quantitative reverse transcriptase polymerase chain reaction by using prespecified genes and a previously validated algorithm. Association of RS and recurrence was analyzed by weighted Cox proportional hazards regression. Results Continuous RS was significantly associated with risk of recurrence (P = .013) as was mismatch repair (MMR) gene deficiency (P = .044). In multivariate analyses, RS was the strongest predictor of recurrence (P = .004), independent of T stage, MMR, number of nodes examined, grade, and lymphovascular invasion. In T3 MMR-intact (MMR-I) patients, prespecified low and high RS groups had average 5-year recurrence risks of 13% (95% CI, 10% to 16%) and 21% (95% CI, 16% to 26%), respectively. Conclusion The 12-gene RS predicts recurrence in stage II colon cancer in CALGB 9581. This is consistent with the importance of stromal response and cell cycle gene expression in colon tumor recurrence. RS appears to be most discerning for patients with T3 MMR-I tumors, although markers such as grade and lymphovascular invasion did not add value in this subset of patients. PMID:23530100

Rapamycin attenuates bleomycin-induced pulmonary fibrosis in rats and the expression of metalloproteinase-9 and tissue inhibitors of metalloproteinase-1 in lung tissue.

PubMed

Jin, Xiaoguang; Dai, Huaping; Ding, Ke; Xu, Xuefeng; Pang, Baosen; Wang, Chen

2014-01-01

Idiopathic pulmonary fibrosis (IPF) is the most common and devastating form of interstitial lung disease (ILD) in the clinic. There is no effective therapy except for lung transplantation. Rapamycin is an immunosuppressive drug with potent antifibrotic activity. The purpose of this study was to examine the effects of rapamycin on bleomycin-induced pulmonary fibrosis in rats and the relation to the expression of metalloproteinase-9 (MMP-9) and tissue inhibitor of metalloproteinase-1 (TIMP-1). Sprague-Dawley rats were treated with intratracheal injection of 0.3 ml of bleomycin (5 mg/kg) in sterile 0.9% saline to make the pulmonary fibrosis model. Rapamycin was given at a dose of 0.5 mg/kg per gavage, beginning one day before bleomycin instillation and once daily until animal sacrifice. Ten rats in each group were sacrificed at 3, 7, 14, 28 and 56 days after bleomycin administration. Alveolitis and pulmonary fibrosis were semi-quantitatively assessed after HE staining and Masson staining under an Olympus BX40 microscope with an IDA-2000 Image Analysis System. Type I and III collagen fibers were identified by Picro-sirius-polarization. Hydroxyproline content in lung tissue was quantified by a colorimetric-based spectrophotometric assay, MMP-9 and TIMP-1 were detected by immunohistochemistry and by realtime quantitative reverse transcriptase polymerase chain reaction (RT-PCR). Bleomycin induced alveolitis and pulmonary fibrosis of rats was inhibited by rapamycin. Significant inhibition of alveolitis and hydroxyproline product were demonstrated when daily administration of rapamycin lasted for at least 14 days. The inhibitory efficacy on pulmonary fibrosis was unremarkable until rapamycin treatment lasted for at least 28 days (P < 0.05). It was also demonstrated that rapamycin treatment reduced the expression of MMP-9 and TIMP-1 in lung tissue that was increased by bleomycin. These results highlight the significance of rapamycin in alleviating alveolitis and pulmonary fibrosis, which is associated with decreased expression of MMP-9 and TIMP-1.

Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

EPA Science Inventory

Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

USDA-ARS?s Scientific Manuscript database

A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

PubMed

Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

2018-01-01

One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

Delivery of Na/I symporter gene into skeletal muscle using nanobubbles and ultrasound: visualization of gene expression by PET.

PubMed

Watanabe, Yukiko; Horie, Sachiko; Funaki, Yoshihito; Kikuchi, Youhei; Yamazaki, Hiromichi; Ishii, Keizo; Mori, Shiro; Vassaux, Georges; Kodama, Tetsuya

2010-06-01

The development of nonviral gene delivery systems is essential in gene therapy, and the use of a minimally invasive imaging methodology can provide important clinical endpoints. In the current study, we present a new methodology for gene therapy-a delivery system using nanobubbles and ultrasound as a nonviral gene delivery method. We assessed whether the gene transfer allowed by this methodology was detectable by PET and bioluminescence imaging. Two kinds of reported vectors (luciferase and human Na/I symporter [hNIS]) were transfected or cotransfected into the skeletal muscles of normal mice (BALB/c) using the ultrasound-nanobubbles method. The kinetics of luciferase gene expression were analyzed in vivo using bioluminescence imaging. At the peak of gene transfer, PET of hNIS expression was performed using our recently developed PET scanner, after (124)I injection. The imaging data were confirmed using reverse-transcriptase polymerase chain reaction amplification, biodistribution, and a blocking study. The imaging potential of the 2 methodologies was evaluated in 2 mouse models of human pathology (McH/lpr-RA1 mice showing vascular disease and C57BL/10-mdx Jic mice showing muscular dystrophy). Peak luciferase gene activity was observed in the skeletal muscle 4 d after transfection. On day 2 after hNIS and luciferase cotransfection, the expression of these genes was confirmed by reverse-transcriptase polymerase chain reaction on a muscle biopsy. PET of the hNIS gene, biodistribution, the blocking study, and autoradiography were performed on day 4 after transfection, and it was indicated that hNIS expression was restricted to the site of plasmid administration (skeletal muscle). Similar localized PET and (124)I accumulation were successfully obtained in the disease-model mice. The hNIS gene was delivered into the skeletal muscle of healthy and disease-model mice by the ultrasound-nanobubbles method, and gene expression was successfully visualized with PET. The combination of ultrasound-nanobubble gene transfer and PET may be applied to gene therapy clinical protocols.

miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

PubMed

Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

2015-05-01

Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

PubMed

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we strongly suggest that the final interpretation of the results from this assay be viewed in light of the other features of the case, including clinical history, histology, and immunohistochemistry, by the diagnostic pathologist. Additional studies such as FISH may be useful in clarifying the nature of equivocal or unexpected results.

EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

EPA Science Inventory

Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

EPA Science Inventory

Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

Polymerase chain displacement reaction.

PubMed

Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

2013-02-01

Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

Pre-Steady-State Kinetic Analysis of Single-Nucleotide Incorporation by DNA Polymerases

PubMed Central

Su, Yan; Guengerich, F. Peter

2016-01-01

Pre-steady-state kinetic analysis is a powerful and widely used method to obtain multiple kinetic parameters. This protocol provides a step-by-step procedure for pre-steady-state kinetic analysis of single-nucleotide incorporation by a DNA polymerase. It describes the experimental details of DNA substrate annealing, reaction mixture preparation, handling of the RQF-3 rapid quench-flow instrument, denaturing polyacrylamide DNA gel preparation, electrophoresis, quantitation, and data analysis. The core and unique part of this protocol is the rationale for preparation of the reaction mixture (the ratio of the polymerase to the DNA substrate) and methods for conducting pre-steady-state assays on an RQF-3 rapid quench-flow instrument, as well as data interpretation after analysis. In addition, the methods for the DNA substrate annealing and DNA polyacrylamide gel preparation, electrophoresis, quantitation and analysis are suitable for use in other studies. PMID:27248785

Mechanical tensile stress effects on the expression of bone sialoprotein in bovine cementoblasts.

PubMed

Yu, Hongyou; Ren, Yijin; Sandham, Andrew; Ren, Aishu; Huang, Lan; Bai, Ding

2009-03-01

To develop a new cementoblast culture method and to detect bone sialoprotein (BSP) expression in response to high and low mechanical tensile stress in cementoblast in vitro. Cementoblasts were collected from the roots of newborn bovine teeth and were identified with cementum-derived attachment protein (CAP) antibody 3G9. Cell proliferation was evaluated by MTT [3-(4,5-dimethylthazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay, and mineralization was confirmed by von Kossa staining. Mechanical tensile stress was applied in vitro to the cementoblast with the use of a uniaxial four-point bending system with 2000 or 4000 microstrains, at a frequency of 0.5 Hz for 3, 6, 12, 24, or 36 hours. BSP mRNA level was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). A large amount of cementoblast was observed to be expressing CAP. Cementoblasts had a proliferation tendency similar to that of osteoblasts but different from that of periodontal ligament (PDL) cells. Cementoblasts had the ability to become mineralized between osteoblasts and PDL cells. The mechanical tensile stress significantly up-regulated BSP mRNA expression, which reached a peak at 24 hours in both 2000 and 4000 microstrain groups (P < .01) and was tenfold and sixfold higher than that of controls, respectively. BSP expression dropped toward baseline levels at 36 hours in both groups. Mechanical tensile stress up-regulated the expression of BSP. Low mechanical tensile stress induced earlier and more intensive up-regulation of BSP mRNA; this might represent the optimal stimuli for cementoblast activity.

Human Platelet Lysate as a Replacement for Fetal Bovine Serum in Limbal Stem Cell Therapy.

PubMed

Suri, Kunal; Gong, Hwee K; Yuan, Ching; Kaufman, Stephen C

2016-10-01

To evaluate the use of human platelet lysate (HPL) as an alternative supplement for limbal explant culture. Culture media were prepared using either 10% pooled HPL (PHPL), single donor HPL, or fetal bovine serum (FBS). Limbal tissues, obtained from the Minnesota Lions Eye Bank, were cultured in each medium on plastic plates or on denuded amniotic membrane (AM). Immunofluorescence staining was performed for ABCG2, tumor protein p63α, and cytokeratin 3 (K3). Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was used to evaluate the expression of ABCG2 and p63. Limbal explants grown in each medium were labeled with bromodeoxyuridine (BrdU) to assess the proliferative capacity in each medium. Concentration of growth factors including epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), transforming growth factor-β (TGF-β), and platelet derived growth factor (PDGF) in HPL and PHPL was compared to that in human serum (HS). Immunofluorescence staining on AM showed prominent expression of ABCG2, p63α but sparse expression of K3 in HPL and PHPL supplemented medium. Real time-PCR showed 1.7 fold higher expression of ABCG2 in PHPL supplemented medium (p = 0.03), and similar expression of p63 in HPL and PHPL supplemented medium compared to FBS medium. The proliferation assay showed that LSCs retained their proliferative potential in HPL supplemented medium. Higher concentration of growth factors were found in HPL, compared to HS. Human platelet lysate has higher concentration of grown factors and is effective in maintaining growth and stem cell phenotype of corneal limbal explant cultures.

CsSCL1 is differentially regulated upon maturation in chestnut microshoots and is specifically expressed in rooting-competent cells.

PubMed

Vielba, Jesús M; Díaz-Sala, Carmen; Ferro, Enrique; Rico, Saleta; Lamprecht, María; Abarca, Dolores; Ballester, Antonio; Sánchez, Conchi

2011-10-01

The Castanea sativa SCL1 gene (CsSCL1) has previously been shown to be induced by auxin during adventitious root (AR) formation in rooting-competent microshoots. However, its expression has not previously been analyzed in rooting-incompetent shoots. This study focuses on the regulation of CsSCL1 during maturation and the role of the gene in the formation of AR. The expression of CsSCL1 in rooting-incompetent microshoots and other tissues was investigated by quantitative reverse transcriptase--polymerase chain reaction. The analysis was complemented by in situ hybridization of the basal segments of rooting-competent and --incompetent microshoots during AR induction, as well as in AR and lateral roots. It was found that CsSCL1 is upregulated by auxin in a cell-type- and phase-dependent manner during the induction of AR. In root-forming shoots, CsSCL1 mRNA was specifically located in the cambial zone and derivative cells, which are rooting-competent cells, whereas in rooting-incompetent shoots the hybridization signal was more diffuse and evenly distributed through the phloem and parenchyma. CsSCL1 expression was also detected in lateral roots and axillary buds. The different CsSCL1 expression patterns in rooting-competent and -incompetent microshoots, together with the specific location of transcripts in cell types involved in root meristem initiation and in the root primordia of AR and lateral roots, indicate an important role for the gene in determining whether certain cells will enter the root differentiation pathway and its involvement in meristem maintenance.

Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

PubMed

Veldman, Matthew B; Lin, Shuo

2012-01-20

Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication

PubMed Central

Castrillón-Betancur, Juan Camilo; Urcuqui-Inchima, Silvio

2017-01-01

BACKGROUND Dengue is considered one of the world’s most important mosquito-borne diseases. MicroRNAs (miRNAs) are small non-coding single-stranded RNAs that play an important role in the regulation of gene expression in eukaryotes. Although miRNAs possess antiviral activity against many mammalian-infecting viruses, their involvement in Dengue virus (DENV) replication remains poorly understood. OBJECTIVE To determine the role of miR-484 and miR-744 in DENV infection and to examine whether DENV infection alters the expression of both miRNAs. METHODS We used bioinformatics tools to explore the relationship between DENV and cellular miRNAs. We then overexpressed miR-484 or miR-744 in Vero cells to examine their role in DENV replication using flow cytometry, reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), and western blotting. FINDINGS We found several cellular miRNAs that target a conserved region within the 3′ untranslated region (3′ UTR) of the genome of the four DENV serotypes and found that overexpression of miR-484 or miR-744 inhibits infection by DENV-1 to DENV-4. Furthermore, we observed that DENV RNA might be involved in the downregulation of endogenous miR-484 and miR-744. CONCLUSION Our study identifies miR-484 and miR-744 as two possible restriction host factors against DENV infection. However, further studies are needed to directly verify whether miR-484 and miR-744 both have an anti-DENV effect in vivo. PMID:28327787

Use of functional gene expression and respirometry to study wastewater nitrification activity after exposure to low doses of copper.

PubMed

Kapoor, Vikram; Li, Xuan; Chandran, Kartik; Impellitteri, Christopher A; Santo Domingo, Jorge W

2016-04-01

Autotrophic nitrification in biological nitrogen removal systems has been shown to be sensitive to the presence of heavy metals in wastewater treatment plants. Using transcriptase-quantitative polymerase chain reaction (RT-qPCR) data, we examined the effect of copper on the relative expression of functional genes (i.e., amoA, hao, nirK, and norB) involved in redox nitrogen transformation in batch enrichment cultures obtained from a nitrifying bioreactor operated as a continuous reactor (24-h hydraulic retention time). 16S ribosomal RNA (rRNA) gene next-generation sequencing showed that Nitrosomonas-like populations represented 60-70% of the bacterial community, while other nitrifiers represented <5%. We observed a strong correspondence between the relative expression of amoA and hao and ammonia removal in the bioreactor. There were no considerable changes in the transcript levels of amoA, hao, nirK, and norB for nitrifying samples exposed to copper dosages ranging from 0.01 to 10 mg/L for a period of 12 h. Similar results were obtained when ammonia oxidation activity was measured via specific oxygen uptake rate (sOUR). The lack of nitrification inhibition by copper at doses lower than 10 mg/L may be attributed to the role of copper as cofactor for ammonia monooxygenase or to the sub-inhibitory concentrations of copper used in this study. Overall, these results demonstrate the use of molecular methods combined with conventional respirometry assays to better understand the response of wastewater nitrifying systems to the presence of copper.

Compensatory molecular and functional mechanisms in nervous system of the Grm1(crv4) mouse lacking the mGlu1 receptor: a model for motor coordination deficits.

PubMed

Rossi, Pia Irene Anna; Musante, Ilaria; Summa, Maria; Pittaluga, Anna; Emionite, Laura; Ikehata, Masami; Rastaldi, Maria Pia; Ravazzolo, Roberto; Puliti, Aldamaria

2013-09-01

The metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, the only members of group I mGlu receptors, are implicated in synaptic plasticity and mechanisms of feedback control of glutamate release. They exhibit nearly complementary distributions throughout the central nervous system, well evident in the cerebellum, where mGlu1 receptor is most intensely expressed while mGlu5 receptor is not. Despite their different distribution, they show a similar subcellular localization and use common transducing pathways. We recently described the Grm1(crv4) mouse with motor coordination deficits and renal anomalies caused by a spontaneous mutation inactivating the mGlu1 receptor. To define the neuropathological mechanisms in these mice, we evaluated expression and function of the mGlu5 receptor in cerebral and cerebellar cortices. Western blot and immunofluorescence analyses showed mGlu5 receptor overexpression. Quantitative reverse transcriptase-polymerase chain reaction results indicated that the up-regulation is already evident at RNA level. Functional studies confirmed an enhanced glutamate release from cortical cerebral and cerebellar synaptosomes when compared with wild-type that is abolished by the mGlu5 receptor-specific inhibitor, 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP). Finally, acute MPEP treatment of Grm1(crv4/crv4) mice induced an evident although incomplete improvement of motor coordination, suggesting that mGlu5 receptors enhanced activity worsens, instead of improving, the motor-coordination defects in the Grm1(crv4/crv4) mice.

Inhibition of P-glycoprotein and glutathione S-transferase-pi mediated resistance by fluoxetine in MCF-7/ADM cells.

PubMed

Zhang, Ye; Zhou, Ting; Duan, Jingjing; Xiao, Zhijun; Li, Guihua; Xu, Feng

2013-10-01

Chemotherapy is important in the systematic treatment of breast cancer. While multidrug resistance (MDR) is the main obstacle in chemotherapy, a reversal reagent with high reversal effect but low toxicity is the hotspot issue at present to overcome MDR. Antidepressant fluoxetine (FLX) is a potential new highly effective chemosensitizer, however, the possible mechanism is unclear. In this study, the effect of FLX on multidrug resistance mediated by P-glycoprotein (P-gp) and glutathione S-transferase-pi (GST-π) were researched in resistant/sensitive breast cancer cells. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was used to determine the cells viability after being incubated with FLX/Adriamycin (ADM)/Paclitaxel (PTX) alone or FLX-ADM, FLX-PTX combination. Western blot was performed to assay the expression of P-gp and GST-π proteins. Reverse transcriptase polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qRT-PCR) were performed to assay the level of MDR1 mRNA. The results showed that pre-treatment with FLX enhance cytotoxicity significantly both on resistant and sensitive cells, downregulated the expression of P-gp and GST-π proteins in resistance cells, decreased the MDR1 mRNA by FLX-PTX combination only. No P-gp and GST-π were detected in sensitive cells. Our research thus indicated that FLX reverse the breast cancer cell's resistance and enhance the chemosensitivity by regulating P-gp and GST-π levels. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Regulatory and activated effector T cells in chronic hepatitis C virus: Relation to autoimmunity

PubMed Central

Fouad, Hanan; El Raziky, Maissa; Hassan, Eman Medhat; Aziz, Ghada Mahmoud Abdel; Darweesh, Samar K; Sayed, Ahmed Reda

2016-01-01

AIM To investigate how Tregs are regulated in chronic hepatitis C virus (HCV) patients via assessment of Tregs markers (granzyme 2, CD69 and FoxP3), Teffs markers [TNFRSF4 (OX40), INFG] and CD4, CD25 genes. METHODS A prospective study was conducted on 120 subjects divided into 4 groups: Group I (n = 30) treatment naïve chronic HCV patients; Group II (n = 30) chronic HCV treated with Peg/Riba; Group III (n = 30) chronic HCV associated with non-organ specific autoantibody and Group IV (n = 30) healthy persons as a control group. Tregs and Teffs markers were assessed in peripheral blood mononuclear cells by quantitative real time reverse transcriptase-polymerase chain reaction. RESULTS Chronic HCV patients exhibited significant higher levels of both Teffs and Tregs in comparison to healthy control group. Tregs markers were significantly decreased in Peg/Riba treated HCV patients in comparison to treatment naïve HCV group. In HCV patients with antinuclear antibody (ANA) +ve, Tregs markers were significantly decreased in comparison to all other studied groups. Teffs markers were significantly elevated in all HCV groups in comparison to control and in HCV group with ANA +ve in comparison to treatment naïve HCV group. CONCLUSION Elevated Tregs cells in chronic HCV patients dampen both CD4+ and CD8+ autologous T cell immune response. Interferon-α and ribavirin therapy suppress proliferation of Tregs. More significant suppression of Tregs was observed in HCV patients with autoantibodies favoring pathological autoimmune response. PMID:27843539

Quantifying whole transcriptome size, a prerequisite for understanding transcriptome evolution across species: an example from a plant allopolyploid.

PubMed

Coate, Jeremy E; Doyle, Jeff J

2010-01-01

Evolutionary biologists are increasingly comparing gene expression patterns across species. Due to the way in which expression assays are normalized, such studies provide no direct information about expression per gene copy (dosage responses) or per cell and can give a misleading picture of genes that are differentially expressed. We describe an assay for estimating relative expression per cell. When used in conjunction with transcript profiling data, it is possible to compare the sizes of whole transcriptomes, which in turn makes it possible to compare expression per cell for each gene in the transcript profiling data set. We applied this approach, using quantitative reverse transcriptase-polymerase chain reaction and high throughput RNA sequencing, to a recently formed allopolyploid and showed that its leaf transcriptome was approximately 1.4-fold larger than either progenitor transcriptome (70% of the sum of the progenitor transcriptomes). In contrast, the allopolyploid genome is 94.3% as large as the sum of its progenitor genomes and retains > or =93.5% of the sum of its progenitor gene complements. Thus, "transcriptome downsizing" is greater than genome downsizing. Using this transcriptome size estimate, we inferred dosage responses for several thousand genes and showed that the majority exhibit partial dosage compensation. Homoeologue silencing is nonrandomly distributed across dosage responses, with genes showing extreme responses in either direction significantly more likely to have a silent homoeologue. This experimental approach will add value to transcript profiling experiments involving interspecies and interploidy comparisons by converting expression per transcriptome to expression per genome, eliminating the need for assumptions about transcriptome size.

High expression of AFAP1-AS1 is associated with poor survival and short-term recurrence in pancreatic ductal adenocarcinoma.

PubMed

Ye, Yibiao; Chen, Jie; Zhou, Yu; Fu, Zhiqiang; Zhou, Quanbo; Wang, YingXue; Gao, Wenchao; Zheng, ShangYou; Zhao, Xiaohui; Chen, Tao; Chen, Rufu

2015-04-30

Pancreatic ductal adenocarcinoma (PDAC) is still a lethal malignancy. Long noncoding RNAs (lncRNAs) have been shown to play a critical role in cancer development and progression. Here we identified overexpression of the lncRNA AFAP1-AS1 in PDAC patients and evaluated its prognostic and functional relevance. The global lncRNA expression profile in PDAC was measured by lncRNA microarray. Expression of AFAP1-AS1 was evaluated by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR) in 90 PDAC tissue samples and adjacent normal tissues. The impact of AFAP1-AS1 expression on cell proliferation, migration, and invasion were evaluated in vitro using knockdown and ectopic expression strategies. Microarray analysis revealed that up-regulation of AFAP1-AS1 expression in PDAC tissues compared with normal adjacent tissues, which was confirmed by RT-qPCR in 69/90 cases (76.7%). Its overexpression was associated with lymph node metastasis, perineural invasion, and poor survival. When using AFAP1-AS1 as a prognostic marker, the areas under ROC curves were 0.8669 and 0.9370 for predicting tumor progression within 6 months and 1 year, respectively. In vitro functional experiments involving knockdown of AFAP1-AS1 resulted in attenuated PDAC cell proliferation, migration, and invasion. Ectopic expression of AFAP1-AS1 promoted cell proliferation, migration, and invasion. AFAP1-AS1 is a potential novel prognostic marker to predict the clinical outcome of PDAC patients after surgery and may be a rational target for therapy.

Vcsa1 Acts as a Marker of Erectile Function Recovery After Gene Therapeutic and Pharmacological Interventions

PubMed Central

Calenda, Giulia; Tong, Yuehong; Tar, Moses; Lowe, Daniel; Siragusa, Joseph; Melman, Arnold; Davies, Kelvin P.

2010-01-01

Purpose We identified molecular markers of erectile function, particularly those responding to erectile dysfunction treatment. Materials and Methods Sprague-Dawley retired breeder rats were intracorporeally injected with pVAX-hSlo, pSMAA-hSlo or the control plasmid pVAX. One week later the intracorporeal pressure-to-blood pressure ratio and gene expression were determined by microarray analysis and quantitative reverse transcriptase-polymerase chain reaction. Rat corporeal cells were transfected in vitro with pVAX-hSlo, pSMAA-hSlo or pVAX and the change in gene expression was determined. We also determined whether Vcsa1 expression was changed after pharmacotherapy using tadalafil. Results Animals treated with vectors expressing hSlo had significantly improved erectile function compared to that in controls, accompanied by changed expression of a subset of genes. Vcsa1 was one of the genes that was most changed in expression (the third of approximately 31,000 with greater than 10-fold up-regulation). Changes in gene expression were different than those observed in corporeal cells transfected in vitro, distinguishing gene expression changes that were a direct effect of hSlo over expression. When tadalafil was administered in retired breeder rats, the Vcsa1 transcript increased 4-fold in corporeal tissue compared to that in untreated controls. Conclusions Our study identifies a set of genes that are changed in response to improved erectile function, rather than as a direct effect of treatment. We noted Vcsa1 may act as marker of the restoration of erectile function after gene transfer and pharmacotherapy. PMID:19375734

Vcsa1 acts as a marker of erectile function recovery after gene therapeutic and pharmacological interventions.

PubMed

Calenda, Giulia; Tong, Yuehong; Tar, Moses; Lowe, Daniel; Siragusa, Joseph; Melman, Arnold; Davies, Kelvin P

2009-06-01

We identified molecular markers of erectile function, particularly those responding to erectile dysfunction treatment. Sprague-Dawley retired breeder rats were intracorporeally injected with pVAX-hSlo, pSMAA-hSlo or the control plasmid pVAX. One week later the intracorporeal pressure-to-blood pressure ratio and gene expression were determined by microarray analysis and quantitative reverse transcriptase-polymerase chain reaction. Rat corporeal cells were transfected in vitro with pVAX-hSlo, pSMAA-hSlo or pVAX and the change in gene expression was determined. We also determined whether Vcsa1 expression was changed after pharmacotherapy using tadalafil. Animals treated with vectors expressing hSlo had significantly improved erectile function compared to that in controls, accompanied by changed expression of a subset of genes. Vcsa1 was one of the genes that was most changed in expression (the third of approximately 31,000 with greater than 10-fold up-regulation). Changes in gene expression were different than those observed in corporeal cells transfected in vitro, distinguishing gene expression changes that were a direct effect of hSlo over expression. When tadalafil was administered in retired breeder rats, the Vcsa1 transcript increased 4-fold in corporeal tissue compared to that in untreated controls. Our study identifies a set of genes that are changed in response to improved erectile function, rather than as a direct effect of treatment. We noted Vcsa1 may act as marker of the restoration of erectile function after gene transfer and pharmacotherapy.

Somatostatinergic modulation of firing pattern and calcium-activated potassium currents in medium spiny neostriatal neurons.

PubMed

Galarraga, E; Vilchis, C; Tkatch, T; Salgado, H; Tecuapetla, F; Perez-Rosello, T; Perez-Garci, E; Hernandez-Echeagaray, E; Surmeier, D J; Bargas, J

2007-05-11

Somatostatin is synthesized and released by aspiny GABAergic interneurons of the neostriatum, some of them identified as low threshold spike generating neurons (LTS-interneurons). These neurons make synaptic contacts with spiny neostriatal projection neurons. However, very few somatostatin actions on projection neurons have been described. The present work reports that somatostatin modulates the Ca(2+) activated K(+) currents (K(Ca) currents) expressed by projection cells. These actions contribute in designing the firing pattern of the spiny projection neuron; which is the output of the neostriatum. Small conductance (SK) and large conductance (BK) K(Ca) currents represent between 30% and 50% of the sustained outward current in spiny cells. Somatostatin reduces SK-type K(+) currents and at the same time enhances BK-type K(+) currents. This dual effect enhances the fast component of the after hyperpolarizing potential while reducing the slow component. Somatostatin then modifies the firing pattern of spiny neurons which changed from a tonic regular pattern to an interrupted "stuttering"-like pattern. Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) tissue expression analysis of dorsal striatal somatostatinergic receptors (SSTR) mRNA revealed that all five SSTR mRNAs are present. However, single cell RT-PCR profiling suggests that the most probable receptor in charge of this modulation is the SSTR2 receptor. Interestingly, aspiny interneurons may exhibit a "stuttering"-like firing pattern. Therefore, somatostatin actions appear to be the entrainment of projection neurons to the rhythms generated by some interneurons. Somatostatin is then capable of modifying the processing and output of the neostriatum.

A Comparative Study of Drug Delivery Methods Targeted to the Mouse Inner Ear: Bullostomy Versus Transtympanic Injection

PubMed Central

Cediel, Rafael; Celaya, Adelaida M.; Lassaletta, Luis; Varela-Nieto, Isabel; Contreras, Julio

2017-01-01

We present two minimally invasive microsurgical techniques in rodents for specific drug delivery into the middle ear so that it may reach the inner ear. The first procedure consists of perforation of the tympanic bulla, termed bullostomy; the second one is a transtympanic injection. Both emulate human clinical intratympanic procedures. Chitosan-glycerophosphate (CGP) and Ringer´s Lactate buffer (RL) were used as biocompatible vehicles for local drug delivery. CGP is a nontoxic biodegradable polymer widely used in pharmaceutical applications. It is a viscous liquid at RT but it congeals to a semi solid phase at body temperature. RL is an isotonic solution used for intravenous administrations in humans. A small volume of this vehicle is precisely placed on the Round Window (RW) niche by means of a bullostomy. A transtympanic injection fills the middle ear and allows less control but broader access to the inner ear. The safety profiles of both techniques were studied and compared by using functional and morphological tests. Hearing was evaluated by registering the Auditory Brainstem Response (ABR) before and several times after microsurgery. The cytoarchitecture and preservation level of cochlear structures were studied by conventional histological techniques in paraformaldehyde-fixed and decalcified cochlear samples. In parallel, unfixed cochlear samples were taken and immediately frozen to analyze gene expression profiles of inflammatory markers by quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR). Both procedures are suitable as drug delivery methods into the mouse middle ear, although transtympanic injection proved to be less invasive compared to bullostomy. PMID:28362376

Identification of the heme acquisition system in Vibrio vulnificus M2799.

PubMed

Kawano, Hiroaki; Miyamoto, Katsushiro; Yasunobe, Megumi; Murata, Masahiro; Yamahata, Eri; Yamaguchi, Ryo; Miyaki, Yuta; Tsuchiya, Takahiro; Tanabe, Tomotaka; Funahashi, Tatsuya; Tsujibo, Hiroshi

2018-04-01

Vibrio vulnificus, the causative agent of serious, often fatal, infections in humans, requires iron for its pathogenesis. As such, it obtains iron via both vulnibactin and heme-mediated iron-uptake systems. In this study, we identified the heme acquisition system in V. vulnificus M2799. The nucleotide sequences of the genes encoding heme receptors HupA and HvtA and the ATP-binding cassette (ABC) transport system proteins HupB, HupC, and HupD were determined, and then used in the construction of deletion mutants developed from a Δics strain, which could not synthesize vulnibactin. Growth experiments using these mutants indicated that HupA and HvtA are major and minor heme receptors, respectively. The expressions of two proteins were analyzed by the quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, complementation analyses confirmed that the HupBCD proteins are the only ABC transport system shared by both the HupA and HvtA receptors. This is the first genetic evidence that the HupBCD proteins are essential for heme acquisition by V. vulnificus. Further investigation showed that hupA, hvtA, and hupBCD are regulated by Fur. The qRT-PCR analysis of the heme receptor genes revealed that HupR, a LysR-family positive transcriptional activator, upregulates the expression of hupA, but not hvtA. In addition, ptrB was co-transcribed with hvtA, and PtrB had no influence on growth in low-iron CM9 medium supplemented with hemin, hemoglobin, or cytochrome C. Copyright © 2018 Elsevier Ltd. All rights reserved.

A phytoestrogen-rich diet increases energy expenditure and decreases adiposity in mice.

PubMed

Cederroth, Christopher R; Vinciguerra, Manlio; Kühne, Françoise; Madani, Rime; Doerge, Daniel R; Visser, Theo J; Foti, Michelangelo; Rohner-Jeanrenaud, Françoise; Vassalli, Jean-Dominique; Nef, Serge

2007-10-01

Obesity is an increasingly prevalent health problem, and natural effective therapeutic approaches are required to prevent its occurrence. Phytoestrogens are plant-derived compounds with estrogenic activities; they can bind to both estrogen receptors alpha and beta and mimic the action of estrogens on target organs. The purpose of this study was to examine the influence of soy-derived phytoestrogens on energy balance and metabolism. Male outbred mice (CD-1) were allowed ad libitum access to either a high soy-containing diet or a soy-free diet from conception to adulthood. We measured circulating serum isoflavone levels using reverse-phase solid-phase extraction for subsequent liquid chromatography electrospray tandem mass spectrometry analysis. Adult animals were analyzed for body composition by dual-energy X-ray absorptiometry, locomotor activity by running-wheel experiments, respiratory exchange rate by indirect calorimetry, and food intake using metabolic cages. Quantitative reverse transcriptase-polymerase chain reaction was performed to determine the expression of hypothalamic neuropeptide genes. We found that adult mice fed a soy-rich diet had reduced body weight, adiposity, and resistance to cold. This lean phenotype was associated with an increase in lipid oxidation due to a preferential use of lipids as fuel source and an increase in locomotor activity. The modulation of energy balance was associated with a central effect of phytoestrogens on the expression of hypothalamic neuropeptides, including agouti-related protein. The data suggest that dietary soy could have beneficial effects on obesity, but they also emphasize the importance of monitoring the phytoestrogen content of diets as a parameter of variability in animal experiments.

Microbial water quality before and after the repair of a failing onsite wastewater treatment system adjacent to coastal waters

USGS Publications Warehouse

Conn, K.E.; Habteselassie, M.Y.; Denene, Blackwood A.; Noble, R.T.

2012-01-01

Aims: The objective was to assess the impacts of repairing a failing onsite wastewater treatment system (OWTS, i.e., septic system) as related to coastal microbial water quality. Methods and Results: Wastewater, groundwater and surface water were monitored for environmental parameters, faecal indicator bacteria (total coliforms, Escherichia coli, enterococci) and the viral tracer MS2 before and after repairing a failing OWTS. MS2 results using plaque enumeration and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) often agreed, but inhibition limited the qRT-PCR assay sensitivity. Prerepair, MS2 persisted in groundwater and was detected in the nearby creek; postrepair, it was not detected. In groundwater, total coliform concentrations were lower and E.??coli was not detected, while enterococci concentrations were similar to prerepair levels. E.??coli and enterococci surface water concentrations were elevated both before and after the repair. Conclusions: Repairing the failing OWTS improved groundwater microbial water quality, although persistence of bacteria in surface water suggests that the OWTS was not the singular faecal contributor to adjacent coastal waters. A suite of tracers is needed to fully assess OWTS performance in treating microbial contaminants and related impacts on receiving waters. Molecular methods like qRT-PCR have potential but require optimization. Significance and Impact of Study: This is the first before and after study of a failing OWTS and provides guidance on selection of microbial tracers and methods. ?? 2011 The Authors. Journal of Applied Microbiology ?? 2011 The Society for Applied Microbiology.

The endocannabinoid gene faah2a modulates stress-associated behavior in zebrafish

PubMed Central

Lee, Han B.; El Khoury, Louis Y.; Sigafoos, Ashley N.; Petersen, Morgan O.; Clark, Karl J.

2018-01-01

The ability to orchestrate appropriate physiological and behavioral responses to stress is important for survival, and is often dysfunctional in neuropsychiatric disorders that account for leading causes of global disability burden. Numerous studies have shown that the endocannabinoid neurotransmitter system is able to regulate stress responses and could serve as a therapeutic target for the management of these disorders. We used quantitative reverse transcriptase-polymerase chain reactions to show that genes encoding enzymes that synthesize (abhd4, gde1, napepld), enzymes that degrade (faah, faah2a, faah2b), and receptors that bind (cnr1, cnr2, gpr55-like) endocannabinoids are expressed in zebrafish (Danio rerio). These genes are conserved in many other vertebrates, including humans, but fatty acid amide hydrolase 2 has been lost in mice and rats. We engineered transcription activator-like effector nucleases to create zebrafish with mutations in cnr1 and faah2a to test the role of these genes in modulating stress-associated behavior. We showed that disruption of cnr1 potentiated locomotor responses to hyperosmotic stress. The increased response to stress was consistent with rodent literature and served to validate the use of zebrafish in this field. Moreover, we showed for the first time that disruption of faah2a attenuated the locomotor responses to hyperosmotic stress. This later finding suggests that FAAH2 may be an important mediator of stress responses in non-rodent vertebrates. Accordingly, FAAH and FAAH2 modulators could provide distinct therapeutic options for stress-aggravated disorders. PMID:29304078

Large-scale production of embryonic red blood cells from human embryonic stem cells.

PubMed

Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

2006-12-01

To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

Immunomodulatory Effects of Balneotherapy with Hae-Un-Dae Thermal Water on Imiquimod-Induced Psoriasis-Like Murine Model

PubMed Central

Lee, Young Bok; Lee, Jun Young; Lee, Hye Jin; Yun, Seong Taek; Lee, Jong Tae; Kim, Hong Jig; Yu, Dong Soo

2014-01-01

Background Balneotherapy, although not a well-established dermatological treatment, is thought to have therapeutic properties for psoriasis and is used as an alternative treatment modality throughout the world. Objective To evaluate the mechanism underlying the therapeutic immunologic effects of thermomineral water. Methods A murine model of imiquimod-induced psoriasis-like skin inflammation was used for evaluating the therapeutic effects of balneotherapy with Hae-Un-Dae hot spring mineral water. The clinical improvements were evaluated by a dermatologist. Lesional cytokines, including interleukin (IL)-17A, IL-23, and IL-22, were quantitatively measured by real-time reverse transcriptase polymerase chain reaction. Serum levels of interferon-γ, IL-4, IL-5, and IL-17A were measured by enzyme-linked immunosorbent assay. T cell proportions in the spleen were evaluated by flow cytometry, and histopathological evaluation of the skin was also performed. Results The mineral water balneotherapy group showed faster improvement in skin erythema and scales than the distilled water bathing group. A substantial reduction was observed in the lesional mRNA levels of IL-17A and IL-23 in the mineral water group. Serum levels of IL-4 and IL-5 were significantly decreased in the mineral water group but not in the distilled water group. Normalized T cell proportions were observed after bathing. Conclusion Balneotherapy showed immunomodulatory effects in a psoriasis-like murine model. Balneotherapy suppressed lesional IL-23 and IL-17A, which are important cytokines in the pathogenesis of psoriasis. These results suggest that balneotherapy can be used as an effective and safe treatment for psoriasis. PMID:24882978

Immunomodulatory effects of balneotherapy with hae-un-dae thermal water on imiquimod-induced psoriasis-like murine model.

PubMed

Lee, Young Bok; Lee, Jun Young; Lee, Hye Jin; Yun, Seong Taek; Lee, Jong Tae; Kim, Hong Jig; Yu, Dong Soo; Woo, So Youn; Kim, Jin-Wou

2014-04-01

Balneotherapy, although not a well-established dermatological treatment, is thought to have therapeutic properties for psoriasis and is used as an alternative treatment modality throughout the world. To evaluate the mechanism underlying the therapeutic immunologic effects of thermomineral water. A murine model of imiquimod-induced psoriasis-like skin inflammation was used for evaluating the therapeutic effects of balneotherapy with Hae-Un-Dae hot spring mineral water. The clinical improvements were evaluated by a dermatologist. Lesional cytokines, including interleukin (IL)-17A, IL-23, and IL-22, were quantitatively measured by real-time reverse transcriptase polymerase chain reaction. Serum levels of interferon-γ, IL-4, IL-5, and IL-17A were measured by enzyme-linked immunosorbent assay. T cell proportions in the spleen were evaluated by flow cytometry, and histopathological evaluation of the skin was also performed. The mineral water balneotherapy group showed faster improvement in skin erythema and scales than the distilled water bathing group. A substantial reduction was observed in the lesional mRNA levels of IL-17A and IL-23 in the mineral water group. Serum levels of IL-4 and IL-5 were significantly decreased in the mineral water group but not in the distilled water group. Normalized T cell proportions were observed after bathing. Balneotherapy showed immunomodulatory effects in a psoriasis-like murine model. Balneotherapy suppressed lesional IL-23 and IL-17A, which are important cytokines in the pathogenesis of psoriasis. These results suggest that balneotherapy can be used as an effective and safe treatment for psoriasis.

Gene expression related to oxidative stress in the heart of mice after intestinal ischemia

PubMed Central

Somaio Neto, Frederico; Ikejiri, Adauto Tsutomu; Bertoletto, Paulo Roberto; Chaves, José Carlos Bertoletto; Teruya, Roberto; Fagundes, Djalma José; Taha, Murched Omar

2014-01-01

Background Intestinal ischemia-reperfusion is a frequent clinical event associated to injury in distant organs, especially the heart. Objective To investigate the gene expression of oxidative stress and antioxidant defense in the heart of inbred mice subjected to intestinal ischemia and reperfusion (IR). Methods Twelve mice (C57BL / 6) were assigned to: IR Group (GIR) with 60 minutes of superior mesenteric artery occlusion followed by 60 minutes of reperfusion; Control Group (CG) which underwent anesthesia and laparotomy without IR procedure and was observed for 120 minutes. Intestine and heart samples were processed using the RT-qPCR / Reverse transcriptase-quantitative Polymerase Chain Reaction method for the gene expression of 84 genes related to oxidative stress and oxidative defense (Student's "t" test, p < 0.05). Results The intestinal tissue (GIR) was noted to have an up-regulation of 65 genes (74.71%) in comparison to normal tissue (CG), and 37 genes (44.04%) were hyper-expressed (greater than three times the threshold allowed by the algorithm). Regarding the remote effects of intestinal I/R in cardiac tissue an up-regulation of 28 genes (33.33%) was seen, but only eight genes (9.52%) were hyper-expressed three times above threshold. Four (7.14%) of these eight genes were expressed in both intestinal and cardiac tissues. Cardiomyocytes with smaller and pyknotic nuclei, rich in heterochromatin with rare nucleoli, indicating cardiac distress, were observed in the GIR. Conclusion Intestinal I/R caused a statistically significant over expression of 8 genes associated with oxidative stress in remote myocardial tissue. PMID:24346830

Measurement of Gene Expression in Archival Paraffin-Embedded Tissues

PubMed Central

Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.

2004-01-01

Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316

TH and DCX mRNAs in peripheral blood and bone marrow predict outcome in metastatic neuroblastoma patients.

PubMed

Yáñez, Yania; Hervás, David; Grau, Elena; Oltra, Silvestre; Pérez, Gema; Palanca, Sarai; Bermúdez, Mar; Márquez, Catalina; Cañete, Adela; Castel, Victoria

2016-03-01

In metastatic neuroblastoma (NB) patients, accurate risk stratification and disease monitoring would reduce relapse probabilities. This study aims to evaluate the independent prognostic significance of detecting tyrosine hydroxylase (TH) and doublecortin (DCX) mRNAs by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in peripheral blood (PB) and bone marrow (BM) samples from metastatic NB patients. RT-qPCR was performed on PB and BM samples from metastatic NB patients at diagnosis, post-induction therapy and at the end of treatment for TH and DCX mRNAs detection. High levels of TH and DCX mRNAs when detected in PB and BM at diagnosis independently predicted worse outcome in a cohort of 162 metastatic NB. In the subgroup of high-risk metastatic NB, TH mRNA detected in PB remained as independent predictor of EFS and OS at diagnosis. After the induction therapy, high levels of TH mRNA in PB and DCX mRNA in BM independently predicted poor EFS and OS. Furthermore TH mRNA when detected in BM predicted worse EFS. TH mRNA in PB samples at the end of treatment is an independent predictor of worse outcome. TH and DCX mRNAs levels in PB and BM assessed by RT-qPCR should be considered in new pre-treatment risk stratification strategies to reliable estimate outcome differences in metastatic NB patients. In those high-risk metastatic NB, TH and DCX mRNA quantification could be used for the assessment of response to treatment and for early detection of progressive disease or relapses.

Relationships between infection, dissemination, and transmission of West Nile virus RNA in Culex pipiens quinquefasciatus (Diptera: Culicidae).

PubMed

Richards, Stephanie L; Anderson, Sheri L; Lord, Cynthia C; Smartt, Chelsea T; Tabachnick, Walter J

2012-01-01

Culex pipiens quinquefasciatus Say fed blood containing 6.8 +/- 0.3 logs (mean +/- SE) plaque-forming units of West Nile virus (WNV)/ml were maintained at 28 degrees C for incubation periods (IP) of 7, 14, or 21 d. Several attributes of vector competence were determined at each IP using quantitative real-time reverse transcriptase polymerase chain reaction to estimate plaque forming unit equivalents including: infection rate (WNV-positive abdomens), dissemination rate (WNV-positive legs or thoraces), combined dissemination rate (WNV-positive legs and thoraces), transmission rate (WNV-positive saliva), and WNV titers in abdomens, legs, thoraces, and saliva. Each rate increased or was equivalent with increasing IP. Mosquitoes transmitting WNV in saliva also had significantly higher IP-dependent WNV titers in abdomens, legs, and thoraces. Titers of WNV in abdomens were significantly correlated with titers in legs and thoraces, but the degree of association changed with IP. However, titers of abdomens, legs, and thoraces were not correlated with WNV presence or titer in the saliva. The results show that WNV presence or titer in the saliva of infected Cx. p. quinquefasciatus was not directly influenced by processes involved in WNV replication in other tissues. The processes controlling midgut infection and escape are, in part, independent from the infection processes in other tissues. The relationship between infection, dissemination, and transmission varied over time. The infection and replication of WNV in different tissues is likely influenced by different barriers encountered during the extrinsic incubation period. The significance of these observations for understanding vector competence is discussed.

Transcriptome Analysis of Orbital Adipose Tissue in Active Thyroid Eye Disease Using Next Generation RNA Sequencing Technology

PubMed Central

Lee, Bradford W.; Kumar, Virender B.; Biswas, Pooja; Ko, Audrey C.; Alameddine, Ramzi M.; Granet, David B.; Ayyagari, Radha; Kikkawa, Don O.; Korn, Bobby S.

2018-01-01

Objective: This study utilized Next Generation Sequencing (NGS) to identify differentially expressed transcripts in orbital adipose tissue from patients with active Thyroid Eye Disease (TED) versus healthy controls. Method: This prospective, case-control study enrolled three patients with severe, active thyroid eye disease undergoing orbital decompression, and three healthy controls undergoing routine eyelid surgery with removal of orbital fat. RNA Sequencing (RNA-Seq) was performed on freshly obtained orbital adipose tissue from study patients to analyze the transcriptome. Bioinformatics analysis was performed to determine pathways and processes enriched for the differential expression profile. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR) was performed to validate the differential expression of selected genes identified by RNA-Seq. Results: RNA-Seq identified 328 differentially expressed genes associated with active thyroid eye disease, many of which were responsible for mediating inflammation, cytokine signaling, adipogenesis, IGF-1 signaling, and glycosaminoglycan binding. The IL-5 and chemokine signaling pathways were highly enriched, and very-low-density-lipoprotein receptor activity and statin medications were implicated as having a potential role in TED. Conclusion: This study is the first to use RNA-Seq technology to elucidate differential gene expression associated with active, severe TED. This study suggests a transcriptional basis for the role of statins in modulating differentially expressed genes that mediate the pathogenesis of thyroid eye disease. Furthermore, the identification of genes with altered levels of expression in active, severe TED may inform the molecular pathways central to this clinical phenotype and guide the development of novel therapeutic agents. PMID:29760827

Analysis of myosin heavy chain mRNA expression by RT-PCR

NASA Technical Reports Server (NTRS)

Wright, C.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

1997-01-01

An assay was developed for rapid and sensitive analysis of myosin heavy chain (MHC) mRNA expression in rodent skeletal muscle. Only 2 microg of total RNA were necessary for the simultaneous analysis of relative mRNA expression of six different MHC genes. We designed synthetic DNA fragments as internal standards, which contained the relevant primer sequences for the adult MHC mRNAs type I, IIa, IIx, IIb as well as the embryonic and neonatal MHC mRNAs. A known amount of the synthetic fragment was added to each polymerase chain reaction (PCR) and yielded a product of different size than the amplified MHC mRNA fragment. The ratio of amplified MHC fragment to synthetic fragment allowed us to calculate percentages of the gene expression of the different MHC genes in a given muscle sample. Comparison with the traditional Northern blot analysis demonstrated that our reverse transcriptase-PCR-based assay was reliable, fast, and quantitative over a wide range of relative MHC mRNA expression in a spectrum of adult and neonatal rat skeletal muscles. Furthermore, the high sensitivity of the assay made it very useful when only small quantities of tissue were available. Statistical analysis of the signals for each MHC isoform across the analyzed samples showed a highly significant correlation between the PCR and the Northern signals as Pearson correlation coefficients ranged between 0.77 and 0.96 (P < 0.005). This assay has potential use in analyzing small muscle samples such as biopsies and samples from pre- and/or neonatal stages of development.

Impact of Antiretroviral Treatment Containing Tenofovir Difumarate on the Telomere Length of Aviremic HIV-Infected Patients.

PubMed

Montejano, Rocio; Stella-Ascariz, Natalia; Monge, Susana; Bernardino, José I; Pérez-Valero, Ignacio; Montes, María L; Valencia, Eulalia; Martín-Carbonero, Luz; Moreno, Victoria; González-García, Juan; Arnalich, Francisco; Mingorance, Jesús; Pintado Berniches, Laura; Perona, Rosario; Arribas, José R

2017-09-01

To evaluate the in vivo relevance of the inhibitory effect of tenofovir on telomerase activity observed in vitro. Cross-sectional study of HIV-infected patients with suppressed virological replication (HIV RNA <50 copies/mL for more than 1 year). Telomere length in whole blood was measured by quantitative real-time polymerase chain reaction. We performed a multivariate analysis to elucidate variables associated with telomere length and also evaluated the association between telomere length and use of tenofovir difumarate (TDF) adjusted by significant confounders. 200 patients included, 72% men, median age 49 (IQR 45-54.5), 103 with exposure to a TDF containing antiretroviral treatment (ART) regimen (69.9% for more than 5 years) and 97 never exposed to a TDF containing ART regimen. In the multivariate analysis, significant predictors of shorter telomere length were older age (P = 0.008), parental age at birth (P = 0.038), white race (P = 0.048), and longer time of known HIV infection (10-20 and ≥20 years compared with <10 years, P = 0.003 and P = 0.056, respectively). There was no association between TDF exposure and telomere length after adjusting for possible confounding factors (age, parental age at birth, race, and time of HIV infection). Total time receiving ART and duration of treatment with nucleoside reverse transcriptase inhibitors were associated with shorter telomere length, but these associations were explained by time of known HIV infection. Our data do not suggest that telomerase activity inhibition caused by TDF in vitro leads to telomere shortening in peripheral blood of HIV-infected patients.

Molecular changes in obese and depressive patients are similar to neurodegenerative disorders

PubMed Central

Habibi, Laleh; Tafakhori, Abbas; Hadiani, Rasoul; Maserat-Mashhadi, Maryam; Kafrash, Zeinab; Torabi, Shahla; Azhdarzadeh, Mohammad; Akrami, Seyed Mohammad; Mahmoudi, Morteza; Dinarvand, Rasoul

2017-01-01

Background: Neurodegenerative disorders (NDs) are categorized as multifactorial conditions with different molecular and environmental causes. Disturbance of important signaling pathways, such as energy metabolism and inflammation induced by environmental agents, is involved in the pathophysiology of NDs. It has been proposed that changes in the lifestyle and nutrition (metabolism) during mid-life could trigger and accumulate cellular and molecular damages resulting in NDs during aging. Methods: In order to test the hypothesis, we investigated the expression level of two energy metabolism-related [forkhead box O1 (FOXO1) and forkhead box O3 (FOXO3A)] and two pro-inflammatory cytokines [interleukin 1β (IL-1β) and IL-6] genes, using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, changes in the ionic concentration of three essential heavy metals [iron (Fe), copper (Cu), and zinc (Zn)] by atomic absorption spectroscopy in patients with NDs, depression, obesity, and diabetes type II, were evaluated and compared with the results of normal individuals. Results: More than half of the participants in obesity, depression, and ND groups had significant up-regulation of FOXO1 and FOXO3A, down-regulation of IL-1β and IL-6, and higher levels of Fe and Cu in their blood. This pattern of gene expression was not repeated in diabetic patients. Conclusion: It could be concluded that individuals affected with different levels of obesity and depression have increased the risk of developing NDs later in life, probably through changes in energy metabolism, inflammatory pathways, and ionic concentrations. PMID:29736225

Molecular changes in obese and depressive patients are similar to neurodegenerative disorders.

PubMed

Habibi, Laleh; Tafakhori, Abbas; Hadiani, Rasoul; Maserat-Mashhadi, Maryam; Kafrash, Zeinab; Torabi, Shahla; Azhdarzadeh, Mohammad; Akrami, Seyed Mohammad; Mahmoudi, Morteza; Dinarvand, Rasoul

2017-10-07

Background: Neurodegenerative disorders (NDs) are categorized as multifactorial conditions with different molecular and environmental causes. Disturbance of important signaling pathways, such as energy metabolism and inflammation induced by environmental agents, is involved in the pathophysiology of NDs. It has been proposed that changes in the lifestyle and nutrition (metabolism) during mid-life could trigger and accumulate cellular and molecular damages resulting in NDs during aging. Methods: In order to test the hypothesis, we investigated the expression level of two energy metabolism-related [forkhead box O1 (FOXO1) and forkhead box O3 (FOXO3A)] and two pro-inflammatory cytokines [interleukin 1β (IL-1β) and IL-6] genes, using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, changes in the ionic concentration of three essential heavy metals [iron (Fe), copper (Cu), and zinc (Zn)] by atomic absorption spectroscopy in patients with NDs, depression, obesity, and diabetes type II, were evaluated and compared with the results of normal individuals. Results: More than half of the participants in obesity, depression, and ND groups had significant up-regulation of FOXO1 and FOXO3A, down-regulation of IL-1β and IL-6, and higher levels of Fe and Cu in their blood. This pattern of gene expression was not repeated in diabetic patients. Conclusion: It could be concluded that individuals affected with different levels of obesity and depression have increased the risk of developing NDs later in life, probably through changes in energy metabolism, inflammatory pathways, and ionic concentrations.

Transcription and translation of the chemokines RANTES and MCP-1 in nasal polyps and mucosa in allergic and non-allergic rhinopathies.

PubMed

Marcella, Reale; Croce, Adelchi; Moretti, Antonio; Barbacane, Renato C; Di Giocchino, Mario; Conti, Pio

2003-12-15

The pathogenetic findings of rhinopathies show an increase in infiltrating cells including eosinophils. RANTES is a beta chemokine in which the cysteines are adjacent (C-C), and it attracts and activates eosinophil. We hypothesize that RANTES is locally produced within the nasal polyp microenvironment and is responsible for the inflammatory cell recruitment present in nasal polyposis. To test this hypothesis, we evaluated nasal polyps and mucosa from allergic and control, non-allergic patients for RANTES content. The relative levels of RANTES and MCP-1 protein in tissue homogenates were quantified using enzyme-linked immunosorbent assay technology, and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) tests for RANTES and MCP-1 mRNA expression were performed. The results indicate that RANTES expression and production increase in nasal mucosa (septal and turbinate portions) of allergic patients compared to the same mucosa in non-allergic patients. In allergic patients, RANTES levels of nasal polyp homogenates were nearly 12-fold higher than the RANTES levels in mucosa homogenate. In this study, we hypothesize that the particular anatomic structure and physiologic function of the turbinates are more involved in the pathogenesis of rhinitis and may undergo polypoid degeneration in allergic rhinitis than any other anatomical structure of the nose. Our data suggest that RANTES is more involved than MCP-1 in recruiting inflammatory cells in rhinological disease and may reflect the degree of local inflammation as consequence of the specific chemoattractant properties of RANTES. The level of RANTES in nasal polyps could be important in the development of the pathological state.

Rare occurrence of natural transovarial transmission of dengue virus and elimination of infected foci as a possible intervention method.

PubMed

Angel, Annette; Angel, Bennet; Joshi, Vinod

2016-03-01

Transovarial transmission of dengue virus has been studied in 33 districts of Rajasthan, India. Small proportion (1.09%) of breeding containers positive for the virus and their elimination has been demonstrated as a possible intervention method of disease control. Dengue virus was isolated from individual mosquitoes employing Indirect Fluorescence Antibody Test and Reverse Transcriptase Polymerase Chain Reaction. Out of 1,30,525 containers examined only 1432(1.09%) showed transovarially transmitted virus activity. Elimination of larvae from all the 1432 virus positive containers resulted in substantial control over prospective transmission of dengue. The study highlights rarity of transovarial transmission under natural conditions and sensitizes whether elimination of vertically infected foci could be used as a new intervention method. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of a highly sensitive screen for influenza A in guano and its application in the search for ancient RNA preserved under Antarctic Adelie penguin colonies.

PubMed

Briggs, L C; Ashton, R M; Metcalf, P

2003-01-01

We have developed a reverse transcriptase polymerase chain reaction (RT-PCR)-based assay to detect influenza A in guano samples as part of our program to investigate ancient viral RNA from under Antarctic Adelie penguin (Pygoscelis adeliae) colonies. Of five extraction protocols tested (RNeasy, GTC TRIZOL, GTC Silica, Rnaid, and AGPC), AGPC proved to be the most consistent and sensitive to low concentrations of influenza, but further purification with commercial viral nucleic acid spin filter system was still required to remove remaining PCR inhibitors. RT-PCR was then performed on the eluent and 650 bases of the M1 gene were amplified. The assay was found to be able to detect as little as 100 microl of 0.1 hemagglutination units (HU)/ml influenza.

Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

PubMed

Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

2001-07-01

Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

[Expression of cell adhesion molecules in acute leukemia cell].

PubMed

Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang

2002-11-01

To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.

Cykotine mRNA expression in mouse retina after laser injury by reverse transcriptase-polymerase chain reaction (RT-PCR)

NASA Astrophysics Data System (ADS)

Schuschereba, Steven T.; Bowman, Phillip D.; Ujimore, Veronica; Hoxie, Stephen W.; Pizarro, Jose M.; Cross, Michael E.; Lund, David J.

1996-04-01

The purpose of this study was to identify cytokines produced by the retina after laser injury. With the aid of a scanning laser ophthalmoscope (SLO), right eyes of mice received lesions from a continuous wave argon laser. Left eyes served as unirradiated controls. At 2, 4, 6, 12, 24, and 48 hr after laser irradiation groups of 3 mice were euthanized and retinas fixed for histology or isolated for RNA. Messenger RNA (mRNA) was reverse-transcribed into complementary DNA (cDNA) and subjected to polymerase chain reaction for the following cytokines: tumor necrosis factor-(alpha) (TNF-(alpha) ), interleukin-1(alpha) /(Beta) (IL- 1(alpha) /(Beta) ), interleukin-6 (IL-6), transforming growth factor-(Beta) 1 (TGF- (Beta) 1), macrophage colony stimulating factor (M-CSF), inducible nitric oxide synthase (iNOS), and glyceraldehyde 3-phosphate dehydrogenase (G3PDH). Histologically, lesions were confined to the photoreceptors, retinal pigment epithelium, and choroid. In laser-injured retinas, mRNA levels were elevated for IL-1(alpha) , TGF-(Beta) 1, iNOS, and G3PDH, but not TNF-(alpha) , IL-1(Beta) , or IL-6. It appears that the retina, in response to laser injury, upregulates a select number of cytokines in a time-course dependent fashion.

A general method to eliminate laboratory induced recombinants during massive, parallel sequencing of cDNA library.

PubMed

Waugh, Caryll; Cromer, Deborah; Grimm, Andrew; Chopra, Abha; Mallal, Simon; Davenport, Miles; Mak, Johnson

2015-04-09

Massive, parallel sequencing is a potent tool for dissecting the regulation of biological processes by revealing the dynamics of the cellular RNA profile under different conditions. Similarly, massive, parallel sequencing can be used to reveal the complexity of viral quasispecies that are often found in the RNA virus infected host. However, the production of cDNA libraries for next-generation sequencing (NGS) necessitates the reverse transcription of RNA into cDNA and the amplification of the cDNA template using PCR, which may introduce artefact in the form of phantom nucleic acids species that can bias the composition and interpretation of original RNA profiles. Using HIV as a model we have characterised the major sources of error during the conversion of viral RNA to cDNA, namely excess RNA template and the RNaseH activity of the polymerase enzyme, reverse transcriptase. In addition we have analysed the effect of PCR cycle on detection of recombinants and assessed the contribution of transfection of highly similar plasmid DNA to the formation of recombinant species during the production of our control viruses. We have identified RNA template concentrations, RNaseH activity of reverse transcriptase, and PCR conditions as key parameters that must be carefully optimised to minimise chimeric artefacts. Using our optimised RT-PCR conditions, in combination with our modified PCR amplification procedure, we have developed a reliable technique for accurate determination of RNA species using NGS technology.

Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

PubMed

Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

2007-02-01

In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

DOEpatents

Cruz-Perez, Patricia; Buttner, Mark P.

2004-05-11

A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

PubMed

Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

2016-08-01

On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

HSP90 and its R2TP/Prefoldin-like cochaperone are involved in the cytoplasmic assembly of RNA polymerase II.

PubMed

Boulon, Séverine; Pradet-Balade, Bérengère; Verheggen, Céline; Molle, Dorothée; Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I; Bertrand, Edouard

2010-09-24

RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. Copyright © 2010 Elsevier Inc. All rights reserved.

HSP90 and Its R2TP/Prefoldin-like Cochaperone Are Involved in the Cytoplasmic Assembly of RNA Polymerase II

PubMed Central

Boireau, Stéphanie; Georgieva, Marya; Azzag, Karim; Robert, Marie-Cécile; Ahmad, Yasmeen; Neel, Henry; Lamond, Angus I.; Bertrand, Edouard

2015-01-01

SUMMARY RNA polymerases are key multisubunit cellular enzymes. Microscopy studies indicated that RNA polymerase I assembles near its promoter. However, the mechanism by which RNA polymerase II is assembled from its 12 subunits remains unclear. We show here that RNA polymerase II subunits Rpb1 and Rpb3 accumulate in the cytoplasm when assembly is prevented and that nuclear import of Rpb1 requires the presence of all subunits. Using MS-based quantitative proteomics, we characterized assembly intermediates. These included a cytoplasmic complex containing subunits Rpb1 and Rpb8 associated with the HSP90 cochaperone hSpagh (RPAP3) and the R2TP/Prefoldin-like complex. Remarkably, HSP90 activity stabilized incompletely assembled Rpb1 in the cytoplasm. Our data indicate that RNA polymerase II is built in the cytoplasm and reveal quality-control mechanisms that link HSP90 to the nuclear import of fully assembled enzymes. hSpagh also bound the free RPA194 subunit of RNA polymerase I, suggesting a general role in assembling RNA polymerases. PMID:20864038

Touch-down reverse transcriptase-PCR detection of IgV(H) rearrangement and Sybr-Green-based real-time RT-PCR quantitation of minimal residual disease in patients with chronic lymphocytic leukemia.

PubMed

Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí

2005-01-01

Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.

Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

PubMed

Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

2014-01-01

A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

EPA Science Inventory

Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

Gammaretrovirus-Specific Antibodies in Free-Ranging and Captive Namibian Cheetahs

PubMed Central

Krengel, Annika; Cattori, Valentino; Meli, Marina L.; Wachter, Bettina; Böni, Jürg; Bisset, Leslie R.; Thalwitzer, Susanne; Melzheimer, Jörg; Jago, Mark; Hofmann-Lehmann, Regina; Hofer, Heribert

2015-01-01

The cheetah population in Namibia is the largest free-ranging population in the world and a key population for research regarding the health status of this species. We used serological methods and quantitative real-time PCR to test free-ranging and captive Namibian cheetahs for the presence of feline leukemia virus (FeLV), a gammaretrovirus that can be highly aggressive in populations with low genetic diversity, such as cheetahs. We also assessed the presence of antibodies to other gammaretroviruses and the responses to a FeLV vaccine developed for domestic cats. Up to 19% of the free-ranging cheetahs, 27% of the captive nonvaccinated cheetahs, and 86% of the captive vaccinated cheetahs tested positive for FeLV antibodies. FeLV-antibody-positive free-ranging cheetahs also tested positive for Rauscher murine leukemia virus antibodies. Nevertheless, FeLV was not detectable by quantitative real-time PCR and no reverse transcriptase activity was detectable by product-enhanced reverse transcriptase assay in the plasma of cheetahs or the supernatants from cultures of peripheral blood mononuclear cells. The presence of antibodies to gammaretroviruses in clinically healthy specimens may be caused either by infection with a low-pathogenic retrovirus or by the expression of endogenous retroviral sequences. The strong humoral immune responses to FeLV vaccination demonstrate that cheetahs can respond to the vaccine and that vaccination against FeLV infection may be beneficial should FeLV infection ever become a threat, as was seen in Iberian lynx and Florida panthers. PMID:25809630

Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

USGS Publications Warehouse

Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

2011-01-01

Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

Balancing Antiviral Potency and Host Toxicity: Identifying a Nucleotide Inhibitor with an Optimal Kinetic Phenotype for HIV-1 Reverse Transcriptase

PubMed Central

Sohl, Christal D.; Kasiviswanathan, Rajesh; Kim, Jiae; Pradere, Ugo; Schinazi, Raymond F.; Copeland, William C.; Mitsuya, Hiroaki; Baba, Masanori

2012-01-01

Two novel thymidine analogs, 3′-fluoro-3′-deoxythymidine (FLT) and 2′,3′-didehydro-3′-deoxy-4′-ethynylthymidine (Ed4T), have been investigated as nucleoside reverse transcriptase inhibitors (NRTIs) for treatment of HIV infection. Ed4T seems very promising in phase II clinical trials, whereas toxicity halted FLT development during this phase. To understand these different molecular mechanisms of toxicity, pre–steady-state kinetic studies were used to examine the interactions of FLT and Ed4T with wild-type (WT) human mitochondrial DNA polymerase γ (pol γ), which is often associated with NRTI toxicity, as well as the viral target protein, WT HIV-1 reverse transcriptase (RT). We report that Ed4T-triphosphate (TP) is the first analog to be preferred over native nucleotides by RT but to experience negligible incorporation by WT pol γ, with an ideal balance between high antiretroviral efficacy and minimal host toxicity. WT pol γ could discriminate Ed4T-TP from dTTP 12,000-fold better than RT, with only an 8.3-fold difference in discrimination being seen for FLT-TP. A structurally related NRTI, 2′,3′-didehydro-2′,3′-dideoxythymidine, is the only other analog favored by RT over native nucleotides, but it exhibits only a 13-fold difference (compared with 12,000-fold for Ed4T) in discrimination between the two enzymes. We propose that the 4′-ethynyl group of Ed4T serves as an enzyme selectivity moiety, critical for discernment between RT and WT pol γ. We also show that the pol γ mutation R964C, which predisposes patients to mitochondrial toxicity when receiving 2′,3′-didehydro-2′,3′-dideoxythymidine to treat HIV, produced some loss of discrimination for FLT-TP and Ed4T-TP. These molecular mechanisms of analog incorporation, which are critical for understanding pol γ-related toxicity, shed light on the unique toxicity profiles observed during clinical trials. PMID:22513406

Chandipura virus infection causing encephalitis in a tribal population of Odisha in eastern India.

PubMed

Dwibedi, Bhagirathi; Sabat, Jyotsnamayee; Hazra, Rupenangshu K; Kumar, Anu; Dinesh, Diwakar Singh; Kar, Shantanu K

2015-01-01

The sudden death of 10 children in a tribal village of Kandhamal district, Odisha in eastern India led to this investigation. We conducted a door-to-door survey to identify cases. Antibodies for Chandipura, Japanese encephalitis, dengue, chikungunya and West Nile viruses were tested by ELISA in probable cases. Chandipura virus RNA was tested from both human blood samples and sand flies by reverse transcriptase polymerase chain reaction. We conducted vector surveys in domestic and peridomestic areas, and collected sand flies. Entomological investigations revealed the presence of Phlebotomus argentipes and Sergentomiya sp. Thirty-five patients presented with fever, 12 of them had altered sensorium including 4 who had convulsions. The blood samples of 21 patients were tested; four samples revealed Chandipura virusspecific IgM antibody. Chandipura virus infection causing encephalitis affected this tribal population in eastern India at 1212 m above sea level. Copyright 2015, NMJI.

Binding of Nickel to Testicular Glutamate–Ammonia Ligase Inhibits Its Enzymatic Activity

PubMed Central

SUN, YINGBIAO; OU, YOUNG; CHENG, MIN; RUAN, YIBING; VAN DER HOORN, FRANS A.

2016-01-01

SUMMARY Exposure to nickel has been shown to cause damage to the testis in several animal models. It is not known if the testis expresses protein(s) that can bind nickel. To test this, we used a nickel-binding assay to isolate testicular nickel-binding proteins. We identified glutamate–ammonia ligase (GLUL) as a prominent nickel-binding protein by mass spectrometry. Protein analysis and reverse transcriptase polymerase chain reaction showed that GLUL is expressed in the testis, predominantly in interstitial cells. We determined that GLUL has a higher affinity for nickel than for its regular co-factor manganese. We produced an enzymatically active, recombinant GLUL protein. Upon binding, nickel interferes with the manganese-catalyzed enzymatic activity of recombinant GLUL protein. We also determined that GLUL activity in testes of animals exposed to nickel sulfate is reduced. Our results identify testicular GLUL as the first testicular protein shown to be affected by nickel exposure. PMID:21254280

Evidence of human hantavirus infection and zoonotic investigation of hantavirus prevalence in rodents in western Java, Indonesia.

PubMed

Kosasih, Herman; Ibrahim, Ima Nurisa; Wicaksana, Rudi; Alisjahbana, Bachti; Hoo, Yumilia; Yo, Iing H; Antonjaya, Ungke; Widjaja, Susana; Winoto, Imelda; Williams, Maya; Blair, Patrick J

2011-06-01

During febrile surveillance in the western Java City of Bandung, Indonesia, a patient with clinical symptoms consistent with hantavirus infection was found to have elevated titers of hantavirus-specific immunoglobulin M (IgM) and IgG antibodies. A subsequent epizoological investigation demonstrated a higher prevalence of hantavirus IgG antibodies in rodents trapped in the vicinity of the patient's home compared with rodents from a control area (13.2% vs. 4.7%, p = 0.036). The Old World Seoul hantavirus was detected by reverse transcriptase-polymerase chain reaction in the organs of 71% of the seropositive rodents tested. This is the first report of a Seoul virus infection in Indonesia supported by clinical, serological, and epizoological evidences. These findings suggest that hantavirus infection should be on the clinical differential diagnosis when acutely ill febrile patients report for care in western Java.

Ebola Virus VP35-VP40 Interaction Is Sufficient for Packaging 3E-5E Minigenome RNA into Virus-Like Particles

PubMed Central

Johnson, Reed F.; McCarthy, Sarah E.; Godlewski, Peter J.; Harty, Ronald N.

2006-01-01

The packaging of viral genomic RNA into nucleocapsids and subsequently into virions is not completely understood. Phosphoprotein (P) and nucleoprotein (NP) interactions link NP-RNA complexes with P-L (polymerase) complexes to form viral nucleocapsids. The nucleocapsid then interacts with the viral matrix protein, leading to specific packaging of the nucleocapsid into the virion. A mammalian two-hybrid assay and confocal microscopy were used to demonstrate that Ebola virus VP35 and VP40 interact and colocalize in transfected cells. VP35 was packaged into budding virus-like particles (VLPs) as observed by protease protection assays. Moreover, VP40 and VP35 were sufficient for packaging an Ebola virus minignome RNA into VLPs. Results from immunoprecipitation-reverse transcriptase PCR experiments suggest that VP35 confers specificity of the nucleocapsid for viral genomic RNA by direct VP35-RNA interactions. PMID:16698994

HIV-1 reverse transcriptase and antiviral drug resistance. Part 2.

PubMed

Das, Kalyan; Arnold, Eddy

2013-04-01

Structures of RT and its complexes combined with biochemical and clinical data help in illuminating the molecular mechanisms of different drug-resistance mutations. The NRTI drugs that are used in combinations have different primary mutation sites. RT mutations that confer resistance to one drug can be hypersensitive to another RT drug. Structure of an RT-DNA-nevirapine complex revealed how NNRTI binding forbids RT from forming a polymerase competent complex. Collective knowledge about various mechanisms of drug resistance by RT has broader implications for understanding and targeting drug resistance in general. In Part 1, we discussed the role of RT in developing HIV-1 drug resistance, structural and functional states of RT, and the nucleoside/nucleotide analog (NRTI) and non-nucleoside (NNRTI) drugs used in treating HIV-1 infections. In this part, we discuss structural understanding of various mechanisms by which RT confers antiviral drug resistance. Copyright © 2013 Elsevier B.V. All rights reserved.

Evidence for airborne transmission of Norwalk-like virus (NLV) in a hotel restaurant.

PubMed

Marks, P J; Vipond, I B; Carlisle, D; Deakin, D; Fey, R E; Caul, E O

2000-06-01

An outbreak of gastroenteritis followed a meal in a large hotel during which one of the diners vomited. The clinical features of the illness suggested Norwalk-like virus (NLV, small round structured virus) infection, and this was confirmed by electron microscopy and reverse transcriptase polymerase chain reaction (RT-PCR) of stool samples. Further characterization of the virus by nucleotide sequence analysis of the PCR amplicons revealed identical strains in all the affected individuals. The foods served at the meal could not be demonstrated to be the cause of the outbreak. Analysis of attack rates by dining table showed an inverse relationship with the distance from the person who vomited. No one eating in a separate restaurant reported illness. Transmission from person-to-person or direct contamination of food seems unlikely in this outbreak. However, the findings are consistent with airborne spread of NLV with infection by inhalation with subsequent ingestion of virus particles.

Failure to Detect Borna Disease Virus Antibody and RNA from Peripheral Blood Mononuclear Cells of Psychiatric Patients

PubMed Central

Na, Kyoung-Sae; Tae, Seong-Ho; Song, Jin-won

2009-01-01

Objective Borna disease virus (BDV) is a highly neurotropic agent causing various neuropsychiatric symptoms in animals. Over the past two decades, it has been suggested that BDV might be associated with human psychiatric diseases. We aimed to investigate whether BDV is associated with psychiatric patients in Korea. Methods We recruited 60 normal controls and 198 psychiatric patients (98 patients with depressive disorder, 60 with schizophrenia, and 40 with bipolar disorder). We used an indirect immunofluorescence antibody (IFA) test for the BDV antibody and a real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assay for p24 and p40 RNA from peripheral blood mononuclear cells (PBMCs). Results Neither the BDV antibody nor p24, p40 RNA was detected in controls and patients groups. Conclusion Our results suggest that BDV might not be associated with psychiatric patients in Korea. PMID:20140130

Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini) development.

PubMed

Santana, Flávia A; Nunes, Francis M F; Vieira, Carlos U; Machado, Maria Alice M S; Kerr, Warwick E; Silva, Wilson A; Bonetti, Ana Maria

2006-03-01

We have compared gene expression, using the Differential Display Reverse Transcriptase-Polymerase Chain Reaction (DDRT-PCR) technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

Stable prevalence of Powassan virus in Ixodes scapularis in a northern Wisconsin focus.

PubMed

Brackney, Doug E; Nofchissey, Robert A; Fitzpatrick, Kelly A; Brown, Ivy K; Ebel, Gregory D

2008-12-01

Deer tick virus (DTV), a variant of Powassan virus (POWV), appears to be maintained in nature in an enzootic cycle between Ixodes scapularis ticks and small mammals. Although POWV infection of human beings is rare, a recent report suggests increasing incidence and the possibility that POWV may be an emerging tick-borne zoonosis. Therefore, we assessed the long-term stability of the POWV transmission cycle in northwestern Wisconsin. Adult I. scapularis and Dermacentor variabilis were collected from Hayward and Spooner, Wisconsin, screened for infection by reverse transcriptase polymerase chain reaction (RT-PCR), and virus was isolated. Seventeen of 1,335 (1.3%) of I. scapularis and 0 of 222 (0%) of D. variabilis ticks were infected. All isolated virus belonged to the DTV genotype of POWV. These findings suggest stable transmission of POWV in this focus over ten years and highlight the potential for this agent to emerge as a public health concern.

Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

PubMed

Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

2003-07-25

A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

2006-08-01

A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

[Relationship between the methylenetetrahydrofolate reductase gene polymorphism and adverse reactions of high-dose methotrexate in children with acute lymphocytic leukemia].

PubMed

Zheng, Miao-Miao; Yue, Li-Jie; Chen, Xiao-Wen; Wen, Fei-Qiu; Li, Chang-Gang; Yang, Chun-Lan; Xie, Cai; Ding, Hui

2013-03-01

To study the association between methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and toxicities after high-dose methotrexate (HD-MTX) infusion in children with acute lymphocytic leukemia (ALL). MTHFR variants in 52 children with ALL were determined by reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. Toxicities of children who received HD-MTX chemotherapy were evaluated according to the National Cancer Institute-Common Toxicity Criteria (NCI-CTC). The children carrying MTHFR 1298AC had a higher risk of developing thrombocytopenia compared with the carriers of the 1298 AA genotype (OR=13.7, 95%CI=1.18-159.36, P=0.036). There was no significant difference in HD-MTX chemotherapy-related adverse effects between the patients with different MTHFR C677T or G1793A genotypes. MTHFR A1298C polymorohism may associate with the toxicity of HD-MTX chemotherapy in children with ALL.

Podoscyphic acid, a new inhibitor of avian myeloblastosis virus and Moloney murine leukemia virus reverse transcriptase from a Podoscypha species.

PubMed

Erkel, G; Anke, T; Velten, R; Steglich, W

1991-01-01

A novel enzyme inhibitor of RNA-directed DNA-polymerases of avian myeloblastosis and murine leukemia virus was isolated from fermentations of an tasmanian Podoscypha species. Its structure was elucidated by spectroscopic methods and oxidative degradation as (E)-4,5-dioxo-2-hexadecenoic acid (1). The enzyme inhibitor, which was named podoscyphic acid, did not inhibit DNA and RNA synthesis in permeabilized L 1210 cells nor did it affect RNA synthesis in isolated nuclei of L 1210 cells. 1 inhibits protein synthesis in whole L 1210 cells and rabbit reticulocyte lysate and shows very weak antimicrobial and cytotoxic properties. The testing of ethyl (E)-4,5-dioxo-2-hexadecenoate (2) and (E)-4-oxo-2-tetradecenoic acid (11) revealed the importance of the free gamma-oxoacrylic acid unit for the biological activities of 1.

How Conformational Dynamics of DNA Polymerase Select Correct Substrates: Experiments and Simulations

PubMed Central

Kirmizialtin, Serdal; Nguyen, Virginia; Johnson, Kenneth A.; Elber, Ron

2012-01-01

Summary Nearly every enzyme undergoes a significant change in structure after binding it’s substrate. New experimental and theoretical analyses of the role of changes in HIV reverse transcriptase structure in selecting a correct substrate are presented. Atomically detailed simulations using the Milestoning method predict a rate and free energy profile of the conformational change commensurate with experimental data. A large conformational change occurring on a ms timescale locks the correct nucleotide at the active site, but promotes release of a mismatched nucleotide. The positions along the reaction coordinate that decide the yield of the reaction are not determined by the chemical step. Rather, the initial steps of weak substrate binding and protein conformational transition significantly enrich the yield of a reaction with a correct substrate, while the same steps diminish the reaction probability of an incorrect substrate. PMID:22483109

Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

PubMed

Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

2008-01-01

The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

Expression of placental protein 14 by the new endometrial cancer cell line MFE-280 in vitro and by endometrial carcinomas in vivo.

PubMed

Hackenberg, R; Loos, S; Nia, A H; Kunzmann, R; Schulz, K D

1998-01-01

MFE-280 endometrial cancer cells express PP14 (placental protein 14) in vitro. PP14 is normally found in the secretory endometrium and in placental tissue. MFE-280 cells, which are tumorigenic in nude mice, were derived from a recurrent, poorly differentiated endometrial carcinoma. The cells were initially grown in suspension culture and later transferred to monolayer cultures. Karyotyping revealed near-diploidy with a complex heterogeneous aberration pattern. MFE-280 cells were positive for the cytokeratins 7, 8, 18 and 19 as well as for vimentin. The expression of PP14 in MFE-280 cells was demonstrated by immunochemistry and reverse transcriptase--polymerase chain reaction. PP14-mRNA was also detected in one out of five endometrial cancer specimen. In tumor tissue the expression of PP14 was not dependent on progestins.

RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

EPA Science Inventory

Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

EPA Science Inventory

Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

MONITORING ASPERGILLUS SPECIES BY QUANTITATIVE PCR DURING CONSTRUCTION OF A MULTI-STORY HOSPITAL BUILDING

EPA Science Inventory

Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...

Mutations of mtDNA polymerase-γ and hyperlactataemia in the HIV-infected Zulu population of South Africa.

PubMed

Ojwach, D B A; Aldous, C; Kochleff, P; Sartorius, B

2016-12-01

Mitochondrial toxicity, particularly symptomatic hyperlactataemia or lactic acidosis (SHL/LA), has been attributed to the use of nucleoside reverse transcriptase inhibitors (NRTIs), possibly because of their capacity to impede human mitochondrial DNA polymerase-γ (POLG), which is responsible for the replication of mitochondrial DNA. To determine whether known monogenic POLG1 polymorphisms could be linked with the unexpectedly high incidence of SHL/LA observed in HIV-infected Zulu-speaking patients exposed to the NRTIs stavudine or zidovudine in their antiretroviral therapy. One hundred and sixteen patients from Edendale Hospital, Pietermaritzburg, South Africa, participated in the study between March and August 2014. Fifty-nine symptomatic cases were compared with 57 non-symptomatic controls on stavudine for ≥24 months. Among the symptomatic patients, 13 had SHL with measured lactate between 3.0 and 4.99 mmol/L, and 46 had LA with a lactate level ≥5 mmol/L. Genomic DNA from 113 samples was used for subsequent allelic discrimination polymerase chain reaction screening for the R964C and E1143G single-nucleotide polymorphisms of POLG1. Sequencing was performed for 40/113 randomly selected samples for confirmation of the genotyping results. Neither of the two known POLG1 mutations was observed. The cases presented with SHL/LA between 4 and 18 months on stavudine. Females (70.4%) were significantly (p<0.001) more likely to be cases (adjusted odds ratio 24.24, 95% CI 5.14 - 114.25) compared with males. This study has shown that our sample of the Zulu-speaking population does not exhibit a genetic predisposition to SHL/LA associated with known monogenic POLG1 mutations, indicating another possible predisposing factor for increased risk of SHL/LA.

First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

PubMed

Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

2018-05-01

Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

The mechano-chemistry of a monomeric reverse transcriptase

PubMed Central

Malik, Omri; Khamis, Hadeel; Rudnizky, Sergei

2017-01-01

Abstract Retroviral reverse transcriptase catalyses the synthesis of an integration-competent dsDNA molecule, using as a substrate the viral RNA. Using optical tweezers, we follow the Murine Leukemia Virus reverse transcriptase as it performs strand-displacement polymerization on a template under mechanical force. Our results indicate that reverse transcriptase functions as a Brownian ratchet, with dNTP binding as the rectifying reaction of the ratchet. We also found that reverse transcriptase is a relatively passive enzyme, able to polymerize on structured templates by exploiting their thermal breathing. Finally, our results indicate that the enzyme enters the recently characterized backtracking state from the pre-translocation complex. PMID:29165701

fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

PubMed

Khun, H H; Deved, V; Wong, H; Lee, B C

2000-12-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

fbpABC Gene Cluster in Neisseria meningitidis Is Transcribed as an Operon

PubMed Central

Khun, Heng H.; Deved, Vinay; Wong, Howard; Lee, B. Craig

2000-01-01

The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR. PMID:11083849

Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

PubMed

Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

2015-01-01

The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

Quantitative analysis of pork and chicken products by droplet digital PCR.

PubMed

Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

2014-01-01

In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

Effects of hypothermia and cerebral ischemia on cold-inducible RNA-binding protein mRNA expression in rat brain.

PubMed

Liu, Aijun; Zhang, Zhiwen; Li, Anmin; Xue, Jinghui

2010-08-06

CIRP (cold-inducible RNA-binding protein) mRNA is highly expressed in hypothermic conditions in mammalian cells, and the relationship between CIRP and neuroprotection for cerebral ischemia under hypothermia has been focused upon. At present, however, the expression characteristics of CIRP under hypothermia and cerebral ischemia in vivo are not clearly elucidated. In this study, CIRP mRNA expression in various regions of rat brain was examined by reverse transcriptase polymerase chain reaction (RT-PCR). CIRP expression levels were found to be similar in the hippocampus and cortex. Real-time quantitative PCR analysis revealed increasing CIRP mRNA expression in the cortex during the 24-h observation period following treatment with hypothermia or cerebral ischemia, with a greater increase in the hypothermia group. When cerebral ischemia was induced following hypothermia, CIRP mRNA expression in the cortex again showed a significant increasing tendency, but ischemia delayed the appearance of this increase. To reveal the relationship between CIRP and energy metabolism in the rat brain, lactate and pyruvate concentrations in the cortex of the rats treated with hypothermia, ischemia and ischemia after hypothermia were determined by spectrophotometric assay, and levels of phosphofructokinas-1 (PFK-1), the major regulatory enzyme of the glycolytic pathway, in the rat cortex in the three groups was also analyzed by Western blot. Using linear correlation, lactate and pyruvate concentrations, and PFK-1 levels, were each analyzed in the three groups in association with CIRP mRNA expression levels. The analysis did not reveal any correlation between the three metabolic parameters and CIRP mRNA expression induced by hypothermia, suggesting that while playing a role in neuroprotection under hypothermia, CIRP does not affect cerebral energy metabolism. Copyright 2010. Published by Elsevier B.V.

Artesunate modulates expression of matrix metalloproteinases and their inhibitors as well as collagen-IV to attenuate pulmonary fibrosis in rats.

PubMed

Wang, Y; Huang, G; Mo, B; Wang, C

2016-06-03

The aim of this study was to determine the effect of artesunate on extracellular matrix (ECM) accumulation and the expression of collagen-IV, matrix metalloproteinase (MMP), and tissue inhibitor of matrix metalloproteinase (TIMP) to understand the pharmacological role of artesunate in pulmonary fibrosis. Eighty Sprague-Dawley rats were randomly assigned to four groups that were administered saline alone, bleomycin (BLM) alone, BLM + artesunate, or artesunate alone for 28 days. Lung tissues from 10 rats in each group were used to obtain lung fibroblast (LF) primary cells, and the rest were used to analyze protein expression. The mRNA expression of collagen-IV, MMP-2, MMP-9, TIMP-1, and TIMP-2 in lung fibroblasts was detected by real-time quantitative reverse transcriptase polymerase chain reaction. The protein levels of collagen-IV, MMP-2, MMP-9, TIMP-1, and TIMP-2 protein in lung tissues were analyzed by western blotting. Artesunate treatment alleviated alveolitis and pulmonary fibrosis induced by bleomycin in rats, as indicated by a decreased lung coefficient and improvement of lung tissue morphology. Artesunate treatment also led to decreased collagen-IV protein levels, which might be a result of its downregulated expression and increased MMP-2 and MMP-9 protein and mRNA levels. Increased TIMP-1 and TIMP- 2 protein and mRNA levels were detected after artesunate treatment in lung tissues and primary lung fibroblast cells and may contribute to enhanced activity of MMP-2 and -9. These findings suggested that artesunate attenuates alveolitis and pulmonary fibrosis by regulating expression of collagen-IV, TIMP-1 and 2, as well as MMP-2 and -9, to reduce ECM accumulation.

Autophagy-related genes in Helicobacter pylori infection.

PubMed

Tanaka, Shingo; Nagashima, Hiroyuki; Uotani, Takahiro; Graham, David Y; Yamaoka, Yoshio

2017-06-01

In vitro studies have shown that Helicobacter pylori (H. pylori) infection induces autophagy in gastric epithelial cells. However, prolonged exposure to H. pylori reduces autophagy by preventing maturation of the autolysosome. The alterations of the autophagy-related genes in H. pylori infection are not yet fully understood. We analyzed autophagy-related gene expression in H. pylori-infected gastric mucosa compared with uninfected gastric mucosa obtained from 136 Bhutanese volunteers with mild dyspeptic symptoms. We also studied single nucleotide polymorphisms (SNPs) of autophagy-related gene in 283 Bhutanese participants to identify the influence on susceptibility to H. pylori infection. Microarray analysis of 226 autophagy-related genes showed that 16 genes were upregulated (7%) and nine were downregulated (4%). We used quantitative reverse transcriptase polymerase chain reaction to measure mRNA levels of the downregulated genes (ATG16L1, ATG5, ATG4D, and ATG9A) that were core molecules of autophagy. ATG16L1 and ATG5 mRNA levels in H. pylori-positive specimens (n=86) were significantly less than those in H. pylori-negative specimens (n=50). ATG16L1 mRNA levels were inversely related to H. pylori density. We also compared SNPs of ATG16L1 (rs2241880) among 206 H. pylori-positive and 77 H. pylori-negative subjects. The odds ratio for the presence of H. pylori in the GG genotype was 0.40 (95% CI: 0.18-0.91) relative to the AA/AG genotypes. Autophagy-related gene expression profiling using high-throughput microarray analysis indicated that downregulation of core autophagy machinery genes may depress autophagy functions and possibly provide a better intracellular habit for H. pylori in gastric epithelial cells. © 2017 John Wiley & Sons Ltd.

Interactions between meniscal cells and a self assembled biomimetic surface composed of hyaluronic acid, chitosan and meniscal extracellular matrix molecules.

PubMed

Tan, Guak-Kim; Dinnes, Donna L M; Butler, Lauren N; Cooper-White, Justin J

2010-08-01

Menisci are one of the most commonly injured parts of the knee with a limited healing potential. This study focuses on fabrication and characterization of biomimetic surfaces for meniscal tissue engineering. To achieve this, a combination of hyaluronic acid/chitosan (HA/CH) mutilayers with covalently immobilized major extracellular matrix (ECM) components of native meniscus, namely collagen I/II (COL.I/II) and chondroitin-6-sulfate (C6S) was employed. Adsorption of the biomolecules was monitored using a quartz crystal microbalance with dissipation (QCM-D) and fourier transform-surface plasmon resonance (FT-SPR). Immobilization of the biomolecules onto HA/CH mutilayers was achieved by sequential adsorption, with optimum binding at a molar ratio of 1.4:1 (COL.I/II: C6S). After adding COL.I/II, the layers became relatively more rigid and large aggregates were evident. The effects of the modified surfaces on cell proliferation, gene expression and proteoglycan production of rat meniscal cells were examined. Quantitative real-time reverse transcriptase polymerase chain reaction (RT-qPCR) analysis showed that primary meniscal cells dedifferentiated rapidly after one passage in monolayer culture. This process could be reversed by culturing the cells on C6S surfaces, as indicated by increases in both collagen II and aggrecan gene expression, as well as proteoglycan production. Cells with abundant lipid vacuoles were evident on all the surfaces over an extended culture period. The results demonstrate the feasibility of C6S surfaces to avoid the dedifferentiation that normally occurs during monolayer expansion of meniscal cells. Crown Copyright 2010. Published by Elsevier Ltd. All rights reserved.

Pectate lyase affects pathogenicity in natural isolates of Colletotrichum coccodes and in pelA gene-disrupted and gene-overexpressing mutant lines.

PubMed

Ben-Daniel, Bat-Hen; Bar-Zvi, Dudy; Tsror Lahkim, Leah

2012-02-01

Colletotrichum coccodes (Wallr.) S. Hughes, the causal agent of black dot on potato and anthracnose on tomato, reduces yield and crop quality. We explored the role of secreted pectate lyase (PL), a cell wall-degrading enzyme, in the aggressiveness of C. coccodes. In vitro-cultivated highly aggressive isolates secreted immunologically detectable PL levels 6 h after transfer to secondary medium versus 12 h for mildly aggressive isolates, suggesting that secreted PL is a virulence factor. The gene encoding PL, CcpelA, was cloned and used for the genetic manipulation of highly (US-41 and Si-72) and mildly (Si-60) aggressive isolates. CcpelA gene-disrupted mutants showed reduced aggressiveness towards tomato fruits and impaired PL secretion and extracellular activity. Conversely, overexpression of CcpelA in the Si-60 isolate increased its aggressiveness and PL secretion. Comparison of CcpelA cloned from isolates US-41 and Si-60 revealed that both encode identical proteins, but differ in their promoters. Bioinformatics analysis for cis-acting elements suggested that the promoters of the US-41 and Si-60 isolates contain one and no AreA-binding site (GATA box), respectively. AreA has been suggested to be involved in fungal aggressiveness; therefore, CcpelA may be a key virulence factor in C. coccodes pathogenicity, and the differences in isolate aggressiveness might result from promoter activity. Quantitative reverse transcriptase-polymerase chain reaction analyses confirmed the higher level of CcpelA transcript in isolate US-41 versus Si-60. © 2011 THE AUTHORS. MOLECULAR PLANT PATHOLOGY © 2011 BSPP AND BLACKWELL PUBLISHING LTD.

TERT promoter mutation as an early genetic event activating telomerase in follicular thyroid adenoma (FTA) and atypical FTA.

PubMed

Wang, Na; Liu, Tiantian; Sofiadis, Anastasios; Juhlin, C Christofer; Zedenius, Jan; Höög, Anders; Larsson, Catharina; Xu, Dawei

2014-10-01

The telomerase reverse transcriptase (TERT) promoter mutations C228T and C250T have been found in many malignancies, including in thyroid carcinomas. However, it is unclear how early these mutations occur in thyroid tumorigenesis. The study included primary tumors from 58 patients initially diagnosed with follicular thyroid adenoma (FTA), a benign entity, 18 with atypical FTA (AFTA) having an uncertain malignant potential, and 52 with follicular thyroid carcinoma (FTC). Sanger sequencing was used to investigate the mutational status of the TERT promoter. Telomere length and TERT messenger RNA (mRNA) expression were determined using quantitative polymerase chain reaction (PCR). Telomerase activity was assessed using a Telomerase PCR enzyme-linked immunosorbent assay kit. The C228T mutation was identified in 1 of 58 FTA (2%) and 3 of 18 AFTA (17%) samples. These 4 tumors all expressed TERT mRNA and telomerase activity, whereas the majority of C228T-negative adenomas lacked TERT expression (C228T versus wild-type, P = .008). The C228T mutation was associated with NRAS gene mutations (P = .016). The patient with C228T-mutated FTA later developed a scar recurrence and died of FTC, whereas none of the remaining 57 patients with FTA had recurrence. No recurrence occurred in 3 patients with AFTA who carried C228T during the follow-up period (36-285 months). Nine of the 52 FTCs (17%) exhibited the TERT mutation (8 of 9 C228T and 1 of 9 C250T), and the presence of the mutation was associated with shorter patient survival. TERT promoter mutations may occur as an early genetic event in thyroid follicular tumors that have not developed malignant features on routine histopathological workup. © 2014 American Cancer Society.

Resuscitation with lactated ringer's does not increase inflammatory response in a Swine model of uncontrolled hemorrhagic shock.

PubMed

Watters, Jennifer M; Brundage, Susan I; Todd, S Rob; Zautke, Nathan A; Stefater, J A; Lam, J C; Muller, Patrick J; Malinoski, Darren; Schreiber, Martin A

2004-09-01

Lactated Ringer's (LR) and normal saline (NS) are widely and interchangeably used for resuscitation of trauma victims. Studies show LR to be superior to NS in the physiologic response to resuscitation. Recent in vitro studies demonstrate equivalent effects of LR and NS on leukocytes. We aimed to determine whether LR resuscitation would produce an equivalent inflammatory response compared with normal saline (NS) resuscitation in a clinically relevant swine model of uncontrolled hemorrhagic shock. Thirty-two swine were randomized. Control animals (n = 6) were sacrificed following induction of anesthesia for baseline data. Sham animals (n = 6) underwent laparotomy and 2 h of anesthesia. Uncontrolled hemorrhagic shock animals (n = 10/group) underwent laparotomy, grade V liver injury, and blinded resuscitation with LR or NS to maintain baseline blood pressure for 1.5 h before sacrifice. Lung was harvested, and tissue mRNA levels of interleukin-6 (IL-6), granulocyte colony-stimulating factor (G-CSF), and tumor necrosis factor-alpha (TNF-alpha) were determined using quantitative reverse transcriptase polymerase chain reaction (Q-RT-PCR). Sections of lung were processed and examined for neutrophils sequestered within the alveolar walls. Cytokine analysis showed no difference in IL-6 gene transcription in any group (P = 0.99). Resuscitated swine had elevated G-CSF and TNF-alpha gene transcription, but LR and NS groups were not different from each other (P= 0.96 and 0.10, respectively). Both resuscitation groups had significantly more alveolar neutrophils present than controls (P < 0.01) and shams (P < 0.05) but were not different from one another (P= 0.83). LR and NS resuscitation have equivalent effects on indices of inflammation in the lungs in our model of uncontrolled hemorrhagic shock.

The effects of small interfering RNA–targeting tissue factor on an in vitro model of neovascularization

PubMed Central

Peng, Wenyan; Yu, Ying; Li, Tiejun; Zhu, Yuanyuan

2013-01-01

Purpose Tissue factor (TF) plays an important role in neovascularization (NV). This study aimed to determine whether small interfering RNA–targeting TF (TF-siRNA) could knock down TF expression and inhibit cell proliferation, cell migration, and tube formation in an in vitro model of NV. Methods Lipopolysaccharide (LPS) was used to stimulate human umbilical vein endothelial cell (HUVEC) lines to express TF and mimic certain phenotypes of NV in vitro. HUVECs were transfected with TF-siRNAs and control siRNAs using LipofectamineTM 2000. The inhibitory effect of the siRNAs on the expression of TF mRNA and protein was evaluated by quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) and western blot analysis. The effects on the cell viability, migration, and tube formation of siRNA-treated cells were examined by MTT assay, wound-healing assay, and Matrigel-induced capillary tube formation. Results Lipopolysaccharide treatment increased the expression of TF. TF-siRNAs effectively knocked down TF expression, with the most efficient TF-siRNA reducing 78.9% of TF expression. TF protein was also notably curtailed by TF-siRNA. The MTT and wound-healing assays showed that the TF-siRNA substantially inhibited the proliferation and migration of HUVECs. Tube formation was decreased by 47.4% and 59.4% in cells treated with the TF-siRNA and vascular endothelial growth factor–siRNA, respectively, compared with the blank control. Conclusions TF-siRNA can knockdown TF expression and inhibit cell proliferation, migration, and tube formation in vitro. TF-siRNA may provide a novel therapeutic candidate for NV-related diseases. PMID:23805036

Genes indicative of zoonotic and swine pathogens are persistent in stream water and sediment following a swine manure spill

USGS Publications Warehouse

Haack, Sheridan K.; Duris, Joseph W.; Kolpin, Dana W.; Fogarty, Lisa R.; Johnson, Heather E.; Gibson, Kristen E.; Focazio, Michael J.; Schwab, Kellogg J.; Hubbard, Laura E.; Foreman, William T.

2015-01-01

Manure spills to streams are relatively frequent, but no studies have characterized stream contamination with zoonotic and veterinary pathogens, or fecal chemicals, following a spill. We tested stream water and sediment over 25 days and downstream for 7.6 km for: fecal indicator bacteria (FIB); the fecal indicator chemicals cholesterol and coprostanol; 20 genes for zoonotic and swine-specific bacterial pathogens by presence/absence polymerase chain reaction (PCR) for viable cells; one swine-specific Escherichia coli toxin gene (STII) by quantitative PCR (qPCR); and nine human and animal viruses by qPCR, or reverse-transcriptase qPCR. Twelve days post-spill, and 4.2 km downstream, water concentrations of FIB, cholesterol, and coprostanol were 1-2 orders of magnitude greater than those detected before, or above, the spill, and genes indicating viable zoonotic or swine-infectious Escherichia coli, were detected in water or sediment. STII increased from undetectable before, or above the spill, to 105 copies/100 mL water 12 days post-spill. Thirteen of 14 water (8/9 sediment) samples had viable STII-carrying cells post-spill. Eighteen days post-spill porcine adenovirus and teschovirus were detected 5.6 km downstream. Sediment FIB concentrations (per gram wet weight) were greater than in water, and sediment was a continuous reservoir of genes and chemicals post-spill. Constituent concentrations were much lower, and detections less frequent, in a runoff event (200 days post-spill) following manure application, although the swine-associated STII and stx2e genes were detected. Manure spills are an underappreciated pathway for livestock-derived contaminants to enter streams, with persistent environmental outcomes, and the potential for human and veterinary health consequences.

Isolation of chicken homolog of the FOXL2 gene and comparison of its expression patterns with those of aromatase during ovarian development.

PubMed

Govoroun, Marina S; Pannetier, Maëlle; Pailhoux, Eric; Cocquet, Julie; Brillard, Jean-Pierre; Couty, Isabelle; Batellier, Florence; Cotinot, Corinne

2004-12-01

Mutations in the forkhead transcription factor gene FOXL2 are involved in ovarian failure, which occurs in human BPES syndrome. This syndrome presents a sexually dimorphic expression, specific to the ovary in several vertebrates. We cloned the open reading frame of chicken FOXL2 (cFoxL2) and studied cFoxL2 expression in developing gonads and during adulthood to examine the role of FOXL2 in ovarian differentiation and function in birds. The spatial and temporal dynamics of cFoxL2 and aromatase expression were analyzed in parallel by using real-time quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry in attempt to investigate the possible role of cFoxL2 in the regulation of aromatase. The expression patterns of cFoxL2 and aromatase transcripts were highly correlated during the sex-differentiation period (4.7-12.7 days of incubation). Aromatase and cFoxL2 proteins were colocalized in the medullar part of female gonads on embryonic day 14. Fourteen days after hatching, cFoxL2 protein was mainly detected in granulosa cells of developing follicles. In adult ovary follicular envelopes, apart from granulosa cells, cFoxL2 transcript and protein were detected at lower levels in theca cells where aromatase was present. A high level of cFoxL2 transcription was also observed in maturing and ovulated oocytes. Our results confirm that FoxL2 is an early regulator of ovarian development in birds and may be involved in aromatase transcription regulation. Copyright (c) 2004 Wiley-Liss, Inc.

Two microRNA panels to discriminate three subtypes of lung carcinoma in bronchial brushing specimens.

PubMed

Huang, Wei; Hu, Jie; Yang, Da-wei; Fan, Xin-ting; Jin, Yi; Hou, Ying-yong; Wang, Ji-ping; Yuan, Yun-feng; Tan, Yun-shan; Zhu, Xiong-Zeng; Bai, Chun-xue; Wu, Ying; Zhu, Hong-guang; Lu, Shao-hua

2012-12-01

Effective treatment for lung cancer requires accuracy in subclassification of carcinoma subtypes. To identify microRNAs in bronchial brushing specimens for discriminating small cell lung cancer (SCLC) from non-small cell lung cancer (NSCLC) and for further differentiating squamous cell carcinoma (SQ) from adenocarcinoma (AC). Microarrays were used to screen 723 microRNAs in laser-captured, microdissected cancer cells from 82 snap-frozen surgical lung specimens. Quantitative reverse-transcriptase polymerase chain reaction was performed on 153 macrodissected formalin-fixed, paraffin-embedded (FFPE) surgical lung specimens to evaluate seven microRNA candidates discovered from microarrays. Two microRNA panels were constructed on the basis of a training cohort (n = 85) and validated using an independent cohort (n = 68). The microRNA panels were applied as differentiators of SCLC from NSCLC and of SQ from AC in 207 bronchial brushing specimens. Two microRNA panels yielded high diagnostic accuracy in discriminating SCLC from NSCLC (miR-29a and miR-375; area under the curve [AUC], 0.991 and 0.982 for training and validation data set, respectively) and in differentiating SQ from AC (miR-205 and miR-34a; AUC, 0.977 and 0.982 for training and validation data set, respectively) in FFPE surgical lung specimens. Moreover, the microRNA panels accurately differentiated SCLC from NSCLC (AUC, 0.947) and SQ from AC (AUC, 0.962) in bronchial brushing specimens. We found two microRNA panels that accurately discriminated between the three subtypes of lung carcinoma in bronchial brushing specimens. The identified microRNA panels may have considerable clinical value in differential diagnosis and optimizing treatment strategies based on lung cancer subtypes.

Evaluation of Anti-Metastatic Potential of the Combination of Fisetin with Paclitaxel on A549 Non-Small Cell Lung Cancer Cells.

PubMed

Klimaszewska-Wiśniewska, Anna; Hałas-Wiśniewska, Marta; Grzanka, Alina; Grzanka, Dariusz

2018-02-27

The identification and development of new agents with a therapeutic potential as well as novel drug combinations are gaining the attention of scientists and clinicians as a plausible approach to improve therapeutic regimens for chemoresistant tumors. We have recently reported that the flavonoid fisetin (FIS), at physiologically attainable concentrations, acts synergistically with clinically achievable doses of paclitaxel (PTX) to produce growth inhibitory and pro-death effects on A549 human non-small cell lung cancer (NSCLC) cells. To further investigate a potential therapeutic efficacy of the combination of fisetin with paclitaxel, we decided to assess its impact on metastatic capability of A549 cells as well as its toxicity toward normal human lung fibroblast. Cell viability, cell migration, and invasion were measured by thiazolyl blue tetrazolium bromide (MTT) assay, wound healing assay, and Transwell chamber assay, respectively. The expression of metastasis-related genes was assessed with quantitative reverse transcriptase real-time polymerase chain reaction (qRT-PCR). Actin and vimentin filaments were examined under the fluorescence microscope. The combination of FIS and PTX significantly reduced cancer cell migration and invasion, at least partially, through a marked rearrangement of actin and vimentin cytoskeleton and the modulation of metastasis-related genes. Most of these effects of the combination treatment were significantly greater than those of individual agents. Paclitaxel alone was even more toxic to normal cells than the combination of this drug with the flavonoid, suggesting that FIS may provide some protection against PTX-mediated cytotoxicity. The combination of FIS and PTX is expected to have a synergistic anticancer efficacy and a significant potential for the treatment of NSCLC, however, further in vitro and in vivo studies are required to confirm this preliminary evidence.

Shear stress upregulates regeneration-related immediate early genes in liver progenitors in 3D ECM-like microenvironments.

PubMed

Nishii, Kenichiro; Brodin, Erik; Renshaw, Taylor; Weesner, Rachael; Moran, Emma; Soker, Shay; Sparks, Jessica L

2018-05-01

The role of fluid stresses in activating the hepatic stem/progenitor cell regenerative response is not well understood. This study hypothesized that immediate early genes (IEGs) with known links to liver regeneration will be upregulated in liver progenitor cells (LPCs) exposed to in vitro shear stresses on the order of those produced from elevated interstitial flow after partial hepatectomy. The objectives were: (1) to develop a shear flow chamber for application of fluid stress to LPCs in 3D culture; and (2) to determine the effects of fluid stress on IEG expression in LPCs. Two hours of shear stress exposure at ∼4 dyn/cm 2 was applied to LPCs embedded individually or as 3D spheroids within a hyaluronic acid/collagen I hydrogel. Results were compared against static controls. Quantitative reverse transcriptase polymerase chain reaction was used to evaluate the effect of experimental treatments on gene expression. Twenty-nine genes were analyzed, including IEGs and other genes linked to liver regeneration. Four IEGs (CFOS, IP10, MKP1, ALB) and three other regeneration-related genes (WNT, VEGF, EpCAM) were significantly upregulated in LPCs in response to fluid mechanical stress. LPCs maintained an early to intermediate stage of differentiation in spheroid culture in the absence of the hydrogel, and addition of the gel initiated cholangiocyte differentiation programs which were abrogated by the onset of flow. Collectively the flow-upregulated genes fit the pattern of an LPC-mediated proliferative/regenerative response. These results suggest that fluid stresses are potentially important regulators of the LPC-mediated regeneration response in liver. © 2017 Wiley Periodicals, Inc.

A mammalian melanopsin in the retina of a fresh water turtle, the red-eared slider (Trachemys scripta elegans).

PubMed

Dearworth, James R; Selvarajah, Brian P; Kalman, Ross A; Lanzone, Andrew J; Goch, Abraham M; Boyd, Alison B; Goldberg, Laura A; Cooper, Lori J

2011-01-28

A mammalian-like melanopsin (Opn4m) has been found in all major vertebrate classes except reptile. Since the pupillary light reflex (PLR) of the fresh water turtle takes between 5 and 10 min to achieve maximum constriction, and since photosensitive retinal ganglion cells (ipRGCs) in mammals use Opn4m to control their slow sustained pupil responses, we hypothesized that a Opn4m homolog exists in the retina of the turtle. To identify its presence, retinal tissue was dissected from seven turtles, and total RNA extracted. Reverse transcriptase-polymerase chain reactions (RT-PCRs) were carried out to amplify gene sequences using primers targeting the highly conserved core region of Opn4m, and PCR products were analyzed by gel electrophoresis and sequenced. Sequences derived from a 1004-bp PCR product were compared to those stored in GenBank by the basic local alignment search tool (BLAST) algorithm and returned significant matches to several Opn4ms from other vertebrates including chicken. Quantitative real-time PCR (qPCR) was also carried out to compare expression levels of Opn4m in different tissues. The normalized expression level of Opn4m in the retina was higher in comparison to other tissue types: iris, liver, lung, and skeletal muscle. The results suggest that Opn4m exists in the retina of the turtle and provides a possible explanation for the presence of a slow PLR. The turtle is likely to be a useful model for further understanding the photoreceptive mechanisms in the retina which control the dynamics of the PLR. Copyright © 2010 Elsevier Ltd. All rights reserved.

Diabetes Mellitus in Pregnancy Leads to Growth Restriction and Epigenetic Modification of the Srebf2 Gene in Rat Fetuses.

PubMed

Golic, Michaela; Stojanovska, Violeta; Bendix, Ivo; Wehner, Anika; Herse, Florian; Haase, Nadine; Kräker, Kristin; Fischer, Caroline; Alenina, Natalia; Bader, Michael; Schütte, Till; Schuchardt, Mirjam; van der Giet, Markus; Henrich, Wolfgang; Muller, Dominik N; Felderhoff-Müser, Ursula; Scherjon, Sicco; Plösch, Torsten; Dechend, Ralf

2018-05-01

Diabetic pregnancy is correlated with increased risk of metabolic and neurological disorders in the offspring putatively mediated epigenetically. Little is known about epigenetic changes already present in fetuses of diabetic pregnancies. We aimed at characterizing the perinatal environment after preexisting maternal diabetes mellitus and at identifying relevant epigenetic changes in the fetus. We focused on the transcription factor Srebf2 (sterol regulatory element binding transcription factor 2), a master gene in regulation of cholesterol metabolism. We tested whether diabetic pregnancy induces epigenetic changes in the Srebf2 promoter and if they become manifest in altered Srebf2 gene expression. We worked with a transgenic rat model of type 2 diabetes mellitus (Tet29) in which the insulin receptor is knocked down by doxycycline-induced RNA interference. Doxycycline was administered preconceptionally to Tet29 and wild-type control rats. Only Tet29 doxycycline dams were hyperglycemic, hyperinsulinemic, and hyperlipidemic. Gene expression was analyzed with quantitative real-time reverse transcriptase polymerase chain reaction and CpG promoter methylation with pyrosequencing. Immunohistochemistry was performed on fetal brains. Fetuses from diabetic Tet29 dams were hyperglycemic and growth restricted at the end of pregnancy. They further displayed decreased liver and brain weight with concomitant decreased microglial activation in the hippocampus in comparison to fetuses of normoglycemic mothers. Importantly, diabetic pregnancy induced CpG hypermethylation of the Srebf2 promoter in the fetal liver and brain, which was associated with decreased Srebf2 gene expression. In conclusion, diabetic and hyperlipidemic pregnancy induces neurological, metabolic, and epigenetic alterations in the rat fetus. Srebf2 is a potential candidate mediating intrauterine environment-driven epigenetic changes and later diabetic offspring health. © 2018 American Heart Association, Inc.

Identification of Appropriate Reference Genes for Normalization of miRNA Expression in Grafted Watermelon Plants under Different Nutrient Stresses

PubMed Central

Wu, Weifang; Deng, Qin; Shi, Pibiao; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

2016-01-01

Watermelon (Citrullus lanatus) is a globally important crop belonging to the family Cucurbitaceae. The grafting technique is commonly used to improve its tolerance to stress, as well as to enhance its nutrient uptake and utilization. It is believed that miRNA is most likely involved in its nutrient-starvation response as a graft-transportable signal. The quantitative real-time reverse transcriptase polymerase chain reaction is the preferred method for miRNA functional analysis, in which reliable reference genes for normalization are crucial to ensure the accuracy. The purpose of this study was to select appropriate reference genes in scion (watermelon) and rootstocks (squash and bottle gourd) of grafted watermelon plants under normal growth conditions and nutrient stresses (nitrogen and phosphorus starvation). Under nutrient starvation, geNorm identified miR167c and miR167f as two most stable genes in both watermelon leaves and squash roots. miR166b was recommended by both geNorm and NormFinder as the best reference in bottle gourd roots under nutrient limitation. Expression of a new Cucurbitaceae miRNA, miR85, was used to validate the reliability of candidate reference genes under nutrient starvation. Moreover, by comparing several target genes expression in qRT-PCR analysis with those in RNA-seq data, miR166b and miR167c were proved to be the most suitable reference genes to normalize miRNA expression under normal growth condition in scion and rootstock tissues, respectively. This study represents the first comprehensive survey of the stability of miRNA reference genes in Cucurbitaceae and provides valuable information for investigating more accurate miRNA expression involving grafted watermelon plants. PMID:27749935

Identification of Appropriate Reference Genes for Normalization of miRNA Expression in Grafted Watermelon Plants under Different Nutrient Stresses.

PubMed

Wu, Weifang; Deng, Qin; Shi, Pibiao; Yang, Jinghua; Hu, Zhongyuan; Zhang, Mingfang

2016-01-01

Watermelon (Citrullus lanatus) is a globally important crop belonging to the family Cucurbitaceae. The grafting technique is commonly used to improve its tolerance to stress, as well as to enhance its nutrient uptake and utilization. It is believed that miRNA is most likely involved in its nutrient-starvation response as a graft-transportable signal. The quantitative real-time reverse transcriptase polymerase chain reaction is the preferred method for miRNA functional analysis, in which reliable reference genes for normalization are crucial to ensure the accuracy. The purpose of this study was to select appropriate reference genes in scion (watermelon) and rootstocks (squash and bottle gourd) of grafted watermelon plants under normal growth conditions and nutrient stresses (nitrogen and phosphorus starvation). Under nutrient starvation, geNorm identified miR167c and miR167f as two most stable genes in both watermelon leaves and squash roots. miR166b was recommended by both geNorm and NormFinder as the best reference in bottle gourd roots under nutrient limitation. Expression of a new Cucurbitaceae miRNA, miR85, was used to validate the reliability of candidate reference genes under nutrient starvation. Moreover, by comparing several target genes expression in qRT-PCR analysis with those in RNA-seq data, miR166b and miR167c were proved to be the most suitable reference genes to normalize miRNA expression under normal growth condition in scion and rootstock tissues, respectively. This study represents the first comprehensive survey of the stability of miRNA reference genes in Cucurbitaceae and provides valuable information for investigating more accurate miRNA expression involving grafted watermelon plants.

Induction of human macrophage vascular endothelial growth factor and intercellular adhesion molecule-1 by Ureaplasma urealyticum and downregulation by steroids.

PubMed

Li, Ying-Hua; Brauner, Annelie; Jensen, Jørgen Skov; Tullus, Kjell

2002-01-01

Chronic lung disease (CLD) remains a major cause of morbidity for the prematurely born infant. The pathogenesis of CLD is complex and has not been defined entirely. Infection and lung inflammatory events have been thought to play a key role in the development of CLD. However, the contribution of Ureaplasma urealyticum to the development of CLD is debated and steroids produce some improvement in neonates with this disease. The aim of this study was to investigate if U. urealyticum could stimulate macrophages to produce vascular endothelial growth factor (VEGF) and intercellular adhesion molecule-1 (ICAM-1) in vitro, which are potentially associated with both early and later pathological changes in the lung during the development of CLD. In addition, the impact of dexamethasone and budesonide on these processes was examined. We found that U. urealyticum antigen (>/=4 x 10(7) color-changing units/ml) stimulated human macrophages (phorbol 12-myristate 13-acetate-differentiated THP-1 cell line) to produce VEGF and soluble ICAM-1 in a dose-dependent manner (p < 0.05) measured by ELISA. Likewise, cell surface ICAM-1 (CD54) measured by flow cytometry was increased after stimulation with U. urealyticum. This effect was attenuated by budesonide and dexamethasone (p < 0.05). The mRNA expressions of VEGF and ICAM-1 detected by a semi-quantitative reverse transcriptase polymerase chain reaction were also induced in response to U. urealyticum and inhibited by the steroids (p < 0.05). The expression of ICAM-1 was reduced by 85.5% when the TNF-alpha production was neutralized with an anti-TNF-alpha antibody. Our findings imply that U. urealyticum might be involved in the development of CLD of prematurity. Copyright 2002 S. Karger AG, Basel

Molecular cloning of heat shock protein 60 (PtHSP60) from Portunus trituberculatus and its expression response to salinity stress.

PubMed

Xu, Qianghua; Qin, Ye

2012-09-01

Heat shock protein 60 (HSP60) is a highly conserved and multi-functional molecular chaperone that plays an essential role in both cellular metabolism and stress response. Portunus trituberculatus is an important marine fishery and aquaculture species, and water salinity condition influenced its artificial propagations significantly. In order to investigate the function of P. trituberculatus HSP60 against osmotic stress, P. trituberculatus HSP60 gene was firstly cloned. The full-length cDNA of PtHSP60 contains 1,743 nucleotides encoding 577 amino acids with a calculated molecular weight of 61.25 kDa. Multiple alignments indicated that the deduced amino acid sequences of PtHSP60 shared a high level of identity with invertebrate and vertebrate HSP60 sequence including shrimp, fruit fly, zebrafish, and human. The expression profiles of PtHSP60 at mRNA and protein levels under salinity treatment were investigated by semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blot analysis, respectively. It was found that the mRNA transcripts of PtHSP60 gene varied among different tissues under normal salinity conditions, and the antennal gland showed the highest expression level among the tissues tested. As for low salinity challenge, the mRNA expression of PtHSP60 gene was higher in the gill and appendicular muscle compared with other tissues, and gill and hypodermis represented the higher gene expressions during the hyperosmotic stress, which indicated that those tissues were salinity-sensitive tissues. In addition, salinity challenges significantly altered the expression of PtHSP60 at mRNA and protein level in a salinity- and time-dependent manner in P. trituberculatus gill tissue. The results indicate that PtHSP60 played important roles in mediating the salinity stress in P. trituberculatus.

Improved Detection of Norovirus and Hepatitis A Virus in Surface Water by Applying Pre-PCR Processing.

PubMed

Borgmästars, Emmy; Jazi, Mehrdad Mousavi; Persson, Sofia; Jansson, Linda; Rådström, Peter; Simonsson, Magnus; Hedman, Johannes; Eriksson, Ronnie

2017-12-01

Quantitative reverse transcriptase polymerase chain reaction (RT-qPCR) detection of waterborne RNA viruses generally requires concentration of large water volumes due to low virus levels. A common approach is to use dead-end ultrafiltration followed by precipitation with polyethylene glycol. However, this procedure often leads to the co-concentration of PCR inhibitors that impairs the limit of detection and causes false-negative results. Here, we applied the concept of pre-PCR processing to optimize RT-qPCR detection of norovirus genogroup I (GI), genogroup II (GII), and hepatitis A virus (HAV) in challenging water matrices. The RT-qPCR assay was improved by screening for an inhibitor-tolerant master mix and modifying the primers with twisted intercalating nucleic acid molecules. Additionally, a modified protocol based on chaotropic lysis buffer and magnetic silica bead nucleic acid extraction was developed for complex water matrices. A validation of the modified extraction protocol on surface and drinking waters was performed. At least a 26-fold improvement was seen in the most complex surface water studied. The modified protocol resulted in average recoveries of 33, 13, 8, and 4% for mengovirus, norovirus GI, GII, and HAV, respectively. The modified protocol also improved the limit of detection for norovirus GI and HAV. RT-qPCR inhibition with C q shifts of 1.6, 2.8, and 3.5 for norovirus GI, GII, and HAV, respectively, obtained for the standard nucleic acid extraction were completely eliminated by the modified protocol. The standard nucleic acid extraction method worked well on drinking water with no RT-qPCR inhibition observed and average recoveries of 80, 124, 89, and 32% for mengovirus, norovirus GI, GII, and HAV, respectively.

Arachidonic acid-and docosahexaenoic acid-enriched formulas modulate antigen-specific T cell responses to influenza virus in neonatal piglets.

PubMed

Bassaganya-Riera, Josep; Guri, Amir J; Noble, Alexis M; Reynolds, Kathryn A; King, Jennifer; Wood, Cynthia M; Ashby, Michael; Rai, Deshanie; Hontecillas, Raquel

2007-03-01

Whereas the immunomodulatory effects of feeding either arachidonic acid (AA) or docosahexaenoic acid (DHA) separately have been previously investigated, little is known about the immunomodulatory efficacy of AA or DHA when they are fed in combination as infant formula ingredients. The objective of this study was to investigate the ability of AA- and DHA(AA/DHA)-enriched infant formula to modulate immune responses in the neonate in response to an inactivated influenza virus vaccine. Neonatal piglets (n = 48) were weaned on day 2 of age and distributed into 16 blocks of 3 littermate piglets each. Within each block, piglets were randomly assigned to a control formula, AA/DHA-enriched formula (0.63% AA and 0.34% DHA), or sow milk for 30 d. On day 9, 8 blocks of piglets were immunized with an inactivated influenza virus vaccine. On days 0, 9, 16, 23, and 30 after weaning, we measured influenza virus-specific T cell proliferation and phenotype of T subsets in peripheral blood. A delayed-type hypersensitivity reaction test was administered on day 28. Cytokine messenger RNA expression was determined by quantitative real time reverse transcriptase-polymerase chain reaction on day 30. The influenza virus-specific CD4(+) and CD8(+) T cell ex vivo lymphoproliferative responses were significantly lower on day 23 after immunization in piglets receiving dietary AA/DHA supplementation and sow milk than in those receiving the unsupplemented control formula. The immunomodulatory effects of AA/DHA-enriched formulas were consistent with up-regulation of interleukin 10 in peripheral blood mononuclear cells. Overall, it appears that the AA/DHA-enriched formula modulated antigen-specific T cell responses in part through an interleukin 10-dependent mechanism.

Assessing similarity to primary tissue and cortical layer identity in induced pluripotent stem cell-derived cortical neurons through single-cell transcriptomics

PubMed Central

Handel, Adam E.; Chintawar, Satyan; Lalic, Tatjana; Whiteley, Emma; Vowles, Jane; Giustacchini, Alice; Argoud, Karene; Sopp, Paul; Nakanishi, Mahito; Bowden, Rory; Cowley, Sally; Newey, Sarah; Akerman, Colin; Ponting, Chris P.; Cader, M. Zameel

2016-01-01

Induced pluripotent stem cell (iPSC)-derived cortical neurons potentially present a powerful new model to understand corticogenesis and neurological disease. Previous work has established that differentiation protocols can produce cortical neurons, but little has been done to characterize these at cellular resolution. In particular, it is unclear to what extent in vitro two-dimensional, relatively disordered culture conditions recapitulate the development of in vivo cortical layer identity. Single-cell multiplex reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) was used to interrogate the expression of genes previously implicated in cortical layer or phenotypic identity in individual cells. Totally, 93.6% of single cells derived from iPSCs expressed genes indicative of neuronal identity. High proportions of single neurons derived from iPSCs expressed glutamatergic receptors and synaptic genes. And, 68.4% of iPSC-derived neurons expressing at least one layer marker could be assigned to a laminar identity using canonical cortical layer marker genes. We compared single-cell RNA-seq of our iPSC-derived neurons to available single-cell RNA-seq data from human fetal and adult brain and found that iPSC-derived cortical neurons closely resembled primary fetal brain cells. Unexpectedly, a subpopulation of iPSC-derived neurons co-expressed canonical fetal deep and upper cortical layer markers. However, this appeared to be concordant with data from primary cells. Our results therefore provide reassurance that iPSC-derived cortical neurons are highly similar to primary cortical neurons at the level of single cells but suggest that current layer markers, although effective, may not be able to disambiguate cortical layer identity in all cells. PMID:26740550

mRNA expression levels of hypoxia-induced and stem cell-associated genes in human glioblastoma.

PubMed

Bache, Matthias; Rot, Swetlana; Keßler, Jacqueline; Güttler, Antje; Wichmann, Henri; Greither, Thomas; Wach, Sven; Taubert, Helge; Söling, Ariane; Bilkenroth, Udo; Kappler, Matthias; Vordermark, Dirk

2015-06-01

The roles of hypoxia-induced and stem cell-associated genes in the development of malignancy and tumour progression are well known. However, there are a limited number of studies analysing the impact of mRNA expression levels of hypoxia-induced and stem cell-associated genes in the tissues of brain tumours and glioblastoma patients. In this study, tumour tissues from patients with glioblastoma multiforme and tumour adjacent tissues were analysed. We investigated mRNA expression levels of hypoxia-inducible factor-1α (HIF-1α), hypoxia-inducible factor-2α (HIF-2α), carbonic anhydrase 9 (CA9), vascular endothelial growth factor (VEGF), glucose transporter-1 (GLUT-1) and osteopontin (OPN), and stem cell-associated genes survivin, epidermal growth factor receptor (EGFR), human telomerase reverse transcriptase (hTERT), Nanog and octamer binding transcription factor 4 (OCT4) using quantitative real-time polymerase chain reaction (qRT-PCR). Our data revealed higher mRNA expression levels of hypoxia-induced and stem cell-associated genes in tumour tissue than levels in the tumour adjacent tissues in patients with glioblastoma multiforme. A strong positive correlation between the mRNA expression levels of HIF-2α, CA9, VEGF, GLUT-1 and OPN suggests a specific hypoxia-associated profile of mRNA expression in glioblastoma multiforme. Additionally, the results indicate the role of stem-cell-related genes in tumour hypoxia. Kaplan-Maier analysis revealed that high mRNA expression levels of hypoxia-induced markers showed a trend towards shorter overall survival in glioblastoma patients (P=0.061). Our data suggest that mRNA expression levels of hypoxia-induced genes are important tumour markers in patients with glioblastoma multiforme.

Mutations in TUBB8 and Human Oocyte Meiotic Arrest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feng, Ruizhi; Sang, Qing; Kuang, Yanping

BACKGROUND: We present that human reproduction depends on the fusion of a mature oocyte with a sperm cell to form a fertilized egg. The genetic events that lead to the arrest of human oocyte maturation are unknown. METHODS: We sequenced the exomes of five members of a four-generation family, three of whom had infertility due to oocyte meiosis I arrest. We performed Sanger sequencing of a candidate gene, TUBB8, in DNA samples from these members, additional family members, and members of 23 other affected families. The expression of TUBB8 and all other β-tubulin isotypes was assessed in human oocytes, earlymore » embryos, sperm cells, and several somatic tissues by means of a quantitative reverse- transcriptase-polymerase-chain-reaction assay. We evaluated the effect of the TUBB8 mutations on the assembly of the heterodimer consisting of one α-tubulin polypeptide and one β-tubulin polypeptide (α/β-tubulin heterodimer) in vitro, on microtubule architecture in HeLa cells, on microtubule dynamics in yeast cells, and on spindle assembly in mouse and human oocytes. RESULTSL: We identified seven mutations in the primate-specific gene TUBB8 that were responsible for oocyte meiosis I arrest in 7 of the 24 families. TUBB8 expression is unique to oocytes and the early embryo, in which this gene accounts for almost all the expressed β-tubulin. The mutations affect chaperone-dependent folding and assembly of the α/β-tubulin heterodimer, disrupt microtubule behavior on expression in cultured cells, alter microtubule dynamics in vivo, and cause catastrophic spindle-assembly defects and maturation arrest on expression in mouse and human oocytes. CONCLUSIONS: Lastly, TUBB8 mutations have dominant-negative effects that disrupt microtubule behavior and oocyte meiotic spindle assembly and maturation, causing female infertility.« less

Perfluorooctanoic acid induces gene promoter hypermethylation of glutathione-S-transferase Pi in human liver L02 cells.

PubMed

Tian, Meiping; Peng, Siyuan; Martin, Francis L; Zhang, Jie; Liu, Liangpo; Wang, Zhanlin; Dong, Sijun; Shen, Heqing

2012-06-14

Perfluorooctanoic acid (PFOA) is one of the most commonly used perfluorinated compounds. Being a persistent environmental pollutant, it can accumulate in human tissues via various exposure routes. PFOA may interfere in a toxic fashion on the immune system, liver, development, and endocrine systems. In utero human exposure had been associated with cord serum global DNA hypomethylation. In light of this, we investigated possible PFOA-induced DNA methylation alterations in L02 cells in order to shed light into its epigenetic-mediated mechanisms of toxicity in human liver. L02 cells were exposed to 5, 10, 25, 50 or 100 mg/L PFOA for 72h. Global DNA methylation levels were determined by LC/ESI-MS, glutathione-S-transferase Pi (GSTP) gene promoter DNA methylation was investigated by methylation-specific polymerase chain reaction (PCR) with bisulfite sequencing, and consequent mRNA expression levels were measured with quantitative real-time reverse transcriptase PCR. A dose-related increase of GSTP promoter methylation at the transcription factor specificity protein 1 (SP1) binding site was observed. However, PFOA did not significantly influence global DNA methylation; nor did it markedly alter the promoter gene methylation of p16 (cyclin-dependent kinase inhibitor 2A), ERα (estrogen receptor α) or PRB (progesterone receptor B). In addition, PFOA significantly elevated mRNA transcript levels of DNMT3A (which mediates de novo DNA methylation), Acox (lipid metabolism) and p16 (cell apoptosis). Considering the role of GSTP in detoxification, aberrant methylation may be pivotal in PFOA-mediated toxicity response via the inhibition of SP1 binding to GSTP promoter. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Study on predictive role of AR and EGFR family genes with response to neoadjuvant chemotherapy in locally advanced breast cancer in Indian women.

PubMed

Singh, L C; Chakraborty, Anurupa; Mishra, Ashwani K; Devi, Thoudam Regina; Sugandhi, Nidhi; Chintamani, Chintamani; Bhatnagar, Dinesh; Kapur, Sujala; Saxena, Sunita

2012-06-01

Locally advanced breast cancer (LABC) remains a clinical challenge as the majority of patients with this diagnosis develop distant metastases despite appropriate therapy. We analyzed expression of steroid and growth hormone receptor genes as well as gene associated with metabolism of chemotherapeutic drugs in locally advanced breast cancer before and after neoadjuvant chemotherapy (NACT) to study whether there is a change in gene expression induced by chemotherapy and whether such changes are associated with tumor response or non-response. Fifty patients were included with locally advanced breast cancer treated with cyclophosphamide, adriamycin, 5-fluorouracil (CAF)-based neoadjuvant chemotherapy before surgery. Total RNA was extracted from 50 match samples of pre- and post-NACT tumor tissues. RNA expression levels of epidermal growth factor receptor family genes including EGFR, ERBB2, ERBB3, androgen receptor (AR), and multidrug-resistance gene 1 (MDR1) were determined by quantitative real-time reverse transcriptase-polymerase chain reaction. Responders show significantly high levels of pre-NACT AR gene expression (P = 0.016), which reduces following NACT (P = 0.008), and hence can serve as a useful tool for the prediction of the success of neoadjuvant chemotherapy in individual cancer patients with locally advanced breast carcinoma. Moreover, a significant post-therapeutic increase in the expression levels of EGFR and MDR1 gene in responders (P = 0.026 and P < 0.001) as well as in non-responders (P = 0.055, P = 0.001) suggests that expression of these genes changes during therapy but they do not have any impact on tumor response, whereas a post-therapeutic reduction was observed in AR in responders. This indicates an independent predictive role of AR with response to NACT.

Increased expression of native cytosolic Cu/Zn superoxide dismutase and ascorbate peroxidase improves tolerance to oxidative and chilling stresses in cassava (Manihot esculenta Crantz)

PubMed Central

2014-01-01

Background Cassava (Manihot esculenta Crantz) is a tropical root crop, and is therefore, extremely sensitive to low temperature; its antioxidative response is pivotal for its survival under stress. Timely turnover of reactive oxygen species (ROS) in plant cells generated by chilling-induced oxidative damages, and scavenging can be achieved by non-enzymatic and enzymatic reactions in order to maintain ROS homeostasis. Results Transgenic cassava plants that co-express cytosolic superoxide dismutase (SOD), MeCu/ZnSOD, and ascorbate peroxidase (APX), MeAPX2, were produced and tested for tolerance against oxidative and chilling stresses. The up-regulation of MeCu/ZnSOD and MeAPX2 expression was confirmed by the quantitative reverse transcriptase-polymerase chain reaction, and enzymatic activity analyses in the leaves of transgenic cassava plant lines with a single-transgene integration site. Upon exposure to ROS-generating agents, 100 μM ROS-generating reagent methyl viologen and 0.5 M H2O2, higher levels of enzymatic activities of SOD and APX were detected in transgenic plants than the wild type. Consequently, the oxidative stress parameters, such as lipid peroxidation, chlorophyll degradation and H2O2 synthesis, were lower in the transgenic lines than the wild type. Tolerance to chilling stress at 4°C for 2 d was greater in transgenic cassava, as observed by the higher levels of SOD, catalase, and ascorbate-glutathione cycle enzymes (e.g., APX, monodehydroascorbate reductase, dehydroascorbate reducatase and glutathione reductase) and lower levels of malondialdehyde content. Conclusions These results suggest that the expression of native cytosolic SOD and APX simultaneously activated the antioxidative defense mechanisms via cyclic ROS scavenging, thereby improving its tolerance to cold stress. PMID:25091029

Transcriptional activity of TGFβ1 and its receptors genes in thyroid gland.

PubMed

Kajdaniuk, Dariusz; Marek, Anna; Marek, Bogdan; Mazurek, Urszula; Fila-Daniłow, Anna; Foltyn, Wanda; Morawiec-Szymonik, Elżbieta; Siemińśka, Lucyna; Nowak, Mariusz; Głogowska-Szeląg, Joanna; Niedziołka-Zielonka, Danuta; Seemann, Michał; Kos-Kudła, Beata

2016-01-01

Determination of gene-candidates' profile expression responsible for fibrosis, immunosuppression, angiogenesis, and neoplasia processes in the pathogenesis of thyroid gland disease. Sixty-three patients underwent thyroidectomy: 27 with non-toxic nodular goitre (NG), 22 with toxic nodular goitre (TNG), six with papillary cancer (PTC), and eight with Graves' disease (GD). In thyroid tissues, transcriptional activity of TGFbeta1 and its receptors TGFbetaRI, TGFbetaRII, and TGFbetaRIII genes were assessed using RT-qPCR (Reverse Transcriptase Quantitative Polymerase Chain Reaction). Molecular analysis was performed in tissues derived from GD and from the tumour centre (PTC, NG, TNG) and from peripheral parts of the removed lobe without histopathological lesions (tissue control). Control tissue for analysis performed in GD was an unchanged tissue derived from peripheral parts of the removed lobe of patients surgically treated for a single benign tumour. Strict regulation observed among transcriptional activity of TGFb1 and their receptor TGFbetaRI-III genes in control tissues is disturbed in all pathological tissues - it is completely disturbed in PTC and GD, and partially in NG and TNG. Additionally, higher transcriptional activity of TGFb1 gene in PTC in comparison with benign tissues (NG, GD) and lower expression of mRNA TGFbRII (than in TNG, GD) and mRNA TGFbetaRIII than in all studied benign tissues (NG, TNG, GD) suggests a pathogenetic importance of this cytokine and its receptors in PTC development. In GD tissue, higher transcriptional activity of TGFbetaRII and TGFbetaRIII genes as compared to other pathological tissues was observed, indicating a participation of the receptors in the pathomechanism of autoimmune thyroid disease (AITD). TGFbeta1 blood concentrations do not reflect pathological processes taking place in thyroid gland. (Endokrynol Pol 2016; 67 (4): 375-382).

Dietary catechins and procyanidins modulate zinc homeostasis in human HepG2 cells.

PubMed

Quesada, Isabel M; Bustos, Mario; Blay, Mayte; Pujadas, Gerard; Ardèvol, Anna; Salvadó, M Josepa; Bladé, Cinta; Arola, Lluís; Fernández-Larrea, Juan

2011-02-01

Catechins and their polymers procyanidins are health-promoting flavonoids found in edible vegetables and fruits. They act as antioxidants by scavenging reactive oxygen species and by chelating the redox-active metals iron and copper. They also behave as signaling molecules, modulating multiple cell signalling pathways and gene expression, including that of antioxidant enzymes. This study aimed at determining whether catechins and procyanidins interact with the redox-inactive metal zinc and at assessing their effect on cellular zinc homeostasis. We found that a grape-seed procyanidin extract (GSPE) and the green tea flavonoid (-)-epigallocatechin-3-gallate (EGCG) bind zinc cations in solution with higher affinity than the zinc-specific chelator Zinquin, and dose-dependently prevent zinc-induced toxicity in the human hepatocarcinoma cell line HepG2, evaluated by the lactate dehydrogenase test. GSPE and EGCG hinder intracellular accumulation of total zinc, measured by atomic flame absorption spectrometry, concomitantly increasing the level of cytoplasmic labile zinc detectable by Zinquin fluorescence. Concurrently, GSPE and EGCG inhibit the expression, evaluated at the mRNA level by quantitative reverse transcriptase-polymerase chain reaction, of zinc-binding metallothioneins and of plasma membrane zinc exporter ZnT1 (SLC30A1), while enhancing the expression of cellular zinc importers ZIP1 (SLC39A1) and ZIP4 (SLC39A4). GSPE and EGCG also produce all these effects when HepG2 cells are stimulated to import zinc by treatment with supplemental zinc or the proinflammatory cytokine interleukin-6. We suggest that extracellular complexation of zinc cations and the elevation of cytoplasmic labile zinc may be relevant mechanisms underlying the modulation of diverse cell signaling and metabolic pathways by catechins and procyanidins. Copyright © 2011 Elsevier Inc. All rights reserved.

RET fusions define a unique molecular and clinicopathologic subtype of non-small-cell lung cancer.

PubMed

Wang, Rui; Hu, Haichuan; Pan, Yunjian; Li, Yuan; Ye, Ting; Li, Chenguang; Luo, Xiaoyang; Wang, Lei; Li, Hang; Zhang, Yang; Li, Fei; Lu, Yongming; Lu, Qiong; Xu, Jie; Garfield, David; Shen, Lei; Ji, Hongbin; Pao, William; Sun, Yihua; Chen, Haiquan

2012-12-10

The RET fusion gene has been recently described in a subset of non-small-cell lung cancers (NSCLCs). Because we have limited knowledge about these tumors, this study was aimed at determining the clinicopathologic characteristics of patients with NSCLC harboring the RET fusion gene. We examined the RET fusion gene in 936 patients with surgically resected NSCLC using a reverse transcriptase polymerase chain reaction (PCR) plus quantitative real-time PCR strategy, with validation using immunohistochemical and fluorescent in situ hybridization assays. A subset of 633 lung adenocarcinomas was also studied for EGFR, KRAS, HER2, and BRAF mutations, as well as ALK rearrangements. Patient characteristics, including age, sex, smoking history, stage, grade, International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society classification of subtypes of lung adenocarcinoma, and relapse-free survival, were collected. Of 936 patients with NSCLC, the RET fusion gene was exclusively detected in 13 patients (11 of 633 patients with adenocarcinomas and two of 24 patients with adenosquamous cell carcinomas). Of the 13 patients, nine patients had KIF5B-RET, three patients had CCDC6-RET, and one patient had a novel NCOA4-RET fusion. Patients with lung adenocarcinomas with RET fusion gene had more poorly differentiated tumors (63.6%; P = .029 for RET v ALK, P = .007 for RET v EGFR), with a tendency to be younger (≤ 60 years; 72.7%) and never-smokers (81.8%) and to have solid subtype (63.6%) and a smaller tumor (≤ 3 cm) with N2 disease (54.4%). The median relapse-free survival was 20.9 months. RET fusion occurs in 1.4% of NSCLCs and 1.7% of lung adenocarcinomas and has identifiable clinicopathologic characteristics, warranting further clinical consideration and targeted therapy investigation.

Down-regulation of annexin A1 in the urothelium decreases cell survival after bacterial toxin exposure.

PubMed

Monastyrskaya, Katia; Babiychuk, Eduard B; Draeger, Annette; Burkhard, Fiona C

2013-07-01

We examined the role of annexins in bladder urothelium. We characterized expression and distribution in normal bladders, biopsies from patients with bladder pain syndrome, cultured human urothelium and urothelial TEU-2 cells. Annexin expression in bladder layers was analyzed by quantitative reverse transcriptase-polymerase chain reaction and immunofluorescence. We assessed cell survival after exposure to the pore forming bacterial toxin streptolysin O by microscopy and alamarBlue® assay. Bladder dome biopsies were obtained from 8 asymptomatic controls and 28 patients with symptoms of bladder pain syndrome. Annexin A1, A2, A5 and A6 were differentially distributed in bladder layers. Annexin A6 was abundant in detrusor smooth muscle and low in urothelium, while annexin A1 was the highest in urothelium. Annexin A2 was localized to the lateral membrane of umbrella cells but excluded from tight junctions. TEU-2 cell differentiation caused up-regulation of annexin A1 and A2 and down-regulation of annexin A6 mRNA. Mature urothelium dedifferentiation during culture caused the opposite effect, decreasing annexin A1 and increasing annexin A6. Annexin A2 influenced TEU-2 cell epithelial permeability. siRNA mediated knockdown of annexin A1 in TEU-2 cells caused significantly decreased cell survival after streptolysin O exposure. Annexin A1 was significantly reduced in biopsies from patients with bladder pain syndrome. Several annexins are expressed in human bladder and TEU-2 cells, in which levels are regulated during urothelial differentiation. Annexin A1 down-regulation in patients with bladder pain syndrome might decrease cell survival and contribute to compromised urothelial function. Copyright © 2013 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Mycophenolate mofetil increases adhesion capacity of tumor cells in vitro.

PubMed

Blaheta, Roman A; Bogossian, Harilaos; Beecken, Wolf-Dietrich; Jonas, Dietger; Hasenberg, Christoph; Makarevic, Jasmina; Ogbomo, Henry; Bechstein, Wolf O; Oppermann, Elsie; Leckel, Kerstin; Cinatl, Jindrich

2003-12-27

The immunosuppressive drug mycophenolate mofetil (MMF) reduces expression of the heterophilic binding elements intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 and thereby prevents attachment of alloactivated leukocytes to donor endothelium. The authors speculated that MMF might further diminish receptors of the immunoglobulin superfamily which, however, act as homophilic binding elements. Because decrease of homophilic adhesion receptors correlates with tumor dissemination and metastasis, MMF could trigger development or recurrence of neoplastic tumors. The authors analyzed the influence of MMF on homotypic adhesion receptors and its consequence for tumor cell attachment to an endothelial cell monolayer. Neuroblastoma (NB) cells, which self-aggregate by means of the homophilic-binding element neural cell adhesion molecule (NCAM), were used. Effects of MMF on the 140- and 180-kDa NCAM isoforms were investigated quantitatively by flow cytometry, Western blot, and reverse-transcriptase (RT) polymerase chain reaction (PCR). The relevance of NCAM for tumor cell binding was proven by treating NB with NCAM antisense oligonucleotides. MMF profoundly increased the number of adherent NB cells, with a maximum effect at 0.1 microM, compared with controls. Decrease of NCAM on the cell surface was detected by flow cytometry. Western blot and RT-PCR demonstrated reduced protein and RNA levels of the 140- and 180-kDa isoforms. Treatment of NB cells with NCAM antisense oligonucleotides showed that reduced NCAM expression leads to enhanced tumor cell adhesion. MMF decreases NCAM receptors, which is associated with enhanced tumor cell invasiveness. The authors conclude that an MMF-based immunosuppressive regimen might increase the risk of tumor metastasis if this process is predominantly conveyed by means of homophilic adhesion proteins.

Disease transmission and passenger behaviors during a high morbidity Norovirus outbreak on a cruise ship, January 2009.

PubMed

Wikswo, Mary E; Cortes, Jennifer; Hall, Aron J; Vaughan, George; Howard, Christopher; Gregoricus, Nicole; Cramer, Elaine H

2011-05-01

Norovirus continues to pose a significant burden on cruise ships, causing an average of 27 confirmed outbreaks annually over the past 5 years. In January 2009, the report of a suspected norovirus outbreak among passengers on a cruise ship prompted an investigation. A retrospective cohort study among passengers was conducted on board the ship. Questionnaires about health care-seeking behaviors, hygiene practices, and possible norovirus exposures were placed in every cabin. Stool samples from several ill passengers were tested for norovirus by quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) and confirmed by sequence analysis. Of 1842 passengers, 1532 (83.2%) returned questionnaires, and 236 (15.4% of participants) met the case definition. Of these, 95 (40%) did not report to the infirmary. Case passengers were significantly more likely to have an ill cabin mate (relative risk [RR] = 3.0; P < .01) and to have witnessed vomiting during boarding (RR = 2.8; P = .01). Over 90% of all passengers reported increased hand hygiene practices following the outbreak; 38% of ill passengers and 11% of well passengers decreased participation in public activities. Of 14 samples tested, 12 were positive for norovirus by RT-qPCR; 5 of these were confirmed by sequence analysis and typed as GII.4 Minerva. Person-to-person transmission, including an incident of public vomiting during boarding, likely contributed to this high morbidity outbreak. Infirmary surveillance detected only 60% of acute gastroenteritis (AGE) cases involved in this outbreak. Adjustments to outbreak reporting thresholds may be needed to account for incomplete voluntary AGE reporting and to more rapidly implement control measures.

The Effect of Exposure to a High-Fat Diet on MicroRNA Expression in the Liver of Blunt Snout Bream (Megalobrama amblycephala)

PubMed Central

Zhang, Dingdong; Lu, Kangle; Dong, Zaijie; Jiang, Guangzhen; Xu, Weina; Liu, Wenbin

2014-01-01

Blunt snout bream (Megalobrama amblycephala) are susceptible to hepatic steatosis when maintained in modern intensive culture systems. The aim of this study was to investigate the potential roles of microRNAs (miRNAs) in diet-induced hepatic steatosis in this species. MiRNAs, small non-coding RNAs that regulate gene expression at the posttranscriptional level, are involved in diverse biological processes, including lipid metabolism. Deep sequencing of hepatic small RNA libraries from blunt snout bream fed normal-fat and high-fat diets identified 202 (193 known and 9 novel) miRNAs, of which 12 were differentially expressed between the normal-fat and high-fat diet groups. Quantitative stem-loop reverse transcriptase-polymerase chain reaction analyses confirmed the upregulation of miR-30c and miR-30e-3p and the downregulation of miR-145 and miR-15a-5p in high-fat diet-fed fish. Bioinformatics tools were used to predict the targets of these verified miRNAs and to explore potential downstream gene ontology biological process categories and Kyoto Encyclopedia of Genes and Genomes pathways. Six putative lipid metabolism-related target genes (fetuin-B, Cyp7a1, NADH dehydrogenase (ubiquinone) 1 beta subcomplex subunit 2, 3-oxoacid CoA transferase 1b, stearoyl-CoA desaturase, and fatty-acid synthase) were identified as having potential important roles in the development of diet-induced hepatic steatosis in blunt snout bream. The results presented here are a foundation for future studies of miRNA-controlled lipid metabolism regulatory networks in blunt snout bream. PMID:24788396

cDNA-AFLP analysis of transcripts induced in chickpea plants by TiO2 nanoparticles during cold stress.

PubMed

Amini, Saeed; Maali-Amiri, Reza; Mohammadi, Rahmat; Kazemi-Shahandashti, Seyyedeh-Sanam

2017-02-01

We evaluated the effect of TiO 2 nanoparticles (NPs) on cold tolerance (CT) development in two chickpea (Cicer arietinum L.) genotypes (Sel96Th11439, cold tolerant, and ILC533, cold susceptible) by using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique during the first and sixth days of cold stress (CS) at 4 °C. Selective amplification by primer combinations generated 4200 transcript-derived fragments (TDFs) while 100 of them (2.62%) were differentially expressed. During CS, 60 differentially expressed TDFs of TiO 2 NPs-treated plants were cloned and 10 of them produced successfully readable sequences. These data represented different groups of genes involved in metabolism pathways, cellular defense, cell connections and signaling, transcriptional regulation and chromatin architecture. Two out of 10 TDFs were unknown genes with uncharacterized functions or sequences without homology to known ones. The network-based analysis showed a gene-gene relationship in response to CS. Quantitative reverse-transcriptase polymerase chain reaction (qPCR) confirmed differential expression of identified genes (six out of 10 TDFs) with potential functions in CT and showed similar patterns with cDNA-AFLP results. An increase in transcription level of these TDFs, particularly on the first day of CS, was crucial for developing CT through decreasing electrolyte leakage index (ELI) content in tolerant plants compared to susceptible ones, as well as in TiO 2 NPs-treated plants compared to control ones. It could also indicate probable role of TiO 2 NPs against CS-induced oxidative stress. Therefore, a new application of TiO 2 NPs in CT development is suggested for preventing or controlling the damages in field conditions and increasing crop productivity. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Genome-scale analysis of anaerobic benzoate and phenol metabolism in the hyperthermophilic archaeon Ferroglobus placidus

PubMed Central

Holmes, Dawn E; Risso, Carla; Smith, Jessica A; Lovley, Derek R

2012-01-01

Insight into the mechanisms for the anaerobic metabolism of aromatic compounds by the hyperthermophilic archaeon Ferroglobus placidus is expected to improve understanding of the degradation of aromatics in hot (>80° C) environments and to identify enzymes that might have biotechnological applications. Analysis of the F. placidus genome revealed genes predicted to encode enzymes homologous to those previously identified as having a role in benzoate and phenol metabolism in mesophilic bacteria. Surprisingly, F. placidus lacks genes for an ATP-independent class II benzoyl-CoA (coenzyme A) reductase (BCR) found in all strictly anaerobic bacteria, but has instead genes coding for a bzd-type ATP-consuming class I BCR, similar to those found in facultative bacteria. The lower portion of the benzoate degradation pathway appears to be more similar to that found in the phototroph Rhodopseudomonas palustris, than the pathway reported for all heterotrophic anaerobic benzoate degraders. Many of the genes predicted to be involved in benzoate metabolism were found in one of two gene clusters. Genes for phenol carboxylation proceeding through a phenylphosphate intermediate were identified in a single gene cluster. Analysis of transcript abundance with a whole-genome microarray and quantitative reverse transcriptase polymerase chain reaction demonstrated that most of the genes predicted to be involved in benzoate or phenol metabolism had higher transcript abundance during growth on those substrates vs growth on acetate. These results suggest that the general strategies for benzoate and phenol metabolism are highly conserved between microorganisms living in moderate and hot environments, and that anaerobic metabolism of aromatic compounds might be analyzed in a wide range of environments with similar molecular targets. PMID:21776029

Nitrate reduction mechanisms and rates in an unconfined eogenetic karst aquifer in two sites with different redox potential

NASA Astrophysics Data System (ADS)

Henson, W. R.; Huang, L.; Graham, W. D.; Ogram, A.

2017-05-01

This study integrates push-pull tracer tests (PPTT) with microbial characterization of extracted water via quantitative polymerase chain reaction (qPCR) and reverse transcriptase qPCR (RT-qPCR) of selected functional N transformation genes to quantify nitrate reduction mechanisms and rates in sites with different redox potential in a karst aquifer. PPTT treatments with nitrate (AN) and nitrate-fumarate (ANC) were executed in two wells representing anoxic and oxic geochemical end-members. Oxic aquifer zero-order nitrate loss rates (mmol L-1 h-1) were similar for AN and ANC treatment, ranging from 0.03 ± 0.01 to 0.05 ± 0.01. Anoxic aquifer zero-order nitrate loss rates ranged from 0.03 ± 0.02 (AN) to 0.13 ± 0.02 (ANC). Microbial characterization indicates mechanisms influencing these rates were dissimilatory nitrate reduction to ammonium (DNRA) at the anoxic site with AN treatment, assimilatory reduction of nitrate to ammonium (ANRA) with ANC treatment in the water column at both sites, and additional documented nitrate reduction that occurred in unsampled biofilms. With carbon treatment, total numbers of microbes (16S rRNA genes) significantly increased (fourteenfold to thirtyfold), supporting stimulated growth with resulting ANRA. Decreased DNRA gene concentrations (nrfA DNA) and increased DNRA activity ratio (nrfA-cDNA/DNA) supported the assertion that DNRA occurred in the anoxic zone with AN and ANC treatment. Furthermore, decreased DNRA gene copy numbers at the anoxic site with ANC treatment suggests that DNRA microbes in the anoxic site are chemolithoautotrophic. Increased RT-qPCR denitrification gene expression (nirK and nirS) was not observed in water samples, supporting that any observed NO3-N loss due to denitrification may be occurring in unsampled microbial biofilms.

Molecular analysis of alternative transcripts of equine AXL receptor tyrosine kinase gene.

PubMed

Park, Jeong-Woong; Song, Ki-Duk; Kim, Nam Young; Choi, Jae-Young; Hong, Seul A; Oh, Jin Hyeog; Kim, Si Won; Lee, Jeong Hyo; Park, Tae Sub; Kim, Jin-Kyoo; Kim, Jong Geun; Cho, Byung-Wook

2017-10-01

Since athletic performance is a most importance trait in horses, most research focused on physiological and physical studies of horse athletic abilities. In contrast, the molecular analysis as well as the regulatory pathway studies remain insufficient for evaluation and prediction of horse athletic abilities. In our previous study, we identified AXL receptor tyrosine kinase ( AXL ) gene which was expressed as alternative spliced isoforms in skeletal muscle during exercise. In the present study, we validated two AXL alternative splicing transcripts (named as AXLa for long form and AXLb for short form) in equine skeletal muscle to gain insight(s) into the role of each alternative transcript during exercise. We validated two isoforms of AXL transcripts in horse tissues by reverse transcriptase polymerase chain reaction (RT-PCR), and then cloned the transcripts to confirm the alternative locus and its sequences. Additionally, we examined the expression patterns of AXLa and AXLb transcripts in horse tissues by quantitative RT-PCR (qRT-PCR). Both of AXLa and AXLb transcripts were expressed in horse skeletal muscle and the expression levels were significantly increased after exercise. The sequencing analysis showed that there was an alternative splicing event at exon 11 between AXLa and AXLb transcripts. 3-dimentional (3D) prediction of the alternative protein structures revealed that the structural distance of the connective region between fibronectin type 3 (FN3) and immunoglobin (Ig) domain was different between two alternative isoforms. It is assumed that the expression patterns of AXLa and AXLb transcripts would be involved in regulation of exercise-induced stress in horse muscle possibly through an NF-κB signaling pathway. Further study is necessary to uncover biological function(s) and significance of the alternative splicing isoforms in race horse skeletal muscle.

Expression profiling of chickpea genes differentially regulated during a resistance response to Ascochyta rabiei.

PubMed

Coram, Tristan E; Pang, Edwin C K

2006-11-01

Using microarray technology and a set of chickpea (Cicer arietinum L.) unigenes, grasspea (Lathyrus sativus L.) expressed sequence tags (ESTs) and lentil (Lens culinaris Med.) resistance gene analogues, the ascochyta blight (Ascochyta rabiei (Pass.) L.) resistance response was studied in four chickpea genotypes, including resistant, moderately resistant, susceptible and wild relative (Cicer echinospermum L.) genotypes. The experimental system minimized environmental effects and was conducted in reference design, in which samples from mock-inoculated controls acted as reference against post-inoculation samples. Robust data quality was achieved through the use of three biological replicates (including a dye swap), the inclusion of negative controls and strict selection criteria for differentially expressed genes, including a fold change cut-off determined by self-self hybridizations, Student's t-test and multiple testing correction (P < 0.05). Microarray observations were also validated by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). The time course expression patterns of 756 microarray features resulted in the differential expression of 97 genes in at least one genotype at one time point. k-means clustering grouped the genes into clusters of similar observations for each genotype, and comparisons between A. rabiei-resistant and A. rabiei-susceptible genotypes revealed potential gene 'signatures' predictive of effective A. rabiei resistance. These genes included several pathogenesis-related proteins, SNAKIN2 antimicrobial peptide, proline-rich protein, disease resistance response protein DRRG49-C, environmental stress-inducible protein, leucine-zipper protein, polymorphic antigen membrane protein, Ca-binding protein and several unknown proteins. The potential involvement of these genes and their pathways of induction are discussed. This study represents the first large-scale gene expression profiling in chickpea, and future work will focus on the functional validation of the genes of interest.

Grouping and characterization of putative glycosyltransferase genes from Panax ginseng Meyer.

PubMed

Khorolragchaa, Altanzul; Kim, Yu-Jin; Rahimi, Shadi; Sukweenadhi, Johan; Jang, Moon-Gi; Yang, Deok-Chun

2014-02-15

Glycosyltransferases are members of the multigene family of plants that can transfer single or multiple activated sugars to a range of plant molecules, resulting in the glycosylation of plant compounds. Although the activities of many glycosyltransferases and their products have been recognized for a long time, only in recent years were some glycosyltransferase genes identified and few have been functionally characterized in detail. Korean ginseng (Panax ginseng Meyer), belonging to Araliaceae, has been well known as a popular mysterious medicinal herb in East Asia for over 2,000 years. A total of 704 glycosyltransferase unique sequences have been found from a ginseng expressed sequence tag (EST) library, and these sequences encode enzymes responsible for the secondary metabolite biosynthesis. Finally, twelve UDP glycosyltransferases (UGTs) were selected as the candidates most likely to be involved in triterpenoid synthesis. In this study, we classified the candidate P. ginseng UGTs (PgUGTs) into proper families and groups, which resulted in eight UGT families and six UGT groups. We also investigated those gene candidates encoding for glycosyltransferases by analysis of gene expression in methyl jasmonate (MeJA)-treated ginseng adventitious roots and different tissues from four-year-old ginseng using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). For organ-specific expression, most of PgUGT transcription levels were higher in leaves and roots compared with flower buds and stems. The transcription of PgUGTs in adventitious roots treated with MeJA increased as compared with the control. PgUGT1 and PgUGT2, which belong to the UGT71 family genes expressed in MeJA-treated adventitious roots, were especially sensitive, showing 33.32 and 38.88-fold expression increases upon 24h post-treatments, respectively. © 2013 Elsevier B.V. All rights reserved.

Total bile acids in the maternal and fetal compartment in relation to placental ABCG2 expression in preeclamptic pregnancies complicated by HELLP syndrome.

PubMed

Jebbink, Jiska; Veenboer, Geertruda; Boussata, Souad; Keijser, Remco; Kremer, Andreas E; Elferink, Ronald Oude; van der Post, Joris; Afink, Gijs; Ris-Stalpers, Carrie

2015-01-01

To investigate total bile acid (TBA) levels in maternal (MB) and umbilical cord blood (UCB) in normotensive, preeclamptic (PE), and PE pregnancies complicated by hemolysis elevated liver enzymes and low platelets (HELLP) syndrome in the context of ABCG2 placental gene expression levels, a recently reported placental bile acid transporter. TBA levels were determined in 83 paired MB and UCB samples of normotensive, PE and PE/HELLP pregnancies and in 22 paired arterial and venous UCB samples from uncomplicated term pregnancies. ABCG2 gene expression was measured in 104 human placentas by reverse transcriptase quantitative polymerase chain reaction. Overall, TBA levels in MB are higher compared to levels in UCB (p<0.0001), but this comparison looses statistical significance for the 11 PE/HELLP cases. TBA levels in maternal blood are increased in PE/HELLP compared to PE pregnancies (p=0.016). TBA levels in arterial and venous UCB from 22 normotensive pregnancies are not statistically different. ABCG2 expression is reduced in pregnancies where preeclampsia is further complicated by HELLP syndrome. ABCG2 expression in human placenta is not correlated with TBA levels in either the maternal or fetal compartment. Increased maternal TBA levels in PE/HELLP pregnancies indicate a relation between bile acids in the maternal circulation and HELLP syndrome. As overall TBA levels in maternal blood are increased compared to UCB, we conclude that the placenta partly protects the fetus from increased maternal TBA levels. This consistent difference in TBA levels between the maternal and fetal compartment is unrelated to the placental expression of ABCG2. Copyright © 2014 Elsevier B.V. All rights reserved.

RORA and Autism in The Isfahan Population: Is There An Epigenetic Relationship.

PubMed

Salehi, Mansoor; Kamali, Elahe; Karahmadi, Mojgan; Mousavi, Seyyed Mohammad

2017-01-01

Autism is a neurodevelopmental disorder characterized by difficulty in verbal and non-verbal communication, impaired social interaction, and restricted and repetitive behavior. It has been recently introduced as a multigenic disorder with significant epigenetic effects on its pathology. Recently, epigenetic silencing of retinoic acid receptor- related orphan receptor alpha ( RORα ) gene (which has an essential role in neural tissue development) was shown to have occurred in autistic children due to methylation of its promoter region. This may thus explain a significant part of the molecular pathogenesis of autism. Therefore, we aimed to confirm this finding by implementing a case-control (experimental) study in the population of Isfahan. The methylation status of a 136 bp sequence of a GpG island (encompassing 13 CpG sites) in the RORA promoter region (positions -200 to -64) as an experimental study was examined in the lymphocyte cells of 30 autistic children after sodium bisulfite treatment using the melting curve analysis-methylation (MCA-Meth) assay compared with normal children. Also, quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis was used to estimate the level of mRNA transcripts and to evaluate MCA-Meth analysis results. This study revealed no methylation in the examined promoter regions in both autistic and normal children, with the melting curve of all studied samples being comparable to that of the non-methylated control. The results of MCA-Meth analysis were also consistent with qRT-PCR results. We therefore observed no significant difference in the levels of RORα transcripts in the blood lymphocytes between autistic and healthy children. The methylation of the RORA promoter region may not be considered as a common epigenetic risk factor for autism in all populations. Hence, the molecular pathogenesis of autism remains unclear in the population investigated.

Increased expression of native cytosolic Cu/Zn superoxide dismutase and ascorbate peroxidase improves tolerance to oxidative and chilling stresses in cassava (Manihot esculenta Crantz).

PubMed

Xu, Jia; Yang, Jun; Duan, Xiaoguang; Jiang, Yueming; Zhang, Peng

2014-08-05

Cassava (Manihot esculenta Crantz) is a tropical root crop, and is therefore, extremely sensitive to low temperature; its antioxidative response is pivotal for its survival under stress. Timely turnover of reactive oxygen species (ROS) in plant cells generated by chilling-induced oxidative damages, and scavenging can be achieved by non-enzymatic and enzymatic reactions in order to maintain ROS homeostasis. Transgenic cassava plants that co-express cytosolic superoxide dismutase (SOD), MeCu/ZnSOD, and ascorbate peroxidase (APX), MeAPX2, were produced and tested for tolerance against oxidative and chilling stresses. The up-regulation of MeCu/ZnSOD and MeAPX2 expression was confirmed by the quantitative reverse transcriptase-polymerase chain reaction, and enzymatic activity analyses in the leaves of transgenic cassava plant lines with a single-transgene integration site. Upon exposure to ROS-generating agents, 100 μM ROS-generating reagent methyl viologen and 0.5 M H₂O₂, higher levels of enzymatic activities of SOD and APX were detected in transgenic plants than the wild type. Consequently, the oxidative stress parameters, such as lipid peroxidation, chlorophyll degradation and H₂O₂ synthesis, were lower in the transgenic lines than the wild type. Tolerance to chilling stress at 4°C for 2 d was greater in transgenic cassava, as observed by the higher levels of SOD, catalase, and ascorbate-glutathione cycle enzymes (e.g., APX, monodehydroascorbate reductase, dehydroascorbate reducatase and glutathione reductase) and lower levels of malondialdehyde content. These results suggest that the expression of native cytosolic SOD and APX simultaneously activated the antioxidative defense mechanisms via cyclic ROS scavenging, thereby improving its tolerance to cold stress.

Strong Inverse Correlation Between MicroRNA-125b and Human Papillomavirus DNA in Productive Infection

PubMed Central

Nuovo, Gerard J.; Wu, Xin; Volinia, Stefano; Yan, Fengting; di Leva, Gianpiero; Chin, Nena; Nicol, Alcina F.; Jiang, Jinmai; Otterson, Gregory; Schmittgen, Thomas D.; Croce, Carlo

2014-01-01

Infection by the human papillomavirus (HPV) is a cause of cervical intraepithelial neoplasia (CIN) and cancer. microRNA (miRNA) in situ analysis of the transformation zone epithelia, the site of initial cervical HPV infection, showed that miRNAs let-7c, — 99a, 26a, and 125b were the most abundantly expressed. In situ testing of CIN 1 showed a dramatic reduction in miR-125b expression in the koilocytes, the cytologic marker of productive HPV infection. A marked reduction in miR-125b was likewise observed in the HPV-infected cells of the condyloma acuminatum, verruca vulgaris, and epidermodysplasia verruciformis. Reverse transcriptase in situ polymerase chain reaction (PCR) showed that the pre-miRNA 125b was present in the koilocyte, suggesting direct inactivation of the mature miRNA. HEK cells transfected with only the antimiR-125b showed perinuclear halos equivalent to HPV-infected koilocytes. NIH 3T3 cells transfected with the HPV 16 full-length genome and mimetic miR-125b showed a marked reduction in viral DNA and protein synthesis by quantitative PCR and in situ-based analyses, respectively (P=0.002). Alternatively, cotransfection with anti-miR-125b and HPV 16 markedly increased HPV DNA (P=0.002). Sequence analyses showed strong homology between L2 of different HPV genotypes and miR-125b. Transfection with HPV 16 L2 resulted in a marked reduction in miR-125b levels in the NIH 3T3 cells. HPV L2-induced inactivation of miR-125b is associated with the classic cytologic changes of the koilocyte, and the exogenous application of mimetic miR-125b markedly inhibits HPV DNA synthesis. PMID:20736742

Strong inverse correlation between microRNA-125b and human papillomavirus DNA in productive infection.

PubMed

Nuovo, Gerard J; Wu, Xin; Volinia, Stefano; Yan, Fengting; di Leva, Gianpiero; Chin, Nena; Nicol, Alcina F; Jiang, Jinmai; Otterson, Gregory; Schmittgen, Thomas D; Croce, Carlo

2010-09-01

Infection by the human papillomavirus (HPV) is a cause of cervical intraepithelial neoplasia (CIN) and cancer. microRNA (miRNA) in situ analysis of the transformation zone epithelia, the site of initial cervical HPV infection, showed that miRNAs let-7c, -99a, 26a, and 125b were the most abundantly expressed. In situ testing of CIN 1 showed a dramatic reduction in miR-125b expression in the koilocytes, the cytologic marker of productive HPV infection. A marked reduction in miR-125b was likewise observed in the HPV-infected cells of the condyloma acuminatum, verruca vulgaris, and epidermodysplasia verruciformis. Reverse transcriptase in situ polymerase chain reaction (PCR) showed that the pre-miRNA 125b was present in the koilocyte, suggesting direct inactivation of the mature miRNA. HEK cells transfected with only the antimiR-125b showed perinuclear halos equivalent to HPV-infected koilocytes. NIH 3T3 cells transfected with the HPV 16 full-length genome and mimetic miR-125b showed a marked reduction in viral DNA and protein synthesis by quantitative PCR and in situ-based analyses, respectively (P=0.002). Alternatively, cotransfection with anti-miR-125b and HPV 16 markedly increased HPV DNA (P=0.002). Sequence analyses showed strong homology between L2 of different HPV genotypes and miR-125b. Transfection with HPV 16 L2 resulted in a marked reduction in miR-125b levels in the NIH 3T3 cells. HPV L2-induced inactivation of miR-125b is associated with the classic cytologic changes of the koilocyte, and the exogenous application of mimetic miR-125b markedly inhibits HPV DNA synthesis.

Protective effects of grape seed proanthocyanidin extracts on cerebral cortex of streptozotocin-induced diabetic rats through modulating AGEs/RAGE/NF-kappaB pathway.

PubMed

Lu, Mei; Xu, Ling; Li, Baoying; Zhang, Weidong; Zhang, Chengmei; Feng, Hong; Cui, Xiaopei; Gao, Haiqing

2010-01-01

Diabetic encephalopathy is a severe complication in patients with long-term hyperglycemia. Oxidative stress is thought to be closely implicated in this disorder, so in this study, we examined whether grape seed proanthocyanidin extract (GSPE), a naturally occurring antioxidant derived from grape seeds, could reduce the injuries in the cerebral cortex of diabetic rats by modulating advanced glycation end products (AGEs)/the receptor for AGEs (RAGE)/nuclear factor-kappa B p65 (NF-kappaB p65) pathway, which is crucial in oxidative stress. Body weight and serum AGEs were tested; cerebral cortexes were isolated for morphological observations and the pyramidal cell layers were immunohistochemically stained for the detection of RAGE, NF-kappaB p65, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule-1 (VCAM-1) as well. For RAGE and NF-kappaB p65, quantitative reverse transcriptase coupled to polymerase chain reaction (RT-PCR) was employed for determination of mRNA levels, and western blot was used to detect protein expression. Our results showed that long term hyperglycemia in diabetic rats caused the degeneration of neurons and the up-regulation of serum AGEs, and also the up-regulation of RAGE, NF-kappaB p65, VCAM-1 and ICAM-1 in the brain. We found that GSPE treatment improved the pathological changes of diabetic rats by modulating the AGEs/RAGE/NF-kappaB p65 pathway. This study enables us to further understand the key role that the AGEs/RAGE/NF-kappaB pathway plays in the pathogenesis of diabetic encephalopathy, and confirms that GSPE might be a therapeutical means to the prevention and treatment of this disorder.

Cri du Chat syndrome

PubMed Central

Cerruti Mainardi, Paola

2006-01-01

The Cri du Chat syndrome (CdCS) is a genetic disease resulting from a deletion of variable size occurring on the short arm of chromosome 5 (5p-). The incidence ranges from 1:15,000 to 1:50,000 live-born infants. The main clinical features are a high-pitched monochromatic cry, microcephaly, broad nasal bridge, epicanthal folds, micrognathia, abnormal dermatoglyphics, and severe psychomotor and mental retardation. Malformations, although not very frequent, may be present: cardiac, neurological and renal abnormalities, preauricular tags, syndactyly, hypospadias, and cryptorchidism. Molecular cytogenetic analysis has allowed a cytogenetic and phenotypic map of 5p to be defined, even if results from the studies reported up to now are not completely in agreement. Genotype-phenotype correlation studies showed a clinical and cytogenetic variability. The identification of phenotypic subsets associated with a specific size and type of deletion is of diagnostic and prognostic relevance. Specific growth and psychomotor development charts have been established. Two genes, Semaphorin F (SEMAF) and δ-catenin (CTNND2), which have been mapped to the "critical regions", are potentially involved in cerebral development and their deletion may be associated with mental retardation in CdCS patients. Deletion of the telomerase reverse transcriptase (hTERT) gene, localised to 5p15.33, could contribute to the phenotypic changes in CdCS. The critical regions were recently refined by using array comparative genomic hybridisation. The cat-like cry critical region was further narrowed using quantitative polymerase chain reaction (PCR) and three candidate genes were characterised in this region. The diagnosis is based on typical clinical manifestations. Karyotype analysis and, in doubtful cases, FISH analysis will confirm the diagnosis. There is no specific therapy for CdCS but early rehabilitative and educational interventions improve the prognosis and considerable progress has been made in the social adjustment of CdCS patients. PMID:16953888

Cyclooxygenase-dependent alterations in substance P-mediated contractility and tachykinin NK1 receptor expression in the colonic circular muscle of patients with slow transit constipation.

PubMed

Liu, Lu; Shang, Fei; Morgan, Matthew J; King, Denis W; Lubowski, David Z; Burcher, Elizabeth

2009-04-01

Tachykinins are important neurotransmitters regulating intestinal motility. Slow transit constipation (STC) represents an extreme colonic dysmotility with unknown etiology that predominantly affects women. We examined whether the tachykinin system is involved in the pathogenesis of STC. Isolated sigmoid colon circular muscle from female STC and control patients was studied using functional and quantitative reverse transcriptase-polymerase chain reaction methods. A possible alteration of neurotransmission was investigated by electrical field stimulation (EFS) and ganglionic stimulation by dimethylphenylpiperazinium (DMPP). Substance P (SP)-mediated contractions in circular muscle strips were significantly diminished in STC compared with age-matched control (P < 0.001). In contrast, contractile responses to neurokinin A, the selective tachykinin NK(2) receptor agonist, [Lys(5),MeLeu(9),Nle(10)]NKA(4-10), and acetylcholine were unaltered in STC. The reduced responses to SP in STC were fully restored by indomethacin, partially reversed by tetrodotoxin (TTX), but unaffected by atropine or hexamethonium. The restoration by indomethacin was blocked by the NK(1) receptor antagonist CP99994 [(2S,3S)-3-(2-methoxybenzylamino)-2-phenylpiperidine] and TTX. In STC colonic muscle, there was a significant increase of NK(1) receptor mRNA expression, but no difference in NK(2) mRNA level. DMPP generated biphasic responses, relaxation at lower and contraction at higher concentrations. Although the responses to DMPP were similar in STC and control, an altered contractile pattern in response to EFS was observed in STC circular muscle. In conclusion, we postulate that the diminished contractile response to SP in STC is due to an increased release of inhibitory prostaglandins through activation of up-regulated NK(1) receptors. Our results also indicate some malfunction of the enteric nervous system in STC.

Effects of zoledronic acid and geranylgeraniol on the cellular behaviour and gene expression of primary human alveolar osteoblasts.

PubMed

Zafar, S; Coates, D E; Cullinan, M P; Drummond, B K; Milne, T; Seymour, G J

2016-11-01

Bisphosphonate-related osteonecrosis of the jaw (BRONJ) is a serious complication of bisphosphonate therapy. The mechanism underlying BRONJ pathogenesis is poorly understood. To determine the effects of zoledronic acid (ZA) and geranylgeraniol (GGOH) on the mevalonate pathway (MVP) in osteoblasts generated from the human mandibular alveolar bone in terms of cell viability/proliferation, migration, apoptosis and gene expression. Primary human osteoblasts (HOBs) isolated from the mandibular alveolar bone were phenotyped. HOBs were cultured with or without ZA and GGOH for up to 72 h. Cellular behaviour was examined using a CellTiter-Blue® viability assay, an Ibidi culture-insert migration assay, an Apo-ONE® Homogeneous Caspase-3/7 apoptosis assay and transmission electron microscopy (TEM). Quantitative real-time reverse transcriptase polymerase chain reaction (qRT 2 -PCR) was used to determine the simultaneous expression of 168 osteogenic and angiogenic genes modulated in the presence of ZA and GGOH. ZA decreased cell viability and migration and induced apoptosis in HOBs. TEM revealed signs of apoptosis in ZA-treated HOBs. However, the co-addition of GGOH ameliorated the effect of ZA and partially restored the cells to the control state. Twenty-eight genes in the osteogenic array and 27 genes in the angiogenic array were significantly regulated in the presence of ZA compared with those in the controls at one or more time points. The cytotoxic effect of ZA on HOBs and its reversal by the addition of GGOH suggests that the effect of ZA on HOBs is mediated via the MVP. The results suggest that GGOH could be used as a possible therapeutic/preventive strategy for BRONJ.

Asialofetuin liposome-mediated human alpha1-antitrypsin gene transfer in vivo results in stationary long-term gene expression.

PubMed

Dasí, F; Benet, M; Crespo, J; Crespo, A; Aliño, S F

2001-05-01

The development of nonviral vectors for in vivo gene delivery to hepatocytes is an interesting topic in view of their safety and tremendous gene therapy potential. Since cationic liposomes and liposome uptake by receptor-mediated mechanisms could offer advantages in the efficacy of liposome-mediated gene transfer, we studied the effect of liposome charge (anionic vs. cationic) and the covalently coupled asialofetuin ligand on the liposome surface in mediating human alpha1-antitrypsin (hAAT) gene transfer to mice in vivo. The changes in liposome charge were made by adding the following lipids to the backbone liposomes: anionic phosphatidylserine, cationic N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium methylsulfate or a lipopeptide synthesized from dipalmitoylphosphatidylethanolamine and covalently coupled to the cationic nuclear localization signal peptide. Two plasmids containing the hAAT gene were used: pTG7101, containing the complete genomic sequence of the human gene driven by the natural promoter, and p216, containing the human hAAT cDNA under the control of the CMV promoter. The results indicate that both untargeted anionic and cationic liposomes mediate plasma levels of hAAT that decline over time. However, asialofetuin liposomes increase the plasma levels of hAAT and can mediate long-term gene expression (>12 months) with stationary plasma levels of protein. Results from quantitative and qualitative reverse transcriptase polymerase chain reaction match those from protein plasma levels and confirm both the human origin of the message and the liver as source of the protein. The use of asialofetuin liposomes in hepatic gene therapy may both increase and prolong in vivo gene expression of hAAT and other clinically important genes.

Elevated MLF1 expression correlates with malignant progression from myelodysplastic syndrome.

PubMed

Matsumoto, N; Yoneda-Kato, N; Iguchi, T; Kishimoto, Y; Kyo, T; Sawada, H; Tatsumi, E; Fukuhara, S

2000-10-01

MLF1 is a novel protein identified as the NPM-MLF1 chimeric protein produced by a t(3;5)(q25.1;q34) chromosomal translocation, which is associated with myelodysplastic syndrome (MDS), often prior to acute myeloid leukemia (AML), except for M3. The clinical features of t(3;5)-positive myeloid disorders suggest that this chimeric protein is involved in dysregulation of progenitor cells with the capability to differentiate into multiple lineages. So far, involvement of wild-type MLF1 in hematopoiesis or in leukemogenesis has not been fully investigated. In the present study, 65 patients with AML and 44 patients with MDS were tested for the expression of MLF1 using the quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) method. A significantly higher level of MLF1 expression (ratio of MLF1/beta-actin mRNA >0.4) was readily detected in seven of 65 patients with de novo AML, three of 12 with post-MDS AML and seven of 44 with MDS, but not in any patients with ALL (n = 18). According to the FAB classification, high levels of MLF1 were found in patients with relatively immature subtypes of AML (M1, M2, M6 and M7) and high risk MDS (RAEB and RAEB-T). These findings indicate that the pattern of MLF1 expression is identical to the clinical morphology appearing in the t(3;5)-positive myeloid disorders and is correlated to the MDS-associated AML and transformation phase of MDS in t(3;5)-negative myeloid disorders. A CD34+ population of normal bone marrow cells preferentially expressed MLF1 with obviously decreasing levels of expression during maturation. Therefore, MLF1 normally functions in multi-potent progenitor cells and its dysregulation may take part in leukemogenesis from MDS.

Prenatal alcohol exposure affects vasculature development in the neonatal brain.

PubMed

Jégou, Sylvie; El Ghazi, Faiza; de Lendeu, Pamela Kwetieu; Marret, Stéphane; Laudenbach, Vincent; Uguen, Arnaud; Marcorelles, Pascale; Roy, Vincent; Laquerrière, Annie; Gonzalez, Bruno José

2012-12-01

In humans, antenatal alcohol exposure elicits various developmental disorders, in particular in the brain. Numerous studies focus on the deleterious effects of alcohol on neural cells. Although recent studies suggest that alcohol can affect angiogenesis in adults, the impact of prenatal alcohol exposure on brain microvasculature remains poorly understood. We used a mouse model to investigate effects of prenatal alcohol exposure on the cortical microvascular network in vivo and ex vivo and the action of alcohol, glutamate, and vascular endothelial growth factor A (VEGF) on activity, plasticity, and survival of microvessels. We used quantitative reverse transcriptase polymerase chain reaction, Western blot, immunohistochemistry, calcimetry, and videomicroscopy. We characterized the effect of prenatal alcohol exposure on the cortical microvascular network in human controls and fetal alcohol syndrome (FAS)/partial FAS (pFAS) patients at different developmental stages. In mice, prenatal alcohol exposure induced a reduction of cortical vascular density, loss of the radial orientation of microvessels, and altered expression of VEGF receptors. Time-lapse experiments performed on brain slices revealed that ethanol inhibited glutamate-induced calcium mobilization in endothelial cells, affected plasticity, and promoted death of microvessels. These effects were prevented by VEGF. In humans, we evidenced a stage-dependent alteration of the vascular network in the cortices of fetuses with pFAS/FAS. Whereas no modification was observed from gestational week 20 (WG20) to WG22, the radial organization of cortical microvessels was clearly altered in pFAS/FAS patients from WG30 to WG38. Prenatal alcohol exposure affects cortical angiogenesis both in mice and in pFAS/FAS patients, suggesting that vascular defects contribute to alcohol-induced brain abnormalities. Copyright © 2012 American Neurological Association.

Risk Reduction Modeling of High Pathogenicity Avian Influenza Virus Titers in Nonpasteurized Liquid Egg Obtained from Infected but Undetected Chicken Flocks.

PubMed

Weaver, J Todd; Malladi, Sasidhar; Spackman, Erica; Swayne, David E

2015-11-01

Control of highly pathogenic avian influenza (HPAI) outbreaks in poultry has traditionally involved the establishment of disease containment zones, where poultry products are only permitted to move from within a zone under permit. Nonpasteurized liquid egg (NPLE) is one such commodity for which movements may be permitted, considering inactivation of HPAI virus via pasteurization. Active surveillance testing at the flock level, using targeted matrix gene real-time reversed transcriptase-polymerase chain reaction testing (RRT-PCR) has been incorporated into HPAI emergency response plans as the primary on-farm diagnostic test procedure to detect HPAI in poultry and is considered to be a key risk mitigation measure. To inform decisions regarding the potential movement of NPLE to a pasteurization facility, average HPAI virus concentrations in NPLE produced from a HPAI virus infected, but undetected, commercial table-egg-layer flock were estimated for three HPAI virus strains using quantitative simulation models. Pasteurization under newly proposed international design standards (5 log10 reduction) is predicted to inactivate HPAI virus in NPLE to a very low concentration of less than 1 embryo infectious dose (EID)50 /mL, considering the predicted virus titers in NPLE from a table-egg flock under active surveillance. Dilution of HPAI virus from contaminated eggs in eggs from the same flock, and in a 40,000 lb tanker-truck load of NPLE containing eggs from disease-free flocks was also considered. Risk assessment can be useful in the evaluation of commodity-specific risk mitigation measures to facilitate safe trade in animal products from countries experiencing outbreaks of highly transmissible animal diseases. © 2015 Society for Risk Analysis.

Expression levels of the microRNA maturing microprocessor complex component DGCR8 and the RNA-induced silencing complex (RISC) components argonaute-1, argonaute-2, PACT, TARBP1, and TARBP2 in epithelial skin cancer.

PubMed

Sand, Michael; Skrygan, Marina; Georgas, Dimitrios; Arenz, Christoph; Gambichler, Thilo; Sand, Daniel; Altmeyer, Peter; Bechara, Falk G

2012-11-01

The microprocessor complex mediates intranuclear biogenesis of precursor microRNAs from the primary microRNA transcript. Extranuclear, mature microRNAs are incorporated into the RNA-induced silencing complex (RISC) before interaction with complementary target mRNA leads to transcriptional repression or cleavage. In this study, we investigated the expression profiles of the microprocessor complex subunit DiGeorge syndrome critical region gene 8 (DGCR8) and the RISC components argonaute-1 (AGO1), argonaute-2 (AGO2), as well as double-stranded RNA-binding proteins PACT, TARBP1, and TARBP2 in epithelial skin cancer and its premalignant stage. Patients with premalignant actinic keratoses (AK, n = 6), basal cell carcinomas (BCC, n = 15), and squamous cell carcinomas (SCC, n = 7) were included in the study. Punch biopsies were harvested from the center of the tumors (lesional), from healthy skin sites (intraindividual controls), and from healthy skin sites in a healthy control group (n = 16; interindividual control). The DGCR8, AGO1, AGO2, PACT, TARBP1, and TARBP2 mRNA expression levels were detected by quantitative real-time reverse transcriptase polymerase chain reaction. The DGCR8, AGO1, AGO2, PACT, and TARBP1 expression levels were significantly higher in the AK, BCC, and SCC groups than the healthy controls (P < 0.05). There was no significant difference in the TARBP2 expression levels between groups (P > 0.05). This study indicates that major components of the miRNA pathway, such as the microprocessor complex and RISC, are dysregulated in epithelial skin cancer. Copyright © 2011 Wiley Periodicals, Inc.