Sample records for transcriptase-quantitative polymerase chain

  1. Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

    PubMed Central

    Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

    2010-01-01

    Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

  2. Direct and quantitative detection of HIV-1 RNA in human plasma with a branched DNA signal amplification assay.

    PubMed

    Urdea, M S; Wilber, J C; Yeghiazarian, T; Todd, J A; Kern, D G; Fong, S J; Besemer, D; Hoo, B; Sheridan, P J; Kokka, R

    1993-11-01

    To determine the relative effect of sample matrix on the quantitation of HIV RNA in plasma. Two HIV-positive specimens were diluted into five and 10 different HIV-negative plasma samples, respectively. Branched DNA signal amplification technology and reverse-transcriptase polymerase chain reaction were used to measure the viral load. In one sample the viral load by polymerase chain reaction ranged from undetectable to 1.9 x 10(5) copies/ml, and the branched DNA results ranged from 2.6 x 10(4) to 4.2 x 10(4) HIV RNA equivalent/ml. In the other sample the corresponding figures were 6.3 x 10(4) to 5.5 x 10(5) copies/ml and 5.7 x 10(4) to 7.5 x 10(4) HIV RNA equivalents/ml. In contrast to reverse-transcriptase polymerase chain reaction the branched DNA signal amplification assay does not require a separate extraction step or enzymatic amplification of the target. Therefore this measurement is less affected by the sample matrix and the signal generated is directly proportional to the viral load.

  3. Evaluation of Four RNA Extraction Methods for Gene Expression Analyses of Cryptosporidium parvum and Toxoplasma gondii Oocys

    EPA Science Inventory

    Cryptosporidium spp. and Toxoplasma gondii are important coccidian parasites that have caused waterborne and foodborne disease outbreaks worldwide. Techniques like subtractive hybridization, microarrays, and quantitative reverse transcriptase real-time polymerase chain reaction (...

  4. Expression of Connexin 43 in Synovial Tissue of Patients With Rheumatoid Arthritis

    PubMed Central

    MATSUKI, Tomohiro; TSUCHIDA, Shinji; TERAUCHI, Ryu; ODA, Ryo; FUJIWARA, Hiroyoshi; MAZDA, Osam; KUBO, Toshikazu

    2016-01-01

    Objectives This study aims to identify the distribution and expression level of connexin 43 (Cx43) in synovial tissue in patients with rheumatoid arthritis (RA). Patients and methods The expression of Cx43 in synovial tissue from eight patients with RA (2 males, 6 females; mean age 59.5±2.7 years; range 52 to 71 years), five patients with osteoarthritis (2 males, 3 females; mean age 68.4±2.7 years; range 61 to 81 years), and one normal female subject (mean age 61 year) was analyzed by quantitative reverse transcriptase polymerase chain reaction and immunohistochemistry of tissue sections. Induction of Cx43 following stimulation of human RA synovial fibroblasts with tumor necrosis factor-alpha (TNF-a) cultures was examined by quantitative reverse transcriptase polymerase chain reaction. The effect of small interfering ribonucleic acid targeting Cx43 (siCx43) on the expression of TNF-a and interleukin-6 was examined using quantitative reverse transcriptase polymerase chain reaction and enzyme-linked immunosorbent assays. Results Connexin 43 was highly expressed in RA synovial tissue, which also expressed TNF-a, but was expressed lower in osteoarthritis and normal synovial tissue. Expression of Cx43 was markedly up-regulated in RA synovial fibroblasts after stimulation with TNF-a. The over-expression of pro- inflammatory cytokines was suppressed by transfection of siCx43. Conclusion This study shows that Cx43 is expressed in RA synovial tissue and that its expression is induced by stimulation with TNF-a. The expression of the pro-inflammatory cytokines was inhibited by transfection of siCx43. Cx43 may be a novel marker of inflammation in RA synovial tissue. PMID:29900991

  5. Gene expression analysis of wood decay fungus Fibroporia Radiculosa grown In ACQ-treated wood

    Treesearch

    Ayfer Akgul; Ali Akgul; Juliet D. Diehl Tang

    2018-01-01

    Copper-tolerant brown-rot fungi are able todegrade wood treated with copper or copper-based wood preservatives. This research used quantitative reverse transcriptase polymerase chain reaction to explore what genes of the brown-rot fungus, Fibroporia radiculosa, were expressed when the fungus was overcoming the wood preservatives and decaying the...

  6. Relationship Between Ebola Virus Real-Time Quantitative Polymerase Chain Reaction-Based Threshold Cycle Value and Virus Isolation From Human Plasma.

    PubMed

    Spengler, Jessica R; McElroy, Anita K; Harmon, Jessica R; Ströher, Ute; Nichol, Stuart T; Spiropoulou, Christina F

    2015-10-01

    We performed a longitudinal analysis of plasma samples obtained from 4 patients with Ebola virus (EBOV) disease (EVD) to determine the relationship between the real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)-based threshold cycle (Ct) value and the presence of infectious EBOV. EBOV was not isolated from plasma samples with a Ct value of >35.5 or >12 days after onset of symptoms. EBOV was not isolated from plasma samples in which anti-EBOV nucleoprotein immunoglobulin G was detected. These data demonstrate the utility of interpreting qRT-PCR results in the context of the course of EBOV infection and associated serological responses for patient-management decisions. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  7. A de novo transcriptome and valid reference genes for quantitative real-time PCR in Colaphellus bowringi.

    PubMed

    Tan, Qian-Qian; Zhu, Li; Li, Yi; Liu, Wen; Ma, Wei-Hua; Lei, Chao-Liang; Wang, Xiao-Ping

    2015-01-01

    The cabbage beetle Colaphellus bowringi Baly is a serious insect pest of crucifers and undergoes reproductive diapause in soil. An understanding of the molecular mechanisms of diapause regulation, insecticide resistance, and other physiological processes is helpful for developing new management strategies for this beetle. However, the lack of genomic information and valid reference genes limits knowledge on the molecular bases of these physiological processes in this species. Using Illumina sequencing, we obtained more than 57 million sequence reads derived from C. bowringi, which were assembled into 39,390 unique sequences. A Clusters of Orthologous Groups classification was obtained for 9,048 of these sequences, covering 25 categories, and 16,951 were assigned to 255 Kyoto Encyclopedia of Genes and Genomes pathways. Eleven candidate reference gene sequences from the transcriptome were then identified through reverse transcriptase polymerase chain reaction. Among these candidate genes, EF1α, ACT1, and RPL19 proved to be the most stable reference genes for different reverse transcriptase quantitative polymerase chain reaction experiments in C. bowringi. Conversely, aTUB and GAPDH were the least stable reference genes. The abundant putative C. bowringi transcript sequences reported enrich the genomic resources of this beetle. Importantly, the larger number of gene sequences and valid reference genes provide a valuable platform for future gene expression studies, especially with regard to exploring the molecular mechanisms of different physiological processes in this species.

  8. Susceptibility Testing by Polymerase Chain Reaction DNA Quantitation: A Method to Measure Drug Resistance of Human Immunodeficiency Virus Type 1 Isolates

    NASA Astrophysics Data System (ADS)

    Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.

    1992-04-01

    Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.

  9. The Chemical Chaperone, PBA, Reduces ER Stress and Autophagy and Increases Collagen IV α5 Expression in Cultured Fibroblasts From Men With X-Linked Alport Syndrome and Missense Mutations.

    PubMed

    Wang, Dongmao; Mohammad, Mardhiah; Wang, Yanyan; Tan, Rachel; Murray, Lydia S; Ricardo, Sharon; Dagher, Hayat; van Agtmael, Tom; Savige, Judy

    2017-07-01

    X-linked Alport syndrome (OMIM 301050) is caused by COL4A5 missense variants in 40% of families. This study examined the effects of chemical chaperone treatment (sodium 4-phenylbutyrate) on fibroblast cell lines derived from men with missense mutations. Dermal fibroblast cultures were established from 2 affected men and 3 normals. Proliferation rates were examined, the collagen IV α5 chain localized with immunostaining, and levels of the intra- and extracellular chains quantitated with an in-house enzyme-linked immunosorbent assay. COL4A5 mRNA was measured using quantitative reverse transcriptase polymerase chain reaction. Endoplasmic reticulum (ER) size was measured on electron micrographs and after HSP47 immunostaining. Markers of ER stress (ATF6, HSPA5, DDIT3), autophagy (ATG5, BECN1, ATG7), and apoptosis (CASP3, BAD, BCL 2 ) were also quantitated by quantitative reverse transcriptase polymerase chain reaction. Measurements were repeated after 48 hours of incubation with 10 mM sodium 4-phenylbutyrate acid. Both COL4A5 missense variants were associated with reduced proliferation rates on day 6 ( P  = 0.01 and P  = 0.03), ER enlargement, and increased mRNA for ER stress and autophagy (all P values < 0.05) when compared with normal. Sodium 4-phenylbutyrate treatment increased COL4A5 transcript levels ( P  < 0.01), and reduced ER size ( P  < 0.01 by EM and P  < 0.001 by immunostaining), ER stress (p HSPA5 and DDIT3, all P values < 0.01) and autophagy (ATG7, P  < 0.01). Extracellular collagen IV α5 chain was increased in the M1 line only ( P  = 0.06). Sodium 4-phenylbutyrate increases collagen IV α5 mRNA levels, reduces ER stress and autophagy, and possibly facilitates collagen IV α5 extracellular transport. Whether these actions delay end-stage renal failure in men with X-linked Alport syndrome and missense mutations will only be determined with clinical trials.

  10. Evaluation of different embryonating bird eggs and cell cultures for isolation efficiency of avian influenza A virus and avian paramyxovirus serotype 1 from real-time reverse transcription polymerase chain reaction--positive

    USDA-ARS?s Scientific Manuscript database

    Two hundred samples collected from Anseriformes, Charadriiformes, Gruiformes, and Galliformes were assayed using real-time reverse transcriptase polymerase chain reaction (RRT-PCR) for presence of avian influenza virus and avian paramyxovirus-1. Virus isolation using embryonating chicken eggs, embr...

  11. Proteomic identification of potential biomarkers for cervical squamous cell carcinoma and human papillomavirus infection.

    PubMed

    Qing, Song; Tulake, Wuniqiemu; Ru, Mingfang; Li, Xiaohong; Yuemaier, Reziwanguli; Lidifu, Dilare; Rouzibilali, Aierken; Hasimu, Axiangu; Yang, Yun; Rouziahong, Reziya; Upur, Halmurat; Abudula, Abulizi

    2017-04-01

    It is known that high-risk human papillomavirus infection is the main etiological factor in cervical carcinogenesis. However, human papillomavirus screening is not sufficient for early diagnosis. In this study, we aimed to identify potential biomarkers common to cervical carcinoma and human papillomavirus infection by proteomics for human papillomavirus-based early diagnosis and prognosis. To this end, we collected 76 cases of fresh cervical tissues and 116 cases of paraffin-embedded tissue slices, diagnosed as cervical squamous cell carcinoma, cervical intraepithelial neoplasia II-III, or normal cervix from ethnic Uighur and Han women. Human papillomavirus infection by eight oncogenic human papillomavirus types was detected in tissue DNA samples using a quantitative polymerase chain reaction. The protein profile of cervical specimens from human papillomavirus 16-positive squamous cell carcinoma and human papillomavirus-negative normal controls was analyzed by proteomics and bioinformatics. The expression of candidate proteins was further determined by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. We identified 67 proteins that were differentially expressed in human papillomavirus 16-positive squamous cell carcinoma compared to normal cervix. The quantitative reverse transcriptase-polymerase chain reaction analysis verified the upregulation of ASAH1, PCBP2, DDX5, MCM5, TAGLN2, hnRNPA1, ENO1, TYPH, CYC, and MCM4 in squamous cell carcinoma compared to normal cervix ( p < 0.05). In addition, the transcription of PCBP2, MCM5, hnRNPA1, TYPH, and CYC was also significantly increased in cervical intraepithelial neoplasia II-III compared to normal cervix. Immunohistochemistry staining further confirmed the overexpression of PCBP2, hnRNPA1, ASAH1, and DDX5 in squamous cell carcinoma and cervical intraepithelial neoplasia II-III compared to normal controls ( p < 0.05). Our data suggest that the expression of ASAH1, PCBP2, DDX5, and hnRNPA1, and possibly MCM4, MCM5, CYC, ENO1, and TYPH, is upregulated during cervical carcinogenesis and potentially associated with human papillomavirus infection. Further validation studies of the profile will contribute to establishing auxiliary diagnostic markers for human papillomavirus-based cancer prognosis.

  12. HOX genes in human lung: altered expression in primary pulmonary hypertension and emphysema.

    PubMed

    Golpon, H A; Geraci, M W; Moore, M D; Miller, H L; Miller, G J; Tuder, R M; Voelkel, N F

    2001-03-01

    HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3' end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases.

  13. HOX Genes in Human Lung

    PubMed Central

    Golpon, Heiko A.; Geraci, Mark W.; Moore, Mark D.; Miller, Heidi L.; Miller, Gary J.; Tuder, Rubin M.; Voelkel, Norbert F.

    2001-01-01

    HOX genes belong to the large family of homeodomain genes that function as transcription factors. Animal studies indicate that they play an essential role in lung development. We investigated the expression pattern of HOX genes in human lung tissue by using microarray and degenerate reverse transcriptase-polymerase chain reaction survey techniques. HOX genes predominantly from the 3′ end of clusters A and B were expressed in normal human adult lung and among them HOXA5 was the most abundant, followed by HOXB2 and HOXB6. In fetal (12 weeks old) and diseased lung specimens (emphysema, primary pulmonary hypertension) additional HOX genes from clusters C and D were expressed. Using in situ hybridization, transcripts for HOXA5 were predominantly found in alveolar septal and epithelial cells, both in normal and diseased lungs. A 2.5-fold increase in HOXA5 mRNA expression was demonstrated by quantitative reverse transcriptase-polymerase chain reaction in primary pulmonary hypertension lung specimens when compared to normal lung tissue. In conclusion, we demonstrate that HOX genes are selectively expressed in the human lung. Differences in the pattern of HOX gene expression exist among fetal, adult, and diseased lung specimens. The altered pattern of HOX gene expression may contribute to the development of pulmonary diseases. PMID:11238043

  14. Recommendations for the standardization of bone marrow disease assessment and reporting in children with neuroblastoma on behalf of the International Neuroblastoma Response Criteria Bone Marrow Working Group.

    PubMed

    Burchill, Susan A; Beiske, Klaus; Shimada, Hiroyuki; Ambros, Peter F; Seeger, Robert; Tytgat, Godelieve A M; Brock, Penelope R; Haber, Michelle; Park, Julie R; Berthold, Frank

    2017-04-01

    The current study was conducted to expedite international standardized reporting of bone marrow disease in children with neuroblastoma and to improve equivalence of care. A multidisciplinary International Neuroblastoma Response Criteria Bone Marrow Working Group was convened by the US National Cancer Institute in January 2012 with representation from Europe, North America, and Australia. Practical transferable recommendations to standardize the reporting of bone marrow disease were developed. To the authors' knowledge, the current study is the first to comprehensively present consensus criteria for the collection, analysis, and reporting of the percentage area of bone marrow parenchyma occupied by tumor cells in trephine-biopsies. The quantitative analysis of neuroblastoma content in bone marrow aspirates by immunocytology and reverse transcriptase-quantitative polymerase chain reaction are revised. The inclusion of paired-like homeobox 2b (PHOX2B) for immunohistochemistry and reverse transcriptase-quantitative polymerase chain reaction is recommended. Recommendations for recording bone marrow response are provided. The authors endorse the quantitative assessment of neuroblastoma cell content in bilateral core needle biopsies-trephines and aspirates in all children with neuroblastoma, with the exception of infants, in whom the evaluation of aspirates alone is advised. It is interesting to note that 5% disease is accepted as an internationally achievable level for disease assessment. The quantitative assessment of neuroblastoma cells is recommended to provide data from which evidence-based numerical criteria for the reporting of bone marrow response can be realized. This is particularly important in the minimal disease setting and when neuroblastoma detection in bone marrow is intermittent, where clinical impact has yet to be validated. The wide adoption of these harmonized criteria will enhance the ability to compare outcomes from different trials and facilitate collaborative trial design. Cancer 2017;123:1095-1105. © 2016 American Cancer Society. © 2016 American Cancer Society.

  15. Fatal hemorrhagic fever caused by West Nile virus in the United States.

    PubMed

    Paddock, Christopher D; Nicholson, William L; Bhatnagar, Julu; Goldsmith, Cynthia S; Greer, Patricia W; Hayes, Edward B; Risko, Joseph A; Henderson, Corey; Blackmore, Carina G; Lanciotti, Robert S; Campbell, Grant L; Zaki, Sherif R

    2006-06-01

    Most West Nile virus (WNV) infections in humans are asymptomatic; severe disease occurs in relatively few patients and typically manifests as encephalitis, meningitis, or acute flaccid paralysis. A few cases of life-threatening disease with diffuse hemorrhagic manifestations have been reported in Africa; however, this clinical presentation has not been documented for any of the >16,700 cases of WNV disease reported in the United States during 1999-2004. We describe a case of fulminant WNV infection in a 59-year-old Florida man who died following a brief illness that resembled hemorrhagic disease caused by Rickettsia reckettsii, dengue virus or yellow fever virus. Traditional and contemporary diagnostic assays, including culture isolation, electron microscopic examination, reverse-transcriptase polymerase chain reaction amplification, and immunohistochemical stains, were used to confirm systemic WNV infection in the patient. WNV was isolated in a cell culture from a skin biopsy specimen obtained from the patient shortly prior to death. Electron microscopic examination identified the isolate as a flavivirus, and reverse-transcriptase polymerase chain reaction amplified specific WNV sequences from the isolate and patient tissue. Quantitative polymerase chain reaction identified approximately 1x10(7) viral copies/mL in the patient's serum. WNV antigens were detected by immunohistochemical stains in intravascular mononuclear cells and endothelium in skin, lung, liver, kidney, spleen, bone marrow, and central nervous system; no viral antigens were identified in neurons or glial cells of the central nervous system. Although hemorrhagic disease is a rare manifestation of WNV infection, the findings provided by this report may offer new insights regarding the clinical spectrum and pathogenesis of WNV disease in humans.

  16. Oligonucleotide microarray analysis of gene expression profiles followed by real-time reverse-transcriptase polymerase chain reaction assay in chronic active Epstein-Barr virus infection.

    PubMed

    Ito, Yoshinori; Shibata-Watanabe, Yukiko; Ushijima, Yoko; Kawada, Jun-Ichi; Nishiyama, Yukihiro; Kojima, Seiji; Kimura, Hiroshi

    2008-03-01

    Chronic active Epstein-Barr virus infection (CAEBV) is characterized by recurrent infectious mononucleosis-like symptoms and has high mortality and morbidity. To clarify the mechanisms of CAEBV, the gene-expression profiles of peripheral blood obtained from patients with CAEBV were investigated. Twenty genes were differentially expressed in 4 patients with CAEBV. This microarray result was verified using a real-time reverse-transcriptase polymerase chain reaction assay in a larger group of patients with CAEBV. Eventually, 3 genes were found to be significantly upregulated: guanylate binding protein 1, tumor necrosis factor-induced protein 6, and guanylate binding protein 5. These genes may be associated with the inflammatory reaction or with cell proliferation.

  17. The prognostic role of E2A-PBX1 expression detected by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) in B cell acute lymphoblastic leukemia after allogeneic hematopoietic stem cell transplantation.

    PubMed

    Hong, Yan; Zhao, Xiaosu; Qin, Yazhen; Zhou, Songhai; Chang, Yingjun; Wang, Yu; Zhang, Xiaohui; Xu, Lanping; Huang, Xiaojun

    2018-04-28

    The E2A-PBX1 rearrangement is common in B cell acute lymphoblastic leukemia (B-ALL). However, whether this fusion gene can be used as a reliable marker for minimal residual disease (MRD) following allogeneic hematopoietic stem cell transplantation (allo-HSCT) remains unknown. In this study, clinical data were collected from 28 consecutive B-ALL patients who received allo-HSCT. Their MRD was evaluated by E2A-PBX1 and leukemia-associated immunophenotype (LAIP). The median follow-up was 374 days (55-2342 days). Of the enrolled patients, seven (25%) patients died of leukemia relapse. A total of nine (32.1%) patients experienced relapse at a median of 164 days (75-559 days) after transplantation. The median expression level in the first positive sample was 0.14% (0.0071-902.4%). The duration from E2A-PBX1-positive results to hematological relapse was 74 days (30-469 days). E2A-PBX1 expression generally became positive prior to flow cytometry. Patients with positive E2A-PBX1 gene expression pre-transplantation were more likely to have positive E2A-PBX1 expression after transplantation. Taken all together, E2A-PBX1 expression determined by real-time quantitative reverse transcriptase polymerase chain reaction (RQ-PCR) could be used to evaluate MRD status after allo-HSCT. Patients with positive E2A-PBX1 expression after transplant will have a poor prognosis.

  18. Vascular endothelial growth factor and platelet-derived growth factor are potential angiogenic and metastatic factors in human breast cancer.

    PubMed

    Anan, K; Morisaki, T; Katano, M; Ikubo, A; Kitsuki, H; Uchiyama, A; Kuroki, S; Tanaka, M; Torisu, M

    1996-03-01

    Angiogenesis is a prerequisite for tumor growth and metastasis. Tumor angiogenesis may be mediated by several angiogenic factors such as vascular endothelial growth factor (VEGF), platelet-derived growth factor (PDGF), transforming growth factor-alpha, and basic fibroblast growth factor. Differential mRNA expressions of VEGF, PDGF (A chain), transforming growth factor-alpha and basic fibroblast growth factor in 32 primary invasive breast tumors were examined by reverse transcriptase-polymerase chain reaction. We analyzed relationships between mRNA expressions of these angiogenic factors and the degree of angiogenesis, tumor size, and metastasis. Quantification of angiogenesis was achieved by the immunohistochemical staining of endothelial cells with antibody to CD31. VEGF and PDGF-A mRNAs were expressed more frequently in breast tumors than in nontumor breast tissues, whereas no difference was found in expression frequency of either transforming growth factor-alpha or basic fibroblast growth factor mRNA. Vascular counts in tumors correlated with each expression frequency of VEGF and PDGF-A mRNA. PDGF-A mRNA was expressed more frequently in tumors with lymph node metastasis than in those without metastasis. Expression of VEGF and PDGF mRNAs detected by reverse transcriptase-polymerase chain reaction in breast tumors correlates with tumor-related characteristics of angiogenesis and metastatic potential. Analysis of these mRNAs by reverse transcriptase-polymerase chain reaction may be useful for assessing the biologic behavior of a breast tumor before surgical treatment.

  19. Expression of TGF-beta1, osteonectin, and BMP-4 in mandibular distraction osteogenesis with compression stimulation: reverse transcriptase-polymerase chain reaction study and biomechanical test.

    PubMed

    Kim, Uk-Kyu; Park, Seong-Jin; Seong, Wook-Jin; Heo, Jun; Hwang, Dae-Seok; Kim, Yong-Deok; Shin, Sang-Hun; Kim, Gyoo-Cheon

    2010-09-01

    This study compared the levels of transforming growth factor-beta1 (TGF-beta1), osteonectin, and bone morphogenetic protein-4 (BMP-4) expression in regenerated bone in a rabbit mandible that had undergone conventional distraction osteogenesis (DO) with those in regenerated bone from a modified DO technique with compression stimulation. A total of 42 rabbits were used in this reverse transcriptase-polymerase chain reaction study. In the control group, distraction was performed at 1 mm/day for 8 days. In the experimental group, overdistraction was performed for 10 days, followed by a 3-day latency period and 2 days of compression to achieve the same amount of DO. Three rabbits per subgroup were killed at 0, 5, 13, 20, 27, 34, and 41 days after the initial osteotomy. The levels of TGF-beta1, osteonectin, and BMP-4 in the bone regenerates were measured by reverse transcriptase-polymerase chain reaction. A biomechanical microhardness test was also performed in 8 rabbits as a separate experiment. Reverse transcriptase-polymerase chain reaction revealed a greater level of TGF-beta1 in the experimental group immediately after applying the compression force that continued for 2 weeks. The level then decreased to that of the control group at 3 weeks. The greater level of osteonectin in the experimental group after compression than that in the control group continued for 3 weeks. In the experimental group, the level of BMP-4 increased immediately after compression. However, the level in the control group decreased. The microhardness ratio of distracted bone to normal bone on the cortex was statistically different at 0.47 in the control group and 0.80 in the experimental group (P = .049) at 55 days after osteotomy. The effectiveness of the new DO technique with compression stimulation was confirmed by the gene expression study and the biomechanical test findings. Copyright 2010 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  20. Transcription of G-protein coupled receptors in corporeal smooth muscle is regulated by the endogenous neutral endopeptidase inhibitor sialorphin.

    PubMed

    Tong, Yuehong; Tiplitsky, Scott I; Tar, Moses; Melman, Arnold; Davies, Kelvin P

    2008-08-01

    Several reports suggest that the rat Vcsa1 gene is down-regulated in models of erectile dysfunction. The Vcsa protein product sialorphin is an endogenous neutral endopeptidase inhibitor and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated whether Vcsa1 down-regulation could result in an adaptive change in GPCR (G-protein coupled receptor) expression. Gene expression in cultured rat corporeal smooth muscle cells following treatment with siRNA directed against Vcsa1 or the neutral endopeptidase gene was analyzed using microarray and quantitative reverse transcriptase-polymerase chain reaction. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernous nerves. In that animal model we also investigated whether Vcsa1 down-regulation was accompanied by similar changes in gene expression in corporeal smooth muscle cells in which Vcsa1 was knocked down in vitro. Microarray analysis and quantitative reverse transcriptase-polymerase chain reaction demonstrated that corporeal smooth muscle cells treated in vitro with siRNA against Vcsa1 resulted in GPCR up-regulation as a functional group. In contrast, treatment of corporeal smooth muscle cells that lowered neutral endopeptidase activity resulted in decreased GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on neutral endopeptidase. In animals with bilaterally transected cavernous nerves the decreased Vcsa1 expression is accompanied by increased GPCR expression in cavernous tissue. These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression.

  1. Two assays for measuring fibrosis: reverse transcriptase-polymerase chain reaction of collagen alpha(1) (III) mRNA is an early predictor of subsequent collagen deposition while a novel serum N-terminal procollagen (III) propeptide assay reflects manifest fibrosis in carbon tetrachloride-treated rats.

    PubMed

    Kauschke, S G; Knorr, A; Heke, M; Kohlmeyer, J; Schauer, M; Theiss, G; Waehler, R; Burchardt, E R

    1999-11-15

    Using a novel quantitative reverse transcriptase-polymerase chain reaction assay, we have determined the amount of specific mRNA for procollagen alpha(1) (III) (PIIIP) in the carbon tetrachloride (CCl(4)) model of liver fibrosis in rats. After a single week of CCl(4) application, the amount of PIIIP mRNA was increased approximately 10 times over the untreated control group and continued to increase to approximately 30 times after 7 weeks of intoxication. In this model substantial fibrosis was demonstrated by computer-aided morphometry after 5 to 7 weeks of treatment. Using recombinant murine N-terminal procollagen alpha(1) (III) propeptide (PIIINP), a novel sensitive immunoassay for the measurement of circulating PIIINP in rodent sera was established. An increase in PIIINP serum levels was observed after 5 to 7 weeks of CCl(4) intoxication. Our results suggest PIIIP gene expression is an early marker of tissue fibrosis. Early PIIIP gene expression is correlated with the extent of the subsequent fibrosis. PIIIP mRNA levels increase much earlier than conventional histological examination or PIIINP levels. PIIINP measurements with our new serum assay, on the other hand, are a good noninvasive marker of manifest fibrosis but are a poor marker of fibrogenesis. Copyright 1999 Academic Press.

  2. Differentiation of human-induced pluripotent stem cells into insulin-producing clusters.

    PubMed

    Shaer, Anahita; Azarpira, Negar; Vahdati, Akbar; Karimi, Mohammad Hosein; Shariati, Mehrdad

    2015-02-01

    In diabetes mellitus type 1, beta cells are mostly destroyed; while in diabetes mellitus type 2, beta cells are reduced by 40% to 60%. We hope that soon, stem cells can be used in diabetes therapy via pancreatic beta cell replacement. Induced pluripotent stem cells are a kind of stem cell taken from an adult somatic cell by "stimulating" certain genes. These induced pluripotent stem cells may be a promising source of cell therapy. This study sought to produce isletlike clusters of insulin-producing cells taken from induced pluripotent stem cells. A human-induced pluripotent stem cell line was induced into isletlike clusters via a 4-step protocol, by adding insulin, transferrin, and selenium (ITS), N2, B27, fibroblast growth factor, and nicotinamide. During differentiation, expression of pancreatic β-cell genes was evaluated by reverse transcriptase-polymerase chain reaction; the morphologic changes of induced pluripotent stem cells toward isletlike clusters were observed by a light microscope. Dithizone staining was used to stain these isletlike clusters. Insulin produced by these clusters was evaluated by radio immunosorbent assay, and the secretion capacity was analyzed with a glucose challenge test. Differentiation was evaluated by analyzing the morphology, dithizone staining, real-time quantitative polymerase chain reaction, and immunocytochemistry. Gene expression of insulin, glucagon, PDX1, NGN3, PAX4, PAX6, NKX6.1, KIR6.2, and GLUT2 were documented by analyzing real-time quantitative polymerase chain reaction. Dithizone-stained cellular clusters were observed after 23 days. The isletlike clusters significantly produced insulin. The isletlike clusters could increase insulin secretion after a glucose challenge test. This work provides a model for studying the differentiation of human-induced pluripotent stem cells to insulin-producing cells.

  3. A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

    PubMed

    Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

    2010-01-15

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

  4. Use of Scented Sugar Bait Stations to Track Mosquito-Borne Arbovirus Transmission in California

    PubMed Central

    LOTHROP, HUGH D.; WHEELER, SARAH S.; FANG, YING; REISEN, WILLIAM K.

    2012-01-01

    Laboratory and field research was conducted to determine if Culex tarsalis Coquillett expectorated West Nile virus (WNV) during sugar feeding and if a lure or bait station could be developed to exploit this behavior for WNV surveillance. Experimentally infected Cx. tarsalis repeatedly expectorated WNV onto filter paper strips and into vials with wicks containing sucrose that was readily detectable by a quantitative reverse transcriptase-polymerase chain reaction assay. Few females (33%, n = 27) became infected by imbibing sugar solutions spiked with high concentrations (107 plaque forming units/ml) of WNV, indicating sugar feeding stations probably would not be a source of WNV infection. In nature, sugar bait stations scented with the floral attractant phenyl acetaldehyde tracked WNV transmission activity in desert but not urban or agricultural landscapes in California. When deployed in areas of the Coachella Valley with WNV activity during the summer of 2011, 27 of 400 weekly sugar samples (6.8%) tested positive for WNV RNA by reverse transcriptase-polymerase chain reaction. Prevalence of positives varied spatially, but positive sugar stations were detected before concurrent surveillance measures of infection (mosquito pools) or transmission (sentinel chicken seroconversions). In contrast, sugar bait stations deployed in urban settings in Los Angeles or agricultural habits near Bakersfield in Kern County supporting WNV activity produced 1 of 90 and 0 of 60 positive weekly sugar samples, respectively. These results with sugar bait stations will require additional research to enhance bait attractancy and to understand the relationship between positive sugar stations and standard metrics of arbovirus surveillance. PMID:23270177

  5. Delayed vaccine virus replication in chickens vaccinated subcutaneously with an immune complex infectious bursal disease vaccine: Quantification of vaccine virus by real-time polymerase chain reaction

    PubMed Central

    2005-01-01

    Abstract The distribution of the immune complex vaccine virus for infectious bursal disease (IBD) in tissue was examined and the viral loads of the organs were quantitatively compared. One-day-old specific pathogen free (SPF) and maternally immune broiler chickens were injected subcutaneously with the vaccine. Lymphoid and non-lymphoid tissues were collected at various time intervals during the experiment to test for infectious bursal disease virus (IBDV)-RNA by using reverse transcriptase-polymerase chain reaction (RT-PCR). Only the bursa of Fabricius was found to be positive with unusually long viral persistence in the broiler group. The positive bursa samples were further investigated by using real-time PCR coupled with a TaqMan probe. The highest amounts of the virus were detected at its first appearance in the bursa: on day 14 post vaccination (PV) in the SPF chickens and on day 17 and day 21 PV in the maternally immune broiler group. The virus then gradually cleared, most likely due to the parallel appearance of the active immune response indicated by seroconversion. PMID:15971678

  6. First report of Cocksfoot mottle virus infecting wheat (Triticum aestivum) in Ohio

    USDA-ARS?s Scientific Manuscript database

    Cocksfoot mottle virus (CfMV) was discovered in Ohio wheat during a 2016 field survey utilizing RNA-Seq to identify virus-like sequences. Virus sequences were confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and Sanger sequencing, and CfMV was transmitted to orchardgrass and pas...

  7. Isolation and characterization of an AGAMOUS homolog from Fraxinus pennsylvanica

    Treesearch

    Ningxia Du; Paula M. Pijut

    2010-01-01

    An AGAMOUS homolog (FpAG) was isolated from green ash (Fraxinus pennsylvanica) using a reverse transcriptase polymerase chain reaction method. Southern blot analysis indicated that FpAG was present as a single-copy sequence in the genome of green ash. RNA accumulated in the reproductive tissues (female...

  8. A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†

    PubMed Central

    Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai

    2009-01-01

    During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463

  9. Measurement of gene expression in archival paraffin-embedded tissues: development and performance of a 92-gene reverse transcriptase-polymerase chain reaction assay.

    PubMed

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C; Shak, Steven; Kiefer, Michael C; Esteban, Jose M; Baker, Joffre B

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10- micro m FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests.

  10. Reverse transcriptase polymerase chain reaction on fine needle aspirates for rapid detection of translocations in synovial sarcoma.

    PubMed

    Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O

    1998-01-01

    To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.

  11. Induction of vascular endothelial growth factor expression in human pulp fibroblasts stimulated with black-pigmented Bacteroides.

    PubMed

    Yang, L-C; Tsai, C-H; Huang, F-M; Su, Y-F; Lai, C-C; Liu, C-M; Chang, Y-C

    2004-09-01

    To investigate the effect of black-pigmented Bacteroides on the expression of vascular endothelial growth factor (VEGF) gene in human pulp fibroblasts. The supernatants of Porphyromonas endodontalis, Porphyromonas gingivalis and Prevotella intermedia were used to evaluate VEGF gene expression in human pulp fibroblasts. The levels of mRNAs were measured by the quantitative reverse-transcriptase polymerase chain reaction analysis. Black-pigmented Bacteroides induced significantly high levels of VEGF mRNA gene expression in human pulp fibroblasts (P < 0.05). In addition, the expression of VEGF depended on the bacteria tested. Black-pigmented Bacteroides may be involved in developing pulpal disease through the stimulation of VEGF production that would lead to the expansion of the vascular network coincident to progression of the inflammation.

  12. An inducible HSP70 gene from the midge Chironomus dilutus: Characterization and transcription profile under environmental stress

    USGS Publications Warehouse

    Karouna-Renier, N. K.; Rao, K.R.

    2009-01-01

    In the present study, we identified and characterized an inducible heat shock protein 70 (HSP70) from the midge Chironomus dilutus and investigated the transcriptional profile of the gene under baseline and environmentally stressful conditions. Using real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR), we observed increased expression of CD-HSP70-1 in response to both heat shock and copper stress. We also investigated the expression of this gene during midge development. All C. dilutus developmental stages expressed CD-HSP70-1 under normal conditions, although at extremely low levels. Phylogenetic analysis of the amino acid sequence demonstrated distinct clustering of this gene with inducible HSP70s from other insect species. ?? 2008 The Authors.

  13. Evaluating Fumonisin Gene Expression in Fusarium verticillioides.

    PubMed

    Scala, Valeria; Visentin, Ivan; Cardinale, Francesca

    2017-01-01

    Transcript levels of key genes in a biosynthetic pathway are often taken as a proxy for metabolite production. This is the case of FUM1, encoding the first dedicated enzyme in the metabolic pathway leading to the production of the mycotoxins Fumonisins by fungal species belonging to the genus Fusarium. FUM1 expression can be quantified by different methods; here, we detail a protocol based on quantitative reverse transcriptase polymerase chain reaction (RT-qPCR), by which relative or absolute transcript abundance can be estimated in Fusaria grown in vitro or in planta. As very seldom commercial kits for RNA extraction and cDNA synthesis are optimized for fungal samples, we developed a protocol tailored for these organisms, which stands alone but can be also easily integrated with specific reagents and kits commercially available.

  14. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice.

    PubMed

    Huang, Chun; Li, Runqin; Zhang, Yinglin; Gong, Jianping

    2017-10-01

    Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells.

  15. Amarogentin Induces Apoptosis of Liver Cancer Cells via Upregulation of p53 and Downregulation of Human Telomerase Reverse Transcriptase in Mice

    PubMed Central

    Li, Runqin; Zhang, Yinglin

    2016-01-01

    Background and Objective: Amarogentin has been reported to have a preventive effect on liver cancer via inducing cancer cell apoptosis. We attempted to elucidate the roles of p53-associated apoptosis pathways in the chemopreventive mechanism of amarogentin. The findings of this study will facilitate the development of a novel supplementary strategy for the treatment of liver cancer. Materials and Methods: The purity of amarogentin was assessed by high-performance liquid chromatography. The inhibitory ratios of the liver cell lines were determined using a Cell Counting Kit-8 following treatment with a gradient concentration of amarogentin. Cell apoptosis was detected by flow cytometry using annexin V-fluorescein isothiocyanate/propidium iodide kits. The gene and protein expression of p53-associated molecules, such as Akt, human telomerase reverse transcriptase, RelA, and p38, was detected by real-time quantitative polymerase chain reaction, Western blotting, and immunohistochemical staining in liver cancer cells and mouse tumor tissues after treatment with amarogentin. Results: The inhibitory effect of amarogentin on cell proliferation was more obvious in liver cancer cells, and amarogentin was more likely to induce the apoptosis of liver cancer cells than that of normal liver cells. The gene and protein expression levels of Akt, RelA, and human telomerase reverse transcriptase were markedly higher in the control group than in the preventive group and treatment groups. Only the expression of human telomerase reverse transcriptase was downregulated, accompanied by the upregulation of p53. Conclusion: The results of our study suggest that amarogentin promotes apoptosis of liver cancer cells by the upregulation of p53 and downregulation of human telomerase reverse transcriptase and prevents the malignant transformation of these cells. PMID:27402632

  16. Bioinformatic analysis of variability of Newcastle disease virus diagnostic primers and probes and the potential for false negative detection

    USDA-ARS?s Scientific Manuscript database

    The use of reverse transcriptase polymerase chain reaction (RT-PCR) or other molecular diagnostic methods is commonly used for the primary diagnosis of Newcastle disease virus (NDV). However, NDV in nature has a range of virulence, and the low virulence viruses must be differentiated from virulent ...

  17. Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza

    USDA-ARS?s Scientific Manuscript database

    The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...

  18. Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

    PubMed Central

    Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

    2014-01-01

    Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

  19. A full-coordinate model of the polymerase domain of HIV-1 reverse transcriptase and its interaction with a nucleic acid substrate

    NASA Technical Reports Server (NTRS)

    Setlik, R. F.; Meyer, D. J.; Shibata, M.; Roskwitalski, R.; Ornstein, R. L.; Rein, R.

    1994-01-01

    We present a full-coordinate model of residues 1-319 of the polymerase domain of HIV-I reverse transcriptase. This model was constructed from the x-ray crystallographic structure of Jacobo-Molina et al. (Jacobo-Molina et al., P.N.A.S. USA 90, 6320-6324 (1993)) which is currently available to the degree of C-coordinates. The backbone and side-chain atoms were constructed using the MAXSPROUT suite of programs (L. Holm and C. Sander, J. Mol. Biol. 218, 183-194 (1991)) and refined through molecular modeling. A seven base pair A-form dsDNA was positioned in the nucleic acid binding cleft to represent the template-primer complex. The orientation of the template-primer complex in the nucleic acid binding cleft was guided by the positions of phosphorus atoms in the crystal structure.

  20. Identification of reference genes for RT-qPCR analysis in peach genotypes with contrasting chilling requirements.

    PubMed

    Marini, N; Bevilacqua, C B; Büttow, M V; Raseira, M C B; Bonow, S

    2017-05-25

    Selecting and validating reference genes are the first steps in studying gene expression by reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR). The present study aimed to evaluate the stability of five reference genes for the purpose of normalization when studying gene expression in various cultivars of Prunus persica with different chilling requirements. Flower bud tissues of nine peach genotypes from Embrapa's peach breeding program with different chilling requirements were used, and five candidate reference genes based on the RT-qPCR that were useful for studying the relative quantitative gene expression and stability were evaluated using geNorm, NormFinder, and bestKeeper software packages. The results indicated that among the genes tested, the most stable genes to be used as reference genes are Act and UBQ10. This study is the first survey of the stability of reference genes in peaches under chilling stress and provides guidelines for more accurate RT-qPCR results.

  1. Incorporation of deoxyribonucleotides and ribonucleotides by a dNTP-binding cleft mutated reverse transcriptase in hepatitis B virus core particles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hee-Young; Kim, Hye-Young; Jung, Jaesung

    2008-01-05

    Our recent observation that hepatitis B virus (HBV) DNA polymerase (P) might initiate minus-strand DNA synthesis without primer [Kim et al., (2004) Virology 322, 22-30], raised a possibility that HBV P protein may have the potential to function as an RNA polymerase. Thus, we mutated Phe 436, a bulky amino acid with aromatic side chain, at the putative dNTP-binding cleft in reverse transcriptase (RT) domain of P protein to smaller amino acids (Gly or Val), and examined RNA polymerase activity. HBV core particles containing RT dNTP-binding cleft mutant P protein were able to incorporate {sup 32}P-ribonucleotides, but not HBV coremore » particles containing wild type (wt), priming-deficient mutant, or RT-deficient mutant P proteins. Since all the experiments were conducted with core particles isolated from transfected cells, our results indicate that the HBV RT mutant core particles containing RT dNTP-binding cleft mutant P protein could incorporate both deoxyribonucleotides and ribonucleotides in replicating systems.« less

  2. Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

    PubMed

    Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

    2000-06-15

    A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

  3. Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction.

    PubMed

    Elhafi, G; Naylor, C J; Savage, C E; Jones, R C

    2004-06-01

    A method is described for enabling safe transit of denatured virus samples for polymerase chain reaction (PCR) identification without the risk of unwanted viable viruses. Cotton swabs dipped in avian infectious bronchitis virus (IBV) or avian pneumovirus (APV) were allowed to dry. Newcastle disease virus and avian influenza viruses were used as controls. Autoclaving and microwave treatment for as little as 20 sec destroyed the infectivity of all four viruses. However, both IBV and APV could be detected by reverse transcriptase (RT)-PCR after autoclaving and as long as 5 min microwave treatment (Newcastle disease virus and avian influenza viruses were not tested). Double microwave treatment of IBV and APV with an interval of 2 to 7 days between was tested. After the second treatment, RT-PCR products were readily detected in all samples. Swabs from the tracheas and cloacas of chicks infected with IBV shown to contain infectious virus were microwaved. Swabs from both sources were positive by RT-PCR. Microwave treatment appears to be a satisfactory method of inactivating virus while preserving nucleic acid for PCR identification.

  4. Molecular Diagnostics in Colorectal Carcinoma: Advances and Applications for 2018.

    PubMed

    Bhalla, Amarpreet; Zulfiqar, Muhammad; Bluth, Martin H

    2018-06-01

    The molecular pathogenesis and classification of colorectal carcinoma are based on the traditional adenomaecarcinoma sequence, serrated polyp pathway, and microsatellite instability (MSI). The genetic basis for hereditary nonpolyposis colorectal cancer is the detection of mutations in the MLH1, MSH2, MSH6, PMS2, and EPCAM genes. Genetic testing for Lynch syndrome includes MSI testing, methylator phenotype testing, BRAF mutation testing, and molecular testing for germline mutations in MMR genes. Molecular makers with predictive and prognostic implications include quantitative multigene reverse transcriptase polymerase chain reaction assay and KRAS and BRAF mutation analysis. Mismatch repair-deficient tumors have higher rates of programmed death-ligand 1 expression. Cell-free DNA analysis in fluids are proving beneficial for diagnosis and prognosis in these disease states towards effective patient management. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. Multiplex hydrolysis probe real-time PCR for simultaneous detection of hepatitis A virus and hepatitis E virus.

    PubMed

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-05-30

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV.

  6. DNA and RNA polymerase activity in a Moniliophthora perniciosa mitochondrial plasmid and self-defense against oxidative stress.

    PubMed

    Andrade, B S; Villela-Dias, C; Gomes, D S; Micheli, F; Góes-Neto, A

    2013-06-13

    Moniliophthora perniciosa (Stahel) Aime and Phillips-Mora is a hemibiotrophic basidiomycete (Agaricales, Tricholomataceae) that causes witches' broom disease in cocoa (Theobroma cacao L.). This pathogen carries a stable integrated invertron-type linear plasmid in its mitochondrial genome that encodes viral-like DNA and RNA polymerases related to fungal senescence and longevity. After culturing the fungus and obtaining its various stages of development in triplicate, we carried out total RNA extraction and subsequent complementary DNA synthesis. To analyze DNA and RNA polymerase expression levels, we performed real-time reverse transcriptase polymerase chain reaction for various fungal phases of development. Our results showed that DNA and RNA polymerase gene expression in the primordium phase of M. perniciosa is related to a potential defense mechanism against T. cacao oxidative attack.

  7. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  8. West Nile virus in overwintering Culex mosquitoes, New York City, 2000.

    PubMed Central

    Nasci, R. S.; Savage, H. M.; White, D. J.; Miller, J. R.; Cropp, B. C.; Godsey, M. S.; Kerst, A. J.; Bennett, P.; Gottfried, K.; Lanciotti, R. S.

    2001-01-01

    After the 1999 West Nile (WN) encephalitis outbreak in New York, 2,300 overwintering adult mosquitoes were tested for WN virus by cell culture and reverse transcriptase-polymerase chain reaction. WN viral RNA and live virus were found in pools of Culex mosquitoes. Persistence in overwintering Cx. pipiens may be important in the maintenance of WN virus in the northeastern United States. PMID:11585542

  9. Capsicum annum, a new host of watermelon mosaic virus.

    PubMed

    Hajizadeh, Mohammad; Mohammadi, Kazhal

    2016-03-01

    The occurrence of Watermelon mosaic virus (WMV) in sweet pepper (Capsicum annuum L.) in Kurdistan province, Iran was confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR) and partial characterization of coat protein. To the best of our knowledge, this is the first report of WMV infecting C. annuum, adding a new host to list of more than 170 species infected by this virus.

  10. Generation of non-genomic oligonucleotide tag sequences for RNA template-specific PCR

    PubMed Central

    Pinto, Fernando Lopes; Svensson, Håkan; Lindblad, Peter

    2006-01-01

    Background In order to overcome genomic DNA contamination in transcriptional studies, reverse template-specific polymerase chain reaction, a modification of reverse transcriptase polymerase chain reaction, is used. The possibility of using tags whose sequences are not found in the genome further improves reverse specific polymerase chain reaction experiments. Given the absence of software available to produce genome suitable tags, a simple tool to fulfill such need was developed. Results The program was developed in Perl, with separate use of the basic local alignment search tool, making the tool platform independent (known to run on Windows XP and Linux). In order to test the performance of the generated tags, several molecular experiments were performed. The results show that Tagenerator is capable of generating tags with good priming properties, which will deliberately not result in PCR amplification of genomic DNA. Conclusion The program Tagenerator is capable of generating tag sequences that combine genome absence with good priming properties for RT-PCR based experiments, circumventing the effects of genomic DNA contamination in an RNA sample. PMID:16820068

  11. Multiplex Hydrolysis Probe Real-Time PCR for Simultaneous Detection of Hepatitis A Virus and Hepatitis E Virus

    PubMed Central

    Qiu, Feng; Cao, Jingyuan; Su, Qiudong; Yi, Yao; Bi, Shengli

    2014-01-01

    Detection of hepatitis viral infections has traditionally relied on the circulating antibody test using the enzyme-linked immunosorbent assay. However, multiplex real-time PCR has been increasingly used for a variety of viral nucleic acid detections and has proven to be superior to traditional methods. Hepatitis A virus (HAV) and hepatitis E virus (HEV) are the major causes of acute hepatitis worldwide; both HAV and HEV infection are a main public health problem. In the present study, a one-step multiplex reverse transcriptase quantitative polymerase chain reaction assay using hydrolysis probes was developed for simultaneously detecting HAV and HEV. This novel detection system proved specific to the target viruses, to be highly sensitive and to be applicable to clinical sera samples, making it useful for rapid, accurate and feasible identification of HAV and HEV. PMID:24886818

  12. Effects of Trichostatin A on drug uptake transporters in primary rat hepatocyte cultures

    PubMed Central

    Ramboer, Eva; Rogiers, Vera; Vanhaecke, Tamara; Vinken, Mathieu

    2015-01-01

    The present study was set up to investigate the effects of Trichostatin A (TSA), a prototypical epigenetic modifier, on the expression and activity of hepatic drug uptake transporters in primary cultured rat hepatocytes. To this end, the expression of the sinusoidal transporters sodium-dependent taurocholate cotransporting polypeptide (Ntcp) and organic anion transporting polypeptide 4 (Oatp4) was monitored by real-time quantitative reverse transcriptase polymerase chain reaction analysis and immunoblotting. The activity of the uptake transporters was analyzed using radiolabeled substrates and chemical inhibitors. Downregulation of the expression and activity of Oatp4 and Ntcp was observed as a function of the cultivation time and could not be counteracted by TSA. In conclusion, the epigenetic modifier TSA does not seem to exert a positive effect on the expression and activity of the investigated uptake transporters in primary rat hepatocyte cultures. PMID:26648816

  13. Performance of the Directigen EZ Flu A+B rapid influenza diagnostic test to detect pandemic influenza A/H1N1 2009.

    PubMed

    Boyanton, Bobby L; Almradi, Amro; Mehta, Tejal; Robinson-Dunn, Barbara

    2014-04-01

    The Directigen EZ Flu A+B rapid influenza diagnostic test, as compared to real-time reverse transcriptase polymerase chain reaction, demonstrated suboptimal performance to detect pandemic influenza A/H1N1 2009. Age- and viral load-stratified test sensitivity ranged from 33.3 to 84.6% and 0 to 100%, respectively. © 2013.

  14. Course of c-myc mRNA expression in the regenerating mouse testis determined by competitive reverse transcriptase polymerase chain reaction.

    PubMed

    Amendola, R

    1994-11-01

    The c-myc proto-oncogene is a reliable marker of the "G0-early G1" transition, and its down-regulation is believed to be necessary to obtain cellular differentiation. In murine spermatogenesis, the level of c-myc transcripts does not correlate with the rate of cellular division. Proliferation of supposed staminal spermatogonia to reproduce themselves is induced with a local 5 Gy X-ray dose in 90-day-old C57Bl/6 mice. c-myc quantification by a newly developed competitive reverse transcriptase polymerase chain reaction (RT-PCR) was carried out to follow the expression course of this proto-oncogene. Damage and restoration of spermatogenesis were analyzed at days 3, 6, 9, 10, 13, 30, and 60 after injury by relative testes/body weight determination and histological examination. Proliferative status was determined by histone H3 Northern blot analysis. c-myc mRNA level was 10 times higher after 3 days in the irradiated animals compared to the controls. An increasing number of copies were noted up to 10 days, but promptly decreased to the base level found for irradiated mice from 13 to 60 days. Interestingly, the expression of histone H3 detected S phase only in testes at 60 days from damage.

  15. Use of a novel virus inactivation method for a multicenter avian influenza real-time reverse transcriptase-polymerase chain reaction proficiency study.

    PubMed

    Spackman, Erica; Suarez, David L

    2005-01-01

    Proficiency assessments are important elements in quality control for diagnostic laboratories. Traditionally, proficiency testing for polymerase chain reaction (PCR)-based assays has involved the use of clinical samples, samples "spiked" with live agents or DNA plasmids. Because of government regulations and biosecurity concerns, distribution of live high-consequence pathogens of livestock and poultry, such as avian influenza, is not possible, and DNA plasmids are not technically suitable for evaluating RNA virus detection. Therefore, a proficiency testing panel using whole avian influenza in a diluent containing a phenolic disinfectant that inactivates the virus while preserving the RNA for at least 8 weeks at -70 C was developed and used in a multicenter proficiency assessment for a type A influenza real-time reverse transcriptase (RT)-PCR test. The test, which was highly standardized, except for variation in the real-time RT-PCR equipment used, was shown to be highly reproducible by proficiency testing in 12 laboratories in the United States, Canada, and Hong Kong. Variation in cycle threshold values among 35 data sets and 490 samples was minimal (CV = 5.19%), and sample identifications were highly accurate (96.7% correct identifications) regardless of real-time PCR instrumentation.

  16. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  17. Dietary fat intake promotes the development of hepatic steatosis independently from excess caloric consumption in a murine model.

    PubMed

    de Meijer, Vincent E; Le, Hau D; Meisel, Jonathan A; Akhavan Sharif, M Reza; Pan, Amy; Nosé, Vânia; Puder, Mark

    2010-08-01

    Nonalcoholic fatty liver disease results from overconsumption and is a significant and increasing cause of liver failure. The type of diet that is conducive to the development of this disease has not been established, and evidence-based treatment options are currently lacking. We hypothesized that the onset of hepatic steatosis is linked to the consumption of a diet with a high fat content, rather than related to excess caloric intake. In addition, we also hypothesized that fully manifested hepatic steatosis could be reversed by reducing the fat percentage in the diet of obese mice. C57BL/6J male mice were fed either a purified rodent diet containing 10% fat or a diet with 60% of calories derived from fat. A pair-feeding design was used to distinguish the effects of dietary fat content and caloric intake on dietary-induced hepatic lipid accumulation and associated injury. Livers were analyzed by quantitative reverse transcriptase polymerase chain reaction for lipid metabolism-related gene expression. After 9 weeks, mice on the 60%-fat diet exhibited more weight gain, insulin resistance, and hepatic steatosis compared with mice on a 10%-fat diet with equal caloric intake. Furthermore, mice with established metabolic syndrome at 9 weeks showed reversal of hepatic steatosis, insulin resistance, and obesity when switched to a 10%-fat diet for an additional 9 weeks, independent of caloric intake. Quantitative reverse transcriptase polymerase chain reaction revealed that transcripts related to both de novo lipogenesis and increased uptake of free fatty acids were significantly up-regulated in mice pair-fed a 60%-fat diet compared with 10%-fat-fed animals. Dietary fat content, independent from caloric intake, is a crucial factor in the development of hepatic steatosis, obesity, and insulin resistance in the C57BL/6J diet-induced obesity model caused by increased uptake of free fatty acids and de novo lipogenesis. In addition, once established, all these features of the metabolic syndrome can be successfully reversed after switching obese mice to a diet low in fat. Low-fat diets deserve attention in the investigation of a potential treatment of patients with nonalcoholic fatty liver disease. Copyright 2010 Elsevier Inc. All rights reserved.

  18. Base modifications affecting RNA polymerase and reverse transcriptase fidelity.

    PubMed

    Potapov, Vladimir; Fu, Xiaoqing; Dai, Nan; Corrêa, Ivan R; Tanner, Nathan A; Ong, Jennifer L

    2018-06-20

    Ribonucleic acid (RNA) is capable of hosting a variety of chemically diverse modifications, in both naturally-occurring post-transcriptional modifications and artificial chemical modifications used to expand the functionality of RNA. However, few studies have addressed how base modifications affect RNA polymerase and reverse transcriptase activity and fidelity. Here, we describe the fidelity of RNA synthesis and reverse transcription of modified ribonucleotides using an assay based on Pacific Biosciences Single Molecule Real-Time sequencing. Several modified bases, including methylated (m6A, m5C and m5U), hydroxymethylated (hm5U) and isomeric bases (pseudouridine), were examined. By comparing each modified base to the equivalent unmodified RNA base, we can determine how the modification affected cumulative RNA polymerase and reverse transcriptase fidelity. 5-hydroxymethyluridine and N6-methyladenosine both increased the combined error rate of T7 RNA polymerase and reverse transcriptases, while pseudouridine specifically increased the error rate of RNA synthesis by T7 RNA polymerase. In addition, we examined the frequency, mutational spectrum and sequence context of reverse transcription errors on DNA templates from an analysis of second strand DNA synthesis.

  19. Identification and expression analysis of genes involved in early ovary development in diploid gynogenetic hybrids of red crucian carp x common carp.

    PubMed

    Liu, Dong; Liu, Shaojun; You, Cuiping; Chen, Lin; Liu, Zhen; Liu, Liangguo; Wang, Jing; Liu, Yun

    2010-04-01

    Diploid eggs of allotetraploid hybrids (red crucian carp female symbol x common carp male symbol), when activated by UV-irradiated sperm of scatter scale carp, can develop into diploid progenies without chromosome duplication treatment. Diploid progenies produce diploid eggs, which develop into diploid population by the same way. To understand the molecular mechanism underlying the production of diploid eggs by the diploid fish, we constructed a forward suppression subtractive hybridization complementary DNA (cDNA) library. The cDNAs from the ovary in proliferation phase were employed as the "tester," and those in growth phase were used as the "driver." Seventy-three cDNA clones that are specifically expressed in proliferation phase were detected by dot-blot hybridization. Sequencing analyses revealed that several of these cDNAs have high homologies to the known sequences in the NCBI database. Their encoded proteins include the protein preventing mitosis catastrophe (PMC), the signal recognition particle 9, the ATP-binding cassette transporter, the glucanase-xylanase fusion protein, and others. These genes were confirmed by reverse transcriptase-polymerase chain reaction. The expression profile of the PMC gene at different time points was analyzed by quantitative real-time polymerase chain reaction. The results indicated that the expression of this suppression subtractive hybridization-identified gene changed during the time course, corresponding with the cellular phenomenon in the ovary development. Our studies provide insights into the molecular mechanism underlying the ovary development of diploid gynogenetic fish.

  20. Distemper outbreak and its effect on African wild dog conservation.

    PubMed

    van de Bildt, Marco W G; Kuiken, Thijs; Visee, Aart M; Lema, Sangito; Fitzjohn, Tony R; Osterhaus, Albert D M E

    2002-02-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species.

  1. Determination of Clinical and Demographic Predictors of Laboratory-confirmed Influenza with Subtype Analysis

    DTIC Science & Technology

    2012-06-07

    Advisory Committee on Immunization Practicies (ACIP). vol. 57th edition. Atlanta, GA: MMWR; 2008:1–59. 3. Cox NJ, Subbarao K : Influenza. Lancet 1999...to April 2008. Reverse-transcriptase polymerase chain reaction testing and viral culture for influenza A and B with subtyping were performed on all...REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 RESEARCH

  2. Molecular cloning and expression analysis of annexin A2 gene in sika deer antler tip.

    PubMed

    Xia, Yanling; Qu, Haomiao; Lu, Binshan; Zhang, Qiang; Li, Heping

    2018-04-01

    Molecular cloning and bioinformatics analysis of annexin A2 ( ANXA2 ) gene in sika deer antler tip were conducted. The role of ANXA2 gene in the growth and development of the antler were analyzed initially. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to clone the cDNA sequence of the ANXA2 gene from antler tip of sika deer ( Cervus Nippon hortulorum ) and the bioinformatics methods were applied to analyze the amino acid sequence of Anxa2 protein. The mRNA expression levels of the ANXA2 gene in different growth stages were examined by real time reverse transcriptase polymerase chain reaction (real time RT-PCR). The nucleotide sequence analysis revealed an open reading frame of 1,020 bp encoding 339 amino acids long protein of calculated molecular weight 38.6 kDa and isoelectric point 6.09. Homologous sequence alignment and phylogenetic analysis indicated that the Anxa2 mature protein of sika deer had the closest genetic distance with Cervus elaphus and Bos mutus . Real time RT-PCR results showed that the gene had differential expression levels in different growth stages, and the expression level of the ANXA2 gene was the highest at metaphase (rapid growing period). ANXA2 gene may promote the cell proliferation, and the finding suggested Anxa2 as an important candidate for regulating the growth and development of deer antler.

  3. Disappearance of AML1-MTG8 transcript by reverse transcriptase polymerase chain reaction in a patient in remission of acute myeloid leukemia (M2) after low-dose cytosine arabinoside.

    PubMed

    Sawada, H; Serino, Y; Wake, A; Yamasaki, Y; Izumi, Y

    1998-09-01

    It is well-known that low dose cytosine arabinoside (LDAC) has activity in elderly patients with acute myeloid leukemia (AML). Several studies have shown that AML patients with t(8;21) in long term complete remission (CR) following intensive chemotherapy or allogeneic bone marrow transplantation (BMT) still have persistence of AML1-MTG8 transcripts by reverse transcriptase polymerase chain reaction (RT-PCR) method. We report here a patient who has no evidence of residual disease detectable by RT-PCR after LDAC. A 69-year-old patient did not obtain CR after two courses of intensive chemotherapy with behenoyl-ara-C, daunorubicin, 6-mercaptopurine and prednisolone. He received subcutaneous LDAC 10 mg every 12 h and granulocyte colony-stimulating factor (G-CSF) for 29 days and achieved CR. He continued on a 21 to 28-day course of LDAC without G-CSF every 2 or 3 months and has remained well and in CR for 5 years without chimeric AMLI-MTG8 transcript by RT-PCR. LDAC therapy seems to be effective in eradicating the leukemic clone as post-induction or maintenance therapy in this patient. This is the first case report of the disappearance of AML1-MTG8 transcript by RT-PCR in a patient with t(8;21) in long-term remission after LDAC.

  4. Cardiomyogenic Differentiation in Cardiac Myxoma Expressing Lineage-Specific Transcription Factors

    PubMed Central

    Kodama, Hiroaki; Hirotani, Takashi; Suzuki, Yusuke; Ogawa, Satoshi; Yamazaki, Kazuto

    2002-01-01

    We investigated five cases of cardiac myxoma and one case of cardiac undifferentiated sarcoma by light and electron microscopy, in situ hybridization, immunohistochemical staining, and reverse transcriptase-polymerase chain reaction for cardiomyocyte-specific transcription factors, Nkx2.5/Csx, GATA-4, MEF2, and eHAND. Conventional light microscopy revealed that cardiac myxoma and sarcoma cells presented variable cellular arrangements and different histological characteristics. Ultrastructurally, some of the myxoma cells exhibited endothelium-like or immature mesenchymal cell differentiation. Immunohistochemistry for Nkx2.5/Csx, GATA-4, and eHAND was slightly to intensely positive in all myxoma cases. MEF2 immunoreactivity was observed in all cases including the case of sarcoma, thus suggesting myogenic differentiation of myxoma or sarcoma cells. In situ hybridization for Nkx2.5/Csx also revealed that all myxoma cells, but not sarcoma cells, expressed mRNA of the cardiac homeobox gene, Nkx2.5/Csx. Furthermore, nested reverse transcriptase-polymerase chain reaction from formalin-fixed, paraffin-embedded tissue was performed and demonstrated that the Nkx2.5/Csx and eHAND gene product to be detected in all cases, and in three of six cases, respectively. In conclusion, cardiac myxoma cells were found to express various amounts of cardiomyocyte-specific transcription factor gene products at the mRNA and protein levels, thus suggesting cardiomyogenic differentiation. These results support the concept that cardiac myxoma might arise from mesenchymal cardiomyocyte progenitor cells. PMID:12163362

  5. Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

    PubMed

    Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

    2017-04-01

    Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Effects of Holding Time, Storage, and the Preservation of Samples on Sample Integrity for the Detection of Fecal Indicator Bacteria by Quantitative Polymerase Chain Reaction (qPCR)-based assays.

    EPA Science Inventory

    The purpose of this project was to answer questions related to storage of samples to be analyzed by the quantitative polymerase chain reaction (qPCR)-based assays for fecal indicator bacteria. The project was divided into two parts. The first part was to determine if filters th...

  7. Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

    PubMed

    Navarro, B; Daròs, J A; Flores, R

    1998-07-01

    A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

  8. [The validation of kit of reagents for quantitative detection of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode].

    PubMed

    Sil'veĭstrova, O Iu; Domonova, É A; Shipulina, O Iu

    2014-04-01

    The validation of kit of reagents destined to detection and quantitative evaluation of DNA of human cytomegalovirus in biological material using polymerase chain reaction technique in real time operation mode was implemented. The comparison was made against international WHO standard--The first WHO international standard for human cytomegalovirus to implement measures the kit of reagents "AmpliSens CMV-screen/monitor-FL" and standard sample of enterprise DNA HCMV (The central research institute of epidemiology of Rospotrebnadzor) was applied. The fivefold dilution of international WHO standard and standard sample of enterprise were carried out in concentrations of DNA HCMV from 106 to 102. The arrangement of polymerase chain reaction and analysis of results were implemented using programed amplifier with system of detection of fluorescent signal in real-time mode "Rotor-Gene Q" ("Qiagen", Germany). In the total of three series of experiments, all stages of polymerase chain reaction study included, the coefficient of translation of quantitative evaluation of DNA HCMV from copy/ml to ME/ml equal to 0.6 was introduced for this kit of reagents.

  9. ICI 182,780-Regulated Gene Expression in DU145 Prostate Cancer Cells Is Mediated by Estrogen Receptor-β/NFκB Crosstalk1

    PubMed Central

    Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

    2006-01-01

    Abstract Estrogen receptor (ER)-β is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-β-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 µM ICI. Semi-quantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12α chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-β antisense oligonucleotide reduced cellular ER-β mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFκB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-α and the NFκB signaling pathway, denoting a novel mechanism of ER-β-mediated ICI action. Therefore, combined therapies targeting ER-β and NFκB signaling may be synergistic as treatment for PCa. PMID:16756716

  10. Interaction of aurintricarboxylic acid (ATA) with four nucleic acid binding proteins DNase I, RNase A, reverse transcriptase and Taq polymerase

    NASA Astrophysics Data System (ADS)

    Ghosh, Utpal; Giri, Kalyan; Bhattacharyya, Nitai P.

    2009-12-01

    In the investigation of interaction of aurintricarboxylic acid (ATA) with four biologically important proteins we observed inhibition of enzymatic activity of DNase I, RNase A, M-MLV reverse transcriptase and Taq polymerase by ATA in vitro assay. As the telomerase reverse transcriptase (TERT) is the main catalytic subunit of telomerase holoenzyme, we also monitored effect of ATA on telomerase activity in vivo and observed dose-dependent inhibition of telomerase activity in Chinese hamster V79 cells treated with ATA. Direct association of ATA with DNase I ( Kd = 9.019 μM)), RNase A ( Kd = 2.33 μM) reverse transcriptase ( Kd = 0.255 μM) and Taq polymerase ( Kd = 81.97 μM) was further shown by tryptophan fluorescence quenching studies. Such association altered the three-dimensional conformation of DNase I, RNase A and Taq polymerase as detected by circular dichroism. We propose ATA inhibits enzymatic activity of the four proteins through interfering with DNA or RNA binding to the respective proteins either competitively or allosterically, i.e. by perturbing three-dimensional structure of enzymes.

  11. Evaluation of Cytokine Synthesis in Human Whole Blood by Enzyme Linked Immunoassay (ELISA), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), and Flow Cytometry

    DTIC Science & Technology

    2007-05-08

    deoxynucleotide triphosphates, from Sigma. Sequences for glyceraldehyde-3-phosphate dehydrogenase ( G3PDH ), IL-8,and TNF-a were amplified with primer...This was accomplished by normalizing all samples to the mRNA for the moderately expressed housekeeping function glyceraldehyde-3 -phosphate...without and with isolation of cells before reverse transcription and PCR. G3PDH mRNA target amplifies at 983 base pairs. The 630 base pair band is the

  12. Distemper Outbreak and Its Effect on African Wild Dog Conservation

    PubMed Central

    van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.

    2002-01-01

    In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078

  13. SIRT3 functions as a tumor suppressor in hepatocellular carcinoma.

    PubMed

    Zeng, Xianchun; Wang, Nanzhu; Zhai, Hui; Wang, Rongpin; Wu, Jiahong; Pu, Wei

    2017-03-01

    Hepatocellular carcinoma is one of the leading causes for cancer-related mortality worldwide. SIRT3 may function as either oncogene or tumor suppressor in a panel of cancers; however, the role of SIRT3 in hepatocellular carcinoma remains unclear. In this study, we assayed the expression level of SIRT3 in hepatocellular carcinoma tissues by quantitative reverse transcriptase-polymerase chain reaction and immunohistochemistry. A loss-of-function approach was used to examine the effects of SIRT3 on biological activity, including cell proliferative activity and invasive potential. The results demonstrated that the expression levels of SIRT3 protein in hepatocellular carcinoma tissues were significantly downregulated compared with those in adjacent non-cancerous tissues. Furthermore, SIRT3 could decrease cell proliferation and inhibit cell migration/invasion in hepatocellular carcinoma cell line. Taken together, these results elucidated the function of SIRT3 in hepatocellular carcinoma development and suggested that SIRT3 might function as tumor suppressor in hepatocellular carcinoma by targeting PI3K/Akt pathway.

  14. Advances in Developing HIV-1 Viral Load Assays for Resource-Limited Settings

    PubMed Central

    Wang, ShuQi; Xu, Feng; Demirci, Utkan

    2010-01-01

    Commercial HIV-1 RNA viral load assays have been routinely used in developed countries to monitor antiretroviral treatment (ART). However, these assays require expensive equipment and reagents, well-trained operators, and established laboratory infrastructure. These requirements restrict their use in resource-limited settings where people are most afflicted with the HIV-1 epidemic. Inexpensive alternatives such as the Ultrasensitive p24 assay, the Reverse Transcriptase (RT) assay and in-house reverse transcription quantitative polymerase chain reaction (RT-qPCR) have been developed. However, they are still time-consuming, technologically complex and inappropriate for decentralized laboratories as point-of-care (POC) tests. Recent advances in microfluidics and nanotechnology offer new strategies to develop low-cost, rapid, robust and simple HIV-1 viral load monitoring systems. We review state-of-the-art technologies used for HIV-1 viral load monitoring in both developed and developing settings. Emerging approaches based on microfluidics and nanotechnology, which have potential to be integrated into POC HIV-1 viral load assays, are also discussed. PMID:20600784

  15. Gene expression in the rectus abdominus muscle of patients with and without pelvic organ prolapse.

    PubMed

    Hundley, Andrew F; Yuan, Lingwen; Visco, Anthony G

    2008-02-01

    The objective of the study was to compare gene expression in a group of actin and myosin-related proteins in the rectus muscle of 15 patients with pelvic organ prolapse and 13 controls. Six genes previously identified by microarray GeneChip analysis were examined using real-time quantitative reverse transcriptase-polymerase chain reaction analysis, including 2 genes showing differential expression in pubococcygeus muscle. Samples and controls were run in triplicate in multiplexed wells, and levels of gene expression were analyzed using the comparative critical threshold method. One gene, MYH3, was 3.2 times overexpressed in patients with prolapse (P = .032), but no significant differences in expression were seen for the other genes examined. An age-matched subset of 9 patients and controls showed that MYH3 gene expression was no longer significantly different (P = .058). Differential messenger ribonucleic acid levels of actin and myosin-related genes in patients with pelvic organ prolapse and controls may be limited to skeletal muscle from the pelvic floor.

  16. Chronic myelogenous leukemia: laboratory diagnosis and monitoring.

    PubMed

    Wang, Y L; Bagg, A; Pear, W; Nowell, P C; Hess, J L

    2001-10-01

    Rapid developments have occurred both in laboratory medicine and in therapeutic interventions for the management of patients with chronic myelogenous leukemia (CML). With a wide array of laboratory tests available, selecting the appropriate test for a specific diagnostic or therapeutic setting has become increasingly difficult. In this review, we first discuss, from the point of view of laboratory medicine, the advantages and disadvantages of several commonly used laboratory assays, including cytogenetics, fluorescence in situ hybridization (FISH), and qualitative and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We then discuss, from the point of view of clinical care, the test(s) of choice for the most common clinical scenarios, including diagnosis and monitoring of the therapeutic response and minimal residual disease in patients treated with different therapies. The purpose of this review is to help clinicians and laboratory physicians select appropriate tests for the diagnosis and monitoring of CML, with the ultimate goal of improving the cost-effective usage of clinical laboratories and improving patient care. Copyright 2001 Wiley-Liss, Inc.

  17. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  18. copia-like retrotransposons are ubiquitous among plants.

    PubMed Central

    Voytas, D F; Cummings, M P; Koniczny, A; Ausubel, F M; Rodermel, S R

    1992-01-01

    Transposable genetic elements are assumed to be a feature of all eukaryotic genomes. Their identification, however, has largely been haphazard, limited principally to organisms subjected to molecular or genetic scrutiny. We assessed the phylogenetic distribution of copia-like retrotransposons, a class of transposable element that proliferates by reverse transcription, using a polymerase chain reaction assay designed to detect copia-like element reverse transcriptase sequences. copia-like retrotransposons were identified in 64 plant species as well as the photosynthetic protist Volvox carteri. The plant species included representatives from 9 of 10 plant divisions, including bryophytes, lycopods, ferns, gymnosperms, and angiosperms. DNA sequence analysis of 29 cloned PCR products and of a maize retrotransposon cDNA confirmed the identity of these sequences as copia-like reverse transcriptase sequences, thereby demonstrating that this class of retrotransposons is a ubiquitous component of plant genomes. Images PMID:1379734

  19. Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation platform: assessing its performance in formalin-fixed, paraffin-embedded samples and identifying invasion pattern-related genes in oral squamous cell carcinoma.

    PubMed

    Loudig, Olivier; Brandwein-Gensler, Margaret; Kim, Ryung S; Lin, Juan; Isayeva, Tatyana; Liu, Christina; Segall, Jeffrey E; Kenny, Paraic A; Prystowsky, Michael B

    2011-12-01

    High-throughput gene expression profiling from formalin-fixed, paraffin-embedded tissues has become a reality, and several methods are now commercially available. The Illumina whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay (Illumina, Inc) is a full-transcriptome version of the original 512-gene complementary DNA-mediated annealing, selection, extension and ligation assay, allowing high-throughput profiling of 24,526 annotated genes from degraded and formalin-fixed, paraffin-embedded RNA. This assay has the potential to allow identification of novel gene signatures associated with clinical outcome using banked archival pathology specimen resources. We tested the reproducibility of the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay and its sensitivity for detecting differentially expressed genes in RNA extracted from matched fresh and formalin-fixed, paraffin-embedded cells, after 1 and 13 months of storage, using the human breast cell lines MCF7 and MCF10A. Then, using tumor worst pattern of invasion as a classifier, 1 component of the "risk model," we selected 12 formalin-fixed, paraffin-embedded oral squamous cell carcinomas for whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay analysis. We profiled 5 tumors with nonaggressive, nondispersed pattern of invasion, and 7 tumors with aggressive dispersed pattern of invasion and satellites scattered at least 1 mm apart. To minimize variability, the formalin-fixed, paraffin-embedded specimens were prepared from snap-frozen tissues, and RNA was obtained within 24 hours of fixation. One hundred four down-regulated genes and 72 up-regulated genes in tumors with aggressive dispersed pattern of invasion were identified. We performed quantitative reverse transcriptase polymerase chain reaction validation of 4 genes using Taqman assays and in situ protein detection of 1 gene by immunohistochemistry. Functional cluster analysis of genes up-regulated in tumors with aggressive pattern of invasion suggests presence of genes involved in cellular cytoarchitecture, some of which already associated with tumor invasion. Identification of these genes provides biologic rationale for our histologic classification, with regard to tumor invasion, and demonstrates that the whole-genome complementary DNA-mediated annealing, selection, extension and ligation assay is a powerful assay for profiling degraded RNA from archived specimens when combined with quantitative reverse transcriptase polymerase chain reaction validation. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. The relationship between quantitative human epidermal growth factor receptor 2 gene expression by the 21-gene reverse transcriptase polymerase chain reaction assay and adjuvant trastuzumab benefit in Alliance N9831.

    PubMed

    Perez, Edith A; Baehner, Frederick L; Butler, Steven M; Thompson, E Aubrey; Dueck, Amylou C; Jamshidian, Farid; Cherbavaz, Diana; Yoshizawa, Carl; Shak, Steven; Kaufman, Peter A; Davidson, Nancy E; Gralow, Julie; Asmann, Yan W; Ballman, Karla V

    2015-10-01

    The N9831 trial demonstrated the efficacy of adjuvant trastuzumab for patients with human epidermal growth factor receptor 2 (HER2) locally positive tumors by protein or gene analysis. We used the 21-gene assay to examine the association of quantitative HER2 messenger RNA (mRNA) gene expression and benefit from trastuzumab. N9831 tested the addition of trastuzumab to chemotherapy in stage I-III HER2-positive breast cancer. For two of the arms of the trial, doxorubicin and cyclophosphamide followed by paclitaxel (AC-T) and doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab concurrent chemotherapy-trastuzumab (AC-TH), recurrence score (RS) and HER2 mRNA expression were determined by the 21-gene assay (Oncotype DX®) (negative <10.7, equivocal 10.7 to <11.5, and positive ≥11.5 log2 expression units). Cox regression was used to assess the association of HER2 expression with trastuzumab benefit in preventing distant recurrence. Median follow-up was 7.4 years. Of 1,940 total patients, 901 had consent and sufficient tissue. HER2 by reverse transcriptase polymerase chain reaction (RT-PCR) was negative in 130 (14 %), equivocal in 85 (9 %), and positive in 686 (76 %) patients. Concordance between HER2 assessments was 95 % for RT-PCR versus central immunohistochemistry (IHC) (>10 % positive cells = positive), 91 % for RT-PCR versus central fluorescence in situ hybridization (FISH) (≥2.0 = positive) and 94 % for central IHC versus central FISH. In the primary analysis, the association of HER2 expression by 21-gene assay with trastuzumab benefit was marginally nonsignificant (nonlinear p = 0.057). In hormone receptor-positive patients (local IHC) the association was significant (p = 0.002). The association was nonlinear with the greatest estimated benefit at lower and higher HER2 expression levels. Concordance among HER2 assessments by central IHC, FISH, and RT-PCR were similar and high. Association of HER2 mRNA expression with trastuzumab benefit as measured by time to distant recurrence was nonsignificant. A consistent benefit of trastuzumab irrespective of mHER2 levels was observed in patients with either IHC-positive or FISH-positive tumors. Trend for benefit was observed also for the small groups of patients with negative results by any or all of the central assays. Clinicaltrials.gov NCT00005970 . Registered 5 July 2000.

  1. A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control

    PubMed Central

    2010-01-01

    Background The hepatitis C virus (HCV) genome is extremely heterogeneous. Several HCV infections can not be detected using currently available commercial assays, probably because of mismatches between the template and primers/probes. By aligning the HCV sequences, we developed a duplex real-time reverse transcriptase-polymerase chain reaction (RT-PCR) assay using 2 sets of primers/probes and a specific armored RNA as internal control. The 2 detection probes were labelled with the same fluorophore, namely, 6-carboxyfluorescein (FAM), at the 5' end; these probes could mutually combine, improving the power of the test. Results The limit of detection of the duplex primer/probe assay was 38.99 IU/ml. The sensitivity of the assay improved significantly, while the specificity was not affected. All HCV genotypes in the HCV RNA Genotype Panel for Nucleic Acid Amplification Techniques could be detected. In the testing of 109 serum samples, the performance of the duplex real-time RT-PCR assay was identical to that of the COBAS AmpliPrep (CAP)/COBAS TaqMan (CTM) assay and superior to 2 commercial HCV assay kits. Conclusions The duplex real-time RT-PCR assay is an efficient and effective viral assay. It is comparable with the CAP/CTM assay with regard to the power of the test and is appropriate for blood-donor screening and laboratory diagnosis of HCV infection. PMID:20529244

  2. Lower expressions of the human bitter taste receptor TAS2R in smokers: reverse transcriptase-polymerase chain reaction analysis.

    PubMed

    Aoki, Mieko; Takao, Tetsuya; Takao, Kyoichi; Koike, Fumihiko; Suganuma, Narufumi

    2014-01-01

    Despite the fact that smokers have deficit in detecting taste, particularly bitter taste, no study has investigated its biological correlate. In this context, we compared the expression of the bitter taste receptor gene, taste 2 receptor (TAS2R) in the tongues of smokers and non-smokers. Tissue samples were collected from the lateral portion of the tongues of 22 smokers and 22 age- and gender-matched healthy volunteers (19 males and three females) with no history of smoking. Reverse transcriptase-polymerase chain reaction was used to examine the expression of TAS2R in the two groups, and the effect of aging on TAS2R expression was also assessed. TAS2R expression was significantly lower among smokers than non-smokers (t = 6.525, P < .0001, 11.36 ± 6.0 vs. 2.09 ± 2.8, mean ± SD, non-smokers vs. smokers). Further, a positive correlation between age and expression of TAS2R was observed in non-smokers (r = .642, P = .001), but not smokers (r = .124, P = .584). This correlation difference was significant (Z = 1.96, P = .0496). Smokers showed a significantly lower expression of the bitter taste receptor gene than non-smokers, which is potentially caused by their inability to acquire such receptors with age because of cigarette smoking, in contrast to non-smokers.

  3. HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

    PubMed

    Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

    2014-03-01

    The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

  4. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  5. Assessment Effects of Resveratrol on Human Telomerase Reverse Transcriptase Messenger Ribonucleic Acid Transcript in Human Glioblastoma.

    PubMed

    Mirzazadeh, Azin; Kheirollahi, Majid; Farashahi, Ehsan; Sadeghian-Nodoushan, Fatemeh; Sheikhha, Mohammad Hasan; Aflatoonian, Behrouz

    2017-01-01

    Glioblastoma (GBM) is the most common and aggressive brain tumor, which has a poor prognosis despite the advent of different therapeutic strategies. There are numerous molecular biomarkers to contribute diagnosis, prognosis, and prediction of response to the current therapy in GBM. One of the most important markers that are potentially valuable is immortalization-specific or immortalization-associated marker named "hTERT messenger ribonucleic acid (mRNA)" the key subunit of telomerase enzyme, which is expressed in more than 85% of cancer cells, in spite of the majority of normal somatic cells. In this study, we investigated the effects of resveratrol (RSV) on this mRNA marker level, leading to cancer progression. U-87MG cell line was obtained from Pasteur Institute of Iran and treated with various concentrations of 0-160 μg/mL of RSV and at different time points (24, 48, and 72 h). To evaluate viability of U-87MG cells, standard 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed. Real-time polymerase chain reaction (RT-PCR) was used for comparative and quantitative assessment of human telomerase reverse transcriptase (hTERT) mRNA copy number versus control-untreated group. The results of our investigation suggested that RSV effectively inhibited cell growth and caused cell death in dose-dependent ( P < 0.05) and not in time-dependent manner ( P > 0.05), in vitro . Interestingly, quantitative RT-PCR analysis demonstrated that at half inhibition concentration, RSV dramatically decreased mRNA expression of hTERT, the catalytic subunit of telomerase enzyme, which leads to prevention of cell division and tumor progression. With regard to downregulation of this immortalization-associated marker, RSV may potentially be used as a therapeutic agent against GBM.

  6. Detection of EML4-ALK fusion gene in Chinese non-small cell lung cancer by using a sensitive quantitative real-time reverse transcriptase PCR technique.

    PubMed

    Fu, Sha; Wang, Fang; Shao, Qiong; Zhang, Xu; Duan, Li-Ping; Zhang, Xiao; Zhang, Li; Shao, Jian-Yong

    2015-04-01

    Anaplastic lymphoma kinase (ALK) rearrangement is present in approximately 5% of lung adenocarcinoma. Clinical trials on ALK inhibitor phase I to III have shown an interesting disease control rate and acceptable tolerability in ALK rearrangement patients. In clinical application, the precise diagnostic strategy for identifying ALK rearrangements remains to be determined. In this study, ALK rearrangement was screened by using quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR), direct sequencing, 2 fluorescence in situ hybridization (FISH) assays, and immunohistochemistry in 173 lung adenocarcinomas. We identified 18 cases (10.4%) with EML4-ALK fusion-positive by qRT-PCR, and all were positive for EML4-ALK fusion gene validated by direct sequencing. The result was consistent with that of other methods. Furthermore, of the 18 EML4-ALK fusion-positive cases, 16 (9.2%) were positive by using EML4-ALK fusion probe FISH, and 15 (8.7%) were positive by using ALK break-apart probe FISH and immunohistochemistry staining. Of the 18 ALK fusion-positive lung adenocarcinomas, 8 cases (44.4%) were histologically diagnosed as subtypes of cribriform adenocarcinoma, 7 cases (38.9%) as cribriform adenocarcinoma mixed with papillary and/or mucinous pattern, 2 cases (11.1%) as papillary adenocarcinoma, and 1 case (5.6%) as mucinous adenocarcinoma. In the present study, the ALK rearrangement frequency detected by qRT-PCR in Chinese NSCLC patients was higher than that in the western populations. QRT-PCR is a rapid, sensitive technology that could be used as a screening tool for identifying EML4-ALK fusion-positive NSCLC patients who would be sensitive for receiving ALK inhibitor therapy.

  7. Effects of ß-TCP scaffolds on neurogenic and osteogenic differentiation of human embryonic stem cells.

    PubMed

    Arpornmaeklong, Premjit; Pressler, Michael J

    2018-01-01

    Extracellular matrix (ECM) and adhesion molecules play crucial roles in regulating growth and differentiation of stem cells. The current study aimed to investigate the effects of beta-tricalcium phosphate (ß-TCP) scaffolds on differentiation and expression of ECM and adhesion molecules of human embryonic stem cells (hESCs). Undifferentiated hESCs were seeded on ß-TCP scaffolds and cell culture plates and cultured in growth and osteogenic medium for 21 days. Scanning electron microscopy (SEM) displayed adhesion and growth of hESCs on the porous ß-TCP scaffolds. Histological analysis, immunohistochemical staining and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) demonstrated that the scaffolds supported growth and differentiation of hESCs. Expression levels of neural crest related genes (AP2a, FoxD3, HNK1, P75, Sox1, Sox10) and osteoblast-related genes (Runx2, SPP1 and BGLA) on the scaffolds in osteogenic medium were significantly higher than on the scaffolds in growth and cell culture plates in osteogenic medium, respectively (p<0.05). Polymerase chain reaction array experiments demonstrated increased expression of ECM and adhesion molecule-related genes on the scaffolds. In conclusion, osteoconductive scaffolds such as ß-TCP scaffolds promoted differentiation of hESCs, particularly expression of genes related to neural crest stem cell and osteoblastic differentiations. Beta-TCP scaffolds could be an alternative cell culture substrate for neural crest and osteogenic differentiation of hESCs. Optimization of culture medium may be necessary to enhance lineage restriction of hESCs on the ß-TCP scaffolds. Copyright © 2017 Elsevier GmbH. All rights reserved.

  8. Cloning and Expression Analysis of a PISTILLATA Homologous Gene from Pineapple (Ananas comosus L. Merr)

    PubMed Central

    Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

    2012-01-01

    PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. PMID:22312303

  9. Cloning and expression analysis of a PISTILLATA homologous gene from pineapple (Ananas comosus L. Merr).

    PubMed

    Lv, Ling-Ling; Duan, Jun; Xie, Jiang-Hui; Liu, Yu-Ge; Wei, Chang-Bin; Liu, Sheng-Hui; Zhang, Jian-Xia; Sun, Guang-Ming

    2012-01-01

    PISTILLATA (PI)-like genes are crucial regulators of flowering in angiosperms. A homologue of PI, designated as AcPI (Genbank accession number HQ717796), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcPI is 907 bp in length and contains an open reading frame of 594 bp, which encodes a protein of 197 amino acids. The molecular weight was 2.29 kDa and the isoelectric point was 9.28. The alignment showed that AcPI had a high identity with CsPIC2 (78.6%), AoPI (77.4%), OrcPI (75.7%) and HPI2 (72.4%). Quantitative real-time polymerase chain reaction (qRT-PCR) analyses in different tissues showed that the expression pattern of AcPI was different from the B-class genes in eudicots. AcPI was expressed in all the tissues investigated. The expression level was very low in fruit stems, bracts, leaves and sepals, high in petals and carpels, and moderate in apical meristems, flesh and stamens. The qRT-PCR analyses in different stages indicated that the expression of AcPI reached the highest level at 40 days after flower inducement, when the multiple fruit and floral organs were forming. It proved the important role of AcPI in floral organs and fruit development. The 35S::AcPI transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants.

  10. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    USDA-ARS?s Scientific Manuscript database

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  11. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society. © 2016 American Cancer Society.

  12. Up-regulation of IL-23 expression in human dental pulp fibroblasts by IL-17 via activation of the NF-κB and MAPK pathways.

    PubMed

    Wei, L; Liu, M; Xiong, H; Peng, B

    2017-11-06

    To investigate the effects of the pro-inflammatory and Th17-polarizing mediator IL-17 on HDPFs-mediated IL-23 production and the molecular mechanism involved. Interleukin (IL)-17R expression was determined by semi-quantitative reverse transcriptase-polymerase chain reaction and Western blot in cultured human dental pulp fibroblasts (HDPFs). Quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay were used to determine IL-23 mRNA and protein levels in IL-17-stimulated HDPFs, respectively. The nuclear factor-kappa B (NF-κB) and mitogen-activated protein kinases (MAPKs) signalling pathways that mediate the IL-17-stimulated production of IL-23 was investigated using Western blot and specific signalling inhibitor analyses. Statistical analyses were performed using Kruskal-Wallis tests followed by the Mann-Whitney U-test. Statistical significance was considered when the P value < 0.05. Primary HDPFs steadily expressed IL-17R mRNA and surface-bound protein. IL-17 stimulated the expression of IL-23 mRNA and protein in cultured human dental pulp fibroblasts, which was attenuated by IL-17 or IL-17R neutralizing antibodies. In accordance with the enhanced expression of IL-23, IL-17 stimulation resulted in rapid activation of p38 MAPK, extracellular signal-regulated kinase (ERK) 1/2, c-Jun-N-terminal kinase (JNK) and NF-κB in HDPFs. Inhibitors of p38 MAPK, ERK 1/2 or NF-κB significantly suppressed, whereas blocking JNK substantially augmented IL-23 production from IL-17-stimulated HDPFs. HDPFs expressed IL-17R and responded to IL-17 to produce IL-23 via the activation of the NF-κB and MAPK signalling pathways. The findings provide insights into the cellular mechanisms of the participation of IL-17 in the activation of HDPFs in inflamed pulp tissue. © 2017 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  13. Blastic natural killer cell leukaemia in a dog--a case report.

    PubMed

    Bonkobara, Makoto; Saito, Taro; Yamashita, Masahiro; Tamura, Kyoichi; Yagihara, Hiroko; Isotani, Mayu; Sato, Takashi; Washizu, Tsukimi

    2007-11-01

    A case of canine non-T, non-B lymphoid leukaemia was determined to be of natural killer (NK) cell lineage by detecting specific expression of canine CD56 mRNA by reverse transcriptase polymerase chain reaction analysis. Although NK cells are usually considered to be morphologically large granular lymphocytes, the malignant NK cells in this case were agranular and blast-like, resembling human blastic NK cell leukaemia. The prognosis of human NK cell leukaemia is usually poor. In this case, the dog died 10 days after initial presentation, despite chemotherapy.

  14. Prospective and retrospective evaluation of the Cepheid Xpert® Flu/RSV XC assay for rapid detection of influenza A, influenza B, and respiratory syncytial virus.

    PubMed

    Salez, Nicolas; Nougairede, Antoine; Ninove, Laetitia; Zandotti, Christine; de Lamballerie, Xavier; Charrel, Remi N

    2015-04-01

    A total of 281 clinical specimens (nasal swabs and nasopharyngeal aspirates) were tested with the Xpert® Flu/RSV XC. The results were compared to those obtained with the real-time retro transcriptase-polymerase chain reaction assays routinely used in our laboratory. The Xpert® Flu/RSV XC showed sensitivity/specificity of 97.8%/100% and 97.9%/100% for flu and respiratory syncytial virus, respectively. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Ostertagia circumcincta: isolation of a partial cDNA encoding an unusual member of the mitochondrial processing peptidase subfamily of M16 metallopeptidases.

    PubMed

    Walker, J; Tait, A

    1997-11-01

    A reverse-transcriptase polymerase chain reaction (PCR) procedure was used to isolate an Ostertagia circumcincta partial cDNA encoding a protein with general primary sequence features characteristic of members of the mitochondrial processing peptidase (MPP) subfamily of M16 metallopeptidases. The structural relationships of the predicted protein (Oc MPPX) with MPP subfamily proteins from other species (including the model free-living nematode Caenorhabditis elegans) were examined, and Northern analysis confirmed the expression of the Oc mppx gene in adult nematodes.

  16. Human epidermal growth factor receptor 2 assessment in a case-control study: comparison of fluorescence in situ hybridization and quantitative reverse transcription polymerase chain reaction performed by central laboratories.

    PubMed

    Baehner, Frederick L; Achacoso, Ninah; Maddala, Tara; Shak, Steve; Quesenberry, Charles P; Goldstein, Lynn C; Gown, Allen M; Habel, Laurel A

    2010-10-01

    The optimal method to assess human epidermal growth factor receptor 2 (HER2) status remains highly controversial. Before reporting patient HER2 results, American Society of Clinical Oncology (ASCO)/College of American Pathologists (CAP) guidelines mandate that laboratories demonstrate ≥ 95% concordance to another approved laboratory or methodology. Here, we compare central laboratory HER2 assessed by fluorescence in situ hybridization (FISH) and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) using Oncotype DX in lymph node-negative, chemotherapy-untreated patients from a large Kaiser Permanente case-control study. Breast cancer specimens from the Kaiser-Genomic Health study were examined. Central FISH assessment of HER2 amplification and polysomy 17 was conducted by PhenoPath Laboratories (ratios > 2.2, 1.8 to 2.2, and < 1.8 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). HER2 expression by RT-PCR was conducted using Oncotype DX by Genomic Health (normalized expression units ≥ 11.5, 10.7 to < 11.5, and < 10.7 define HER2 positive, HER2 equivocal, and HER2 negative, respectively). Concordance analyses followed ASCO/CAP guidelines. HER2 concordance by central FISH and central RT-PCR was 97% (95% CI, 96% to 99%). Twelve percent (67 of 568 patients) and 11% (60 of 568 patients) of patients were HER2 positive by RT-PCR and FISH, respectively. HER2-positive patients had increased odds of dying from breast cancer compared with HER2-negative patients. Polysomy 17 was demonstrated in 12.5% of all patients and 33% of FISH-positive patients. Nineteen of 20 FISH-positive patients with polysomy 17 were also RT-PCR HER2 positive. Although not statistically significantly different, HER2-positive/polysomy 17 patients tended to have the worst prognosis, followed by HER2-positive/eusomic, HER2-negative/polysomy 17, and HER2-negative/eusomic patients. There is a high degree of concordance between central FISH and quantitative RT-PCR using Oncotype DX for HER2 status, and the assay warrants additional study in a trastuzumab-treated population.

  17. The origin and early evolution of nucleic acid polymerases

    NASA Technical Reports Server (NTRS)

    Lazcano, A.; Cappello, R.; Valverde, V.; Llaca, V.; Oro, J.

    1992-01-01

    The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the eubacterial RNA-polymerase beta-prime subunit and its homologues is discussed. It is shown that, in the DNA-dependent RNA polymerases from three cellular lineages, a very conserved sequence of eight amino acids, also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein, is present. The optimal conditions for the replicase activity of the avian-myeloblastosis-virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is discussed.

  18. An immortalized goat mammary epithelial cell line induced with human telomerase reverse transcriptase (hTERT) gene transfer.

    PubMed

    He, Y L; Wu, Y H; He, X N; Liu, F J; He, X Y; Zhang, Y

    2009-06-01

    Although mammary epithelial cell lines can provide a rapid and reliable indicator of gene expression efficiency of transgenic animals, their short lifespan greatly limits this application. To provide stable and long lifespan cells, goat mammary epithelial cells (GMECs) were transduced with pLNCX2-hTERT by retrovirus-mediated gene transfer. Transduced GMECs were evaluated by reverse transcriptase polymerase chain reaction (RT-PCR), proliferation assays, karyotype analysis, telomerase activity assay, western blotting, soft agar assay, and injection into nude mice. Non-transduced GMECs were used as a control. The hTERT-GMECs had higher telomerase activity and extended proliferative lifespan compared to non-transfected GMECs; even after Passage 50, hTERT-GMECs had a near diploid complement of chromosomes. Furthermore, they did not gain the anchorage-independent growth property and were not associated with a malignant phenotype in vitro or in vivo.

  19. Human telomerase reverse transcriptase is a promising target for cancer inhibition in squamous cell carcinomas.

    PubMed

    Park, Young-Jin; Kim, Eun-Kyoung; Moon, Sook; Hong, Doo-Pyo; Bae, Jung Yoon; Kim, Jin

    2014-11-01

    The present study aimed to investigate whether the down-regulation of human telomerase reverse transcriptase (hTERT) may induce an anti-invasive effect in oral squamous cell cancer cell lines. A genetically-engineered squamous carcinoma cell line overexpressing hTERT in immortalized oral keratinocytes transfected by human papilloma virus (HPV)-16 E6/E7 (IHOK) was used. In vivo tumorigenicity was examined using an orthotopic xenograft model of nude mice. For evaluating anti-invasive activity by knockdown of hTERT expression, transwell invasion assay and real-time polymerase chain reaction (PCR) for matrix metalloproteinases (MMP) were employed. The down-regulation of hTERT expression reduced the invasive activity and MMP expression. This result was re-confirmed in the HSC3 oral squamous carcinoma cell line. Targeting hTERT may lead to novel therapeutic approaches. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  20. Astrocyte- and endothelial-targeted CCL2 conditional knockout mice: critical tools for studying the pathogenesis of neuroinflammation.

    PubMed

    Ge, Shujun; Murugesan, Nivetha; Pachter, Joel S

    2009-09-01

    While the expression of the C-C chemokine ligand 2 (CCL2) in the central nervous system (CNS) is associated with numerous neuroinflammatory conditions, the critical cellular sources of this chemokine, which is responsible for disease processes-as well as associated pathogenic mechanisms, remain unresolved. As the potential for anti-CCL2 therapeutics in treating neuroinflammatory disease is likely to be contingent upon effective drug delivery to the source(s) and/or target(s) of CCL2 action in the CNS, tools to highlight the course of CCL2 action during neuroinflammation are imperative. In response to this need, we used the Cre/loxP and FLP-FRT recombination system to develop the first two, cell-conditional CCL2 knockout mice-separately targeting CCL2 gene elimination to astrocytes and endothelial cells, both of which have been considered to play crucial though undefined roles in neuroinflammatory disease. Specifically, mice containing a floxed CCL2 allele were intercrossed with GFAP-Cre or Tie2-Cre transgenic mice to generate mice with CCL2-deficient astrocytes (astrocyte KO) or endothelial cells (endothelial KO), respectively. Polymerase chain reaction, reverse transcription polymerase chain reaction/quantitative reverse transcriptase polymerase chain reaction, and enzyme-linked immunosorbent assay of CCL2 gene, RNA, and protein, respectively, from cultured astrocytes and brain microvascular endothelial cells (BMEC) established the efficiency and specificity of the CCL2 gene deletions and a CCL2 null phenotype in these CNS cells. Effective cell-conditional knockout of CCL2 was also confirmed in an in vivo setting, wherein astrocytes and BMEC were retrieved by immune-guided laser capture microdissection from their in situ positions in the brains of mice experiencing acute, lipopolysaccharide-mediated endotoxemia to induce CCL2 gene expression. In vivo analysis further revealed apparent cross-talk between BMEC and astrocytes regarding the regulation of astrocyte CCL2 expression. Use of astrocyte KO and endothelial KO mice should prove critical in elaborating the pathogenic mechanisms of and optimizing the treatments for neuroinflammatory disease.

  1. Pinhole Micro-SPECT/CT for Noninvasive Monitoring and Quantitation of Oncolytic Virus Dispersion and Percent Infection in Solid Tumors

    PubMed Central

    Penheiter, Alan R.; Griesmann, Guy E.; Federspiel, Mark J.; Dingli, David; Russell, Stephen J.; Carlson, Stephanie K.

    2011-01-01

    The purpose of our study was to validate the ability of pinhole micro-single-photon emission computed tomography/computed tomography (SPECT/CT) to 1) accurately resolve the intratumoral dispersion pattern and 2) quantify the infection percentage in solid tumors of an oncolytic measles virus encoding the human sodium iodide symporter (MV-NIS). NIS RNA level and dispersion pattern were determined in control and MV-NIS infected BxPC-3 pancreatic tumor cells and mouse xenografts using quantitative, real-time, reverse transcriptase, polymerase chain reaction, autoradiography, and immunohistochemistry (IHC). Mice with BxPC-3 xenografts were imaged with 123I or 99TcO4 micro-SPECT/CT. Tumor dimensions and radionuclide localization were determined with imaging software. Linear regression and correlation analyses were performed to determine the relationship between tumor infection percentage and radionuclide uptake (% injected dose per gram) above background and a highly significant correlation was observed (r2 = 0.947). A detection threshold of 1.5-fold above the control tumor uptake (background) yielded a sensitivity of 2.7% MV-NIS infected tumor cells. We reliably resolved multiple distinct intratumoral zones of infection from noninfected regions. Pinhole micro-SPECT/CT imaging using the NIS reporter demonstrated precise localization and quantitation of oncolytic MV-NIS infection and can replace more time-consuming and expensive analyses (eg, autoradiography and IHC) that require animal sacrifice. PMID:21753796

  2. Evidence for retrovirus infections in green turtles Chelonia mydas from the Hawaiian islands

    USGS Publications Warehouse

    Casey, R.N.; Quackenbush, S.L.; Work, Thierry M.; Balazs, G.H.; Bowser, P.R.; Casey, J.W.

    1997-01-01

    Apparently normal Hawaiian green turtles Chelonia mydas and those displaying fibropapillomas were analyzed for infection by retroviruses. Strikingly, all samples were positive for polymerase enhanced reverse transcriptase (PERT) with levels high enough to quantitate by the conventional reverse transcriptase (RT) assay. However, samples of skin, even from asymptomatic turtles, were RT positive, although the levels of enzyme activity in healthy turtles hatched and raised in captivity were much lower than those observed in asymptomatic free-ranging turtles. Turtles with fibropapillomas displayed a broad range of reverse transcriptase activity. Skin and eye fibropapillomas and a heart tumor were further analyzed and shown to have reverse transcriptase activity that banded in a sucrose gradient at 1.17 g ml-1. The reverse transcriptase activity purified from the heart tumor displayed a temperature optimum of 37??C and showed a preference for Mn2+ over Mg2+. Sucrose gradient fractions of this sample displaying elevated reverse transcriptase activity contained primarily retrovitalsized particles with prominent envelope spikes, when negatively stained and examined by electron microscopy. Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of gradient-purified virions revealed a conserved profile among 4 independent tumors and showed 7 prominent proteins having molecular weights of 116, 83, 51, 43, 40, 20 and 14 kDa. The data suggest that retroviral infections are widespread in Hawaiian green turtles and a comprehensive investigation is warranted to address the possibility that these agents cause green turtle fibropapillomatosis (GTFP).

  3. Improving statistical inference on pathogen densities estimated by quantitative molecular methods: malaria gametocytaemia as a case study.

    PubMed

    Walker, Martin; Basáñez, María-Gloria; Ouédraogo, André Lin; Hermsen, Cornelus; Bousema, Teun; Churcher, Thomas S

    2015-01-16

    Quantitative molecular methods (QMMs) such as quantitative real-time polymerase chain reaction (q-PCR), reverse-transcriptase PCR (qRT-PCR) and quantitative nucleic acid sequence-based amplification (QT-NASBA) are increasingly used to estimate pathogen density in a variety of clinical and epidemiological contexts. These methods are often classified as semi-quantitative, yet estimates of reliability or sensitivity are seldom reported. Here, a statistical framework is developed for assessing the reliability (uncertainty) of pathogen densities estimated using QMMs and the associated diagnostic sensitivity. The method is illustrated with quantification of Plasmodium falciparum gametocytaemia by QT-NASBA. The reliability of pathogen (e.g. gametocyte) densities, and the accompanying diagnostic sensitivity, estimated by two contrasting statistical calibration techniques, are compared; a traditional method and a mixed model Bayesian approach. The latter accounts for statistical dependence of QMM assays run under identical laboratory protocols and permits structural modelling of experimental measurements, allowing precision to vary with pathogen density. Traditional calibration cannot account for inter-assay variability arising from imperfect QMMs and generates estimates of pathogen density that have poor reliability, are variable among assays and inaccurately reflect diagnostic sensitivity. The Bayesian mixed model approach assimilates information from replica QMM assays, improving reliability and inter-assay homogeneity, providing an accurate appraisal of quantitative and diagnostic performance. Bayesian mixed model statistical calibration supersedes traditional techniques in the context of QMM-derived estimates of pathogen density, offering the potential to improve substantially the depth and quality of clinical and epidemiological inference for a wide variety of pathogens.

  4. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  5. Application of Reverse Transcriptase -PCR (RT-PCR) for rapid detection of viable Escherichia coli in drinking water samples.

    PubMed

    Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah

    2015-01-01

    Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.

  6. Interaction of HIV-1 reverse transcriptase ribonuclease H with an acylhydrazone inhibitor.

    PubMed

    Gong, Qingguo; Menon, Lakshmi; Ilina, Tatiana; Miller, Lena G; Ahn, Jinwoo; Parniak, Michael A; Ishima, Rieko

    2011-01-01

    HIV-1 reverse transcriptase is a bifunctional enzyme, having both DNA polymerase (RNA- and DNA-dependent) and ribonuclease H activities. HIV-1 reverse transcriptase has been an exceptionally important target for antiretroviral therapeutic development, and nearly half of the current clinically used antiretrovirals target reverse transcriptase DNA polymerase. However, no inhibitors of reverse transcriptase ribonuclease H are on the market or in preclinical development. Several drug-like small molecule inhibitors of reverse transcriptase ribonuclease H have been described, but little structural information is available about the interactions between reverse transcriptase ribonuclease H and inhibitors that exhibit antiviral activity. In this report, we describe NMR studies of the interaction of a new ribonuclease H inhibitor, BHMP07, with a catalytically active HIV-1 reverse transcriptase ribonuclease H domain fragment. We carried out solution NMR experiments to identify the interaction interface of BHMP07 with the ribonuclease H domain fragment. Chemical shift changes of backbone amide signals at different BHMP07 concentrations clearly demonstrate that BHMP07 mainly recognizes the substrate handle region in the ribonuclease H fragment. Using ribonuclease H inhibition assays and reverse transcriptase mutants, the binding specificity of BHMP07 was compared with another inhibitor, dihydroxy benzoyl naphthyl hydrazone. Our results provide a structural characterization of the ribonuclease H inhibitor interaction and are likely to be useful for further improvements of the inhibitors. © 2010 John Wiley & Sons A/S.

  7. From Cells to Virus Particles: Quantitative Methods to Monitor RNA Packaging

    PubMed Central

    Ferrer, Mireia; Henriet, Simon; Chamontin, Célia; Lainé, Sébastien; Mougel, Marylène

    2016-01-01

    In cells, positive strand RNA viruses, such as Retroviridae, must selectively recognize their full-length RNA genome among abundant cellular RNAs to assemble and release particles. How viruses coordinate the intracellular trafficking of both RNA and protein components to the assembly sites of infectious particles at the cell surface remains a long-standing question. The mechanisms ensuring packaging of genomic RNA are essential for viral infectivity. Since RNA packaging impacts on several essential functions of retroviral replication such as RNA dimerization, translation and recombination events, there are many studies that require the determination of RNA packaging efficiency and/or RNA packaging ability. Studies of RNA encapsidation rely upon techniques for the identification and quantification of RNA species packaged by the virus. This review focuses on the different approaches available to monitor RNA packaging: Northern blot analysis, ribonuclease protection assay and quantitative reverse transcriptase-coupled polymerase chain reaction as well as the most recent RNA imaging and sequencing technologies. Advantages, disadvantages and limitations of these approaches will be discussed in order to help the investigator to choose the most appropriate technique. Although the review was written with the prototypic simple murine leukemia virus (MLV) and complex human immunodeficiency virus type 1 (HIV-1) in mind, the techniques were described in order to benefit to a larger community. PMID:27556480

  8. A competitive chemiluminescence enzyme immunoassay method for β-defensin-2 detection in transgenic mice.

    PubMed

    Yang, Xi; Zhou, Tao; Yu, Lei; Tan, Wenwen; Zhou, Rui; Hu, Yonggang

    2015-03-01

    A competitive chemiluminescence enzyme immunoassay (CLEIA) method for porcine β-defensin-2 (pBD-2) detection in transgenic mice was established. Several factors that affect detection, including luminol, p-iodophenol and hydrogen peroxide concentrations, as well as pH, were studied and optimized. The linear range of the proposed method for pBD-2 detection under optimal conditions was 0.05-80 ng/mL with a correlation coefficient of 0.9960. Eleven detections of a 30 ng/mL pBD-2 standard sample were performed. Reproducible results were obtained with a relative standard deviation of 3.94%. The limit of detection of the method for pBD-2 was 3.5 pg/mL (3σ). The proposed method was applied to determine pBD-2 expression levels in the tissues of pBD-2 transgenic mice, and compared with LC-MS/MS and quantitative real-time reverse-transcriptase polymerase chain reaction. This suggests that the CLEIA can be used as a valuable method to detect and quantify pBD-2. Copyright © 2014 John Wiley & Sons, Ltd.

  9. Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

    PubMed

    Jiang, Z; Gui, S; Zhang, Y

    2011-05-01

    Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Molecular cloning and expression profile analysis of porcine TCAP gene.

    PubMed

    Cheng, Hunjun; Xu, Xuewen; Zhao, Shuhong; Liu, Bang; Yu, Mei; Fan, Bin

    2010-03-01

    The gradually discovered sarcomeric proteins play important roles for structural integrity and signal transduction of sarcomere during myofibril genesis. TCAP (also described as telethonin, T-cap), one of the sarcomeric protein genes, is regulated developmentally. In this study, we reported the molecular characteristics of porcine TCAP gene. A 979 bp TCAP cDNA nucleotide sequence was obtained in pig and the deduced amino acid sequence had 92 and 91% identity to those of human and mouse homologous genes, respectively. One SNP was discovered and the allele frequency analysis showed that G allele frequency was low among 221 unrelated pigs from seven breeds. The tissue distribution patterns revealed that TCAP mRNA was expressed abundantly in skeletal and heart muscle tissue. Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) results displayed TCAP mRNA was up-regulated in both Tongcheng and Landrace pigs during prenatal skeletal muscle development stages. This study suggested that TCAP gene might be a prospective candidate gene affecting muscle mass and meat quality traits in the pig, and also implicated the possible significance of TCAP on sarcomere assembly.

  11. Garlic (Allium sativum) stimulates lipopolysaccharide-induced tumor necrosis factor-alpha production from J774A.1 murine macrophages.

    PubMed

    Sung, Jessica; Harfouche, Youssef; De La Cruz, Melissa; Zamora, Martha P; Liu, Yan; Rego, James A; Buckley, Nancy E

    2015-02-01

    Garlic (Allium sativum) is known to have many beneficial attributes such as antimicrobial, antiatherosclerotic, antitumorigenetic, and immunomodulatory properties. In the present study, we investigated the effects of an aqueous garlic extract on macrophage cytokine production by challenging the macrophage J774A.1 cell line with the garlic extract in the absence or presence of lipopolysaccharide (LPS) under different conditions. The effect of allicin, the major component of crushed garlic, was also investigated. Using enzyme-linked immunosorbent assay and reverse transcriptase-quantitative polymerase chain reaction, it was found that garlic and synthetic allicin greatly stimulated tumor necrosis factor-alpha (TNF-α) production in macrophages treated with LPS. The TNF-α secretion levels peaked earlier and were sustained for a longer time in cells treated with garlic and LPS compared with cells treated with LPS alone. Garlic acted in a time-dependent manner. We suggest that garlic, at least partially via its allicin component, acts downstream from LPS to stimulate macrophage TNF-α secretion. © 2014 The Authors. Phytotherapy Research published by John Wiley & Sons, Ltd.

  12. MAEWEST expression in flower development of two petunia species.

    PubMed

    Segatto, Ana Lúcia A; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B; Monte-Bello, Carolina C; Dornelas, Marcelo C; Margis, Rogerio; Freitas, Loreta B

    2013-07-03

    Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription-quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

  13. Downregulation of telomerase activity in human promyelocytic cell line using RNA interference.

    PubMed

    Miri-Moghaddam, E; Deezagi, A; Soheili, Z S

    2009-12-01

    Telomerase is a ribonucleoprotein complex. It consists of two main components, human telomerase reverse transcriptase (hTERT) and human telomerase RNA. High telomerase activity is present in most malignant cells, but it is barely detectable in majority of somatic cells. The direct correlation between telomerase reactivation and carcinogens has made hTERT a key target for anticancer therapeutic studies. In this study, for the first time, we evaluated the ability of the new generation of short interfering RNA (siRNA) to regulate telomerase activity in the human promyelocytic leukemia cell line (HL-60). Transient transfection cell line by hTERT siRNAs resulted in statistically significant suppression of hTERT messenger RNAs which were detected by quantitative real-time polymerase chain reaction, while the expressed hTERT protein levels were measured by flow cytometry. The results of telomeric repeat amplification protocol showed that telomerase activity was significantly reduced upon transfection of the HL-60 cell line with hTERT siRNAs. The results of this study showed that telomerase activity and cell proliferation were efficiently inhibited in the hTERT siRNA-treated leukemic cell line.

  14. Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

    PubMed

    Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

    2016-10-01

    Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

  15. The citrus flavonone hesperetin attenuates the nuclear translocation of aryl hydrocarbon receptor.

    PubMed

    Tan, Yan Qin; Chiu-Leung, Leo Clement; Lin, Shu-Mei; Leung, Lai K

    2018-08-01

    The environmental polycyclic aromatic hydrocarbons (PAH) and dioxins are carcinogens and their adverse effects have been largely attributed to the activation of AhR. Hesperetin is a flavonone found abundantly in citrus fruits and has been shown to be a biologically active agent. In the present study, the effect of hesperetin on the nuclear translocation of AhR and the downstream gene expression was investigated in MCF-7 cells. Confocal microscopy indicated that 7, 12-dimethylbenz[α]anthracene (DMBA) or 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) -induced nuclear translocation of AhR was deterred by hesperetin treatment. The reduced nuclear translocation could also be observed in Western analysis. Reporter-gene assay further illustrated that the induced XRE transactivation was weakened by the treatment of hesperetin. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay demonstrated that the gene expressions of CYP1A1, 1A2, and 1B1 followed the same pattern of AhR translocation. These results suggested that hesperetin counteracted AhR transactivation and suppressed the downstream gene expression. Copyright © 2018 Elsevier Inc. All rights reserved.

  16. Detection and management of minimal residual disease in acute lymphoblastic leukemia.

    PubMed

    Schrappe, Martin

    2014-12-05

    The detection of minimal residual disease (MRD) has become part of the state-of-the-art diagnostics to guide treatment both in pediatric and adult acute lymphoblastic leukemia (ALL). This applies to the treatment of de novo and recurrent ALL. In high-risk ALL, MRD detection is considered an important tool to adjust therapy before and after hematopoietic stem cell transplantation. Precise quantification and quality control is instrumental to avoid false treatment assignment. A new methodological approach to analyzing MRD has become available and is based on next-generation sequencing. In principle, this technique will be able to detect a large number of leukemic subclones at a much higher speed than before. Carefully designed prospective studies need to demonstrate concordance or even superiority compared with those techniques in use right now: detection of aberrant expression of leukemia-specific antigens by flow cytometry of blood or bone marrow, or detection of specific rearrangements of the T-cell receptor or immunoglobulin genes by real-time quantitative polymerase chain reaction using DNA of leukemic cells. In some cases with known fusion genes, such as BCR/ABL, reverse transcriptase-polymerase chain reaction has been used as additional method to identify leukemic cells by analyzing RNA in patient samples. MRD detection may be used to modulate treatment intensity once it has been demonstrated at well-defined informative checkpoints that certain levels of MRD can reliably predict the risk of relapse. In addition, MRD is used as end point to determine the activity of a given agent or treatment protocol. If activity translates into antileukemic efficacy, MRD may be considered a surrogate clinical end point. © 2014 by The American Society of Hematology. All rights reserved.

  17. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  18. Biofilms and Antifungal Susceptibility Testing.

    PubMed

    Simitsopoulou, Maria; Chatzimoschou, Athanasios; Roilides, Emmanuel

    2016-01-01

    Yeasts and filamentous fungi both exist as single cells and hyphal forms, two morphologies used by most fungal organisms to create a complex multilayered biofilm structure. In this chapter we describe the most widely used assays for the determination of biofilm production and assessment of susceptibility of biofilms to antifungal agents or host phagocytes as various methods, the most frequent of which are staining, confocal laser scanning microscopy, quantification of extracellular DNA and protein associated with extracellular matrix and XTT metabolic reduction assay. Pathway-focused biofilm gene expression profiling is assessed by real-time reverse transcriptase polymerase chain reaction.

  19. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    PubMed

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  20. A Model of Risk Analysis in Analytical Methodology for Biopharmaceutical Quality Control.

    PubMed

    Andrade, Cleyton Lage; Herrera, Miguel Angel De La O; Lemes, Elezer Monte Blanco

    2018-01-01

    One key quality control parameter for biopharmaceutical products is the analysis of residual cellular DNA. To determine small amounts of DNA (around 100 pg) that may be in a biologically derived drug substance, an analytical method should be sensitive, robust, reliable, and accurate. In principle, three techniques have the ability to measure residual cellular DNA: radioactive dot-blot, a type of hybridization; threshold analysis; and quantitative polymerase chain reaction. Quality risk management is a systematic process for evaluating, controlling, and reporting of risks that may affects method capabilities and supports a scientific and practical approach to decision making. This paper evaluates, by quality risk management, an alternative approach to assessing the performance risks associated with quality control methods used with biopharmaceuticals, using the tool hazard analysis and critical control points. This tool provides the possibility to find the steps in an analytical procedure with higher impact on method performance. By applying these principles to DNA analysis methods, we conclude that the radioactive dot-blot assay has the largest number of critical control points, followed by quantitative polymerase chain reaction, and threshold analysis. From the analysis of hazards (i.e., points of method failure) and the associated method procedure critical control points, we conclude that the analytical methodology with the lowest risk for performance failure for residual cellular DNA testing is quantitative polymerase chain reaction. LAY ABSTRACT: In order to mitigate the risk of adverse events by residual cellular DNA that is not completely cleared from downstream production processes, regulatory agencies have required the industry to guarantee a very low level of DNA in biologically derived pharmaceutical products. The technique historically used was radioactive blot hybridization. However, the technique is a challenging method to implement in a quality control laboratory: It is laborious, time consuming, semi-quantitative, and requires a radioisotope. Along with dot-blot hybridization, two alternatives techniques were evaluated: threshold analysis and quantitative polymerase chain reaction. Quality risk management tools were applied to compare the techniques, taking into account the uncertainties, the possibility of circumstances or future events, and their effects upon method performance. By illustrating the application of these tools with DNA methods, we provide an example of how they can be used to support a scientific and practical approach to decision making and can assess and manage method performance risk using such tools. This paper discusses, considering the principles of quality risk management, an additional approach to the development and selection of analytical quality control methods using the risk analysis tool hazard analysis and critical control points. This tool provides the possibility to find the method procedural steps with higher impact on method reliability (called critical control points). Our model concluded that the radioactive dot-blot assay has the larger number of critical control points, followed by quantitative polymerase chain reaction and threshold analysis. Quantitative polymerase chain reaction is shown to be the better alternative analytical methodology in residual cellular DNA analysis. © PDA, Inc. 2018.

  1. Evaluation of reference genes for quantitative real-time RT-PCR analysis of gene expression in Nile tilapia (Oreochromis niloticus).

    PubMed

    Yang, Chang Geng; Wang, Xian Li; Tian, Juan; Liu, Wei; Wu, Fan; Jiang, Ming; Wen, Hua

    2013-09-15

    Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) has been used frequently to study gene expression related to fish immunology. In such studies, a stable reference gene should be selected to correct the expression of the target gene. In this study, seven candidate reference genes (glyceraldehyde-3-phosphate dehydrogenase (GADPH), ubiquitin-conjugating enzyme (UBCE), 18S ribosomal RNA (18S rRNA), beta-2-microglobulin (B2M), elongation factor 1 alpha (EF1A), tubulin alpha chain-like (TUBA) and beta actin (ACTB)), were selected to analyze their stability and normalization in seven tissues (liver, spleen, kidney, brain, heart, muscle and intestine) of Nile tilapia (Oreochromis niloticus) challenged with Streptococcus agalactiae or Streptococcus iniae, respectively. The results showed that all the candidate reference genes exhibited tissue-dependent transcriptional variations. With PBS injection as a control, UBCE was the most stable and suitable single reference gene in the intestine, liver, brain, kidney, and spleen after S. iniae infection, and in the liver, kidney, and spleen after S. agalactiae infection. EF1A was the most suitable in heart and muscle after S. iniae or S. agalactiae infection. GADPH was the most suitable gene in intestine and brain after S. agalactiae infection. In normal conditions, UBCE and 18S rRNA were the most stably expressed genes across the various tissues. These results showed that for RT-qPCR analysis of tilapia, selecting two or more reference genes may be more suitable for cross-tissue analysis of gene expression. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Evidence of cardiac involvement in the fetal inflammatory response syndrome: disruption of gene networks programming cardiac development in nonhuman primates.

    PubMed

    Mitchell, Timothy; MacDonald, James W; Srinouanpranchanh, Sengkeo; Bammler, Theodor K; Merillat, Sean; Boldenow, Erica; Coleman, Michelle; Agnew, Kathy; Baldessari, Audrey; Stencel-Baerenwald, Jennifer E; Tisoncik-Go, Jennifer; Green, Richard R; Gale, Michael J; Rajagopal, Lakshmi; Adams Waldorf, Kristina M

    2018-04-01

    Most early preterm births are associated with intraamniotic infection and inflammation, which can lead to systemic inflammation in the fetus. The fetal inflammatory response syndrome describes elevations in the fetal interleukin-6 level, which is a marker for inflammation and fetal organ injury. An understanding of the effects of inflammation on fetal cardiac development may lead to insight into the fetal origins of adult cardiovascular disease. The purpose of this study was to determine whether the fetal inflammatory response syndrome is associated with disruptions in gene networks that program fetal cardiac development. We obtained fetal cardiac tissue after necropsy from a well-described pregnant nonhuman primate model (pigtail macaque, Macaca nemestrina) of intrauterine infection (n=5) and controls (n=5). Cases with the fetal inflammatory response syndrome (fetal plasma interleukin-6 >11 pg/mL) were induced by either choriodecidual inoculation of a hypervirulent group B streptococcus strain (n=4) or intraamniotic inoculation of Escherichia coli (n=1). RNA and protein were extracted from fetal hearts and profiled by microarray and Luminex (Millipore, Billerica, MA) for cytokine analysis, respectively. Results were validated by quantitative reverse transcriptase polymerase chain reaction. Statistical and bioinformatics analyses included single gene analysis, gene set analysis, Ingenuity Pathway Analysis (Qiagen, Valencia, CA), and Wilcoxon rank sum. Severe fetal inflammation developed in the context of intraamniotic infection and a disseminated bacterial infection in the fetus. Interleukin-6 and -8 in fetal cardiac tissues were elevated significantly in fetal inflammatory response syndrome cases vs controls (P<.05). A total of 609 probe sets were expressed differentially (>1.5-fold change, P<.05) in the fetal heart (analysis of variance). Altered expression of select genes was validated by quantitative reverse transcriptase polymerase chain reaction that included several with known functions in cardiac injury, morphogenesis, angiogenesis, and tissue remodeling (eg, angiotensin I converting enzyme 2, STEAP family member 4, natriuretic peptide A, and secreted frizzled-related protein 4; all P<.05). Multiple gene sets and pathways that are involved in cardiac morphogenesis and vasculogenesis were downregulated significantly by gene set and Ingenuity Pathway Analysis (hallmark transforming growth factor beta signaling, cellular morphogenesis during differentiation, morphology of cardiovascular system; all P<.05). Disruption of gene networks for cardiac morphogenesis and vasculogenesis occurred in the preterm fetal heart of nonhuman primates with preterm labor, intraamniotic infection, and severe fetal inflammation. Inflammatory injury to the fetal heart in utero may contribute to the development of heart disease later in life. Development of preterm labor therapeutics must also target fetal inflammation to lessen organ injury and potential long-term effects on cardiac function. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

  4. Diagnosis of feline leukaemia virus infection by semi-quantitative real-time polymerase chain reaction.

    PubMed

    Pinches, Mark D G; Helps, Christopher R; Gruffydd-Jones, Tim J; Egan, Kathy; Jarrett, Oswald; Tasker, Séverine

    2007-02-01

    In this paper the design and use of a semi-quantitative real-time polymerase chain reaction assay (RT-PCR) for feline leukaemia virus (FeLV) provirus is described. Its performance is evaluated against established methods of FeLV diagnosis, including virus isolation and enzyme-linked immunoassay (ELISA) in a population of naturally infected cats. The RT-PCR assay is found to have both a high sensitivity (0.92) and specificity (0.99) when examined by expectation maximisation methods and is also able to detect a large number of cats with low FeLV proviral loads that were negative by other conventional test methods.

  5. Low-grade sinonasal sarcoma with neural and myogenic features: a clinicopathologic analysis of 28 cases.

    PubMed

    Lewis, Jason T; Oliveira, Andre M; Nascimento, Antonio G; Schembri-Wismayer, David; Moore, Eric A; Olsen, Kerry D; Garcia, Joaquin G; Lonzo, Melissa L; Lewis, Jean E

    2012-04-01

    Sarcomas of the sinonasal region are rare. We describe a distinct spindle cell sarcoma of the sinonasal region characterized by concomitant neural and myogenic differentiation. Consultation files and surgical cases from Mayo Clinic were reviewed. Twenty-eight cases were identified that met the inclusion criteria. Clinical data were collected from medical records, consultation letters, and referring pathologists. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was performed on 18 cases. Cytogenetic studies were performed on 2 cases. The 21 female and 7 male patients ranged in age from 24 to 85 years (mean, 52 y). All cases showed a characteristic histology, which included a cellular spindle cell neoplasm with uniform, elongate nuclei and an infiltrative growth pattern. All tumors demonstrated expression of S-100 with actin positivity in 96% of cases tested. Reverse transcriptase-polymerase chain reaction for synovial sarcoma fusion transcripts was negative in all cases tested. Cytogenetic studies conducted on 2 cases demonstrated the chromosomal translocation t(2;4). The nasal cavity (54%) and ethmoid sinus (57%) were the most commonly involved areas, singly or in combination. Follow-up information was available for 57% (16/28) of cases, with a mean of 8.3 years. Of these, 44% (7/16) experienced at least 1 recurrence. No patient has developed metastases or died of disease. We describe a unique tumor with a characteristic morphologic, immunophenotypic, and cytogenetic profile. On the basis of the locally aggressive nature of this lesion we believe it is best considered a low-grade sarcoma and suggest the term low-grade sinonasal sarcoma with neural and myogenic features.

  6. Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma

    PubMed Central

    Palmieri, Giuseppe; Satriano, Sabrina MR; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

    2006-01-01

    Background Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). Methods One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Results Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (≥2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Conclusion Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease. PMID:17107608

  7. Serial detection of circulating tumour cells by reverse transcriptase-polymerase chain reaction assays is a marker for poor outcome in patients with malignant melanoma.

    PubMed

    Palmieri, Giuseppe; Satriano, Sabrina M R; Budroni, Mario; Cossu, Antonio; Tanda, Francesco; Canzanella, Sergio; Caracò, Corrado; Simeone, Ester; Daponte, Antonio; Mozzillo, Nicola; Comella, Giuseppe; Castello, Giuseppe; Ascierto, Paolo A

    2006-11-15

    Detection of circulating malignant cells (CMCs) through a reverse transcriptase-polymerase chain reaction (RT-PCR) assay seems to be a demonstration of systemic disease. We here evaluated the prognostic role of RT-PCR assays in serially-taken peripheral blood samples from patients with malignant melanoma (MM). One hundred forty-nine melanoma patients with disease stage ranging from I to III were consecutively collected in 1997. A multi-marker RT-PCR assay was used on peripheral blood samples obtained at time of diagnosis and every 6 months during the first two years of follow-up (total: 5 samples). Univariate and multivariate analyses were performed after 83 months of median follow-up. Detection of at least one circulating mRNA marker was considered a signal of the presence of CMC (referred to as PCR-positive assay). A significant correlation was found between the rate of recurrences and the increasing number of PCR-positive assays (P = 0.007). Presence of CMC in a high number (> or =2) of analysed blood samples was significantly correlated with a poor clinical outcome (disease-free survival: P = 0.019; overall survival: P = 0.034). Multivariate analysis revealed that presence of a PCR-positive status does play a role as independent prognostic factors for overall survival in melanoma patients, adding precision to the predictive power of the disease stage. Our findings indicated that serial RT-PCR assay may identify a high risk subset of melanoma patients with occult cancer cells constantly detected in blood circulation. Prolonged presence of CMCs seems to act as a surrogate marker of disease progression or a sign of more aggressive disease.

  8. Sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction detecting feline coronavirus mutations in effusion and serum/plasma of cats to diagnose feline infectious peritonitis.

    PubMed

    Felten, Sandra; Leutenegger, Christian M; Balzer, Hans-Joerg; Pantchev, Nikola; Matiasek, Kaspar; Wess, Gerhard; Egberink, Herman; Hartmann, Katrin

    2017-08-02

    Feline coronavirus (FCoV) exists as two pathotypes, and FCoV spike gene mutations are considered responsible for the pathotypic switch in feline infectious peritonitis (FIP) pathogenesis. The aim of this study was to evaluate sensitivity and specificity of a real-time reverse transcriptase polymerase chain reaction (RT-PCR) specifically designed to detect FCoV spike gene mutations at two nucleotide positions. It was hypothesized that this test would correctly discriminate feline infectious peritonitis virus (FIPV) and feline enteric coronavirus (FECV). The study included 63 cats with signs consistent with FIP. FIP was confirmed in 38 cats. Twenty-five control cats were definitively diagnosed with a disease other than FIP. Effusion and/or serum/plasma samples were examined by real-time RT-PCR targeting the two FCoV spike gene fusion peptide mutations M1058 L and S1060A using an allelic discrimination approach. Sensitivity, specificity, negative and positive predictive values including 95% confidence intervals (95% CI) were calculated. FIPV was detected in the effusion of 25/59 cats, one of them being a control cat with chronic kidney disease. A mixed population of FIPV/FECV was detected in the effusion of 2/59 cats; all of them had FIP. RT-PCR was negative or the pathotype could not be determined in 34/59 effusion samples. In effusion, sensitivity was 68.6% (95% CI 50.7-83.2), specificity was 95.8% (95% CI 78.9-99.9). No serum/plasma samples were positive for FIPV. Although specificity of the test in effusions was high, one false positive result occurred. The use of serum/plasma cannot be recommended due to a low viral load in blood.

  9. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST).

    PubMed

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase-polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains.

  10. Assessment Effects of Resveratrol on Human Telomerase Reverse Transcriptase Messenger Ribonucleic Acid Transcript in Human Glioblastoma

    PubMed Central

    Mirzazadeh, Azin; Kheirollahi, Majid; Farashahi, Ehsan; Sadeghian-Nodoushan, Fatemeh; Sheikhha, Mohammad Hasan; Aflatoonian, Behrouz

    2017-01-01

    Background: Glioblastoma (GBM) is the most common and aggressive brain tumor, which has a poor prognosis despite the advent of different therapeutic strategies. There are numerous molecular biomarkers to contribute diagnosis, prognosis, and prediction of response to the current therapy in GBM. One of the most important markers that are potentially valuable is immortalization-specific or immortalization-associated marker named “hTERT messenger ribonucleic acid (mRNA)” the key subunit of telomerase enzyme, which is expressed in more than 85% of cancer cells, in spite of the majority of normal somatic cells. In this study, we investigated the effects of resveratrol (RSV) on this mRNA marker level, leading to cancer progression. Materials and Methods: U-87MG cell line was obtained from Pasteur Institute of Iran and treated with various concentrations of 0–160 μg/mL of RSV and at different time points (24, 48, and 72 h). To evaluate viability of U-87MG cells, standard 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay was performed. Real-time polymerase chain reaction (RT-PCR) was used for comparative and quantitative assessment of human telomerase reverse transcriptase (hTERT) mRNA copy number versus control–untreated group. Results: The results of our investigation suggested that RSV effectively inhibited cell growth and caused cell death in dose-dependent (P < 0.05) and not in time-dependent manner (P > 0.05), in vitro. Interestingly, quantitative RT-PCR analysis demonstrated that at half inhibition concentration, RSV dramatically decreased mRNA expression of hTERT, the catalytic subunit of telomerase enzyme, which leads to prevention of cell division and tumor progression. Conclusion: With regard to downregulation of this immortalization-associated marker, RSV may potentially be used as a therapeutic agent against GBM. PMID:28706881

  11. Clinical comparison of branched DNA and reverse transcriptase-PCR and nucleic acid sequence-based amplification assay for the quantitation of circulating recombinant form_BC HIV-1 RNA in plasma.

    PubMed

    Pan, Pinliang; Tao, Xiaoxia; Zhang, Qi; Xing, Wenge; Sun, Xianguang; Pei, Lijian; Jiang, Yan

    2007-12-01

    To investigate the correlation between three viral load assays for circulating recombinant form (CRF)_BC. Recent studies in HIV-1 molecular epidemiology, reveals that CRF_BC is the dominant subtype of HIV-1 virus in mainland China, representing over 45% of the HIV-1 infected population. The performances of nucleic acid sequence-based amplification (NASBA), branched DNA (bDNA) and reverse transcriptase polymerase chain reaction (RT-PCR) were compared for the HIV-1 viral load detection and quantitation of CRF_BC in China. Sixteen HIV-1 positive and three HIV-1 negative samples were collected. Sequencing of the positive samples in the gp41 region was conducted. The HIV-1 viral load values were determined using bDNA, RT-PCR and NASBA assays. Deming regression analysis with SPSS 12.0 (SPS Inc., Chicago, Illinois, USA) was performed for data analysis. Sequencing and phylogenetic analysis of env gene (gp41) region of the 16 HIV-1 positive clinical specimens from Guizhou Province in southwest China revealed the dominance of the subtype CRF_BC in that region. A good correlation of their viral load values was observed among three assays. Pearson's correlation between RT-PCR and bDNA is 0.969, Lg(VL)RT-PCR = 0.969 * Lg(VL)bDNA + 0.55; Pearson's correlation between RT-PCR and NASBA is 0.968, Lg(VL)RT-PCR = 0.968 * Lg(VL)NASBA + 0.937; Pearson's correlation between NASBA and bDNA is 0.980, Lg(VL)NASBA = 0.980 * Lg(VL)bDNA - 0.318. When testing with 3 different assays, RT-PCR, bDNA and NASBA, the group of 16 HIV-1 positive samples showed the viral load value was highest for RT-PCR, followed by bDNA then NASBA, which is consistent with the former results in subtype B. The three viral load assays are highly correlative for CRF_BC in China.

  12. Digital PCR Quantitation of Muscle Mitochondrial DNA: Age, Fiber Type, and Mutation-Induced Changes.

    PubMed

    Herbst, Allen; Widjaja, Kevin; Nguy, Beatrice; Lushaj, Entela B; Moore, Timothy M; Hevener, Andrea L; McKenzie, Debbie; Aiken, Judd M; Wanagat, Jonathan

    2017-10-01

    Definitive quantitation of mitochondrial DNA (mtDNA) and mtDNA deletion mutation abundances would help clarify the role of mtDNA instability in aging. To more accurately quantify mtDNA, we applied the emerging technique of digital polymerase chain reaction to individual muscle fibers and muscle homogenates from aged rodents. Individual fiber mtDNA content correlated with fiber type and decreased with age. We adapted a digital polymerase chain reaction deletion assay that was accurate in mixing experiments to a mutation frequency of 0.03% and quantitated an age-induced increase in deletion frequency from rat muscle homogenates. Importantly, the deletion frequency measured in muscle homogenates strongly correlated with electron transport chain-deficient fiber abundance determined by histochemical analyses. These data clarify the temporal accumulation of mtDNA deletions that lead to electron chain-deficient fibers, a process culminating in muscle fiber loss. © The Author 2017. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Estrogen- and progesterone-receptor status in ECOG 2197: comparison of immunohistochemistry by local and central laboratories and quantitative reverse transcription polymerase chain reaction by central laboratory.

    PubMed

    Badve, Sunil S; Baehner, Frederick L; Gray, Robert P; Childs, Barrett H; Maddala, Tara; Liu, Mei-Lan; Rowley, Steve C; Shak, Steven; Perez, Edith A; Perez, Edith D; Shulman, Lawrence J; Martino, Silvana; Davidson, Nancy E; Sledge, George W; Goldstein, Lori J; Sparano, Joseph A

    2008-05-20

    Central and local laboratory concordance for hormone receptor measurement is therapeutically important. This study compares estrogen receptor (ER) and progesterone receptor (PR) measured by local laboratory immunohistochemistry (IHC), central IHC, and central reverse-transcriptase polymerase chain reaction (RT-PCR) using a proprietary 21-gene assay. A case-control sample of 776 breast cancer patients from Eastern Cooperative Oncology Group (ECOG) study E2197 was evaluated. Central IHC Allred score for ER and PR was obtained using tissue microarrays and 1D5 ER antibody and 636 PR antibody. Quantitative RT-PCR for ER and PR in whole sections was performed using the 21-gene assay. For ER, the concordance between local and central IHC was 90% (95% CI, 88% to 92%), between local IHC and central RT-PCR was 91% (95% CI, 89% to 93%), and between central IHC and central RT-PCR was 93% (95% CI, 91% to 95%). For PR, the concordance between local IHC and central IHC was 84% (95% CI, 82% to 87%), between local IHC and central RT-PCR was 88% (95% CI, 85% to 90%), and between central IHC and central RT-PCR was 90% (95% CI, 88% to 92%). Although concordance was high, IHC ER-negative cases that were RT-PCR positive were more common than IHC ER-positive cases that were RT-PCR negative. In ER-positive patients, ER expression by central IHC Allred score was marginally associated with recurrence (P = .091), and ER expression by central RT-PCR was significantly associated with recurrence (P = .014). However, recurrence score, which incorporates additional genes/pathways, was a highly significant predictor of recurrence (P < .0001). There is a high degree of concordance among local IHC, central IHC, and central RT-PCR by the proprietary gene assay for ER and PR status. Although ER expression is marginally associated with relapse in ER-positive patients treated with chemohormonal therapy, recurrence score is a highly significant predictor of recurrence.

  14. Role of chicken astrovirus as a causative agent of gout in commercial broilers in India.

    PubMed

    Bulbule, N R; Mandakhalikar, K D; Kapgate, S S; Deshmukh, V V; Schat, K A; Chawak, M M

    2013-01-01

    Several outbreaks of gout were reported in commercial broilers in India during 2011 and 2012, causing up to 40% mortality in the birds. Gross and histopathological observations confirmed gout. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis from kidney samples of gout-affected birds indicated the presence of chicken astrovirus (CAstV) in 41.7% of cases and a mixed infection of CAstV and avian nephritis virus (ANV) in 36.4% of cases. CAstV isolated from gout-affected kidneys by inoculating embryonated specific pathogen free (SPF) eggs showed dwarfing in embryos and a cytopathic effect in chicken embryo kidney cells. Inoculation of 1-day-old SPF and broiler chicks with CAstVs caused gout and mortality between 4 and 10 days post inoculation. Virus isolation and qRT-PCR analysis showed the presence of only CAstV in inoculated chicks. Sequence analysis of capsid genes indicated a major group of Indian CAstVs that displayed 92.0 to 99.2% intergroup amino acid identity and 83.9 to 90.4% identity with subgroup Bi CAstVs of UK origin. We designated this group Indian Bi. Analysis of the partial polymerase amino acid sequences of our isolates indicated two groups of CAstVs (Indian 1 and 2) that displayed 90.2 to 95.5% amino acid identity between them. We thus report for the first time that, in addition to infectious bronchitis virus and ANV, CAstVs are a causative agent of gout.

  15. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  16. Polymerase chain displacement reaction.

    PubMed

    Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang

    2013-02-01

    Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.

  17. Printed Flexible Plastic Microchip for Viral Load Measurement through Quantitative Detection of Viruses in Plasma and Saliva

    PubMed Central

    Shafiee, Hadi; Kanakasabapathy, Manoj Kumar; Juillard, Franceline; Keser, Mert; Sadasivam, Magesh; Yuksekkaya, Mehmet; Hanhauser, Emily; Henrich, Timothy J.; Kuritzkes, Daniel R.; Kaye, Kenneth M.; Demirci, Utkan

    2015-01-01

    We report a biosensing platform for viral load measurement through electrical sensing of viruses on a flexible plastic microchip with printed electrodes. Point-of-care (POC) viral load measurement is of paramount importance with significant impact on a broad range of applications, including infectious disease diagnostics and treatment monitoring specifically in resource-constrained settings. Here, we present a broadly applicable and inexpensive biosensing technology for accurate quantification of bioagents, including viruses in biological samples, such as plasma and artificial saliva, at clinically relevant concentrations. Our microchip fabrication is simple and mass-producible as we print microelectrodes on flexible plastic substrates using conductive inks. We evaluated the microchip technology by detecting and quantifying multiple Human Immunodeficiency Virus (HIV) subtypes (A, B, C, D, E, G, and panel), Epstein-Barr Virus (EBV), and Kaposi’s Sarcoma-associated Herpes Virus (KSHV) in a fingerprick volume (50 µL) of PBS, plasma, and artificial saliva samples for a broad range of virus concentrations between 102 copies/mL and 107 copies/mL. We have also evaluated the microchip platform with discarded, de-identified HIV-infected patient samples by comparing our microchip viral load measurement results with reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) as the gold standard method using Bland-Altman Analysis. PMID:26046668

  18. One-Step Reverse Transcription-Polymerase Chain Reaction for Ebola and Marburg Viruses.

    PubMed

    Park, Sun-Whan; Lee, Ye-Ji; Lee, Won-Ja; Jee, Youngmee; Choi, WooYoung

    2016-06-01

    Ebola and Marburg viruses (EBOVs and MARVs, respectively) are causative agents of severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. In 2014, there was a major Ebola outbreak in various countries in West Africa, including Guinea, Liberia, Republic of Sierra Leone, and Nigeria. EBOV and MARV are clinically difficult to diagnose and distinguish from other African epidemic diseases. Therefore, in this study, we aimed to develop a method for rapid identification of the virus to prevent the spread of infection. We established a conventional one-step reverse transcription-polymerase chain reaction (RT-PCR) assay for these pathogens based on the Superscript Reverse Transcriptase-Platinum Taq polymerase enzyme mixture. All assays were thoroughly optimized using in vitro-transcribed RNA. We designed seven primer sets of nucleocapsid protein (NP) genes based on sequences from seven filoviruses, including five EBOVs and two MARVs. To evaluate the sensitivity of the RT-PCR assay for each filovirus, 10-fold serial dilutions of synthetic viral RNA transcripts of EBOV or MARV NP genes were used to assess detection limits of viral RNA copies. The potential for these primers to cross react with other filoviruses was also examined. The results showed that the primers were specific for individual genotype detection in the examined filoviruses. The assay established in this study may facilitate rapid, reliable laboratory diagnosis in suspected cases of Ebola and Marburg hemorrhagic fevers.

  19. Effect of platform, reference material, and quantification model on enumeration of Enterococcus by quantitative PCR methods

    EPA Science Inventory

    Quantitative polymerase chain reaction (qPCR) is increasingly being used for the quantitative detection of fecal indicator bacteria in beach water. QPCR allows for same-day health warnings, and its application is being considered as an optionn for recreational water quality testi...

  20. Analysis of myosin heavy chain mRNA expression by RT-PCR

    NASA Technical Reports Server (NTRS)

    Wright, C.; Haddad, F.; Qin, A. X.; Baldwin, K. M.

    1997-01-01

    An assay was developed for rapid and sensitive analysis of myosin heavy chain (MHC) mRNA expression in rodent skeletal muscle. Only 2 microg of total RNA were necessary for the simultaneous analysis of relative mRNA expression of six different MHC genes. We designed synthetic DNA fragments as internal standards, which contained the relevant primer sequences for the adult MHC mRNAs type I, IIa, IIx, IIb as well as the embryonic and neonatal MHC mRNAs. A known amount of the synthetic fragment was added to each polymerase chain reaction (PCR) and yielded a product of different size than the amplified MHC mRNA fragment. The ratio of amplified MHC fragment to synthetic fragment allowed us to calculate percentages of the gene expression of the different MHC genes in a given muscle sample. Comparison with the traditional Northern blot analysis demonstrated that our reverse transcriptase-PCR-based assay was reliable, fast, and quantitative over a wide range of relative MHC mRNA expression in a spectrum of adult and neonatal rat skeletal muscles. Furthermore, the high sensitivity of the assay made it very useful when only small quantities of tissue were available. Statistical analysis of the signals for each MHC isoform across the analyzed samples showed a highly significant correlation between the PCR and the Northern signals as Pearson correlation coefficients ranged between 0.77 and 0.96 (P < 0.005). This assay has potential use in analyzing small muscle samples such as biopsies and samples from pre- and/or neonatal stages of development.

  1. Consensus criteria for sensitive detection of minimal neuroblastoma cells in bone marrow, blood and stem cell preparations by immunocytology and QRT-PCR: recommendations by the International Neuroblastoma Risk Group Task Force

    PubMed Central

    Beiske, K; Burchill, S A; Cheung, I Y; Hiyama, E; Seeger, R C; Cohn, S L; Pearson, A D J; Matthay, K K

    2009-01-01

    Disseminating disease is a predictive and prognostic indicator of poor outcome in children with neuroblastoma. Its accurate and sensitive assessment can facilitate optimal treatment decisions. The International Neuroblastoma Risk Group (INRG) Task Force has defined standardised methods for the determination of minimal disease (MD) by immunocytology (IC) and quantitative reverse transcriptase-polymerase chain reaction (QRT-PCR) using disialoganglioside GD2 and tyrosine hydroxylase mRNA respectively. The INRG standard operating procedures (SOPs) define methods for collecting, processing and evaluating bone marrow (BM), peripheral blood (PB) and peripheral blood stem cell harvest by IC and QRT-PCR. Sampling PB and BM is recommended at diagnosis, before and after myeloablative therapy and at the end of treatment. Peripheral blood stem cell products should be analysed at the time of harvest. Performing MD detection according to INRG SOPs will enable laboratories throughout the world to compare their results and thus facilitate quality-controlled multi-centre prospective trials to assess the clinical significance of MD and minimal residual disease in heterogeneous patient groups. PMID:19401690

  2. Mechanism of Glucose Regulates the Fruiting Body Formation in the Beech Culinary-Medicinal Mushroom, Hypsizygus marmoreus (Agaricomycetes).

    PubMed

    Zhang, Jin-Jing; Chen, Hui; Xie, Min-Ying; Chen, Ming-Jie; Hao, Hai-Bo; Wang, Hong; Feng, Zhi-Yong

    2017-01-01

    To understand the fruiting process of Hypsizygus marmoreus, a synthetic liquid medium (SLM) was optimized to induce fruiting body initiation. Dependent on the SLM, the effect of a monofactor (glucose) on the fruiting bodies of H. marmoreus was studied at different concentrations (10 and 40 g/L). Primordia appeared approximately 10 days earlier in low-glucose media (LGM) than in high-glucose media (HGM), whereas mature fruiting bodies formed on mushrooms approximately 7 days earlier and more primordia developed into mature fruiting bodies when cultured in HGM. In addition, the morphogenesis of the primordia was clustered in HGM, which was different than what was observed in LGM. Furthermore, differentially expressed genes (DEGs) that encoded various proteins involved in cell structure, general metabolism, signal transduction, and transcription and translation were analyzed by transcriptome sequencing. Six DEGs were detected by quantitative reverse-transcriptase polymerase chain reaction, and the results were consistent with the altered patterns of gene expression revealed by the transcriptome. This study not only identifies new candidate genes involved in the development of H. marmoreus but also provides a new research platform for studying the development of other edible mushrooms.

  3. Gene signature based on degradome-related genes can predict distal metastasis in cervical cancer patients.

    PubMed

    Fernandez-Retana, Jorge; Zamudio-Meza, Horacio; Rodriguez-Morales, Miguel; Pedroza-Torres, Abraham; Isla-Ortiz, David; Herrera, Luis; Jacobo-Herrera, Nadia; Peralta-Zaragoza, Oscar; López-Camarillo, César; Morales-Gonzalez, Fermin; Cantu de Leon, David; Pérez-Plasencia, Carlos

    2017-06-01

    Cervical cancer is one of the leading causes of death in women worldwide, which mainly affects developing countries. The patients who suffer a recurrence and/or progression disease have a higher risk of developing distal metastases. Proteases comprising the degradome given its ability to promote cell growth, migration, and invasion of tissues play an important role during tumor development and progression. In this study, we used high-density microarrays and quantitative reverse transcriptase polymerase chain reaction to evaluate the degradome profile and their inhibitors in 112 samples of patients diagnosed with locally advanced cervical cancer. Clinical follow-up was done during a period of 3 years. Using a correlation analysis between the response to treatment and the development of metastasis, we established a molecular signature comprising eight degradome-related genes (FAM111B, FAM111A, CFB, PSMB8, PSMB9, CASP7, PRSS16, and CD74) with the ability to discriminate patients at risk of distal metastases. In conclusion, present results show that molecular signature obtained from degradome genes can predict the possibility of metastasis in patients with locally advanced cervical cancer.

  4. Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

    PubMed

    Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

    2010-11-01

    Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

  5. Biodistribution and safety of a live attenuated tetravalent dengue vaccine in the cynomolgus monkey.

    PubMed

    Ravel, Guillaume; Mantel, Nathalie; Silvano, Jeremy; Rogue, Alexandra; Guy, Bruno; Jackson, Nicholas; Burdin, Nicolas

    2017-10-13

    The first licensed dengue vaccine is a recombinant, live, attenuated, tetravalent dengue virus vaccine (CYD-TDV; Sanofi Pasteur). This study assessed the biodistribution, shedding, and toxicity of CYD-TDV in a non-human primate model as part of the nonclinical safety assessment program for the vaccine. Cynomolgus monkeys were given one subcutaneous injection of either one human dose (5log 10 CCID 50 /serotype) of CYD-TDV or saline control. Study endpoints included clinical observations, body temperature, body weight, food consumption, clinical pathology, immunogenicity, and post-mortem examinations including histopathology. Viral load, distribution, persistence, and shedding in tissues and body fluids were evaluated by quantitative reverse transcriptase polymerase chain reaction. The subcutaneous administration of CYD-TDV was well tolerated. There were no toxicological findings other than expected minor local reactions at the injection site. A transient low level of CYD-TDV viral RNA was detected in blood and the viral genome was identified primarily at the injection site and in the draining lymph nodes following immunization. These results, together with other data from repeat-dose toxicity and neurovirulence studies, confirm the absence of toxicological concern with CYD-TDV and corroborate clinical study observations. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Stable Reference Gene Selection for RT-qPCR Analysis in Nonviruliferous and Viruliferous Frankliniella occidentalis.

    PubMed

    Yang, Chunxiao; Li, Hui; Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong

    2015-01-01

    Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔCt method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔCt method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions.

  7. MAEWEST Expression in Flower Development of Two Petunia Species

    PubMed Central

    Segatto, Ana Lúcia A.; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B.; Monte-Bello, Carolina C.; Dornelas, Marcelo C.; Margis, Rogerio; Freitas, Loreta B.

    2013-01-01

    Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription–quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions. PMID:23823801

  8. Subglottic injury, gastric juice, corticosteroids, and peptide growth factors in a porcine model.

    PubMed

    Yellon, R F; Szeremeta, W; Grandis, J R; Diguisseppe, P; Dickman, P S

    1998-06-01

    To study the effects of mucosal injury, gastric juice, and corticosteroids and to determine the presence of peptide growth factors in the subglottic mucosa in a porcine model. Prospective cohort animal study. In this model of subglottic injury, five groups (n = 5 each) of piglets were used. Injury was induced by electrocautery (acute), electrocautery plus repeated saline application (chronic), electrocautery plus repeated gastric juice application (chronic plus gastric juice), or repeated gastric juice application (gastric). Control piglets had normal saline applied repeatedly. Histopathologic findings for the gastric juice group included basal cell hyperplasia (80%), squamous metaplasia (80%), and mucosal ulceration (40%). Control piglets showed squamous metaplasia (80%) but no basilar hyperplasia or ulceration. Immunohistochemistry detected peptide growth factors and epidermal growth factor receptor (EGFR) in all groups. Decreased staining was most frequent in the acute injury group. Quantitative reverse transcriptase polymerase chain reaction (RT-PCR) documented lower expression of EGFR in the gastric juice group (P = .01). These findings suggest that peptide growth factors and EGFR are part of normal subglottic mucosal turnover. Noxious stimuli decrease production of these factors. Gastric juice had adverse effects documented by histopathology and molecular techniques.

  9. A two-step lyssavirus real-time polymerase chain reaction using degenerate primers with superior sensitivity to the fluorescent antigen test.

    PubMed

    Suin, Vanessa; Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael; Van Gucht, Steven

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤ 1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible.

  10. A Two-Step Lyssavirus Real-Time Polymerase Chain Reaction Using Degenerate Primers with Superior Sensitivity to the Fluorescent Antigen Test

    PubMed Central

    Nazé, Florence; Francart, Aurélie; Lamoral, Sophie; De Craeye, Stéphane; Kalai, Michael

    2014-01-01

    A generic two-step lyssavirus real-time reverse transcriptase polymerase chain reaction (qRT-PCR), based on a nested PCR strategy, was validated for the detection of different lyssavirus species. Primers with 17 to 30% of degenerate bases were used in both consecutive steps. The assay could accurately detect RABV, LBV, MOKV, DUVV, EBLV-1, EBLV-2, and ABLV. In silico sequence alignment showed a functional match with the remaining lyssavirus species. The diagnostic specificity was 100% and the sensitivity proved to be superior to that of the fluorescent antigen test. The limit of detection was ≤1 50% tissue culture infectious dose. The related vesicular stomatitis virus was not recognized, confirming the selectivity for lyssaviruses. The assay was applied to follow the evolution of rabies virus infection in the brain of mice from 0 to 10 days after intranasal inoculation. The obtained RNA curve corresponded well with the curves obtained by a one-step monospecific RABV-qRT-PCR, the fluorescent antigen test, and virus titration. Despite the presence of degenerate bases, the assay proved to be highly sensitive, specific, and reproducible. PMID:24822188

  11. Disappearance of Ph1 chromosome with intensive chemotherapy and detection of minimal residual disease by polymerase chain reaction in a patient with blast crisis of chronic myelogenous leukemia.

    PubMed

    Honda, H; Miyagawa, K; Endo, M; Takaku, F; Yazaki, Y; Hirai, H

    1993-06-01

    We diagnosed a patient with chronic myelogenous leukemia (CML) in chronic phase (CP) on the basis of clinical findings, Ph1 chromosome detected by cytogenetic analysis, and bcr-abl fusion mRNA detected by reverse transcriptase-dependent polymerase chain reaction (RT-PCR). One month after diagnosis, the patient developed extramedullary blast crisis in the lymph nodes, and then medullary blast crisis in the bone marrow, in which different surface markers were shown. Combination chemotherapy with BH-AC, VP16, and mitoxantrone was administered; this resulted in rapid disappearance of the lymphadenopathy, restoration of normal hematopoiesis, and no Ph1 chromosome being detected by cytogenetic analysis. RT-PCR performed to detect the residual Ph1 clone revealed that although the Ph1 clone was preferentially suppressed, it was still residual. The intensive chemotherapy regimen preferentially suppressed the Ph1-positive clone and led to both clinical and cytogenetic remission in this patient with BC of CML; we suggest that RT-PCR is a sensitive and useful method for detecting minimal residual disease during the clinical course of this disease.

  12. Sexing chick mRNA: A protocol based on quantitative real-time polymerase chain reaction.

    PubMed

    Wan, Z; Lu, Y; Rui, L; Yu, X; Li, Z

    2017-03-01

    The accurate identification of sex in birds is important for research on avian sex determination and differentiation. Polymerase chain reaction (PCR)-based methods have been widely applied for the molecular sexing of birds. However, these methods have used genomic DNA. Here, we present the first sexing protocol for chick mRNA based on real-time quantitative PCR. We demonstrate that this method can accurately determine sex using mRNA from chick gonads and other tissues, such as heart, liver, spleen, lung, and muscle. The strategy of this protocol also may be suitable for other species in which sex is determined by the inheritance of sex chromosomes (ZZ male and ZW female). © 2016 Poultry Science Association Inc.

  13. Reverse Transcription Quantitative Polymerase Chain Reaction for Detection of and Differentiation Between RNA and DNA of HIV-1-Based Lentiviral Vectors.

    PubMed

    Pavlovic, Melanie; Koehler, Nina; Anton, Martina; Dinkelmeier, Anna; Haase, Maren; Stellberger, Thorsten; Busch, Ulrich; Baiker, Armin E

    2017-08-01

    The purpose of the described method is the detection of and differentiation between RNA and DNA of human immunodeficiency virus (HIV)-derived lentiviral vectors (LV) in cell culture supernatants and swab samples. For the analytical surveillance of genetic engineering, operations methods for the detection of the HIV-1-based LV generations are required. Furthermore, for research issues, it is important to prove the absence of LV particles for downgrading experimental settings in terms of the biosafety level. Here, a quantitative polymerase chain reaction method targeting the long terminal repeat U5 subunit and the start sequence of the packaging signal ψ is described. Numerous controls are included in order to monitor the technical procedure.

  14. A case of Pitt-Hopkins syndrome with absence of hyperventilation.

    PubMed

    Inati, Adlette; Abbas, Hussein A; Korjian, Serge; Daaboul, Yazan; Harajeily, Mohamad; Saab, Raya

    2013-12-01

    Pitt-Hopkins syndrome is characterized by mental retardation, hyperventilation, and dysmorphic features due to TCF4 mutations. We report a case of Pitt-Hopkins syndrome in a 2½-year-old boy presenting with psychomotor retardation, recurrent respiratory tract infections, and dysmorphic features with absence of hyperventilation or other breathing abnormalities. Comparative genomic hybridization and quantitative real-time polymerase chain reaction were used to confirm TCF4 haploinsufficiency. Pitt-Hopkins syndrome is a rare debilitating disease that should be in the differential diagnosis of other neurodevelopmental disorders characterized by mental retardation and hypotonicity despite the absence of hyperapnea and seizures. Quantitative real-time polymerase chain reaction is another method to identify TCF4 and to confirm Pitt-Hopkins syndrome diagnosis.

  15. EVALUATION OF QUANTITATIVE REAL TIME PCR FOR THE MEASUREMENT OF HELICOBATER PYLORI AT LOW CONCENTRATIONS IN DRINKING WATER

    EPA Science Inventory

    Aims: To determine the performance of a rapid, real time polymerase chain reaction (PCR) method for the detection and quantitative analysis Helicobacter pylori at low concentrations in drinking water.

    Methods and Results: A rapid DNA extraction and quantitative PCR (QPCR)...

  16. EVALUATION OF STACHYBOTRYS CHARTARUM IN THE HOUSE OF AN INFANT WITH PULMONARY HEMORRHAGE: QUANTITATIVE ASSESSMENT BEFORE, DURING, AND AFTER REMEDIATION

    EPA Science Inventory

    Stachybotrys chartarum is an indoor mold that has been associated with pulmonary hemorrhage (PH) cases in the Cleveland, Ohio area. This study applied two new quantitative measurements to air samples from a home where an infant developed PH. Quantitative polymerase chain reacti...

  17. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation.

    PubMed

    Huang, Dong-Sheng; Wang, Zhaohui; He, Xu-Jun; Diplas, Bill H; Yang, Rui; Killela, Patrick J; Meng, Qun; Ye, Zai-Yuan; Wang, Wei; Jiang, Xiao-Ting; Xu, Li; He, Xiang-Lei; Zhao, Zhong-Sheng; Xu, Wen-Juan; Wang, Hui-Ju; Ma, Ying-Yu; Xia, Ying-Jie; Li, Li; Zhang, Ru-Xuan; Jin, Tao; Zhao, Zhong-Kuo; Xu, Ji; Yu, Sheng; Wu, Fang; Liang, Junbo; Wang, Sizhen; Jiao, Yuchen; Yan, Hai; Tao, Hou-Quan

    2015-05-01

    Several somatic mutation hotspots were recently identified in the telomerase reverse transcriptase (TERT) promoter region in human cancers. Large scale studies of these mutations in multiple tumour types are limited, in particular in Asian populations. This study aimed to: analyse TERT promoter mutations in multiple tumour types in a large Chinese patient cohort, investigate novel tumour types and assess the functional significance of the mutations. TERT promoter mutation status was assessed by Sanger sequencing for 13 different tumour types and 799 tumour tissues from Chinese cancer patients. Thymic epithelial tumours, gastrointestinal leiomyoma, and gastric schwannoma were included, for which the TERT promoter has not been previously sequenced. Functional studies included TERT expression by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR), telomerase activity by the telomeric repeat amplification protocol (TRAP) assay and promoter activity by the luciferase reporter assay. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). C228T and C250T were the most common mutations. In urothelial carcinoma, several novel rare mutations were identified. TERT promoter mutations were absent in gastrointestinal stromal tumour (GIST), thymic epithelial tumours, gastrointestinal leiomyoma, gastric schwannoma, cholangiocarcinoma, gastric and pancreatic cancer. TERT promoter mutations highly correlated with upregulated TERT mRNA expression and telomerase activity in adult gliomas. These mutations differentially enhanced the transcriptional activity of the TERT core promoter. TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients. The functional significance of these mutations reflect the importance to telomere maintenance and hence tumourigenesis, making them potential therapeutic targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Comparison between culture and a multiplex quantitative real-time polymerase chain reaction assay detecting Ureaplasma urealyticum and U. parvum.

    PubMed

    Frølund, Maria; Björnelius, Eva; Lidbrink, Peter; Ahrens, Peter; Jensen, Jørgen Skov

    2014-01-01

    A novel multiplex quantitative real-time polymerase chain reaction (qPCR) for simultaneous detection of U. urealyticum and U. parvum was developed and compared with quantitative culture in Shepard's 10 C medium for ureaplasmas in urethral swabs from 129 men and 66 women, and cervical swabs from 61 women. Using culture as the gold standard, the sensitivity of the qPCR was 96% and 95% for female urethral and cervical swabs, respectively. In male urethral swabs the sensitivity was 89%. The corresponding specificities were 100%, 87% and 99%. The qPCR showed a linear increasing DNA copy number with increasing colour-changing units. Although slightly less sensitive than culture, this multiplex qPCR assay detecting U. urealyticum and U. parvum constitutes a simple and fast alternative to the traditional methods for identification of ureaplasmas and allows simultaneous species differentiation and quantitation in clinical samples. Furthermore, specimens overgrown by other bacteria using the culture method can be evaluated in the qPCR.

  19. Quantitative gene expression deregulation in mantle-cell lymphoma: correlation with clinical and biologic factors.

    PubMed

    Kienle, Dirk; Katzenberger, Tiemo; Ott, German; Saupe, Doreen; Benner, Axel; Kohlhammer, Holger; Barth, Thomas F E; Höller, Sylvia; Kalla, Jörg; Rosenwald, Andreas; Müller-Hermelink, Hans Konrad; Möller, Peter; Lichter, Peter; Döhner, Hartmut; Stilgenbauer, Stephan

    2007-07-01

    There is evidence for a direct role of quantitative gene expression deregulation in mantle-cell lymphoma (MCL) pathogenesis. Our aim was to investigate gene expression associations with other pathogenic factors and the significance of gene expression in a multivariate survival analysis. Quantitative expression of 20 genes of potential relevance for MCL prognosis and pathogenesis were analyzed using real-time reverse transcriptase polymerase chain reaction and correlated with clinical and genetic factors, tumor morphology, and Ki-67 index in 65 MCL samples. Genomic losses at the loci of TP53, RB1, and P16 were associated with reduced transcript levels of the respective genes, indicating a gene-dosage effect as the pathomechanism. Analysis of gene expression correlations between the candidate genes revealed a separation into two clusters, one dominated by proliferation activators, another by proliferation inhibitors and regulators of apoptosis. Whereas only weak associations were identified between gene expression and clinical parameters or blastoid morphology, several genes were correlated closely with the Ki-67 index, including the short CCND1 variant (positive correlation) and RB1, ATM, P27, and BMI (negative correlation). In multivariate survival analysis, expression levels of MYC, MDM2, EZH2, and CCND1 were the strongest prognostic factors independently of tumor proliferation and clinical factors. These results indicate a pathogenic contribution of several gene transcript levels to the biology and clinical course of MCL. Genes can be differentiated into factors contributing to proliferation deregulation, either by enhancement or loss of inhibition, and proliferation-independent factors potentially contributing to MCL pathogenesis by apoptosis impairment.

  20. MZC Gel Inhibits SHIV-RT and HSV-2 in Macaque Vaginal Mucosa and SHIV-RT in Rectal Mucosa.

    PubMed

    Calenda, Giulia; Villegas, Guillermo; Barnable, Patrick; Litterst, Claudia; Levendosky, Keith; Gettie, Agegnehu; Cooney, Michael L; Blanchard, James; Fernández-Romero, José A; Zydowsky, Thomas M; Teleshova, Natalia

    2017-03-01

    The Population Council's microbicide gel MZC (also known as PC-1005) containing MIV-150 and zinc acetate dihydrate (ZA) in carrageenan (CG) has shown promise as a broad-spectrum microbicide against HIV, herpes simplex virus (HSV), and human papillomavirus. Previous data show antiviral activity against these viruses in cell-based assays, prevention of vaginal and rectal simian-human immunodeficiency virus reverse transcriptase (SHIV-RT) infection, and reduction of vaginal HSV shedding in rhesus macaques and also excellent antiviral activity against HSV and human papillomavirus in murine models. Recently, we demonstrated that MZC is safe and effective against SHIV-RT in macaque vaginal explants. Here we established models of ex vivo SHIV-RT/HSV-2 coinfection of vaginal mucosa and SHIV-RT infection of rectal mucosa in macaques (challenge of rectal mucosa with HSV-2 did not result in reproducible tissue infection), evaluated antiviral activity of MZC, and compared quantitative polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay readouts for monitoring SHIV-RT infection. MZC (at nontoxic dilutions) significantly inhibited SHIV-RT in vaginal and rectal mucosas and HSV-2 in vaginal mucosa when present during viral challenge. Analysis of SHIV-RT infection and MZC activity by 1-step simian immunodeficiency virus gag quantitative RT-PCR and p27 enzyme-linked immunosorbent assay demonstrated similar virus growth dynamics and MZC activity by both methods and higher sensitivity of quantitative RT-PCR. Our data provide more evidence that MZC is a promising dual compartment multipurpose prevention technology candidate.

  1. Quantitative estimation of Nipah virus replication kinetics in vitro

    PubMed Central

    Chang, Li-Yen; Ali, AR Mohd; Hassan, Sharifah Syed; AbuBakar, Sazaly

    2006-01-01

    Background Nipah virus is a zoonotic virus isolated from an outbreak in Malaysia in 1998. The virus causes infections in humans, pigs, and several other domestic animals. It has also been isolated from fruit bats. The pathogenesis of Nipah virus infection is still not well described. In the present study, Nipah virus replication kinetics were estimated from infection of African green monkey kidney cells (Vero) using the one-step SYBR® Green I-based quantitative real-time reverse transcriptase-polymerase chain reaction (qRT-PCR) assay. Results The qRT-PCR had a dynamic range of at least seven orders of magnitude and can detect Nipah virus from as low as one PFU/μL. Following initiation of infection, it was estimated that Nipah virus RNA doubles at every ~40 minutes and attained peak intracellular virus RNA level of ~8.4 log PFU/μL at about 32 hours post-infection (PI). Significant extracellular Nipah virus RNA release occurred only after 8 hours PI and the level peaked at ~7.9 log PFU/μL at 64 hours PI. The estimated rate of Nipah virus RNA released into the cell culture medium was ~0.07 log PFU/μL per hour and less than 10% of the released Nipah virus RNA was infectious. Conclusion The SYBR® Green I-based qRT-PCR assay enabled quantitative assessment of Nipah virus RNA synthesis in Vero cells. A low rate of Nipah virus extracellular RNA release and low infectious virus yield together with extensive syncytial formation during the infection support a cell-to-cell spread mechanism for Nipah virus infection. PMID:16784519

  2. Pannus invasion and cartilage degradation in rheumatoid arthritis: involvement of MMP-3 and interleukin-1beta.

    PubMed

    Ainola, M M; Mandelin, J A; Liljeström, M P; Li, T F; Hukkanen, M V J; Konttinen, Y T

    2005-01-01

    Synovial inflammation in rheumatoid arthritis (RA) leads to pannus tissue invasion and destruction of cartilage/bone matrix by proteinases. Our intention was to analyze some of the key matrix metalloproteinases (MMPs) in pannus tissue overlying evolving cartilage erosions in RA. Frozen tissue samples of pannus and synovium from advanced RA and synovium from osteoarthritic patients were used for immunohistochemical, western blotting and quantitative reverse transcriptase polymerase chain reaction (RT-PCR) analysis of MMP-1, -3, -13 and -14. Synovial fibroblast cultures, stimulated with tumour necrosis factor alpha (TNF-alpha) and interleukin-1 beta (IL-1beta), were analyzed with enzyme-linked immunosorbent assays (ELISA) and quantitative RT-PCR. MMP-3 was highly expressed in pannus tissue compared with significantly lower expression levels of MMP-1, -13 and -14. In fibroblast cultures IL-1beta was a potent stimulus for MMP-3, whereas TNF-alpha was more potent for MMP-1. This is the first study to demonstrate quantitatively in real time that MMP-3 mRNA expression is clearly higher in advanced RA pannus tissue compared to parallel RA or osteoarthritic synovium. MMP-3 mRNA levels were also clearly overexpressed in RA pannus compared to MMP-1, -13 and -14. Advanced RA has previously been found to overexpress IL-1beta. The high expression of MMP-3 in pannus and IL-1beta, mediated stimulation of MMP-3 suggest that MMP-3 plays a significant role in the progression of erosions through the proteoglycan-rich cartilage matrix.

  3. Three cases of imported dengue virus infection from Madeira to Belgium, 2012.

    PubMed

    Cnops, Lieselotte; Franco, Leticia; Van Meensel, Britt; Van den Ende, Jef; Paz Sanchez-Seco, Maria; Van Esbroeck, Marjan

    2014-01-01

    We report three laboratory-confirmed dengue virus (DENV) infections imported to Belgium by travelers returning from Madeira (Portugal). Despite the use of a mosquito-repellent spray as reported by two patients, the infection could not be prevented. Diagnosis was made by antigen detection and real-time reverse transcriptase polymerase chain reaction (RT-PCR) in two cases and by serology 1 month after onset of symptoms in a third one. The responsible virus was identified as DENV serotype 1, American/African genotype (genotype V). The close relationship to isolates from Colombia supports the previous findings that a South American strain originated the outbreak in Madeira in 2012. © 2014 International Society of Travel Medicine.

  4. Isolation of Ganjam virus from ticks collected off domestic animals around Pune, Maharashtra, India.

    PubMed

    Joshi, M V; Geevarghese, G; Joshi, G D; Ghodke, Y S; Mourya, D T; Mishra, A C

    2005-03-01

    Studies on viruses of zoonotic importance in certain villages around Pune were undertaken between December 2000 and January 2002. A total of 1,138 adult ticks belonging to six different species were collected off domestic animals and processed for virus isolation. Six virus isolates were obtained. All six isolates were identified as Ganjam virus by Quick Complement Fixation test and reverse transcriptase-polymerase chain reaction using RNA nucleocapsid gene amplification. Five isolates were from the pools of adult Hemaphysalis intermedia ticks, and one isolate was from a pool of adult Rhipecephalus hemaphysaloides. This is the first report of isolation of Ganjam virus from Maharashtra state of India.

  5. Microaspiration of esophageal gland cells and cDNA library construction for identifying parasitism genes of plant-parasitic nematodes.

    PubMed

    Hussey, Richard S; Huang, Guozhong; Allen, Rex

    2011-01-01

    Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.

  6. Coronavirus 229E-related pneumonia in immunocompromised patients.

    PubMed

    Pene, Frédéric; Merlat, Annabelle; Vabret, Astrid; Rozenberg, Flore; Buzyn, Agnès; Dreyfus, François; Cariou, Alain; Freymuth, François; Lebon, Pierre

    2003-10-01

    Coronaviruses strains 229E and OC43 have been associated with various respiratory illnesses ranging from the self-resolving common cold to severe pneumonia. Although chronic underlying conditions are major determinants of severe respiratory virus infections, few data about coronavirus-related pneumonia in immunocompromised patients are available. Here we report 2 well-documented cases of pneumonia related to coronavirus 229E, each with a different clinical presentation. Diagnosis was made on the basis of viral culture and electron microscopy findings that exhibited typical crown-like particles and through amplification of the viral genome by reverse transcriptase-polymerase chain reaction. On the basis of this report, coronaviruses should be considered as potential causative microorganisms of pneumonia in immunocompromised patients.

  7. West Nile Flavivirus Polioencephalomyelitis in a harbor seal (Phoca vitulina).

    PubMed

    Del Piero, F; Stremme, D W; Habecker, P L; Cantile, C

    2006-01-01

    A 12-year-old male harbor seal presented with progressive signs of neurologic dysfunction including head tremors, muzzle twitching, clonic spasms, and weakness. Lesions included polioencephalomyelitis with glial nodules, spheroids, neuronophagia, ring hemorrhages, and a few neutrophils. Neurons, fibers, and glial nodules were multifocally colonized with intracytoplasmic West Nile flavivirus antigens that were demonstrated using indirect immunohistochemical analysis. Flavivirus on cultured cells also was isolated and was identified by use of monoclonal antibodies and reverse transcriptase-polymerase chain reaction analysis. Clinical signs of disease and lesion morphology and distribution were similar to those of equine West Nile virus infection. Similar to horses, alpacas, humans, dogs, and reptiles, seals can be dead-end hosts of West Nile virus.

  8. mRNA expression OF IFN-λs in the gingival tissue of chronic and aggressive periodontitis patients: A polymerase chain reaction study.

    PubMed

    Bilichodmath, Shivaprasad; Nair, Sruthi K; Bilichodmath, Rekha; Mangalekar, Sachin B

    2018-05-01

    Several studies have proven the existence of herpesviruses in periodontal pockets of chronic and aggressive periodontitis patients. Recently discovered interferon lambda (IFN-λ) has antiviral properties and is induced by herpesviruses. The present study was aimed at quantitative analysis of mRNA expression of IFN-λs (IFN-λ1, IFN-λ2, IFN-λ3) in the gingival tissues of chronic and aggressive periodontitis patients. A total of 90 participants (50 males and 40 females; age ranging from 19 to 50 years, mean age 31.50±7.8) were categorized into three groups as healthy participants, chronic periodontitis patients and aggressive periodontitis patients. mRNA expression of IFN-λs in gingival tissues was estimated using reverse transcriptase polymerase chain reaction and was correlated with clinical parameters such as gingival index (GI), probing pocket depth (PPD), and clinical attachment level (CAL). mRNA of IFN-λ1, IFN-λ2 and IFN-λ3 was expressed in gingival tissues of healthy participants, chronic and aggressive periodontitis patients. Highest level of IFN-λ1 was observed in aggressive periodontitis patients (3.049±9.793), whereas IFN-λ2 (4.322±11.310) and IFN-λ3 (11.932±27.479) were maximum in chronic periodontitis patients. The difference in the mRNA expression of IFN-λ1 (p = 0.008) and IFN-λ3 (p = 0.043) among three groups was statistically significant CONCLUSION: Increased quantity of IFN-λs in chronic and aggressive periodontitis patients suggests a role in periodontitis. Variation in the expression of IFN-λ1 and IFN-λ3 in periodontitis patients needs to be further evaluated. The mRNA expression of antiviral IFN-λs in gingival tissues might enhance our understanding related to viral pathogenesis of periodontal diseases. This article is protected by copyright. All rights reserved. © 2018 American Academy of Periodontology.

  9. Grouping patients for masseter muscle genotype-phenotype studies.

    PubMed

    Moawad, Hadwah Abdelmatloub; Sinanan, Andrea C M; Lewis, Mark P; Hunt, Nigel P

    2012-03-01

    To use various facial classifications, including either/both vertical and horizontal facial criteria, to assess their effects on the interpretation of masseter muscle (MM) gene expression. Fresh MM biopsies were obtained from 29 patients (age, 16-36 years) with various facial phenotypes. Based on clinical and cephalometric analysis, patients were grouped using three different classifications: (1) basic vertical, (2) basic horizontal, and (3) combined vertical and horizontal. Gene expression levels of the myosin heavy chain genes MYH1, MYH2, MYH3, MYH6, MYH7, and MYH8 were recorded using quantitative reverse transcriptase polymerase chain reaction (RT-PCR) and were related to the various classifications. The significance level for statistical analysis was set at P ≤ .05. Using classification 1, none of the MYH genes were found to be significantly different between long face (LF) patients and the average vertical group. Using classification 2, MYH3, MYH6, and MYH7 genes were found to be significantly upregulated in retrognathic patients compared with prognathic and average horizontal groups. Using classification 3, only the MYH7 gene was found to be significantly upregulated in retrognathic LF compared with prognathic LF, prognathic average vertical faces, and average vertical and horizontal groups. The use of basic vertical or basic horizontal facial classifications may not be sufficient for genetics-based studies of facial phenotypes. Prognathic and retrognathic facial phenotypes have different MM gene expressions; therefore, it is not recommended to combine them into one single group, even though they may have a similar vertical facial phenotype.

  10. Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

    PubMed

    Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

    2016-11-01

    A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

  11. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  12. Probing the structural and molecular basis of nucleotide selectivity by human mitochondrial DNA polymerase γ

    PubMed Central

    Sohl, Christal D.; Szymanski, Michal R.; Mislak, Andrea C.; Shumate, Christie K.; Amiralaei, Sheida; Schinazi, Raymond F.; Anderson, Karen S.; Yin, Y. Whitney

    2015-01-01

    Nucleoside analog reverse transcriptase inhibitors (NRTIs) are the essential components of highly active antiretroviral (HAART) therapy targeting HIV reverse transcriptase (RT). NRTI triphosphates (NRTI-TP), the biologically active forms, act as chain terminators of viral DNA synthesis. Unfortunately, NRTIs also inhibit human mitochondrial DNA polymerase (Pol γ), causing unwanted mitochondrial toxicity. Understanding the structural and mechanistic differences between Pol γ and RT in response to NRTIs will provide invaluable insight to aid in designing more effective drugs with lower toxicity. The NRTIs emtricitabine [(-)-2,3′-dideoxy-5-fluoro-3′-thiacytidine, (-)-FTC] and lamivudine, [(-)-2,3′-dideoxy-3′-thiacytidine, (-)-3TC] are both potent RT inhibitors, but Pol γ discriminates against (-)-FTC-TP by two orders of magnitude better than (-)-3TC-TP. Furthermore, although (-)-FTC-TP is only slightly more potent against HIV RT than its enantiomer (+)-FTC-TP, it is discriminated by human Pol γ four orders of magnitude more efficiently than (+)-FTC-TP. As a result, (-)-FTC is a much less toxic NRTI. Here, we present the structural and kinetic basis for this striking difference by identifying the discriminator residues of drug selectivity in both viral and human enzymes responsible for substrate selection and inhibitor specificity. For the first time, to our knowledge, this work illuminates the mechanism of (-)-FTC-TP differential selectivity and provides a structural scaffold for development of novel NRTIs with lower toxicity. PMID:26124101

  13. Diagnosis of ocular toxoplasmosis by two polymerase chain reaction (PCR) examinations: qualitative multiplex and quantitative real-time.

    PubMed

    Sugita, Sunao; Ogawa, Manabu; Inoue, Shizu; Shimizu, Norio; Mochizuki, Manabu

    2011-09-01

    To establish a two-step polymerase chain reaction (PCR) diagnostic system for ocular toxoplasmosis. A total of 13 ocular fluid samples (11 aqueous humor and 2 vitreous fluid) were collected from 13 patients with clinically suspected ocular toxoplasmosis. Ten ocular samples from other uveitis patients and 20 samples from subjects without ocular inflammation were used as controls. Two polymerase chain reaction (PCR) methods, i.e., qualitative multiplex PCR and quantitative real-time PCR, were used to measure the toxoplasma genome (T. gondii B1 gene). Qualitative multiplex PCR detected T. gondii B1 gene in the ocular fluids of 11 out of 13 patients with clinically suspected ocular toxoplasmosis. In real-time PCR, we detected high copy numbers of T. gondii DNA (5.1 × 10(2)-2.1 × 10(6) copies/mL) in a total of 10 patients (10/13, 77%). Only ocular toxoplasmosis scar lesions were observed in the three real-time PCR-negative patients. PCR assay results for the samples from the two control groups were all negative. The two-step PCR examination to detect toxoplasma DNA is a useful tool for diagnosing ocular toxoplasmosis.

  14. New Performance Metrics for Quantitative Polymerase Chain Reaction-Based Microbial Source Tracking Methods

    EPA Science Inventory

    Binary sensitivity and specificity metrics are not adequate to describe the performance of quantitative microbial source tracking methods because the estimates depend on the amount of material tested and limit of detection. We introduce a new framework to compare the performance ...

  15. First report of Toxoplasma gondii sporulated oocysts and Giardia duodenalis in commercial green-lipped mussels (Perna canaliculus) in New Zealand.

    PubMed

    Coupe, Alicia; Howe, Laryssa; Burrows, Elizabeth; Sine, Abigail; Pita, Anthony; Velathanthiri, Niluka; Vallée, Emilie; Hayman, David; Shapiro, Karen; Roe, Wendi D

    2018-05-01

    Pollution of marine ecosystems with the protozoan parasites Toxoplasma gondii, Cryptosporidium spp. and Giardia duodenalis can be studied using bivalve shellfish as biosentinels. Although evidence suggests that these parasites are present in New Zealand coastal waters, the extent of protozoal pollution has not been investigated. This study used optimised molecular methods to detect the presence of Cryptosporidium spp., G. duodenalis and T. gondii in commercially sourced green-lipped mussel (Perna canaliculus), an endemic species found throughout coastal New Zealand. A nested polymerase chain reaction was validated for detection of T. gondii DNA and applied to 104 commercially sourced mussels. Thirteen mussels were positive for T. gondii DNA with an estimated true prevalence of 16.4% using Bayesian statistics, and the presence of T. gondii in mussels was significantly associated with collection during the summer compared with that in the winter (P = 0.003). Consumption of contaminated shellfish may also pose a health risk for humans and marine wildlife. As only sporulated T. gondii oocysts can be infectious, a reverse transcriptase-polymerase chain reaction was used to confirm presence of a sporozoite-specific marker (SporoSAG), detected in four mussels. G. duodenalis assemblage B, known to be pathogenic in humans, was also discovered in 1% mussels, tested by polymerase chain reaction (n = 90). Cryptosporidium spp. was not detected in the sampled mussel haemolymph. Results suggest that New Zealand may have high levels of coastal contamination with T. gondii, particularly in summer months, and that naturally exposed mussels can ingest and retain sporulated oocysts, further establishing shellfish consumption as a health concern.

  16. Modeling qRT-PCR dynamics with application to cancer biomarker quantification.

    PubMed

    Chervoneva, Inna; Freydin, Boris; Hyslop, Terry; Waldman, Scott A

    2017-01-01

    Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is widely used for molecular diagnostics and evaluating prognosis in cancer. The utility of mRNA expression biomarkers relies heavily on the accuracy and precision of quantification, which is still challenging for low abundance transcripts. The critical step for quantification is accurate estimation of efficiency needed for computing a relative qRT-PCR expression. We propose a new approach to estimating qRT-PCR efficiency based on modeling dynamics of polymerase chain reaction amplification. In contrast, only models for fluorescence intensity as a function of polymerase chain reaction cycle have been used so far for quantification. The dynamics of qRT-PCR efficiency is modeled using an ordinary differential equation model, and the fitted ordinary differential equation model is used to obtain effective polymerase chain reaction efficiency estimates needed for efficiency-adjusted quantification. The proposed new qRT-PCR efficiency estimates were used to quantify GUCY2C (Guanylate Cyclase 2C) mRNA expression in the blood of colorectal cancer patients. Time to recurrence and GUCY2C expression ratios were analyzed in a joint model for survival and longitudinal outcomes. The joint model with GUCY2C quantified using the proposed polymerase chain reaction efficiency estimates provided clinically meaningful results for association between time to recurrence and longitudinal trends in GUCY2C expression.

  17. Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

    Cancer.gov

    Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in

  18. NEW TARGET AND CONTROL ASSAYS FOR QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS OF ENTEROCOCCI IN WATER

    EPA Science Inventory

    Enterococci are frequently monitored in water samples as indicators of fecal pollution. Attention is now shifting from culture based methods for enumerating these organisms to more rapid molecular methods such as QPCR. Accurate quantitative analyses by this method requires highly...

  19. MONITORING ASPERGILLUS SPECIES BY QUANTITATIVE PCR DURING CONSTRUCTION OF A MULTI-STORY HOSPITAL BUILDING

    EPA Science Inventory

    Noscomial fungal infections represent a persistent threat in hospitals. One of the major issues in fungal control has been monitoring these fungi in a timely manner. Quantitative polymerase chain reaction (QPCR) allows for the rapid (2 to 4 h), sensitive (often down to a single...

  20. Combined use of reverse transcriptase polymerase chain reaction and flow cytometry to study minimal residual disease in Philadelphia positive acute lymphoblastic leukemia.

    PubMed

    Muñoz, L; López, O; Martino, R; Brunet, S; Bellido, M; Rubiol, E; Sierra, J; Nomdedéu, J F

    2000-07-01

    The Philadelphia chromosome in acute lymphoblastic leukemia (Ph+ ALL) is associated with a poor prognosis given the high frequency of chemoresistance and leukemia relapse. Minimal residual disease (MRD) detection before cytogenetic and hematologic relapse could be useful in early therapy. The most suitable methods for detecting MRD in Ph+ ALL are flow cytometry (FC) and reverse transcriptase polymerase chain reaction (RT-PCR). However, since both techniques carry the risk of false-negative results the combined use of these two techniques could overcome this problem. We report our experience using this approach in 47 bone marrow samples obtained from 10 Ph+ ALL patients. Twenty-seven marrow aspirates were taken from patients in clinical remission (CR). The samples were considered positive for MRD by FC when two conditions were met: 1) detection of an abnormal B-cell differentiation pattern and 2) presence of more than 1x10(-3) cells coexpressing CD22/CD34/CD45 or CD66/CD34/CD10. After FC analysis, RNA was purified using standard methods. FC was positive in 23/27 samples in CR (sensitivity 85%). RT-PCR was successfully performed in 23 samples in CR. RT-PCR was positive in 18/23 samples (sensitivity 78%). There were 5 samples with discordant results. FC was positive in 3 samples with a negative RT-PCR and FC was negative in 2 samples with a positive RT. All the 10 patients relapsed and only 1 is currently alive after an allogeneic stem cell transplantation (alloSCT). The median (range) time from MRD detection to relapse in patients treated with chemotherapy was 42 (39-71) days. These data suggest that RT-PCR may be negative despite the presence of neoplastic cells identified by their immunophenotypic traits. We conclude that immunologic and molecular techniques can be used in tandem for monitoring MRD in Ph+ ALL.

  1. Detection of PAX3-FKHR and PAX7-FKHR fusion transcripts in rhabdomyosarcoma by reverse transcriptase-polymerase chain reaction using paraffin-embedded tissue.

    PubMed

    Chen, B F; Chen, M L; Liang, D C; Huang, Y W; Liu, H C; Chen, S H

    1999-02-01

    Alveolar rhabdomyosarcoma (RMS) is associated with a characteristic chromosomal translocation t(2;13)(q35;q14). The genes involved in this translocation are paired box (PAX)3 on chromosome 2 and forkhead in RMS (FKHR) on chromosome 13. An occasional variant translocation t(1;13)(p36;q14) affecting PAX7 and FKHR on chromosomes 1 and 13, respectively, has also been described. Chromosomal translocations in RMS are detected using conventional cytogenetic analysis, fluorescence in situ hybridization (FISH) or reverse transcriptase-polymerase chain reaction (RT-PCR) on fresh or frozen tissue samples. We describe the results of RT-PCR analysis of PAX3-FKHR and PAX7-FKHR chimeric messages in formalin-fixed, paraffin-embedded tissue samples from 17 RMS cases. RNA was extracted from formalin-fixed, paraffin-embedded RMS tissue. Oligonucleotide primers corresponding to the regions of PAX3, PAX7 and FKHR were used for the detection of PAX3-FKHR and PAX7-FKHR chimeric messages. A seminested PCR of the PCR products was used to increase the sensitivity of detection. The amplified fragments were purified and directly sequenced to confirm the specificity of the methods. The PAX3-FKHR chimeric message was detected in all three cases of alveolar RMS but not in any of the 12 embryonal and two pleomorphic RMS cases. The PAX7-FKHR fusion transcript was detected in one case of embryonal RMS. The results indicate that the RT-PCR assay is a reliable method for the detection of the PAX3-FKHR fusion transcript of alveolar RMS in formalin-fixed, paraffin-embedded tissue. This simple method enables pathologists to identify chromosomal rearrangements in RMS as a diagnostic aid in cases where fresh or frozen tissue is not available.

  2. Modified concentration method for the detection of enteric viruses on fruits and vegetables by reverse transcriptase-polymerase chain reaction or cell culture.

    PubMed

    Dubois, Eric; Agier, Cécilia; Traoré, Ousmane; Hennechart, Catherine; Merle, Ghislaine; Crucière, Catherine; Laveran, Henri

    2002-12-01

    Fruits and vegetables may act as a vehicle of human enteric virus if they are irrigated with sewage-contaminated water or prepared by infected food handlers. An elution-concentration method was modified to efficiently detect, by reverse transcriptase-polymerase chain reaction (RT-PCR) or by cell culture, contamination by poliovirus, hepatitis A virus (HAV), and Norwalk-like virus (NLV) of various fresh and frozen berries and fresh vegetables. The protocol included washing the fruit or vegetable surface with 100 mM Tris-HCl, 50 mM glycine, and 3% beef extract, pH 9.5 buffer, which favors viral elution from acid-releasing berries, supplemented with 50 mM MgCl2 to reduce the decrease in viral infectivity during the process. The viral concentration method was based on polyethylene glycol precipitation. Copurified RT-PCR inhibitors and cytotoxic compounds were removed from viral concentrates by chloroform-butanol extraction. Viruses from 100 g of vegetal products could be recovered in volumes of 3 to 5 ml. Viral RNAs were isolated by a spin column method before molecular detection or concentrates were filtered (0.22-microm porosity) and inoculated on cell culture for infectious virus detection. About 15% of infectious poliovirus and 20% of infectious HAV were recovered from frozen raspberry surfaces. The percentage of viral RNA recovery was estimated by RT-PCR to be about 13% for NLV, 17% for HAV, and 45 to 100% for poliovirus. By this method, poliovirus and HAV RNA were detected on products inoculated with a titer of about 5 x 10(1) 50% tissue culture infectious dose per 100 g. NLV RNA was detected at an initial inoculum of 1.2 x 10(3) RT-PCR amplifiable units. This method would be useful for the viral analysis of fruits or vegetables during an epidemiological investigation of foodborne diseases.

  3. Reduction in the incidence of influenza A but not influenza B associated with use of hand sanitizer and cough hygiene in schools: a randomized controlled trial.

    PubMed

    Stebbins, Samuel; Cummings, Derek A T; Stark, James H; Vukotich, Chuck; Mitruka, Kiren; Thompson, William; Rinaldo, Charles; Roth, Loren; Wagner, Michael; Wisniewski, Stephen R; Dato, Virginia; Eng, Heather; Burke, Donald S

    2011-11-01

    Laboratory-based evidence is lacking regarding the efficacy of nonpharmaceutical interventions (NPIs) such as alcohol-based hand sanitizer and respiratory hygiene to reduce the spread of influenza. The Pittsburgh Influenza Prevention Project was a cluster-randomized trial conducted in 10 elementary schools in Pittsburgh, PA, during the 2007 to 2008 influenza season. Children in 5 intervention schools received training in hand and respiratory hygiene, and were provided and encouraged to use hand sanitizer regularly. Children in 5 schools acted as controls. Children with influenza-like illness were tested for influenza A and B by reverse-transcriptase polymerase chain reaction. A total of 3360 children participated in this study. Using reverse-transcriptase polymerase chain reaction, 54 cases of influenza A and 50 cases of influenza B were detected. We found no significant effect of the intervention on the primary study outcome of all laboratory-confirmed influenza cases (incidence rate ratio [IRR]: 0.81; 95% confidence interval [CI]: 0.54, 1.23). However, we did find statistically significant differences in protocol-specified ancillary outcomes. Children in intervention schools had significantly fewer laboratory-confirmed influenza A infections than children in control schools, with an adjusted IRR of 0.48 (95% CI: 0.26, 0.87). Total absent episodes were also significantly lower among the intervention group than among the control group; adjusted IRR 0.74 (95% CI: 0.56, 0.97). NPIs (respiratory hygiene education and the regular use of hand sanitizer) did not reduce total laboratory-confirmed influenza. However, the interventions did reduce school total absence episodes by 26% and laboratory-confirmed influenza A infections by 52%. Our results suggest that NPIs can be an important adjunct to influenza vaccination programs to reduce the number of influenza A infections among children.

  4. In vivo cartilage formation using chondrogenic-differentiated human adipose-derived mesenchymal stem cells mixed with fibrin glue.

    PubMed

    Jung, Sung-No; Rhie, Jong Won; Kwon, Ho; Jun, Young Joon; Seo, Je-Won; Yoo, Gyeol; Oh, Deuk Young; Ahn, Sang Tae; Woo, Jihyoun; Oh, Jieun

    2010-03-01

    Human adipose-derived mesenchymal stem cells (MSCs) were differentiated into chondrogenic MSCs, and fibrin glue was used together to explore the feasibility of whether cartilages can be generated in vivo by injecting the differentiated cells. Mesenchymal stem cells extracted from human adipose were differentiated into chondrogenic MSCs, and such differentiated cells mixed with fibrin glue were injected subcutaneously into the back of the nude mouse. In addition to visual evaluation of the tissues formed after 4, 8, and 12 weeks, hematoxylin-eosin staining, Masson trichrome staining, measurement of glycosaminoglycan concentration using dimethylmethylene blue, agreecan through reverse transcriptase-polymerase chain reaction, type II collagen, and expression of SOX-9 were verified. Moreover, the results were compared with 2 groups of controls: 1 control group that received only injection of chondrogenic-differentiated MSC and the supporting control group that received only fibrin glue injection. For the experimental group, cartilage-like tissues were formed after 4, 8, and 12 weeks. Formation of cartilage tissues was not observed in any of 4, 8, and 12 weeks of the control group. The supporting control group had only a small structure formation after 4 weeks, but the formed structure was completely decomposed by the 8th and 12th weeks. The range of staining dramatically increased with time at 4, 8, and 12 weeks in Masson trichrome staining. The concentration of glycosaminoglycan also increased with time. The increased level was statistically significant with more than 3 times more after 8 weeks compared with 4 weeks and more than 2 times more after 12 weeks compared with 8 weeks. Also, in reverse transcriptase-polymerase chain reaction at 4, 8, and 12 weeks, all results expressed a cartilage-specific gene called aggrecan, type II collagen, and SOX-9. The study verified that the chondrogenic-differentiated MSCs derived from human adipose tissues with fibrin glue can proliferate and form new cartilage. Our findings suggest that formation of cartilages in vivo is possible.

  5. A comparative kinetic RT/-PCR strategy for the quantitation of mRNAs in microdissected human renal biopsy specimens.

    PubMed

    Del Prete, D; Forino, M; Gambaro, G; D'Angelo, A; Baggio, B; Anglani, F

    1998-01-01

    Molecular biology techniques, to be applicable to a diagnostic renal biopsy specimen, should (1) be highly sensitive to be performed on a very small quantity of tissue; (2) be quantitative because they have to analyze genes normally expressed in the tissue and (3) allow the analysis of as large a number of genes as possible. Among different methods, only the reverse-transcriptase polymerase chain reaction (RT/-PCR) might comply with previous requisites, but the few RT/-PCR examples on renal biopsies in the literature do not allow starting RNA quantification and quality control; furthermore they have the drawback of analyzing only few genes. In an ongoing study to assess the expression of a number of genes in glomeruli and in tubulointerstitium of patients with different nephropathies, we developed a comparative RT/-PCR kinetic strategy based on the purification and quantification of total glomerular and tubulointerstitial RNA and on the use of an internal standard, the housekeeping gene G3PDH. We demonstrate that in microdissected diagnostic renal biopsies (1) glomerular and interstitial starting RNA can be quantified; (2) the G3PDH gene may be used both as an internal standard and as an indirect marker of RNA integrity; (3) as low as 28 ng of total RNA is sufficient to obtain PCR products of eight genes, and (4) it is worth to operate on microdissected biopsy specimens because of the different expression of genes in the two renal compartments.

  6. Estrogen receptor-α, progesterone receptor, and c-erbB/HER-family receptor mRNA detection and phenotype analysis in spontaneous canine models of breast cancer

    PubMed Central

    Kabir, Farruk M. Lutful; DeInnocentes, Patricia; Agarwal, Payal; Mill, Christopher P.; Riese, David J.

    2017-01-01

    Well characterized, stable, p16-defective canine mammary cancer (CMT) cell lines and normal canine mammary epithelial cells were used to investigate expression of the major breast cancer-specific hormone receptors estrogen receptor alpha (ER1) and progesterone receptor (PR) as well as luminal epithelial-specific proto-oncogenes encoding c-erbB-1 (epidermal growth factor receptor/EGFr), c-erbB-2/HER2, c-erbB-3, and c-erbB-4 receptors. The investigation developed and validated quantitative reverse transcriptase polymerase chain reaction assays for each transcript to provide rapid assessment of breast cancer phenotypes for canine cancers, based on ER1, PR, and c-erbB-2/HER2 expressions, similar to those in human disease. Roles for relatively underexplored c-erbB-3 and c-erbB-4 receptor expressions in each of these breast cancer phenotypes were also evaluated. Each quantitative assay was validated by assessment of amplicon size and DNA sequencing following amplification. Differential expression of ER1, PR, and c-erbB-2 in CMT cell lines clearly defined distinct human-like breast cancer phenotypes for a selection of CMT-derived cell lines. Expression profiles for EGFr family genes c-erbB-3 and c-erbB-4 in CMT models also provided an enriched classification of canine breast cancer identifying new extended phenotypes beyond the conventional luminal-basal characterization used in human breast cancer. PMID:27515268

  7. Geographic variation in marine turtle fibropapillomatosis

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Dutton, P.; Sutton, C.A.; Spraker, T.R.; Casey, R.N.; Diez, C.E.; Parker, Dana C.; St. Ledger, J.; Balazs, G.H.; Casey, J.W.

    2005-01-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  8. Geographic variation in marine turtle fibropapillomatosis.

    PubMed

    Greenblatt, Rebecca J; Work, Thierry M; Dutton, Peter; Sutton, Claudia A; Spraker, Terry R; Casey, Rufina N; Diez, Carlos E; Parker, Denise; St Leger, Judy; Balazs, George H; Casey, James W

    2005-09-01

    We document three examples of fibropapillomatosis by histology, quantitative polymerase chain reaction (qPCR), and sequence analysis from three different geographic areas. Tumors compatible in morphology with fibropapillomatosis were seen in green turtles from Puerto Rico and San Diego (California) and in a hybrid loggerhead/ hawksbill turtle from Florida Bay (Florida). Tumors were confirmed as fibropapillomas on histology, although severity of disease varied between cases. Polymerase chain reaction (PCR) analyses revealed infection with the fibropapilloma-associated turtle herpesvirus (FPTHV) in all cases, albeit at highly variable copy numbers per cell. Alignment of a portion of the polymerase gene from each fibropapilloma-associated turtle herpesvirus isolate demonstrated geographic variation in sequence. These cases illustrate geographic variation in both the pathology and the virology of fibropapillomatosis.

  9. Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cao Hongbin; Banh, Alice; Kwok, Shirley

    Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed bymore » p16{sup INK4a} staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using {sup 18}F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.« less

  10. Cykotine mRNA expression in mouse retina after laser injury by reverse transcriptase-polymerase chain reaction (RT-PCR)

    NASA Astrophysics Data System (ADS)

    Schuschereba, Steven T.; Bowman, Phillip D.; Ujimore, Veronica; Hoxie, Stephen W.; Pizarro, Jose M.; Cross, Michael E.; Lund, David J.

    1996-04-01

    The purpose of this study was to identify cytokines produced by the retina after laser injury. With the aid of a scanning laser ophthalmoscope (SLO), right eyes of mice received lesions from a continuous wave argon laser. Left eyes served as unirradiated controls. At 2, 4, 6, 12, 24, and 48 hr after laser irradiation groups of 3 mice were euthanized and retinas fixed for histology or isolated for RNA. Messenger RNA (mRNA) was reverse-transcribed into complementary DNA (cDNA) and subjected to polymerase chain reaction for the following cytokines: tumor necrosis factor-(alpha) (TNF-(alpha) ), interleukin-1(alpha) /(Beta) (IL- 1(alpha) /(Beta) ), interleukin-6 (IL-6), transforming growth factor-(Beta) 1 (TGF- (Beta) 1), macrophage colony stimulating factor (M-CSF), inducible nitric oxide synthase (iNOS), and glyceraldehyde 3-phosphate dehydrogenase (G3PDH). Histologically, lesions were confined to the photoreceptors, retinal pigment epithelium, and choroid. In laser-injured retinas, mRNA levels were elevated for IL-1(alpha) , TGF-(Beta) 1, iNOS, and G3PDH, but not TNF-(alpha) , IL-1(Beta) , or IL-6. It appears that the retina, in response to laser injury, upregulates a select number of cytokines in a time-course dependent fashion.

  11. Quantitative Tetraplex Real-Time Polymerase Chain Reaction Assay with TaqMan Probes Discriminates Cattle, Buffalo, and Porcine Materials in Food Chain.

    PubMed

    Hossain, M A Motalib; Ali, Md Eaqub; Sultana, Sharmin; Asing; Bonny, Sharmin Quazi; Kader, Md Abdul; Rahman, M Aminur

    2017-05-17

    Cattle, buffalo, and porcine materials are widely adulterated, and their quantification might safeguard health, religious, economic, and social sanctity. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays have been documented but they are just suitable for identification, cannot quantify adulterations. We described here a quantitative tetraplex real-time PCR assay with TaqMan Probes to quantify contributions from cattle, buffalo, and porcine materials simultaneously. Amplicon-sizes were very short (106-, 90-, and 146-bp for cattle, buffalo, and porcine) because longer targets could be broken down, bringing serious ambiguity in molecular diagnostics. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 27 frankfurters and 27 meatballs reflected 84-115% target recovery at 0.1-10% adulterations. Finally, a test of 36 commercial products revealed 71% beef frankfurters, 100% meatballs, and 85% burgers contained buffalo adulteration, but no porcine was found in beef products.

  12. Synthesis, biological evaluation and molecular modeling of 2-Hydroxyisoquinoline-1,3-dione analogues as inhibitors of HIV reverse transcriptase associated ribonuclease H and polymerase.

    PubMed

    Tang, Jing; Vernekar, Sanjeev Kumar V; Chen, Yue-Lei; Miller, Lena; Huber, Andrew D; Myshakina, Nataliya; Sarafianos, Stefan G; Parniak, Michael A; Wang, Zhengqiang

    2017-06-16

    Human immunodeficiency virus (HIV) reverse transcriptase (RT) associated ribonuclease H (RNase H) remains the only virally encoded enzymatic function not clinically validated as an antiviral target. 2-Hydroxyisoquinoline-1,3-dione (HID) is known to confer active site directed inhibition of divalent metal-dependent enzymatic functions, such as HIV RNase H, integrase (IN) and hepatitis C virus (HCV) NS5B polymerase. We report herein the synthesis and biochemical evaluation of a few C-5, C-6 or C-7 substituted HID subtypes as HIV RNase H inhibitors. Our data indicate that while some of these subtypes inhibited both the RNase H and polymerase (pol) functions of RT, potent and selective RNase H inhibition was achieved with subtypes 8-9 as exemplified with compounds 8c and 9c. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  13. EPA Scientists Develop Research Methods for Studying Mold Fact Sheet

    EPA Pesticide Factsheets

    In 2002, U.S. Environmental Protection Agency researchers developed a DNA-based Mold Specific Quantitative Polymerase Chain Reaction method (MSQPCR) for identifying and quantifying over 100 common molds and fungi.

  14. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  15. Clinical characteristics of children with viral single- and co-infections and a petechial rash.

    PubMed

    Schneider, Henriette; Adams, Ortwin; Weiss, Christel; Merz, Ulrich; Schroten, Horst; Tenenbaum, Tobias

    2013-05-01

    Children with petechial rash are more likely to undergo invasive diagnostics, to be treated with antibiotics for potential bacterial infection and to be hospitalized. However, viruses have also been associated with petechial rash. Nonetheless, a systematic analysis of viral infections with modern available techniques as quantitative real-time polymerase chain reaction in the context of petechial rash is lacking. The purpose of this pediatric study was to prospectively uncover viral pathogens that may promote the emergence of petechiae and to analyze the correlation with the clinical characteristics and course. We conducted a prospective study in children (0 to 18 years) presenting with petechiae and signs or symptoms of infection at the emergency department between November 2009 and March 2012. In nasopharyngeal aspirates the following viruses were analyzed by quantitative real-time polymerase chain reaction: cytomegalovirus, Epstein-Barr virus, parvovirus B19, influenza A and B, parainfluenza viruses, human respiratory syncytial virus A and B, human metapneumovirus, rhinovirus, enterovirus, adenovirus, human coronavirus OC43, 229E, NL63 and human bocavirus. A viral pathogen was identified in 67% of the analyzed 58 cases with petechial rash. Virus positive patients showed a significantly higher incidence of lower respiratory tract infections. Forty-one percent were viral coinfections, which were significantly younger than virus negative patients, had a higher leukocyte count and were hospitalized for a longer time. A petechial rash is frequently associated viral single- and coinfections and can rapidly be identified via quantitative real-time polymerase chain reaction.

  16. Detection limits and cost comparisons of human- and gull-associated conventional and quantitative PCR assays in artificial and environmental waters

    EPA Science Inventory

    Modern techniques for tracking fecal pollution in environmental waters require investing in DNA-based methods to determine the presence of specific fecal sources. To help water quality managers decide whether to employ routine polymerase chain reaction (PCR) or quantitative PC...

  17. Correlation between quantitative PCR and Culture-Based methods for measuring Enterococcus spp. over various temporal scales at three California marine beaches

    EPA Science Inventory

    Several studies have examined how fecal indicator bacteria (FIB) measurements compare between quantitative polymerase chain reaction (QPCR) and the culture methods it is intended to replace. Here we extend those studies by examining the stability of that relationship within a be...

  18. Identification and evaluation of reliable reference genes for quantitative real-time PCR analysis in tea plant (Camellia sinensis (L.) O. Kuntze)

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time polymerase chain reaction (qRT-PCR) is a commonly used technique for measuring gene expression levels due to its simplicity, specificity, and sensitivity. Reliable reference selection for the accurate quantification of gene expression under various experimental conditions is a...

  19. Yellow Fever Vaccination of a Primary Vaccinee During Adalimumab Therapy.

    PubMed

    Nash, Esther R; Brand, Myron; Chalkias, Spyridon

    2015-01-01

    In this case report, we describe a 63-year-old female with Crohn's disease since age 16 years, and on adalimumab therapy, who inadvertently received a yellow fever vaccine (YFV) 4 days before her next dose of adalimumab. She had never received YFV. Her next dose of tumor necrosis factor (TNF) antagonist was held. She did not report any adverse effects referable to the vaccine. Reverse transcriptase-polymerase chain reaction (RT-PCR) for yellow fever (YF) viral RNA on days 12 and 18 postvaccination was negative. Neutralizing antibody to YF virus vaccine was immunoprotective on day 18 following vaccination, which further increased by day 26. A neutralizing antibody obtained 2 years following vaccination also remained immunoprotective. © 2015 International Society of Travel Medicine.

  20. Comparison of ELISA and RT-PCR for the detection of Prunus necrotic ring spot virus and prune dwarf virus in almond (Prunus dulcis).

    PubMed

    Mekuria, Genet; Ramesh, Sunita A; Alberts, Evita; Bertozzi, Terry; Wirthensohn, Michelle; Collins, Graham; Sedgley, Margaret

    2003-12-01

    A technique based on the reverse transcriptase-polymerase chain reaction (RT-PCR) has been developed to detect the presence of Prunus necrotic ringspot virus (PNRSV) and prune dwarf virus (PDV) simultaneously in almond. This paper presents the results of a 3-year study comparing both enzyme-linked immunosorbent assay (ELISA) and RT-PCR for the detection of PNRSV and PDV using 175 almond leaf samples. Multiplex RT-PCR was found to be more sensitive than ELISA, especially when followed by nested PCR for the detection of PDV. The RT-PCR technique has the added advantage that plant material can be tested at any time throughout the growing season.

  1. Targeting FOXM1 Improves Cytotoxicity of Paclitaxel and Cisplatinum in Platinum-Resistant Ovarian Cancer.

    PubMed

    Westhoff, Gina L; Chen, Yi; Teng, Nelson N H

    2017-10-01

    Aberrantly activated FOXM1 (forkhead box protein M1) leading to uncontrolled cell proliferation and dysregulation of FOXM1 transcription network occurs in 84% of ovarian cancer cases. It was demonstrated that thiostrepton, a thiazole antibiotic, decreases FOXM1 expression. We aimed to determine if targeting the FOXM1 pathway with thiostrepton could improve the efficacy of paclitaxel and cisplatin in human ovarian cancer ascites cells ex vivo. Human ovarian cancer cell lines and patients' ascites cells were treated with paclitaxel, cisplatin, and thiostrepton or a combination for 48 hours, and cytotoxicity was assessed. Drug combination effects were determined by calculating the combination index values using the Chou and Talalay method. Quantitative reverse transcriptase-polymerase chain reaction was performed to determine changes in FOXM1 expression and its downstream targets. Ovarian cancer cell lines and the patients' ascites cancer cells had an overexpression of FOXM1 expression levels. Targeting FOXM1 with thiostrepton decreased FOXM1 mRNA expression and its downstream targets such as CCNB1 and CDC25B, leading to cell death in both cell lines and patients' ascites cancer cells. Furthermore, addition of thiostrepton to paclitaxel and cisplatin showed synergistic effects in chemoresistant ovarian cancer patients' ascites cells ex vivo. Targeting FOXM1 may lead to novel therapeutics for chemoresistant epithelial ovarian cancer.

  2. Identification of Reference Genes and Analysis of Heat Shock Protein Gene Expression in Lingzhi or Reishi Medicinal Mushroom, Ganoderma lucidum, after Exposure to Heat Stress.

    PubMed

    Liu, Yong-Nan; Lu, Xiao-Xiao; Ren, Ang; Shi, Liang; Jiang, Ai-Liang; Yu, Han-Shou; Zhao, Ming-Wen

    2017-01-01

    Ganoderma lucidum has been considered an emerging model species for studying how environmental factors regulate the growth, development, and secondary metabolism of Basidiomycetes. Heat stress, which is one of the most important environmental abiotic stresses, seriously affects the growth, development, and yield of microorganisms. Understanding the response to heat stress has gradually become a hotspot in microorganism research. But suitable reference genes for expression analysis under heat stress have not been reported in G. lucidum. In this study, we systematically identified 11 candidate reference genes that were measured using reverse transcriptase quantitative polymerase chain reaction, and the gene expression stability was analyzed under heat stress conditions using geNorm and NormFinder. The results show that 5 reference genes-CYP and TIF, followed by UCE2, ACTIN, and UBQ1-are the most stable genes under our experimental conditions. Moreover, the relative expression levels of 3 heat stress response genes (hsp17.4, hsp70, and hsp90) were analyzed under heat stress conditions with different normalization strategies. The results show that use of a gene with unstable expression (SAND) as the reference gene leads to biased data and misinterpretations of the target gene expression level under heat stress.

  3. DNA Methylation Signatures of Early Childhood Malnutrition Associated With Impairments in Attention and Cognition.

    PubMed

    Peter, Cyril J; Fischer, Laura K; Kundakovic, Marija; Garg, Paras; Jakovcevski, Mira; Dincer, Aslihan; Amaral, Ana C; Ginns, Edward I; Galdzicka, Marzena; Bryce, Cyralene P; Ratner, Chana; Waber, Deborah P; Mokler, David; Medford, Gayle; Champagne, Frances A; Rosene, Douglas L; McGaughy, Jill A; Sharp, Andrew J; Galler, Janina R; Akbarian, Schahram

    2016-11-15

    Early childhood malnutrition affects 113 million children worldwide, impacting health and increasing vulnerability for cognitive and behavioral disorders later in life. Molecular signatures after childhood malnutrition, including the potential for intergenerational transmission, remain unexplored. We surveyed blood DNA methylomes (~483,000 individual CpG sites) in 168 subjects across two generations, including 50 generation 1 individuals hospitalized during the first year of life for moderate to severe protein-energy malnutrition, then followed up to 48 years in the Barbados Nutrition Study. Attention deficits and cognitive performance were evaluated with the Connors Adult Attention Rating Scale and Wechsler Abbreviated Scale of Intelligence. Expression of nutrition-sensitive genes was explored by quantitative reverse transcriptase polymerase chain reaction in rat prefrontal cortex. We identified 134 nutrition-sensitive, differentially methylated genomic regions, with most (87%) specific for generation 1. Multiple neuropsychiatric risk genes, including COMT, IFNG, MIR200B, SYNGAP1, and VIPR2 showed associations of specific methyl-CpGs with attention and IQ. IFNG expression was decreased in prefrontal cortex of rats showing attention deficits after developmental malnutrition. Early childhood malnutrition entails long-lasting epigenetic signatures associated with liability for attention and cognition, and limited potential for intergenerational transmission. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  4. Sepsis-Induced Coagulation in the Baboon Lung Is Associated with Decreased Tissue Factor Pathway Inhibitor

    PubMed Central

    Tang, Haiwang; Ivanciu, Lacramioara; Popescu, Narcis; Peer, Glenn; Hack, Erik; Lupu, Cristina; Taylor, Fletcher B.; Lupu, Florea

    2007-01-01

    Increased tissue factor (TF)-dependent procoagulant activity in sepsis may be partly due to decreased expression or function of tissue factor pathway inhibitor (TFPI). To test this hypothesis, baboons were infused with live Escherichia coli and sacrificed after 2, 8, or 24 hours. Confocal and electron microscopy revealed increased leukocyte infiltration and fibrin deposition in the intravascular and interstitial compartments. Large amounts of TF were detected by immunostaining in leukocytes and platelet-rich microthrombi. TF induction was documented by quantitative reverse transcriptase-polymerase chain reaction, enzyme-linked immunosorbent assay, and coagulation assays. Lung-associated TFPI antigen and mRNA decreased during sepsis, and TFPI activity diminished abruptly at 2 hours. Blocking antibodies against TFPI increased fibrin deposition in septic baboon lungs, suggesting that TF-dependent coagulation might be aggravated by reduced endothelial TFPI. Decreased TFPI activity coincided with the release of tissue plasminogen activator and the peak of plasmin generation, suggesting that TFPI could undergo proteolytic inactivation by plasmin. Enhanced plasmin produced in septic baboons by infusion of blocking antibodies against plasminogen activator inhibitor-1 led to decreased lung-associated TFPI and unforeseen massive fibrin deposition. We conclude that activation of TF-driven coagulation not adequately countered by TFPI may underlie the widespread thrombotic complications of sepsis. PMID:17640967

  5. Polycyclic aromatic hydrocarbon-induced CYP1B1 activity is suppressed by perillyl alcohol in MCF-7 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chan, Nelson L.S.; Wang Huan; Wang Yun

    2006-06-01

    Perillyl alcohol (POH) is a dietary monoterpene with potential applications in chemoprevention and chemotherapy. Although clinical trials are under way, POH's physiological and pharmacological properties are still unclear. In the present study, the effect of POH on polycyclic aromatic hydrocarbon (PAH)-induced genotoxicity, and the related expression were examined in MCF-7 cells. Exposure to environmental toxicant increases the risk of cancer. Many of these compounds are pro-carcinogens and are biotransformed into their ultimate genotoxic structures by xenobiotic metabolizing enzymes. CYP1A1 and 1B1 are enzymes that catalyze the biotransformation of dimethylbenz[a]anthracene (DMBA). Our data revealed that 0.5 {mu}M of POH was effectivemore » in blocking DMBA-DNA binding. Ethoxyresorufin-O-deethylase (EROD) assay indicated that the administration of POH inhibited the DMBA-induced enzyme activity in MCF-7 cells. Enzyme kinetic analysis revealed that POH inhibited CYP1B1 but not CYP1A1 activity. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay also demonstrated that the monoterpene reduced CYP1B1 mRNA abundance induced by DMBA. The present study illustrated that POH might inhibit and downregulate CYP1B1, which could protect against PAH-induced carcinogenesis.« less

  6. Selection of reference genes for RT-qPCR analysis in a predatory biological control agent, Coleomegilla maculata (Coleoptera: Coccinellidae).

    PubMed

    Yang, Chunxiao; Pan, Huipeng; Noland, Jeffrey Edward; Zhang, Deyong; Zhang, Zhanhong; Liu, Yong; Zhou, Xuguo

    2015-12-10

    Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for quantifying gene expression across various biological processes, of which requires a set of suited reference genes to normalize the expression data. Coleomegilla maculata (Coleoptera: Coccinellidae), is one of the most extensively used biological control agents in the field to manage arthropod pest species. In this study, expression profiles of 16 housekeeping genes selected from C. maculata were cloned and investigated. The performance of these candidates as endogenous controls under specific experimental conditions was evaluated by dedicated algorithms, including geNorm, Normfinder, BestKeeper, and ΔCt method. In addition, RefFinder, a comprehensive platform integrating all the above-mentioned algorithms, ranked the overall stability of these candidate genes. As a result, various sets of suitable reference genes were recommended specifically for experiments involving different tissues, developmental stages, sex, and C. maculate larvae treated with dietary double stranded RNA. This study represents the critical first step to establish a standardized RT-qPCR protocol for the functional genomics research in a ladybeetle C. maculate. Furthermore, it lays the foundation for conducting ecological risk assessment of RNAi-based gene silencing biotechnologies on non-target organisms; in this case, a key predatory biological control agent.

  7. Enhancing acute myeloid leukemia therapy - monitoring response using residual disease testing as a guide to therapeutic decision-making.

    PubMed

    Tomlinson, Benjamin; Lazarus, Hillard M

    2017-06-01

    Current standards for monitoring the response of acute myeloid leukemia (AML) are based on morphologic assessments of the bone marrow and recovery of peripheral blood counts. A growing experience is being developed to enhance the detection of small amounts of AML, or minimal residual disease (MRD). Areas covered: Available techniques include multi-color flow cytometry (MFC) of leukemia associated immunophenotypes (LAIP), quantitative reverse transcriptase polymerase chain reaction (QRT-PCR) for detecting fusion and mutated genes (RUNX1-RUNX1T1, CBFB-MYH11, and NPM1), overexpression of genes such as WT1, and next generation sequencing (NGS) for MRD. Expert commentary: While MRD monitoring is standard of care in some leukemia subsets such as acute promyelocytic leukemia, this approach for the broader AML population does not universally predict outcomes as some patients may experience relapse in the setting of undetectable leukemia while others show no obvious disease progression despite MRD positivity. However, there are instances where MRD can identify patients at increased risk for relapse that may change recommended therapy. Currently, prospective investigations to define clinically relevant MRD thresholds are ongoing. Risk-adapted trials are needed to best define the use of MRD in the follow up of AML patients after initial induction therapy.

  8. Particulate matter from indoor environments of classroom induced higher cytotoxicity and leakiness in human microvascular endothelial cells in comparison with those collected from corridor.

    PubMed

    Chua, M L; Setyawati, M I; Li, H; Fang, C H Y; Gurusamy, S; Teoh, F T L; Leong, D T; George, S

    2017-05-01

    We investigated the physicochemical properties (size, shape, elemental composition, and endotoxin) of size resolved particulate matter (PM) collected from the indoor and corridor environments of classrooms. A comparative hazard profiling of these PM was conducted using human microvascular endothelial cells (HMVEC). Oxidative stress-dependent cytotoxicity responses were assessed using quantitative reverse transcriptase polymerase chain reaction (RT-PCR) and high content screening (HCS), and disruption of monolayer cell integrity was assessed using fluorescence microscopy and transwell assay. Scanning electron microscopy (SEM) coupled with energy-dispersive X-ray spectroscopy (EDX) analysis showed differences in the morphology and elemental composition of PM of different sizes and origins. While the total mass of PM collected from indoor environment was lower in comparison with those collected from the corridor, the endotoxin content was substantially higher in indoor PM (e.g., ninefold higher endotoxin level in indoor PM 8.1-20 ). The ability to induce oxidative stress-mediated cytotoxicity and leakiness in cell monolayer were higher for indoor PM compared to those collected from the corridor. In conclusion, this comparative analysis suggested that indoor PM is relatively more hazardous to the endothelial system possibly because of higher endotoxin content. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae)

    PubMed Central

    Barandoc-Alviar, Karen; Ramirez, Girly M.; Rotenberg, Dorith; Whitfield, Anna E.

    2016-01-01

    The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. PMID:28076276

  10. Elevation of macrophage-derived chemokine in eosinophilic pneumonia: a role of alveolar macrophages.

    PubMed

    Manabe, Kazuyoshi; Nishioka, Yasuhiko; Kishi, Jun; Inayama, Mami; Aono, Yoshinori; Nakamura, Yoichi; Ogushi, Fumitaka; Bando, Hiroyasu; Tani, Kenji; Sone, Saburo

    2005-02-01

    Macrophage-derived chemokine (MDC/CCL22) and thymus-and activation-regulated chemokine (TARC/CCL17) are ligands for CC chemokine receptor 4. Recently, TARC has been reported to play a role in the pathogenesis of idiopathic eosinophilic pneumonia (IEP). The purpose of this study was to evaluate the role of MDC in IEP and other interstitial lung diseases (ILDs). MDC and TARC in the bronchoalveolar lavage fluid (BALF) were measured by enzyme-linked immunosorbent assay in patients with ILDs and healthy volunteers (HV). We also examined the expression of MDC mRNA in alveolar macrophages (AM) by real-time quantitative reverse transcriptase-polymerase chain reaction. Both MDC and TARC were detected only in BALF obtained from IEP patients. The concentration of MDC was higher than that of TARC in all cases. The level of MDC in IEP correlated with that of TARC. AM from IEP patients expressed a significantly higher amount of MDC than that from HV at the levels of protein and mRNA. MDC in BALF from IEP dramatically decreased when patients achieved remission. These findings suggest that MDC, in addition to TARC, might be involved in the pathogenesis of IEP, and AM play a role in the elevation of MDC in IEP.

  11. Comparative proteomic analysis of outer membrane protein 43 (omp43)-deficient Bartonella henselae.

    PubMed

    Kang, Jun-Gu; Lee, Hee-Woo; Ko, Sungjin; Chae, Joon-Seok

    2018-01-31

    Outer membrane proteins (OMPs) of Gram-negative bacteria constitute the first line of defense protecting cells against environmental stresses including chemical, biophysical, and biological attacks. Although the 43-kDa OMP (OMP43) is major porin protein among Bartonella henselae -derived OMPs, its function remains unreported. In this study, OMP43-deficient mutant B. henselae (Δomp43) was generated to investigate OMP43 function. Interestingly, Δ omp 43 exhibited weaker proliferative ability than that of wild-type (WT) B. henselae . To study the differences in proteomic expression between WT and Δ omp 43, two-dimensional gel electrophoresis-based proteomic analysis was performed. Based on Clusters of Orthologus Groups functional assignments, 12 proteins were associated with metabolism, 7 proteins associated with information storage and processing, and 3 proteins associated with cellular processing and signaling. By semi-quantitative reverse transcriptase polymerase chain reaction, increases in tld D, efp, ntr X, pdh A, pur B, and ATPA mRNA expression and decreases in Rho and yfe A mRNA expression were confirmed in Δ omp 43. In conclusion, this is the first report showing that a loss of OMP43 expression in B. henselae leads to retarded proliferation. Furthermore, our proteomic data provide useful information for the further investigation of mechanisms related to the growth of B. henselae.

  12. Construction and analysis of the cDNA subtraction library of yeast and mycelial phases of Sporothrix globosa isolated in China: identification of differentially expressed genes*

    PubMed Central

    Hu, Qing-bi; He, Yu; Zhou, Xun

    2015-01-01

    Species included in the Sporothrix schenckii complex are temperature-dependent with dimorphic growth and cause sporotrichosis that is characterized by chronic and fatal lymphocutaneous lesions. The putative species included in the Sporothrix complex are S. brasiliensis, S. globosa, S. mexicana, S. pallida, S. schenckii, and S. lurei. S. globosa is the causal agent of sporotrichosis in China, and its pathogenicity appears to be closely related to the dimorphic transition, i.e. from the mycelial to the yeast phase, it adapts to changing environmental conditions. To determine the molecular mechanisms of the switching process that mediates the dimorphic transition of S. globosa, suppression subtractive hybridization (SSH) was used to prepare a complementary DNA (cDNA) subtraction library from the yeast and mycelial phases. Bioinformatics analysis was performed to profile the relationship between differently expressed genes and the dimorphic transition. Two genes that were expressed at higher levels by the yeast form were selected, and their differential expression levels were verified using a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). It is believed that these differently expressed genes are involved in the pathogenesis of S. globosa infection in China. PMID:26642182

  13. Virus-Induced Gene Silencing in Cultivated Cotton (Gossypium spp.) Using Tobacco Rattle Virus.

    PubMed

    Mustafa, Roma; Shafiq, Muhammad; Mansoor, Shahid; Briddon, Rob W; Scheffler, Brian E; Scheffler, Jodi; Amin, Imran

    2016-01-01

    The study described here has optimized the conditions for virus-induced gene silencing (VIGS) in three cultivated cotton species (Gossypium hirsutum, G. arboreum, and G. herbaceum) using a Tobacco rattle virus (TRV) vector. The system was used to silence the homolog of the Arabidopsis thaliana chloroplastos alterados 1 (AtCLA1) gene, involved in chloroplast development, in G. herbaceum, G. arboreum, and six commercial G. hirsutum cultivars. All plants inoculated with the TRV vector to silence CLA1 developed a typical albino phenotype indicative of silencing this gene. Although silencing in G. herbaceum and G. arboreum was complete, silencing efficiency differed for each G. hirsutum cultivar. Reverse transcriptase polymerase chain reaction (PCR) and real-time quantitative PCR showed a reduction in mRNA levels of the CLA1 homolog in all three species, with the highest efficiency (lowest CLA1 mRNA levels) in G. arboreum followed by G. herbaceum and G. hirsutum. The results indicate that TRV is a useful vector for VIGS in Gossypium species. However, selection of host cultivar is important. With the genome sequences of several cotton species recently becoming publicly available, this system has the potential to provide a very powerful tool for the rapid, large-scale reverse-genetic analysis of genes in Gossypium spp.

  14. Understanding of how Propionibacterium acidipropionici respond to propionic acid stress at the level of proteomics

    PubMed Central

    Guan, Ningzi; Shin, Hyun-dong; Chen, Rachel R.; Li, Jianghua; Liu, Long; Du, Guocheng; Chen, Jian

    2014-01-01

    Propionic acid (PA) is an important platform chemical in the food, agriculture, and pharmaceutical industries and is mainly biosynthesized by propionibacteria. Acid tolerance in PA-producing strains is crucial. In previous work, we investigated the acid tolerance mechanism of Propionibacterium acidipropionici at microenvironmental levels by analyzing physiological changes in the parental strain and three PA-tolerant mutants obtained by genome shuffling. However, the molecular mechanism of PA tolerance in P. acidipropionici remained unclear. Here, we performed a comparative proteomics study of P. acidipropionici CGMCC 1.2230 and the acid-tolerant mutant P. acidipropionici WSH1105; MALDI-TOF/MS identified 24 proteins that significantly differed between the parental and shuffled strains. The differentially expressed proteins were mainly categorized as key components of crucial biological processes and the acid stress response. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was used to confirm differential expression of nine key proteins. Overexpression of the secretory protein glyceraldehyde-3-phosphate dehydrogenase and ATP synthase subunit α in Escherichia coli BL21 improved PA and acetic acid tolerance; overexpression of NADH dehydrogenase and methylmalonyl-CoA epimerase improved PA tolerance. These results provide new insights into the acid tolerance of P. acidipropionici and will facilitate the development of PA production through fermentation by propionibacteria. PMID:25377721

  15. A comparative gene expression analysis of iron-limited cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensis using newly developed iron assays

    NASA Astrophysics Data System (ADS)

    Abdala, Z. M.; Powell, K.; Cronin, D.; Chappell, D.

    2016-02-01

    A comparative gene expression analysis of iron-limited cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensisusing newly developed iron assays Zuzanna M. Abdala, Kimberly Powell, Dylan P. Cronin, P. Dreux Chappell Diatoms, accounting for about 40% of the primary production in marine ecosystems, play a vital role in the dynamics of marine systems. Iron availability is understood to be a driving factor controlling productivity of many marine phytoplankton, including diatoms, as it functions as a cofactor for many proteins including several involved with photosynthetic processes. Previous work examining transcriptomes of diatoms of the Thalassiosira genus grown in controlled laboratory settings has identified genes whose expression can be used as sensitive markers of iron status. Data mining publically available diatom transcriptome data for these genes enables development of additional iron status assays for environmentally-relevant diatoms. For the present study, gene expression analysis of iron-limited laboratory cultures of Chaetoceros socialis and Pseudo-nitzschia arenysensis grown in continuous light was done using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). C. socialis and P. arenysensis serve as comparative models for analyzing gene expression in iron limitation in different ecological community assemblages. These data may ultimately assist to illuminate the function of iron in photosynthetic activity in diatoms.

  16. Decreased cathepsin K levels in human atherosclerotic plaques are associated with plaque instability.

    PubMed

    Zhao, Huiying; Qin, Xiujiao; Wang, Shuai; Sun, Xiwei; Dong, Bin

    2017-10-01

    Investigating the determinants and dynamics of atherosclerotic plaque instability is a key area of current cardiovascular research. Extracellular matrix degradation from excessive proteolysis induced by enzymes such as cathepsin K (Cat K) is implicated in the pathogenesis of unstable plaques. The current study assessed the expression of Cat K in human unstable atherosclerotic plaques. Specimens of popliteal arteries with atherosclerotic plaques were classified as stable (<40% lipid core plaque area; n=6) or unstable (≥40% lipid core plaque area; n=14) based on histopathological examinations of hematoxylin and eosin stained sections. The expression of Cat K and cystatin C (Cys C) were assessed by immunohistochemical examination and levels of Cat K mRNA were detected by semi-quantitative reverse transcriptase polymerase chain reaction. Morphological changes including a larger lipid core, endothelial proliferation with foam cells and destruction of internal elastic lamina were observed in unstable atherosclerotic plaques. In unstable plaques, the expression of Cat K protein and mRNA was upregulated, whereas Cys C protein expression was downregulated. The interplay between Cat K and Cys C may underlie the progression of plaques from stable to unstable and the current study indicated that Cat K and Cys C are potential targets for preventing and treating vulnerable atherosclerotic plaque ruptures.

  17. Submicroscopic malaria infections in pregnant women from six departments in Haiti.

    PubMed

    Elbadry, Maha A; Tagliamonte, Massimiliano S; Raccurt, Christian P; Lemoine, Jean F; Existe, Alexandre; Boncy, Jacques; Weppelmann, Thomas A; Dame, John B; Okech, Bernard A

    2017-08-01

    To describe the epidemiology of malaria in pregnancy in Haiti. Cross-sectional study among pregnant women in six departments of Haiti. After obtaining informed consent, whole blood samples and demographic surveys were collected to investigate malaria prevalence, anaemia and socio-behavioural risk factors for infection, respectively. A total of 311 pregnant women were screened for Plasmodium falciparum infection using a rapid diagnostic test (RDT), microscopy and a novel, quantitative reverse transcriptase polymerase chain reaction method (qRT-PCR). Overall, 1.2% (4/311) of pregnant women were tested positive for malaria infection by both microscopy and RDT. However, using the qRT-PCR, 16.4% (51/311) of pregnant women were positive. The prevalence of malaria infection varied with geographical locations ranging between 0% and 46.4%. Additionally, 53% of pregnant women had some form of anaemia; however, no significant association was found between anaemia and submicroscopic malaria infection. The socio-behavioural risk factors identified to be protective of malaria infection were marital status (P < 0.05) and travel within one month prior to screening (P < 0.05). This study is the first to document the high prevalence of submicroscopic malaria infections among pregnant women in Haiti and identify social and behavioural risk factors for disease transmission. © 2017 John Wiley & Sons Ltd.

  18. Leptin influences estrogen metabolism and accelerates prostate cell proliferation.

    PubMed

    Habib, Christine N; Al-Abd, Ahmed M; Tolba, Mai F; Khalifa, Amani E; Khedr, Alaa; Mosli, Hisham A; Abdel-Naim, Ashraf B

    2015-01-15

    The present study was designed to investigate the effect of leptin on estrogen metabolism in prostatic cells. Malignant (PC-3) and benign (BPH-1) human prostate cells were treated with 17-β-hydroxyestradiol (1 μM) alone or in combination with leptin (0.4, 4, 40 ng/ml) for 72 h. Cell proliferation assay, immunocytochemical staining of estrogen receptor (ER), liquid chromatography-tandem mass spectrometry method (LC-MS) and semi-quantitative reverse transcriptase polymerase chain reaction (RT-PCR) were used. Cell proliferation assay demonstrated that leptin caused significant growth potentiation in both cells. Immunocytochemical staining showed that leptin significantly increased the expression of ER-α and decreased that of ER-β in PC-3 cells. LC-MS method revealed that leptin increased the concentration 4-hydroxyestrone and/or decreased that of 2-methoxyestradiol, 4-methoxyestradiol and 2-methoxyestrone. Interestingly, RT-PCR showed that leptin significantly up-regulated the expression of aromatase and cytochrome P450 1B1 (CYP1B1) enzymes; however down-regulated the expression of catechol-o-methyltransferase (COMT) enzyme. These data indicate that leptin-induced proliferative effect in prostate cells might be partly attributed to estrogen metabolism. Thus, leptin might be a novel target for therapeutic intervention in prostatic disorders. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. The HGF Receptor c-Met Is Overexpressed in Esophageal Adenocarcinoma1

    PubMed Central

    Herrera, Luis J; El-Hefnawy, Talal; Queiroz de Oliveira, Pierre E; Raja, Siva; Finkelstein, Sydney; Gooding, William; Luketich, James D; Godfrey, Tony E; Hughes, Steven J

    2005-01-01

    Abstract The hepatocyte growth factor (HGF) receptor, Met, has established oncogenic properties; however, its expression and function in esophageal adenocarcinoma (EA) remain poorly understood. We aimed to determine the expression and potential alterations in Met expression in EA. Met expression was investigated in surgical specimens of EA, Barrett's esophagus (BE), and normal esophagus (NE) using immunohistochemistry (IHC) and quantitative reverse transcriptase polymerase chain reaction. Met expression, phosphorylation, and the effect of COX-2 inhibition on expression were examined in EA cell lines. IHC demonstrated intense Met immunoreactivity in all (100%) EA and dysplastic BE specimens. In contrast, minimal immunostaining was observed in BE without dysplasia or NE specimens. Met mRNA and protein levels were increased in three EA cell lines, and Met protein was phosphorylated in the absence of serum. Sequence analysis found the kinase domain of c-met to be wild type in all three EA cell lines. HGF mRNA expression was identified in two EA cell lines. In COX-2-overexpressing cells, COX-2 inhibition decreased Met expression. Met is consistently overexpressed in EA surgical specimens and in three EA cell lines. Met dysregulation occurs early in Barrett's dysplasia to adenocarcinoma sequence. Future study of Met inhibition as a potential biologic therapy for EA is warranted. PMID:15720819

  20. Polycyclic aromatic hydrocarbon-induced CYP1B1 activity is suppressed by perillyl alcohol in MCF-7 cells.

    PubMed

    Chan, Nelson L S; Wang, Huan; Wang, Yun; Leung, Hau Yi; Leung, Lai K

    2006-06-01

    Perillyl alcohol (POH) is a dietary monoterpene with potential applications in chemoprevention and chemotherapy. Although clinical trials are under way, POH's physiological and pharmacological properties are still unclear. In the present study, the effect of POH on polycyclic aromatic hydrocarbon (PAH)-induced genotoxicity, and the related expression were examined in MCF-7 cells. Exposure to environmental toxicant increases the risk of cancer. Many of these compounds are pro-carcinogens and are biotransformed into their ultimate genotoxic structures by xenobiotic metabolizing enzymes. CYP1A1 and 1B1 are enzymes that catalyze the biotransformation of dimethylbenz[a]anthracene (DMBA). Our data revealed that 0.5 microM of POH was effective in blocking DMBA-DNA binding. Ethoxyresorufin-O-deethylase (EROD) assay indicated that the administration of POH inhibited the DMBA-induced enzyme activity in MCF-7 cells. Enzyme kinetic analysis revealed that POH inhibited CYP1B1 but not CYP1A1 activity. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) assay also demonstrated that the monoterpene reduced CYP1B1 mRNA abundance induced by DMBA. The present study illustrated that POH might inhibit and downregulate CYP1B1, which could protect against PAH-induced carcinogenesis.

  1. Stable Reference Gene Selection for RT-qPCR Analysis in Nonviruliferous and Viruliferous Frankliniella occidentalis

    PubMed Central

    Pan, Huipeng; Ma, Yabin; Zhang, Deyong; Liu, Yong; Zhang, Zhanhong; Zheng, Changying; Chu, Dong

    2015-01-01

    Reverse transcriptase-quantitative polymerase chain reaction (RT-qPCR) is a reliable technique for measuring and evaluating gene expression during variable biological processes. To facilitate gene expression studies, normalization of genes of interest relative to stable reference genes is crucial. The western flower thrips Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae), the main vector of tomato spotted wilt virus (TSWV), is a destructive invasive species. In this study, the expression profiles of 11 candidate reference genes from nonviruliferous and viruliferous F. occidentalis were investigated. Five distinct algorithms, geNorm, NormFinder, BestKeeper, the ΔC t method, and RefFinder, were used to determine the performance of these genes. geNorm, NormFinder, BestKeeper, and RefFinder identified heat shock protein 70 (HSP70), heat shock protein 60 (HSP60), elongation factor 1 α, and ribosomal protein l32 (RPL32) as the most stable reference genes, and the ΔC t method identified HSP60, HSP70, RPL32, and heat shock protein 90 as the most stable reference genes. Additionally, two reference genes were sufficient for reliable normalization in nonviruliferous and viruliferous F. occidentalis. This work provides a foundation for investigating the molecular mechanisms of TSWV and F. occidentalis interactions. PMID:26244556

  2. Isolation and characterization of a FLOWERING LOCUS T homolog from pineapple (Ananas comosus (L.) Merr).

    PubMed

    Lv, LingLing; Duan, Jun; Xie, JiangHui; Wei, ChangBin; Liu, YuGe; Liu, ShengHui; Sun, GuangMing

    2012-09-01

    FLOWERING LOCUS T (FT)-like genes are crucial regulators of flowering in angiosperms. A homolog of FT, designated as AcFT (GenBank ID: HQ343233), was isolated from pineapple cultivar Comte de Paris by reverse transcriptase polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). The cDNA sequence of AcFT is 915 bp in length and contains an ORF of 534 bp, which encodes a protein of 177 aa. Molecular weight was 19.9 kDa and isoelectric point was 6.96. The deduced protein sequence of AcFT was 84% and 82% identical to homologs encoded by CgFT in Cymbidium goeringii and OgFT in Oncidium Gower Ramsey respectively. Quantitative real-time PCR (qRT-PCR) analyses showed that the expression of AcFT was high in flesh and none in leaves. qRT-PCR analyses in different stages indicated that the expression of AcFT reached the highest level on 40 d after flower inducing, when the multiple fruit and floral organs were forming. The 35S::AcFT transgenic Arabidopsis plants flowered earlier and had more inflorescences or branches than wild type plants. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Characterization and expression profiles of MaACS and MaACO genes from mulberry (Morus alba L.)*

    PubMed Central

    Liu, Chang-ying; Lü, Rui-hua; Li, Jun; Zhao, Ai-chun; Wang, Xi-ling; Diane, Umuhoza; Wang, Xiao-hong; Wang, Chuan-hong; Yu, Ya-sheng; Han, Shu-mei; Lu, Cheng; Yu, Mao-de

    2014-01-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) and 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) are encoded by multigene families and are involved in fruit ripening by catalyzing the production of ethylene throughout the development of fruit. However, there are no reports on ACS or ACO genes in mulberry, partly because of the limited molecular research background. In this study, we have obtained five ACS gene sequences and two ACO gene sequences from Morus Genome Database. Sequence alignment and phylogenetic analysis of MaACO1 and MaACO2 showed that their amino acids are conserved compared with ACO proteins from other species. MaACS1 and MaACS2 are type I, MaACS3 and MaACS4 are type II, and MaACS5 is type III, with different C-terminal sequences. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) expression analysis showed that the transcripts of MaACS genes were strongly expressed in fruit, and more weakly in other tissues. The expression of MaACO1 and MaACO2 showed different patterns in various mulberry tissues. MaACS and MaACO genes demonstrated two patterns throughout the development of mulberry fruit, and both of them were strongly up-regulated by abscisic acid (ABA) and ethephon. PMID:25001221

  4. Up-regulation of proproliferative genes and the ligand/receptor pair placental growth factor and vascular endothelial growth factor receptor 1 in hepatitis C cirrhosis.

    PubMed

    Huang, Xiao X; McCaughan, Geoffrey W; Shackel, Nicholas A; Gorrell, Mark D

    2007-09-01

    Cirrhosis can lead to hepatocellular carcinoma (HCC). Non-diseased liver and hepatitis C virus (HCV)-associated cirrhosis with or without HCC were compared. Proliferation pathway genes, immune response genes and oncogenes were analysed by a quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and immunostaining. Real-time RT-PCR showed up-regulation of genes in HCV cirrhosis including the proliferation-associated genes bone morphogenetic protein 3 (BMP3), placental growth factor 3 (PGF3), vascular endothelial growth factor receptor 1 (VEGFR1) and soluble VEGFR1, the oncogene FYN, and the immune response-associated genes toll-like receptor 9 (TLR9) and natural killer cell transcript 4 (NK4). Expressions of TLR2 and the oncogenes B-cell CLL/lymphoma 9 (BCL9) and PIM2 were decreased in HCV cirrhosis. In addition, PIM2 and TLR2 were increased in HCV cirrhosis with HCC compared with HCV cirrhosis. The ligand/receptor pair PGF and VEGFR1 was intensely expressed by the portal tract vascular endothelium. VEGFR1 was expressed in reactive biliary epithelial structures in fibrotic septum and in some stellate cells and macrophages. PGF and VEGFR1 may have an important role in the pathogenesis of the neovascular response in cirrhosis.

  5. Identification and validation of reference genes for qRT-PCR studies of the obligate aphid pathogenic fungus Pandora neoaphidis during different developmental stages.

    PubMed

    Zhang, Shutao; Chen, Chun; Xie, Tingna; Ye, Sudan

    2017-01-01

    The selection of stable reference genes is a critical step for the accurate quantification of gene expression. To identify and validate the reference genes in Pandora neoaphidis-an obligate aphid pathogenic fungus-the expression of 13classical candidate reference genes were evaluated by quantitative real-time reverse transcriptase polymerase chain reaction(qPCR) at four developmental stages (conidia, conidia with germ tubes, short hyphae and elongated hyphae). Four statistical algorithms, including geNorm, NormFinder, BestKeeper and Delta Ct method were used to rank putative reference genes according to their expression stability and indicate the best reference gene or combination of reference genes for accurate normalization. The analysis of comprehensive ranking revealed that ACT1and 18Swas the most stably expressed genes throughout the developmental stages. To further validate the suitability of the reference genes identified in this study, the expression of cell division control protein 25 (CDC25) and Chitinase 1(CHI1) genes were used to further confirm the validated candidate reference genes. Our study presented the first systematic study of reference gene(s) selection for P. neoaphidis study and provided guidelines to obtain more accurate qPCR results for future developmental efforts.

  6. HSV2 acute retinal necrosis: diagnosis and monitoring with quantitative polymerase chain reaction.

    PubMed

    Cottet, L; Kaiser, L; Hirsch, H H; Baglivo, E

    2009-06-01

    To describe a case of HSV2 acute retinal necrosis (ARN) diagnosed and monitored with quantitative polymerase chain reaction (PCR) in ocular fluids. Case report. Quantitative PCR was performed in the aqueous humor (AH) and vitreous using primers specific for herpes virus. A positive PCR was found for HSV2 in the AH (>100,000,000 viral copies - 8.00 log/ml). After therapy, another anterior chamber tap showed a reduction of the viral load at 4.28 log/ml (19205 copies), confirming the efficacy of the treatment. After six months, PCR on the vitreous still showed the presence of HSV2 viral particles in the eye (3.14 log DNA copies/ml, 1379 copies) although the lesion was healed. This case demonstrates that PCR is useful to detect viral DNA in AH and vitreous and to monitor viral activity and therapeutic response. Viral DNA persists in ocular fluids for months in the presence of a healed infection.

  7. Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

    PubMed

    Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

    2016-04-01

    Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

  8. Selection of internal reference genes for normalization of reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis in the rumen epithelium

    USDA-ARS?s Scientific Manuscript database

    The rumen is lined on the luminal side by a stratified squamous epithelium that is responsible for not only absorption, but also transport, extensive short-chain fatty acid (SCFA) metabolism and protection. Butyrate has been demonstrated to initiate the differentiation of the tissue following intro...

  9. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis. © 2015 Wiley Periodicals, Inc.

  10. Detection of medically important Candida species by absolute quantitation real-time polymerase chain reaction.

    PubMed

    Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong

    2015-01-01

    The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.

  11. Quantitative analysis of pork and chicken products by droplet digital PCR.

    PubMed

    Cai, Yicun; Li, Xiang; Lv, Rong; Yang, Jielin; Li, Jian; He, Yuping; Pan, Liangwen

    2014-01-01

    In this project, a highly precise quantitative method based on the digital polymerase chain reaction (dPCR) technique was developed to determine the weight of pork and chicken in meat products. Real-time quantitative polymerase chain reaction (qPCR) is currently used for quantitative molecular analysis of the presence of species-specific DNAs in meat products. However, it is limited in amplification efficiency and relies on standard curves based Ct values, detecting and quantifying low copy number target DNA, as in some complex mixture meat products. By using the dPCR method, we find the relationships between the raw meat weight and DNA weight and between the DNA weight and DNA copy number were both close to linear. This enabled us to establish formulae to calculate the raw meat weight based on the DNA copy number. The accuracy and applicability of this method were tested and verified using samples of pork and chicken powder mixed in known proportions. Quantitative analysis indicated that dPCR is highly precise in quantifying pork and chicken in meat products and therefore has the potential to be used in routine analysis by government regulators and quality control departments of commercial food and feed enterprises.

  12. Molecular epidemiology of human metapneumovirus in Ireland.

    PubMed

    Carr, Michael J; Waters, Allison; Fenwick, Fiona; Toms, Geoffrey L; Hall, William W; O'Kelly, Edwin

    2008-03-01

    Human metapneumovirus (hMPV) is a cause of respiratory illness ranging from wheezing to bronchiolitis and pneumonia in children. A quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) assay was developed for the detection of all four main genetic lineages of hMPV and employed to validate an indirect immunofluorescence (IF) assay to detect hMPV positive specimens. The IF assay detected 24 positives from a screen of 625 randomly selected pediatric respiratory specimens collected (3.8% prevalence). From this cohort of 625 specimens, 229 were also tested by real-time RT-PCR assay. This included the 24 IF positive specimens and 205 randomly selected specimens from both study periods. In addition to confirming all the IF positives, the real-time assay detected an additional six hMPV positive specimens giving rise to a combined prevalence of 4.8%. Phylogenetic analysis showed that hMPV subtypes A2b and B2 to be the most prevalent genotypes circulating in our population and surprisingly no hMPV subgroups A1 or B1 were detected during this study period. Based on this phylogenetic analysis, we propose the existence of sub-clusters of hMPV genotype B2 present in our population which we term subtypes B2a and B2b. The mean log 10 copies/ml of quantitative RT-PCR determinations from these 30 hMPV positive respiratory specimens was 6.35 (range = 4.44-8.15). Statistical analysis of quantitative RT-PCR determinations of viral load from these 30 respiratory specimens suggests that hMPV genotype B specimens have a higher viral load than hMPV genotype A isolates (P < 0.03).

  13. The role of phenylalanine-119 of the reverse transcriptase of mouse mammary tumour virus in DNA synthesis, ribose selection and drug resistance.

    PubMed

    Entin-Meer, Michal; Sevilya, Ziv; Hizi, Amnon

    2002-10-15

    Phe-119 in the reverse transcriptase (RT) of mouse mammary tumour virus (MMTV) is homologous with Tyr-115 in HIV type 1 (HIV-1) RT and to Phe-155 in murine leukaemia virus (MLV) RT. By mutating these residues in HIV-1 and MLV RTs (which are strict DNA polymerases) the enzymes were shown to function also as RNA polymerases. Owing to the uniqueness of MMTV as a type B retrovirus, we have generated a Phe-119-Val mutant of MMTV RT to study the involvement of this residue in affecting the catalytic features of this RT. The data presented here show that the mutant MMTV RT can incorporate both deoxyribonucleosides and ribonucleosides while copying either RNA or DNA. In addition, this mutant RT shows resistance to nucleoside analogues and an enhanced fidelity of DNA synthesis; all relative to the wild-type enzyme. The Phe-119-Val mutant is also different from the wild-type enzyme in its preference for most template primers tested and in its ability to synthesize DNA under non-processive and processive conditions. Overall, it is likely that the aromatic side chain of Phe-119 is located at the dNTP-binding site of MMTV RT and thus might be part of a putative "steric gate" that prevents the incorporation of nucleoside triphosphates. Since the only three-dimensional structures of RTs published so far are those of HIV-1 and MLV, it is likely that MMTV RT folds quite similarly to these RTs.

  14. Emergence of a replicating species from an in vitro RNA evolution reaction

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.

    1994-01-01

    The technique of self-sustained sequence replication allows isothermal amplification of DNA and RNA molecules in vitro. This method relies on the activities of a reverse transcriptase and a DNA-dependent RNA polymerase to amplify specific nucleic acid sequences. We have modified this protocol to allow selective amplification of RNAs that catalyze a particular chemical reaction. During an in vitro RNA evolution experiment employing this modified system, a unique class of "selfish" RNAs emerged and replicated to the exclusion of the intended RNAs. Members of this class of selfish molecules, termed RNA Z, amplify efficiently despite their inability to catalyze the target chemical reaction. Their amplification requires the action of both reverse transcriptase and RNA polymerase and involves the synthesis of both DNA and RNA replication intermediates. The proposed amplification mechanism for RNA Z involves the formation of a DNA hairpin that functions as a template for transcription by RNA polymerase. This arrangement links the two strands of the DNA, resulting in the production of RNA transcripts that contain an embedded RNA polymerase promoter sequence.

  15. Detection of the Single Nucleotide Polymorphism at Position rs2735940 in the Human Telomerase Reverse Transcriptase Gene by the Introduction of a New Restriction Enzyme Site for the PCR-RFLP Assay.

    PubMed

    Wang, Sihua; Ding, Mingcui; Duan, Xiaoran; Wang, Tuanwei; Feng, Xiaolei; Wang, Pengpeng; Yao, Wu; Wu, Yongjun; Yan, Zhen; Feng, Feifei; Yu, Songcheng; Wang, Wei

    2017-09-01

    It has been shown that the single nucleotide polymorphism (SNP) of the rs2735940 site in the human telomerase reverse transcriptase ( hTERT ) gene is associated with increased cancer risk. The traditional method to detect SNP genotypes is polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). However, there is a limitation to utilizing PCR-RFLP due to a lack of proper restriction enzyme sites at many polymorphic loci. This study used an improved PCR-RFLP method with a mismatched base for detection of the SNP rs2735940. A new restriction enzyme cutting site was created by created restriction site PCR (CRS-PCR), and in addition, the restriction enzyme Msp I for CRS-PCR was cheaper than other enzymes. We used this novel assay to determine the allele frequencies in 552 healthy Chinese Han individuals, and found the allele frequencies to be 63% for allele C and 37% for allele T In summary, the modified PCR-RFLP can be used to detect the SNP of rs2735940 with low cost and high efficiency. © 2017 by the Association of Clinical Scientists, Inc.

  16. Human-Associated Fecal Quantitative Polymerase Chain ReactionMeasurements and Simulated Risk of Gastrointestinal Illness in Recreational Waters Contaminated with Raw Sewage

    EPA Science Inventory

    We used quantitative microbial risk assessment (QMRA) to estimate the risk of gastrointestinal (GI) illness associated with swimming in recreational waters containing different concentrations of human-associated fecal qPCR markers from raw sewage– HF183 and HumM2. The volume/volu...

  17. Optimisation of techniques for quantification of Botrytis cinerea in grape berries and receptacles by quantitative polymerase chain reaction

    USDA-ARS?s Scientific Manuscript database

    Quantitative PCR (qPCR) can be used to detect and monitor pathogen colonization, but early attempts to apply the technology to Botrytis cinerea infection of grape berries have identified limitations to current techniques. In this study, four DNA extraction methods, two grinding methods, two grape or...

  18. COMPARISON OF POPULATIONS OF MOULD SPECIES IN HOMES IN THE UK AND US USING MOLD-SPECIFIC QUANTITATIVE PCR (MSQPCR)

    EPA Science Inventory

    The goal of this research was to compare the populations of 81 mold species in homes in USA and UK using mould specific quantitative polymerase chain reaction (MSQPCR) technology. Dust samples were obtained from randomly selected homes in Great Britain (n=11). The mould populat...

  19. COMPARISON OF ENTEROCOCCUS MEASUREMENTS IN FRESHWATER AT TWO RECREATIONAL BEACHES BY QUANTITATIVE POLYMERASE CHAIN REACTION AND MEMBRANE FILER CULTURE ANALYSIS

    EPA Science Inventory

    Cell densities of the fecal pollution indicator genus, Enterococcus, were determined by a rapid (2-3 hr) quantitative PCR (QPCR) analysis based method in 100 ml water samples collected from recreational beaches on Lake Michigan and Lake Erie during the summer of 2003. Enumeration...

  20. Development of a non invasion real-time PCR assay for the quantitation of chicken parvovirus in fecal swabs

    USDA-ARS?s Scientific Manuscript database

    The present study describes the development of a real time Taqman polymerase chain reaction (PCR) assay using a fluorescent labeled probe for the detection and quantitation of chicken parvovirus (ChPV) in feces. The primers and probes were designed based on the nucleotide sequence of the non struct...

  1. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  2. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  3. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    PubMed

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  4. International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

    PubMed

    Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

    2015-05-27

    This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

  5. Brief ultrasonication improves detection of biofilm-formative bacteria around a metal implant.

    PubMed

    Kobayashi, Naomi; Bauer, Thomas W; Tuohy, Marion J; Fujishiro, Takaaki; Procop, Gary W

    2007-04-01

    Biofilms are complex microenvironments produced by microorganisms on surfaces. Ultrasonication disrupts biofilms and may make the microorganism or its DNA available for detection. We determined whether ultrasonication could affect our ability to detect bacteria adherent to a metal substrate. A biofilm-formative Staphylococcus aureus strain was used for an in vitro implant infection model (biofilm-formative condition). We used quantitative culture and real time-polymerase chain reaction to determine the influence of different durations of ultrasound on bacterial adherence and viability. Sonication for 1 minute increased the yield of bacteria. Sonication longer than 5 minutes led to fewer bacterial colonies by conventional culture but not by polymerase chain reaction. This suggests short periods of sonication help release bacteria from the metal substrate by disrupting the biofilm, but longer periods of sonication lyse bacteria prohibiting their detection in microbiologic cultures. A relatively short duration of sonication may be desirable for maximizing detection of biofilm-formative bacteria around implants by culture or polymerase chain reaction.

  6. The Discovery of Reverse Transcriptase.

    PubMed

    Coffin, John M; Fan, Hung

    2016-09-29

    In 1970 the independent and simultaneous discovery of reverse transcriptase in retroviruses (then RNA tumor viruses) by David Baltimore and Howard Temin revolutionized molecular biology and laid the foundations for retrovirology and cancer biology. In this historical review we describe the formulation of the controversial provirus hypothesis by Temin, which ultimately was proven by his discovery of reverse transcriptase in Rous sarcoma virus virions. Baltimore arrived at the same discovery through his studies on replication of RNA-containing viruses, starting with poliovirus and then moving to vesicular stomatitis virus, where he discovered a virion RNA polymerase. Subsequent studies of reverse transcriptase led to the elucidation of the mechanism of retrovirus replication, the discovery of oncogenes, the advent of molecular cloning, the search for human cancer viruses, and the discovery and treatment of HIV/AIDS.

  7. Peroxisome proliferator-activated receptor delta (PPARdelta) activation protects H9c2 cardiomyoblasts from oxidative stress-induced apoptosis.

    PubMed

    Pesant, Matthieu; Sueur, Stéphanie; Dutartre, Patrick; Tallandier, Mireille; Grimaldi, Paul A; Rochette, Luc; Connat, Jean-Louis

    2006-02-01

    Activation of peroxisome proliferator-activated receptor alpha (PPARalpha) and PPARgamma plays beneficial roles in cardiovascular disorders such as atherosclerosis and heart reperfusion. Although PPARalpha and gamma have been documented to reduce oxidative stress in the vasculature and the heart, the role of PPARdelta remains poorly studied. We focused on PPARdelta function in the regulation of oxidative stress-induced apoptosis in the rat cardiomyoblast cell line H9c2. Using semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we showed that PPARdelta is the predominantly expressed isotype whereas PPARalpha was weakly detected. By performing cell viability assays, we also showed that the selective PPARdelta agonist GW501516 protected cells from H(2)O(2)-induced cell death. The protective effect of GW501516 was due to an inhibition of H(2)O(2)-triggered apoptosis as shown by annexin-V labeling, DNA fragmentation analysis, and caspase-3 activity measurement. We demonstrated by transient transfection of a dominant negative mutant of PPARdelta that the protection induced by GW501516 was totally dependent on PPARdelta. Semi-quantitative RT-PCR and Western blotting analysis demonstrated that GW501516 treatment upregulated catalase. Moreover, forced overexpression of catalase inhibited H(2)O(2)-triggered apoptosis, as evidenced by annexin-V labeling. Taken together, our results account for an important role of PPARdelta in inhibiting the onset of oxidative stress-induced apoptosis in H9c2 cells. PPARdelta appears to be a new therapeutic target for the regulation of heart reperfusion-associated oxidative stress and stimulation of enzymatic antioxidative defences.

  8. Molecular detection of mixed infections with multiple dengue virus serotypes in suspected dengue samples in Tamaulipas, Mexico.

    PubMed

    Requena-Castro, Rocío; Reyes-López, Miguel Ángel; Rodríguez-Reyna, Rosa Eminé; Palma-Nicolás, Prisco; Bocanegra-García, Virgilio

    2017-07-01

    This study aimed to detect dengue virus (DENV) serotypes in serum samples obtained in Matamoros Tamaulipas, Mexico, and to determine the concordance of conventional nested reverse transcriptase polymerase chain reaction (RT-PCR) and a serological test [enzyme-linked immunosorbent assay (ELISA NS1)]. Here, we detected mixed infections consisting of four serotypes of DENV. The most prevalent serotype was DENV-1, followed by DENV-4. This is the first report of DENV-4 in our region. Mixed infections were also detected in 21.5% of samples, and the predominant coinfection consisted of DENV-1 and DENV-2. Therefore, continuous epidemiological surveillance of DENV in this area is required to predict future forms of dengue heterologous infections and the effect of this on health care.

  9. Prolonged excretion of a low-pathogenicity H5N2 avian influenza virus strain in the Pekin duck

    PubMed Central

    Carranza-Flores, José Manuel; Padilla-Noriega, Luis; Loza-Rubio, Elizabeth

    2013-01-01

    H5N2 strains of low-pathogenicity avian influenza virus (LPAIV) have been circulating for at least 17 years in some Mexican chicken farms. We measured the rate and duration of viral excretion from Pekin ducks that were experimentally inoculated with an H5N2 LPAIV that causes death in embryonated chicken eggs (A/chicken/Mexico/2007). Leghorn chickens were used as susceptible host controls. The degree of viral excretion was evaluated with real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) using samples from oropharyngeal and cloacal swabs. We observed prolonged excretion from both species of birds lasting for at least 21 days. Prolonged excretion of LPAIV A/chicken/Mexico/2007 is atypical. PMID:23820212

  10. Investigation of the presence of human or bovine respiratory syncytial virus in the lungs of mink (Neovison vison) with hemorrhagic pneumonia due to Pseudomonas aeruginosa.

    PubMed

    Salomonsen, Charlotte M; Breum, Solvej Ø; Larsen, Lars E; Jakobsen, Jeanette; Høiby, Niels; Hammer, Anne S

    2012-11-26

    Hemorrhagic pneumonia is a disease of farmed mink (Neovison vison) caused by Pseudomonas aeruginosa. The disease is highly seasonal in Danish mink with outbreaks occurring almost exclusively in the autumn. Human respiratory syncytial virus (RSV) has been shown to augment infection with P. aeruginosa in mice and to promote adhesion of P. aeruginosa to human respiratory cells. We tested 50 lung specimens from mink with hemorrhagic pneumonia for bovine RSV by reverse transcriptase polymerase chain reaction (PCR) and for human RSV by a commercial real-time PCR. RSV was not found. This study indicates that human and bovine RSV is not a major co-factor for development of hemorrhagic pneumonia in Danish mink.

  11. The molecular genetic basis of mitochondrial malfunction in bladder tissue following outlet obstruction.

    PubMed

    Levin, Robert M; Hudson, Alan P

    2004-08-01

    Bladder dysfunction following partial outlet obstruction is a frequent consequence of benign prostatic hyperplasia and an increasingly common problem given the aging of the general population. Recent studies from this and other groups have begun to elucidate the molecular bases for the well described physiological malfunctions that characterize this clinical entity. We summarized and synthesized that information. Using modern methods of molecular genetics, including real-time polymerase chain reaction, real-time reverse transcriptase-polymerase chain reaction and others, as well as traditional experimental techniques such as electron microscopy we and others examined the transcriptional profile, morphology, etc of bladder smooth muscle mitochondria in experimental models of outlet obstruction. Data from many studies have demonstrated that aberrant gene expression in the mitochondrial and mitochondria related nuclear genetic systems underlies the loss of compliance and other attributes of bladder dysfunction following outlet obstruction. Such aberrant transcriptional characteristics engender loss of function in the electron transport and oxidative phosphorylation systems. Morphological studies of mitochondria in the animal model systems support this conclusion. In large part the loss of function in bladder smooth muscle following outlet obstruction results from the attenuation of mitochondrial energy production. In this article we reviewed and synthesized all available experimental observations relevant to this problem and we suggest future lines of inquiry that should prove fruitful in developing new strategies to treat the condition.

  12. Development of a reverse transcription polymerase chain reaction method for yellow fever virus detection.

    PubMed

    Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A

    2013-09-01

    Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.

  13. Establishment of a new human pre-B acute lymphoblastic leukemia cell line (KMO-90) with 1;19 translocation carrying p53 gene alterations.

    PubMed

    Sotomatsu, M; Hayashi, Y; Kawamura, M; Yugami, S; Shitara, T

    1993-10-01

    A new human pre-B acute lymphoblastic leukemia cell line (KMO-90) was established from the bone marrow sample of a 12-year-old girl with acute lymphoblastic leukemia (ALL) carrying 1;19 chromosome translocation. KMO-90 cells expressed HLA-DR, CD10, CD19, and CD22 antigens. These cells had also cytoplasmic immunoglobulin lacking surface immunoglobulin, indicating that these had a pre-B phenotype. Chromosome analysis of this cell line showed 48, XX, +8, +19, t(1;19)(q23;p13). Southern blot analysis showed the same sized rearrangements of the E2A gene in KMO-90 cells as those in the original leukemic cells. By means of reverse transcriptase-polymerase chain reaction analysis, we detected E2A/PBX1 fusion transcripts in KMO-90 cells. KMO-90 is useful when studying the role of the 1;19 translocation in the etiology of pre-B ALL. Furthermore, we studied alterations of the p53 gene in this cell line by polymerase chain reaction, single-strand conformation polymorphism analysis. KMO-90 cells were identified to have a point mutation at codon 177 (CCC-->TCC) of the p53 gene, suggesting that alterations of the p53 gene may have an important role in the establishment of this cell line.

  14. Matrix metalloprotease-3 expression in the medial plica and pannus-like tissue in knees from patients with medial compartment osteoarthritis.

    PubMed

    Wang, Hwai-Shi; Kuo, Pei-Yin; Yang, Chih-Chang; Lyu, Shaw-Ruey

    2011-03-01

    The severity of cartilage degeneration is positively correlated with the severity of the pathologic change of medial plica. However, knowledge of the pathogenic mechanisms and the impact of plica on cartilage destruction is limited. The aim of the present study was therefore to investigate matrix metalloprotease-3 (MMP-3) expression in the plica isolated from patients with medial compartment osteoarthritis of the knee. Immunohistochemistry showed that MMP-3 was highly expressed in pannus-like tissue and the plica. Western blotting of culture supernatants showed that interleukin-1β (IL-1β) treatment induced MMP-3 release by cells isolated from pannus tissue or the plica. Furthermore, reverse transcriptase polymerase chain reaction and real-time polymerase chain reaction analysis showed that MMP-3 mRNA levels were increased after IL-1β treatment of the cultured cells. MMP-3 and IL-1β mRNAs were expressed in the plica and pannus-like tissue, with MMP-3 mRNA being expressed at significantly higher levels in the plica than in normal synovial membrane and highly expressed in the plica at different stages in osteoarthritis (OA) patients. Pannus-like tissue and the plica express IL-1β and MMP-3. Moreover, MMP-3 mRNA and protein expression in the plica may contribute to the pathogenesis of OA. © 2011 Blackwell Publishing Limited.

  15. Signal-boosted qualitative ultrasensitive p24 antigen assay for diagnosis of subtype C HIV-1 infection in infants under the age of 2 years.

    PubMed

    Zijenah, Lynn S; Tobaiwa, Ocean; Rusakaniko, Simbarashe; Nathoo, Kusum J; Nhembe, Margaret; Matibe, Petronella; Katzenstein, David A

    2005-08-01

    The gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. However, these tests are expensive and therefore not available in resource-limited countries. With the increasing availability of antiretroviral drugs for prevention of mother-to-child transmission of HIV and treatment of AIDS in resource-poor countries, there is an urgent need to develop cheaper, alternative, and cost-effective laboratory methods for early diagnosis of infant HIV-1 infection that will be useful in identifying infected infants who may benefit from early cotrimoxazole prophylaxis or commencement of antiretroviral therapy. We evaluated an alternative method, the enzyme-linked immunosorbent assay-based qualitative ultrasensitive p24 antigen assay for diagnosis of subtype C HIV-1 infection in infants under the age of 2 years using DNA polymerase chain reaction as the reference method. The assay showed a sensitivity of 96.7% (95% CI: 93.0-100) for detection of HIV-1 infection among infants 0-18 months of age with a specificity of 96.1% (95% CI: 91.7-100). These evaluated parameters were not statistically different between infants aged 0-6 and 7-18 months. The ultrasensitive p24 antigen assay is a useful diagnostic test for detection of HIV-1 infection among infants aged 0-18 months.

  16. Using the rate of bacterial clearance determined by real-time polymerase chain reaction as a timely surrogate marker to evaluate the appropriateness of antibiotic usage in critical patients with Acinetobacter baumannii bacteremia.

    PubMed

    Chuang, Yu-Chung; Chang, Shan-Chwen; Wang, Wei-Kung

    2012-08-01

    Bacteremia caused by Acinetobacter baumannii is becoming more frequent among critically ill patients, and has been associated with high mortality and prolonged hospital stay. Multidrug resistance and delay in blood culture have been shown to be significant barriers to appropriate antibiotic treatment. Quantitative polymerase chain reaction assays were recently used to monitor bacterial loads; we hypothesized that the rate of bacterial clearance determined by quantitative polymerase chain reaction can be used as a timely surrogate marker to evaluate the appropriateness of antibiotic usage. Prospective observational study. University hospital and research laboratory. Patients with culture-proven A. baumannii bacteremia in the intensive care units were prospectively enrolled from April 2008 to February 2009. Plasmid Oxa-51/pCRII-TOPO, which contained a 431-bp fragment of the A. baumannii-specific Oxa-51 gene in a pCRII-TOPO vector, was used as the standard. Sequential bacterial DNA loads in the blood were measured by a quantitative polymerase chain reaction assay. We enrolled 51 patients with A. baumannii bacteremia, and examined 318 sequential whole blood samples. The initial mean bacterial load was 2.15 log copies/mL, and the rate of bacterial clearance was 0.088 log copies/mL/day. Multivariate linear regression using the generalized estimation equation approach revealed that the use of immunosuppressants was an independent predictor for slower bacterial clearance (coefficient, 1.116; p<.001), and appropriate antibiotic usage was an independent predictor for more rapid bacterial clearance (coefficient, -0.995; p<.001). Patients with a slower rate of bacterial clearance experienced higher in-hospital mortality (odds ratio, 2.323; p=.04) Immunosuppression and appropriate antibiotic usage were independent factors affecting the rate of clearance of A. baumannii bacteremia in critical patients. These findings highlight the importance of appropriate antibiotic usage and development of effective antibiotics against A. baumannii in an era of emerging antibiotic resistance. The rate of bacterial clearance could serve as a timely surrogate marker for evaluating the appropriateness of antibiotics.

  17. Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies.

    PubMed

    Tricarico, Carmela; Pinzani, Pamela; Bianchi, Simonetta; Paglierani, Milena; Distante, Vito; Pazzagli, Mario; Bustin, Stephen A; Orlando, Claudio

    2002-10-15

    Careful normalization is essential when using quantitative reverse transcription polymerase chain reaction assays to compare mRNA levels between biopsies from different individuals or cells undergoing different treatment. Generally this involves the use of internal controls, such as mRNA specified by a housekeeping gene, ribosomal RNA (rRNA), or accurately quantitated total RNA. The aim of this study was to compare these methods and determine which one can provide the most accurate and biologically relevant quantitative results. Our results show significant variation in the expression levels of 10 commonly used housekeeping genes and 18S rRNA, both between individuals and between biopsies taken from the same patient. Furthermore, in 23 breast cancers samples mRNA and protein levels of a regulated gene, vascular endothelial growth factor (VEGF), correlated only when normalized to total RNA, as did microvessel density. Finally, mRNA levels of VEGF and the most popular housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were significantly correlated in the colon. Our results suggest that the use of internal standards comprising single housekeeping genes or rRNA is inappropriate for studies involving tissue biopsies.

  18. Novel Structure of Ty3 Reverse Transcriptase | Center for Cancer Research

    Cancer.gov

    Retrotransposons are mobile genetic elements that self amplify via a single-stranded RNA intermediate, which is converted to double-stranded DNA by an encoded reverse transcriptase (RT) with both DNA polymerase (pol) and ribonuclease H (RNase) activities. Categorized by whether they contain flanking long terminal repeat (LTR) sequences, retrotransposons play a critical role in the architecture of eukaryotic genomes and are the evolutionary origin of retroviruses, including human immunodeficiency virus (HIV).

  19. Micro-droplet Digital Polymerase Chain Reaction and Real-Time Quantitative Polymerase Chain Reaction Technologies Provide Highly Sensitive and Accurate Detection of Zika Virus.

    PubMed

    Hui, Yuan; Wu, Zhiming; Qin, Zhiran; Zhu, Li; Liang, Junhe; Li, Xujuan; Fu, Hanmin; Feng, Shiyu; Yu, Jianhai; He, Xiaoen; Lu, Weizhi; Xiao, Weiwei; Wu, Qinghua; Zhang, Bao; Zhao, Wei

    2018-06-01

    The establishment of highly sensitive diagnostic methods is critical in the early diagnosis and control of Zika virus (ZIKV) and in preventing serious neurological complications of ZIKV infection. In this study, we established micro-droplet digital polymerase chain reaction (ddPCR) and real-time quantitative PCR (RT-qPCR) protocols for the detection of ZIKV based on the amplification of the NS5 gene. For the ZIKV standard plasmid, the RT-qPCR results showed that the cycle threshold (Ct) value was linear from 10 1 to 10 8  copy/μL, with a standard curve R 2 of 0.999 and amplification efficiency of 92.203%; however, a concentration as low as 1 copy/μL could not be detected. In comparison with RT-qPCR, the ddPCR method resulted in a linear range of 10 1 -10 4  copy/μL and was able to detect concentrations as low as 1 copy/μL. Thus, for detecting ZIKV from clinical samples, RT-qPCR is a better choice for high-concentration samples (above 10 1  copy/μL), while ddPCR has excellent accuracy and sensitivity for low-concentration samples. These results indicate that the ddPCR method should be of considerable use in the early diagnosis, laboratory study, and monitoring of ZIKV.

  20. Synthesis, Activity and Structural Analysis of Novel α-Hydroxytropolone Inhibitors of Human Immunodeficiency Virus Reverse Transcriptase-Associated Ribonuclease H

    PubMed Central

    Chung, Suhman; Himmel, Daniel M.; Jiang, Jian-Kang; Wojtak, Krzysztof; Bauman, Joseph D.; Rausch, Jason W.; Wilson, Jennifer A.; Beutler, John A.; Thomas, Craig J.; Arnold, Eddy; Le Grice, Stuart F.J.

    2011-01-01

    The α-hydroxytroplone, manicol (5,7-dihydroxy-2-isopropenyl-9-methyl-1,2,3,4-tetrahydro-benzocyclohepten-6-one) potently and specifically inhibits ribonuclease H (RNase H) activity of human immunodeficiency virus reverse transcriptase (HIV RT) in vitro. However, manicol was ineffective in reducing virus replication in culture. Ongoing efforts to improve the potency and specificity over the lead compound led us to synthesize 14 manicol derivatives that retain the divalent metal-chelating α-hydroxytropolone pharmacophore. These efforts were augmented by a high resolution structure of p66/p51 HIV-1 RT containing the nonnucleoside reverse transcriptase inhibitor (NNRTI), TMC278 and manicol in the DNA polymerase and RNase H active sites, respectively. We demonstrate here that several modified α-hydroxytropolones exhibit antiviral activity at non-cytotoxic concentrations. Inclusion of RNase H active site mutants indicated that manicol analogs can occupy an additional site in or around the DNA polymerase catalytic center. Collectively, our studies will promote future structure-based design of improved α-hydroxytropolones to complement the NRTI and NNRTI currently in clinical use. PMID:21568335

  1. A novel quantitative real-time polymerase chain reaction method for detecting toxigenic Pasteurella multocida in nasal swabs from swine.

    PubMed

    Scherrer, Simone; Frei, Daniel; Wittenbrink, Max Michael

    2016-12-01

    Progressive atrophic rhinitis (PAR) in pigs is caused by toxigenic Pasteurella multocida. In Switzerland, PAR is monitored by selective culture of nasal swabs and subsequent polymerase chain reaction (PCR) screening of bacterial colonies for the P. multocida toxA gene. A panel of 203 nasal swabs from a recent PAR outbreak were used to evaluate a novel quantitative real-time PCR for toxigenic P. multocida in porcine nasal swabs. In comparison to the conventional PCR with a limit of detection of 100 genome equivalents per PCR reaction, the real-time PCR had a limit of detection of 10 genome equivalents. The real-time PCR detected toxA-positive P. multocida in 101 samples (49.8%), whereas the conventional PCR was less sensitive with 90 toxA-positive samples (44.3%). In comparison to the real-time PCR, 5.4% of the toxA-positive samples revealed unevaluable results by conventional PCR. The approach of culture-coupled toxA PCR for the monitoring of PAR in pigs is substantially improved by a novel quantitative real-time PCR.

  2. Development and accuracy of quantitative real-time polymerase chain reaction assays for detection and quantification of enterotoxigenic Escherichia coli (ETEC) heat labile and heat stable toxin genes in travelers' diarrhea samples.

    PubMed

    Youmans, Bonnie P; Ajami, Nadim J; Jiang, Zhi-Dong; Petrosino, Joseph F; DuPont, Herbert L; Highlander, Sarah K

    2014-01-01

    Enterotoxigenic Escherichia coli (ETEC), the leading bacterial pathogen of travelers' diarrhea, is routinely detected by an established DNA hybridization protocol that is neither sensitive nor quantitative. Quantitative real-time polymerase chain reaction (qPCR) assays that detect the ETEC toxin genes eltA, sta1, and sta2 in clinical stool samples were developed and tested using donor stool inoculated with known quantities of ETEC bacteria. The sensitivity of the qPCR assays is 89%, compared with 22% for the DNA hybridization assay, and the limits of detection are 10,000-fold lower than the DNA hybridization assays performed in parallel. Ninety-three clinical stool samples, previously characterized by DNA hybridization, were tested using the new ETEC qPCR assays. Discordant toxin profiles were observed for 22 samples, notably, four samples originally typed as ETEC negative were ETEC positive. The qPCR assays are unique in their sensitivity and ability to quantify the three toxin genes in clinical stool samples.

  3. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Quantitative competitive (QC) PCR for quantification of porcine DNA.

    PubMed

    Wolf, C; Lüthy, J

    2001-02-01

    Many meat products nowadays may contain several species in different proportions. To protect consumers from fraud and misdeclarations, not only a qualitative but also a quantitative monitoring of ingredients of complex food products is necessary. DNA based techniques like the polymerase chain reaction (PCR) are widely used for identification of species but no answer to the proportional amount of a certain species could be given using current techniques. In this study we report the development and evaluation of a quantitative competitive polymerase chain reaction (QC-PCR) for detection and quantification of porcine DNA using a new porcine specific PCR system based on the growth hormone gene of sus scrofa. A DNA competitor differing by 30 bp in length from the porcine target sequence was constructed and used for PCR together with the target DNA. Specificity of the new primers was evaluated with DNA from cattle, sheep, chicken and turkey. The competitor concentration was adjusted to porcine DNA contents of 2 or 20% by coamplification of mixtures containing porcine and corresponding amounts of bovine DNA in defined ratios.

  5. Extraordinary effects of specific monovalent cations on activation of reovirus transcriptase by chymotrypsin in vitro.

    PubMed

    Borsa, J; Sargent, M D; Long, D G; Chapman, J D

    1973-02-01

    Activation of reovirus transcriptase activity, latent in intact virions, by digestion of purified virions with chymotrypsin (CHT) in vitro shows a stringent requirement for specific monovalent cations. Cs(+), Rb(+), or K(+) ions are capable of facilitating activation by chymotryptic digestion. Na(+), Li(+), or NH(4) (+) ions are not capable of facilitating the CHT activation of polymerase activity and are antagonistic towards the effects of the facilitating ions. The data indicate that the effect of the cations is exerted on activation of the polymerase activity by CHT as opposed to an effect on polymerization per se. This effect may be important biologically in that it provides a mechanism whereby the virion can sense whether it is in an intracellular or an extracellular environment and thereby can avoid premature uncoating.

  6. Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

    PubMed Central

    Duan, L; Pomerantz, R J

    1994-01-01

    The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

  7. Delivery of Na/I symporter gene into skeletal muscle using nanobubbles and ultrasound: visualization of gene expression by PET.

    PubMed

    Watanabe, Yukiko; Horie, Sachiko; Funaki, Yoshihito; Kikuchi, Youhei; Yamazaki, Hiromichi; Ishii, Keizo; Mori, Shiro; Vassaux, Georges; Kodama, Tetsuya

    2010-06-01

    The development of nonviral gene delivery systems is essential in gene therapy, and the use of a minimally invasive imaging methodology can provide important clinical endpoints. In the current study, we present a new methodology for gene therapy-a delivery system using nanobubbles and ultrasound as a nonviral gene delivery method. We assessed whether the gene transfer allowed by this methodology was detectable by PET and bioluminescence imaging. Two kinds of reported vectors (luciferase and human Na/I symporter [hNIS]) were transfected or cotransfected into the skeletal muscles of normal mice (BALB/c) using the ultrasound-nanobubbles method. The kinetics of luciferase gene expression were analyzed in vivo using bioluminescence imaging. At the peak of gene transfer, PET of hNIS expression was performed using our recently developed PET scanner, after (124)I injection. The imaging data were confirmed using reverse-transcriptase polymerase chain reaction amplification, biodistribution, and a blocking study. The imaging potential of the 2 methodologies was evaluated in 2 mouse models of human pathology (McH/lpr-RA1 mice showing vascular disease and C57BL/10-mdx Jic mice showing muscular dystrophy). Peak luciferase gene activity was observed in the skeletal muscle 4 d after transfection. On day 2 after hNIS and luciferase cotransfection, the expression of these genes was confirmed by reverse-transcriptase polymerase chain reaction on a muscle biopsy. PET of the hNIS gene, biodistribution, the blocking study, and autoradiography were performed on day 4 after transfection, and it was indicated that hNIS expression was restricted to the site of plasmid administration (skeletal muscle). Similar localized PET and (124)I accumulation were successfully obtained in the disease-model mice. The hNIS gene was delivered into the skeletal muscle of healthy and disease-model mice by the ultrasound-nanobubbles method, and gene expression was successfully visualized with PET. The combination of ultrasound-nanobubble gene transfer and PET may be applied to gene therapy clinical protocols.

  8. miR-128 modulates chemosensitivity and invasion of prostate cancer cells through targeting ZEB1.

    PubMed

    Sun, Xianglun; Li, Youkong; Yu, Jie; Pei, Hong; Luo, Pengcheng; Zhang, Jie

    2015-05-01

    Recent reports strongly suggest the profound role of miRNAs in cancer therapeutic response and progression, including invasion and metastasis. The sensitivity to therapy and invasion is the major obstacle for successful treatment in prostate cancer. We aimed to investigate the regulative effect of miR-128/zinc-finger E-box-binding homeobox 1 axis on prostate cancer cell chemosensitivity and invasion. The miR-128 expression pattern of prostate cancer cell lines and tissues was detected by real-time reverse transcriptase-polymerase chain reaction, while the mRNA and protein expression levels of zinc-finger E-box-binding homeobox 1 were measured by real-time reverse transcriptase-polymerase chain reaction and western blot assay, respectively. Dual-luciferase reporter gene assay was used to find the direct target of miR-128. Furthermore, prostate cancer cells were treated with miR-128 mimic or zinc-finger E-box-binding homeobox 1-siRNA, and then the cells' chemosensitivity and invasion were detected by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and transwell assay, respectively. We found miR-128 expression obviously decreased in prostate cancer tissues compared with paired normal tissues. Restored miR-128 expression sensitized prostate cancer cells to cisplatin and inhibited the invasion. Furthermore, there was an inverse expression pattern between miR-128 and zinc-finger E-box-binding homeobox 1 in prostate cancer cells and tissues, and zinc-finger E-box-binding homeobox 1 was identified as a direct target of miR-128 in prostate cancer. Knockdown of zinc-finger E-box-binding homeobox 1 expression efficiently sensitized prostate cancer cells to cisplatin and inhibited the invasion. However, ectopic zinc-finger E-box-binding homeobox 1 expression impaired the effects of miR-128 on chemosensitivity and invasion in prostate cancer cells. miR-128 functions as a potential cancer suppressor in prostate cancer progression and rational therapeutic strategies for prostate cancer would be developed based on miR-128/zinc-finger E-box-binding homeobox 1 axis. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

    PubMed

    Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

    2003-01-01

    Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we strongly suggest that the final interpretation of the results from this assay be viewed in light of the other features of the case, including clinical history, histology, and immunohistochemistry, by the diagnostic pathologist. Additional studies such as FISH may be useful in clarifying the nature of equivocal or unexpected results.

  10. Comparison of EPA Method 1615 RT-qPCR Assays in Standard and Kit Format

    EPA Science Inventory

    EPA Method 1615 contains protocols for measuring enterovirus and norovirus by reverse transcription quantitative polymerase chain reaction. A commercial kit based upon these protocols was designed and compared to the method's standard approach. Reagent grade, secondary effluent, ...

  11. MATERIALS SUPPORTING THE NEW RECREATIONAL WATER QUALITY CRITERIA FOR PATHOGENS

    EPA Science Inventory

    EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures...

  12. 77 FR 71191 - 2012 Recreational Water Quality Criteria

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-11-29

    ... Criteria AGENCY: Environmental Protection Agency (EPA). ACTION: Notice of availability of the 2012... for beach monitoring, quantitative polymerase chain reaction (qPCR), for the detection of enterococci... managing recreational waters, such as predictive modeling; the EPA is providing a beach action value for...

  13. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots.

    PubMed

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

    2017-02-06

    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. 'MAPK cascade'), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway'), reactive oxygen species (ROS) metabolic process (e.g. 'hydrogen peroxide catabolic process') and transcription factors (e.g., 'MYB, ZFP and bZIP') were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment.

  14. Aggressive melanoma cells escape from BMP7-mediated autocrine growth inhibition through coordinated Noggin upregulation

    PubMed Central

    Hsu, Mei-Yu; Rovinsky, Sherry; Lai, Chiou-Yan; Qasem, Shadi; Liu, Xiaoming; How, Joan; Engelhardt, John F.; Murphy, George F.

    2009-01-01

    Bone morphogenetic proteins (BMPs) are members of the TGF-β superfamily responsible for mediating a diverse array of cellular functions both during embryogenesis and in adult life. Previously, we reported that upregulation of BMP7 in human melanoma correlates with tumor progression. However, melanoma cells are either inhibited by or become resistant to BMP7 as a function of tumor progression, with normal melanocytes being most susceptible. Herein, real-time quantitative reverse transcriptase-polymerase chain reactions and Western blotting revealed that the expression of BMP antagonist, Noggin, correlates with resistance to BMP7 in advanced melanoma cells. To test the hypothesis that coordinated upregulation of Noggin protects advanced melanoma cells from autocrine inhibition by BMP7, functional expression of Noggin in susceptible melanoma cells was achieved by adenoviral gene transfer. The Noggin-overexpressing cells exhibited a growth advantage in response to subsequent BMP7 transduction in vitro under anchorage-dependent and -independent conditions, in three-dimensional skin reconstructs, as well as in vivo in severe combined immune-deficiency mice. In concordance, Noggin knockdown by lentiviral shRNA confers sensitivity to BMP7-induced growth inhibition in advanced melanoma cells. Our findings suggest that, like TGF-β, BMP7 acts as an autocrine growth inhibitor in melanocytic cells, and that advanced melanoma cells may escape from BMP7-induced inhibition through concomitant aberrant expression of Noggin. PMID:18560367

  15. Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6

    PubMed Central

    Yuan, Jun; Zhang, Nan; Huang, Qiwei; Raza, Waseem; Li, Rong; Vivanco, Jorge M.; Shen, Qirong

    2015-01-01

    The successful colonization of plant growth promoting rhizobacteria (PGPR) in the rhizosphere is an initial and compulsory step in the protection of plants from soil-borne pathogens. Therefore, it is necessary to evaluate the role of root exudates in the colonization of PGPR. Banana root exudates were analyzed by high pressure liquid chromatography (HPLC) which revealed exudates contained several organic acids (OAs) including oxalic, malic and fumaric acid. The chemotactic response and biofilm formation of Bacillus amyloliquefaciens NJN-6 were investigated in response to OA’s found in banana root exudates. Furthermore, the transcriptional levels of genes involved in biofilm formation, yqxM and epsD, were evaluated in response to OAs via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Results suggested that root exudates containing the OAs both induced the chemotaxis and biofilm formation in NJN-6. In fact, the strongest chemotactic and biofilm response was found when 50 μM of OAs were applied. More specifically, malic acid showed the greatest chemotactic response whereas fumaric acid significantly induced biofilm formation by a 20.7–27.3% increase and therefore biofilm formation genes expression. The results showed banana root exudates, in particular the OAs released, play a crucial role in attracting and initiating PGPR colonization on the host roots. PMID:26299781

  16. Specific Detection of CD56 (NCAM) Isoforms for the Identification of Aggressive Malignant Neoplasms with Progressive Development

    PubMed Central

    Gattenlöhner, Stefan; Stühmer, Thorsten; Leich, Ellen; Reinhard, Matthias; Etschmann, Benjamin; Völker, Hans-Ulrich; Rosenwald, Andreas; Serfling, Edgar; Christian Bargou, Ralf; Ertl, Georg; Einsele, Hermann; Müller-Hermelink, Hans-Konrad

    2009-01-01

    Alternative splicing of transcripts from many cancer-associated genes is believed to play a major role in carcinogenesis as well as in tumor progression. Alternative splicing of one such gene, the neural cell adhesion molecule CD56 (NCAM), impacts the progression, inadequate therapeutic response, and reduced total survival of patients who suffer from numerous malignant neoplasms. Although previous investigations have determined that CD56 exists in three major isoforms (CD56120kD, CD56140kD, and CD56180kD) with individual structural and functional properties, neither the expression profiles nor the functional relevance of these isoforms in malignant tumors have been consistently investigated. Using new quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) strategies and novel CD56 isoform-specific antibodies, CD56140kD was shown to be exclusively expressed in a number of highly malignant CD56+ neoplasms and was associated with the progression of CD56+ precursor lesions of unclear malignant potential. Moreover, only CD56140kD induced antiapoptotic/proliferative pathways and specifically phosphorylated calcium-dependent kinases that are relevant for tumorigenesis. We conclude, therefore, that the specific detection of CD56 isoforms will help to elucidate their individual functions in the pathogenesis and progression of malignant neoplasms and may have a positive impact on the development of CD56-based immunotherapeutic strategies. PMID:19246644

  17. SGK is a primary glucocorticoid-induced gene in the human.

    PubMed

    Náray-Fejes-Tóth, A; Fejes-Tóth, G; Volk, K A; Stokes, J B

    2000-12-01

    Serum- and glucocorticoid-induced kinase (sgk) is transcriptionally regulated by corticosteroids in several cell types. Recent findings suggest that sgk is an important gene in the early action of corticosteroids on epithelial sodium reabsorption. Surprisingly, the human sgk was reported not to be transcriptionally regulated by corticosteroids in a hepatoma cell line, and thus far no glucocorticoid response element has been identified in the human SGK gene. Since humans clearly respond to both aldosterone and glucocorticoids in cells where sgk action seems to be important, in this study we determined sgk mRNA levels following dexamethasone treatment for various duration in five human cell lines. These cell lines included epithelial cells (H441, T84 and HT29) and lymphoid/monocyte (U937 and THP-1) lines. Using quantitative reverse transcriptase-polymerase chain reaction (RT-PCR), we found that sgk mRNA levels are markedly induced by glucocorticoids in all of the five cell lines studied. Time course analyses revealed that sgk mRNA levels are elevated as early as 30 min after addition of the glucocorticoid, and remain elevated for several hours. Northern analysis in H441 cells confirmed that sgk is an early induced gene. The induction of sgk by dexamethasone was unaffected by cycloheximide, indicating that it does not require de novo protein synthesis. These results indicate that the human sgk, just like its counterparts in other species, is a primary glucocorticoid-induced gene.

  18. Overexpression of PHRF1 attenuates the proliferation and tumorigenicity of non-small cell lung cancer cells.

    PubMed

    Wang, Yadong; Wang, Haiyu; Pan, Teng; Li, Li; Li, Jiangmin; Yang, Haiyan

    2016-09-27

    The aim of this study was to investigate the potential role of PHRF1 in lung tumorigenesis. Western blot analysis was used to detect the expression of proteins. Quantitative reverse transcriptase polymerase chain reaction, immunohistochemistry, soft agar assay and tumor formation assay in nude mice were applied. Cell cycle distribution was analyzed by flow cytometry. The lower level of PHRF1 mRNA was observed in human lung cancer tissues than that in paracancerous tissues. The decreased expression of PHRF1 protein was observed in H1299 and H1650 cell lines than that in 16HBE and BEAS-2B cell lines. The decreased expression of PHRF1 protein was observed in malignant 16HBE cells compared to control cells. The reduced expression of PHRF1 protein was observed in mice lung tissues treated with BaP than that in control group. Overexpression of PHRF1 inhibited H1299 cell proliferation, colony formation in vitro and growth of tumor xenograft in vivo, and arrested cell cycle in G1 phase. The decreased expression of TGIF and c-Myc proteins and the increased expression of p21 protein were observed in H1299-PHRF1 cells compared with H1299-pvoid cells. In conclusion, our findings suggest that overexpression of PHRF1 attenuated the proliferation and tumorigenicity of non-small cell lung cancer cell line of H1299.

  19. Effect of miRNA-203 on cervical cancer cells and its underlying mechanism.

    PubMed

    Yin, X Z; Zhao, D M; Zhang, G X; Liu, L

    2016-09-23

    miRNA-203 is involved in the development and progression of various types of cancer. However, its role in cervical cancer remains unclear. The aim of this study was to investigate the effect of miRNA-203 on the proliferation and migration of HeLa cervical cancer cells, as well as survivin expression in these cells. A miRNA-203 primer probe was designed according to a sequence obtained from NCBI. The expression of miRNA-203 in cervical epithelial cells and cervical cancer cells was detected by quantitative reverse transcriptase-polymerase chain reaction. The miRNA-203 expression pattern was compared between these two cell lines. The cervical cancer cells were transfected with miRNA-203 mimic or inhibitor to determine their effects on proliferation and migration. The expression of the miRNA-203 target protein (survivin) was analyzed by western blot. Cervical cancer cells showed reduced miRNA-203 expression compared to cervical epithelial cells. Transfection of miRNA-203 mimic upregulated the expression of miRNA-203, suppressed cell proliferation and migration, and downregulated survivin expression (P < 0.05). However, downregulation of miRNA-203 expression did not affect proliferation, migration, and survivin expression in cervical cancer cells (P > 0.05). In conclusion, upregulation of miRNA-203 in cervical cancer cells inhibits the proliferative and migratory capacities of these cells by downregulating the expression of survivin.

  20. Analysis of Acquisition and Titer of Maize Mosaic Rhabdovirus in Its Vector, Peregrinus maidis (Hemiptera: Delphacidae).

    PubMed

    Barandoc-Alviar, Karen; Ramirez, Girly M; Rotenberg, Dorith; Whitfield, Anna E

    2016-01-01

    The corn planthopper, Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae), transmits Maize mosaic rhabdovirus (MMV), an important pathogen of maize and sorghum, in a persistent propagative manner. To better understand the vectorial capacity of P. maidis, we determined the efficiency of MMV acquisition by nymphal and adult stages, and characterized MMV titer through development. Acquisition efficiency, i.e., proportion of insects that acquired the virus, was determined by reverse transcriptase polymerase chain reaction (RT-PCR) and virus titer of individual insects was estimated by quantitative RT-PCR. Acquisition efficiency of MMV differed significantly between nymphs and adults. MMV titer increased significantly over time and throughout insect development from nymphal to adult stage, indication of virus replication in the vector during development. There was a positive association between the vector developmental stage and virus titer. Also, the average titer in male insects was threefold higher than female titers, and this difference persisted up to 30 d post adult eclosion. Overall, our findings indicate that nymphs are more efficient than adults at acquiring MMV and virus accumulated in the vector over the course of nymphal development. Furthermore, sustained infection over the lifespan of P. maidis indicates a potentially high capacity of this vector to transmit MMV. © The Author 2016. Published by Oxford University Press on behalf of the Entomological Society of America.

  1. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

    PubMed

    Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

    2012-10-01

    Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  2. An investigation into the effect of surface roughness of stainless steel on human umbilical vein endothelial cell gene expression.

    PubMed

    McLucas, E; Moran, M T; Rochev, Y; Carroll, W M; Smith, T J

    2006-01-01

    The surface properties of vascular devices dictate the initial postimplantation reactions that occur and thus the efficacy of the implantation procedure. Over the last number of years, a number of different stent designs have emerged and stents are generally polished to a mirror finish during the manufacturing procedure. This study sought to investigate the effect of stainless steel surface roughness on endothelial cell gene expression using an appropriate cell culture in vitro assay system. Stainless steel discs were roughened by shot blasting or polished by mechanical polishing. The surface roughness of the treated and untreated discs was determined by atomic force microscopy (AFM). Cells were seeded on collagen type 1 gels and left to attach for 24 h. Stainless steel discs of varying roughness were then placed in contact with the cells and incubated for 24 h. RNA extractions and quantitative real-time reverse transcriptase-polymerase chain reaction (RT-PCR) was then performed to determine the expression levels of candidate genes in the treated cells compared to suitable control cells. E-selectin and vascular cellular adhesion molecule (VCAM-1) were found to be significantly up-regulated in cells incubated with polished and roughened samples, indicating endothelial cell activation and inflammation. This study indicates that the surface roughness of stainless steel is an important surface property in the development of vascular stents.

  3. A distinct role of pectate lyases in the formation of feeding structures induced by cyst and root-knot nematodes.

    PubMed

    Wieczorek, K; Elashry, A; Quentin, M; Grundler, F M W; Favery, B; Seifert, G J; Bohlmann, H

    2014-09-01

    Pectin in the primary plant cell wall is thought to be responsible for its porosity, charge density, and microfibril spacing and is the main component of the middle lamella. Plant-parasitic nematodes secrete cell wall-degrading enzymes that macerate the plant tissue, facilitating the penetration and migration within the roots. In sedentary endoparasitic nematodes, these enzymes are released only during the migration of infective juveniles through the root. Later, nematodes manipulate the expression of host plant genes, including various cell wall enzymes, in order to induce specific feeding sites. In this study, we investigated expression of two Arabidopsis pectate lyase-like genes (PLL), PLL18 (At3g27400) and PLL19 (At4g24780), together with pectic epitopes with different degrees of methylesterification in both syncytia induced by the cyst nematode Heterodera schachtii and giant cells induced by the root-knot nematode Meloidogyne incognita. We confirmed upregulation of PLL18 and PLL19 in both types of feeding sites with quantitative reverse-transcriptase polymerase chain reaction (RT-PCR) and in situ RT-PCR. Furthermore, the functional analysis of mutants demonstrated the important role of both PLL genes in the development and maintenance of syncytia but not giant cells. Our results show that both enzymes play distinct roles in different infected root tissues as well as during parasitism of different nematodes.

  4. Low-level lasers alter mRNA levels from traditional reference genes used in breast cancer cells

    NASA Astrophysics Data System (ADS)

    Teixeira, A. F.; Canuto, K. S.; Rodrigues, J. A.; Fonseca, A. S.; Mencalha, A. L.

    2017-07-01

    Cancer is among the leading causes of mortality worldwide, increasing the importance of treatment development. Low-level lasers are used in several diseases, but some concerns remains on cancers. Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is a technique used to understand cellular behavior through quantification of mRNA levels. Output data from target genes are commonly relative to a reference that cannot vary according to treatment. This study evaluated reference genes levels from MDA-MB-231 cells exposed to red or infrared lasers at different fluences. Cultures were exposed to red and infrared lasers, incubated (4 h, 37 °C), total RNA was extracted and cDNA synthesis was performed to evaluate mRNA levels from ACTB, GUSB and TRFC genes by RT-qPCR. Specific amplification was verified by melting curves and agarose gel electrophoresis. RefFinder enabled data analysis by geNorm, NormFinder and BestKeeper. Specific amplifications were obtained and, although mRNA levels from ACTB, GUSB or TRFC genes presented no significant variation through traditional statistical analysis, Excel-based tools revealed that the use of these reference genes are dependent of laser characteristics. Our data showed that exposure to low-level red and infrared lasers at different fluences alter the mRNA levels from ACTB, GUSB and TRFC in MDA-MB-231 cells.

  5. Combined analysis of mRNA and miRNA identifies dehydration and salinity responsive key molecular players in citrus roots

    PubMed Central

    Xie, Rangjin; Zhang, Jin; Ma, Yanyan; Pan, Xiaoting; Dong, Cuicui; Pang, Shaoping; He, Shaolan; Deng, Lie; Yi, Shilai; Zheng, Yongqiang; Lv, Qiang

    2017-01-01

    Citrus is one of the most economically important fruit crops around world. Drought and salinity stresses adversely affected its productivity and fruit quality. However, the genetic regulatory networks and signaling pathways involved in drought and salinity remain to be elucidated. With RNA-seq and sRNA-seq, an integrative analysis of miRNA and mRNA expression profiling and their regulatory networks were conducted using citrus roots subjected to dehydration and salt treatment. Differentially expressed (DE) mRNA and miRNA profiles were obtained according to fold change analysis and the relationships between miRNAs and target mRNAs were found to be coherent and incoherent in the regulatory networks. GO enrichment analysis revealed that some crucial biological processes related to signal transduction (e.g. ‘MAPK cascade’), hormone-mediated signaling pathways (e.g. abscisic acid- activated signaling pathway’), reactive oxygen species (ROS) metabolic process (e.g. ‘hydrogen peroxide catabolic process’) and transcription factors (e.g., ‘MYB, ZFP and bZIP’) were involved in dehydration and/or salt treatment. The molecular players in response to dehydration and salt treatment were partially overlapping. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis further confirmed the results from RNA-seq and sRNA-seq analysis. This study provides new insights into the molecular mechanisms how citrus roots respond to dehydration and salt treatment. PMID:28165059

  6. Presence of Human Herpesvirus 6B in the Pancreas of Subjects With and Without Type 1 Diabetes.

    PubMed

    Ericsson, Maja; Skog, Oskar

    The aims of this study were to investigate the presence of human herpesvirus 6 (HHV6) A and B in human pancreata and to search for signs of active infection in this organ of subjects with and without type 1 diabetes (T1D). Pancreata from brain-dead organ donors with and without T1D were examined for the presence of HHV6 genomic sequences by polymerase chain reaction (PCR), transcripts by reverse transcriptase-PCR, and protein by immunohistochemistry. Quantitative PCR of isolated pancreatic islets and exocrine cell clusters was used to determine the intrapancreatic location of HHV6 DNA. Human herpesvirus 6B genomic sequences were present in 1 of 2 donors who died of acute-onset T1D, 4 of 6 donors with long-standing T1D, and 9 of 12 nondiabetic donors. Higher copy numbers of HHV6B DNA were present in isolated islets than in exocrine tissue from the same donors. No signs of active HHV6 transcription were found. Human herpesvirus 6A was not present in any tested pancreas. The herein presented data demonstrate, for the first time, the presence of a latent HHV6B infection in the pancreas and islets of Langerhans. Whether this virus can contribute to disease in the pancreas remains to be determined.

  7. Role of deferoxamine on enzymatic stress markers in an animal model of Alzheimer's disease after chronic aluminum exposure.

    PubMed

    Esparza, José L; Garcia, Tania; Gómez, Mercedes; Nogués, M Rosa; Giralt, Montserrat; Domingo, José L

    2011-06-01

    The effect of the chelator deferoxamine (DFO) on the activity of enzymatic stress markers was assessed in amyloid beta peptide (AβPP) transgenic mice, an animal model of Alzheimer's disease, after oral aluminum (Al) exposure for 6 months. AβPP transgenic (Tg2576) and C57BL6/SJL wild-type mice of 5 months of age were fed a diet supplemented with Al lactate (1 mg of Al/g food). Four groups of Tg2576 and wild-type animals were used: control, Al only, DFO only, and Al plus DFO. Mice in the DFO-treated groups received also subcutaneous injections of 0.20 mmol/kg/d of this chelating agent twice a week until the end of the study at 11 months of age. The hippocampus, cerebellum, and cortex were removed and processed to examine a number of oxidative stress markers. Furthermore, the expression of Cu-Zn superoxide dismutase, glutathione reductase, and catalase was evaluated by quantitative reverse transcriptase polymerase chain reaction analysis. Aluminum levels in the hippocampus of Tg2576 mice were higher than those found in cerebellum and cortex, while the main oxidative effects were evidenced in the presence of DFO only. Oral Al exposure of AβPP transgenic mice would have some potential to promote pro-oxidant events, while DFO administration would not help in preventing these deleterious effects.

  8. Increased expression and processing of caspase-12 after traumatic brain injury in rats.

    PubMed

    Larner, Stephen F; Hayes, Ronald L; McKinsey, Deborah M; Pike, Brian R; Wang, Kevin K W

    2004-01-01

    Traumatic brain injury (TBI) disrupts tissue homeostasis resulting in pathological apoptotic activation. Recently, caspase-12 was reported to be induced and activated by the unfolded protein response following excess endoplasmic reticulum (ER) stress. This study examined rat caspase-12 expression using the controlled cortical impact TBI model. Immunoblots of fractionalized cell lysates found elevated caspase-12 proform (approximately 60 kDa) and processed form (approximately 12 kDa), with peak induction observed within 24 h post-injury in the cortex (418% and 503%, respectively). Hippocampus caspase-12 proform induction peaked at 24 h post-injury (641%), while processed form induction peaked at 6 h (620%). Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis confirmed elevated caspase-12 mRNA levels after TBI. Injury severity (1.0, 1.2 or 1.6 mm compression) was associated with increased caspase-12 mRNA expression, peaking at 5 days in the cortex (657%, 651% and 1259%, respectively) and 6 h in the hippocampus (435%, 451% and 460%, respectively). Immunohistochemical analysis revealed caspase-12 induction in neurons in both the cortex and hippocampus as well as in astrocytes at the contusion site. This is the first report of increased expression of caspase-12 following TBI. Our results suggest that the caspase-12-mediated ER apoptotic pathway may play a role in rat TBI pathology independent of the receptor- or mitochondria-mediated apoptotic pathways.

  9. RITA inhibits growth of human hepatocellular carcinoma through induction of apoptosis.

    PubMed

    Wang, Haihe; Chen, Guofu; Wang, Hongzhi; Liu, Chunbo

    2013-01-01

    RBP-J-interacting and tubulin-associated (RITA) is a novel RBP-J-interacting protein that downregulates Notch-mediated transcription. The current study focuses on the antitumor effect of RITA in human hepatocellular carcinoma (HCC) and aims to explore its molecular mechanism. Thirty paired HCC and adjacent non-tumoral liver samples were analyzed by real-time quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). RITA overexpression was induced by transfection of a pcDNA3.1-Flag-RITA plasmid into HepG2 cells. RITA knockdown was achieved by siRNA transfection. mRNA and protein expression of target genes were quantified by qRT-PCR and Western blotting, respectively. Cell proliferation and apoptosis were measured using MTT assay and flow cytometry. Our results demonstrate that adjacent nontumoral liver samples exhibited increased RITA expression compared to HCC tissues (p < 0.05); RITA levels were associated with tumor differentiation status. Overexpression of RITA suppressed cell proliferation and promoted early apoptosis, while its silencing promoted cell growth dramatically (p < 0.05). RITA overexpression upregulated p53 and reduced cyclin E levels, whereas silencing of RITA had the opposite effect on p53 and cyclin E expression. Our in vitro results represent the first evidence that RITA might suppress tumor growth and induce apoptosis in HCCs, and may be a potent antitumoral agent for HCC treatment that deserves further exploration.

  10. Decreased expression of the APOA1-APOC3-APOA4 gene cluster is associated with risk of Alzheimer's disease.

    PubMed

    Lin, Qiao; Cao, Yunpeng; Gao, Jie

    2015-01-01

    Apolipoprotein is genetically associated with the risk of Alzheimer's disease (AD). The APOA1, APOC3, and APOA4 genes are closely linked and located on human chromosome 11. Therefore, this gene cluster may be related to the risk of AD. A total of 147 AD patients and 160 healthy controls were randomly recruited from June 2013 to August 2014. APOA1, APOC3, and APOA4 levels were measured using real-time quantitative reverse-transcriptase polymerase chain reaction and enzyme-linked immunosorbent assay. APOA1, APOC3 and APOA4 levels were significantly lower in AD patients than controls (P<0.01). APOA1, APOC3, and APOA4 levels were negatively related with the severities of AD determined by Clinical Dementia Rating scores (P<0.01). APOA1, APOC3, and APOA4 levels showed a negative relation with Montgomery-Åsberg Depression Rating Scale scores and a positive relation with RAND 36-item health-survey scores (P<0.01). There was a decreased trend for levels of APOA1, APOC3, and APOA4 in AD patients. Low levels of APOA1, APOC3, and APOA4 are associated with risk of AD. APOA1, APOC3, and APOA4 should be developed as combined drugs for the therapy of AD.

  11. Decreased expression of the APOA1–APOC3–APOA4 gene cluster is associated with risk of Alzheimer’s disease

    PubMed Central

    Lin, Qiao; Cao, Yunpeng; Gao, Jie

    2015-01-01

    Background Apolipoprotein is genetically associated with the risk of Alzheimer’s disease (AD). The APOA1, APOC3, and APOA4 genes are closely linked and located on human chromosome 11. Therefore, this gene cluster may be related to the risk of AD. Patients and methods A total of 147 AD patients and 160 healthy controls were randomly recruited from June 2013 to August 2014. APOA1, APOC3, and APOA4 levels were measured using real-time quantitative reverse-transcriptase polymerase chain reaction and enzyme-linked immunosorbent assay. Results APOA1, APOC3 and APOA4 levels were significantly lower in AD patients than controls (P<0.01). APOA1, APOC3, and APOA4 levels were negatively related with the severities of AD determined by Clinical Dementia Rating scores (P<0.01). APOA1, APOC3, and APOA4 levels showed a negative relation with Montgomery–Åsberg Depression Rating Scale scores and a positive relation with RAND 36-item health-survey scores (P<0.01). There was a decreased trend for levels of APOA1, APOC3, and APOA4 in AD patients. Conclusion Low levels of APOA1, APOC3, and APOA4 are associated with risk of AD. APOA1, APOC3, and APOA4 should be developed as combined drugs for the therapy of AD. PMID:26491253

  12. Identification of mRNA transcript and screening of amino acids in response to interaction of salinity and nitrate in aquatic fern Azolla caroliniana.

    PubMed

    Tammam, A A; Mostafa, E M

    2012-06-01

    The mechanisms by which Azolla caroliniana respond to salt stress in absence and presence of nitrate is investigated. Screening of amino acid and differential display is used to compare overall differences in gene expression between salinity-stressed and unstressed Azolla caroliniana by quantitative reverse transcriptase polymerase chain reaction (RT-PC R). Results showed that under saline conditions, aspartic acid, glutamic acid, alanine and leucine were the amino acids found to be abundant in Azolla caroliniana, accounting for 11.26%, 8.66%, 9.43%, and 12.36%, respectively. Following salinity stress, a decrease in free glutamate concomitant with a parallel decrease in free proline was indeed evident. Interaction between nitrate and salinity stress increased proline content significantly. By screening a cDNA library, we have identified protein products by homology with known proteins. The RNA transcripts encoding protein influencing secondary metabolites and vacuolar Na+/H+ antiporter that facilitate the transport system. The databasematched under interaction of nitrate and 50 mM NaCl were associated with wall biosynthesis, disease resistance, metabolite transport and protein regulator, other gene for metabolism of steroids and secondary transport. Results obtained from this research could represent a key step in understanding the molecular mechanism of salt tolerance of Azolla caroliniana in the presence and absence of nitrate.

  13. A noncoding melanophilin gene (MLPH) SNP at the splice donor of exon 1 represents a candidate causal mutation for coat color dilution in dogs.

    PubMed

    Drögemüller, Cord; Philipp, Ute; Haase, Bianca; Günzel-Apel, Anne-Rose; Leeb, Tosso

    2007-01-01

    Coat color dilution in several breeds of dog is characterized by a specific pigmentation phenotype and sometimes accompanied by hair loss and recurrent skin inflammation, the so-called color dilution alopecia or black hair follicular dysplasia. Coat color dilution (d) is inherited as a Mendelian autosomal recessive trait. In a previous study, MLPH polymorphisms showed perfect cosegregation with the dilute phenotype within breeds. However, different dilute haplotypes were found in different breeds, and no single polymorphism was identified in the coding sequence that was likely to be causative for the dilute phenotype. We resequenced the 5'-region of the canine MLPH gene and identified a strong candidate single nucleotide polymorphism within the nontranslated exon 1, which showed perfect association to the dilute phenotype in 65 dilute dogs from 7 different breeds. The A/G polymorphism is located at the last nucleotide of exon 1 and the mutant A-allele is predicted to reduce splicing efficiency 8-fold. An MLPH mRNA expression study using quantitative reverse transcriptase-polymerase chain reaction confirmed that dd animals had only about approximately 25% of the MLPH transcript compared with DD animals. These results provide preliminary evidence that the reported regulatory MLPH mutation might represent a causal mutation for coat color dilution in dogs.

  14. Difference in drug resistance patterns between minor HIV-1 populations in cerebrospinal fluid and plasma.

    PubMed

    Bergroth, T; Ekici, H; Gisslén, M; Hagberg, L; Sönnerborg, A

    2009-02-01

    The aim of the study was to determine to what extent unique drug resistance patterns appear in minor and major HIV-1 quasispecies in cerebrospinal fluid (CSF) as compared with blood. Forty-four plasma and CSF samples from 13 multi-treatment-experienced patients, seven of whom provided longitudinal samples, were included in the study. The subjects had failed antiretroviral therapy including lamivudine. The reverse transcriptase (RT) gene was examined by selective real-time polymerase chain reaction (SPCR), which can detect M184I/V mutants down to 0.2% of the viral population. SPCR revealed differences at amino acid position 184 in the plasma/CSF populations in 12 paired samples from eight patients. One plasma sample was positive by SPCR where direct sequencing showed wild-type M184. The other 11 paired samples showed quantitative differences in the mixed populations of the mutant or wild-type M184 quasispecies. Differences in other resistance-associated mutations between plasma and CSF viruses were also found by direct sequencing. In multi-treatment-experienced patients with therapy failure, differences in drug resistance patterns were found frequently between plasma and CSF in both minor and major viral populations. To what extent this was a true biological phenomenon remains to be established, and the clinical relevance of these findings is yet to be determined.

  15. Shedding and transmission of novel influenza virus A/H1N1 infection in households--Germany, 2009.

    PubMed

    Suess, Thorsten; Buchholz, Udo; Dupke, Susann; Grunow, Roland; an der Heiden, Matthias; Heider, Alla; Biere, Barbara; Schweiger, Brunhilde; Haas, Walter; Krause, Gérard

    2010-06-01

    Essential epidemiologic and virologic parameters must be measured to provide evidence for policy/public health recommendations and mathematical modeling concerning novel influenza A/H1N1 virus (NIV) infections. Therefore, from April through August of 2009, the authors collected nasopharyngeal specimens and information on antiviral medication and symptoms from households with NIV infection on a daily basis in Germany. Specimens were analyzed quantitatively by using reverse transcriptase-polymerase chain reaction. In 36 households with 83 household contacts, 15 household contacts became laboratory-confirmed secondary cases of NIV. Among 47 contacts without antiviral prophylaxis, 12 became cases (secondary attack rate of 26%), and 1 (8%) of these was asymptomatic. The mean and median serial interval were 2.6 and 3 days, respectively (range: 1-3 days). On average, the authors detected viral RNA copies for 6.6 illness days (treated in time = 5.7 days, not treated in time = 7.1 days; P = 0.06), but they estimated that most patients cease to excrete viable virus by the fifth illness day. Shedding profiles were consistent with the number and severity of symptoms. Compared with other nasopharyngeal specimen types, nasal wash was the most sensitive. These results support the notion that epidemiologic and virologic characteristics of NIV are in many aspects similar to those of seasonal influenza.

  16. Characterization and distribution of natriuretic peptide receptors in the rat uterus.

    PubMed

    Dos Reis, A M; Fujio, N; Dam, T V; Mukaddam-Daher, S; Jankowski, M; Tremblay, J; Gutkowska, J

    1995-10-01

    Atrial natriuretic peptide (ANP) receptors were characterized in rat uterus. The binding of [125I]ANP to uterine membranes was completely competed for by increasing concentrations of unlabeled ANP (Kd = 0.39 nM) and brain natriuretic peptide (Kd = 1.24 nM) and partially by C-type natriuretic peptide (CNP; Kd = 80.4 nM), but not by C-ANF. Also, [125I]Tyr-CNP bound to uterine membranes was completely competed by unlabeled CNP (Kd = 1.12 nM). Cross-linking of [125I]ANP to uterine membranes revealed the presence of one band of 130 kilodaltons, corresponding to the guanylyl cyclase (GC-A and/or GC-B) subtypes of natriuretic peptide receptors. The presence of messenger RNA coding for genes of both GC-A and GC-B receptors was shown by quantitative reverse transcriptase polymerase chain reaction. Furthermore, ANP and, to a lesser degree, CNP stimulated the production of cGMP in rat uterus. Autoradiographic studies localized the highest binding of [125I]ANP in the endometrium, whereas [125I]Tyr-CNP binding was distributed in the endometrium as well as in the myometrium. These results demonstrate that rat uterine ANP receptors are of the guanylyl cyclase-coupled subtypes. The uterus is a target of natriuretic peptides where ANP induces its biological effects through the production of cGMP.

  17. Reverse transcriptase activity and particles of retroviral density in cultured canine lymphosarcoma supernatants.

    PubMed Central

    Tomley, F. M.; Armstrong, S. J.; Mahy, B. W.; Owen, L. N.

    1983-01-01

    Lymphoid tissue from 43 cases of canine lymphosarcoma and from 40 clinically normal dogs have been examined for markers of retrovirus infection. From 69-76% of culture supernatants from lymphosarcomas were shown to contain particles of retroviral density and to possess poly rC-oligo dG templated polymerase (reverse transcriptase) activity compared with 17-24% of culture supernatants from normal canine lymphoid cells. In 6 culture supernatants from cases of lymphosarcoma, high molecular weight 60-70S RNA was detected and shown to be found in association with this particulate reverse transcriptase activity. No such RNA was detected in 6 culture supernatants from normal canine lymphoid cells. PMID:6186265

  18. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nasarabadi, Shanavaz

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reactionmore » chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.« less

  19. T85C polymorphisms of the dihydropyrimidine dehydrogenase gene detected in gastric cancer tissues by high-resolution melting curve analysis.

    PubMed

    Fang, Weijia; Xu, Nong; Jin, Dazhi; Chen, Yu; Chen, Xiaogang; Zheng, Yi; Shen, Hong; Yuan, Ying; Zheng, Shusen

    2012-01-01

    Dihydropyrimidine dehydrogenase is a key enzyme acting on the metabolic pathway of medications for gastric cancer. High-resolution melting curve technology, which was developed recently, can distinguish the wild-type dihydropyrimidine dehydrogenase gene from multiple polymorphisms by fluorescent quantitative polymerase chain reaction products in a direct and effective manner. T85C polymorphisms of dihydropyrimidine dehydrogenase in the peripheral blood of 112 Chinese gastric cancer patients were detected by real-time polymerase chain reaction combined with high-resolution melting curve technology. Primer design, along with the reaction system and conditions, was optimized based on the GenBank sequence. Seventy nine cases of wild-type (TT, [70.5%]), 29 cases of heterozygous (TC, [25.9%]), and 4 cases of homozygous mutant (CC, [3.6%]) were observed. The result was completely consistent with the results of the sequencing. Real-time polymerase chain reaction combined with high-resolution melting curve technology is a rapid, simple, reliable, direct-viewing, and convenient method for the detection and screening of polymorphisms.

  20. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  1. Carbocyclic nucleoside analogues: classification, target enzymes, mechanisms of action and synthesis

    NASA Astrophysics Data System (ADS)

    Matyugina, E. S.; Khandazhinskaya, A. P.; Kochetkov, Sergei N.

    2012-08-01

    Key biological targets (S-adenosyl-L-homocysteine hydrolase, telomerase, human immunodeficiency virus reverse transcriptase, herpes virus DNA polymerase and hepatitis B virus DNA polymerase) and the mechanisms of action of carbocyclic nucleoside analogues are considered. Structural types of analogues are discussed. Methods of synthesis for the most promising compounds and the spectrum of their biological activities are described. The bibliography includes 126 references.

  2. *A FASTER METHOD OF MEASURING RECREATIONAL WATER QUALITY FOR BETTER PROTECTION OF SWIMMER'S HEALTH

    EPA Science Inventory

    We previously reported that a faster method (< 2 hours) of measuring fecal indicator bacteria (FIB), based on Quantitative Polymerase Chain Reaction (QPCR), was predictive of swimming associated gastrointestinal illness. Using data from two additional beaches, we examined the re...

  3. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  4. Four-hour quantitative real-time polymerase chain reaction-based comprehensive chromosome screening and accumulating evidence of accuracy, safety, predictive value, and clinical efficacy.

    PubMed

    Treff, Nathan R; Scott, Richard T

    2013-03-15

    Embryonic comprehensive chromosomal euploidy may represent a powerful biomarker to improve the success of IVF. However, there are a number of aneuploidy screening strategies to consider, including different technologic platforms with which to interrogate the embryonic DNA, and different embryonic developmental stages from which DNA can be analyzed. Although there are advantages and disadvantages associated with each strategy, a series of experiments producing evidence of accuracy, safety, clinical predictive value, and clinical efficacy indicate that trophectoderm biopsy and quantitative real-time polymerase chain reaction (qPCR)-based comprehensive chromosome screening (CCS) may represent a useful strategy to improve the success of IVF. This Biomarkers in Reproductive Medicine special issue review summarizes the accumulated experience with the development and clinical application of a 4-hour blastocyst qPCR-based CCS technology. Copyright © 2013 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo

    PubMed Central

    Yang, Jin-Long; Cheng, An-Chun; Wang, Ming-Shu; Pan, Kang-Cheng; Li, Min; Guo, Yu-Fei; Li, Chuan-Feng; Zhu, De-Kang; Chen, Xiao-Yue

    2009-01-01

    Background Goose parvovirus (GPV) is a Dependovirus associated with latent infection and mortality in geese. Currently, it severely affects geese production worldwide. The objective of this study was to develop a fluorescent quantitative real-time polymerase chain reaction (PCR) (FQ-PCR) assay for fast and accurate quantification of GPV DNA in infected goslings, which can aid in the understanding of the regular distribution pattern and the nosogenesis of GPV in vivo. Results The detection limit of the assay was 2.8 × 101 standard DNA copies, with a sensitivity of 3 logs higher than that of the conventional gel-based PCR assay targeting the same gene. The real-time PCR was reproducible, as shown by satisfactory low intraassay and interassay coefficients of variation. Conclusion The high sensitivity, specificity, simplicity, and reproducibility of the GPV fluorogenic PCR assay, combined with a high throughput, make this method suitable for a broad spectrum of GPV etiology-related applications. PMID:19754946

  6. Detection of eastern equine encephalomyelitis virus RNA in North American snakes.

    PubMed

    Bingham, Andrea M; Graham, Sean P; Burkett-Cadena, Nathan D; White, Gregory S; Hassan, Hassan K; Unnasch, Thomas R

    2012-12-01

    The role of non-avian vertebrates in the ecology of eastern equine encephalomyelitis virus (EEEV) is unresolved, but mounting evidence supports a potential role for snakes in the EEEV transmission cycle, especially as over-wintering hosts. To determine rates of exposure and infection, we examined serum samples from wild snakes at a focus of EEEV in Alabama for viral RNA using quantitative reverse transcription polymerase chain reaction. Two species of vipers, the copperhead (Agkistrodon contortrix) and the cottonmouth (Agkistrodon piscivorus), were found to be positive for EEEV RNA using this assay. Prevalence of EEEV RNA was more frequent in seropositive snakes than seronegative snakes. Positivity for the quantitative reverse transcription polymerase chain reaction in cottonmouths peaked in April and September. Body size and sex ratios were not significantly different between infected and uninfected snakes. These results support the hypothesis that snakes are involved in the ecology of EEEV in North America, possibly as over-wintering hosts for the virus.

  7. Extraordinary Effects of Specific Monovalent Cations on Activation of Reovirus Transcriptase by Chymotrypsin In Vitro

    PubMed Central

    Borsa, J.; Sargent, M. D.; Long, D. G.; Chapman, J. D.

    1973-01-01

    Activation of reovirus transcriptase activity, latent in intact virions, by digestion of purified virions with chymotrypsin (CHT) in vitro shows a stringent requirement for specific monovalent cations. Cs+, Rb+, or K+ ions are capable of facilitating activation by chymotryptic digestion. Na+, Li+, or NH4+ ions are not capable of facilitating the CHT activation of polymerase activity and are antagonistic towards the effects of the facilitating ions. The data indicate that the effect of the cations is exerted on activation of the polymerase activity by CHT as opposed to an effect on polymerization per se. This effect may be important biologically in that it provides a mechanism whereby the virion can sense whether it is in an intracellular or an extracellular environment and thereby can avoid premature uncoating. PMID:4347424

  8. Imprint cytology of clear cell sarcoma-like tumor of the gastrointestinal tract in the small intestine: A case report.

    PubMed

    Kato, Takashi; Ichihara, Shin; Gotoda, Hiroko; Muraoka, Shunji; Kubo, Terufumi; Sugita, Shintaro; Hasegawa, Tadashi

    2017-12-01

    Clear cell sarcoma-like tumor of the gastrointestinal tract (CCSLGT) is an extremely rare malignant neoplasm in the digestive tract. Its cytomorphologic features have never previously been reported. Here, we describe a case of CCSLGT, including its cytologic examination findings. A 47-year-old woman presented with a mass in the small intestine, which was resected and sent for imprint cytology. Imprint smears revealed tumor cells with light eosinophilic or clear cytoplasm in a necrotic background. Many of the tumor cells were arranged in a perivascular growth with a pseudopapillary formation, and there were some non-neoplastic osteoclast-like giant cells. Histological examination revealed solid nests and a pseudopapillary pattern of the tumor cells with clear or pale eosinophilic cytoplasm and large nuclei with small nucleoli. Immunohistochemistry showed positive for vimentin, S-100, and SOX-10, and negative for SMA, c-KIT, cytokeratin, HMB-45, and MelanA. The EWSR1 gene split signal was detected by reverse transcriptase fluorescence in situ hybridization, and EWSR1-CREB1 gene fusion was indicated by reverse transcriptase polymerase chain reaction analysis. From these findings, we diagnosed the tumor as CCSLGT. To best of our knowledge, this is the first description of the imprint cytology features of CCSLGT. © 2017 Wiley Periodicals, Inc.

  9. Structural basis for the D-stereoselectivity of human DNA polymerase β

    PubMed Central

    Vyas, Rajan; Reed, Andrew J.; Raper, Austin T.; Zahurancik, Walter J.; Wallenmeyer, Petra C.

    2017-01-01

    Abstract Nucleoside reverse transcriptase inhibitors (NRTIs) with L-stereochemistry have long been an effective treatment for viral infections because of the strong D-stereoselectivity exhibited by human DNA polymerases relative to viral reverse transcriptases. The D-stereoselectivity of DNA polymerases has only recently been explored structurally and all three DNA polymerases studied to date have demonstrated unique stereochemical selection mechanisms. Here, we have solved structures of human DNA polymerase β (hPolβ), in complex with single-nucleotide gapped DNA and L-nucleotides and performed pre-steady-state kinetic analysis to determine the D-stereoselectivity mechanism of hPolβ. Beyond a similar 180° rotation of the L-nucleotide ribose ring seen in other studies, the pre-catalytic ternary crystal structures of hPolβ, DNA and L-dCTP or the triphosphate forms of antiviral drugs lamivudine ((-)3TC-TP) and emtricitabine ((-)FTC-TP) provide little structural evidence to suggest that hPolβ follows the previously characterized mechanisms of D-stereoselectivity. Instead, hPolβ discriminates against L-stereochemistry through accumulation of several active site rearrangements that lead to a decreased nucleotide binding affinity and incorporation rate. The two NRTIs escape some of the active site selection through the base and sugar modifications but are selected against through the inability of hPolβ to complete thumb domain closure. PMID:28402499

  10. Directed evolution of DNA polymerase, RNA polymerase and reverse transcriptase activity in a single polypeptide.

    PubMed

    Ong, Jennifer L; Loakes, David; Jaroslawski, Szymon; Too, Kathleen; Holliger, Philipp

    2006-08-18

    DNA polymerases enable key technologies in modern biology but for many applications, native polymerases are limited by their stringent substrate recognition. Here we describe short-patch compartmentalized self-replication (spCSR), a novel strategy to expand the substrate spectrum of polymerases in a targeted way. spCSR is based on the previously described CSR, but unlike CSR only a short region (a "patch") of the gene under investigation is diversified and replicated. This allows the selection of polymerases under conditions where catalytic activity and processivity are compromised to the extent that full self-replication is inefficient. We targeted two specific motifs involved in substrate recognition in the active site of DNA polymerase I from Thermus aquaticus (Taq) and selected for incorporation of both ribonucleotide- (NTP) and deoxyribonucleotide-triphosphates (dNTPs) using spCSR. This allowed the isolation of multiple variants of Taq with apparent dual substrate specificity. They were able to synthesize RNA, while still retaining essentially wild-type (wt) DNA polymerase activity as judged by PCR. One such mutant (AA40: E602V, A608V, I614M, E615G) was able to incorporate both NTPs and dNTPs with the same catalytic efficiency as the wt enzyme incorporates dNTPs. AA40 allowed the generation of mixed RNA-DNA amplification products in PCR demonstrating DNA polymerase, RNA polymerase as well as reverse transcriptase activity within the same polypeptide. Furthermore, AA40 displayed an expanded substrate spectrum towards other 2'-substituted nucleotides and was able to synthesize nucleic acid polymers in which each base bore a different 2'-substituent. Our results suggest that spCSR will be a powerful strategy for the generation of polymerases with altered substrate specificity for applications in nano- and biotechnology and in the enzymatic synthesis of antisense and RNAi probes.

  11. Rare occurrence of natural transovarial transmission of dengue virus and elimination of infected foci as a possible intervention method.

    PubMed

    Angel, Annette; Angel, Bennet; Joshi, Vinod

    2016-03-01

    Transovarial transmission of dengue virus has been studied in 33 districts of Rajasthan, India. Small proportion (1.09%) of breeding containers positive for the virus and their elimination has been demonstrated as a possible intervention method of disease control. Dengue virus was isolated from individual mosquitoes employing Indirect Fluorescence Antibody Test and Reverse Transcriptase Polymerase Chain Reaction. Out of 1,30,525 containers examined only 1432(1.09%) showed transovarially transmitted virus activity. Elimination of larvae from all the 1432 virus positive containers resulted in substantial control over prospective transmission of dengue. The study highlights rarity of transovarial transmission under natural conditions and sensitizes whether elimination of vertically infected foci could be used as a new intervention method. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Development of a highly sensitive screen for influenza A in guano and its application in the search for ancient RNA preserved under Antarctic Adelie penguin colonies.

    PubMed

    Briggs, L C; Ashton, R M; Metcalf, P

    2003-01-01

    We have developed a reverse transcriptase polymerase chain reaction (RT-PCR)-based assay to detect influenza A in guano samples as part of our program to investigate ancient viral RNA from under Antarctic Adelie penguin (Pygoscelis adeliae) colonies. Of five extraction protocols tested (RNeasy, GTC TRIZOL, GTC Silica, Rnaid, and AGPC), AGPC proved to be the most consistent and sensitive to low concentrations of influenza, but further purification with commercial viral nucleic acid spin filter system was still required to remove remaining PCR inhibitors. RT-PCR was then performed on the eluent and 650 bases of the M1 gene were amplified. The assay was found to be able to detect as little as 100 microl of 0.1 hemagglutination units (HU)/ml influenza.

  13. [Expression of cell adhesion molecules in acute leukemia cell].

    PubMed

    Ju, Xiaoping; Peng, Min; Xu, Xiaoping; Lu, Shuqing; Li, Yao; Ying, Kang; Xie, Yi; Mao, Yumin; Xia, Fang

    2002-11-01

    To investigate the role of cell adhesion molecule in the development and extramedullary infiltration (EI) of acute leukemia. The expressions of neural cell adhesion molecule (NCAM) gene, intercellular adhesion molecule-1 (ICAM-1) and vascular cell adhesion molecule (VCAM-1) genes in 25 acute leukemia patients bone marrow cells were detected by microarray and reverse transcriptase-polymerase chain reaction (RT-PCR). The expressions of NCAM, ICAM-1 and VCAM-1 gene were significantly higher in acute leukemia cells and leukemia cells with EI than in normal tissues and leukemia cells without EI, respectively, both by cDNA microarray and by RT-PCR. The cDNA microarray is a powerful technique in analysis of acute leukemia cells associated genes. High expressions of cell adhesion molecule genes might be correlated with leukemia pathogenesis and infiltration of acute leukemia cell.

  14. Development of an event-specific hydrolysis probe quantitative real-time polymerase chain reaction assay for Embrapa 5.1 genetically modified common bean (Phaseolus vulgaris).

    PubMed

    Treml, Diana; Venturelli, Gustavo L; Brod, Fábio C A; Faria, Josias C; Arisi, Ana C M

    2014-12-10

    A genetically modified (GM) common bean event, namely Embrapa 5.1, resistant to the bean golden mosaic virus (BGMV), was approved for commercialization in Brazil. Brazilian regulation for genetically modified organism (GMO) labeling requires that any food containing more than 1% GMO be labeled. The event-specific polymerase chain reaction (PCR) method has been the primary trend for GMO identification and quantitation because of its high specificity based on the flanking sequence. This work reports the development of an event-specific assay, named FGM, for Embrapa 5.1 detection and quantitation by use of SYBR Green or hydrolysis probe. The FGM assay specificity was tested for Embrapa 2.3 event (a noncommercial GM common bean also resistant to BGMV), 46 non-GM common bean varieties, and other crop species including maize, GM maize, soybean, and GM soybean. The FGM assay showed high specificity to detect the Embrapa 5.1 event. Standard curves for the FGM assay presented a mean efficiency of 95% and a limit of detection (LOD) of 100 genome copies in the presence of background DNA. The primers and probe developed are suitable for the detection and quantitation of Embrapa 5.1.

  15. A novel duplex real time quantitative reverse transcription polymerase chain reaction for rubella virus with armored RNA as a noncompetitive internal positive control.

    PubMed

    Zhao, Lihong; Li, Ruiying; Liu, Aihua; Zhao, Shuping

    2015-07-01

    The objective of this study was to build and apply a duplex real time quantitative reverse transcription-polymerase chain reaction (RT-PCR) for rubella virus. Firstly, a 60-bp-long armored RV RNA was constructed in the laboratory. Secondly, a duplex real time RT-PCR assay was established. Thirdly, the 60-bp-long armored RV RNA was used as an internal positive control (IPC) for the duplex real time RT-PCR. And finally the duplex real time RT-PCR assay was applied to detect RV RNA in clinical specimens. The in-house assay has a high amplification efficiency (0.99), a high analytical sensitivity (200 copies/mL), and a good reproducibility. The diagnostic specificity and sensitivity of the in-house assay were both 100%, due to the monitoring of the armored RV RNA IPC. Therefore, the in-house duplex real time quantitative RT-PCR assay is a specific, sensitive, reproducible and accurate assay for quantitation of RV RNA in clinical specimens. And noncompetitive armored RV RNA IPC can monitor RT-PCR inhibition and prevent false-negative and inaccurate results in the real time detection system. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. SWIMMING ASSOCIATED ILLNESS AND RAPID MEASURES OF WATER QUALITY AT A GULF BEACH

    EPA Science Inventory

    Studies at Great Lakes beaches have provided evidence that faster ways of measuring the fecal indicator bacteria (FIB) Enterococcus using quantitative polymerase chain reaction (qPCR) are predictive of swimming associated illness. In 2005 we conducted an epidemiology study to eva...

  17. RAPID MONITORING BY QPCR FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polymerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventi...

  18. Clusters of antibiotic resistance genes enriched together stay together in swine agriculture

    USDA-ARS?s Scientific Manuscript database

    Antibiotic resistance has developed into a worldwide health risk. The nature and extent of the contribution of animal agriculture to the evolution of antibiotic resistance in bacterial communities remains unclear. Using quantitative polymerase chain reaction (PCR) in tandem with next-generation sequ...

  19. RECREATIONAL BEACH WATER QUALITY MONITORING WITH QUANTITATIVE POLYMERASE CHAIN

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in monitoring the water at these beaches for fecal indicator bacteria as a means of determining if it is safe for pu...

  20. Detection and quantification limits of the EPA Enterococcus qPCR method

    EPA Science Inventory

    The U.S. EPA will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality in 2013 and has published preliminary proposed water quality criteria guidelines for the method. An im...

  1. Phleboviruses associated with sand flies in arid bio-geographical areas of Central Tunisia.

    PubMed

    Dachraoui, K; Fares, W; Bichaud, L; Barhoumi, W; Beier, J C; Derbali, M; Cherni, S; Lamballerie, X de; Chelbi, I; Charrel, R N; Zhioua, E

    2016-06-01

    An entomological investigation was carried out in 2014 at two sites located in Central Tunisia, one irrigated and another non-irrigated situated in arid bio-geographical areas. Sand flies of the subgenus Larroussius namely Phlebotomus perfiliewi, Phlebotomus perniciosus, and Phlebotomus longicuspis are the most abundant sand fly species in the irrigated site. However, in the non-irrigated site, Phlebotomus papatasi of the Phlebotomus genus is the most abundant species. A total of 3191 sand flies were collected and pooled with up to 30 specimens per pool based on sex, trapping location and collection date, were tested for the presence of phleboviruses by nested reverse transcriptase polymerase chain reaction in the polymerase gene and sequenced. Of a total of 117 pools, 4 were positive, yielding a minimum infection rate of sand flies with phleboviruses of 0.12%. Phylogenetic analysis performed using partial nucleotide and amino acid sequence in the polymerase gene showed that these phleboviruses belonged to four different clusters corresponding to Toscana virus (TOSV), Saddaguia virus (SADV), Sandfly Fever Sicilian Virus (SFSV) and Utique virus (UTIV). This study provides more evidence that the abundance of P. perfiliewi is associated with the development of irrigation in arid bio-geographical areas of Central Tunisia which may have led to the emergence of phleboviruses. We report the first detection of TOSV from sand flies collected from Central Tunisia. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Quantitative polymerase chain reaction for transforming growth factor-β applied to a field study of fish health in Chesapeake Bay tributaries

    USGS Publications Warehouse

    Harms, Craig A.; Ottinger, Christopher A.; Blazer, Vicki S.; Densmore, Christine L.; Pieper, L.H.; Kennedy-Stoskopf, S.

    2000-01-01

    Fish morbidity and mortality events in Chesapeake Bay tributaries have aroused concern over the health of this important aquatic ecosystem. We applied a recently described method for quantifying mRNA of an immunosuppressive cytokine, transforming growth factor-β (TGF-β), by reverse transcription quantitative-competitive polymerase chain reaction to a field study of fish health in the Chesapeake Basin, and compared the results to those of a traditional cellular immunoassay macrophage bactericidal activity. We selected the white perch (Morone americana) as the sentinel fish species because of its abundance at all of the collection sites. White perch were sampled from Chesapeake Bay tributaries in June, August, and October 1998. Splenic mononuclear cell TGF-β mRNA levels increased and anterior kidney macrophage bactericidal activity decreased, particularly in eastern shore tributaries, from June to August and October. The results of the two assays correlated inversely (Kendall's τ b = -0.600; p = 0.0102). The results indicated both temporal and spatial modulation of white perch immune systems in the Chesapeake Basin, and demonstrated the utility of quantitative PCR for TGF-β as a molecular biomarker for field assessment of teleost fish immune status.

  3. Detection of Legionella by cultivation and quantitative real-time polymerase chain reaction in biological waste water treatment plants in Norway.

    PubMed

    Lund, Vidar; Fonahn, Wenche; Pettersen, Jens Erik; Caugant, Dominique A; Ask, Eirik; Nysaeter, Ase

    2014-09-01

    Cases of Legionnaires' disease associated with biological treatment plants (BTPs) have been reported in six countries between 1997 and 2010. However, knowledge about the occurrence of Legionella in BTPs is scarce. Hence, we undertook a qualitative and quantitative screening for Legionella in BTPs treating waste water from municipalities and industries in Norway, to assess the transmission potential of Legionella from these installations. Thirty-three plants from different industries were sampled four times within 1 year. By cultivation, 21 (16%) of 130 analyses were positive for Legionella species and 12 (9%) of 130 analyses were positive for Legionella pneumophila. By quantitative real-time polymerase chain reaction (PCR), 433 (99%) of 437 analyses were positive for Legionella species and 218 (46%) of 470 analyses were positive for L. pneumophila. This survey indicates that PCR could be the preferable method for detection of Legionella in samples from BTPs. Sequence types of L. pneumophila associated with outbreaks in Norway were not identified from the BTPs. We showed that a waste water treatment plant with an aeration basin can produce high concentrations of Legionella. Therefore, these plants should be considered as a possible source of community-acquired Legionella infections.

  4. The role of environmental contamination with small round structured viruses in a hospital outbreak investigated by reverse-transcriptase polymerase chain reaction assay.

    PubMed

    Green, J; Wright, P A; Gallimore, C I; Mitchell, O; Morgan-Capner, P; Brown, D W

    1998-05-01

    In May 1994 an outbreak of vomiting and diarrhoea occurred in a 28-bed long-stay ward for the mentally infirm. The predominant symptoms were vomiting, diarrhoea, malaise and abdominal pain lasting for approximately 12 h in most cases. The attack rate was 62% (13/21) for patients and 46% (16/35) for staff members. Infection control measures were implemented (containment of infectious individuals, hand hygiene among staff and environmental decontamination) and the ward was closed to admissions. Affected staff were excluded from contact with patients and their food until asymptomatic for 72 h. The outbreak lasted for 17 days. Faecal samples from nine symptomatic persons were negative for bacterial enteric pathogens, Giardia, Cryptosporidium and group A rotavirus. Electron microscopy of 12 faecal samples and one sample of vomitus revealed small round structured virus (SRSV) particles in one faecal sample. A further 30 faecal samples and seven vomitus samples were tested by reverse transcription polymerase chain reaction (RT-PCR) for SRSV of which 12 (40%) and 1 (14%) were positive respectively. Twenty-eight throat swabs from symptomatic and asymptomatic patients were collected, three (9.5%) of which were positive for SRSV by RT-PCR. Thirty-six environmental swabs were collected on the affected ward, and 11 (30%) were positive by RT-PCR. Positive swabs were from lockers, curtains and commodes and confined to the immediate environment of symptomatic patients. The distribution of contamination supports the rationale of cohorting sick patients.

  5. An animal model for human EBV-associated hemophagocytic syndrome: herpesvirus papio frequently induces fatal lymphoproliferative disorders with hemophagocytic syndrome in rabbits.

    PubMed

    Hayashi, K; Ohara, N; Teramoto, N; Onoda, S; Chen, H L; Oka, T; Kondo, E; Yoshino, T; Takahashi, K; Yates, J; Akagi, T

    2001-04-01

    Epstein-Barr virus-associated hemophagocytic syndrome (EBV-AHS) is often associated with fatal infectious mononucleosis. However, the animal model for EBV-AHS has not been developed. We reported the first animal model for EBV-AHS using rabbits infected with EBV-related herpesvirus of baboon (HVP). Eleven of 13 (85%) rabbits inoculated intravenously with HVP-producing cells developed fatal lymphoproliferative disorders (LPD) between 22 and 105 days after inoculation. LPD was also accompanied by hemophagocytic syndrome (HPS) in nine of these 11 rabbits. The peroral spray of cell-free HVP induced the virus infection with increased anti-EBV-viral capsid antigen-IgG titers in three of five rabbits, and two of these three infected rabbits died of LPD with HPS. Autopsy revealed hepatosplenomegaly and swollen lymph nodes. Atypical lymphoid T cells expressing EBV-encoded small RNA-1 infiltrated diffusely in many organs, frequently involving the lymph nodes, spleen, and liver. Hemophagocytic histiocytosis was observed in the lymph nodes, spleen, bone marrow, and thymus. HVP-DNA was detected in the tissues and peripheral blood from the infected rabbits by polymerase chain reaction or Southern blot analysis. Reverse transcriptase-polymerase chain reaction revealed both HVP-EBNA1 and HVP-EBNA2 transcripts, suggesting latency type III infection. These data indicate that the high rate of rabbit LPD with HPS induction is caused by HVP. This system is useful for studying the pathogenesis, prevention, and treatment of human EBV-AHS.

  6. An Animal Model for Human EBV-Associated Hemophagocytic Syndrome

    PubMed Central

    Hayashi, Kazuhiko; Ohara, Nobuya; Teramoto, Norihiro; Onoda, Sachiyo; Chen, Hong-Li; Oka, Takashi; Kondo, Eisaku; Yoshino, Tadashi; Takahashi, Kiyoshi; Yates, John; Akagi, Tadaatsu

    2001-01-01

    Epstein-Barr virus-associated hemophagocytic syndrome (EBV-AHS) is often associated with fatal infectious mononucleosis. However, the animal model for EBV-AHS has not been developed. We reported the first animal model for EBV-AHS using rabbits infected with EBV-related herpesvirus of baboon (HVP). Eleven of 13 (85%) rabbits inoculated intravenously with HVP-producing cells developed fatal lymphoproliferative disorders (LPD) between 22 and 105 days after inoculation. LPD was also accompanied by hemophagocytic syndrome (HPS) in nine of these 11 rabbits. The peroral spray of cell-free HVP induced the virus infection with increased anti-EBV-viral capsid antigen-IgG titers in three of five rabbits, and two of these three infected rabbits died of LPD with HPS. Autopsy revealed hepatosplenomegaly and swollen lymph nodes. Atypical lymphoid T cells expressing EBV-encoded small RNA-1 infiltrated diffusely in many organs, frequently involving the lymph nodes, spleen, and liver. Hemophagocytic histiocytosis was observed in the lymph nodes, spleen, bone marrow, and thymus. HVP-DNA was detected in the tissues and peripheral blood from the infected rabbits by polymerase chain reaction or Southern blot analysis. Reverse transcriptase-polymerase chain reaction revealed both HVP-EBNA1 and HVP-EBNA2 transcripts, suggesting latency type III infection. These data indicate that the high rate of rabbit LPD with HPS induction is caused by HVP. This system is useful for studying the pathogenesis, prevention, and treatment of human EBV-AHS. PMID:11290571

  7. Activation of RAS family genes in urothelial carcinoma.

    PubMed

    Boulalas, I; Zaravinos, A; Karyotis, I; Delakas, D; Spandidos, D A

    2009-05-01

    Bladder cancer is the fifth most common malignancy in men in Western society. We determined RAS codon 12 and 13 point mutations and evaluated mRNA expression levels in transitional cell carcinoma cases. Samples from 30 human bladder cancers and 30 normal tissues were analyzed by polymerase chain reaction/restriction fragment length polymorphism and direct sequencing to determine the occurrence of mutations in codons 12 and 13 of RAS family genes. Moreover, we used real-time reverse transcriptase-polymerase chain reaction to evaluate the expression profile of RAS genes in bladder cancer specimens compared to that in adjacent normal tissues. Overall H-RAS mutations in codon 12 were observed in 9 tumor samples (30%). Two of the 9 patients (22%) had invasive bladder cancer and 7 (77%) had noninvasive bladder cancer. One H-RAS mutation (11%) was homozygous and the remaining 89% were heterozygous. All samples were WT for K and N-RAS oncogenes. Moreover, 23 of 30 samples (77%) showed over expression in at least 1 RAS family gene compared to adjacent normal tissue. K and N-RAS had the highest levels of over expression in bladder cancer specimens (50%), whereas 27% of transitional cell carcinomas demonstrated H-RAS over expression relative to paired normal tissues. Our results underline the importance of H-RAS activation in human bladder cancer by codon 12 mutations. Moreover, they provide evidence that increased expression of all 3 RAS genes is a common event in bladder cancer that is associated with disease development.

  8. Comparison of histopathology and real-time polymerase chain reaction (RT-PCR) for detection of Mycobacterium tuberculosis in fistula-in-ano.

    PubMed

    Garg, Pankaj

    2017-07-01

    Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.

  9. Sequence of events in measles virus replication: role of phosphoprotein-nucleocapsid interactions.

    PubMed

    Brunel, Joanna; Chopy, Damien; Dosnon, Marion; Bloyet, Louis-Marie; Devaux, Patricia; Urzua, Erica; Cattaneo, Roberto; Longhi, Sonia; Gerlier, Denis

    2014-09-01

    The genome of nonsegmented negative-strand RNA viruses is tightly embedded within a nucleocapsid made of a nucleoprotein (N) homopolymer. To ensure processive RNA synthesis, the viral polymerase L in complex with its cofactor phosphoprotein (P) binds the nucleocapsid that constitutes the functional template. Measles virus P and N interact through two binding sites. While binding of the P amino terminus with the core of N (NCORE) prevents illegitimate encapsidation of cellular RNA, the interaction between their C-terminal domains, P(XD) and N(TAIL) is required for viral RNA synthesis. To investigate the binding dynamics between the two latter domains, the P(XD) F497 residue that makes multiple hydrophobic intramolecular interactions was mutated. Using a quantitative mammalian protein complementation assay and recombinant viruses, we found that an increase in P(XD)-to-N(TAIL) binding strength is associated with a slower transcript accumulation rate and that abolishing the interaction renders the polymerase nonfunctional. The use of a newly developed system allowing conditional expression of wild-type or mutated P genes, revealed that the loss of the P(XD)-N(TAIL) interaction results in reduced transcription by preformed transcriptases, suggesting reduced engagement on the genomic template. These intracellular data indicate that the viral polymerase entry into and progression along its genomic template relies on a protein-protein interaction that serves as a tightly controlled dynamic anchor. Mononegavirales have a unique machinery to replicate RNA. Processivity of their polymerase is only achieved when the genome template is entirely embedded into a helical homopolymer of nucleoproteins that constitutes the nucleocapsid. The polymerase binds to the nucleocapsid template through the phosphoprotein. How the polymerase complex enters and travels along the nucleocapsid template to ensure uninterrupted synthesis of up to ∼ 6,700-nucleotide messenger RNAs from six to ten consecutive genes is unknown. Using a quantitative protein complementation assay and a biGene-biSilencing system allowing conditional expression of two P genes copies, the role of the P-to-N interaction in polymerase function was further characterized. We report here a dynamic protein anchoring mechanism that differs from all other known polymerases that rely only onto a sustained and direct binding to their nucleic acid template. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  10. Characterization of neuronal cell death in the spiral ganglia of a mouse model of endolymphatic hydrops.

    PubMed

    Semaan, Maroun T; Zheng, Qing Y; Han, Fengchan; Zheng, Yuxi; Yu, Heping; Heaphy, John C; Megerian, Cliff A

    2013-04-01

    Spiral ganglion neurons (SGN) in the Phex male mouse, a murine model of postnatal endolymphatic hydrops (ELH) undergo progressive deterioration reminiscent of human and other animal models of ELH with features suggesting apoptosis as an important mechanism. Histologic analysis of the mutant's cochlea demonstrates ELH by postnatal Day (P) 21 and SGN loss by P90. The SGN loss seems to occur in a consistent topographic pattern beginning at the cochlear apex. SGN were counted at P60, P90, and P120. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative PCR, and immunohistochemical analyses of activated caspase-3, caspase-8, and caspase-9 were performed on cochlear sections obtained from mutants and controls. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay (TUNEL) was carried out on 2 mutants and 2 controls. Corrected SGN counts in control mice were greater in the apical turn of the cochleae at P90 and P120, respectively (p < 0.01). Increased expression of activated caspase-3, caspase-8, and caspase-9 was seen in the mutant. At later time points, activated caspase expression gradually declined in the apical turns and increased in basal turns of the cochlea. Quantitative and semiquantitative PCR analysis confirmed increased expression of caspase-3, caspase-8, and caspase-9 at P21 and P40. TUNEL staining demonstrated apoptosis at P90 in the apical and basal turns of the mutant cochleae. SGN degeneration in the Phex /Y mouse seems to mimic patterns observed in other animals with ELH. Apoptosis plays an important role in the degeneration of the SGN in the Phex male mouse.

  11. Epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia modulates proliferation, cell survival and chemosensitivity

    PubMed Central

    Thathia, Shabnam H.; Ferguson, Stuart; Gautrey, Hannah E.; van Otterdijk, Sanne D.; Hili, Michela; Rand, Vikki; Moorman, Anthony V.; Meyer, Stefan; Brown, Robert; Strathdee, Gordon

    2012-01-01

    Background Altered regulation of many transcription factors has been shown to be important in the development of leukemia. TWIST2 modulates the activity of a number of important transcription factors and is known to be a regulator of hematopoietic differentiation. Here, we investigated the significance of epigenetic regulation of TWIST2 in the control of cell growth and survival and in response to cytotoxic agents in acute lymphoblastic leukemia. Design and Methods TWIST2 promoter methylation status was assessed quantitatively, by combined bisulfite and restriction analysis (COBRA) and pyrosequencing assays, in multiple types of leukemia and TWIST2 expression was determined by quantitative reverse transcriptase polymerase chain reaction analysis. The functional role of TWIST2 in cell proliferation, survival and response to chemotherapy was assessed in transient and stable expression systems. Results We found that TWIST2 was inactivated in more than 50% of cases of childhood and adult acute lymphoblastic leukemia through promoter hypermethylation and that this epigenetic regulation was especially prevalent in RUNX1-ETV6-driven cases. Re-expression of TWIST2 in cell lines resulted in a dramatic reduction in cell growth and induction of apoptosis in the Reh cell line. Furthermore, re-expression of TWIST2 resulted in increased sensitivity to the chemotherapeutic agents etoposide, daunorubicin and dexamethasone and TWIST2 hypermethylation was almost invariably found in relapsed adult acute lymphoblastic leukemia (91% of samples hypermethylated). Conclusions This study suggests a dual role for epigenetic inactivation of TWIST2 in acute lymphoblastic leukemia, initially through altering cell growth and survival properties and subsequently by increasing resistance to chemotherapy. PMID:22058208

  12. Gene expression analysis in lymphoblasts derived from patients with autism spectrum disorder.

    PubMed

    Yasuda, Yuka; Hashimoto, Ryota; Yamamori, Hidenaga; Ohi, Kazutaka; Fukumoto, Motoyuki; Umeda-Yano, Satomi; Mohri, Ikuko; Ito, Akira; Taniike, Masako; Takeda, Masatoshi

    2011-05-26

    The autism spectrum disorders (ASDs) are complex neurodevelopmental disorders that result in severe and pervasive impairment in the development of reciprocal social interaction and verbal and nonverbal communication skills. In addition, individuals with ASD have stereotypical behavior, interests and activities. Rare mutations of some genes, such as neuroligin (NLGN) 3/4, neurexin (NRXN) 1, SHANK3, MeCP2 and NHE9, have been reported to be associated with ASD. In the present study, we investigated whether alterations in mRNA expression levels of these genes could be found in lymphoblastoid cell lines derived from patients with ASD. We measured mRNA expression levels of NLGN3/4, NRXN1, SHANK3, MeCP2, NHE9 and AKT1 in lymphoblastoid cells from 35 patients with ASD and 35 healthy controls, as well as from 45 patients with schizophrenia and 45 healthy controls, using real-time quantitative reverse transcriptase polymerase chain reaction assays. The mRNA expression levels of NLGN3 and SHANK3 normalized by β-actin or TBP were significantly decreased in the individuals with ASD compared to controls, whereas no difference was found in the mRNA expression level of MeCP2, NHE9 or AKT1. However, normalized NLGN3 and SHANK3 gene expression levels were not altered in patients with schizophrenia, and expression levels of NLGN4 and NRXN1 mRNA were not quantitatively measurable in lymphoblastoid cells. Our results provide evidence that the NLGN3 and SHANK3 genes may be differentially expressed in lymphoblastoid cell lines from individuals with ASD compared to those from controls. These findings suggest the possibility that decreased mRNA expression levels of these genes might be involved in the pathophysiology of ASD in a substantial population of ASD patients.

  13. Biologic determinants of tumor recurrence in stage II colon cancer: validation study of the 12-gene recurrence score in cancer and leukemia group B (CALGB) 9581.

    PubMed

    Venook, Alan P; Niedzwiecki, Donna; Lopatin, Margarita; Ye, Xing; Lee, Mark; Friedman, Paula N; Frankel, Wendy; Clark-Langone, Kim; Millward, Carl; Shak, Steven; Goldberg, Richard M; Mahmoud, Najjia N; Warren, Robert S; Schilsky, Richard L; Bertagnolli, Monica M

    2013-05-10

    A greater understanding of the biology of tumor recurrence should improve adjuvant treatment decision making. We conducted a validation study of the 12-gene recurrence score (RS), a quantitative assay integrating stromal response and cell cycle gene expression, in tumor specimens from patients enrolled onto Cancer and Leukemia Group B (CALGB) 9581. CALGB 9581 randomly assigned 1,713 patients with stage II colon cancer to treatment with edrecolomab or observation and found no survival difference. The analysis reported here included all patients with available tissue and recurrence (n = 162) and a random (approximately 1:3) selection of nonrecurring patients. RS was assessed in 690 formalin-fixed paraffin-embedded tumor samples with quantitative reverse transcriptase polymerase chain reaction by using prespecified genes and a previously validated algorithm. Association of RS and recurrence was analyzed by weighted Cox proportional hazards regression. Continuous RS was significantly associated with risk of recurrence (P = .013) as was mismatch repair (MMR) gene deficiency (P = .044). In multivariate analyses, RS was the strongest predictor of recurrence (P = .004), independent of T stage, MMR, number of nodes examined, grade, and lymphovascular invasion. In T3 MMR-intact (MMR-I) patients, prespecified low and high RS groups had average 5-year recurrence risks of 13% (95% CI, 10% to 16%) and 21% (95% CI, 16% to 26%), respectively. The 12-gene RS predicts recurrence in stage II colon cancer in CALGB 9581. This is consistent with the importance of stromal response and cell cycle gene expression in colon tumor recurrence. RS appears to be most discerning for patients with T3 MMR-I tumors, although markers such as grade and lymphovascular invasion did not add value in this subset of patients.

  14. Validation study of a quantitative multigene reverse transcriptase-polymerase chain reaction assay for assessment of recurrence risk in patients with stage II colon cancer.

    PubMed

    Gray, Richard G; Quirke, Philip; Handley, Kelly; Lopatin, Margarita; Magill, Laura; Baehner, Frederick L; Beaumont, Claire; Clark-Langone, Kim M; Yoshizawa, Carl N; Lee, Mark; Watson, Drew; Shak, Steven; Kerr, David J

    2011-12-10

    We developed quantitative gene expression assays to assess recurrence risk and benefits from chemotherapy in patients with stage II colon cancer. We sought validation by using RNA extracted from fixed paraffin-embedded primary colon tumor blocks from 1,436 patients with stage II colon cancer in the QUASAR (Quick and Simple and Reliable) study of adjuvant fluoropyrimidine chemotherapy versus surgery alone. A recurrence score (RS) and a treatment score (TS) were calculated from gene expression levels of 13 cancer-related genes (n = 7 recurrence genes and n = 6 treatment benefit genes) and from five reference genes with prespecified algorithms. Cox proportional hazards regression models and log-rank methods were used to analyze the relationship between the RS and risk of recurrence in patients treated with surgery alone and between TS and benefits of chemotherapy. Risk of recurrence was significantly associated with RS (hazard ratio [HR] per interquartile range, 1.38; 95% CI, 1.11 to 1.74; P = .004). Recurrence risks at 3 years were 12%, 18%, and 22% for predefined low, intermediate, and high recurrence risk groups, respectively. T stage (HR, 1.94; P < .001) and mismatch repair (MMR) status (HR, 0.31; P < .001) were the strongest histopathologic prognostic factors. The continuous RS was associated with risk of recurrence (P = .006) beyond these and other covariates. There was no trend for increased benefit from chemotherapy at higher TS (P = .95). The continuous 12-gene RS has been validated in a prospective study for assessment of recurrence risk in patients with stage II colon cancer after surgery and provides prognostic value that complements T stage and MMR. The TS was not predictive of chemotherapy benefit.

  15. Evaluation of reference genes in mouse preimplantation embryos for gene expression studies using real-time quantitative RT-PCR (RT-qPCR).

    PubMed

    Jeong, Jae-Kyo; Kang, Min-Hee; Gurunathan, Sangiliyandi; Cho, Ssang-Goo; Park, Chankyu; Seo, Han Geuk; Kim, Jin-Hoi

    2014-09-25

    Real-time quantitative reverse-transcriptase polymerase chain reaction (RT-qPCR) is the most sensitive, and valuable technique for rare mRNA detection. However, the expression profiles of reference genes under different experimental conditions, such as different mouse strains, developmental stage, and culture conditions have been poorly studied. mRNA stability of the actb, gapdh, sdha, ablim, ywhaz, sptbn, h2afz, tgfb1, 18 s and wrnip genes was analyzed. Using the NormFinder program, the most stable genes are as follows: h2afz for the B6D2F-1 and C57BL/6 strains; sptbn for ICR; h2afz for KOSOM and CZB cultures of B6D2F-1 and C57BL/6 strain-derived embryos; wrnip for M16 culture of B6D2F-1 and C57BL/6 strain-derived embryos; ywhaz, tgfb1, 18 s, 18 s, ywhaz, and h2afz for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst embryonic stages cultured in KSOM medium, respectively; h2afz, wrnip, wrnip, h2afz, ywhaz, and ablim for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in CZB medium, respectively; 18 s, h2afz, h2afz, actb, h2afz, and wrnip for zygote, 2-cell, 4-cell, 8-cell, molular, and blastocyst stage embryos cultured in M16 medium, respectively. These results demonstrated that candidate reference genes for normalization of target gene expression using RT-qPCR should be selected according to mouse strains, developmental stage, and culture conditions.

  16. Measurement of messenger RNA encoding the alpha-chain, polymeric immunoglobulin receptor, and J-chain in duodenal mucosa from dogs with and without chronic diarrhea by use of quantitative real-time reverse transcription-polymerase chain reaction assays.

    PubMed

    Peters, Iain R; Helps, Chris R; Calvert, Emma L; Hall, Edward J; Day, Michael J

    2005-01-01

    To examine the difference in expression of messenger RNA (mRNA) transcripts for polymeric immunoglobulin receptor (plgR), alpha-chain, and J-chain determined by use of quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) assays in duodenal biopsy specimens obtained from dogs with and without chronic diarrhea. Biopsy specimens of the proximal portion of the duodenum were obtained endoscopically from 39 dogs evaluated because of chronic diarrhea (12 German Shepherd Dogs and 27 non-German Shepherd Dog breeds); specimens were also obtained from a control group of 7 dogs evaluated because of other gastrointestinal tract diseases and 2 dogs that were euthanatized as a result of nongastrointestinal tract disease. Dogs were anesthetized, and multiple mucosal biopsy specimens were obtained endoscopically at the level of the caudal duodenal flexure by use of biopsy forceps; in 2 control dogs, samples were obtained from the descending duodenum within 5 minutes of euthanasia. One-step QRT-PCR was used to quantify the level of expression of transcripts for the housekeeper gene glyceraldehyde-3-phosphate dehydrogenase, plgR, alpha-chain, and J-chain in duodenal mucosal tissue. There was no significant difference in the level of expression of any transcript among non-German Shepherd Dog breeds without diarrhea (control group), non-German Shepherd Dog breeds with chronic diarrhea, and German Shepherd Dogs with chronic diarrhea. Conclusions and Clinical Relevance-Results indicated that the susceptibility of German Shepherd Dogs to chronic diarrhea is not a result of simple failure of transcription of the key genes that encode molecules involved in mucosal IgA secretion.

  17. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    PubMed

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  18. Relationship and Variation of qPCR and Culturable Enterococci Estimates in Ambient Surface Waters Are Predictable

    EPA Science Inventory

    The quantitative polymerase chain reaction (qPCR) method provides rapid estimates of fecal indicator bacteria densities that have been indicated to be useful in the assessment of water quality. Primarily because this method provides faster results than standard culture-based meth...

  19. I See Your Smart Phone and Raise You Smart Bacteria

    Science.gov Websites

    understanding how bacteria sense their nearest neighbors (including pathogens), a DTRA CB/JSTO-funded research ;wild type" E. coli was tested via reverse transcription quantitative polymerase chain reactions Director of Research, Dale Ormond, kicks off #MATHCOUNTS #NationalCompetition2018 Countdown Round

  20. USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSING TOOL

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

  1. USING TODAY'S DATA TO CLOSE THE BEACH TODAY. QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) RAPID BEACH CLOSINGS TOOL

    EPA Science Inventory

    Recreational beaches are an important economic and aesthetic asset to communities, states and the nation as a whole. Considerable resources are expended each year in the measurement of fecal indicator bacteria concentrations in the water at these beaches to determine whether thes...

  2. Modeling enterococcus densities measured by quantitative polymerase chain reaction and membrane filtration using environmental conditions at four Great Lakes beaches

    EPA Science Inventory

    Data collected by the US Environmental Protection Agency (EPA) during the summer months of 2003 and 2004 at four US Great Lakes beaches were analyzed using regression analysis to identify relationships between meteorological, physical water characteristics, and beach characterist...

  3. QUANTIFICATION AND ASSOCIATED VARIABILITY OF INDUCED VITELLOGENIN GENE TRANSCRIPTS IN FATHEAD MINNOW (PIMEPHALES PROMELAS) BY QUANTITATIVE REAL-TIME POLYMERASE CHAIN REACTION ASSAY

    EPA Science Inventory

    Ecological risk assessors have a growing need for sensitive and rapid indicators of environmental exposure in aquatic ecosystems resulting from natural and synthetic estrogen-like compounds. Investigators developing subcellular exposure markers in traditional sentinel organisms m...

  4. Effect of Environmental Parameters on the qPCR Signal of Enterococci in Tropical Waters

    EPA Science Inventory

    Fecal contamination is the major source of pathogens in recreational waters. The need for quick public notifications has expanded the interest in the use of a rapid, quantitative polymerase chain reaction method (qPCR) to determine enterococci density. However, very little info...

  5. RAPID MEASUREMENT OF BACTERIAL FECAL INDICATORS IN SURFACE WATERS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS

    EPA Science Inventory

    Current methods for determining fecal contamination of recreational waters rely on the culture of bacterial indicators and require at least 24 hours to determine whether the water is unsafe for use. By the time monitoring results are available, exposures have already occurred. N...

  6. Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments - poster

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) will be recommending a quantitative polymerase chain reaction (qPCR) method targeting Enterococcus spp. as an option for monitoring recreational beach water quality. A practical consideration for widespread implementation of this or ...

  7. Quantitation of CYP1A1 and 1B1 mRNA in polycyclic aromatic hydrocarbon-treated human T-47D and HepG2 cells by a modified bDNA assay using fluorescence detection.

    PubMed

    Wu, Susan J; Spink, David C; Spink, Barbara C; Kaminsky, Laurence S

    2003-01-15

    The quantitation of mRNA, essential for assessing mechanisms of enzyme regulation, is normally carried out using reverse transcriptase-polymerase chain reaction (RT-PCR). An alternative method uses a signal-amplification nucleic acid probe assay, which measures RNA directly by the QuantiGene Expression Kit and incorporates branched DNA technology from Bayer and luminometer-based readings of a chemilumigenic alkaline phosphatase substrate. To broaden the utility of this assay, we investigated substitution of a fluorescent substrate, 2'-(2-benzothiazol)-6'-hydroxybenzothiazole phosphate and a fluorometer, and applied the method to quantitation of CYP1A1 and 1B1 mRNA in human T-47D and HepG2 cells following induction by benzo[a]pyrene (B[a]P) and dibenzo[a,h]anthracene (DB[a,h]A). The fluorescence response increased linearly for 200 min without photobleaching and increased linearly (r2=0.997) up to at least 0.2 microg total RNA. The data revealed that at 0.5 and 1.0 microM inducing agent, the induction of CYP1A1 mRNA in HepG2 cells by DB[a,h]A exceeded that by B[a]P by 18- and 6-fold, respectively. In T-47D cells B[a]P induced CYP1A1 mRNA by 23-fold and CYP1B1 mRNA by 3.9-fold. A B[a]P cocontaminant in the environment, arsenite, did not affect B[a]P-induced levels of CYP1A1 or 1B1 mRNA in these cells. The modified analytical system provides a rapid-throughput, reproducible, and less labor-intensive method than RT-PCR for quantifying cellular mRNA levels.

  8. Applicability of integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) for the simultaneous detection of the four human enteric enterovirus species in disinfection studies

    EPA Science Inventory

    A newly developed integrated cell culture reverse transcriptase quantitative PCR (ICC-RTqPCR) method and its applicability in UV disinfection studies is described. This method utilizes a singular cell culture system coupled with four RTqPCR assays to detect infectious serotypes t...

  9. Chandipura virus infection causing encephalitis in a tribal population of Odisha in eastern India.

    PubMed

    Dwibedi, Bhagirathi; Sabat, Jyotsnamayee; Hazra, Rupenangshu K; Kumar, Anu; Dinesh, Diwakar Singh; Kar, Shantanu K

    2015-01-01

    The sudden death of 10 children in a tribal village of Kandhamal district, Odisha in eastern India led to this investigation. We conducted a door-to-door survey to identify cases. Antibodies for Chandipura, Japanese encephalitis, dengue, chikungunya and West Nile viruses were tested by ELISA in probable cases. Chandipura virus RNA was tested from both human blood samples and sand flies by reverse transcriptase polymerase chain reaction. We conducted vector surveys in domestic and peridomestic areas, and collected sand flies. Entomological investigations revealed the presence of Phlebotomus argentipes and Sergentomiya sp. Thirty-five patients presented with fever, 12 of them had altered sensorium including 4 who had convulsions. The blood samples of 21 patients were tested; four samples revealed Chandipura virusspecific IgM antibody. Chandipura virus infection causing encephalitis affected this tribal population in eastern India at 1212 m above sea level. Copyright 2015, NMJI.

  10. Binding of Nickel to Testicular Glutamate–Ammonia Ligase Inhibits Its Enzymatic Activity

    PubMed Central

    SUN, YINGBIAO; OU, YOUNG; CHENG, MIN; RUAN, YIBING; VAN DER HOORN, FRANS A.

    2016-01-01

    SUMMARY Exposure to nickel has been shown to cause damage to the testis in several animal models. It is not known if the testis expresses protein(s) that can bind nickel. To test this, we used a nickel-binding assay to isolate testicular nickel-binding proteins. We identified glutamate–ammonia ligase (GLUL) as a prominent nickel-binding protein by mass spectrometry. Protein analysis and reverse transcriptase polymerase chain reaction showed that GLUL is expressed in the testis, predominantly in interstitial cells. We determined that GLUL has a higher affinity for nickel than for its regular co-factor manganese. We produced an enzymatically active, recombinant GLUL protein. Upon binding, nickel interferes with the manganese-catalyzed enzymatic activity of recombinant GLUL protein. We also determined that GLUL activity in testes of animals exposed to nickel sulfate is reduced. Our results identify testicular GLUL as the first testicular protein shown to be affected by nickel exposure. PMID:21254280

  11. Evidence of human hantavirus infection and zoonotic investigation of hantavirus prevalence in rodents in western Java, Indonesia.

    PubMed

    Kosasih, Herman; Ibrahim, Ima Nurisa; Wicaksana, Rudi; Alisjahbana, Bachti; Hoo, Yumilia; Yo, Iing H; Antonjaya, Ungke; Widjaja, Susana; Winoto, Imelda; Williams, Maya; Blair, Patrick J

    2011-06-01

    During febrile surveillance in the western Java City of Bandung, Indonesia, a patient with clinical symptoms consistent with hantavirus infection was found to have elevated titers of hantavirus-specific immunoglobulin M (IgM) and IgG antibodies. A subsequent epizoological investigation demonstrated a higher prevalence of hantavirus IgG antibodies in rodents trapped in the vicinity of the patient's home compared with rodents from a control area (13.2% vs. 4.7%, p = 0.036). The Old World Seoul hantavirus was detected by reverse transcriptase-polymerase chain reaction in the organs of 71% of the seropositive rodents tested. This is the first report of a Seoul virus infection in Indonesia supported by clinical, serological, and epizoological evidences. These findings suggest that hantavirus infection should be on the clinical differential diagnosis when acutely ill febrile patients report for care in western Java.

  12. Evidence for airborne transmission of Norwalk-like virus (NLV) in a hotel restaurant.

    PubMed

    Marks, P J; Vipond, I B; Carlisle, D; Deakin, D; Fey, R E; Caul, E O

    2000-06-01

    An outbreak of gastroenteritis followed a meal in a large hotel during which one of the diners vomited. The clinical features of the illness suggested Norwalk-like virus (NLV, small round structured virus) infection, and this was confirmed by electron microscopy and reverse transcriptase polymerase chain reaction (RT-PCR) of stool samples. Further characterization of the virus by nucleotide sequence analysis of the PCR amplicons revealed identical strains in all the affected individuals. The foods served at the meal could not be demonstrated to be the cause of the outbreak. Analysis of attack rates by dining table showed an inverse relationship with the distance from the person who vomited. No one eating in a separate restaurant reported illness. Transmission from person-to-person or direct contamination of food seems unlikely in this outbreak. However, the findings are consistent with airborne spread of NLV with infection by inhalation with subsequent ingestion of virus particles.

  13. Failure to Detect Borna Disease Virus Antibody and RNA from Peripheral Blood Mononuclear Cells of Psychiatric Patients

    PubMed Central

    Na, Kyoung-Sae; Tae, Seong-Ho; Song, Jin-won

    2009-01-01

    Objective Borna disease virus (BDV) is a highly neurotropic agent causing various neuropsychiatric symptoms in animals. Over the past two decades, it has been suggested that BDV might be associated with human psychiatric diseases. We aimed to investigate whether BDV is associated with psychiatric patients in Korea. Methods We recruited 60 normal controls and 198 psychiatric patients (98 patients with depressive disorder, 60 with schizophrenia, and 40 with bipolar disorder). We used an indirect immunofluorescence antibody (IFA) test for the BDV antibody and a real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assay for p24 and p40 RNA from peripheral blood mononuclear cells (PBMCs). Results Neither the BDV antibody nor p24, p40 RNA was detected in controls and patients groups. Conclusion Our results suggest that BDV might not be associated with psychiatric patients in Korea. PMID:20140130

  14. Differentially displayed expressed sequence tags in Melipona scutellaris (Hymenoptera, Apidae, Meliponini) development.

    PubMed

    Santana, Flávia A; Nunes, Francis M F; Vieira, Carlos U; Machado, Maria Alice M S; Kerr, Warwick E; Silva, Wilson A; Bonetti, Ana Maria

    2006-03-01

    We have compared gene expression, using the Differential Display Reverse Transcriptase-Polymerase Chain Reaction (DDRT-PCR) technique, by means of mRNA profile in Melipona scutellaris during ontogenetic postembryonic development, in adult worker, and in both Natural and Juvenile Hormone III-induced adult queen. Six, out of the nine ESTs described here, presented differentially expressed in the phases L1 or L2, or even in both of them, suggesting that key mechanisms to the development of Melipona scutellaris are regulated in these stages. The combination HT11G-AP05 revealed in L1 and L2 a product which matches to thioredoxin reductase protein domain in the Clostridium sporogenes, an important protein during cellular oxidoreduction processes. This study represents the first molecular evidence of differential gene expression profiles toward a description of the genetic developmental traits in the genus Melipona.

  15. Stable prevalence of Powassan virus in Ixodes scapularis in a northern Wisconsin focus.

    PubMed

    Brackney, Doug E; Nofchissey, Robert A; Fitzpatrick, Kelly A; Brown, Ivy K; Ebel, Gregory D

    2008-12-01

    Deer tick virus (DTV), a variant of Powassan virus (POWV), appears to be maintained in nature in an enzootic cycle between Ixodes scapularis ticks and small mammals. Although POWV infection of human beings is rare, a recent report suggests increasing incidence and the possibility that POWV may be an emerging tick-borne zoonosis. Therefore, we assessed the long-term stability of the POWV transmission cycle in northwestern Wisconsin. Adult I. scapularis and Dermacentor variabilis were collected from Hayward and Spooner, Wisconsin, screened for infection by reverse transcriptase polymerase chain reaction (RT-PCR), and virus was isolated. Seventeen of 1,335 (1.3%) of I. scapularis and 0 of 222 (0%) of D. variabilis ticks were infected. All isolated virus belonged to the DTV genotype of POWV. These findings suggest stable transmission of POWV in this focus over ten years and highlight the potential for this agent to emerge as a public health concern.

  16. Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

    2003-07-25

    A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

  17. Optimization of the expression of a laccase gene from Trametes versicolor in Pichia methanolica.

    PubMed

    Guo, Mei; Lu, Fuping; Du, Lianxiang; Pu, Jun; Bai, Dongqing

    2006-08-01

    A cDNA encoding for laccase (Lcc1) was isolated from the ligninolytic fungus Trametes versicolor by reverse transcriptase polymerase chain reaction. The Lcc1 gene was subcloned into the Pichia methanolica expression vector pMETalphaA and transformed into the P. methanolica strains PMAD11 and PMAD16. The extracellular laccase activity of the PMAD11 recombinants was found to be 1.3-fold higher than that of the PMAD16 recombinants. The identity of the recombinant protein was further confirmed by immunodetection using the Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form. The effects of copper concentration, cultivation temperature, pH and methanol concentration in the BMMY on laccase expression were investigated. The laccase activity in the PMAD11 recombinant was up to 12.6 U ml(-1) by optimization.

  18. [Relationship between the methylenetetrahydrofolate reductase gene polymorphism and adverse reactions of high-dose methotrexate in children with acute lymphocytic leukemia].

    PubMed

    Zheng, Miao-Miao; Yue, Li-Jie; Chen, Xiao-Wen; Wen, Fei-Qiu; Li, Chang-Gang; Yang, Chun-Lan; Xie, Cai; Ding, Hui

    2013-03-01

    To study the association between methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and toxicities after high-dose methotrexate (HD-MTX) infusion in children with acute lymphocytic leukemia (ALL). MTHFR variants in 52 children with ALL were determined by reverse transcriptase-polymerase chain reaction-denaturing gradient gel electrophoresis and sequencing. Toxicities of children who received HD-MTX chemotherapy were evaluated according to the National Cancer Institute-Common Toxicity Criteria (NCI-CTC). The children carrying MTHFR 1298AC had a higher risk of developing thrombocytopenia compared with the carriers of the 1298 AA genotype (OR=13.7, 95%CI=1.18-159.36, P=0.036). There was no significant difference in HD-MTX chemotherapy-related adverse effects between the patients with different MTHFR C677T or G1793A genotypes. MTHFR A1298C polymorohism may associate with the toxicity of HD-MTX chemotherapy in children with ALL.

  19. Isolation, sequence identification and tissue expression profiles of 3 novel porcine genes: ASPA, NAGA, and HEXA.

    PubMed

    Shu, Xianghua; Liu, Yonggang; Yang, Liangyu; Song, Chunlian; Hou, Jiafa

    2008-01-01

    The complete coding sequences of 3 porcine genes - ASPA, NAGA, and HEXA - were amplified by the reverse transcriptase polymerase chain reaction (RT-PCR) based on the conserved sequence information of the mouse or other mammals and referenced pig ESTs. These 3 novel porcine genes were then deposited in the NCBI database and assigned GeneIDs: 100142661, 100142664 and 100142667. The phylogenetic tree analysis revealed that the porcine ASPA, NAGA, and HEXA all have closer genetic relationships with the ASPA, NAGA, and HEXA of cattle. Tissue expression profile analysis was also carried out and results revealed that swine ASPA, NAGA, and HEXA genes were differentially expressed in various organs, including skeletal muscle, the heart, liver, fat, kidney, lung, and small and large intestines. Our experiment is the first one to establish the foundation for further research on these 3 swine genes.

  20. Expression of placental protein 14 by the new endometrial cancer cell line MFE-280 in vitro and by endometrial carcinomas in vivo.

    PubMed

    Hackenberg, R; Loos, S; Nia, A H; Kunzmann, R; Schulz, K D

    1998-01-01

    MFE-280 endometrial cancer cells express PP14 (placental protein 14) in vitro. PP14 is normally found in the secretory endometrium and in placental tissue. MFE-280 cells, which are tumorigenic in nude mice, were derived from a recurrent, poorly differentiated endometrial carcinoma. The cells were initially grown in suspension culture and later transferred to monolayer cultures. Karyotyping revealed near-diploidy with a complex heterogeneous aberration pattern. MFE-280 cells were positive for the cytokeratins 7, 8, 18 and 19 as well as for vimentin. The expression of PP14 in MFE-280 cells was demonstrated by immunochemistry and reverse transcriptase--polymerase chain reaction. PP14-mRNA was also detected in one out of five endometrial cancer specimen. In tumor tissue the expression of PP14 was not dependent on progestins.

  1. A Novel Leu92 Mutant of HIV-1 Reverse Transcriptase with a Selective Deficiency in Strand Transfer Causes a Loss of Viral Replication.

    PubMed

    Herzig, Eytan; Voronin, Nickolay; Kucherenko, Nataly; Hizi, Amnon

    2015-08-01

    The process of reverse transcription (RTN) in retroviruses is essential to the viral life cycle. This key process is catalyzed exclusively by the viral reverse transcriptase (RT) that copies the viral RNA into DNA by its DNA polymerase activity, while concomitantly removing the original RNA template by its RNase H activity. During RTN, the combination between DNA synthesis and RNA hydrolysis leads to strand transfers (or template switches) that are critical for the completion of RTN. The balance between these RT-driven activities was considered to be the sole reason for strand transfers. Nevertheless, we show here that a specific mutation in HIV-1 RT (L92P) that does not affect the DNA polymerase and RNase H activities abolishes strand transfer. There is also a good correlation between this complete loss of the RT's strand transfer to the loss of the DNA clamp activity of the RT, discovered recently by us. This finding indicates a mechanistic linkage between these two functions and that they are both direct and unique functions of the RT (apart from DNA synthesis and RNA degradation). Furthermore, when the RT's L92P mutant was introduced into an infectious HIV-1 clone, it lost viral replication, due to inefficient intracellular strand transfers during RTN, thus supporting the in vitro data. As far as we know, this is the first report on RT mutants that specifically and directly impair RT-associated strand transfers. Therefore, targeting residue Leu92 may be helpful in selectively blocking this RT activity and consequently HIV-1 infectivity and pathogenesis. Reverse transcription in retroviruses is essential for the viral life cycle. This multistep process is catalyzed by viral reverse transcriptase, which copies the viral RNA into DNA by its DNA polymerase activity (while concomitantly removing the RNA template by its RNase H activity). The combination and balance between synthesis and hydrolysis lead to strand transfers that are critical for reverse transcription completion. We show here for the first time that a single mutation in HIV-1 reverse transcriptase (L92P) selectively abolishes strand transfers without affecting the enzyme's DNA polymerase and RNase H functions. When this mutation was introduced into an infectious HIV-1 clone, viral replication was lost due to an impaired intracellular strand transfer, thus supporting the in vitro data. Therefore, finding novel drugs that target HIV-1 reverse transcriptase Leu92 may be beneficial for developing new potent and selective inhibitors of retroviral reverse transcription that will obstruct HIV-1 infectivity. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  2. Identification and validation of biomarkers of IgV(H) mutation status in chronic lymphocytic leukemia using microfluidics quantitative real-time polymerase chain reaction technology.

    PubMed

    Abruzzo, Lynne V; Barron, Lynn L; Anderson, Keith; Newman, Rachel J; Wierda, William G; O'brien, Susan; Ferrajoli, Alessandra; Luthra, Madan; Talwalkar, Sameer; Luthra, Rajyalakshmi; Jones, Dan; Keating, Michael J; Coombes, Kevin R

    2007-09-01

    To develop a model incorporating relevant prognostic biomarkers for untreated chronic lymphocytic leukemia patients, we re-analyzed the raw data from four published gene expression profiling studies. We selected 88 candidate biomarkers linked to immunoglobulin heavy-chain variable region gene (IgV(H)) mutation status and produced a reliable and reproducible microfluidics quantitative real-time polymerase chain reaction array. We applied this array to a training set of 29 purified samples from previously untreated patients. In an unsupervised analysis, the samples clustered into two groups. Using a cutoff point of 2% homology to the germline IgV(H) sequence, one group contained all 14 IgV(H)-unmutated samples; the other contained all 15 mutated samples. We confirmed the differential expression of 37 of the candidate biomarkers using two-sample t-tests. Next, we constructed 16 different models to predict IgV(H) mutation status and evaluated their performance on an independent test set of 20 new samples. Nine models correctly classified 11 of 11 IgV(H)-mutated cases and eight of nine IgV(H)-unmutated cases, with some models using three to seven genes. Thus, we can classify cases with 95% accuracy based on the expression of as few as three genes.

  3. Comparison of Enterococcus qPCR analysis results from fresh and marine water samples on two real-time instruments -

    EPA Science Inventory

    EPA is currently considering a quantitative polymerase chain reaction (qPCR) method, targeting Enterococcus spp., for beach monitoring. Improvements in the method’s cost-effectiveness may be realized by the use of newer instrumentation such as the Applied Biosystems StepOneTM a...

  4. Development of a duplex ddPCR assay for detection of “Candidatus Liberibacter asiaticus”

    USDA-ARS?s Scientific Manuscript database

    Huanglongbing (HLB) (aka citrus greening) is a devastating citrus disease associated with “Candidatus Liberibacter asiaticus” (CLas). Currently, diagnosis of CLas in regulatory samples is based on a real-time quantitative polymerase chain reaction (qPCR) assay using 16S rRNA gene specific primers/pr...

  5. Selection and validation of endogenous reference genes for qRT-PCR analysis in leafy spurge (Euphorbia esula)

    USDA-ARS?s Scientific Manuscript database

    Quantitative real-time polymerase chain reaction (qRT-PCR) is the most important tool in measuring levels of gene expression due to its accuracy, specificity, and sensitivity. However, the accuracy of qRT-PCR analysis strongly depends on transcript normalization using stably expressed reference gene...

  6. Real-Time PCR (qPCR) Primer Design Using Free Online Software

    ERIC Educational Resources Information Center

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…

  7. DNA-Based Analyses of Molds in Singapore Public Buildings Results in a Proposed Singapore Environmental Relative Moldiness Index

    EPA Science Inventory

    Dust samples (n=75) were collected from shopping malls, hotels and libraries in Singapore and then analyzed using Mold Specific Quantitative Polymerase Chain Reaction(MSQPCR) for the 36 molds that make up the Environmental Relative Moldiness Index (ERMI). Most of these molds (23/...

  8. DETECTION OF STACHYBOTRYS CHARTARUM USING rRNA, tri5, AND Β-TUBULIN PRIMERS AND DETERMINING THEIR RELATIVE COPY NUMBER BY REAL TIME PCR

    EPA Science Inventory

    This research utilizes the quantitative polymerase chain reaction (qPCR) to determine ribosomal copy number of fungal organisms found in unhealthy indoor environments. Knowing specific copy numbers will allow for greater accuracy in quantification when utilizing current pQCR tec...

  9. Evaluation of reference genes for expression studies in ash (Fraxinus spp.)

    Treesearch

    Loren Rivera-Vega; Praveen Mamidala; Jennifer L. Koch; Mary E. Mason; Omprakash Mittapalli

    2012-01-01

    Ash (Fraxinus spp.) is a dominant tree species in North America, in both managed and natural landscapes. However, due to the rapid invasion by the emerald ash borer (Agrilus planipennis), an exotic invasive insect pest, millions of North American ash trees have been killed. Real-time quantitative polymerase chain reaction (RTq-PCR...

  10. Normalised quantitative polymerase chain reaction for diagnosis of tuberculosis-associated uveitis.

    PubMed

    Barik, Manas Ranjan; Rath, Soveeta; Modi, Rohit; Rana, Rajkishori; Reddy, Mamatha M; Basu, Soumyava

    2018-05-01

    Polymerase chain reaction (PCR)-based diagnosis of tuberculosis-associated uveitis (TBU) in TB-endemic countries is challenging due to likelihood of latent mycobacterial infection in both immune and non-immune cells. In this study, we investigated normalised quantitative PCR (nqPCR) in ocular fluids (aqueous/vitreous) for diagnosis of TBU in a TB-endemic population. Mycobacterial copy numbers (mpb64 gene) were normalised to host genome copy numbers (RNAse P RNA component H1 [RPPH1] gene) in TBU (n = 16) and control (n = 13) samples (discovery cohort). The mpb64:RPPH1 ratios (normalised value) from each TBU and control sample were tested against the current reference standard i.e. clinically-diagnosed TBU, to generate Receiver Operating Characteristic (ROC) curves. The optimum cut-off value of mpb64:RPPH1 ratio (0.011) for diagnosing TBU was identified from the highest Youden index. This cut-off value was then tested in a different cohort of TBU and controls (validation cohort, 20 cases and 18 controls), where it yielded specificity, sensitivity and diagnostic accuracy of 94.4%, 85.0%, and 89.4% respectively. The above values for conventional quantitative PCR (≥1 copy of mpb64 per reaction) were 61.1%, 90.0%, and 74.3% respectively. Normalisation markedly improved the specificity and diagnostic accuracy of quantitative PCR for diagnosis of TBU. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Evaluation of p16 hypermethylation in oral submucous fibrosis: A quantitative and comparative analysis in buccal cells and saliva using real-time methylation-specific polymerase chain reaction.

    PubMed

    Kaliyaperumal, Subadra; Sankarapandian, Sathasivasubramanian

    2016-01-01

    The aim of this study was to quantitatively investigate the hypermethylation of p16 gene in buccal cells and saliva of oral submucous fibrosis (OSMF) patients using real-time quantitative methylation-specific polymerase chain reaction (PCR) and to compare the values of two methods. A total of 120 samples were taken from 60 subjects selected for this study, of which 30 were controls and 30 patients were clinically and histopathologically diagnosed with OSMF. In both groups, two sets of samples were collected, one directly from the buccal cells through cytobrush technique and the other through salivary rinse. We analyzed the samples for the presence of p16 hypermethylation using quantitative real-time PCR. In OSMF, the hypermethylation status of p16 in buccal cells was very high (93.3%) and in salivary samples, it was partially methylated (50%). However, no hypermethylation was found in controls suggesting that significant quantity of p16 hypermethylation was present in buccal cells and saliva in OSMF. This study indicates that buccal cell sampling may be a better method for evaluation than the salivary samples. It signifies that hypermethylation of p16 is an important factor to be considered in epigenetic alterations of normal cells to oral precancer, i.e. OSMF.

  12. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  13. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  14. Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

    PubMed

    Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

    2014-10-29

    Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

  15. Quantification of concentrated Chinese medicine granules by quantitative polymerase chain reaction.

    PubMed

    Lo, Yat-Tung; Shaw, Pang-Chui

    2017-10-25

    Determination of the amount of constituent in a multi-herb product is important for quality control. In concentrated Chinese medicine granules (CCMG), no dregs are left after dissolution of the CCMG. This study is the first to examine the feasibility of using quantitative polymerase chain reaction (qPCR) to find the amount of CCMG in solution form. DNA was extracted from Hirudo and Zaocys CCMG mixed at different ratios and amplified in qPCR using species-specific primers. The threshold cycle (C T ) obtained was compared with the respective standard curves. Results showed that reproducible quantification results could be obtained (1) for 5-50mg CCMG using a modified DNA extraction protocol, (2) amongst DNA extracted from the same batch of CCMG and (3) amongst different batches of CCMG from the same company. This study demonstrated the constitute amount of CCMG in a mixture could be determined using qPCR. This work has extended the application of DNA techniques for the quantification of herbal products and this approach may be developed for quality assurance in the CCMG industry. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  17. Detection of Haemophilus influenzae in respiratory secretions from pneumonia patients by quantitative real-time polymerase chain reaction.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Kirsebom, Leif A; Olcén, Per; Blomberg, Jonas; Herrmann, Björn

    2009-08-01

    A quantitative real-time polymerase chain reaction (PCR) based on the omp P6 gene was developed to detect Haemophilus influenzae. Its specificity was determined by analysis of 29 strains of 11 different Haemophilus spp. and was compared with PCR assays having other target genes: rnpB, 16S rRNA, and bexA. The method was evaluated on nasopharyngeal aspirates from 166 adult patients with community-acquired pneumonia. When 10(4) DNA copies/mL was used as cutoff limit for the method, P6 PCR had a sensitivity of 97.5% and a specificity of 96.0% compared with the culture. Of 20 culture-negative but P6 PCR-positive cases, 18 were confirmed by fucK PCR as H. influenzae. Five (5.9%) of 84 nasopharyngeal aspirates from adult controls tested PCR positive. We conclude that the P6 real-time PCR is both sensitive and specific for identification of H. influenzae in respiratory secretions. Quantification facilitates discrimination between disease-causing H. influenzae strains and commensal colonization.

  18. Using Reference Quantitative Polymerase Chain Reaction to Assess the Clinical Performance of the Paracheck-Pf® Rapid Diagnostic Test in a Field Setting in Uganda.

    PubMed

    Mitran, Catherine J; Mbonye, Anthony K; Hawkes, Michael; Yanow, Stephanie K

    2018-06-04

    Malaria rapid diagnostic tests (RDTs) are widely used in clinical and surveillance settings. However, the performance of most RDTs has not been characterized at parasite densities below detection by microscopy. We present findings from Uganda, where RDT results from 491 participants with suspected malaria were correlated with quantitative polymerase chain reaction (qPCR)-defined parasitemia. Compared with qPCR, the sensitivity and specificity of the RDT for Plasmodium falciparum mono-infections were 76% (95% confidence interval [CI]: 68-83%) and 95% (95% CI: 92-97%), respectively. The sensitivity of the RDT at parasite densities between 0.2 and 200 parasites/μL was surprisingly high (87%, 95% CI: 74-94%). The high sensitivity of the RDT is likely because of histidine-rich protein 2 from submicroscopic infections, gametocytes, or sequestered parasites. These findings underscore the importance of evaluating different RDTs in field studies against qPCR reference testing to better define the sensitivity and specificity, particularly at low parasite densities.

  19. A modified single-tube one-step product-enhanced reverse transcriptase (mSTOS-PERT) assay with heparin as DNA polymerase inhibitor for specific detection of RTase activity.

    PubMed

    Fan, Xiao-Yong; Lü, Guo-Zhen; Wu, Li-Na; Chen, Jing-Hua; Xu, Wen-Qing; Zhao, Chun-Nü; Guo, Sheng-Qi

    2006-12-01

    Current regulations and recommendations proposed for the production of vaccines in continuous cell lines of any origin demand that these be free of exogenous viruses, particularly retroviruses. Recently, the ultra-sensitive product-enhanced reverse transcriptase (PERT) assay can be used to detect minute of reverse transcriptase (RTase) in single retroviral particle and is 10(6) times more sensitive than the conventional RTase assays. However, coincidental with this increase in sensitivity is an increase in false-positive reactions derived from contaminating cellular DNA polymerases, which are known to have RTase-like activities. To develop a modified single-tube one-step PERT (mSTOS-PERT) assay with improvements on decreasing significantly the level of false-positive reactions, and to evaluate the mSTOS-PERT assay for sensitivity and specificity. Ampliwaxtrade mark was used to compartmentalize the reverse transcription (RT) and PCR step in the same micro-tube with more efficiency and reproducibility, while maintaining the high sensitivity. The DNA amplification products were separated by 2% agarose gel electrophoresis, and then analyzed by non-isotopic Southern blot hybridization. A wide variety of cell lines used in biologicals production were detected to validate the improved mSTOS-PERT assay. The detection limit for the mSTOS-PERT assay was at least 10(-9)U, when using AMV-RTase as a positive control. Furthermore, heparin involvement in the RT step can eliminate completely the false-positive PERT signals which are exhibited by cellular polymerases such as DNA-dependent DNA polymerase alpha, gamma released by cell death. Most mammalian cells (MRC-5, Vero, WISH, 2BS, RK-13, MDCK, etc.) are PERT-negative in cell supernatants. Some PERT-positive signals in cell lysates were found to be introduced by the cellular DNA polymerases and could be inhibited specifically by heparin. Chick cells derived from either chick embryo fibroblasts (CEF) or allantoic fluid from SPF embryonated eggs, murine hybridoma cell SP2/0, etc., contained authentic RTase activities, which could not be inactivated by heparin. The improved mSTOS-PERT assay described here may distinguish the genuine RTase activity from cellular polymerases with high sensitivity and specificity, and is rapid and easy to perform to screen for the possible contamination of minute retroviruses in the cell substrates used in vaccine production.

  20. A sensitive detection method for MPLW515L or MPLW515K mutation in chronic myeloproliferative disorders with locked nucleic acid-modified probes and real-time polymerase chain reaction.

    PubMed

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M

    2008-09-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy.

  1. Comprehensive evaluation of candidate reference genes for gene expression studies in Lysiphlebia japonica (Hymenoptera: Aphidiidae) using RT-qPCR.

    PubMed

    Gao, Xue-Ke; Zhang, Shuai; Luo, Jun-Yu; Wang, Chun-Yi; Lü, Li-Min; Zhang, Li-Juan; Zhu, Xiang-Zhen; Wang, Li; Lu, Hui; Cui, Jin-Jie

    2017-12-30

    Lysiphlebia japonica (Ashmead) is a predominant parasitoid of cotton-melon aphids in the fields of northern China with a proven ability to effectively control cotton aphid populations in early summer. For accurate normalization of gene expression in L. japonica using quantitative reverse transcriptase-polymerase chain reaction (RT-qPCR), reference genes with stable gene expression patterns are essential. However, no appropriate reference genes is L. japonica have been investigated to date. In the present study, 12 selected housekeeping genes from L. japonica were cloned. We evaluated the stability of these genes under various experimental treatments by RT-qPCR using four independent (geNorm, NormFinder, BestKeeper and Delta Ct) and one comparative (RefFinder) algorithm. We identified genes showing the most stable levels of expression: DIMT, 18S rRNA, and RPL13 during different stages; AK, RPL13, and TBP among sexes; EF1A, PPI, and RPL27 in different tissues, and EF1A, RPL13, and PPI in adults fed on different diets. Moreover, the expression profile of a target gene (odorant receptor 1, OR1) studied during the developmental stages confirms the reliability of the chosen selected reference genes. This study provides for the first time a comprehensive list of suitable reference genes for gene expression studies in L. japonica and will benefit subsequent genomics and functional genomics research on this natural enemy. Copyright © 2017. Published by Elsevier B.V.

  2. Methotrexate increases expression of cell cycle checkpoint genes via Jun-N-terminal kinase activation

    PubMed Central

    Spurlock, Charles F.; Tossberg, John T.; Fuchs, Howard A.; Olsen, Nancy J.; Aune, Thomas M.

    2011-01-01

    Objective To assess defects in expression of critical cell cycle checkpoint genes and proteins in subjects with rheumatoid arthritis relative to presence or absence of methotrexate medication and assess the role of Jun N-terminal kinase in methotrexate induction of these genes. Methods Flow cytometry analysis was used to quantify changes in intracellular proteins, measure reactive oxygen species (ROS), and determine apoptosis in different lymphoid populations. Quantitative reverse transcriptase polymerase chain reaction (Q-RT-PCR) was employed to determine changes in cell cycle checkpoint target genes. Results RA subjects express lower baseline levels of MAPK9, TP53, CDKN1A, CDKN1B, CHEK2, and RANGAP1 messenger RNA (mRNA) and total JNK protein. MAPK9, TP53, CDKN1A, and CDKN1B mRNA expression, but not CHEK2, and RANGAP1, is higher in patients on low-dose MTX therapy. Further, JNK levels inversely correlate with CRP levels in RA patients. In tissue culture, MTX induces expression of both p53 and p21 by JNK2 and JNK1-dependent mechanisms, respectively, while CHEK2 and RANGAP1 are not induced by MTX. MTX also induces ROS production, JNK activation, and sensitivity to apoptosis in activated T cells. Supplementation with tetrahydrobiopterin blocks these MTX-mediated effects. Conclusions Our findings support the notion that MTX restores some, but not all of the proteins contributing to cell cycle checkpoint deficiencies in RA T cells by a JNK dependent pathway. PMID:22183962

  3. Viral shedding of 2009 pandemic H1N1 and evaluation of quarantine recommendations.

    PubMed

    Chin, Bum Sik; Chae, Yun Tae; Choi, Hee Kyung; Baek, Ji-Hyeon; Jin, Sung Joon; Shin, So Youn; Han, Sang Hoon; Choi, Jun Yong; Kim, Chang Oh; Song, Young Goo; Jeong, Seok Hoon; Kim, June Myung

    2012-01-01

    Public health authorities recommend that isolation precautions for influenza should be continued for 7 days after illness onset or until 24 h after the resolution of symptoms, whichever event lasts longer. However, little data are available regarding the duration of isolation for patients with 2009 pandemic H1N1 (pH1N1). We recruited patients with confirmed pH1N1 virus infection at a 2,000-bed tertiary care center. Influenza viral loads from oropharyngeal swab specimens were serially determined by reverse transcriptase quantitative polymerase chain reaction every other day, and the risk factors for prolonged viral shedding were investigated. To evaluate the current recommendations for isolation precautions, we measured the intervals between symptom onset and the last viral RNA detection, and that between the last viral RNA detection and the point at which the patient was symptom-free for 24 h. From November 2009 to January 2010, 26 patients were enrolled, and viral RNA was detected in more than half of the eligible patients (10 of 19, 52.6%) for ≥7 days after symptom onset. While evaluating the policy for lifting quarantine, we found that viral RNA was detected in 4 of 15 patients (26.7%) beyond the recommended duration of isolation. In conclusion, viral RNA was detected in a substantial proportion of hospitalized patients even when they fulfilled the recommended conditions for lifting quarantine, and we believe that more prudence is required in this aspect.

  4. BIRC6/Apollon gene expression in childhood acute leukemia: impact on therapeutic response and prognosis.

    PubMed

    Ismail, Eman Abdel Rahman; Mahmoud, Hanan Mohamed; Tawfik, Lamis Mohamed; Habashy, Deena Mohamed; Adly, Amira Abdel Moneam; El-Sherif, Nayera Hazaa; Abdelwahab, Mahmoud Ahmed

    2012-02-01

    Although BIRC6/Apollon seems to play a critical role as an antiapoptotic regulator, its clinical relevance in acute leukemia remains largely elusive. Therefore, we aimed to investigate BIRC6 gene expression in childhood acute leukemia in relation to clinicopathological characteristics at presentation, therapeutic response, and prognosis. BIRC6 expression level was assessed in 75 children with acute leukemia; 30 patients with acute myeloblastic leukemia (AML) and 45 patients with acute lymphoblastic leukemia (ALL) using real-time quantitative reverse transcriptase-polymerase chain reaction. The median level of BIRC6 expression did not differ significantly between AML and ALL patients. BIRC6 expression level was higher in patients with AML and ALL with extramedullary involvement, white blood cell (WBC) count ≥ 10 × 10(9) /L, and unfavorable cytogenetics at diagnosis. BIRC6 gene expression was higher in patients with unfavorable response to therapy at day 14, those who developed relapse or died in both leukemic groups. The best cutoff value of BIRC6 to predict therapeutic response and disease outcome was determined. AML and ALL patients with BIRC6 overexpression had significantly shorter overall and disease free survivals. This is the first report to study BIRC6 gene in pediatric ALL. Our results suggested that BIRC6 gene expression could be considered as an adverse risk factor in childhood acute leukemia and, hence, could be used to guide therapeutic regimens. © 2012 John Wiley & Sons A/S.

  5. Molecular Validation of Chondrogenic Differentiation and Hypoxia Responsiveness of Platelet-Lysate Expanded Adipose Tissue-Derived Human Mesenchymal Stromal Cells.

    PubMed

    Galeano-Garces, Catalina; Camilleri, Emily T; Riester, Scott M; Dudakovic, Amel; Larson, Dirk R; Qu, Wenchun; Smith, Jay; Dietz, Allan B; Im, Hee-Jeong; Krych, Aaron J; Larson, A Noelle; Karperien, Marcel; van Wijnen, Andre J

    2017-07-01

    To determine the optimal environmental conditions for chondrogenic differentiation of human adipose tissue-derived mesenchymal stromal/stem cells (AMSCs). In this investigation we specifically investigate the role of oxygen tension and 3-dimensional (3D) culture systems. Both AMSCs and primary human chondrocytes were cultured for 21 days in chondrogenic media under normoxic (21% oxygen) or hypoxic (2% oxygen) conditions using 2 distinct 3D culture methods (high-density pellets and poly-ε-caprolactone [PCL] scaffolds). Histologic analysis of chondro-pellets and the expression of chondrocyte-related genes as measured by reverse transcriptase quantitative polymerase chain reaction were used to evaluate the efficiency of differentiation. AMSCs are capable of expressing established cartilage markers including COL2A1, ACAN, and DCN when grown in chondrogenic differentiation media as determined by gene expression and histologic analysis of cartilage markers. Expression of several cartilage-related genes was enhanced by low oxygen tension, including ACAN and HAPLN1. The pellet culture environment also promoted the expression of hypoxia-inducible cartilage markers compared with cells grown on 3D scaffolds. Cell type-specific effects of low oxygen and 3D environments indicate that mesenchymal cell fate and differentiation potential is remarkably sensitive to oxygen. Genetic programming of AMSCs to a chondrocytic phenotype is effective under hypoxic conditions as evidenced by increased expression of cartilage-related biomarkers and biosynthesis of a glycosaminoglycan-positive matrix. Lower local oxygen levels within cartilage pellets may be a significant driver of chondrogenic differentiation.

  6. Supervised Risk Predictor of Breast Cancer Based on Intrinsic Subtypes

    PubMed Central

    Parker, Joel S.; Mullins, Michael; Cheang, Maggie C.U.; Leung, Samuel; Voduc, David; Vickery, Tammi; Davies, Sherri; Fauron, Christiane; He, Xiaping; Hu, Zhiyuan; Quackenbush, John F.; Stijleman, Inge J.; Palazzo, Juan; Marron, J.S.; Nobel, Andrew B.; Mardis, Elaine; Nielsen, Torsten O.; Ellis, Matthew J.; Perou, Charles M.; Bernard, Philip S.

    2009-01-01

    Purpose To improve on current standards for breast cancer prognosis and prediction of chemotherapy benefit by developing a risk model that incorporates the gene expression–based “intrinsic” subtypes luminal A, luminal B, HER2-enriched, and basal-like. Methods A 50-gene subtype predictor was developed using microarray and quantitative reverse transcriptase polymerase chain reaction data from 189 prototype samples. Test sets from 761 patients (no systemic therapy) were evaluated for prognosis, and 133 patients were evaluated for prediction of pathologic complete response (pCR) to a taxane and anthracycline regimen. Results The intrinsic subtypes as discrete entities showed prognostic significance (P = 2.26E-12) and remained significant in multivariable analyses that incorporated standard parameters (estrogen receptor status, histologic grade, tumor size, and node status). A prognostic model for node-negative breast cancer was built using intrinsic subtype and clinical information. The C-index estimate for the combined model (subtype and tumor size) was a significant improvement on either the clinicopathologic model or subtype model alone. The intrinsic subtype model predicted neoadjuvant chemotherapy efficacy with a negative predictive value for pCR of 97%. Conclusion Diagnosis by intrinsic subtype adds significant prognostic and predictive information to standard parameters for patients with breast cancer. The prognostic properties of the continuous risk score will be of value for the management of node-negative breast cancers. The subtypes and risk score can also be used to assess the likelihood of efficacy from neoadjuvant chemotherapy. PMID:19204204

  7. Pathological and immunological responses associated with differential survival of Chinook salmon following Renibacterium salmoninarum challenge

    USGS Publications Warehouse

    Metzger, David C.; Elliott, Diane G.; Wargo, Andrew; Park, Linda K.; Purcell, Maureen K.

    2010-01-01

    Chinook salmon Oncorhynchus tshawytscha are highly susceptible to Renibacterium salmoninarum, the causative agent of bacterial kidney disease (BKD). Previously we demonstrated that introduced Chinook salmon from Lake Michigan, Wisconsin (WI), USA, have higher survival following R. salmoninarum challenge relative to the progenitor stock from Green River, Washington, USA. In the present study, we investigated the pathological and immunological responses that are associated with differential survival in the 2 Chinook salmon stocks following intra-peritoneal R. salmoninarum challenge of 2 different cohort years (2003 and 2005). Histological evaluation revealed delayed appearance of severe granulomatous lesions in the kidney and lower overall prevalence of membranous glomerulopathy in the higher surviving WI stock. The higher survival WI stock had a lower bacterial load at 28 d post-infection, as measured by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR). However, at all other time points, bacterial load levels were similar despite higher mortality in the more susceptible Green River stock, suggesting the possibility that the stocks may differ in their tolerance to infection by the bacterium. Interferon-γ, inducible nitric oxide synthase (iNOS), Mx-1, and transferrin gene expression were up-regulated in both stocks following challenge. A trend of higher iNOS gene expression at later time points (≥28 d post-infection) was observed in the lower surviving Green River stock, suggesting the possibility that higher iNOS expression may contribute to greater pathology in that stock.

  8. A novel TFF2 splice variant (ΔEX2TFF2) correlates with longer overall survival time in cholangiocarcinoma

    PubMed Central

    KAMLUA, SURASEE; PATRAKITKOMJORN, SIRIPORN; JEARANAIKOON, PATCHAREE; MENHENIOTT, TREVELYAN R.; GIRAUD, ANDREW S.; LIMPAIBOON, TEMDUANG

    2012-01-01

    Trefoil factor 2 (TFF2) is a member of trefoil factor family found to be overexpressed in many cancers including cholangiocarcinoma (CCA). The majority of studies have focused on wild-type TFF2 (wtTFF2) expression, but information regarding alternative splicing variants of TFF2 mRNA has not been reported. In this study, we aimed to identify and quantify a novel TFF2 splice variant in cholangiocarcinoma (CCA). Seventy-eight tumors and 15 normal adjacent tissues were quantified for the expression of the TFF2 splice variant relative to wild-type (wt) TFF2 mRNA using quantitative reverse transcriptase polymerase chain reaction (QRT-PCR). The ratio of TFF2 splice variant against wtTFF2 was analyzed for associations with clinical parameters. We found a novel TFF2 splice variant, exon 2 skipping (ΔEX2TFF2), resulting in a stop codon (TAG) at exon 1. The ΔEX2TFF2/wtTFF2 ratio in tumors was significantly higher than in normal tissue (P<0.01). Interestingly, high ΔEX2TFF2/wtTFF2 ratio was significantly associated with good prognosis compared with low ratio (P=0.017). In contrast, the presence of wtTFF2 protein was associated with poor survival of CCA patients (P=0.034). This is the first report of a trefoil factor splice variant and its potential application as a prognostic biomarker in CCA. PMID:22159958

  9. Liarozole inhibits transforming growth factor-β3–mediated extracellular matrix formation in human three-dimensional leiomyoma cultures

    PubMed Central

    Levy, Gary; Malik, Minnie; Britten, Joy; Gilden, Melissa; Segars, James; Catherino, William H.

    2014-01-01

    Objective To investigate the impact of liarozole on transforming growth factor-β3 (TGF-β3) expression, TGF-β3 controlled profibrotic cytokines, and extracellular matrix formation in a three-dimensional (3D) leiomyoma model system. Design Molecular and immunohistochemical analysis in a cell line evaluated in a three-dimensional culture. Setting Laboratory study. Patient(s) None. Intervention(s) Treatment of leiomyoma and myometrial cells with liarozole and TGF-β3 in a three-dimensional culture system. Main Outcome Measure(s) Quantitative real-time reverse-transcriptase polymerase chain reaction and Western blotting to assess fold gene and protein expression of TGF-β3 and TGF-β3 regulated fibrotic cytokines: collagen 1A1 (COL1A1), fibronectin, and versican before and after treatment with liarozole, and confirmatory immunohistochemical stains of treated three-dimensional cultures. Result(s) Both TGF-β3 gene and protein expression were elevated in leiomyoma cells compared with myometrium in two-dimensional and 3D cultures. Treatment with liarozole decreased TGF-β3 gene and protein expression. Extracellular matrix components versican, COL1A1, and fibronectin were also decreased by liarozole treatment in 3D cultures. Treatment of 3D cultures with TGF-β3 increased gene expression and protein production of COL1A1, fibronectin, and versican. Conclusion(s) Liarozole decreased TGF-β3 and TGF-β3–mediated extracellular matrix expression in a 3D uterine leiomyoma culture system. PMID:24825427

  10. Identification of testis-specific male contraceptive targets: insights from transcriptional profiling of the cycle of the rat seminiferous epithelium and purified testicular cells.

    PubMed

    Johnston, Daniel S; Jelinsky, Scott A; Zhi, Yu; Finger, Joshua N; Kopf, Gregory S; Wright, William W

    2007-12-01

    In an effort to identify novel targets for the development of nonhormonal male contraceptives, genome-wide transcriptional profiling of the rat testis was performed. Specifically, enzymatically purified spermatogonia plus early spermatocyctes, pachytene spermatocytes, round spermatids, and Sertoli cells was analyzed along with microdissected rat seminiferous tubules at stages I, II-III, IV-V, VI, VIIa,b, VIIc,d, VIII, IX- XI, XII, XIII-XIV of the cycle of the seminiferous epithelium using RAE 230_2.0 microarrays. The combined analysis of these studies identified 16,971 expressed probe sets on the array. How these expression data, combined with additional bioinformatic data analysis and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analysis, led to the identification of 58 genes that have 1000-fold higher expression transcriptionally in the testis when compared to over 20 other nonreproductive tissues is described. The products of these genes may play important roles in testicular and/or sperm function, and further investigation on their utility as nonhormonal contraceptive targets is warranted. Moreover, these microarray data have been used to expedite the identification of a mutation in RIKEN cDNA 2410004F06 gene as likely being responsible for spermatogenic failure in a line of infertile mice generated by N-ethyl-N-nitrosourea (ENU) mutagenesis. The microarray data and the qRT-PCR data described are available in the Mammalian Reproductive Genetics database (http://mrg.genetics.washington.edu/).

  11. Assessment of the U937 cell line for the detection of contact allergens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Python, Francois; Goebel, Carsten; Aeby, Pierre

    2007-04-15

    The human myeloid cell line U937 was evaluated as an in vitro test system to identify contact sensitizers in order to develop alternatives to animal tests for the cosmetic industry. Specific culture conditions (i.e., presence of interleukin-4, IL-4) were applied to obtain a dendritic cell-like phenotype. In the described test protocol, these cells were exposed to test chemicals and then analyzed by flow cytometry for CD86 expression and by quantitative real-time reverse transcriptase-polymerase chain reaction for IL-1{beta} and IL-8 gene expressions. Eight sensitizers, three non-sensitizers and five oxidative hair dye precursors were examined after 24-, 48- and 72-h exposure times.more » Test item-specific modulations of the chosen activation markers (CD86, IL-1{beta} and IL-8) suggest that this U937 activation test could discriminate test items classified as contact sensitizers or non-sensitizers in the local lymph node assay in mice (LLNA). More specifically, a test item can be considered as a potential sensitizer when it significantly induced the upregulation of the expression of at least two markers. Using this approach, we could correctly evaluate the dendritic cell (DC) activation potential for 15 out of 16 tested chemicals. We conclude that the U937 activation test may represent an useful tool in a future in vitro test battery for predicting sensitizing properties of chemicals.« less

  12. Pluronic-based micelle encapsulation potentiates myricetin-induced cytotoxicity in human glioblastoma cells

    PubMed Central

    Tang, Xiang-Jun; Huang, Kuan-Ming; Gui, Hui; Wang, Jun-Jie; Lu, Jun-Ti; Dai, Long-Jun; Zhang, Li; Wang, Gang

    2016-01-01

    As one of the natural herbal flavonoids, myricetin has attracted much research interest, mainly owing to its remarkable anticancer properties and negligible side effects. It holds great potential to be developed as an ideal anticancer drug through improving its bioavailability. This study was performed to investigate the effects of Pluronic-based micelle encapsulation on myricetin-induced cytotoxicity and the mechanisms underlying its anticancer properties in human glioblastoma cells. Cell viability was assessed using a methylthiazol tetrazolium assay and a real-time cell analyzer. Immunoblotting and quantitative reverse transcriptase polymerase chain reaction techniques were used for determining the expression levels of related molecules in protein and mRNA. The results indicated that myricetin-induced cytotoxicity was highly potentiated by the encapsulation of myricetin. Mitochondrial apoptotic pathway was demonstrated to be involved in myricetin-induced glioblastoma cell death. The epidermal growth factor receptor (EGFR)/PI3K/Akt pathway located in the plasma membrane and cytosol and the RAS-ERK pathway located in mitochondria served as upstream and downstream targets, respectively, in myricetin-induced apoptosis. MiR-21 inhibitors interrupted the expression of EGFR, p-Akt, and K-Ras in the same fashion as myricetin-loaded mixed micelles (MYR-MCs) and miR-21 expression were dose-dependently inhibited by MYR-MCs, indicating the interaction of miR-21 with MYR-MCs. This study provided evidence supportive of further development of MYR-MC formulation for preferentially targeting mitochondria of glioblastoma cells. PMID:27757032

  13. Gene expression profiling analysis of the effects of low-intensity pulsed ultrasound on induced pluripotent stem cell-derived neural crest stem cells.

    PubMed

    Xia, Bin; Zou, Yang; Xu, Zhiling; Lv, Yonggang

    2017-11-01

    Low-intensity pulsed ultrasound (LIPUS) is a noninvasive technique that has been shown to affect cell proliferation, migration, and differentiation and promote the regeneration of damaged peripheral nerve. Our previous studies had proved that LIPUS can significantly promote the neural differentiation of induced pluripotent stem cell-derived neural crest stem cells (iPSCs-NCSCs) and enhance the repair of rat-transected sciatic nerve. To further explore the underlying mechanisms of LIPUS treatment of iPSCs-NCSCs, this study reported the gene expression profiling analysis of iPSCs-NCSCs before and after LIPUS treatment using the RNA-sequencing (RNA-Seq) method. It was found that expression of 76 genes of iPSCs-NCSCs cultured in a serum-free neural induction medium and expression of 21 genes of iPSCs-NCSCs cultured in a neuronal differentiation medium were significantly changed by LIPUS treatment. The differentially expressed genes are related to angiogenesis, nervous system activity and functions, cell activities, and so on. The RNA-seq results were further verified by a quantitative real-time reverse transcriptase polymerase chain reaction (qRT-PCR). High correlation was observed between the results obtained from qRT-PCR and RNA-Seq. This study presented new information on the global gene expression patterns of iPSCs-NCSCs after LIPUS treatment and may expand the understanding of the complex molecular mechanism of LIPUS treatment of iPSCs-NCSCs. © 2017 International Union of Biochemistry and Molecular Biology, Inc.

  14. A small noncoding RNA signature found in exosomes of GBM patient serum as a diagnostic tool.

    PubMed

    Manterola, Lorea; Guruceaga, Elizabeth; Gállego Pérez-Larraya, Jaime; González-Huarriz, Marisol; Jauregui, Patricia; Tejada, Sonia; Diez-Valle, Ricardo; Segura, Victor; Samprón, Nicolás; Barrena, Cristina; Ruiz, Irune; Agirre, Amaia; Ayuso, Angel; Rodríguez, Javier; González, Alvaro; Xipell, Enric; Matheu, Ander; López de Munain, Adolfo; Tuñón, Teresa; Zazpe, Idoya; García-Foncillas, Jesús; Paris, Sophie; Delattre, Jean Yves; Alonso, Marta M

    2014-04-01

    Glioblastoma multiforme (GBM) is the most frequent malignant brain tumor in adults, and its prognosis remains dismal despite intensive research and therapeutic advances. Diagnostic biomarkers would be clinically meaningful to allow for early detection of the tumor and for those cases in which surgery is contraindicated or biopsy results are inconclusive. Recent findings show that GBM cells release microvesicles that contain a select subset of cellular proteins and RNA. The aim of this hypothesis-generating study was to assess the diagnostic potential of miRNAs found in microvesicles isolated from the serum of GBM patients. To control disease heterogeneity, we used patients with newly diagnosed GBM. In the discovery stage, PCR-based TaqMan Low Density Arrays followed by individual quantitative reverse transcriptase polymerase chain reaction were used to test the differences in the miRNA expression levels of serum microvesicles among 25 GBM patients and healthy controls paired by age and sex. The detected noncoding RNAs were then validated in another 50 GBM patients. We found that the expression levels of 1 small noncoding RNA (RNU6-1) and 2 microRNAs (miR-320 and miR-574-3p) were significantly associated with a GBM diagnosis. In addition, RNU6-1 was consistently an independent predictor of a GBM diagnosis. Altogether our results uncovered a small noncoding RNA signature in microvesicles isolated from GBM patient serum that could be used as a fast and reliable differential diagnostic biomarker.

  15. Characterization of xanthine dehydrogenase and aldehyde oxidase of Marsupenaeus japonicus and their response to microbial pathogen.

    PubMed

    Okamura, Yo; Inada, Mari; Elshopakey, Gehad Elsaid; Itami, Toshiaki

    2018-05-16

    Reactive oxygen species (ROS) play key roles in many physiological processes. In particular, the sterilization mechanism of bacteria using ROS in macrophages is a very important function for biological defense. Xanthine dehydrogenase (XDH) and aldehyde oxidase (AOX), members of the molybdo-flavoenzyme subfamily, are known to generate ROS. Although these enzymes occur in many vertebrates, some insects, and plants, little research has been conducted on XDHs and AOXs in crustaceans. Here, we cloned the entire cDNA sequences of XDH (MjXDH: 4328 bp) and AOX (MjAOX: 4425 bp) from Marsupenaeus japonicus (kuruma shrimp) using reverse transcriptase-polymerase chain reaction (RT-PCR) and random amplification of cDNA ends (RACE). Quantitative real-time RT-PCR transcriptional analysis revealed that MjXDH mRNA is highly expressed in heart and stomach tissues, whereas MjAOX mRNA is highly expressed in the lymphoid organ and intestinal tissues. Furthermore, expression of MjAOX was determined to be up-regulated in the lymphoid organ in response to Vibrio penaeicida at 48 and 72 h after injection; in contrast, hydrogen peroxide (H 2 O 2 ) concentrations increased significantly at 6, 12, 48, and 72 h after injection with white spot syndrome virus (WSSV) and at 72 h after injection with V. penaeicida. To the best of our knowledge, this study is the first to have identified and cloned XDH and AOX from a crustacean species.

  16. Yellow Fever Virus Modulates the Expression of Key Proteins Related to the microRNA Pathway in the Human Hepatocarcinoma Cell Line HepG2.

    PubMed

    Holanda, Gustavo Moraes; Casseb, Samir Mansour Moraes; Mello, Karla Fabiane Lopes; Vasconcelos, Pedro Fernando Costa; Cruz, Ana Cecília Ribeiro

    2017-06-01

    Yellow fever is a zoonotic disease caused by the yellow fever virus (YFV) and transmitted by mosquitoes of the family Culicidae. It is well known that cellular and viral microRNAs (miRNAs) are involved in modulation of viral and cellular gene expression, as well as immune response, and are considered by the scientific community as possible targets for an effective therapy against viral infections. This regulation may be involved in different levels of infection and clinical symptomatology. We used viral titration techniques, viral kinetics from 24 to 96 hours postinfection (hpi), and analyzed the expression of key proteins related to the miRNA pathway by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). The expression of Dicer was different when compared over the course of infection by the distinct YFV genotypes. Drosha expression was similar during infection by YFV genotype 1 or 2, with a decrease in their expression over time and a slight increase in 96 hpi. Ago1, Ago2, and Ago4 showed different levels of expression between the viral genotypes: for YFV genotype 1 infection, Ago1 presented a positive expression, while for YFV genotype 2, it showed a negative expression, when compared with negative controls. We conclude that YFV infection modulates the proteins involved in miRNA biogenesis, which can regulate both viral replication and cellular immune response.

  17. In smokers, Sonic hedgehog modulates pulmonary endothelial function through vascular endothelial growth factor.

    PubMed

    Henno, Priscilla; Grassin-Delyle, Stanislas; Belle, Emeline; Brollo, Marion; Naline, Emmanuel; Sage, Edouard; Devillier, Philippe; Israël-Biet, Dominique

    2017-05-23

    Tobacco-induced pulmonary vascular disease is partly driven by endothelial dysfunction. The Sonic hedgehog (SHH) pathway is involved in vascular physiology. We sought to establish whether the SHH pathway has a role in pulmonary endothelial dysfunction in smokers. The ex vivo endothelium-dependent relaxation of pulmonary artery rings in response to acetylcholine (Ach) was compared in 34 current or ex-smokers and 8 never-smokers. The results were expressed as a percentage of the contraction with phenylephrine. We tested the effects of SHH inhibitors (GANT61 and cyclopamine), an SHH activator (SAG) and recombinant VEGF on the Ach-induced relaxation. The level of VEGF protein in the pulmonary artery ring was measured in an ELISA. SHH pathway gene expression was quantified in reverse transcriptase-quantitative polymerase chain reactions. Ach-induced relaxation was much less intense in smokers than in never-smokers (respectively 24 ± 6% and 50 ± 7% with 10 -4 M Ach; p = 0.028). All SHH pathway genes were expressed in pulmonary artery rings from smokers. SHH inhibition by GANT61 reduced Ach-induced relaxation and VEGF gene expression in the pulmonary artery ring. Recombinant VEGF restored the ring's endothelial function. VEGF gene and protein expression levels in the pulmonary artery rings were positively correlated with the degree of Ach-induced relaxation and negatively correlated with the number of pack-years. SHH pathway genes and proteins are expressed in pulmonary artery rings from smokers, where they modulate endothelial function through VEGF.

  18. Cloning of an ADP-ribosylation factor gene from banana (Musa acuminata) and its expression patterns in postharvest ripening fruit.

    PubMed

    Wang, Yuan; Wu, Jing; Xu, Bi-Yu; Liu, Ju-Hua; Zhang, Jian-Bin; Jia, Cai-Hong; Jin, Zhi-Qiang

    2010-08-15

    A full-length cDNA encoding an ADP-ribosylation factor (ARF) from banana (Musa acuminata) fruit was cloned and named MaArf. It contains an open reading frame encoding a 181-amino-acid polypeptide. Sequence analysis showed that MaArf shared high similarity with ARF of other plant species. The genomic sequence of MaArf was also obtained using polymerase chain reaction (PCR). Sequence analysis showed that MaArf was a split gene containing five exons and four introns in genomic DNA. Reverse-transcriptase PCR was used to analyze the spatial expression of MaArf. The results showed that MaArf was expressed in all the organs examined: root, rhizome, leaf, flower and fruit. Real-time quantitative PCR was used to explore expression patterns of MaArf in postharvest banana. There was differential expression of MaArf associated with ethylene biosynthesis. In naturally ripened banana, expression of MaArf was in accordance with ethylene biosynthesis. However, in 1-methylcyclopropene-treated banana, the expression of MaArf was inhibited and changed little. When treated with ethylene, MaArf expression in banana fruit significantly increased in accordance with ethylene biosynthesis; the peak of MaArf was 3 d after harvest, 11 d earlier than for naturally ripened banana fruits. These results suggest that MaArf is induced by ethylene in regulating postharvest banana ripening. Finally, subcellular localization assays showed the MaArf protein in the cytoplasm. Copyright 2010 Elsevier GmbH. All rights reserved.

  19. Low-level lasers and mRNA levels of reference genes used in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Teixeira, A. F.; Machado, Y. L. R. C.; Fonseca, A. S.; Mencalha, A. L.

    2016-11-01

    Low-level lasers are widely used for the treatment of diseases and antimicrobial photodynamic therapy. Reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) is widely used to evaluate mRNA levels and output data from a target gene are commonly relative to a reference mRNA that cannot vary according to treatment. In this study, the level of reference genes from Escherichia coli exposed to red or infrared lasers at different fluences was evaluated. E. coli AB1157 cultures were exposed to red (660 nm) and infrared (808 nm) lasers, incubated (20 min, 37 °C), the total RNA was extracted, and cDNA synthesis was performed to evaluate mRNA levels from arcA, gyrA and rpoA genes by RT-qPCR. Melting curves and agarose gel electrophoresis were carried out to evaluate specific amplification. Data were analyzed by geNorm, NormFinder and BestKeeper. The melting curve and agarose gel electrophoresis showed specific amplification. Although mRNA levels from arcA, gyrA or rpoA genes presented no significant variations trough a traditional statistical analysis, Excel-based tools revealed that these reference genes are not suitable for E. coli cultures exposed to lasers. Our data showed that exposure to low-level red and infrared lasers at different fluences alter the mRNA levels from arcA, gyrA and rpoA in E. coli cells.

  20. Selection of Reference Genes for RT-qPCR Analysis in Coccinella septempunctata to Assess Un-intended Effects of RNAi Transgenic Plants.

    PubMed

    Yang, Chunxiao; Preisser, Evan L; Zhang, Hongjun; Liu, Yong; Dai, Liangying; Pan, Huipeng; Zhou, Xuguo

    2016-01-01

    The development of genetically engineered plants that employ RNA interference (RNAi) to suppress invertebrate pests opens up new avenues for insect control. While this biotechnology shows tremendous promise, the potential for both non-target and off-target impacts, which likely manifest via altered mRNA expression in the exposed organisms, remains a major concern. One powerful tool for the analysis of these un-intended effects is reverse transcriptase-quantitative polymerase chain reaction, a technique for quantifying gene expression using a suite of reference genes for normalization. The seven-spotted ladybeetle Coccinella septempunctata , a commonly used predator in both classical and augmentative biological controls, is a model surrogate species used in the environmental risk assessment (ERA) of plant incorporated protectants (PIPs). Here, we assessed the suitability of eight reference gene candidates for the normalization and analysis of C. septempunctata v-ATPase A gene expression under both biotic and abiotic conditions. Five computational tools with distinct algorisms, geNorm, Normfinder, BestKeeper , the Δ C t method, and RefFinder , were used to evaluate the stability of these candidates. As a result, unique sets of reference genes were recommended, respectively, for experiments involving different developmental stages, tissues, and ingested dsRNAs. By providing a foundation for standardized RT-qPCR analysis in C. septempunctata , our work improves the accuracy and replicability of the ERA of PIPs involving RNAi transgenic plants.

  1. Expression Patterns and Identified Protein-Protein Interactions Suggest That Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses.

    PubMed

    Mo, Chunyan; Wan, Shumin; Xia, Youquan; Ren, Ning; Zhou, Yang; Jiang, Xingyu

    2018-01-01

    Cassava is an energy crop that is tolerant of multiple abiotic stresses. It has been reported that the interaction between Calcineurin B-like (CBL) protein and CBL-interacting protein kinase (CIPK) is implicated in plant development and responses to various stresses. However, little is known about their functions in cassava. Herein, 8 CBL ( MeCBL ) and 26 CIPK ( MeCIPK ) genes were isolated from cassava by genome searching and cloning of cDNA sequences of Arabidopsis CBL s and CIPK s. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis showed that the expression levels of MeCBL and MeCIPK genes were different in different tissues throughout the life cycle. The expression patterns of 7 CBL and 26 CIPK genes in response to NaCl, PEG, heat and cold stresses were analyzed by quantitative real-time PCR (qRT-PCR), and it was found that the expression of each was induced by multiple stimuli. Furthermore, we found that many pairs of CBLs and CIPKs could interact with each other via investigating the interactions between 8 CBL and 25 CIPK proteins using a yeast two-hybrid system. Yeast cells co-transformed with cassava MeCIPK24, MeCBL10 , and Na + /H + antiporter MeSOS1 genes exhibited higher salt tolerance compared to those with one or two genes. These results suggest that the cassava CBL-CIPK signal network might play key roles in response to abiotic stresses.

  2. Expression Patterns and Identified Protein-Protein Interactions Suggest That Cassava CBL-CIPK Signal Networks Function in Responses to Abiotic Stresses

    PubMed Central

    Mo, Chunyan; Wan, Shumin; Xia, Youquan; Ren, Ning; Zhou, Yang; Jiang, Xingyu

    2018-01-01

    Cassava is an energy crop that is tolerant of multiple abiotic stresses. It has been reported that the interaction between Calcineurin B-like (CBL) protein and CBL-interacting protein kinase (CIPK) is implicated in plant development and responses to various stresses. However, little is known about their functions in cassava. Herein, 8 CBL (MeCBL) and 26 CIPK (MeCIPK) genes were isolated from cassava by genome searching and cloning of cDNA sequences of Arabidopsis CBLs and CIPKs. Reverse-transcriptase polymerase chain reaction (RT-PCR) analysis showed that the expression levels of MeCBL and MeCIPK genes were different in different tissues throughout the life cycle. The expression patterns of 7 CBL and 26 CIPK genes in response to NaCl, PEG, heat and cold stresses were analyzed by quantitative real-time PCR (qRT-PCR), and it was found that the expression of each was induced by multiple stimuli. Furthermore, we found that many pairs of CBLs and CIPKs could interact with each other via investigating the interactions between 8 CBL and 25 CIPK proteins using a yeast two-hybrid system. Yeast cells co-transformed with cassava MeCIPK24, MeCBL10, and Na+/H+ antiporter MeSOS1 genes exhibited higher salt tolerance compared to those with one or two genes. These results suggest that the cassava CBL-CIPK signal network might play key roles in response to abiotic stresses. PMID:29552024

  3. Altered serum microRNAs as biomarkers for the early diagnosis of pulmonary tuberculosis infection

    PubMed Central

    2012-01-01

    Background Pulmonary tuberculosis (TB) is a highly lethal infectious disease and early diagnosis of TB is critical for the control of disease progression. The objective of this study was to profile a panel of serum microRNAs (miRNAs) as potential biomarkers for the early diagnosis of pulmonary TB infection. Methods Using TaqMan Low-Density Array (TLDA) analysis followed by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) validation, expression levels of miRNAs in serum samples from 30 patients with active tuberculosis and 60 patients with Bordetella pertussis (BP), varicella-zoster virus (VZV) and enterovirus (EV) were analyzed. Results The Low-Density Array data showed that 97 miRNAs were differentially expressed in pulmonary TB patient sera compared with healthy controls (90 up-regulated and 7 down-regulated). Following qRT-PCR confirmation and receiver operational curve (ROC) analysis, three miRNAs (miR-361-5p, miR-889 and miR-576-3p) were shown to distinguish TB infected patients from healthy controls and other microbial infections with moderate sensitivity and specificity (area under curve (AUC) value range, 0.711-0.848). Multiple logistic regression analysis of a combination of these three miRNAs showed an enhanced ability to discriminate between these two groups with an AUC value of 0.863. Conclusions Our study suggests that altered levels of serum miRNAs have great potential to serve as non-invasive biomarkers for early detection of pulmonary TB infection. PMID:23272999

  4. MiR-221, a potential prognostic biomarker for recurrence in papillary thyroid cancer.

    PubMed

    Dai, Lei; Wang, Yaozong; Chen, Liangliang; Zheng, Jueru; Li, Jianjun; Wu, Xianjiang

    2017-01-07

    Many studies have reported several transcriptionally deregulated microRNAs (miRNAs) in papillary thyroid cancer (PTC) tissue in comparison with benign thyroid nodules and normal thyroid tissues. However, the correlation between miRNA expressions and PTC recurrence still remains unclear. The PTC patients who scheduled to undergo total thyroidectomy by the same surgical team in Ningbo NO.2 Hospital from March 1998 to March 2008 were enrolled in this study. The clinical and pathological characteristics of each patient were recorded in detail. The selected miRNA expressions were detected using quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). Potential predictive factors for cancer recurrence were evaluated by univariate and multivariate Cox proportional hazard analysis. A total of 78 patients were enrolled with 49 females at a mean age of 45.8 years. Enrolled patients were divided into two groups: nonrecurrent group (n = 54) and recurrent group (n = 24). The results from the univariate Cox proportional hazard analysis revealed that primary tumor size, TNM stage, extrathyroid extension, miR-221, and miR-222 expressions were significantly associated with PTC recurrence (P < 0.05). The tissue expression of miR-221 was the only independent risk factor for PTC recurrence (HR 1.41; 95%CI 1.14-1.95, P = 0.007) by multiple Cox proportional hazard analysis. This study identified the potential role of miR-221 as a prognostic biomarker for the recurrence in PTC.

  5. Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes.

    PubMed

    Balasubramaniam, Muthukumar; Davids, Benem; Addai, Amma B; Pandhare, Jui; Dash, Chandravanu

    2017-02-22

    HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3' ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.

  6. Effects of virus dose and extrinsic incubation temperature on vector competence of Culex nigripalpus (Diptera: Culicidae) for St. Louis encephalitis virus.

    PubMed

    Richards, Stephanie L; Anderson, Sheri L; Lord, Cynthia C; Tabachnick, Walter J

    2012-11-01

    Culex nigripalpus Theobald is a primary vector of St. Louis encephalitis virus in the southeastern United States. Cx. nigripalpus females were fed blood containing a low (4.0 +/- 0.01 log10 plaque-forming unit equivalents (PFUeq) /ml) or high (4.7 +/- 0.1 log10 PFUeq/ml) St. Louis encephalitis virus dose and maintained at extrinsic incubation temperatures (EIT) of 25 or 28 degrees C for 12 d. Vector competence was measured via quantitative real-time reverse transcriptase polymerase chain reaction to estimate PFUeq using rates of infection, dissemination, and transmission. There were no differences in infection rates between the two EITs at either dose. The low dose had higher infection rates at both EITs. Dissemination rates were significantly higher at 28 degrees C compared with 25 degrees C at both doses. Virus transmission was observed (<7%) only at 28 degrees C for both doses. The virus titer in body tissues was greater at 28 degrees C compared with 25 degrees C at both doses. The difference between the EITs was greater at the low dose, resulting in a higher titer for the low dose than the high dose at 28 degrees C. Virus titers in leg tissues were greater in mosquitoes fed the high versus low dose, but were not influenced by EIT. Further investigations using a variety of environmental and biological factors would be useful in exploring the complexity of vector competence.

  7. Effects of Virus Dose and Extrinsic Incubation Temperature on Vector Competence of Culex nigripalpus (Diptera: Culicidae) for St. Louis Encephalitis Virus

    PubMed Central

    RICHARDS, STEPHANIE L.; ANDERSON, SHERI L.; LORD, CYNTHIA C.; TABACHNICK, WALTER J.

    2013-01-01

    Culex nigripalpus Theobald is a primary vector of St. Louis encephalitis virus in the southeastern United States. Cx. nigripalpus females were fed blood containing a low (4.0 ± 0.01 log10 plaque-forming unit equivalents (PFUeq)/ml) or high (4.7 ± 0.1 log10 PFUeq/ml) St. Louis encephalitis virus dose and maintained at extrinsic incubation temperatures (EIT) of 25 or 28°C for 12 d. Vector competence was measured via quantitative real-time reverse transcriptase polymerase chain reaction to estimate PFUeq using rates of infection, dissemination, and transmission. There were no differences in infection rates between the two EITs at either dose. The low dose had higher infection rates at both EITs. Dissemination rates were significantly higher at 28°C compared with 25°C at both doses. Virus transmission was observed (<7%) only at 28°C for both doses. The virus titer in body tissues was greater at 28°C compared with 25°C at both doses. The difference between the EITs was greater at the low dose, resulting in a higher titer for the low dose than the high dose at 28°C. Virus titers in leg tissues were greater in mosquitoes fed the high versus low dose, but were not influenced by EIT. Further investigations using a variety of environmental and biological factors would be useful in exploring the complexity of vector competence. PMID:23270182

  8. PLK-1 Silencing in Bladder Cancer by siRNA Delivered With Exosomes.

    PubMed

    Greco, Kristin A; Franzen, Carrie A; Foreman, Kimberly E; Flanigan, Robert C; Kuo, Paul C; Gupta, Gopal N

    2016-05-01

    To use exosomes as a vector to deliver small interfering ribonucleic acid (siRNA) to silence the polo-like kinase 1 (PLK-1) gene in bladder cancer cells. Exosomes were isolated from both human embryonic kidney 293 (HEK293) cell and mesenchymal stem cell (MSC) conditioned media. Fluorescently labeled exosomes were co-cultured with bladder cancer and normal epithelial cells and uptake was quantified by image cytometry. PLK-1 siRNA and negative control siRNA were loaded into HEK293 and MSC exosomes using electroporation. An invasive bladder cancer cell line (UMUC3) was co-cultured with the electroporated exosomes. Quantitative reverse transcriptase polymerase chain reaction was performed. Protein analysis was performed by Western blot. Annexin V staining and MTT assays were used to investigate effects on apoptosis and viability. Bladder cancer cell lines internalize an increased percentage of HEK293 exosomes when compared to normal bladder epithelial cells. Treatment of UMUC3 cells with exosomes electroporated with PLK-1 siRNA achieved successful knockdown of PLK-1 mRNA and protein when compared to cells treated with negative control exosomes. HEK293 and MSC exosomes were effectively used as a delivery vector to transport PLK-1 siRNA to bladder cancer cells in vitro, resulting in selective gene silencing of PLK-1. The use of exosomes as a delivery vector for potential intravesical therapy is attractive. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Skeletal muscle myoblasts possess a stretch-responsive local angiotensin signalling system.

    PubMed

    Johnston, Adam P W; Baker, Jeff; De Lisio, Michael; Parise, Gianni

    2011-06-01

    A paucity of information exists regarding the presence of local renin-angiotensin systems (RASs) in skeletal muscle and associated muscle stem cells. Skeletal muscle and muscle stem cells were isolated from C57BL/6 mice and examined for the presence of a local RAS using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), immunohistochemistry (IHC), Western blotting and liquid chromatography-mass spectrometry (LC-MS). Furthermore, the effect of mechanical stimulation on RAS member gene expression was analysed. Whole skeletal muscle, primary myoblasts and C2C12 derived myoblasts and myotubes differentially expressed members of the RAS including angiotensinogen, angiotensin-converting enzyme (ACE), angiotensin II (Ang II) type 1 (AT(1)) and type 2 (AT(2)). Renin transcripts were never detected, however, mRNA for the 'renin-like' enzyme cathepsin D was observed and Ang I and Ang II were identified in cell culture supernatants from proliferating myoblasts. AT(1) appeared to co-localise with polymerised actin filaments in proliferating myoblasts and was primarily found in the nucleus of terminally differentiated myotubes. Furthermore, mechanical stretch of proliferating and differentiating C2C12 cells differentially induced mRNA expression of angiotensinogen, AT(1) and AT(2). Proliferating and differentiated muscle stem cells possess a local stress-responsive RAS in vitro. The precise function of a local RAS in myoblasts remains unknown. However, evidence presented here suggests that Ang II may be a regulator of skeletal muscle myoblasts.

  10. Myofibroblasts in interstitial lung diseases show diverse electron microscopic and invasive features.

    PubMed

    Karvonen, Henna M; Lehtonen, Siri T; Sormunen, Raija T; Harju, Terttu H; Lappi-Blanco, Elisa; Bloigu, Risto S; Kaarteenaho, Riitta L

    2012-09-01

    The characteristic features of myofibroblasts in various lung disorders are poorly understood. We have evaluated the ultrastructure and invasive capacities of myofibroblasts cultured from small volumes of diagnostic bronchoalveolar lavage (BAL) fluid samples from patients with different types of lung diseases. Cells were cultured from samples of BAL fluid collected from 51 patients that had undergone bronchoscopy and BAL for diagnostic purposes. The cells were visualized by transmission electron microscopy and immunoelectron microscopy to achieve ultrastructural localization of alpha-smooth muscle actin (α-SMA) and fibronectin. The levels of α-SMA protein and mRNA and fibronectin mRNA were measured by western blot and quantitative real-time reverse transcriptase polymerase chain reaction. The invasive capacities of the cells were evaluated. The cultured cells were either fibroblasts or myofibroblasts. The structure of the fibronexus, and the amounts of intracellular actin, extracellular fibronectin and cell junctions of myofibroblasts varied in different diseases. In electron and immunoelectron microscopy, cells cultured from interstitial lung diseases (ILDs) expressed more actin filaments and α-SMA than normal lung. The invasive capacity of the cells obtained from patients with idiopathic pulmonary fibrosis was higher than that from patients with other type of ILDs. Cells expressing more actin filaments had a higher invasion capacity. It is concluded that electron and immunoelectron microscopic studies of myofibroblasts can reveal differential features in various diseases. An analysis of myofibroblasts cultured from diagnostic BAL fluid samples may represent a new kind of tool for diagnostics and research into lung diseases.

  11. 64Cu-DOTATATE PET/MRI for Detection of Activated Macrophages in Carotid Atherosclerotic Plaques: Studies in Patients Undergoing Endarterectomy.

    PubMed

    Pedersen, Sune Folke; Sandholt, Benjamin Vikjær; Keller, Sune Høgild; Hansen, Adam Espe; Clemmensen, Andreas Ettrup; Sillesen, Henrik; Højgaard, Liselotte; Ripa, Rasmus Sejersten; Kjær, Andreas

    2015-07-01

    A feature of vulnerable atherosclerotic plaques of the carotid artery is high activity and abundance of lesion macrophages. There is consensus that this is of importance for plaque vulnerability, which may lead to clinical events, such as stroke and transient ischemic attack. We used positron emission tomography (PET) and the novel PET ligand [(64)Cu] [1,4,7,10-tetraazacyclododecane-N,N',N″,N‴-tetraacetic acid]-d-Phe1,Tyr3-octreotate ((64)Cu-DOTATATE) to specifically target macrophages via the somatostatin receptor subtype-2 in vivo. Ten patients underwent simultaneous PET/MRI to measure (64)Cu-DOTATATE uptake in carotid artery plaques before carotid endarterectomy. (64)Cu-DOTATATE uptake was significantly higher in symptomatic plaque versus the contralateral carotid artery (P<0.001). Subsequently, a total of 62 plaque segments were assessed for gene expression of selected markers of plaque vulnerability using real-time quantitative polymerase chain reaction. These results were compared with in vivo (64)Cu-DOTATATE uptake calculated as the mean standardized uptake value. Univariate analysis of real-time quantitative polymerase chain reaction and PET showed that cluster of differentiation 163 (CD163) and CD68 gene expression correlated significantly but weakly with mean standardized uptake value in scans performed 85 minutes post injection (P<0.001 and P=0.015, respectively). Subsequent multivariate analysis showed that CD163 correlated independently with (64)Cu-DOTATATE uptake (P=0.031) whereas CD68 did not contribute significantly to the final model. The novel PET tracer (64)Cu-DOTATATE accumulates in atherosclerotic plaques of the carotid artery. CD163 gene expression correlated independently with (64)Cu-DOTATATE uptake measured by real-time quantitative polymerase chain reaction in the final multivariate model, indicating that (64)Cu-DOTATATE PET is detecting alternatively activated macrophages. This association could potentially improve noninvasive identification and characterization of vulnerable plaques. © 2015 The Authors.

  12. Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine.

    PubMed Central

    Fitzgibbon, J E; Howell, R M; Haberzettl, C A; Sperber, S J; Gocke, D J; Dubin, D T

    1992-01-01

    To investigate whether human immunodeficiency virus type 1 pol gene mutations are selected during prolonged 2',3'-dideoxycytidine (ddC) therapy, we used the polymerase chain reaction to amplify a portion of the reverse transcriptase segment of the pol gene from the peripheral blood mononuclear cell DNA of a patient with AIDS before and after an 80-week course of ddC therapy. The consensus sequence from the second sample contained a unique double mutation (ACT to GAT) in the codon for reverse transcriptase amino acid 69, causing substitution of aspartic acid (Asp) for the wild-type threonine (Thr). A mutation (ACA to ATA) also occurred in the codon for position 165, causing substitution of isoleucine (Ile) for Thr. The GAT (Asp) codon was introduced into the pol gene of a molecular clone of human immunodeficiency virus via site-directed mutagenesis. Following transfection, mutant and wild-type viruses were tested for susceptibility to ddC by a plaque reduction assay. The mutant virus was fivefold less susceptible to ddC than the wild type; cross-resistance to 3'-azido-3'-deoxythymidine or 2'3'-dideoxyinosine was not found. The Ile-165 mutation did not confer additional ddC resistance. The Asp-69 substitution may have contributed to the generation of resistant virus in this patient. Images PMID:1317143

  13. Postnatal changes of gene expression for tissue inhibitors of metalloproteinase-1 and -2 and cystatins S and C, in rat submandibular gland demonstrated by quantitative reverse transcription-polymerase chain reaction.

    PubMed

    Nishiura, T; Abe, K

    1999-01-01

    The rat submandibular gland is not fully developed at birth and definitive differentiation takes place postnatally. The steady-state mRNA expression for the four proteinase inhibitor molecules, tissue inhibitors of metalloproteinase (TIMP)-1 and -2, and cystatins S and C, and for a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (G3PDH), in rat submandibular glands was measured by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR) at different stages of postnatal development. The gene-expression patterns of TIMP-1 and -2 relative to G3PDH were similar to each other. The TIMP-2 and cystatin C genes were more highly expressed than those of TIMP-1 and cystatin S at all stages. Moreover, the gene expressions of TIMP-1 and -2, and of cystatins S and C, were predominant between 1 and 7, and 7 and 12 weeks of age, respectively, and coincided developmentally with the regression of terminal tubule cells and the differentiation of granular convoluted tubule cells, respectively. Quantitative competitive RT-PCR allowed accurate measurement of small changes in the steady-state concentrations of these proteinase-inhibitor mRNA molecules.

  14. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  15. 9 CFR 147.30 - Laboratory procedure recommended for the polymerase chain reaction (PCR) test for Mycoplasma...

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... the polymerase chain reaction (PCR) test for Mycoplasma gallisepticum and M. synoviae. 147.30 Section... Examination Procedures § 147.30 Laboratory procedure recommended for the polymerase chain reaction (PCR) test... should consist of the following sequences: ER12JA07.005 (c) Polymerase chain reaction. (1) Treat each...

  16. Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR.

    PubMed Central

    Huang, M M; Arnheim, N; Goodman, M F

    1992-01-01

    Thermus aquaticus (Taq) DNA polymerase was used to measure the extension efficiency for all configurations of matched and mismatched base pairs at template-primer 3'-termini. The transition mispairs, A(primer).C, C.A, G.T, and T.G were extended 10(-3) to 10(-4)-fold less efficiently than their correctly paired counterparts. Relative efficiencies for extending transversion mispairs were 10(-4) to 10(-5) for T.C and T.T, about 10(-6) for A.A, and less than 10(-6) for G.A, A.G, G.G and C.C. The transversion mispair C(primer).T was extended with high efficiency, about 10(-2) compared to a correct A.T basepair. The unexpected ease of extending the C.T mismatch was not likely to have been caused by primer-template misalignment. Taq polymerase was observed to bind with similar affinities to each of the correctly paired and mispaired primer-template 3'-ends. Thus, the failure of Taq polymerase to extend mismatches efficiently appears to be an intrinsic property of the enzyme and not due to an inability to bind to 3'-terminal mispairs. For almost all of the mispairs, C.T being the exception, Taq polymerase exhibits about 100 to 1000-fold greater discrimination against mismatch extension compared to avian myeloblastosis reverse transcriptase and HIV-1 reverse transcriptase which extend most mismatched basepairs permissively. Relative mismatch extension efficiencies for Taq polymerase were measured at 45 degrees C, 55 degrees C and 70 degrees C and found to be independent of temperature. The mispair extension data should be important in designing experiments using PCR to distinguish between sequences that vary by a single nucleotide. Images PMID:1408758

  17. High sensitive RNA detection by one-step RT-PCR using the genetically engineered variant of DNA polymerase with reverse transcriptase activity from hyperthermophilies.

    PubMed

    Okano, Hiroyuki; Baba, Misato; Kawato, Katsuhiro; Hidese, Ryota; Yanagihara, Itaru; Kojima, Kenji; Takita, Teisuke; Fujiwara, Shinsuke; Yasukawa, Kiyoshi

    2018-03-01

    One-step RT-PCR has not been widely used even though some thermostable DNA polymerases with reverse transcriptase (RT) activity were developed from bacterial and archaeal polymerases, which is owing to low cDNA synthesis activity from RNA. In the present study, we developed highly-sensitive one-step RT-PCR using the single variant of family A DNA polymerase with RT activity, K4pol L329A (L329A), from the hyperthermophilic bacterium Thermotoga petrophila K4 or the 16-tuple variant of family B DNA polymerase with RT activity, RTX, from the hyperthermophilic archaeon Thermococcus kodakarensis. Optimization of reaction condition revealed that the activities for cDNA synthesis and PCR of K4pol L329A and RTX were highly affected by the concentrations of MgCl 2 and Mn(OCOCH 3 ) 2 as well as those of K4pol L329A or RTX. Under the optimized condition, 300 copies/μl of target RNA in 10 μl reaction volumes were successfully detected by the one-step RT-PCR with K4pol L329A or RTX, which was almost equally sensitive enough compared with the current RT-PCR condition using retroviral RT and thermostable DNA polymerase. Considering that K4pol L329A and RTX are stable even at 90-100°C, our results suggest that the one-step RT-PCR with K4pol L329A or RTX is more advantageous than the current one. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. A polymerase chain reaction strategy for the diagnosis of camelpox.

    PubMed

    Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar

    2009-03-01

    Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.

  19. Effect of human vascular endothelial growth factor gene transfer on endogenous vascular endothelial growth factor mRNA expression in a rat fibroblast and osteoblast culture model.

    PubMed

    Li, Ru; Li, Claire H; Nauth, Aaron; McKee, Michael D; Schemitsch, Emil H

    2010-09-01

    Vascular endothelial growth factor (VEGF) plays an important role in promoting angiogenesis and osteogenesis during fracture repair. Our previous studies have shown that cell-based VEGF gene therapy enhances bone healing of a rabbit tibia segmental bone defect in vivo. The aim of this project was to examine the effect of exogenous human VEGF on the endogenous rat VEGF messenger RNA (mRNA) expression in a cell-based gene transfer model. Rat fibroblasts and osteoblasts were harvested from the dermal tissue and periosteum, respectively, of Fisher 344 rats. The cells were then cultured and transfected with pcDNA-human VEGF using Superfect reagent (Qiagen). Four experimental groups were created: 1) fibroblast-VEGF; 2) osteoblast-VEGF; 3) nontransfected fibroblast controls; and 4) nontransfected osteoblast controls. The cultured cells were harvested at 1, 3, and 7 days after the gene transfection. The total mRNA was extracted (Trizol; Invitrogen); both human VEGF and rat VEGF mRNA were measured by reverse transcriptase-polymerase chain reaction and quantified by VisionWorksLS. The human VEGF165 mRNA was detected by reverse transcriptase-polymerase chain reaction from transfected fibroblasts and osteoblasts at 1, 3, and 7 days after gene transfection. The human VEGF165 levels peaked at Day 1 and then gradually reduced expression in both transfected fibroblasts and osteoblasts. Two endogenous rat VEGF isoforms were detected in this cell culture model: rat VEGF120 and rat VEGF164. We compared the rat VEGF120 and rat VEGF164 expression level of the fibroblasts or osteoblasts that were transfected with human VEGF165, with nontransfected control cells. Both the transfected fibroblasts and osteoblasts showed greater expression of rat VEGF164 than nontransfected controls at Day 1 (peak level) and Day 3, but not at Day 7. The expression of rat VEGF120 was lower in transfected fibroblasts, but higher in transfected osteoblasts, than the relevant control groups at any time point after transfection. In addition, human VEGF gene transfection increased osteoblast cell proliferation after 3 days. These in vitro results suggest that cell-based human VEGF gene therapy is not only effective at causing human VEGF expression, but also enhances endogenous rat VEGF mRNA expression in both fibroblasts and osteoblasts, particularly the rat VEGF164 isoform.

  20. Problem-Solving Test: Catalytic Activities of a Human Nuclear Enzyme

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2011-01-01

    Terms to be familiar with before you start to solve the test: ion exchange chromatography, polynucleotides, oligonucleotides, radioactive labeling, template, primer, DNA polymerase, reverse transcriptase, helicase, nucleoside triphosphates, nucleoside diphosphates, nucleoside monophosphates, nucleosides, 5'-end and 3'-end, bacteriophage,…

  1. The development of a real-time reverse transcription-polymerase chain reaction (rRT-PCR) assay using TaqMan technology for the pan detection of bluetongue virus (BTV).

    PubMed

    Mulholland, Catherine; McMenamy, Michael J; Hoffmann, Bernd; Earley, Bernadette; Markey, Bryan; Cassidy, Joseph; Allan, Gordon; Welsh, Michael D; McKillen, John

    2017-07-01

    Bluetongue virus (BTV) is an infectious, non-contagious viral disease of domestic and wild ruminants that is transmitted by adult females of certain Culicoides species. Since 2006, several serotypes including BTV-1, 2, 4, 6, 8, 9 and 16, have spread from the Mediterranean basin into Northern Europe for the first time. BTV-8 in particular, caused a major epidemic in northern Europe. As a result, it is evident that most European countries are at risk of BTV infection. The objective of this study was to develop and validate a real-time reverse transcriptase-polymerase chain reaction (rRT-PCR) assay based on TaqMan technology for the detection of representative strains of all BTV serotypes. Primers and probes were based on genome segment 10 of the virus, the NS3 gene. The assay was tested for sensitivity, and specificity. The analytical sensitivity of the rRT-PCR assay was 200 copies of RNA per reaction. The assay did not amplify the closely related orbivirus epizootic hemorrhagic disease virus (EHDV) but successfully detected all BTV reference strains including clinical samples from animals experimentally infected with BTV-8. This real time RT-PCR assay offers a sensitive, specific and rapid alternative assay for the pan detection of BTV that could be used as part of a panel of diagnostic assays for the detection of all serotypes of BTV. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  2. Expression of chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI) in bladder transitional cell carcinoma.

    PubMed

    Ham, Won Sik; Lee, Joo Hyoung; Yu, Ho Song; Choi, Young Deuk

    2008-10-01

    An analysis of differentially expressed genes (DEGs) between bladder transitional cell carcinoma (TCC) and the surrounding urothelium to help identify what lies behind the mechanism of multifocal tumor development has not yet been performed. We sought to find a new DEG related to the development of bladder TCC. Thirty-nine bladder TCC tissues paired with normal-appearing urothelium tissues obtained from the same patient were used as subjects. Initially, we compared the messenger RNA (mRNA) profiles between normal-appearing urothelium and TCC tissue of 1 patient by using annealing control primer (ACP)-based GeneFishing polymerase chain reaction (PCR) and selective amplification of family members (SAFM) PCR to identify potential DEGs. To validate the results of the ACP data, reverse transcriptase-polymerase chain reaction (RT-PCR) was performed on those of all 39 patients. Among the several DEGs discovered in the ACP data, 1 DEG was chosen as the candidate for the RT-PCR, that is present or markedly upregulated in normal-appearing urothelial tissue compared with TCC tissue. Gene sequence searching revealed that this DEG is chicken ovalbumin upstream promoter-transcription factor I (COUP-TFI). Downregulation of COUP-TFI mRNA expression in TCC tissue compared to normal-appearing urothelium tissue of the same patient, irrespective of tumor stage and grade, was confirmed by RT-PCR in 39 patients. Our results suggest that the loss of COUP-TFI may play a role in the transition from normal epithelium to TCC. Further characterization of the COUP-TFI gene is expected to give us informations about bladder TCC tumorigenesis.

  3. Poly(adenylic acid) complementary DNA real-time polymerase chain reaction in pancreatic ductal juice in patients undergoing pancreaticoduodenectomy.

    PubMed

    Oliveira-Cunha, Melissa; Byers, Richard J; Siriwardena, Ajith K

    2010-03-01

    There is a need to develop methods of early diagnosis for pancreatic cancer. Pancreatic juice is easily collected by endoscopic retrograde cholangiopancreatography and may facilitate diagnosis using molecular markers. The aim of this work was to explore the feasibility of measurement of gene expression in RNA isolated from ductal juice. Intraoperative sampling of pancreatic juice was undertaken in 27 patients undergoing pancreaticoduodenectomy for suspected tumor. Total RNA was extracted and used as template for poly(adenylic acid) (poly[A]) polymerase chain reaction (PCR) to generate a globally amplified complementary DNA pool representative of all expressed messenger RNAs. Real-time PCR was performed for trefoil factor 2 (TFF2), carboxypeptidase B1 (CPB1), and kallikrein-related peptidase 3 (KLK3) in a subset of samples; all samples were normalized for 3 reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH], PSMB6, and beta-2-microglobulin [B2M]). The median volume of the pancreatic juice obtained was 1245 microL (range, 50-5000 microL). The RNA integrity number ranged from 1.9 to 10. Reverse transcriptase PCR was positive for pancreas-specific genes (TFF2 and CPB1) and negative for prostatic-specific antigen in all samples. These results demonstrate that RNA analysis of pancreatic juice is feasible using a combination of poly(A) PCR and real-time PCR. In addition, the poly(A) complementary DNA generated can be probed for multiple genes and is indefinitely renewable, thereby representing a molecular block of importance for future research.

  4. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    PubMed

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  6. Antitumor effect of CXCR4 antagonist AMD3100 on the tumorigenic cell line of BHP10-3 papillary thyroid cancer cells.

    PubMed

    Jung, Young Ho; Lee, Doh Young; Cha, Wonjae; Kim, Bo Hae; Sung, Myung-Whun; Kim, Kwang Hyun; Ahn, Soon-Hyun

    2016-10-01

    A tumorigenic cell line (BHP10-3M) derived from nontumorigenic papillary thyroid carcinoma (PTC) cells (BHP10-3) having rearranged during transfection (RET)/PTC1 gene rearrangement might have a higher expression of CXCR4, either quantitatively or functionally. The authors also postulated that CXCR4-mediated invasion or tumorigenesis could be blocked by CXCR4 antagonists, including AMD3100. The expression of CXCR4 in BHP10-3 and BHP10-3M cells was assessed using immunoblot analysis, flow cytometry, and quantitative reverse-transcriptase polymerase chain reaction (RT-PCR). The effect of AMD3100 on BHP10-3 and BHP10-3M cell lines was evaluated using cell proliferation assay, invasion assay, and tumor growth experiment in nude mice. Immunoblotting, flow cytometry, and quantitative RT-PCR proved that BHP10-3M cells expressed a higher level of CXCR4 than BHP10-3 cells. Although blocking CXCR4 with AMD3100 did not suppress cell proliferation in both cell lines from 1 ng/mL to 100 ng/mL concentration, AMD3100 suppressed invasion of BHP10-3M cells in vitro in a dose-dependent manner. At higher concentrations from 10(3) ng/mL to 10(5) ng/mL, the proliferation of BHP10-3M cells was inhibited more strongly by AMD3100 than that of BHP10-3 cells. Intraperitoneal injection of AMD3100 inhibited tumor formation by BHP10-3M cells in the thyroid of nude mice. A tumorigenic cell line (BHP10-3M) of PTC showed higher expression of CXCR4 quantitatively and functionally than a nontumorigenic cell line (BHP10-3). The CXCR4 antagonist (AMD3100) showed a significant antitumor effect on the tumorigenic cell line of PTC BHP10-3 cells both in vitro and in vivo. CXCR4 antagonist can be expected to have an adjuvant role in the management of PTC. © 2016 Wiley Periodicals, Inc. Head Neck, 2016 © 2016 Wiley Periodicals, Inc. Head Neck 38: First-1486, 2016. © 2016 Wiley Periodicals, Inc.

  7. A multisite assessment of the quantitative capabilities of the Xpert MTB/RIF assay.

    PubMed

    Blakemore, Robert; Nabeta, Pamela; Davidow, Amy L; Vadwai, Viral; Tahirli, Rasim; Munsamy, Vanisha; Nicol, Mark; Jones, Martin; Persing, David H; Hillemann, Doris; Ruesch-Gerdes, Sabine; Leisegang, Felicity; Zamudio, Carlos; Rodrigues, Camilla; Boehme, Catharina C; Perkins, Mark D; Alland, David

    2011-11-01

    The Xpert MTB/RIF is an automated molecular test for Mycobacterium tuberculosis that estimates bacterial burden by measuring the threshold-cycle (Ct) of its M. tuberculosis-specific real-time polymerase chain reaction. Bacterial burden is an important biomarker for disease severity, infection control risk, and response to therapy. Evaluate bacterial load quantitation by Xpert MTB/RIF compared with conventional quantitative methods. Xpert MTB/RIF results were compared with smear-microscopy, semiquantiative solid culture, and time-to-detection in liquid culture for 741 patients and 2,008 samples tested in a multisite clinical trial. An internal control real-time polymerase chain reaction was evaluated for its ability to identify inaccurate quantitative Xpert MTB/RIF results. Assays with an internal control Ct greater than 34 were likely to be inaccurately quantitated; this represented 15% of M. tuberculosis-positive tests. Excluding these, decreasing M. tuberculosis Ct was associated with increasing smear microscopy grade for smears of concentrated sputum pellets (r(s) = -0.77) and directly from sputum (r(s) =-0.71). A Ct cutoff of approximately 27.7 best predicted smear-positive status. The association between M. tuberculosis Ct and time-to-detection in liquid culture (r(s) = 0.68) and semiquantitative colony counts (r(s) = -0.56) was weaker than smear. Tests of paired same-patient sputum showed that high viscosity sputum samples contained ×32 more M. tuberculosis than nonviscous samples. Comparisons between the grade of the acid-fast bacilli smear and Xpert MTB/RIF quantitative data across study sites enabled us to identify a site outlier in microscopy. Xpert MTB/RIF quantitation offers a new, standardized approach to measuring bacterial burden in the sputum of patients with tuberculosis.

  8. Application of droplet digital PCR for quantitative detection of Spiroplasma citri in comparison with real time PCR

    USDA-ARS?s Scientific Manuscript database

    Droplet digital Polymerase chain reaction (ddPCR) is a unique approach to measure the absolute copy number of nucleic acid targets without the need of external standards. It is a promising DNA quantification technology for medical diagnostics but there are only a few reports of its use for plant pat...

  9. Evaluation and selection of internal reference genes from two- and six-row U.S. malting barley varieties throughout micromalting for use in RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Reverse Transcription quantitative Polymerase Chain Reaction (qRT-PCR) is a popular method for measuring transcript abundance. The most commonly used method of interpretation is relative quantification and thus necessitates the use of normalization controls (i.e. reference genes) to standardize tran...

  10. Group specific quantitative real-time polymerase chain reaction (qRT-PCR) analysis of methanogenic archaea in stored swine manure

    USDA-ARS?s Scientific Manuscript database

    Consolidated storage of swine manure is associated with the production of a variety of odors and emissions which result from anaerobic digestion of materials present in the manure. Methanogenic archaea are a diverse group of anaerobic microorganisms responsible for the production of methane. In th...

  11. MEASURING GROWTH OF A PHENANTHRENE DEGRADING BACTERIAL INOCULUM IN SOIL WITH A QUANTITATIVE COMPETITIVE POLYMERASE CHAIN REACTION METHOD. (R825433)

    EPA Science Inventory

    We measured growth of a phenanthrene-degrading bacterium, Arthrobacter, strain RP17, in Forbes soil, amended with 500 small mu, Greekg g−1 phenanthrene using a quantitati...

  12. Development of Highly Sensitive Bulk Acoustic Wave Device Biosensor Arrays for Screening and Early Detection of Prostate Cancer

    DTIC Science & Technology

    2009-01-01

    Partin, P. C. Walsh, J. I. Epstein, and D. Sidransky, "Quantitative GSTP1 Methylation and the Detection of Prostate Adenocarcinoma in Sextant Biopsies...island methylation changes near the GSTP1 gene in prostatic carcinoma cells detected using the polymerase chain reaction: a new prostate cancer

  13. MONITORING MYCOTOXIN PRODUCTION AT THE GENETIC LEVEL ON VARIOUS GROWTH SUBSTRATES USING QUANTITATIVE REVERSE TRANSCRIPTION POLYMERASE CHAIN REACTION?EXPERIMENT DESIGN

    EPA Science Inventory

    The paper describes a method of analyzing the production of mycotoxins at the genetic level by monitoring the intracellular levels of messenger RNA (mRNA). Initial work will focus on threshing out the mycotoxin gene clusters in Stachybotrys chartarum followed by analysis of toxin...

  14. Influences of sample interference and interference controls on quantification of enterococci fecal indicator bacteria in surface water samples by the qPCR method

    EPA Science Inventory

    A quantitative polymerase chain reaction (qPCR) method for the detection of entercocci fecal indicator bacteria has been shown to be generally applicable for the analysis of temperate fresh (Great Lakes) and marine coastal waters and for providing risk-based determinations of wat...

  15. FECAL INDICATOR BACTERIA MEASUREMENTS BY QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) ANALYSIS IN FRESH ARCHIVED DNA EXTRACT OF WATER SAMPLE FILTRATES

    EPA Science Inventory

    The U.S. EPA has initiated a new recreational water study to evaluate the correlation between illness rates in swimmers and Enterococcus concentrations determined by the mEI agar membrane filter (MF) method and several new technologies including QPCR analysis. Results of this stu...

  16. Low Frequencies of Interference to EPA Quantitative Polymerase Chain Reaction (qPCR) Methods for Microbial Water Quality Monitoring in U.S. Rivers and Streams and Coastal Waters

    EPA Science Inventory

    In collaboration with U.S States and Tribes, the United States Environmental Protection Agency (EPA) conducts periodic and rotating, statistically based surveys of U.S. rivers and streams (National Rivers and Streams Assessment, NRSA), estuarine and Great Lakes nearshore coastal ...

  17. [Application of transcription mediated amplification and real-time reverse transcription polymerase chain reaction in detection of human immunodeficiency virus RNA].

    PubMed

    Wu, Daxian; Tao, Shuhui; Liu, Shuiping; Zhou, Jiebin; Tan, Deming; Hou, Zhouhua

    2017-07-28

    To observe the sensitivity of transcription mediated amplification (TMA), and to compare its performance with real-time reverse transcription polymerase chain reaction (real-time RT-PCR) in detecting human immunodeficiency virus RNA (HIV RNA).
 Methods: TMA system was established with TaqMan probes, specific primers, moloney murine leukemia virus (MMLV) reverse transcriptase, T7 RNA polymerase, and reaction substrates. The sensitivity of TMA was evaluated by amplifying a group of 10-fold diluted HIV RNA standards which were transcribed in vitro. A total of 60 plasma of HIV infected patients were measured by TMA and Cobas Amplicor HIV-1 Monitor test to observe the positive rate. The correlation and concordance of the above two technologies were investigated by linear regression and Bland-Altman analysis.
 Results: TMA system was established successfully and HIV RNA transcribed standards at concentration of equal or more than 10 copies/mL could be detected by TMA technology. Among 60 samples of plasma from HIV infected patients, 46 were positively detected and 12 were negatively amplified by both TMA and Cobas reagents; 2 samples were positively tested by Cobas reagent but negatively tested by TMA system. The concordance rate of the two methods was 97.1% and the difference of positive detection rate between the two methods was not statistically significant (P>0.05). Linear regression was used for 46 samples which were positively detected by both TMA and Cobas reagents and showed an excellent correlation between the two reagents (r=0.997, P<0.001). Bland-Altma analysis revealed that the mean different value of HIV RNA levels for denary logarithm was 0.02. Forty-four samples were included in 95% of credibility interval of concordance.
 Conclusion: TMA system has the potential of high sensitivity. TMA and real-time RT-PCR keep an excellent correlation and consistency in detecting HIV RNA.

  18. ICI 182,780-regulated gene expression in DU145 prostate cancer cells is mediated by estrogen receptor-beta/NFkappaB crosstalk.

    PubMed

    Leung, Yuet-Kin; Gao, Ying; Lau, Kin-Mang; Zhang, Xiang; Ho, Shuk-Mei

    2006-04-01

    Estrogen receptor (ER)-beta is the predominant ER subtype in prostate cancer (PCa). We previously demonstrated that ICI 182,780 (ICI), but not estrogens, exerted dose-dependent growth inhibition on DU145 PCa cells by an ER-beta-mediated pathway. Transcriptional profiling detected a greater than three-fold upregulation of seven genes after a 12-hour exposure to 1 microM ICI. Semiquantitative reverse transcriptase polymerase chain reaction confirmed the upregulation of four genes by ICI: interleukin-12alpha chain, interleukin-8, embryonic growth/differentiation factor, and RYK tyrosine kinase. Treatment with an ER-beta antisense oligonucleotide reduced cellular ER-beta mRNA and induced loss of expression of these genes. Sequence analysis revealed the presence of consensus NFkappaB sites, but not estrogen-responsive elements, in promoters of all four genes. Reporter assay and chromatin immunoprecipitation experiments demonstrated that ICI-induced gene expression could be mediated by crosstalk between ER-beta and the NFkappaB signaling pathway, denoting a novel mechanism of ER-beta-mediated ICI action. Therefore, combined therapies targeting ER-beta and NFkappaB signaling may be synergistic as treatment for PCa.

  19. Coexpression of an unusual form of the EWS-WT1 fusion transcript and interleukin 2/15 receptor betamRNA in a desmoplastic small round cell tumour.

    PubMed

    Nakanishi, Y; Oinuma, T; Sano, M; Fuchinoue, F; Komatsu, K; Seki, T; Obana, Y; Tabata, M; Kikuchi, K; Shimamura, M; Ohmori, K; Nemoto, N

    2006-10-01

    The beta chain of the interleukin 2/15 receptor (IL-2/15Rbeta) is induced by the expression of the EWS-WT1. A case of desmoplastic small round cell tumour (DSRCT) expressing only an unusual EWS-WT1 treated by us is reported here. To characterise an unusual form of EWS-WT1. Frozen tissue sections of the axillary tumour were examined using a laser-assisted microdissection technique and reverse transcriptase polymerase chain reaction. The novel fusion of exon 8 of EWS and the defective exon 10 of WT1 (-KTS) was detected. Although it was an unusual form, the coexpression of the present EWS-WT1, IL-2/15Rbeta and Janus kinase (JAK1) mRNA was detected in the tumour cells. IL-2 and signal transducers and activators of transcription (STAT5) mRNA were detected in both tumour and stromal cells. The induction of the IL-2/15 receptor signalling pathway may contribute to tumorigenesis in DSRCT through a paracrine or an autocrine system, even though the EWS-WT1 was an unusual form.

  20. Expression and characterization of a novel reverse transcriptase of the LTR retrotransposon Tf1.

    PubMed

    Kirshenboim, Noa; Hayouka, Zvi; Friedler, Assaf; Hizi, Amnon

    2007-09-30

    The LTR retrotransposon of Schizosacharomyces pombe, Tf1, has several distinctive properties that can be related to the unique properties of its reverse transcriptase (RT). Consequently, we expressed, purified and studied the recombinant Tf1 RT. This monomeric protein possesses all activities typical to RTs: DNA and RNA-dependent DNA polymerase as well as an inherent ribonuclease H. The DNA polymerase activity shows preference to Mn(+)(2) or Mg(+)(2), depending on the substrate used, whereas the ribonuclease H strongly prefers Mn(+)(2). The most outstanding feature of Tf1 RT is its capacity to add non-templated nucleotides to the 3'-ends of the nascent DNA. This is mainly apparent in the presence of Mn(+)(2), as is the noticeable low fidelity of DNA synthesis. In all, Tf1 RT has a marked infidelity in synthesizing DNA at template ends, a phenomenon that can explain, as discussed herein, some of the features of Tf1 replication in the host cells.

  1. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. A Sensitive Detection Method for MPLW515L or MPLW515K Mutation in Chronic Myeloproliferative Disorders with Locked Nucleic Acid-Modified Probes and Real-Time Polymerase Chain Reaction

    PubMed Central

    Pancrazzi, Alessandro; Guglielmelli, Paola; Ponziani, Vanessa; Bergamaschi, Gaetano; Bosi, Alberto; Barosi, Giovanni; Vannucchi, Alessandro M.

    2008-01-01

    Acquired mutations in the juxtamembrane region of MPL (W515K or W515L), the receptor for thrombopoietin, have been described in patients with primary myelofibrosis or essential thrombocythemia, which are chronic myeloproliferative disorders. We have developed a real-time polymerase chain reaction assay for the detection and quantification of MPL mutations that is based on locked nucleic acid fluorescent probes. Mutational analysis was performed using DNA from granulocytes. Reference curves were obtained using cloned fragments of MPL containing either the wild-type or mutated sequence; the predicted sensitivity level was at least 0.1% mutant allele in a wild-type background. None of the 60 control subjects presented with a MPLW515L/K mutation. Of 217 patients with myelofibrosis, 19 (8.7%) harbored the MPLW515 mutation, 10 (52.6%) with the W515L allele. In one case, both the W515L and W515K alleles were detected by real-time polymerase chain reaction. By comparing results obtained with conventional sequencing, no erroneous genotype attribution using real-time polymerase chain reaction was found, whereas one patient considered wild type according to sequence analysis actually harbored a low W515L allele burden. This is a simple, sensitive, and cost-effective procedure for large-scale screening of the MPLW515L/K mutation in patients suspected to have a myeloproliferative disorder. It can also provide a quantitative estimate of mutant allele burden that might be useful for both patient prognosis and monitoring response to therapy. PMID:18669880

  3. Oxytetracycline induces DNA damage and epigenetic changes: a possible risk for human and animal health?

    PubMed

    Gallo, Adriana; Landi, Rosaria; Rubino, Valentina; Di Cerbo, Alessandro; Giovazzino, Angela; Palatucci, Anna Teresa; Centenaro, Sara; Guidetti, Gianandrea; Canello, Sergio; Cortese, Laura; Ruggiero, Giuseppina; Alessandrini, Andrea; Terrazzano, Giuseppe

    2017-01-01

    Oxytetracycline (OTC), which is largely employed in zootechnical and veterinary practices to ensure wellness of farmed animals, is partially absorbed within the gastrointestinal tract depositing in several tissues. Therefore, the potential OTC toxicity is relevant when considering the putative risk derived by the entry and accumulation of such drug in human and pet food chain supply. Despite scientific literature highlights several OTC-dependent toxic effects on human and animal health, the molecular mechanisms of such toxicity are still poorly understood. Here, we evaluated DNA damages and epigenetic alterations by quantitative reverse transcription polymerase chain reaction, quantitative polymerase chain reaction, chromatin immuno-precipitation and Western blot analysis. We observed that human peripheral blood mononuclear cells (PBMCs) expressed DNA damage features (activation of ATM and p53, phosphorylation of H2AX and modifications of histone H3 methylation of lysine K4 in the chromatin) after the in vitro exposure to OTC. These changes are linked to a robust inflammatory response indicated by an increased expression of Interferon (IFN)- γ and type 1 superoxide dismutase (SOD1). Our data reveal an unexpected biological in vitro activity of OTC able to modify DNA and chromatin in cultured human PBMC. In this regard, OTC presence in foods of animal origin could represent a potential risk for both the human and animal health.

  4. Detection of infectious bronchitis virus with the use of real-time quantitative reverse transcriptase-PCR and correlation with virus detection in embryonated eggs.

    PubMed

    Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W

    2014-09-01

    Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.

  5. Mutational analysis of the reverse transcriptase and ribonuclease H domains of the human foamy virus.

    PubMed Central

    Kögel, D; Aboud, M; Flügel, R M

    1995-01-01

    Human foamy or spuma virus (HFV) codes for a distinct set of pol gen products. To determine the minimal requirements for the HFV enzymatic activities, defined residues of the reverse transcriptase (RT) and ribo-nuclease H (RNase H) domain of the HFV pol gene were mutated by site-specific PCR mutagenesis. The mutant gene products were bacterially expressed, purified by Ni2+ chelate affinity chromatography and characterised by Western blotting. The enzymatic activities of the individual recombinant HFV pol mutant proteins were characterised by the situ RT, RNase H and RNase H assays. Two substitution mutants reached RT activity levels higher than that of the intact recombinant HFV RT-RH-His. When the catalytically essential D508 was substituted by A508, 5% of RNase H activity was retained while DNA polymerase activity increased 2-fold. A deletion of 11 amino acid residues in the hinge region completely abolished DNA polymerase while RNase H activity decreased 2-fold. A deletion mutant in the C-terminal RH domain showed no RNase H but retained RNase H activity indicating that the activities are genetically separable. The combined data reveal that the HFV DNA polymerase and RNase H activities are interdependent. Images PMID:7544460

  6. A Pilot Study of the Noninvasive Assessment of the Lung Microbiota as a Potential Tool for the Early Diagnosis of Ventilator-Associated Pneumonia

    PubMed Central

    Brady, Jacob S.; Romano-Keeler, Joann; Drake, Wonder P.; Norris, Patrick R.; Jenkins, Judith M.; Isaacs, Richard J.; Boczko, Erik M.

    2015-01-01

    BACKGROUND: Ventilator-associated pneumonia (VAP) remains a common complication in critically ill surgical patients, and its diagnosis remains problematic. Exhaled breath contains aerosolized droplets that reflect the lung microbiota. We hypothesized that exhaled breath condensate fluid (EBCF) in hygroscopic condenser humidifier/heat and moisture exchanger (HCH/HME) filters would contain bacterial DNA that qualitatively and quantitatively correlate with pathogens isolated from quantitative BAL samples obtained for clinical suspicion of pneumonia. METHODS: Forty-eight adult patients who were mechanically ventilated and undergoing quantitative BAL (n = 51) for suspected pneumonia in the surgical ICU were enrolled. Per protocol, patients fulfilling VAP clinical criteria undergo quantitative BAL bacterial culture. Immediately prior to BAL, time-matched HCH/HME filters were collected for study of EBCF by real-time polymerase chain reaction. Additionally, convenience samples of serially collected filters in patients with BAL-diagnosed VAP were analyzed. RESULTS: Forty-nine of 51 time-matched EBCF/BAL fluid samples were fully concordant (concordance > 95% by κ statistic) relative to identified pathogens and strongly correlated with clinical cultures. Regression analysis of quantitative bacterial DNA in paired samples revealed a statistically significant positive correlation (r = 0.85). In a convenience sample, qualitative and quantitative polymerase chain reaction analysis of serial HCH/HME samples for bacterial DNA demonstrated an increase in load that preceded the suspicion of pneumonia. CONCLUSIONS: Bacterial DNA within EBCF demonstrates a high correlation with BAL fluid and clinical cultures. Bacterial DNA within EBCF increases prior to the suspicion of pneumonia. Further study of this novel approach may allow development of a noninvasive tool for the early diagnosis of VAP. PMID:25474571

  7. MATERIALS SUPPORTING THE NEW RECREATIONAL ...

    EPA Pesticide Factsheets

    EPA is developing new, rapid methods for monitoring water quality at beaches to determine adequacy of water quality for swimming. The methods being developed rely upon quantitive polymerase chain reaction technology. They will permit real time decisions regarding beach closures. The methods are supported by a series of epidemiology studies evaluating the rate of GI illness resulting from swimming events. Implementation of BEACH Act amendments

  8. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products

    EPA Science Inventory

    Escherichia coli is one of the most commonly used fecal indicator organisms for drinking water and groundwater systems. In order to understand various biogeochemical and biophysical factors affecting its interactions with biofilms, E. coli K12 was chosen as a model organism. A Ta...

  9. A simple and rapid DNA extraction method for Chlamydia trachomatis detection from urogenital swabs.

    PubMed

    Butzler, Matthew A; Reed, Jennifer L; McFall, Sally M

    2017-11-01

    A highly sensitive and specific Chlamydia trachomatis (CT) diagnostic test was developed by combining filtration isolation of nucleic acid (FINA) extraction with quantitative polymerase chain reaction including an internal control to identify test inhibition. A pilot study of 40 clinical specimens yielded 100% sensitivity and specificity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Bioelectrochemical Systems Workshop:Standardized Analyses, Design Benchmarks, and Reporting

    DTIC Science & Technology

    2012-01-01

    related to the exoelectrogenic biofilm activity, and to investigate whether the community structure is a function of design and operational parameters...where should biofilm samples be collected? The most prevalent methods of community characterization in BES studies have entailed phylogenetic ...of function associated with this genetic marker, and in methods that involve polymerase chain reaction (PCR) amplification the quantitative

  11. Electrochemical Branched-DNA Assay for Polymerase Chain Reaction-Free Detection and Quantification of Oncogenes in Messenger RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei

    2008-12-01

    We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection ofmore » target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.« less

  12. Detection of different Ikaros isoforms in human leukaemias using real-time quantitative polymerase chain reaction.

    PubMed

    Olivero, S; Maroc, C; Beillard, E; Gabert, J; Nietfeld, W; Chabannon, C; Tonnelle, C

    2000-09-01

    The Ikaros gene is an essential regulator in development and haematopoiesis. Dysregulated Ikaros gene expression participates in leukaemic processes, as evidenced in animal models, and by analyses of blast-cell populations from leukaemic patients. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the relative abundance of several Ikaros transcript isoforms in a variety of leukaemic-cell samples. Total RNA was isolated from bone-marrow or blood-cell samples collected at diagnosis in children or adult patients, 18 of whom had acute myeloblastic leukaemia (AML), 61 of whom had acute lymphoblastic leukaemia (ALL) and 11 of whom had chronic myeloid leukaemia (CML). The ratio (Ik1 + Ik2)/(Ik1 + Ik2 + Ik4 + Ik7 + Ik8) ranged from 13.5% to 85% and was lower (P < 0. 05) in samples from patients with m-bcr-abl ALL. An alternative splicing resulting in the deletion of 30 nucleotides at the end of exon 6 was observed in leukaemic samples, and in normal thymus and bone marrow. Our results are consistent with previous reports and suggest that the pattern of expression of the different human Ikaros isoforms are not homogeneous among different subsets of leukaemias.

  13. Usefulness of quantitative polymerase chain reaction in amniotic fluid as early prognostic marker of fetal infection with Toxoplasma gondii.

    PubMed

    Romand, Stéphane; Chosson, Muriel; Franck, Jacqueline; Wallon, Martine; Kieffer, François; Kaiser, Karine; Dumon, Henri; Peyron, François; Thulliez, Philippe; Picot, Stéphane

    2004-03-01

    Our purpose was to evaluate Toxoplasma gondii concentration in amniotic fluid (AF) samples as a prognostic marker of congenital toxoplasmosis. A retrospective study was carried out in 88 consecutive AF samples from 86 pregnant women, which were found positive by prospective polymerase chain reaction (PCR) testing. Parasite AF concentrations were estimated by real-time quantitative PCR and analyzed in relation to the clinical outcome of infected fetuses during pregnancy and at birth, taking into account the gestational age at maternal infection. A significant negative linear regression was observed between gestational age at maternal infection and T gondii DNA loads in AF. After adjusting for time at maternal seroconversion by multivariate analysis, higher parasite concentrations were significantly associated with a severe outcome of congenital infection (odds ratio [OR]=15.38/log (parasites/mL AF) [95% CI=2.45-97.7]). PCR quantification of T gondii in AF can be highly contributive for early prognosis of congenital toxoplasmosis. Maternal infections acquired before 20 weeks with a parasite load greater than 100/mL of AF have the highest risk of severe fetal outcome.

  14. Expression of Fra-1 in human hepatocellular carcinoma and its prognostic significance.

    PubMed

    Gao, Xiao-Qiang; Ge, Yong-Sheng; Shu, Qing-Hua; Ma, Hua-Xing

    2017-06-01

    This study aimed to explore the clinical significance and prognostic value of Fra-1 in hepatocellular carcinoma patients after curative resection. Fra-1 expression was investigated using a combination of techniques: immunohistochemistry for 66 samples of hepatocellular carcinoma and quantitative real-time polymerase chain reaction and western blotting assays for 19 matched hepatocellular carcinoma specimens. Fra-1 was present in 38 of 66 (57.6%) tumor tissues, with intense staining in the nuclei. There was also positive staining in 14 of 66 (21.2%) adjacent peritumoral tissues, with weak staining in the cytoplasm. Quantitative real-time polymerase chain reaction and western blotting assays confirmed higher expression of Fra-1 messenger RNA and Fra-1 protein in tumor tissues than adjacent non-tumor tissues for 19 hepatocellular carcinoma samples (p < 0.001). Positive expression of Fra-1 was significantly related to vascular invasion and serum alpha-fetoprotein. Kaplan-Meier survival analysis found that overexpressed Fra-1 was correlated with poor overall survival and disease-free survival. Multivariate analysis identified Fra-1 as an independent prognostic factor. Fra-1 may be involved in the progress of hepatocellular carcinoma and could be a promising molecular candidate in the diagnosis and treatment of hepatocellular carcinoma.

  15. Development of an Escherichia coli K12-specific quantitative polymerase chain reaction assay and DNA isolation suited to biofilms associated with iron drinking water pipe corrosion products.

    PubMed

    Lu, Jingrang; Gerke, Tammie L; Buse, Helen Y; Ashbolt, Nicholas J

    2014-12-01

    A quantitative polymerase chain reaction assay (115 bp amplicon) specific to Escherichia coli K12 with an ABI(TM) internal control was developed based on sequence data encoding the rfb gene cluster. Assay specificity was evaluated using three E. coli K12 strains (ATCC W3110, MG1655 & DH1), 24 non-K12 E. coli and 23 bacterial genera. The biofilm detection limit was 10(3) colony-forming units (CFU) E. coli K12 mL(-1), but required a modified protocol, which included a bio-blocker Pseudomonas aeruginosa with ethylenediaminetetraacetic acid buffered to pH 5 prior to cell lysis/DNA extraction. The novel protocol yielded the same sensitivity for drinking water biofilms associated with Fe3O4 (magnetite)-coated SiO2 (quartz) grains and biofilm-surface iron corrosion products from a drinking water distribution system. The novel DNA extraction protocol and specific E. coli K12 assay are sensitive and robust enough for detection and quantification within iron drinking water pipe biofilms, and are particularly well suited for studying enteric bacterial interactions within biofilms.

  16. Selection of suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using quantitative real-time polymerase chain reaction.

    PubMed

    Zornhagen, K W; Kristensen, A T; Hansen, A E; Oxboel, J; Kjaer, A

    2015-12-01

    Quantitative real-time reverse transcription polymerase chain reaction (RT-qPCR) is a sensitive technique for quantifying gene expression. Stably expressed reference genes are necessary for normalization of RT-qPCR data. Only a few articles have been published on reference genes in canine tumours. The objective of this study was to demonstrate how to identify suitable reference genes for normalization of genes of interest in canine soft tissue sarcomas using RT-qPCR. Primer pairs for 17 potential reference genes were designed and tested in archival tumour biopsies from six dogs. The geNorm algorithm was used to analyse the most suitable reference genes. Eight potential reference genes were excluded from this final analysis because of their dissociation curves. β-Glucuronidase (GUSB) and proteasome subunit, beta type, 6 (PSMB6) were most stably expressed with an M value of 0.154 and a CV of 0.053 describing their average stability. We suggest that choice of reference genes should be based on specific testing in every new experimental set-up. © 2014 John Wiley & Sons Ltd.

  17. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  18. The cervical mucus plug inhibits, but does not block, the passage of ascending bacteria from the vagina during pregnancy.

    PubMed

    Hansen, Lea K; Becher, Naja; Bastholm, Sara; Glavind, Julie; Ramsing, Mette; Kim, Chong J; Romero, Roberto; Jensen, Jørgen S; Uldbjerg, Niels

    2014-01-01

    To evaluate the microbial load and the inflammatory response in the distal and proximal parts of the cervical mucus plug. Experimental research. Twenty women with a normal, singleton pregnancy. Vaginal swabs and specimens from the distal and proximal parts of the cervical mucus plug. Immunohistochemistry, enzyme-linked immunosorbent assay, quantitative polymerase chain reaction and histology. The total bacterial load (16S rDNA) was significantly lower in the cervical mucus plug compared with the vagina (p = 0.001). Among women harboring Ureaplasma parvum, the median genome equivalents/g were 1574 (interquartile range 2526) in the proximal part, 657 (interquartile range 1620) in the distal part and 60,240 (interquartile range 96,386) in the vagina. Histological examinations and quantitative polymerase chain reaction revealed considerable amounts of lactobacilli and inflammatory cells in both parts of the cervical mucus plug. The matrix metalloproteinase-8 concentration was decreased in the proximal part of the plug compared with the distal part (p = 0.08). The cervical mucus plug inhibits, but does not block, the passage of Ureaplasma parvum during its ascending route from the vagina through the cervical canal. © 2013 Nordic Federation of Societies of Obstetrics and Gynecology.

  19. Characterization of Fecal Microbiota across Seven Chinese Ethnic Groups by Quantitative Polymerase Chain Reaction

    PubMed Central

    Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota. PMID:24699404

  20. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  1. Serum miR-338-5p, soluble B-cell-activating factor, allo-antibodies, and renal transplantation.

    PubMed

    Xu, H; Ma, X; He, X; Dong, P; Xue, D; Zhang, Y; Zhang, X

    2015-03-01

    The objective of the study was to explore the expression features of serum miR-338-5p and soluble B-cell-activating factor (sBAFF) in renal transplant recipients. Follow-up renal transplant recipients (n = 49) were enrolled in this study (male/female: 38/11). Healthy volunteers were controlled; 2 mL of peripheral blood from each subject was collected. Total RNA was extracted from serum by use of the miRNeasy Serum/Plasma Kit (QIAGEN), and miR-338-5p was amplified by means of quantitative real-time reverse transcriptase-polymerase chain reaction. sBAFF was detected by means of enzyme-linked immunoassay. LABScreen Mix (LSM12) (One Lambda) was used to test the level of anti-human leukocyte antigen (HLA) I antibody (Ab), anti-HLA II Ab, and anti-major histocompatibility complex class I chain-related A (MICA) Ab. All data are shown as mean ± SD and were analyzed by use of SPSS software 17.0. Compared with healthy volunteers, serum miR-338-5p in recipients was statistically downregulated (2.79 ± 2.5 versus 0.09 ± 0.12, P < .001); sBAFF in recipients was significantly upregulated (1321 ± 950 pg/mL versus 534 ± 327 pg/mL, P < .01); serum anti-HLAII Ab, anti-MICA Ab, and anti-HLA+MICA Abs all statistically increased in recipients (P < .05). Spearman correlation analysis showed that miR-338-5p was significantly negatively correlated with sBAFF (r = -0.51, P < .001) and anti-HLA II antibody with mean fluorescence intensity value >1000 (r = -0.322, P < .05). Analysis results also suggested that sBAFF was significantly negatively correlated with anti-MICA Ab, with mean fluorescence intensity value >1000 (r = -0.579, P < .05). miR-338-5p is closely correlated with the procedure of renal allograft antibody-mediated rejection. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. An ethanolic extract of Artemisia dracunculus L. regulates gene expression of ubiquitin-proteasome system enzymes in skeletal muscle: potential role in the treatment of sarcopenic obesity.

    PubMed

    Kirk-Ballard, Heather; Kilroy, Gail; Day, Britton C; Wang, Zhong Q; Ribnicky, David M; Cefalu, William T; Floyd, Z Elizabeth

    2014-01-01

    Obesity is linked to insulin resistance, a primary component of metabolic syndrome and type 2 diabetes. The problem of obesity-related insulin resistance is compounded when age-related skeletal muscle loss, called sarcopenia, occurs with obesity. Skeletal muscle loss results from elevated levels of protein degradation and prevention of obesity-related sarcopenic muscle loss will depend on strategies that target pathways involved in protein degradation. An extract from Artemisia dracunculus, termed PMI 5011, improves insulin signaling and increases skeletal muscle myofiber size in a rodent model of obesity-related insulin resistance. The aim of this study was to examine the effect of PMI 5011 on the ubiquitin-proteasome system, a central regulator of muscle protein degradation. Gastrocnemius and vastus lateralis skeletal muscle was obtained from KK-A(y) obese diabetic mice fed a control or 1% (w/w) PMI 5011-supplemented diet. Regulation of genes encoding enzymes of the ubiquitin-proteasome system was determined using real-time quantitative reverse transcriptase polymerase chain reaction. Although MuRF-1 ubiquitin ligase gene expression is consistently down-regulated in skeletal muscle, atrogin-1, Fbxo40, and Traf6 expression is differentially regulated by PMI 5011. Genes encoding other enzymes of the ubiquitin-proteasome system ranging from ubiquitin to ubiquitin-specific proteases are also regulated by PMI 5011. Additionally, expression of the gene encoding the microtubule-associated protein-1 light chain 3 (LC3), a ubiquitin-like protein pivotal to autophagy-mediated protein degradation, is down-regulated by PMI 5011 in the vastus lateralis. PMI 5011 alters the gene expression of ubiquitin-proteasome system enzymes that are essential regulators of skeletal muscle mass. This suggests that PMI 5011 has therapeutic potential in the treatment of obesity-linked sarcopenia by regulating ubiquitin-proteasome-mediated protein degradation. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia.

    PubMed

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan-Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1×10(-3) for precursor B-cell acute lymphoblastic leukemia and 1×10(-2) for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1%±5.6% versus 41.7%±17.3%, respectively; p-value=0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. Copyright © 2015 Associação Brasileira de Hematologia, Hemoterapia e Terapia Celular. Published by Elsevier Editora Ltda. All rights reserved.

  4. Mechanical tensile stress effects on the expression of bone sialoprotein in bovine cementoblasts.

    PubMed

    Yu, Hongyou; Ren, Yijin; Sandham, Andrew; Ren, Aishu; Huang, Lan; Bai, Ding

    2009-03-01

    To develop a new cementoblast culture method and to detect bone sialoprotein (BSP) expression in response to high and low mechanical tensile stress in cementoblast in vitro. Cementoblasts were collected from the roots of newborn bovine teeth and were identified with cementum-derived attachment protein (CAP) antibody 3G9. Cell proliferation was evaluated by MTT [3-(4,5-dimethylthazol-2-yl)-2,5-diphenyl tetrazolium bromide] assay, and mineralization was confirmed by von Kossa staining. Mechanical tensile stress was applied in vitro to the cementoblast with the use of a uniaxial four-point bending system with 2000 or 4000 microstrains, at a frequency of 0.5 Hz for 3, 6, 12, 24, or 36 hours. BSP mRNA level was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). A large amount of cementoblast was observed to be expressing CAP. Cementoblasts had a proliferation tendency similar to that of osteoblasts but different from that of periodontal ligament (PDL) cells. Cementoblasts had the ability to become mineralized between osteoblasts and PDL cells. The mechanical tensile stress significantly up-regulated BSP mRNA expression, which reached a peak at 24 hours in both 2000 and 4000 microstrain groups (P < .01) and was tenfold and sixfold higher than that of controls, respectively. BSP expression dropped toward baseline levels at 36 hours in both groups. Mechanical tensile stress up-regulated the expression of BSP. Low mechanical tensile stress induced earlier and more intensive up-regulation of BSP mRNA; this might represent the optimal stimuli for cementoblast activity.

  5. Human Platelet Lysate as a Replacement for Fetal Bovine Serum in Limbal Stem Cell Therapy.

    PubMed

    Suri, Kunal; Gong, Hwee K; Yuan, Ching; Kaufman, Stephen C

    2016-10-01

    To evaluate the use of human platelet lysate (HPL) as an alternative supplement for limbal explant culture. Culture media were prepared using either 10% pooled HPL (PHPL), single donor HPL, or fetal bovine serum (FBS). Limbal tissues, obtained from the Minnesota Lions Eye Bank, were cultured in each medium on plastic plates or on denuded amniotic membrane (AM). Immunofluorescence staining was performed for ABCG2, tumor protein p63α, and cytokeratin 3 (K3). Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) was used to evaluate the expression of ABCG2 and p63. Limbal explants grown in each medium were labeled with bromodeoxyuridine (BrdU) to assess the proliferative capacity in each medium. Concentration of growth factors including epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), transforming growth factor-β (TGF-β), and platelet derived growth factor (PDGF) in HPL and PHPL was compared to that in human serum (HS). Immunofluorescence staining on AM showed prominent expression of ABCG2, p63α but sparse expression of K3 in HPL and PHPL supplemented medium. Real time-PCR showed 1.7 fold higher expression of ABCG2 in PHPL supplemented medium (p = 0.03), and similar expression of p63 in HPL and PHPL supplemented medium compared to FBS medium. The proliferation assay showed that LSCs retained their proliferative potential in HPL supplemented medium. Higher concentration of growth factors were found in HPL, compared to HS. Human platelet lysate has higher concentration of grown factors and is effective in maintaining growth and stem cell phenotype of corneal limbal explant cultures.

  6. CsSCL1 is differentially regulated upon maturation in chestnut microshoots and is specifically expressed in rooting-competent cells.

    PubMed

    Vielba, Jesús M; Díaz-Sala, Carmen; Ferro, Enrique; Rico, Saleta; Lamprecht, María; Abarca, Dolores; Ballester, Antonio; Sánchez, Conchi

    2011-10-01

    The Castanea sativa SCL1 gene (CsSCL1) has previously been shown to be induced by auxin during adventitious root (AR) formation in rooting-competent microshoots. However, its expression has not previously been analyzed in rooting-incompetent shoots. This study focuses on the regulation of CsSCL1 during maturation and the role of the gene in the formation of AR. The expression of CsSCL1 in rooting-incompetent microshoots and other tissues was investigated by quantitative reverse transcriptase--polymerase chain reaction. The analysis was complemented by in situ hybridization of the basal segments of rooting-competent and --incompetent microshoots during AR induction, as well as in AR and lateral roots. It was found that CsSCL1 is upregulated by auxin in a cell-type- and phase-dependent manner during the induction of AR. In root-forming shoots, CsSCL1 mRNA was specifically located in the cambial zone and derivative cells, which are rooting-competent cells, whereas in rooting-incompetent shoots the hybridization signal was more diffuse and evenly distributed through the phloem and parenchyma. CsSCL1 expression was also detected in lateral roots and axillary buds. The different CsSCL1 expression patterns in rooting-competent and -incompetent microshoots, together with the specific location of transcripts in cell types involved in root meristem initiation and in the root primordia of AR and lateral roots, indicate an important role for the gene in determining whether certain cells will enter the root differentiation pathway and its involvement in meristem maintenance.

  7. Etsrp/Etv2 is directly regulated by Foxc1a/b in the zebrafish angioblast.

    PubMed

    Veldman, Matthew B; Lin, Shuo

    2012-01-20

    Endothelial cells are developmentally derived from angioblasts specified in the mesodermal germ cell layer. The transcription factor etsrp/etv2 is at the top of the known genetic hierarchy for angioblast development. The transcriptional events that induce etsrp expression and angioblast specification are not well understood. We generated etsrp:gfp transgenic zebrafish and used them to identify regulatory regions and transcription factors critical for etsrp expression and angioblast specification from mesoderm. To investigate the mechanisms that initiate angioblast cell transcription during embryogenesis, we have performed promoter analysis of the etsrp locus in zebrafish. We describe three enhancer elements sufficient for endothelial gene expression when place in front of a heterologous promoter. The deletion of all 3 regulatory regions led to a near complete loss of endothelial expression from the etsrp promoter. One of the enhancers, located 2.3 kb upstream of etsrp contains a consensus FOX binding site that binds Foxc1a and Foxc1b in vitro by EMSA and in vivo using ChIP. Combined knockdown of foxc1a/b, using morpholinos, led to a significant decrease in etsrp expression at early developmental stages as measured by quantitative reverse transcriptase-polymerase chain reaction and in situ hybridization. Decreased expression of primitive erythrocyte genes scl and gata1 was also observed, whereas pronephric gene pax2a was relatively normal in expression level and pattern. These findings identify mesodermal foxc1a/b as a direct upstream regulator of etsrp in angioblasts. This establishes a new molecular link in the process of mesoderm specification into angioblast.

  8. Overexpression of miR-484 and miR-744 in Vero cells alters Dengue virus replication

    PubMed Central

    Castrillón-Betancur, Juan Camilo; Urcuqui-Inchima, Silvio

    2017-01-01

    BACKGROUND Dengue is considered one of the world’s most important mosquito-borne diseases. MicroRNAs (miRNAs) are small non-coding single-stranded RNAs that play an important role in the regulation of gene expression in eukaryotes. Although miRNAs possess antiviral activity against many mammalian-infecting viruses, their involvement in Dengue virus (DENV) replication remains poorly understood. OBJECTIVE To determine the role of miR-484 and miR-744 in DENV infection and to examine whether DENV infection alters the expression of both miRNAs. METHODS We used bioinformatics tools to explore the relationship between DENV and cellular miRNAs. We then overexpressed miR-484 or miR-744 in Vero cells to examine their role in DENV replication using flow cytometry, reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), and western blotting. FINDINGS We found several cellular miRNAs that target a conserved region within the 3′ untranslated region (3′ UTR) of the genome of the four DENV serotypes and found that overexpression of miR-484 or miR-744 inhibits infection by DENV-1 to DENV-4. Furthermore, we observed that DENV RNA might be involved in the downregulation of endogenous miR-484 and miR-744. CONCLUSION Our study identifies miR-484 and miR-744 as two possible restriction host factors against DENV infection. However, further studies are needed to directly verify whether miR-484 and miR-744 both have an anti-DENV effect in vivo. PMID:28327787

  9. Use of functional gene expression and respirometry to study wastewater nitrification activity after exposure to low doses of copper.

    PubMed

    Kapoor, Vikram; Li, Xuan; Chandran, Kartik; Impellitteri, Christopher A; Santo Domingo, Jorge W

    2016-04-01

    Autotrophic nitrification in biological nitrogen removal systems has been shown to be sensitive to the presence of heavy metals in wastewater treatment plants. Using transcriptase-quantitative polymerase chain reaction (RT-qPCR) data, we examined the effect of copper on the relative expression of functional genes (i.e., amoA, hao, nirK, and norB) involved in redox nitrogen transformation in batch enrichment cultures obtained from a nitrifying bioreactor operated as a continuous reactor (24-h hydraulic retention time). 16S ribosomal RNA (rRNA) gene next-generation sequencing showed that Nitrosomonas-like populations represented 60-70% of the bacterial community, while other nitrifiers represented <5%. We observed a strong correspondence between the relative expression of amoA and hao and ammonia removal in the bioreactor. There were no considerable changes in the transcript levels of amoA, hao, nirK, and norB for nitrifying samples exposed to copper dosages ranging from 0.01 to 10 mg/L for a period of 12 h. Similar results were obtained when ammonia oxidation activity was measured via specific oxygen uptake rate (sOUR). The lack of nitrification inhibition by copper at doses lower than 10 mg/L may be attributed to the role of copper as cofactor for ammonia monooxygenase or to the sub-inhibitory concentrations of copper used in this study. Overall, these results demonstrate the use of molecular methods combined with conventional respirometry assays to better understand the response of wastewater nitrifying systems to the presence of copper.

  10. Compensatory molecular and functional mechanisms in nervous system of the Grm1(crv4) mouse lacking the mGlu1 receptor: a model for motor coordination deficits.

    PubMed

    Rossi, Pia Irene Anna; Musante, Ilaria; Summa, Maria; Pittaluga, Anna; Emionite, Laura; Ikehata, Masami; Rastaldi, Maria Pia; Ravazzolo, Roberto; Puliti, Aldamaria

    2013-09-01

    The metabotropic glutamate type 1 (mGlu1) and type 5 (mGlu5) receptors, the only members of group I mGlu receptors, are implicated in synaptic plasticity and mechanisms of feedback control of glutamate release. They exhibit nearly complementary distributions throughout the central nervous system, well evident in the cerebellum, where mGlu1 receptor is most intensely expressed while mGlu5 receptor is not. Despite their different distribution, they show a similar subcellular localization and use common transducing pathways. We recently described the Grm1(crv4) mouse with motor coordination deficits and renal anomalies caused by a spontaneous mutation inactivating the mGlu1 receptor. To define the neuropathological mechanisms in these mice, we evaluated expression and function of the mGlu5 receptor in cerebral and cerebellar cortices. Western blot and immunofluorescence analyses showed mGlu5 receptor overexpression. Quantitative reverse transcriptase-polymerase chain reaction results indicated that the up-regulation is already evident at RNA level. Functional studies confirmed an enhanced glutamate release from cortical cerebral and cerebellar synaptosomes when compared with wild-type that is abolished by the mGlu5 receptor-specific inhibitor, 2-methyl-6-(phenylethynyl) pyridine hydrochloride (MPEP). Finally, acute MPEP treatment of Grm1(crv4/crv4) mice induced an evident although incomplete improvement of motor coordination, suggesting that mGlu5 receptors enhanced activity worsens, instead of improving, the motor-coordination defects in the Grm1(crv4/crv4) mice.

  11. Inhibition of P-glycoprotein and glutathione S-transferase-pi mediated resistance by fluoxetine in MCF-7/ADM cells.

    PubMed

    Zhang, Ye; Zhou, Ting; Duan, Jingjing; Xiao, Zhijun; Li, Guihua; Xu, Feng

    2013-10-01

    Chemotherapy is important in the systematic treatment of breast cancer. While multidrug resistance (MDR) is the main obstacle in chemotherapy, a reversal reagent with high reversal effect but low toxicity is the hotspot issue at present to overcome MDR. Antidepressant fluoxetine (FLX) is a potential new highly effective chemosensitizer, however, the possible mechanism is unclear. In this study, the effect of FLX on multidrug resistance mediated by P-glycoprotein (P-gp) and glutathione S-transferase-pi (GST-π) were researched in resistant/sensitive breast cancer cells. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was used to determine the cells viability after being incubated with FLX/Adriamycin (ADM)/Paclitaxel (PTX) alone or FLX-ADM, FLX-PTX combination. Western blot was performed to assay the expression of P-gp and GST-π proteins. Reverse transcriptase polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qRT-PCR) were performed to assay the level of MDR1 mRNA. The results showed that pre-treatment with FLX enhance cytotoxicity significantly both on resistant and sensitive cells, downregulated the expression of P-gp and GST-π proteins in resistance cells, decreased the MDR1 mRNA by FLX-PTX combination only. No P-gp and GST-π were detected in sensitive cells. Our research thus indicated that FLX reverse the breast cancer cell's resistance and enhance the chemosensitivity by regulating P-gp and GST-π levels. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  12. Regulatory and activated effector T cells in chronic hepatitis C virus: Relation to autoimmunity

    PubMed Central

    Fouad, Hanan; El Raziky, Maissa; Hassan, Eman Medhat; Aziz, Ghada Mahmoud Abdel; Darweesh, Samar K; Sayed, Ahmed Reda

    2016-01-01

    AIM To investigate how Tregs are regulated in chronic hepatitis C virus (HCV) patients via assessment of Tregs markers (granzyme 2, CD69 and FoxP3), Teffs markers [TNFRSF4 (OX40), INFG] and CD4, CD25 genes. METHODS A prospective study was conducted on 120 subjects divided into 4 groups: Group I (n = 30) treatment naïve chronic HCV patients; Group II (n = 30) chronic HCV treated with Peg/Riba; Group III (n = 30) chronic HCV associated with non-organ specific autoantibody and Group IV (n = 30) healthy persons as a control group. Tregs and Teffs markers were assessed in peripheral blood mononuclear cells by quantitative real time reverse transcriptase-polymerase chain reaction. RESULTS Chronic HCV patients exhibited significant higher levels of both Teffs and Tregs in comparison to healthy control group. Tregs markers were significantly decreased in Peg/Riba treated HCV patients in comparison to treatment naïve HCV group. In HCV patients with antinuclear antibody (ANA) +ve, Tregs markers were significantly decreased in comparison to all other studied groups. Teffs markers were significantly elevated in all HCV groups in comparison to control and in HCV group with ANA +ve in comparison to treatment naïve HCV group. CONCLUSION Elevated Tregs cells in chronic HCV patients dampen both CD4+ and CD8+ autologous T cell immune response. Interferon-α and ribavirin therapy suppress proliferation of Tregs. More significant suppression of Tregs was observed in HCV patients with autoantibodies favoring pathological autoimmune response. PMID:27843539

  13. Quantifying whole transcriptome size, a prerequisite for understanding transcriptome evolution across species: an example from a plant allopolyploid.

    PubMed

    Coate, Jeremy E; Doyle, Jeff J

    2010-01-01

    Evolutionary biologists are increasingly comparing gene expression patterns across species. Due to the way in which expression assays are normalized, such studies provide no direct information about expression per gene copy (dosage responses) or per cell and can give a misleading picture of genes that are differentially expressed. We describe an assay for estimating relative expression per cell. When used in conjunction with transcript profiling data, it is possible to compare the sizes of whole transcriptomes, which in turn makes it possible to compare expression per cell for each gene in the transcript profiling data set. We applied this approach, using quantitative reverse transcriptase-polymerase chain reaction and high throughput RNA sequencing, to a recently formed allopolyploid and showed that its leaf transcriptome was approximately 1.4-fold larger than either progenitor transcriptome (70% of the sum of the progenitor transcriptomes). In contrast, the allopolyploid genome is 94.3% as large as the sum of its progenitor genomes and retains > or =93.5% of the sum of its progenitor gene complements. Thus, "transcriptome downsizing" is greater than genome downsizing. Using this transcriptome size estimate, we inferred dosage responses for several thousand genes and showed that the majority exhibit partial dosage compensation. Homoeologue silencing is nonrandomly distributed across dosage responses, with genes showing extreme responses in either direction significantly more likely to have a silent homoeologue. This experimental approach will add value to transcript profiling experiments involving interspecies and interploidy comparisons by converting expression per transcriptome to expression per genome, eliminating the need for assumptions about transcriptome size.

  14. High expression of AFAP1-AS1 is associated with poor survival and short-term recurrence in pancreatic ductal adenocarcinoma.

    PubMed

    Ye, Yibiao; Chen, Jie; Zhou, Yu; Fu, Zhiqiang; Zhou, Quanbo; Wang, YingXue; Gao, Wenchao; Zheng, ShangYou; Zhao, Xiaohui; Chen, Tao; Chen, Rufu

    2015-04-30

    Pancreatic ductal adenocarcinoma (PDAC) is still a lethal malignancy. Long noncoding RNAs (lncRNAs) have been shown to play a critical role in cancer development and progression. Here we identified overexpression of the lncRNA AFAP1-AS1 in PDAC patients and evaluated its prognostic and functional relevance. The global lncRNA expression profile in PDAC was measured by lncRNA microarray. Expression of AFAP1-AS1 was evaluated by reverse-transcriptase quantitative polymerase chain reaction (RT-qPCR) in 90 PDAC tissue samples and adjacent normal tissues. The impact of AFAP1-AS1 expression on cell proliferation, migration, and invasion were evaluated in vitro using knockdown and ectopic expression strategies. Microarray analysis revealed that up-regulation of AFAP1-AS1 expression in PDAC tissues compared with normal adjacent tissues, which was confirmed by RT-qPCR in 69/90 cases (76.7%). Its overexpression was associated with lymph node metastasis, perineural invasion, and poor survival. When using AFAP1-AS1 as a prognostic marker, the areas under ROC curves were 0.8669 and 0.9370 for predicting tumor progression within 6 months and 1 year, respectively. In vitro functional experiments involving knockdown of AFAP1-AS1 resulted in attenuated PDAC cell proliferation, migration, and invasion. Ectopic expression of AFAP1-AS1 promoted cell proliferation, migration, and invasion. AFAP1-AS1 is a potential novel prognostic marker to predict the clinical outcome of PDAC patients after surgery and may be a rational target for therapy.

  15. Vcsa1 Acts as a Marker of Erectile Function Recovery After Gene Therapeutic and Pharmacological Interventions

    PubMed Central

    Calenda, Giulia; Tong, Yuehong; Tar, Moses; Lowe, Daniel; Siragusa, Joseph; Melman, Arnold; Davies, Kelvin P.

    2010-01-01

    Purpose We identified molecular markers of erectile function, particularly those responding to erectile dysfunction treatment. Materials and Methods Sprague-Dawley retired breeder rats were intracorporeally injected with pVAX-hSlo, pSMAA-hSlo or the control plasmid pVAX. One week later the intracorporeal pressure-to-blood pressure ratio and gene expression were determined by microarray analysis and quantitative reverse transcriptase-polymerase chain reaction. Rat corporeal cells were transfected in vitro with pVAX-hSlo, pSMAA-hSlo or pVAX and the change in gene expression was determined. We also determined whether Vcsa1 expression was changed after pharmacotherapy using tadalafil. Results Animals treated with vectors expressing hSlo had significantly improved erectile function compared to that in controls, accompanied by changed expression of a subset of genes. Vcsa1 was one of the genes that was most changed in expression (the third of approximately 31,000 with greater than 10-fold up-regulation). Changes in gene expression were different than those observed in corporeal cells transfected in vitro, distinguishing gene expression changes that were a direct effect of hSlo over expression. When tadalafil was administered in retired breeder rats, the Vcsa1 transcript increased 4-fold in corporeal tissue compared to that in untreated controls. Conclusions Our study identifies a set of genes that are changed in response to improved erectile function, rather than as a direct effect of treatment. We noted Vcsa1 may act as marker of the restoration of erectile function after gene transfer and pharmacotherapy. PMID:19375734

  16. Vcsa1 acts as a marker of erectile function recovery after gene therapeutic and pharmacological interventions.

    PubMed

    Calenda, Giulia; Tong, Yuehong; Tar, Moses; Lowe, Daniel; Siragusa, Joseph; Melman, Arnold; Davies, Kelvin P

    2009-06-01

    We identified molecular markers of erectile function, particularly those responding to erectile dysfunction treatment. Sprague-Dawley retired breeder rats were intracorporeally injected with pVAX-hSlo, pSMAA-hSlo or the control plasmid pVAX. One week later the intracorporeal pressure-to-blood pressure ratio and gene expression were determined by microarray analysis and quantitative reverse transcriptase-polymerase chain reaction. Rat corporeal cells were transfected in vitro with pVAX-hSlo, pSMAA-hSlo or pVAX and the change in gene expression was determined. We also determined whether Vcsa1 expression was changed after pharmacotherapy using tadalafil. Animals treated with vectors expressing hSlo had significantly improved erectile function compared to that in controls, accompanied by changed expression of a subset of genes. Vcsa1 was one of the genes that was most changed in expression (the third of approximately 31,000 with greater than 10-fold up-regulation). Changes in gene expression were different than those observed in corporeal cells transfected in vitro, distinguishing gene expression changes that were a direct effect of hSlo over expression. When tadalafil was administered in retired breeder rats, the Vcsa1 transcript increased 4-fold in corporeal tissue compared to that in untreated controls. Our study identifies a set of genes that are changed in response to improved erectile function, rather than as a direct effect of treatment. We noted Vcsa1 may act as marker of the restoration of erectile function after gene transfer and pharmacotherapy.

  17. Somatostatinergic modulation of firing pattern and calcium-activated potassium currents in medium spiny neostriatal neurons.

    PubMed

    Galarraga, E; Vilchis, C; Tkatch, T; Salgado, H; Tecuapetla, F; Perez-Rosello, T; Perez-Garci, E; Hernandez-Echeagaray, E; Surmeier, D J; Bargas, J

    2007-05-11

    Somatostatin is synthesized and released by aspiny GABAergic interneurons of the neostriatum, some of them identified as low threshold spike generating neurons (LTS-interneurons). These neurons make synaptic contacts with spiny neostriatal projection neurons. However, very few somatostatin actions on projection neurons have been described. The present work reports that somatostatin modulates the Ca(2+) activated K(+) currents (K(Ca) currents) expressed by projection cells. These actions contribute in designing the firing pattern of the spiny projection neuron; which is the output of the neostriatum. Small conductance (SK) and large conductance (BK) K(Ca) currents represent between 30% and 50% of the sustained outward current in spiny cells. Somatostatin reduces SK-type K(+) currents and at the same time enhances BK-type K(+) currents. This dual effect enhances the fast component of the after hyperpolarizing potential while reducing the slow component. Somatostatin then modifies the firing pattern of spiny neurons which changed from a tonic regular pattern to an interrupted "stuttering"-like pattern. Semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) tissue expression analysis of dorsal striatal somatostatinergic receptors (SSTR) mRNA revealed that all five SSTR mRNAs are present. However, single cell RT-PCR profiling suggests that the most probable receptor in charge of this modulation is the SSTR2 receptor. Interestingly, aspiny interneurons may exhibit a "stuttering"-like firing pattern. Therefore, somatostatin actions appear to be the entrainment of projection neurons to the rhythms generated by some interneurons. Somatostatin is then capable of modifying the processing and output of the neostriatum.

  18. A Comparative Study of Drug Delivery Methods Targeted to the Mouse Inner Ear: Bullostomy Versus Transtympanic Injection

    PubMed Central

    Cediel, Rafael; Celaya, Adelaida M.; Lassaletta, Luis; Varela-Nieto, Isabel; Contreras, Julio

    2017-01-01

    We present two minimally invasive microsurgical techniques in rodents for specific drug delivery into the middle ear so that it may reach the inner ear. The first procedure consists of perforation of the tympanic bulla, termed bullostomy; the second one is a transtympanic injection. Both emulate human clinical intratympanic procedures. Chitosan-glycerophosphate (CGP) and Ringer´s Lactate buffer (RL) were used as biocompatible vehicles for local drug delivery. CGP is a nontoxic biodegradable polymer widely used in pharmaceutical applications. It is a viscous liquid at RT but it congeals to a semi solid phase at body temperature. RL is an isotonic solution used for intravenous administrations in humans. A small volume of this vehicle is precisely placed on the Round Window (RW) niche by means of a bullostomy. A transtympanic injection fills the middle ear and allows less control but broader access to the inner ear. The safety profiles of both techniques were studied and compared by using functional and morphological tests. Hearing was evaluated by registering the Auditory Brainstem Response (ABR) before and several times after microsurgery. The cytoarchitecture and preservation level of cochlear structures were studied by conventional histological techniques in paraformaldehyde-fixed and decalcified cochlear samples. In parallel, unfixed cochlear samples were taken and immediately frozen to analyze gene expression profiles of inflammatory markers by quantitative Reverse Transcriptase Polymerase Chain Reaction (qRT-PCR). Both procedures are suitable as drug delivery methods into the mouse middle ear, although transtympanic injection proved to be less invasive compared to bullostomy. PMID:28362376

  19. Identification of the heme acquisition system in Vibrio vulnificus M2799.

    PubMed

    Kawano, Hiroaki; Miyamoto, Katsushiro; Yasunobe, Megumi; Murata, Masahiro; Yamahata, Eri; Yamaguchi, Ryo; Miyaki, Yuta; Tsuchiya, Takahiro; Tanabe, Tomotaka; Funahashi, Tatsuya; Tsujibo, Hiroshi

    2018-04-01

    Vibrio vulnificus, the causative agent of serious, often fatal, infections in humans, requires iron for its pathogenesis. As such, it obtains iron via both vulnibactin and heme-mediated iron-uptake systems. In this study, we identified the heme acquisition system in V. vulnificus M2799. The nucleotide sequences of the genes encoding heme receptors HupA and HvtA and the ATP-binding cassette (ABC) transport system proteins HupB, HupC, and HupD were determined, and then used in the construction of deletion mutants developed from a Δics strain, which could not synthesize vulnibactin. Growth experiments using these mutants indicated that HupA and HvtA are major and minor heme receptors, respectively. The expressions of two proteins were analyzed by the quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, complementation analyses confirmed that the HupBCD proteins are the only ABC transport system shared by both the HupA and HvtA receptors. This is the first genetic evidence that the HupBCD proteins are essential for heme acquisition by V. vulnificus. Further investigation showed that hupA, hvtA, and hupBCD are regulated by Fur. The qRT-PCR analysis of the heme receptor genes revealed that HupR, a LysR-family positive transcriptional activator, upregulates the expression of hupA, but not hvtA. In addition, ptrB was co-transcribed with hvtA, and PtrB had no influence on growth in low-iron CM9 medium supplemented with hemin, hemoglobin, or cytochrome C. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. A phytoestrogen-rich diet increases energy expenditure and decreases adiposity in mice.

    PubMed

    Cederroth, Christopher R; Vinciguerra, Manlio; Kühne, Françoise; Madani, Rime; Doerge, Daniel R; Visser, Theo J; Foti, Michelangelo; Rohner-Jeanrenaud, Françoise; Vassalli, Jean-Dominique; Nef, Serge

    2007-10-01

    Obesity is an increasingly prevalent health problem, and natural effective therapeutic approaches are required to prevent its occurrence. Phytoestrogens are plant-derived compounds with estrogenic activities; they can bind to both estrogen receptors alpha and beta and mimic the action of estrogens on target organs. The purpose of this study was to examine the influence of soy-derived phytoestrogens on energy balance and metabolism. Male outbred mice (CD-1) were allowed ad libitum access to either a high soy-containing diet or a soy-free diet from conception to adulthood. We measured circulating serum isoflavone levels using reverse-phase solid-phase extraction for subsequent liquid chromatography electrospray tandem mass spectrometry analysis. Adult animals were analyzed for body composition by dual-energy X-ray absorptiometry, locomotor activity by running-wheel experiments, respiratory exchange rate by indirect calorimetry, and food intake using metabolic cages. Quantitative reverse transcriptase-polymerase chain reaction was performed to determine the expression of hypothalamic neuropeptide genes. We found that adult mice fed a soy-rich diet had reduced body weight, adiposity, and resistance to cold. This lean phenotype was associated with an increase in lipid oxidation due to a preferential use of lipids as fuel source and an increase in locomotor activity. The modulation of energy balance was associated with a central effect of phytoestrogens on the expression of hypothalamic neuropeptides, including agouti-related protein. The data suggest that dietary soy could have beneficial effects on obesity, but they also emphasize the importance of monitoring the phytoestrogen content of diets as a parameter of variability in animal experiments.

  1. Microbial water quality before and after the repair of a failing onsite wastewater treatment system adjacent to coastal waters

    USGS Publications Warehouse

    Conn, K.E.; Habteselassie, M.Y.; Denene, Blackwood A.; Noble, R.T.

    2012-01-01

    Aims: The objective was to assess the impacts of repairing a failing onsite wastewater treatment system (OWTS, i.e., septic system) as related to coastal microbial water quality. Methods and Results: Wastewater, groundwater and surface water were monitored for environmental parameters, faecal indicator bacteria (total coliforms, Escherichia coli, enterococci) and the viral tracer MS2 before and after repairing a failing OWTS. MS2 results using plaque enumeration and quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) often agreed, but inhibition limited the qRT-PCR assay sensitivity. Prerepair, MS2 persisted in groundwater and was detected in the nearby creek; postrepair, it was not detected. In groundwater, total coliform concentrations were lower and E.??coli was not detected, while enterococci concentrations were similar to prerepair levels. E.??coli and enterococci surface water concentrations were elevated both before and after the repair. Conclusions: Repairing the failing OWTS improved groundwater microbial water quality, although persistence of bacteria in surface water suggests that the OWTS was not the singular faecal contributor to adjacent coastal waters. A suite of tracers is needed to fully assess OWTS performance in treating microbial contaminants and related impacts on receiving waters. Molecular methods like qRT-PCR have potential but require optimization. Significance and Impact of Study: This is the first before and after study of a failing OWTS and provides guidance on selection of microbial tracers and methods. ?? 2011 The Authors. Journal of Applied Microbiology ?? 2011 The Society for Applied Microbiology.

  2. The endocannabinoid gene faah2a modulates stress-associated behavior in zebrafish

    PubMed Central

    Lee, Han B.; El Khoury, Louis Y.; Sigafoos, Ashley N.; Petersen, Morgan O.; Clark, Karl J.

    2018-01-01

    The ability to orchestrate appropriate physiological and behavioral responses to stress is important for survival, and is often dysfunctional in neuropsychiatric disorders that account for leading causes of global disability burden. Numerous studies have shown that the endocannabinoid neurotransmitter system is able to regulate stress responses and could serve as a therapeutic target for the management of these disorders. We used quantitative reverse transcriptase-polymerase chain reactions to show that genes encoding enzymes that synthesize (abhd4, gde1, napepld), enzymes that degrade (faah, faah2a, faah2b), and receptors that bind (cnr1, cnr2, gpr55-like) endocannabinoids are expressed in zebrafish (Danio rerio). These genes are conserved in many other vertebrates, including humans, but fatty acid amide hydrolase 2 has been lost in mice and rats. We engineered transcription activator-like effector nucleases to create zebrafish with mutations in cnr1 and faah2a to test the role of these genes in modulating stress-associated behavior. We showed that disruption of cnr1 potentiated locomotor responses to hyperosmotic stress. The increased response to stress was consistent with rodent literature and served to validate the use of zebrafish in this field. Moreover, we showed for the first time that disruption of faah2a attenuated the locomotor responses to hyperosmotic stress. This later finding suggests that FAAH2 may be an important mediator of stress responses in non-rodent vertebrates. Accordingly, FAAH and FAAH2 modulators could provide distinct therapeutic options for stress-aggravated disorders. PMID:29304078

  3. Large-scale production of embryonic red blood cells from human embryonic stem cells.

    PubMed

    Olivier, Emmanuel N; Qiu, Caihong; Velho, Michelle; Hirsch, Rhoda Elison; Bouhassira, Eric E

    2006-12-01

    To develop a method to produce in culture large number of erythroid cells from human embryonic stem cells. Human H1 embryonic stem cells were differentiated into hematopoietic cells by coculture with a human fetal liver cell line, and the resulting CD34-positive cells were expanded in vitro in liquid culture using a three-step method. The erythroid cells produced were then analyzed by light microscopy and flow cytometry. Globin expression was characterized by quantitative reverse-transcriptase polymerase chain reaction and by high-performance liquid chromatography. CD34-positive cells produced from human embryonic stem cells could be efficiently differentiated into erythroid cells in liquid culture leading to a more than 5000-fold increase in cell number. The erythroid cells produced are similar to primitive erythroid cells present in the yolk sac of early human embryos and did not enucleate. They are fully hemoglobinized and express a mixture of embryonic and fetal globins but no beta-globin. We have developed an experimental protocol to produce large numbers of primitive erythroid cells starting from undifferentiated human embryonic stem cells. As the earliest human erythroid cells, the nucleated primitive erythroblasts, are not very well characterized because experimental material at this stage of development is very difficult to obtain, this system should prove useful to answer a number of experimental questions regarding the biology of these cells. In addition, production of mature red blood cells from human embryonic stem cells is of great potential practical importance because it could eventually become an alternate source of cell for transfusion.

  4. Immunomodulatory Effects of Balneotherapy with Hae-Un-Dae Thermal Water on Imiquimod-Induced Psoriasis-Like Murine Model

    PubMed Central

    Lee, Young Bok; Lee, Jun Young; Lee, Hye Jin; Yun, Seong Taek; Lee, Jong Tae; Kim, Hong Jig; Yu, Dong Soo

    2014-01-01

    Background Balneotherapy, although not a well-established dermatological treatment, is thought to have therapeutic properties for psoriasis and is used as an alternative treatment modality throughout the world. Objective To evaluate the mechanism underlying the therapeutic immunologic effects of thermomineral water. Methods A murine model of imiquimod-induced psoriasis-like skin inflammation was used for evaluating the therapeutic effects of balneotherapy with Hae-Un-Dae hot spring mineral water. The clinical improvements were evaluated by a dermatologist. Lesional cytokines, including interleukin (IL)-17A, IL-23, and IL-22, were quantitatively measured by real-time reverse transcriptase polymerase chain reaction. Serum levels of interferon-γ, IL-4, IL-5, and IL-17A were measured by enzyme-linked immunosorbent assay. T cell proportions in the spleen were evaluated by flow cytometry, and histopathological evaluation of the skin was also performed. Results The mineral water balneotherapy group showed faster improvement in skin erythema and scales than the distilled water bathing group. A substantial reduction was observed in the lesional mRNA levels of IL-17A and IL-23 in the mineral water group. Serum levels of IL-4 and IL-5 were significantly decreased in the mineral water group but not in the distilled water group. Normalized T cell proportions were observed after bathing. Conclusion Balneotherapy showed immunomodulatory effects in a psoriasis-like murine model. Balneotherapy suppressed lesional IL-23 and IL-17A, which are important cytokines in the pathogenesis of psoriasis. These results suggest that balneotherapy can be used as an effective and safe treatment for psoriasis. PMID:24882978

  5. Immunomodulatory effects of balneotherapy with hae-un-dae thermal water on imiquimod-induced psoriasis-like murine model.

    PubMed

    Lee, Young Bok; Lee, Jun Young; Lee, Hye Jin; Yun, Seong Taek; Lee, Jong Tae; Kim, Hong Jig; Yu, Dong Soo; Woo, So Youn; Kim, Jin-Wou

    2014-04-01

    Balneotherapy, although not a well-established dermatological treatment, is thought to have therapeutic properties for psoriasis and is used as an alternative treatment modality throughout the world. To evaluate the mechanism underlying the therapeutic immunologic effects of thermomineral water. A murine model of imiquimod-induced psoriasis-like skin inflammation was used for evaluating the therapeutic effects of balneotherapy with Hae-Un-Dae hot spring mineral water. The clinical improvements were evaluated by a dermatologist. Lesional cytokines, including interleukin (IL)-17A, IL-23, and IL-22, were quantitatively measured by real-time reverse transcriptase polymerase chain reaction. Serum levels of interferon-γ, IL-4, IL-5, and IL-17A were measured by enzyme-linked immunosorbent assay. T cell proportions in the spleen were evaluated by flow cytometry, and histopathological evaluation of the skin was also performed. The mineral water balneotherapy group showed faster improvement in skin erythema and scales than the distilled water bathing group. A substantial reduction was observed in the lesional mRNA levels of IL-17A and IL-23 in the mineral water group. Serum levels of IL-4 and IL-5 were significantly decreased in the mineral water group but not in the distilled water group. Normalized T cell proportions were observed after bathing. Balneotherapy showed immunomodulatory effects in a psoriasis-like murine model. Balneotherapy suppressed lesional IL-23 and IL-17A, which are important cytokines in the pathogenesis of psoriasis. These results suggest that balneotherapy can be used as an effective and safe treatment for psoriasis.

  6. Gene expression related to oxidative stress in the heart of mice after intestinal ischemia

    PubMed Central

    Somaio Neto, Frederico; Ikejiri, Adauto Tsutomu; Bertoletto, Paulo Roberto; Chaves, José Carlos Bertoletto; Teruya, Roberto; Fagundes, Djalma José; Taha, Murched Omar

    2014-01-01

    Background Intestinal ischemia-reperfusion is a frequent clinical event associated to injury in distant organs, especially the heart. Objective To investigate the gene expression of oxidative stress and antioxidant defense in the heart of inbred mice subjected to intestinal ischemia and reperfusion (IR). Methods Twelve mice (C57BL / 6) were assigned to: IR Group (GIR) with 60 minutes of superior mesenteric artery occlusion followed by 60 minutes of reperfusion; Control Group (CG) which underwent anesthesia and laparotomy without IR procedure and was observed for 120 minutes. Intestine and heart samples were processed using the RT-qPCR / Reverse transcriptase-quantitative Polymerase Chain Reaction method for the gene expression of 84 genes related to oxidative stress and oxidative defense (Student's "t" test, p < 0.05). Results The intestinal tissue (GIR) was noted to have an up-regulation of 65 genes (74.71%) in comparison to normal tissue (CG), and 37 genes (44.04%) were hyper-expressed (greater than three times the threshold allowed by the algorithm). Regarding the remote effects of intestinal I/R in cardiac tissue an up-regulation of 28 genes (33.33%) was seen, but only eight genes (9.52%) were hyper-expressed three times above threshold. Four (7.14%) of these eight genes were expressed in both intestinal and cardiac tissues. Cardiomyocytes with smaller and pyknotic nuclei, rich in heterochromatin with rare nucleoli, indicating cardiac distress, were observed in the GIR. Conclusion Intestinal I/R caused a statistically significant over expression of 8 genes associated with oxidative stress in remote myocardial tissue. PMID:24346830

  7. Measurement of Gene Expression in Archival Paraffin-Embedded Tissues

    PubMed Central

    Cronin, Maureen; Pho, Mylan; Dutta, Debjani; Stephans, James C.; Shak, Steven; Kiefer, Michael C.; Esteban, Jose M.; Baker, Joffre B.

    2004-01-01

    Throughout the last decade many laboratories have shown that mRNA levels in formalin-fixed and paraffin-embedded (FPE) tissue specimens can be quantified by reverse transcriptase-polymerase chain reaction (RT-PCR) techniques despite the extensive RNA fragmentation that occurs in tissues so preserved. We have developed RT-PCR methods that are sensitive, precise, and that have multianalyte capability for potential wide use in clinical research and diagnostic assays. Here it is shown that the extent of fragmentation of extracted FPE tissue RNA significantly increases with archive storage time. Probe and primer sets for RT-PCR assays based on amplicons that are both short and homogeneous in length enable effective reference gene-based data normalization for cross comparison of specimens that differ substantially in age. A 48-gene assay used to compare gene expression profiles from the same breast cancer tissue that had been either frozen or FPE showed very similar profiles after reference gene-based normalization. A 92-gene assay, using RNA extracted from three 10-μm FPE sections of archival breast cancer specimens (dating from 1985 to 2001) yielded analyzable data for these genes in all 62 tested specimens. The results were substantially concordant when estrogen receptor, progesterone receptor, and HER2 receptor status determined by RT-PCR was compared with immunohistochemistry assays for these receptors. Furthermore, the results highlight the advantages of RT-PCR over immunohistochemistry with respect to quantitation and dynamic range. These findings support the development of RT-PCR analysis of FPE tissue RNA as a platform for multianalyte clinical diagnostic tests. PMID:14695316

  8. TH and DCX mRNAs in peripheral blood and bone marrow predict outcome in metastatic neuroblastoma patients.

    PubMed

    Yáñez, Yania; Hervás, David; Grau, Elena; Oltra, Silvestre; Pérez, Gema; Palanca, Sarai; Bermúdez, Mar; Márquez, Catalina; Cañete, Adela; Castel, Victoria

    2016-03-01

    In metastatic neuroblastoma (NB) patients, accurate risk stratification and disease monitoring would reduce relapse probabilities. This study aims to evaluate the independent prognostic significance of detecting tyrosine hydroxylase (TH) and doublecortin (DCX) mRNAs by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) in peripheral blood (PB) and bone marrow (BM) samples from metastatic NB patients. RT-qPCR was performed on PB and BM samples from metastatic NB patients at diagnosis, post-induction therapy and at the end of treatment for TH and DCX mRNAs detection. High levels of TH and DCX mRNAs when detected in PB and BM at diagnosis independently predicted worse outcome in a cohort of 162 metastatic NB. In the subgroup of high-risk metastatic NB, TH mRNA detected in PB remained as independent predictor of EFS and OS at diagnosis. After the induction therapy, high levels of TH mRNA in PB and DCX mRNA in BM independently predicted poor EFS and OS. Furthermore TH mRNA when detected in BM predicted worse EFS. TH mRNA in PB samples at the end of treatment is an independent predictor of worse outcome. TH and DCX mRNAs levels in PB and BM assessed by RT-qPCR should be considered in new pre-treatment risk stratification strategies to reliable estimate outcome differences in metastatic NB patients. In those high-risk metastatic NB, TH and DCX mRNA quantification could be used for the assessment of response to treatment and for early detection of progressive disease or relapses.

  9. Relationships between infection, dissemination, and transmission of West Nile virus RNA in Culex pipiens quinquefasciatus (Diptera: Culicidae).

    PubMed

    Richards, Stephanie L; Anderson, Sheri L; Lord, Cynthia C; Smartt, Chelsea T; Tabachnick, Walter J

    2012-01-01

    Culex pipiens quinquefasciatus Say fed blood containing 6.8 +/- 0.3 logs (mean +/- SE) plaque-forming units of West Nile virus (WNV)/ml were maintained at 28 degrees C for incubation periods (IP) of 7, 14, or 21 d. Several attributes of vector competence were determined at each IP using quantitative real-time reverse transcriptase polymerase chain reaction to estimate plaque forming unit equivalents including: infection rate (WNV-positive abdomens), dissemination rate (WNV-positive legs or thoraces), combined dissemination rate (WNV-positive legs and thoraces), transmission rate (WNV-positive saliva), and WNV titers in abdomens, legs, thoraces, and saliva. Each rate increased or was equivalent with increasing IP. Mosquitoes transmitting WNV in saliva also had significantly higher IP-dependent WNV titers in abdomens, legs, and thoraces. Titers of WNV in abdomens were significantly correlated with titers in legs and thoraces, but the degree of association changed with IP. However, titers of abdomens, legs, and thoraces were not correlated with WNV presence or titer in the saliva. The results show that WNV presence or titer in the saliva of infected Cx. p. quinquefasciatus was not directly influenced by processes involved in WNV replication in other tissues. The processes controlling midgut infection and escape are, in part, independent from the infection processes in other tissues. The relationship between infection, dissemination, and transmission varied over time. The infection and replication of WNV in different tissues is likely influenced by different barriers encountered during the extrinsic incubation period. The significance of these observations for understanding vector competence is discussed.

  10. Transcriptome Analysis of Orbital Adipose Tissue in Active Thyroid Eye Disease Using Next Generation RNA Sequencing Technology

    PubMed Central

    Lee, Bradford W.; Kumar, Virender B.; Biswas, Pooja; Ko, Audrey C.; Alameddine, Ramzi M.; Granet, David B.; Ayyagari, Radha; Kikkawa, Don O.; Korn, Bobby S.

    2018-01-01

    Objective: This study utilized Next Generation Sequencing (NGS) to identify differentially expressed transcripts in orbital adipose tissue from patients with active Thyroid Eye Disease (TED) versus healthy controls. Method: This prospective, case-control study enrolled three patients with severe, active thyroid eye disease undergoing orbital decompression, and three healthy controls undergoing routine eyelid surgery with removal of orbital fat. RNA Sequencing (RNA-Seq) was performed on freshly obtained orbital adipose tissue from study patients to analyze the transcriptome. Bioinformatics analysis was performed to determine pathways and processes enriched for the differential expression profile. Quantitative Reverse Transcriptase-Polymerase Chain Reaction (qRT-PCR) was performed to validate the differential expression of selected genes identified by RNA-Seq. Results: RNA-Seq identified 328 differentially expressed genes associated with active thyroid eye disease, many of which were responsible for mediating inflammation, cytokine signaling, adipogenesis, IGF-1 signaling, and glycosaminoglycan binding. The IL-5 and chemokine signaling pathways were highly enriched, and very-low-density-lipoprotein receptor activity and statin medications were implicated as having a potential role in TED. Conclusion: This study is the first to use RNA-Seq technology to elucidate differential gene expression associated with active, severe TED. This study suggests a transcriptional basis for the role of statins in modulating differentially expressed genes that mediate the pathogenesis of thyroid eye disease. Furthermore, the identification of genes with altered levels of expression in active, severe TED may inform the molecular pathways central to this clinical phenotype and guide the development of novel therapeutic agents. PMID:29760827

  11. Impact of Antiretroviral Treatment Containing Tenofovir Difumarate on the Telomere Length of Aviremic HIV-Infected Patients.

    PubMed

    Montejano, Rocio; Stella-Ascariz, Natalia; Monge, Susana; Bernardino, José I; Pérez-Valero, Ignacio; Montes, María L; Valencia, Eulalia; Martín-Carbonero, Luz; Moreno, Victoria; González-García, Juan; Arnalich, Francisco; Mingorance, Jesús; Pintado Berniches, Laura; Perona, Rosario; Arribas, José R

    2017-09-01

    To evaluate the in vivo relevance of the inhibitory effect of tenofovir on telomerase activity observed in vitro. Cross-sectional study of HIV-infected patients with suppressed virological replication (HIV RNA <50 copies/mL for more than 1 year). Telomere length in whole blood was measured by quantitative real-time polymerase chain reaction. We performed a multivariate analysis to elucidate variables associated with telomere length and also evaluated the association between telomere length and use of tenofovir difumarate (TDF) adjusted by significant confounders. 200 patients included, 72% men, median age 49 (IQR 45-54.5), 103 with exposure to a TDF containing antiretroviral treatment (ART) regimen (69.9% for more than 5 years) and 97 never exposed to a TDF containing ART regimen. In the multivariate analysis, significant predictors of shorter telomere length were older age (P = 0.008), parental age at birth (P = 0.038), white race (P = 0.048), and longer time of known HIV infection (10-20 and ≥20 years compared with <10 years, P = 0.003 and P = 0.056, respectively). There was no association between TDF exposure and telomere length after adjusting for possible confounding factors (age, parental age at birth, race, and time of HIV infection). Total time receiving ART and duration of treatment with nucleoside reverse transcriptase inhibitors were associated with shorter telomere length, but these associations were explained by time of known HIV infection. Our data do not suggest that telomerase activity inhibition caused by TDF in vitro leads to telomere shortening in peripheral blood of HIV-infected patients.

  12. Molecular changes in obese and depressive patients are similar to neurodegenerative disorders

    PubMed Central

    Habibi, Laleh; Tafakhori, Abbas; Hadiani, Rasoul; Maserat-Mashhadi, Maryam; Kafrash, Zeinab; Torabi, Shahla; Azhdarzadeh, Mohammad; Akrami, Seyed Mohammad; Mahmoudi, Morteza; Dinarvand, Rasoul

    2017-01-01

    Background: Neurodegenerative disorders (NDs) are categorized as multifactorial conditions with different molecular and environmental causes. Disturbance of important signaling pathways, such as energy metabolism and inflammation induced by environmental agents, is involved in the pathophysiology of NDs. It has been proposed that changes in the lifestyle and nutrition (metabolism) during mid-life could trigger and accumulate cellular and molecular damages resulting in NDs during aging. Methods: In order to test the hypothesis, we investigated the expression level of two energy metabolism-related [forkhead box O1 (FOXO1) and forkhead box O3 (FOXO3A)] and two pro-inflammatory cytokines [interleukin 1β (IL-1β) and IL-6] genes, using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, changes in the ionic concentration of three essential heavy metals [iron (Fe), copper (Cu), and zinc (Zn)] by atomic absorption spectroscopy in patients with NDs, depression, obesity, and diabetes type II, were evaluated and compared with the results of normal individuals. Results: More than half of the participants in obesity, depression, and ND groups had significant up-regulation of FOXO1 and FOXO3A, down-regulation of IL-1β and IL-6, and higher levels of Fe and Cu in their blood. This pattern of gene expression was not repeated in diabetic patients. Conclusion: It could be concluded that individuals affected with different levels of obesity and depression have increased the risk of developing NDs later in life, probably through changes in energy metabolism, inflammatory pathways, and ionic concentrations. PMID:29736225

  13. Molecular changes in obese and depressive patients are similar to neurodegenerative disorders.

    PubMed

    Habibi, Laleh; Tafakhori, Abbas; Hadiani, Rasoul; Maserat-Mashhadi, Maryam; Kafrash, Zeinab; Torabi, Shahla; Azhdarzadeh, Mohammad; Akrami, Seyed Mohammad; Mahmoudi, Morteza; Dinarvand, Rasoul

    2017-10-07

    Background: Neurodegenerative disorders (NDs) are categorized as multifactorial conditions with different molecular and environmental causes. Disturbance of important signaling pathways, such as energy metabolism and inflammation induced by environmental agents, is involved in the pathophysiology of NDs. It has been proposed that changes in the lifestyle and nutrition (metabolism) during mid-life could trigger and accumulate cellular and molecular damages resulting in NDs during aging. Methods: In order to test the hypothesis, we investigated the expression level of two energy metabolism-related [forkhead box O1 (FOXO1) and forkhead box O3 (FOXO3A)] and two pro-inflammatory cytokines [interleukin 1β (IL-1β) and IL-6] genes, using quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). Furthermore, changes in the ionic concentration of three essential heavy metals [iron (Fe), copper (Cu), and zinc (Zn)] by atomic absorption spectroscopy in patients with NDs, depression, obesity, and diabetes type II, were evaluated and compared with the results of normal individuals. Results: More than half of the participants in obesity, depression, and ND groups had significant up-regulation of FOXO1 and FOXO3A, down-regulation of IL-1β and IL-6, and higher levels of Fe and Cu in their blood. This pattern of gene expression was not repeated in diabetic patients. Conclusion: It could be concluded that individuals affected with different levels of obesity and depression have increased the risk of developing NDs later in life, probably through changes in energy metabolism, inflammatory pathways, and ionic concentrations.

  14. Transcription and translation of the chemokines RANTES and MCP-1 in nasal polyps and mucosa in allergic and non-allergic rhinopathies.

    PubMed

    Marcella, Reale; Croce, Adelchi; Moretti, Antonio; Barbacane, Renato C; Di Giocchino, Mario; Conti, Pio

    2003-12-15

    The pathogenetic findings of rhinopathies show an increase in infiltrating cells including eosinophils. RANTES is a beta chemokine in which the cysteines are adjacent (C-C), and it attracts and activates eosinophil. We hypothesize that RANTES is locally produced within the nasal polyp microenvironment and is responsible for the inflammatory cell recruitment present in nasal polyposis. To test this hypothesis, we evaluated nasal polyps and mucosa from allergic and control, non-allergic patients for RANTES content. The relative levels of RANTES and MCP-1 protein in tissue homogenates were quantified using enzyme-linked immunosorbent assay technology, and quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) tests for RANTES and MCP-1 mRNA expression were performed. The results indicate that RANTES expression and production increase in nasal mucosa (septal and turbinate portions) of allergic patients compared to the same mucosa in non-allergic patients. In allergic patients, RANTES levels of nasal polyp homogenates were nearly 12-fold higher than the RANTES levels in mucosa homogenate. In this study, we hypothesize that the particular anatomic structure and physiologic function of the turbinates are more involved in the pathogenesis of rhinitis and may undergo polypoid degeneration in allergic rhinitis than any other anatomical structure of the nose. Our data suggest that RANTES is more involved than MCP-1 in recruiting inflammatory cells in rhinological disease and may reflect the degree of local inflammation as consequence of the specific chemoattractant properties of RANTES. The level of RANTES in nasal polyps could be important in the development of the pathological state.

  15. Variant translocation partners of the anaplastic lymphoma kinase (ALK) gene in two cases of anaplastic large cell lymphoma, identified by inverse cDNA polymerase chain reaction.

    PubMed

    Takeoka, Kayo; Okumura, Atsuko; Honjo, Gen; Ohno, Hitoshi

    2014-01-01

    In anaplastic large cell lymphoma (ALCL), the anaplastic lymphoma kinase (ALK) gene is rearranged with diverse partners due to variant translocations/inversions. Case 1 was a 39-year-old man who developed multiple tumors in the mediastinum, psoas muscle, lung, and lymph nodes. A biopsy specimen of the inguinal node was effaced by large tumor cells expressing CD30, epithelial membrane antigen, and cytoplasmic ALK, which led to a diagnosis of ALK(+) ALCL. Case 2 was a 51-year-old man who was initially diagnosed with undifferentiated carcinoma. He developed multiple skin tumors eight years after his initial presentation, and was finally diagnosed with ALK(+) ALCL. He died of therapy-related acute myeloid leukemia. G-banding and fluorescence in situ hybridization using an ALK break-apart probe revealed the rearrangement of ALK and suggested variant translocation in both cases. We applied an inverse cDNA polymerase chain reaction (PCR) strategy to identify the partner of ALK. Nucleotide sequencing of the PCR products and a database search revealed that the sequences of ATIC in case 1 and TRAF1 in case 2 appeared to follow those of ALK. We subsequently confirmed ATIC-ALK and TRAF1-ALK fusions by reverse transcriptase PCR and nucleotide sequencing. We successfully determined the partner gene of ALK in two cases of ALK(+) ALCL. ATIC is the second most common partner of variant ALK rearrangements, while the TRAF1-ALK fusion gene was first reported in 2013, and this is the second reported case of ALK(+) ALCL carrying TRAF1-ALK.

  16. Analysis by rotavirus gene 6 reverse transcriptase-polymerase chain reaction assay of rotavirus-positive gastroenteritis cases observed during the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST)

    PubMed Central

    Matson, David O; Vesikari, Timo; Dennehy, Penelope; Dallas, Michael D; Goveia, Michelle G; Itzler, Robbin F; Ciarlet, Max

    2014-01-01

    During the vaccination phase of the Rotavirus Efficacy and Safety Trial (REST), the period between the administration of dose 1 through 13 days after the administration of dose 3, there were more wild-type rotavirus gastroenteritis (RVGE) cases among vaccine recipients compared with placebo recipients using the protocol-specified microbiological plaque assay in the clinical-efficacy cohort, a subset of subjects where vaccine efficacy against RVGE of any severity was assessed. In this study, a rotavirus genome segment 6-based reverse transcriptase–polymerase chain reaction assay was applied post hoc to clarify the accuracy of type categorization of all these RVGE cases in vaccine recipients during the vaccination phase of REST. The assay characterized 147 (90%) of 163 re-assayed RVGE cases or rotavirus-associated health care contacts as type-determinable: either wild-type or vaccine-type rotavirus strains. In the clinical-efficacy cohort (N = 5673), 19 (18.8%) of 101 samples from RVGE cases contained wild-type rotavirus, 70 (69.3%) vaccine virus, and 12 (11.9%) were indeterminable. In the large-scale cohort (N = 68,038), 10 (34.5%) of 29 samples from RVGE-related health care contacts contained wild-type rotavirus strains, 15 (51.7%) vaccine-type rotavirus strains, and 4 (13.8%) were indeterminable. Of the 33 samples from RVGE cases in placebo recipients, all were confirmed to contain wild-type rotaviruses. Altogether, this post-hoc re-evaluation showed that the majority (75%) of type-determinable RVGE cases or health care contacts that occurred during the vaccination phase of REST in vaccine recipients were associated with vaccine-type rotavirus strains rather than wild-type rotavirus strains. PMID:25424931

  17. Incidence of enteroviruses in Mamala Bay, Hawaii using cell culture and direct polymerase chain reaction methodologies.

    PubMed

    Reynolds, K A; Roll, K; Fujioka, R S; Gerba, C P; Pepper, I L

    1998-06-01

    The consequence of point and nonpoint pollution sources, discharged into marine waters, on public recreational beaches in Mamala Bay, Hawaii was evaluated using virus cell culture and direct reverse transcriptase-polymerase chain reaction (RT-PCR). Twelve sites, nine marine, two freshwater (one stream and one canal), and one sewage, were assessed either quarterly or monthly for 1 year to detect the presence of human enteric viruses. Water samples were concentrated from initial volumes of 400 L to final volumes of 30 mL using Filterite electronegative cartridge filters and a modified beef extract elution procedure. Cell culture was applied using the Buffalo Green Monkey kidney cell line to analyze samples for enteroviruses. Positive samples were also evaluated by RT-PCR, using enterovirus-specific primers. Levels of RT-PCR inhibition varied with each concentrated sample. Resin column purification increased PCR detection sensitivity by at least one order of magnitude in a variety of sewage outfall and recreational marine water samples but not in the freshwater canal samples. Using cell culture, viable enteroviruses were found in 50 and 17% of all outfall and canal samples, respectively. Samples were positive at beaches 8% of the time. These data illustrate the potential public health hazard associated with recreational waters. Using direct PCR, viruses were detected at the outfall but were not found in any beach or canal samples, in part, owing to substances that inhibit PCR. Therefore, conventional cell culture is the most effective means of detecting low levels of infectious enteroviruses in environmental waters, whereas direct RT-PCR is rendered less effective by inhibitory compounds and low equivalent reaction volumes.

  18. Aspirin inhibits human telomerase activation in unstable carotid plaques

    PubMed Central

    LI, FANGMING; GUO, YI; JIANG, XIN; ZHONG, JIANXIN; LI, GUANDONG; SUN, SHENGGANG

    2013-01-01

    The activation of telomerase in unstable plaques is an important factor in atherosclerosis, and may be predictive of the risk of cerebrovascular diseases. Human telomerase reverse transcriptase (hTERT) is a subunit of telomerase that is essential for telomerase activation. The aim of the present study was to investigate whether aspirin inhibits the activation of telomerase and hTERT in unstable carotid plaques. Polymorphonuclear neutrophils (PMNs) derived from carotid plaques were isolated from the washing medium of angioplasty balloons, while circulating PMNs, isolated from arterial blood, served as the controls. A polymerase chain reaction-based telomeric repeat amplification protocol (TRAP) enzyme-linked immunosorbent assay (ELISA) was used to measure the telomerase activity in the cells following treatment with aspirin. The mRNA and protein expression of hTERT were detected by a reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis, respectively. The results revealed that the atherosclerotic plaques were positive for telomerase activity, and that aspirin inhibited the telomerase activity of the PMNs derived from the plaques. In addition, aspirin was demonstrated to inhibit the mRNA and protein expression of hTERT through the suppression of hTERT transcriptional activity; however, it had no inhibitory effect on the telomerase activity of the circulating PMNs. Thus, the activation of telomerase in resident PMNs is critical in the instability of carotid plaques. The upregulation of telomerase and hTERT during the progression of atherosclerosis may indicate a role for telomerase in the vascular remodeling that occurs during atherogenesis. Aspirin was demonstrated to inhibit the activation of telomerase via an hTERT-dependent manner in the PMN cells of unstable carotid plaques, and thus hTERT may be considered as a target in the treatment of cerebrovascular diseases. PMID:23935747

  19. Measurement of indicator genes using global complementary DNA (cDNA) amplification, by polyadenylic acid reverse transcriptase polymerase chain reaction (poly A RT-PCR): A feasibility study using paired samples from tissue and ductal juice in patients undergoing pancreatoduodenectomy.

    PubMed

    Sanyal, Sudip; Siriwardena, Ajith K; Byers, Richard

    2018-06-01

    The aim of this study is to compare gene expression profiles in RNA isolated from pancreatic ductal juice with the RNA expression profiles of the same genes from matched intra-operative tissue samples from pancreatic tumours. Intra-operative sampling of pancreatic juice and collection of matched tissue samples was undertaken in patients undergoing pancreatoduodenectomy for clinically suspected pancreatic cancer and a precursor lesion, main-duct intraductal papillary mucinous neoplasm. RNA was isolated and Poly A PCR was used to globally amplify the RNA. Real-time polymerase chain reaction (RT-PCR) was used to measure expression levels of 17 genes selected from microarray studies. Spearman's rank correlation test was used to examine the relationship of gene expression between pancreatic juice and tissue. The study was approved by Regional Ethics Committee. Mesothelin (MSLN) showed significant correlation (p < 0.008) in expression levels between paired pancreatic juice and tissue samples in pancreas cancer. In intraductal papillary mucinous neoplasms (IPMN), Matrix Metalloproteinase 7 (MMP7), showed significant correlation (p < 0.01) in the expression levels between paired pancreatic juice and tissue samples. This study confirms that RNA analysis of paired pancreatic juice and tissue samples and establishment of cDNA using poly A PCR is technically feasible. Application of the technique to non-invasively obtained pancreatic juice during endoscopic assessment of tumours and the use of gene arrays of cancer indicator genes are the next steps in development of this technique. Copyright © 2018 IAP and EPC. Published by Elsevier B.V. All rights reserved.

  20. T lymphocytes among HIV-infected and -uninfected infants: CD4/CD8 ratio as a potential tool in diagnosis of infection in infants under the age of 2 years.

    PubMed

    Zijenah, Lynn S; Katzenstein, David A; Nathoo, Kusum J; Rusakaniko, Simbarashe; Tobaiwa, Ocean; Gwanzura, Christine; Bikoue, Arsene; Nhembe, Margaret; Matibe, Petronella; Janossy, George

    2005-02-01

    BACKGROUND: Serologic tests for HIV infection in infants less than 18 months do not differentiate exposure and infection since maternally acquired IgG antibodies may be detected in infants. Thus, the gold standard for diagnosis of HIV-1 infection in infants under the age of 2 years is DNA or reverse transcriptase polymerase chain reaction. There is an urgent need to evaluate alternative and cost effective laboratory methods for early diagnosis of infant HIV-1 infection as well as identifying infected infants who may benefit from cotrimoxazole prophylaxis and/or initiation of highly active antiretroviral therapy. METHODS: Whole blood was collected in EDTA from 137 infants aged 0 to 18 months. DNA polymerase chain reaction was used as the reference standard for diagnosis of HIV-1 infection. T-cell subset profiles were determined by flow cytometry. RESULTS: Seventy-six infants were DNA PCR positive while 61 were negative. The median CD4 counts of PCR negative infants were significantly higher than those of the PCR positive infants, p < 0.001. The median CD4/CD8 ratio and the %CD4 of the PCR positive infants were both significantly lower than those of the negative infants, p < 0.001. The CD4/CD8 ratio had a >98% sensitivity for diagnosis of HIV-1 infection and a specificity of >98%. CONCLUSION: The CD4/CD8 ratio appears useful in identifying HIV-infected infants. The development of lower cost and more robust flow cytometric methods that provide both CD4/CD8 ratio and %CD4 may be cost-effective for HIV-1 diagnosis and identification of infants for cotrimoxazole prophylaxis and/or highly active antiretroviral therapy.

Top