Sample records for transfer matrix method

  1. Transfer matrix method for four-flux radiative transfer.

    PubMed

    Slovick, Brian; Flom, Zachary; Zipp, Lucas; Krishnamurthy, Srini

    2017-07-20

    We develop a transfer matrix method for four-flux radiative transfer, which is ideally suited for studying transport through multiple scattering layers. The model predicts the specular and diffuse reflection and transmission of multilayer composite films, including interface reflections, for diffuse or collimated incidence. For spherical particles in the diffusion approximation, we derive closed-form expressions for the matrix coefficients and show remarkable agreement with numerical Monte Carlo simulations for a range of absorption values and film thicknesses, and for an example multilayer slab.

  2. Hybrid transfer-matrix FDTD method for layered periodic structures.

    PubMed

    Deinega, Alexei; Belousov, Sergei; Valuev, Ilya

    2009-03-15

    A hybrid transfer-matrix finite-difference time-domain (FDTD) method is proposed for modeling the optical properties of finite-width planar periodic structures. This method can also be applied for calculation of the photonic bands in infinite photonic crystals. We describe the procedure of evaluating the transfer-matrix elements by a special numerical FDTD simulation. The accuracy of the new method is tested by comparing computed transmission spectra of a 32-layered photonic crystal composed of spherical or ellipsoidal scatterers with the results of direct FDTD and layer-multiple-scattering calculations.

  3. A review of the matrix-exponential formalism in radiative transfer

    NASA Astrophysics Data System (ADS)

    Efremenko, Dmitry S.; Molina García, Víctor; Gimeno García, Sebastián; Doicu, Adrian

    2017-07-01

    This paper outlines the matrix exponential description of radiative transfer. The eigendecomposition method which serves as a basis for computing the matrix exponential and for representing the solution in a discrete ordinate setting is considered. The mathematical equivalence of the discrete ordinate method, the matrix operator method, and the matrix Riccati equations method is proved rigorously by means of the matrix exponential formalism. For optically thin layers, approximate solution methods relying on the Padé and Taylor series approximations to the matrix exponential, as well as on the matrix Riccati equations, are presented. For optically thick layers, the asymptotic theory with higher-order corrections is derived, and parameterizations of the asymptotic functions and constants for a water-cloud model with a Gamma size distribution are obtained.

  4. Assessment of a hybrid finite element-transfer matrix model for flat structures with homogeneous acoustic treatments.

    PubMed

    Alimonti, Luca; Atalla, Noureddine; Berry, Alain; Sgard, Franck

    2014-05-01

    Modeling complex vibroacoustic systems including poroelastic materials using finite element based methods can be unfeasible for practical applications. For this reason, analytical approaches such as the transfer matrix method are often preferred to obtain a quick estimation of the vibroacoustic parameters. However, the strong assumptions inherent within the transfer matrix method lead to a lack of accuracy in the description of the geometry of the system. As a result, the transfer matrix method is inherently limited to the high frequency range. Nowadays, hybrid substructuring procedures have become quite popular. Indeed, different modeling techniques are typically sought to describe complex vibroacoustic systems over the widest possible frequency range. As a result, the flexibility and accuracy of the finite element method and the efficiency of the transfer matrix method could be coupled in a hybrid technique to obtain a reduction of the computational burden. In this work, a hybrid methodology is proposed. The performances of the method in predicting the vibroacoutic indicators of flat structures with attached homogeneous acoustic treatments are assessed. The results prove that, under certain conditions, the hybrid model allows for a reduction of the computational effort while preserving enough accuracy with respect to the full finite element solution.

  5. Polarimetric signatures of a canopy of dielectric cylinders based on first and second order vector radiative transfer theory

    NASA Technical Reports Server (NTRS)

    Tsang, Leung; Chan, Chi Hou; Kong, Jin AU; Joseph, James

    1992-01-01

    Complete polarimetric signatures of a canopy of dielectric cylinders overlying a homogeneous half space are studied with the first and second order solutions of the vector radiative transfer theory. The vector radiative transfer equations contain a general nondiagonal extinction matrix and a phase matrix. The energy conservation issue is addressed by calculating the elements of the extinction matrix and the elements of the phase matrix in a manner that is consistent with energy conservation. Two methods are used. In the first method, the surface fields and the internal fields of the dielectric cylinder are calculated by using the fields of an infinite cylinder. The phase matrix is calculated and the extinction matrix is calculated by summing the absorption and scattering to ensure energy conservation. In the second method, the method of moments is used to calculate the elements of the extinction and phase matrices. The Mueller matrix based on the first order and second order multiple scattering solutions of the vector radiative transfer equation are calculated. Results from the two methods are compared. The vector radiative transfer equations, combined with the solution based on method of moments, obey both energy conservation and reciprocity. The polarimetric signatures, copolarized and depolarized return, degree of polarization, and phase differences are studied as a function of the orientation, sizes, and dielectric properties of the cylinders. It is shown that second order scattering is generally important for vegetation canopy at C band and can be important at L band for some cases.

  6. Model reduction of nonsquare linear MIMO systems using multipoint matrix continued-fraction expansions

    NASA Technical Reports Server (NTRS)

    Guo, Tong-Yi; Hwang, Chyi; Shieh, Leang-San

    1994-01-01

    This paper deals with the multipoint Cauer matrix continued-fraction expansion (MCFE) for model reduction of linear multi-input multi-output (MIMO) systems with various numbers of inputs and outputs. A salient feature of the proposed MCFE approach to model reduction of MIMO systems with square transfer matrices is its equivalence to the matrix Pade approximation approach. The Cauer second form of the ordinary MCFE for a square transfer function matrix is generalized in this paper to a multipoint and nonsquare-matrix version. An interesting connection of the multipoint Cauer MCFE method to the multipoint matrix Pade approximation method is established. Also, algorithms for obtaining the reduced-degree matrix-fraction descriptions and reduced-dimensional state-space models from a transfer function matrix via the multipoint Cauer MCFE algorithm are presented. Practical advantages of using the multipoint Cauer MCFE are discussed and a numerical example is provided to illustrate the algorithms.

  7. Fast mean and variance computation of the diffuse sound transmission through finite-sized thick and layered wall and floor systems

    NASA Astrophysics Data System (ADS)

    Decraene, Carolina; Dijckmans, Arne; Reynders, Edwin P. B.

    2018-05-01

    A method is developed for computing the mean and variance of the diffuse field sound transmission loss of finite-sized layered wall and floor systems that consist of solid, fluid and/or poroelastic layers. This is achieved by coupling a transfer matrix model of the wall or floor to statistical energy analysis subsystem models of the adjacent room volumes. The modal behavior of the wall is approximately accounted for by projecting the wall displacement onto a set of sinusoidal lateral basis functions. This hybrid modal transfer matrix-statistical energy analysis method is validated on multiple wall systems: a thin steel plate, a polymethyl methacrylate panel, a thick brick wall, a sandwich panel, a double-leaf wall with poro-elastic material in the cavity, and a double glazing. The predictions are compared with experimental data and with results obtained using alternative prediction methods such as the transfer matrix method with spatial windowing, the hybrid wave based-transfer matrix method, and the hybrid finite element-statistical energy analysis method. These comparisons confirm the prediction accuracy of the proposed method and the computational efficiency against the conventional hybrid finite element-statistical energy analysis method.

  8. A Synthetic Approach to the Transfer Matrix Method in Classical and Quantum Physics

    ERIC Educational Resources Information Center

    Pujol, O.; Perez, J. P.

    2007-01-01

    The aim of this paper is to propose a synthetic approach to the transfer matrix method in classical and quantum physics. This method is an efficient tool to deal with complicated physical systems of practical importance in geometrical light or charged particle optics, classical electronics, mechanics, electromagnetics and quantum physics. Teaching…

  9. Fast radiative transfer models for retrieval of cloud properties in the back-scattering region: application to DSCOVR-EPIC sensor

    NASA Astrophysics Data System (ADS)

    Molina Garcia, Victor; Sasi, Sruthy; Efremenko, Dmitry; Doicu, Adrian; Loyola, Diego

    2017-04-01

    In this work, the requirements for the retrieval of cloud properties in the back-scattering region are described, and their application to the measurements taken by the Earth Polychromatic Imaging Camera (EPIC) on board the Deep Space Climate Observatory (DSCOVR) is shown. Various radiative transfer models and their linearizations are implemented, and their advantages and issues are analyzed. As radiative transfer calculations in the back-scattering region are computationally time-consuming, several acceleration techniques are also studied. The radiative transfer models analyzed include the exact Discrete Ordinate method with Matrix Exponential (DOME), the Matrix Operator method with Matrix Exponential (MOME), and the approximate asymptotic and equivalent Lambertian cloud models. To reduce the computational cost of the line-by-line (LBL) calculations, the k-distribution method, the Principal Component Analysis (PCA) and a combination of the k-distribution method plus PCA are used. The linearized radiative transfer models for retrieval of cloud properties include the Linearized Discrete Ordinate method with Matrix Exponential (LDOME), the Linearized Matrix Operator method with Matrix Exponential (LMOME) and the Forward-Adjoint Discrete Ordinate method with Matrix Exponential (FADOME). These models were applied to the EPIC oxygen-A band absorption channel at 764 nm. It is shown that the approximate asymptotic and equivalent Lambertian cloud models give inaccurate results, so an offline processor for the retrieval of cloud properties in the back-scattering region requires the use of exact models such as DOME and MOME, which behave similarly. The combination of the k-distribution method plus PCA presents similar accuracy to the LBL calculations, but it is up to 360 times faster, and the relative errors for the computed radiances are less than 1.5% compared to the results when the exact phase function is used. Finally, the linearized models studied show similar behavior, with relative errors less than 1% for the radiance derivatives, but FADOME is 2 times faster than LDOME and 2.5 times faster than LMOME.

  10. Discriminative Transfer Subspace Learning via Low-Rank and Sparse Representation.

    PubMed

    Xu, Yong; Fang, Xiaozhao; Wu, Jian; Li, Xuelong; Zhang, David

    2016-02-01

    In this paper, we address the problem of unsupervised domain transfer learning in which no labels are available in the target domain. We use a transformation matrix to transfer both the source and target data to a common subspace, where each target sample can be represented by a combination of source samples such that the samples from different domains can be well interlaced. In this way, the discrepancy of the source and target domains is reduced. By imposing joint low-rank and sparse constraints on the reconstruction coefficient matrix, the global and local structures of data can be preserved. To enlarge the margins between different classes as much as possible and provide more freedom to diminish the discrepancy, a flexible linear classifier (projection) is obtained by learning a non-negative label relaxation matrix that allows the strict binary label matrix to relax into a slack variable matrix. Our method can avoid a potentially negative transfer by using a sparse matrix to model the noise and, thus, is more robust to different types of noise. We formulate our problem as a constrained low-rankness and sparsity minimization problem and solve it by the inexact augmented Lagrange multiplier method. Extensive experiments on various visual domain adaptation tasks show the superiority of the proposed method over the state-of-the art methods. The MATLAB code of our method will be publicly available at http://www.yongxu.org/lunwen.html.

  11. The analytical transfer matrix method for PT-symmetric complex potential

    NASA Astrophysics Data System (ADS)

    Naceri, Leila; Hammou, Amine B.

    2017-07-01

    We have extended the analytical transfer matrix (ATM) method to solve quantum mechanical bound state problems with complex PT-symmetric potentials. Our work focuses on a class of models studied by Bender and Jones, we calculate the energy eigenvalues, discuss the critical values of g and compare the results with those obtained from other methods such as exact numerical computation and WKB approximation method.

  12. Generalization of the Mulliken-Hush treatment for the calculation of electron transfer matrix elements

    NASA Astrophysics Data System (ADS)

    Cave, Robert J.; Newton, Marshall D.

    1996-01-01

    A new method for the calculation of the electronic coupling matrix element for electron transfer processes is introduced and results for several systems are presented. The method can be applied to ground and excited state systems and can be used in cases where several states interact strongly. Within the set of states chosen it is a non-perturbative treatment, and can be implemented using quantities obtained solely in terms of the adiabatic states. Several applications based on quantum chemical calculations are briefly presented. Finally, since quantities for adiabatic states are the only input to the method, it can also be used with purely experimental data to estimate electron transfer matrix elements.

  13. Extension of modified power method to two-dimensional problems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Peng; Ulsan National Institute of Science and Technology, 50 UNIST-gil, Ulsan 44919; Lee, Hyunsuk

    2016-09-01

    In this study, the generalized modified power method was extended to two-dimensional problems. A direct application of the method to two-dimensional problems was shown to be unstable when the number of requested eigenmodes is larger than a certain problem dependent number. The root cause of this instability has been identified as the degeneracy of the transfer matrix. In order to resolve this instability, the number of sub-regions for the transfer matrix was increased to be larger than the number of requested eigenmodes; and a new transfer matrix was introduced accordingly which can be calculated by the least square method. Themore » stability of the new method has been successfully demonstrated with a neutron diffusion eigenvalue problem and the 2D C5G7 benchmark problem. - Graphical abstract:.« less

  14. Matrix method for two-dimensional waveguide mode solution

    NASA Astrophysics Data System (ADS)

    Sun, Baoguang; Cai, Congzhong; Venkatesh, Balajee Seshasayee

    2018-05-01

    In this paper, we show that the transfer matrix theory of multilayer optics can be used to solve the modes of any two-dimensional (2D) waveguide for their effective indices and field distributions. A 2D waveguide, even composed of numerous layers, is essentially a multilayer stack and the transmission through the stack can be analysed using the transfer matrix theory. The result is a transfer matrix with four complex value elements, namely A, B, C and D. The effective index of a guided mode satisfies two conditions: (1) evanescent waves exist simultaneously in the first (cladding) layer and last (substrate) layer, and (2) the complex element D vanishes. For a given mode, the field distribution in the waveguide is the result of a 'folded' plane wave. In each layer, there is only propagation and absorption; at each boundary, only reflection and refraction occur, which can be calculated according to the Fresnel equations. As examples, we show that this method can be used to solve modes supported by the multilayer step-index dielectric waveguide, slot waveguide, gradient-index waveguide and various plasmonic waveguides. The results indicate the transfer matrix method is effective for 2D waveguide mode solution in general.

  15. A Transfer Learning Approach for Applying Matrix Factorization to Small ITS Datasets

    ERIC Educational Resources Information Center

    Voß, Lydia; Schatten, Carlotta; Mazziotti, Claudia; Schmidt-Thieme, Lars

    2015-01-01

    Machine Learning methods for Performance Prediction in Intelligent Tutoring Systems (ITS) have proven their efficacy; specific methods, e.g. Matrix Factorization (MF), however suffer from the lack of available information about new tasks or new students. In this paper we show how this problem could be solved by applying Transfer Learning (TL),…

  16. The vector radiative transfer numerical model of coupled ocean-atmosphere system using the matrix-operator method

    NASA Astrophysics Data System (ADS)

    Xianqiang, He; Delu, Pan; Yan, Bai; Qiankun, Zhu

    2005-10-01

    The numerical model of the vector radiative transfer of the coupled ocean-atmosphere system is developed based on the matrix-operator method, which is named PCOART. In PCOART, using the Fourier analysis, the vector radiative transfer equation (VRTE) splits up into a set of independent equations with zenith angle as only angular coordinate. Using the Gaussian-Quadrature method, VRTE is finally transferred into the matrix equation, which is calculated by using the adding-doubling method. According to the reflective and refractive properties of the ocean-atmosphere interface, the vector radiative transfer numerical model of ocean and atmosphere is coupled in PCOART. By comparing with the exact Rayleigh scattering look-up-table of MODIS(Moderate-resolution Imaging Spectroradiometer), it is shown that PCOART is an exact numerical calculation model, and the processing methods of the multi-scattering and polarization are correct in PCOART. Also, by validating with the standard problems of the radiative transfer in water, it is shown that PCOART could be used to calculate the underwater radiative transfer problems. Therefore, PCOART is a useful tool to exactly calculate the vector radiative transfer of the coupled ocean-atmosphere system, which can be used to study the polarization properties of the radiance in the whole ocean-atmosphere system and the remote sensing of the atmosphere and ocean.

  17. Rotordynamic analysis using the Complex Transfer Matrix: An application to elastomer supports using the viscoelastic correspondence principle

    NASA Astrophysics Data System (ADS)

    Varney, Philip; Green, Itzhak

    2014-11-01

    Numerous methods are available to calculate rotordynamic whirl frequencies, including analytic methods, finite element analysis, and the transfer matrix method. The typical real-valued transfer matrix (RTM) suffers from several deficiencies, including lengthy computation times and the inability to distinguish forward and backward whirl. Though application of complex coordinates in rotordynamic analysis is not novel per se, specific advantages gained from using such coordinates in a transfer matrix analysis have yet to be elucidated. The present work employs a complex coordinate redefinition of the transfer matrix to obtain reduced forms of the elemental transfer matrices in inertial and rotating reference frames, including external stiffness and damping. Application of the complex-valued state variable redefinition results in a reduction of the 8×8 RTM to the 4×4 Complex Transfer Matrix (CTM). The CTM is advantageous in that it intrinsically separates forward and backward whirl, eases symbolic manipulation by halving the transfer matrices’ dimension, and provides significant improvement in computation time. A symbolic analysis is performed on a simple overhung rotor to demonstrate the mathematical motivation for whirl frequency separation. The CTM's utility is further shown by analyzing a rotordynamic system supported by viscoelastic elastomer rings. Viscoelastic elastomer ring supports can provide significant damping while reducing the cost and complexity associated with conventional components such as squeeze film dampers. The stiffness and damping of a viscoelastic damper ring are determined herein as a function of whirl frequency using the viscoelastic correspondence principle and a constitutive fractional calculus viscoelasticity model. The CTM is then employed to obtain the characteristic equation, where the whirl frequency dependent stiffness and damping of the elastomer supports are included. The Campbell diagram is shown, demonstrating the CTM's ability to intrinsically separate synchronous whirl direction for a non-trivial rotordynamic system. Good agreement is found between the CTM results and previously obtained analytic and experimental results for the elastomer ring supported rotordynamic system.

  18. Real-Time Parameter Estimation Method Applied to a MIMO Process and its Comparison with an Offline Identification Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaplanoglu, Erkan; Safak, Koray K.; Varol, H. Selcuk

    2009-01-12

    An experiment based method is proposed for parameter estimation of a class of linear multivariable systems. The method was applied to a pressure-level control process. Experimental time domain input/output data was utilized in a gray-box modeling approach. Prior knowledge of the form of the system transfer function matrix elements is assumed to be known. Continuous-time system transfer function matrix parameters were estimated in real-time by the least-squares method. Simulation results of experimentally determined system transfer function matrix compare very well with the experimental results. For comparison and as an alternative to the proposed real-time estimation method, we also implemented anmore » offline identification method using artificial neural networks and obtained fairly good results. The proposed methods can be implemented conveniently on a desktop PC equipped with a data acquisition board for parameter estimation of moderately complex linear multivariable systems.« less

  19. Centralized PI control for high dimensional multivariable systems based on equivalent transfer function.

    PubMed

    Luan, Xiaoli; Chen, Qiang; Liu, Fei

    2014-09-01

    This article presents a new scheme to design full matrix controller for high dimensional multivariable processes based on equivalent transfer function (ETF). Differing from existing ETF method, the proposed ETF is derived directly by exploiting the relationship between the equivalent closed-loop transfer function and the inverse of open-loop transfer function. Based on the obtained ETF, the full matrix controller is designed utilizing the existing PI tuning rules. The new proposed ETF model can more accurately represent the original processes. Furthermore, the full matrix centralized controller design method proposed in this paper is applicable to high dimensional multivariable systems with satisfactory performance. Comparison with other multivariable controllers shows that the designed ETF based controller is superior with respect to design-complexity and obtained performance. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  20. Solid-perforated panel layout optimization by topology optimization based on unified transfer matrix.

    PubMed

    Kim, Yoon Jae; Kim, Yoon Young

    2010-10-01

    This paper presents a numerical method for the optimization of the sequencing of solid panels, perforated panels and air gaps and their respective thickness for maximizing sound transmission loss and/or absorption. For the optimization, a method based on the topology optimization formulation is proposed. It is difficult to employ only the commonly-used material interpolation technique because the involved layers exhibit fundamentally different acoustic behavior. Thus, an optimization method formulation using a so-called unified transfer matrix is newly proposed. The key idea is to form elements of the transfer matrix such that interpolated elements by the layer design variables can be those of air, perforated and solid panel layers. The problem related to the interpolation is addressed and bench mark-type problems such as sound transmission or absorption maximization problems are solved to check the efficiency of the developed method.

  1. Application of unsteady flow rate evaluations to identify the dynamic transfer function of a cavitatingVenturi

    NASA Astrophysics Data System (ADS)

    Marie-Magdeleine, A.; Fortes-Patella, R.; Lemoine, N.; Marchand, N.

    2012-11-01

    This study concerns the simulation of the implementation of the Kinetic Differential Pressure (KDP) method used for the unsteady mass flow rate evaluation in order to identify the dynamic transfer matrix of a cavitatingVenturi. Firstly, the equations of the IZ code used for this simulation are introduced. Next, the methodology for evaluating unsteady pressures and mass flow rates at the inlet and the outlet of the cavitatingVenturi and for identifying the dynamic transfer matrix is presented. Later, the robustness of the method towards measurement uncertainties implemented as a Gaussian white noise is studied. The results of the numerical simulations let us estimate the system linearity domain and to perform the Empirical Transfer Function Evaluation on the inlet frequency per frequency signal and on the chirp signal tests. Then the pressure data obtained with the KDP method is taken and the identification procedure by ETFE and by the user-made Auto-Recursive Moving-Average eXogenous algorithms is performed and the obtained transfer matrix coefficients are compared with those obtained from the simulated input and output data.

  2. Linearized radiative transfer models for retrieval of cloud parameters from EPIC/DSCOVR measurements

    NASA Astrophysics Data System (ADS)

    Molina García, Víctor; Sasi, Sruthy; Efremenko, Dmitry S.; Doicu, Adrian; Loyola, Diego

    2018-07-01

    In this paper, we describe several linearized radiative transfer models which can be used for the retrieval of cloud parameters from EPIC (Earth Polychromatic Imaging Camera) measurements. The approaches under examination are (1) the linearized forward approach, represented in this paper by the linearized discrete ordinate and matrix operator methods with matrix exponential, and (2) the forward-adjoint approach based on the discrete ordinate method with matrix exponential. To enhance the performance of the radiative transfer computations, the correlated k-distribution method and the Principal Component Analysis (PCA) technique are used. We provide a compact description of the proposed methods, as well as a numerical analysis of their accuracy and efficiency when simulating EPIC measurements in the oxygen A-band channel at 764 nm. We found that the computation time of the forward-adjoint approach using the correlated k-distribution method in conjunction with PCA is approximately 13 s for simultaneously computing the derivatives with respect to cloud optical thickness and cloud top height.

  3. Parallel family trees for transfer matrices in the Potts model

    NASA Astrophysics Data System (ADS)

    Navarro, Cristobal A.; Canfora, Fabrizio; Hitschfeld, Nancy; Navarro, Gonzalo

    2015-02-01

    The computational cost of transfer matrix methods for the Potts model is related to the question in how many ways can two layers of a lattice be connected? Answering the question leads to the generation of a combinatorial set of lattice configurations. This set defines the configuration space of the problem, and the smaller it is, the faster the transfer matrix can be computed. The configuration space of generic (q , v) transfer matrix methods for strips is in the order of the Catalan numbers, which grows asymptotically as O(4m) where m is the width of the strip. Other transfer matrix methods with a smaller configuration space indeed exist but they make assumptions on the temperature, number of spin states, or restrict the structure of the lattice. In this paper we propose a parallel algorithm that uses a sub-Catalan configuration space of O(3m) to build the generic (q , v) transfer matrix in a compressed form. The improvement is achieved by grouping the original set of Catalan configurations into a forest of family trees, in such a way that the solution to the problem is now computed by solving the root node of each family. As a result, the algorithm becomes exponentially faster than the Catalan approach while still highly parallel. The resulting matrix is stored in a compressed form using O(3m ×4m) of space, making numerical evaluation and decompression to be faster than evaluating the matrix in its O(4m ×4m) uncompressed form. Experimental results for different sizes of strip lattices show that the parallel family trees (PFT) strategy indeed runs exponentially faster than the Catalan Parallel Method (CPM), especially when dealing with dense transfer matrices. In terms of parallel performance, we report strong-scaling speedups of up to 5.7 × when running on an 8-core shared memory machine and 28 × for a 32-core cluster. The best balance of speedup and efficiency for the multi-core machine was achieved when using p = 4 processors, while for the cluster scenario it was in the range p ∈ [ 8 , 10 ] . Because of the parallel capabilities of the algorithm, a large-scale execution of the parallel family trees strategy in a supercomputer could contribute to the study of wider strip lattices.

  4. Multi-spectrometer calibration transfer based on independent component analysis.

    PubMed

    Liu, Yan; Xu, Hao; Xia, Zhenzhen; Gong, Zhiyong

    2018-02-26

    Calibration transfer is indispensable for practical applications of near infrared (NIR) spectroscopy due to the need for precise and consistent measurements across different spectrometers. In this work, a method for multi-spectrometer calibration transfer is described based on independent component analysis (ICA). A spectral matrix is first obtained by aligning the spectra measured on different spectrometers. Then, by using independent component analysis, the aligned spectral matrix is decomposed into the mixing matrix and the independent components of different spectrometers. These differing measurements between spectrometers can then be standardized by correcting the coefficients within the independent components. Two NIR datasets of corn and edible oil samples measured with three and four spectrometers, respectively, were used to test the reliability of this method. The results of both datasets reveal that spectra measurements across different spectrometers can be transferred simultaneously and that the partial least squares (PLS) models built with the measurements on one spectrometer can predict that the spectra can be transferred correctly on another.

  5. Transfer matrix spectrum for cyclic representations of the 6-vertex reflection algebra by quantum separation of variables

    NASA Astrophysics Data System (ADS)

    Pezelier, Baptiste

    2018-02-01

    In this proceeding, we recall the notion of quantum integrable systems on a lattice and then introduce the Sklyanin’s Separation of Variables method. We sum up the main results for the transfer matrix spectral problem for the cyclic representations of the trigonometric 6-vertex reflection algebra associated to the Bazanov-Stroganov Lax operator. These results apply as well to the spectral analysis of the lattice sine-Gordon model with open boundary conditions. The transfer matrix spectrum (both eigenvalues and eigenstates) is completely characterized in terms of the set of solutions to a discrete system of polynomial equations. We state an equivalent characterization as the set of solutions to a Baxter’s like T-Q functional equation, allowing us to rewrite the transfer matrix eigenstates in an algebraic Bethe ansatz form.

  6. Development of RWHet to Simulate Contaminant Transport in Fractured Porous Media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yong; LaBolle, Eric; Reeves, Donald M

    2012-07-01

    Accurate simulation of matrix diffusion in regional-scale dual-porosity and dual-permeability media is a critical issue for the DOE Underground Test Area (UGTA) program, given the prevalence of fractured geologic media on the Nevada National Security Site (NNSS). Contaminant transport through regional-scale fractured media is typically quantified by particle-tracking based Lagrangian solvers through the inclusion of dual-domain mass transfer algorithms that probabilistically determine particle transfer between fractures and unfractured matrix blocks. UGTA applications include a wide variety of fracture aperture and spacing, effective diffusion coefficients ranging four orders of magnitude, and extreme end member retardation values. This report incorporates the currentmore » dual-domain mass transfer algorithms into the well-known particle tracking code RWHet [LaBolle, 2006], and then tests and evaluates the updated code. We also develop and test a direct numerical simulation (DNS) approach to replace the classical transfer probability method in characterizing particle dynamics across the fracture/matrix interface. The final goal of this work is to implement the algorithm identified as most efficient and effective into RWHet, so that an accurate and computationally efficient software suite can be built for dual-porosity/dual-permeability applications. RWHet is a mature Lagrangian transport simulator with a substantial user-base that has undergone significant development and model validation. In this report, we also substantially tested the capability of RWHet in simulating passive and reactive tracer transport through regional-scale, heterogeneous media. Four dual-domain mass transfer methodologies were considered in this work. We first developed the empirical transfer probability approach proposed by Liu et al. [2000], and coded it into RWHet. The particle transfer probability from one continuum to the other is proportional to the ratio of the mass entering the other continuum to the mass in the current continuum. Numerical examples show that this method is limited to certain ranges of parameters, due to an intrinsic assumption of an equilibrium concentration profile in the matrix blocks in building the transfer probability. Subsequently, this method fails in describing mass transfer for parameter combinations that violate this assumption, including small diffusion coefficients (i.e., the free-water molecular diffusion coefficient 1×10-11 meter2/second), relatively large fracture spacings (such as meter), and/or relatively large matrix retardation coefficients (i.e., ). These “outliers” in parameter range are common in UGTA applications. To address the above limitations, we then developed a Direct Numerical Simulation (DNS)-Reflective method. The novel DNS-Reflective method can directly track the particle dynamics across the fracture/matrix interface using a random walk, without any empirical assumptions. This advantage should make the DNS-Reflective method feasible for a wide range of parameters. Numerical tests of the DNS-Reflective, however, show that the method is computationally very demanding, since the time step must be very small to resolve particle transfer between fractures and matrix blocks. To improve the computational efficiency of the DNS approach, we then adopted Roubinet et al.’s method [2009], which uses first passage time distributions to simulate dual-domain mass transfer. The DNS-Roubinet method was found to be computationally more efficient than the DNS-Reflective method. It matches the analytical solution for the whole range of major parameters (including diffusion coefficient and fracture aperture values that are considered “outliers” for Liu et al.’s transfer probability method [2000]) for a single fracture system. The DNS-Roubinet method, however, has its own disadvantage: for a parallel fracture system, the truncation of the first passage time distribution creates apparent errors when the fracture spacing is small, and thus it tends to erroneously predict breakthrough curves (BTCs) for the parallel fracture system. Finally, we adopted the transient range approach proposed by Pan and Bodvarsson [2002] in RWHet. In this method, particle transfer between fractures and matrix blocks can be resolved without using very small time steps. It does not use any truncation of the first passage time distribution for particles. Hence it does not have the limitation identified above for the DNS-Reflective method and the DNS-Roubinet method. Numerical results were checked against analytical solutions, and also compared to DCPTV2.0 [Pan, 2002]. This version of RWHet (called RWHet-Pan&Bodvarsson in this report) can accurately capture contaminant transport in fractured porous media for a full range of parameters without any practical or theoretical limitations.« less

  7. Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

    NASA Technical Reports Server (NTRS)

    Murthy, V. R.; Shultz, Louis A.

    1994-01-01

    The goal of this research is to develop the transfer matrix method to treat nonlinear autonomous boundary value problems with multiple branches. The application is the complete nonlinear aeroelastic analysis of multiple-branched rotor blades. Once the development is complete, it can be incorporated into the existing transfer matrix analyses. There are several difficulties to be overcome in reaching this objective. The conventional transfer matrix method is limited in that it is applicable only to linear branch chain-like structures, but consideration of multiple branch modeling is important for bearingless rotors. Also, hingeless and bearingless rotor blade dynamic characteristics (particularly their aeroelasticity problems) are inherently nonlinear. The nonlinear equations of motion and the multiple-branched boundary value problem are treated together using a direct transfer matrix method. First, the formulation is applied to a nonlinear single-branch blade to validate the nonlinear portion of the formulation. The nonlinear system of equations is iteratively solved using a form of Newton-Raphson iteration scheme developed for differential equations of continuous systems. The formulation is then applied to determine the nonlinear steady state trim and aeroelastic stability of a rotor blade in hover with two branches at the root. A comprehensive computer program is developed and is used to obtain numerical results for the (1) free vibration, (2) nonlinearly deformed steady state, (3) free vibration about the nonlinearly deformed steady state, and (4) aeroelastic stability tasks. The numerical results obtained by the present method agree with results from other methods.

  8. General transfer matrix formalism to calculate DNA-protein-drug binding in gene regulation: application to OR operator of phage lambda.

    PubMed

    Teif, Vladimir B

    2007-01-01

    The transfer matrix methodology is proposed as a systematic tool for the statistical-mechanical description of DNA-protein-drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the O(R) operator of phage lambda. The transfer matrix formalism allowed the description of the lambda-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI-Cro-RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the O(R) and O(L) operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters P(R) and P(RM) becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed.

  9. General transfer matrix formalism to calculate DNA–protein–drug binding in gene regulation: application to OR operator of phage λ

    PubMed Central

    Teif, Vladimir B.

    2007-01-01

    The transfer matrix methodology is proposed as a systematic tool for the statistical–mechanical description of DNA–protein–drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the OR operator of phage λ. The transfer matrix formalism allowed the description of the λ-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI–Cro–RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the OR and OL operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters PR and PRM becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed. PMID:17526526

  10. Spectral analysis of the UFBG-based acousto—optical modulator in V-I transmission matrix formalism

    NASA Astrophysics Data System (ADS)

    Wu, Liang-Ying; Pei, Li; Liu, Chao; Wang, Yi-Qun; Weng, Si-Jun; Wang, Jian-Shuai

    2014-11-01

    In this study, the V-I transmission matrix formalism (V-I method) is proposed to analyze the spectrum characteristics of the uniform fiber Bragg grating (FBG)-based acousto—optic modulators (UFBG-AOM). The simulation results demonstrate that both the amplitude of the acoustically induced strain and the frequency of the acoustic wave (AW) have an effect on the spectrum. Additionally, the wavelength spacing between the primary reflectivity peak and the secondary reflectivity peak is proportional to the acoustic frequency with the ratio 0.1425 nm/MHz. Meanwhile, we compare the amount of calculation. For the FBG whose period is M, the calculation of the V-I method is 4 × (2M-1) in addition/subtraction, 8 × (2M - 1) in multiply/division and 2M in exponent arithmetic, which is almost a quarter of the multi-film method and transfer matrix (TM) method. The detailed analysis indicates that, compared with the conventional multi-film method and transfer matrix (TM) method, the V-I method is faster and less complex.

  11. Frequency domain system identification methods - Matrix fraction description approach

    NASA Technical Reports Server (NTRS)

    Horta, Luca G.; Juang, Jer-Nan

    1993-01-01

    This paper presents the use of matrix fraction descriptions for least-squares curve fitting of the frequency spectra to compute two matrix polynomials. The matrix polynomials are intermediate step to obtain a linearized representation of the experimental transfer function. Two approaches are presented: first, the matrix polynomials are identified using an estimated transfer function; second, the matrix polynomials are identified directly from the cross/auto spectra of the input and output signals. A set of Markov parameters are computed from the polynomials and subsequently realization theory is used to recover a minimum order state space model. Unevenly spaced frequency response functions may be used. Results from a simple numerical example and an experiment are discussed to highlight some of the important aspect of the algorithm.

  12. Applying transfer matrix method to the estimation of the modal characteristics of the NASA Mini-Mass Truss

    NASA Technical Reports Server (NTRS)

    Shen, Ji-Yao; Taylor, Lawrence W., Jr.

    1994-01-01

    It is beneficial to use a distributed parameter model for large space structures because the approach minimizes the number of model parameters. Holzer's transfer matrix method provides a useful means to simplify and standardize the procedure for solving the system of partial differential equations. Any large space structures can be broken down into sub-structures with simple elastic and dynamical properties. For each single element, such as beam, tether, or rigid body, we can derive the corresponding transfer matrix. Combining these elements' matrices enables the solution of the global system equations. The characteristics equation can then be formed by satisfying the appropriate boundary conditions. Then natural frequencies and mode shapes can be determined by searching the roots of the characteristic equation at frequencies within the range of interest. This paper applies this methodology, and the maximum likelihood estimation method, to refine the modal characteristics of the NASA Mini-Mast Truss by successively matching the theoretical response to the test data of the truss. The method is being applied to more complex configurations.

  13. Coupled bending-torsion steady-state response of pretwisted, nonuniform rotating beams using a transfer-matrix method

    NASA Technical Reports Server (NTRS)

    Gray, Carl E., Jr.

    1988-01-01

    Using the Newtonian method, the equations of motion are developed for the coupled bending-torsion steady-state response of beams rotating at constant angular velocity in a fixed plane. The resulting equations are valid to first order strain-displacement relationships for a long beam with all other nonlinear terms retained. In addition, the equations are valid for beams with the mass centroidal axis offset (eccentric) from the elastic axis, nonuniform mass and section properties, and variable twist. The solution of these coupled, nonlinear, nonhomogeneous, differential equations is obtained by modifying a Hunter linear second-order transfer-matrix solution procedure to solve the nonlinear differential equations and programming the solution for a desk-top personal computer. The modified transfer-matrix method was verified by comparing the solution for a rotating beam with a geometric, nonlinear, finite-element computer code solution; and for a simple rotating beam problem, the modified method demonstrated a significant advantage over the finite-element solution in accuracy, ease of solution, and actual computer processing time required to effect a solution.

  14. Radiative transfer models for retrieval of cloud parameters from EPIC/DSCOVR measurements

    NASA Astrophysics Data System (ADS)

    Molina García, Víctor; Sasi, Sruthy; Efremenko, Dmitry S.; Doicu, Adrian; Loyola, Diego

    2018-07-01

    In this paper we analyze the accuracy and efficiency of several radiative transfer models for inferring cloud parameters from radiances measured by the Earth Polychromatic Imaging Camera (EPIC) on board the Deep Space Climate Observatory (DSCOVR). The radiative transfer models are the exact discrete ordinate and matrix operator methods with matrix exponential, and the approximate asymptotic and equivalent Lambertian cloud models. To deal with the computationally expensive radiative transfer calculations, several acceleration techniques such as, for example, the telescoping technique, the method of false discrete ordinate, the correlated k-distribution method and the principal component analysis (PCA) are used. We found that, for the EPIC oxygen A-band absorption channel at 764 nm, the exact models using the correlated k-distribution in conjunction with PCA yield an accuracy better than 1.5% and a computation time of 18 s for radiance calculations at 5 viewing zenith angles.

  15. Radiative Transfer Model for Operational Retrieval of Cloud Parameters from DSCOVR-EPIC Measurements

    NASA Astrophysics Data System (ADS)

    Yang, Y.; Molina Garcia, V.; Doicu, A.; Loyola, D. G.

    2016-12-01

    The Earth Polychromatic Imaging Camera (EPIC) onboard the Deep Space Climate Observatory (DSCOVR) measures the radiance in the backscattering region. To make sure that all details in the backward glory are covered, a large number of streams is required by a standard radiative transfer model based on the discrete ordinates method. Even the use of the delta-M scaling and the TMS correction do not substantially reduce the number of streams. The aim of this work is to analyze the capability of a fast radiative transfer model to retrieve operationally cloud parameters from EPIC measurements. The radiative transfer model combines the discrete ordinates method with matrix exponential for the computation of radiances and the matrix operator method for the calculation of the reflection and transmission matrices. Standard acceleration techniques as, for instance, the use of the normalized right and left eigenvectors, telescoping technique, Pade approximation and successive-order-of-scattering approximation are implemented. In addition, the model may compute the reflection matrix of the cloud by means of the asymptotic theory, and may use the equivalent Lambertian cloud model. The various approximations are analyzed from the point of view of efficiency and accuracy.

  16. Investigation of a broadband coherent perfect absorber in a multi-layer structure by using the transfer matrix method

    NASA Astrophysics Data System (ADS)

    Na, Jihoon; Noh, Heeso

    2018-01-01

    We investigated a multi-layer structure for a broadband coherent perfect absorber (CPA). The transfer matrix method (TMM) is useful for analyzing the optical properties of structures and optimizing multi-layer structures. The broadband CPA strongly depends on the phase of the light traveling in one direction and the light reflected within the structure. The TMM simulation shows that the absorption bandwidth is increased by 95% in a multi-layer CPA compared to that in a single-layer CPA.

  17. Resonance Phenomena in Goupillaud-type Media

    DTIC Science & Technology

    2010-10-01

    time-harmonic forcing function at one end, with the other end fixed. Analytical stress solutions are derived from a global system of recursion...relationships using z-transform methods, where the determinant of the resulting global system matrix |Am| in the z-space is a palindromic polynomial with real...media (35). The present treatment uses a global matrix method that is attributed to Knopoff (36), rather than the Thomsen-Haskell transfer matrix

  18. A revised version of the transfer matrix method to analyze one-dimensional structures

    NASA Technical Reports Server (NTRS)

    Nitzsche, F.

    1983-01-01

    A new and general method to analyze both free and forced vibration characteristics of one-dimensional structures is discussed in this paper. This scheme links for the first time the classical transfer matrix method with the recently developed integrating matrix technique to integrate systems of differential equations. Two alternative approaches to the problem are presented. The first is based upon the lumped parameter model to account for the inertia properties of the structure. The second releases that constraint allowing a more precise description of the physical system. The free vibration of a straight uniform beam under different support conditions is analyzed to test the accuracy of the two models. Finally some results for the free vibration of a 12th order system representing a curved, rotating beam prove that the present method is conveniently extended to more complicated structural dynamics problems.

  19. Matrix form of Legendre polynomials for solving linear integro-differential equations of high order

    NASA Astrophysics Data System (ADS)

    Kammuji, M.; Eshkuvatov, Z. K.; Yunus, Arif A. M.

    2017-04-01

    This paper presents an effective approximate solution of high order of Fredholm-Volterra integro-differential equations (FVIDEs) with boundary condition. Legendre truncated series is used as a basis functions to estimate the unknown function. Matrix operation of Legendre polynomials is used to transform FVIDEs with boundary conditions into matrix equation of Fredholm-Volterra type. Gauss Legendre quadrature formula and collocation method are applied to transfer the matrix equation into system of linear algebraic equations. The latter equation is solved by Gauss elimination method. The accuracy and validity of this method are discussed by solving two numerical examples and comparisons with wavelet and methods.

  20. Development of a hybrid wave based-transfer matrix model for sound transmission analysis.

    PubMed

    Dijckmans, A; Vermeir, G

    2013-04-01

    In this paper, a hybrid wave based-transfer matrix model is presented that allows for the investigation of the sound transmission through finite multilayered structures placed between two reverberant rooms. The multilayered structure may consist of an arbitrary configuration of fluid, elastic, or poro-elastic layers. The field variables (structural displacements and sound pressures) are expanded in terms of structural and acoustic wave functions. The boundary and continuity conditions in the rooms determine the participation factors in the pressure expansions. The displacement of the multilayered structure is determined by the mechanical impedance matrix, which gives a relation between the pressures and transverse displacements at both sides of the structure. The elements of this matrix are calculated with the transfer matrix method. First, the hybrid model is numerically validated. Next a comparison is made with sound transmission loss measurements of a hollow brick wall and a sandwich panel. Finally, numerical simulations show the influence of structural damping, room dimensions and plate dimensions on the sound transmission loss of multilayered structures.

  1. Transfer matrix method for dynamics modeling and independent modal space vibration control design of linear hybrid multibody system

    NASA Astrophysics Data System (ADS)

    Rong, Bao; Rui, Xiaoting; Lu, Kun; Tao, Ling; Wang, Guoping; Ni, Xiaojun

    2018-05-01

    In this paper, an efficient method of dynamics modeling and vibration control design of a linear hybrid multibody system (MS) is studied based on the transfer matrix method. The natural vibration characteristics of a linear hybrid MS are solved by using low-order transfer equations. Then, by constructing the brand-new body dynamics equation, augmented operator and augmented eigenvector, the orthogonality of augmented eigenvector of a linear hybrid MS is satisfied, and its state space model expressed in each independent model space is obtained easily. According to this dynamics model, a robust independent modal space-fuzzy controller is designed for vibration control of a general MS, and the genetic optimization of some critical control parameters of fuzzy tuners is also presented. Two illustrative examples are performed, which results show that this method is computationally efficient and with perfect control performance.

  2. Aeroelastic analysis of a troposkien-type wind turbine blade

    NASA Technical Reports Server (NTRS)

    Nitzsche, F.

    1981-01-01

    The linear aeroelastic equations for one curved blade of a vertical axis wind turbine in state vector form are presented. The method is based on a simple integrating matrix scheme together with the transfer matrix idea. The method is proposed as a convenient way of solving the associated eigenvalue problem for general support conditions.

  3. A new method for the calculation of the conductivity of inhomogeneous systems

    NASA Astrophysics Data System (ADS)

    Byshkin, M. S.; Turkin, A. A.

    2005-06-01

    A new method for computing the conductivity of random irregular resistor networks is developed. This method is a generalization of the transfer-matrix technique, proposed by Derrida and Vannimenus for regular 2D and 3D lattices. At the same time for large systems the method presented in this paper is more efficient than the transfer-matrix technique. To demonstrate the method it is applied to a cubic lattice at the percolation threshold and away from it. The conductivity has been found for lattices with size up to 3243. The ratio between the conductivity exponent t and the correlation length exponent η was estimated to be t/η = 2.315, in good agreement with the literature data.

  4. Transfer matrix approach for the Kerr and Faraday rotation in layered nanostructures.

    PubMed

    Széchenyi, Gábor; Vigh, Máté; Kormányos, Andor; Cserti, József

    2016-09-21

    To study the optical rotation of the polarization of light incident on multilayer systems consisting of atomically thin conductors and dielectric multilayers we present a general method based on transfer matrices. The transfer matrix of the atomically thin conducting layer is obtained using the Maxwell equations. We derive expressions for the Kerr (Faraday) rotation angle and for the ellipticity of the reflected (transmitted) light as a function of the incident angle and polarization of the light. The method is demonstrated by calculating the Kerr (Faraday) angle for bilayer graphene in the quantum anomalous Hall state placed on the top of dielectric multilayers. The optical conductivity of the bilayer graphene is calculated in the framework of a four-band model.

  5. Theorems on symmetries and flux conservation in radiative transfer using the matrix operator theory.

    NASA Technical Reports Server (NTRS)

    Kattawar, G. W.

    1973-01-01

    The matrix operator approach to radiative transfer is shown to be a very powerful technique in establishing symmetry relations for multiple scattering in inhomogeneous atmospheres. Symmetries are derived for the reflection and transmission operators using only the symmetry of the phase function. These results will mean large savings in computer time and storage for performing calculations for realistic planetary atmospheres using this method. The results have also been extended to establish a condition on the reflection matrix of a boundary in order to preserve reciprocity. Finally energy conservation is rigorously proven for conservative scattering in inhomogeneous atmospheres.

  6. Comparison of Five System Identification Algorithms for Rotorcraft Higher Harmonic Control

    NASA Technical Reports Server (NTRS)

    Jacklin, Stephen A.

    1998-01-01

    This report presents an analysis and performance comparison of five system identification algorithms. The methods are presented in the context of identifying a frequency-domain transfer matrix for the higher harmonic control (HHC) of helicopter vibration. The five system identification algorithms include three previously proposed methods: (1) the weighted-least- squares-error approach (in moving-block format), (2) the Kalman filter method, and (3) the least-mean-squares (LMS) filter method. In addition there are two new ones: (4) a generalized Kalman filter method and (5) a generalized LMS filter method. The generalized Kalman filter method and the generalized LMS filter method were derived as extensions of the classic methods to permit identification by using more than one measurement per identification cycle. Simulation results are presented for conditions ranging from the ideal case of a stationary transfer matrix and no measurement noise to the more complex cases involving both measurement noise and transfer-matrix variation. Both open-loop identification and closed- loop identification were simulated. Closed-loop mode identification was more challenging than open-loop identification because of the decreasing signal-to-noise ratio as the vibration became reduced. The closed-loop simulation considered both local-model identification, with measured vibration feedback and global-model identification with feedback of the identified uncontrolled vibration. The algorithms were evaluated in terms of their accuracy, stability, convergence properties, computation speeds, and relative ease of implementation.

  7. Dynamical simulation of electron transfer processes in self-assembled monolayers at metal surfaces using a density matrix approach.

    PubMed

    Prucker, V; Bockstedte, M; Thoss, M; Coto, P B

    2018-03-28

    A single-particle density matrix approach is introduced to simulate the dynamics of heterogeneous electron transfer (ET) processes at interfaces. The characterization of the systems is based on a model Hamiltonian parametrized by electronic structure calculations and a partitioning method. The method is applied to investigate ET in a series of nitrile-substituted (poly)(p-phenylene)thiolate self-assembled monolayers adsorbed at the Au(111) surface. The results show a significant dependence of the ET on the orbital symmetry of the donor state and on the molecular and electronic structure of the spacer.

  8. Time evolution of photon-pulse propagation in scattering and absorbing media: The dynamic radiative transfer system

    NASA Astrophysics Data System (ADS)

    Georgakopoulos, A.; Politopoulos, K.; Georgiou, E.

    2018-03-01

    A new dynamic-system approach to the problem of radiative transfer inside scattering and absorbing media is presented, directly based on first-hand physical principles. This method, the Dynamic Radiative Transfer System (DRTS), employs a dynamical system formality using a global sparse matrix, which characterizes the physical, optical and geometrical properties of the material-volume of interest. The new system state is generated by the above time-independent matrix, using simple matrix-vector multiplication for each subsequent time step. DRTS is capable of calculating accurately the time evolution of photon propagation in media of complex structure and shape. The flexibility of DRTS allows the integration of time-dependent sources, boundary conditions, different media and several optical phenomena like reflection and refraction in a unified and consistent way. Various examples of DRTS simulation results are presented for ultra-fast light pulse 3-D propagation, demonstrating greatly reduced computational cost and resource requirements compared to other methods.

  9. First-order transitions and thermodynamic properties in the 2D Blume-Capel model: the transfer-matrix method revisited

    NASA Astrophysics Data System (ADS)

    Jung, Moonjung; Kim, Dong-Hee

    2017-12-01

    We investigate the first-order transition in the spin-1 two-dimensional Blume-Capel model in square lattices by revisiting the transfer-matrix method. With large strip widths increased up to the size of 18 sites, we construct the detailed phase coexistence curve which shows excellent quantitative agreement with the recent advanced Monte Carlo results. In the deep first-order area, we observe the exponential system-size scaling of the spectral gap of the transfer matrix from which linearly increasing interfacial tension is deduced with decreasing temperature. We find that the first-order signature at low temperatures is strongly pronounced with much suppressed finite-size influence in the examined thermodynamic properties of entropy, non-zero spin population, and specific heat. It turns out that the jump at the transition becomes increasingly sharp as it goes deep into the first-order area, which is in contrast to the Wang-Landau results where finite-size smoothing gets more severe at lower temperatures.

  10. The application of nonlinear programming and collocation to optimal aeroassisted orbital transfers

    NASA Astrophysics Data System (ADS)

    Shi, Y. Y.; Nelson, R. L.; Young, D. H.; Gill, P. E.; Murray, W.; Saunders, M. A.

    1992-01-01

    Sequential quadratic programming (SQP) and collocation of the differential equations of motion were applied to optimal aeroassisted orbital transfers. The Optimal Trajectory by Implicit Simulation (OTIS) computer program codes with updated nonlinear programming code (NZSOL) were used as a testbed for the SQP nonlinear programming (NLP) algorithms. The state-of-the-art sparse SQP method is considered to be effective for solving large problems with a sparse matrix. Sparse optimizers are characterized in terms of memory requirements and computational efficiency. For the OTIS problems, less than 10 percent of the Jacobian matrix elements are nonzero. The SQP method encompasses two phases: finding an initial feasible point by minimizing the sum of infeasibilities and minimizing the quadratic objective function within the feasible region. The orbital transfer problem under consideration involves the transfer from a high energy orbit to a low energy orbit.

  11. Diagonalization of transfer matrix of supersymmetry U{sub q}(sl-caret(M+1|N+1)) chain with a boundary

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kojima, Takeo

    2013-04-15

    We study the supersymmetry U{sub q}(sl-caret(M+1|N+1)) analogue of the supersymmetric t-J model with a boundary. Our approach is based on the algebraic analysis method of solvable lattice models. We diagonalize the commuting transfer matrix by using the bosonizations of the vertex operators associated with the quantum affine supersymmetry U{sub q}(sl-caret(M+1|N+1)).

  12. On the formulation of a minimal uncertainty model for robust control with structured uncertainty

    NASA Technical Reports Server (NTRS)

    Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

    1991-01-01

    In the design and analysis of robust control systems for uncertain plants, representing the system transfer matrix in the form of what has come to be termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents a transfer function matrix M(s) of the nominal closed loop system, and the delta represents an uncertainty matrix acting on M(s). The nominal closed loop system M(s) results from closing the feedback control system, K(s), around a nominal plant interconnection structure P(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unsaturated uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, but for real parameter variations delta is a diagonal matrix of real elements. Conceptually, the M-delta structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the currently available literature addresses computational methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty, where the term minimal refers to the dimension of the delta matrix. Since having a minimally dimensioned delta matrix would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta would be useful. Hence, a method of obtaining the interconnection system P(s) is required. A generalized procedure for obtaining a minimal P-delta structure for systems with real parameter variations is presented. Using this model, the minimal M-delta model can then be easily obtained by closing the feedback loop. The procedure involves representing the system in a cascade-form state-space realization, determining the minimal uncertainty matrix, delta, and constructing the state-space representation of P(s). Three examples are presented to illustrate the procedure.

  13. Linear and nonlinear dynamic analysis of redundant load path bearingless rotor systems

    NASA Technical Reports Server (NTRS)

    Murthy, V. R.

    1985-01-01

    The bearingless rotorcraft offers reduced weight, less complexity and superior flying qualities. Almost all the current industrial structural dynamic programs of conventional rotors which consist of single load path rotor blades employ the transfer matrix method to determine natural vibration characteristics because this method is ideally suited for one dimensional chain like structures. This method is extended to multiple load path rotor blades without resorting to an equivalent single load path approximation. Unlike the conventional blades, it isk necessary to introduce the axial-degree-of-freedom into the solution process to account for the differential axial displacements in the different load paths. With the present extension, the current rotor dynamic programs can be modified with relative ease to account for the multiple load paths without resorting to the equivalent single load path modeling. The results obtained by the transfer matrix method are validated by comparing with the finite element solutions. A differential stiffness matrix due to blade rotation is derived to facilitate the finite element solutions.

  14. Electrodialytic matrix isolation for metal cations.

    PubMed

    Ohira, Shin-Ichi; Hiroyama, Yuri; Nakamura, Koretaka; Koda, Takumi; Dasgupta, Purnendu K; Toda, Kei

    2015-01-01

    Electrodialytic ion transfer was studied as a matrix isolation tool for heavy metal determinations. An ion transfer device (ITD) was used for the transfer of heavy metal cations. Under optimized flow rates applied voltage and receptor composition, heavy metal ions were quantitatively transferred at concentrations spanning µg L(-1) to mg L(-1). As long as the sample pH was acidic, there was no significant sample pH effect on the transfer efficiencies. Significant salt concentrations (>1 mM NaCl), however, decreased the transfer efficiency. This could be ameliorated (up to 5 mM NaCl) by transient instead of continuous sample introduction. The device was applied to the determination of Fe, Cu and Zn in equine and bovine serum; the reproducibility was better than conventional digestion method. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Heat exchanger and method of making. [bonding rocket chambers with a porous metal matrix

    NASA Technical Reports Server (NTRS)

    Fortini, A.; Kazaroff, J. M. (Inventor)

    1978-01-01

    A heat exchanger of increased effectiveness is disclosed. A porous metal matrix is disposed in a metal chamber or between walls through which a heat-transfer fluid is directed. The porous metal matrix has internal bonds and is bonded to the chamber in order to remove all thermal contact resistance within the composite structure. Utilization of the invention in a rocket chamber is disclosed as a specific use. Also disclosed is a method of constructing the heat exchanger.

  16. Diffusive transfer to membranes as an effective interface between gel electrophoresis and mass spectrometry

    NASA Astrophysics Data System (ADS)

    Ogorzalek Loo, Rachel R.; Mitchell, Charles; Stevenson, Tracy I.; Loo, Joseph A.; Andrews, Philip C.

    1997-12-01

    Diffusive transfer was examined as a blotting method to transfer proteins from polyacrylamide gels to membranes for ultraviolet matrix-assisted laser desorption ionization (MALDI) mass spectrometry. The method is well-suited for transfers from isoelectric focusing (IEF) gels. Spectra have been obtained for 11 pmol of 66 kDa albumin loaded onto an IEF gel and subsequently blotted to polyethylene. Similarly, masses of intact carbonic anhydrase and hemoglobin were obtained from 14 and 20 pmol loadings. This methodology is also compatible with blotting high molecular weight proteins, as seen for 6 pmol of the 150 kDa monoclonal antibody anti-[beta]-galactosidase transferred to Goretex. Polypropylene, Teflon, Nafion and polyvinylidene difluoride (PVDF) also produced good spectra following diffusive transfer. Only analysis from PVDF required that the membrane be kept wet prior to application of matrix. Considerations in mass accuracy for analysis from large-area membranes with continuous extraction and delayed extraction were explored, as were remedies for surface charging. Vapor phase CNBr cleavage was applied to membrane-bound samples for peptide mapping.

  17. FDTD and transfer matrix methods for evaluating the performance of photonic crystal based microcavities for exciton-polaritons

    NASA Astrophysics Data System (ADS)

    Liu, Yi-Cheng; Byrnes, Tim

    2016-11-01

    We investigate alternative microcavity structures for exciton-polaritons consisting of photonic crystals instead of distributed Bragg reflectors. Finite-difference time-domain simulations and scattering transfer matrix methods are used to evaluate the cavity performance. The results are compared with conventional distributed Bragg reflectors. We find that in terms of the photon lifetime, the photonic crystal based microcavities are competitive, with typical lifetimes in the region of ∼20 ps being achieved. The photonic crystal microcavities have the advantage that they are compact and are frequency adjustable, showing that they are viable to investigate exciton-polariton condensation physics.

  18. Ab initio quantum chemical calculation of electron transfer matrix elements for large molecules

    NASA Astrophysics Data System (ADS)

    Zhang, Linda Yu; Friesner, Richard A.; Murphy, Robert B.

    1997-07-01

    Using a diabatic state formalism and pseudospectral numerical methods, we have developed an efficient ab initio quantum chemical approach to the calculation of electron transfer matrix elements for large molecules. The theory is developed at the Hartree-Fock level and validated by comparison with results in the literature for small systems. As an example of the power of the method, we calculate the electronic coupling between two bacteriochlorophyll molecules in various intermolecular geometries. Only a single self-consistent field (SCF) calculation on each of the monomers is needed to generate coupling matrix elements for all of the molecular pairs. The largest calculations performed, utilizing 1778 basis functions, required ˜14 h on an IBM 390 workstation. This is considerably less cpu time than would be necessitated with a supermolecule adiabatic state calculation and a conventional electronic structure code.

  19. Superconducting coil and method of stress management in a superconducting coil

    DOEpatents

    McIntyre, Peter M.; Shen, Weijun; Diaczenko, Nick; Gross, Dan A.

    1999-01-01

    A superconducting coil (12) having a plurality of superconducting layers (18) is provided. Each superconducting layer (18) may have at least one superconducting element (20) which produces an operational load. An outer support structure (24) may be disposed outwardly from the plurality of layers (18). A load transfer system (22) may be coupled between at least one of the superconducting elements (20) and the outer support structure (24). The load transfer system (22) may include a support matrix structure (30) operable to transfer the operational load from the superconducting element (20) directly to the outer support structure (24). A shear release layer (40) may be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a shear stress between the superconducting element (20) and the support matrix structure (30). A compliant layer (42) may also be disposed, in part, between the superconducting element (20) and the support matrix structure (30) for relieving a compressive stress on the superconducting element (20).

  20. A modified Finite Element-Transfer Matrix for control design of space structures

    NASA Technical Reports Server (NTRS)

    Tan, T.-M.; Yousuff, A.; Bahar, L. Y.; Konstandinidis, M.

    1990-01-01

    The Finite Element-Transfer Matrix (FETM) method was developed for reducing the computational efforts involved in structural analysis. While being widely used by structural analysts, this method does, however, have certain limitations, particularly when used for the control design of large flexible structures. In this paper, a new formulation based on the FETM method is presented. The new method effectively overcomes the limitations in the original FETM method, and also allows an easy construction of reduced models that are tailored for the control design. Other advantages of this new method include the ability to extract open loop frequencies and mode shapes with less computation, and simplification of the design procedures for output feedback, constrained compensation, and decentralized control. The development of this new method and the procedures for generating reduced models using this method are described in detail and the role of the reduced models in control design is discussed through an illustrative example.

  1. An extension to the Chahine method of inverting the radiative transfer equation. [application to ozone distribution in atmosphere

    NASA Technical Reports Server (NTRS)

    Twomey, S.; Herman, B.; Rabinoff, R.

    1977-01-01

    An extension of the Chahine relaxation method (1970) for inverting the radiative transfer equation is presented. This method is superior to the original method in that it takes into account in a realistic manner the shape of the kernel function, and its extension to nonlinear systems is much more straightforward. A comparison of the new method with a matrix method due to Twomey (1965), in a problem involving inference of vertical distribution of ozone from spectroscopic measurements in the near ultraviolet, indicates that in this situation this method is stable with errors in the input data up to 4%, whereas the matrix method breaks down at these levels. The problem of non-uniqueness of the solution, which is a property of the system of equations rather than of any particular algorithm for solving them, remains, although it takes on slightly different forms for the two algorithms.

  2. Transfer-Matrix Method for Solving the Spin 1/2 Antiferromagnetic Heisenberg Chain

    NASA Astrophysics Data System (ADS)

    Garcia-Bach, M. A.; Klein, D. J.; Valenti, R.

    Following the discovery of high Tc superconductivity in the copper oxides, there has been a great deal of interest in the RVB wave function proposed by Anderson [1]. As a warm-up exercise we have considered a valence-bond wave function for the one dimensional spin-1/2 Heisenberg chain. The main virtue of our work is to propose a new variational singlet wavefunction which is almost analytically tractable by a transfer-matrix technique. We have obtained the ground state energy for finite as well as infinite chains, in good agreement with exact results. Correlation functions, excited states, and the effects of other interactions (e.g., spin-Peierls) are also accessible within this scheme [2]. Since the ground state of the chain is known to be a singlet (Lieb & Mattis [3]), we write the appropriate wave function as a superposition of valence-bond singlets, |ψ > =∑ limits k C k | k>, where |k> is a spin configuration obtained by pairing all spins into singlet pairs, in a way which is common in valence-bond calculations of large molecules. As in that case, each configuration, |k>, can be represented by a Rümer diagram, with directed bonds connecting each pair of spins on the chain. The ck's are variational co-efficients, the form of which is determined as follows: Each singlet configuration (Rümer diagram) is divided into "zones", a "zone" corresponding to the region between two consecutive sites. Each zone is indexed by its distance from the end of the chain and by the number of bonds crossing it. Our procedure assigns a variational parameter, xij, to the jth zone, when crossed by i bonds. The resulting wavefunction for an N-site chain is written as |ψ > =∑ limits k ∏ M limits { i =1} ∏ { N -1}limits { j =1} X ij{ m ij (k)} | k> where mij(k) equals 1 when zone j is crossed by i bonds and zero otherwise. To make the calculation tractable we reduce the number of variational parameters by disallowing configurations with bonds connecting any two sites separated by more than 2M lattice points. (For simplicity, we have limited ourselves to M=3, but the scheme can be used for any M). With the simple ansatz, matrix elements can be calculated by a transfer-matrix method. To understand the transfer-matrix method note that since only local zone parameters appear in the description of each state |k>, matrix elements and overlaps, < k| bar S q bar S{ q +1} |k'> and , are completely specified by a small number of "local states" associated with each zone. Within a given zone a local state is defined by (i) the number of bonds crossing the zone and (ii), by whether the bonds originate from the initial (|k>) or final (|k'>) state. It is then easy to see that "local states" of consecutive zones are connected by a 15 × 15 transfer matrix (for the case M=3). Furthermore, the overlap matrix element can be written as a product of transfer-matrices associated with each zone of the chain. When calculating matrix elements of the Hamiltonian, an additional matrix, U, must be defined, to represent the particular zone involving the two spins connected by the Heisenberg interaction. The relevant details as well as the comparison with exact results will be given elsewhere. We are planning to ultimately apply this method to the two dimensional case, and hope to include the effects of holes.

  3. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  4. Complete spatiotemporal characterization and optical transfer matrix inversion of a 420 mode fiber.

    PubMed

    Carpenter, Joel; Eggleton, Benjamin J; Schröder, Jochen

    2016-12-01

    The ability to measure a scattering medium's optical transfer matrix, the mapping between any spatial input and output, has enabled applications such as imaging to be performed through media which would otherwise be opaque due to scattering. However, the scattering of light occurs not just in space, but also in time. We complete the characterization of scatter by extending optical transfer matrix methods into the time domain, allowing any spatiotemporal input state at one end to be mapped directly to its corresponding spatiotemporal output state. We have measured the optical transfer function of a multimode fiber in its entirety; it consists of 420 modes in/out at 32768 wavelengths, the most detailed complete characterization of multimode waveguide light propagation to date, to the best of our knowledge. We then demonstrate the ability to generate any spatial/polarization state at the output of the fiber at any wavelength, as well as predict the temporal response of any spatial/polarization input state.

  5. Comparison of finite element and transfer matrix methods for numerical investigation of surface plasmon waveguides

    NASA Astrophysics Data System (ADS)

    Haddouche, Issam; Cherbi, Lynda

    2017-01-01

    In this paper, we investigate Surface Plasmon Polaritons (SPPs) in the visible regime at a metal/dielectric interface within two different waveguide structures, the first is a Photonic Crystal Fiber where the Full Vector Finite Element Method (FVFEM) is used and the second is a slab waveguide where the transfer matrix method (TMM) is used. Knowing the diversities between the two methods in terms of speed, simplicity, and scope of application, computation is implemented with respect to wavelength and metal layer thickness in order to analyze and compare the performances of the two methods. Simulation results show that the TMM can be a good approximation for the FVFEM and that SPPs behave more like modes propagating in a semi infinite metal/dielectric structure as metal thickness increases from about 150 nm.

  6. Modeling of trim panels in the energy finite element analysis

    NASA Astrophysics Data System (ADS)

    Moravaeji, Seyed-Javid

    Modeling a trim panel is divided into finding the power exchange through two different paths: (i) the connection of the outer and inner panels (ii) through the layers directly. The vibrational power exchanged through the mounts is modeled as the connection of two parallel plates connected via a beam. Wave matrices representing plates and beams are derived separately; then a matrix method is proposed to solve for the wave amplitudes and hence the vibrational power exchange between the plates accordingly. A closed form formula for the case of connection of two identical plates is derived. For the power transmission loss directly through the layers, first transfer matrices representing layers made of different materials is considered. New matrices for a porous layer are derived. A method of finding the layered structure transfer matrix is proposed. It is concluded that in general a single isotropic layer cannot replace a structure accurately. Finally, on the basis of an equivalent transfer matrix, an optimization process for is proposed to replace the panel by a suitable set of layers.

  7. Beam-tracing model for predicting sound fields in rooms with multilayer bounding surfaces

    NASA Astrophysics Data System (ADS)

    Wareing, Andrew; Hodgson, Murray

    2005-10-01

    This paper presents the development of a wave-based room-prediction model for predicting steady-state sound fields in empty rooms with specularly reflecting, multilayer surfaces. A triangular beam-tracing model with phase, and a transfer-matrix approach to model the surfaces, were involved. Room surfaces were modeled as multilayers of fluid, solid, or porous materials. Biot theory was used in the transfer-matrix formulation of the porous layer. The new model consisted of the transfer-matrix model integrated into the beam-tracing algorithm. The transfer-matrix model was validated by comparing predictions with those by theory, and with experiment. The test surfaces were a glass plate, double drywall panels, double steel panels, a carpeted floor, and a suspended-acoustical ceiling. The beam-tracing model was validated in the cases of three idealized room configurations-a small office, a corridor, and a small industrial workroom-with simple boundary conditions. The number of beams, the reflection order, and the frequency resolution required to obtain accurate results were investigated. Beam-tracing predictions were compared with those by a method-of-images model with phase. The model will be used to study sound fields in rooms with local- or extended-reaction multilayer surfaces.

  8. Radiative-Transfer Modeling of Spectra of Densely Packed Particulate Media

    NASA Astrophysics Data System (ADS)

    Ito, G.; Mishchenko, M. I.; Glotch, T. D.

    2017-12-01

    Remote sensing measurements over a wide range of wavelengths from both ground- and space-based platforms have provided a wealth of data regarding the surfaces and atmospheres of various solar system bodies. With proper interpretations, important properties, such as composition and particle size, can be inferred. However, proper interpretation of such datasets can often be difficult, especially for densely packed particulate media with particle sizes on the order of wavelength of light being used for remote sensing. Radiative transfer theory has often been applied to the study of densely packed particulate media like planetary regoliths and snow, but with difficulty, and here we continue to investigate radiative transfer modeling of spectra of densely packed media. We use the superposition T-matrix method to compute scattering properties of clusters of particles and capture the near-field effects important for dense packing. Then, the scattering parameters from the T-matrix computations are modified with the static structure factor correction, accounting for the dense packing of the clusters themselves. Using these corrected scattering parameters, reflectance (or emissivity via Kirchhoff's Law) is computed with the method of invariance imbedding solution to the radiative transfer equation. For this work we modeled the emissivity spectrum of the 3.3 µm particle size fraction of enstatite, representing some common mineralogical and particle size components of regoliths, in the mid-infrared wavelengths (5 - 50 µm). The modeled spectrum from the T-matrix method with static structure factor correction using moderate packing densities (filling factors of 0.1 - 0.2) produced better fits to the laboratory measurement of corresponding spectrum than the spectrum modeled by the equivalent method without static structure factor correction. Future work will test the method of the superposition T-matrix and static structure factor correction combination for larger particles sizes and polydispersed clusters in search for the most effective modeling of spectra of densely packed particulate media.

  9. Estimates of electronic coupling for excess electron transfer in DNA

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2005-07-01

    Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

  10. Drawing a different picture with pencil lead as matrix-assisted laser desorption/ionization matrix for fullerene derivatives.

    PubMed

    Nye, Leanne C; Hungerbühler, Hartmut; Drewello, Thomas

    2018-02-01

    Inspired by reports on the use of pencil lead as a matrix-assisted laser desorption/ionization matrix, paving the way towards matrix-free matrix-assisted laser desorption/ionization, the present investigation evaluates its usage with organic fullerene derivatives. Currently, this class of compounds is best analysed using the electron transfer matrix trans-2-[3-(4-tert-butylphenyl)-2-methyl-2-propenylidene] malononitrile (DCTB), which was employed as the standard here. The suitability of pencil lead was additionally compared to direct (i.e. no matrix) laser desorption/ionization-mass spectrometry. The use of (DCTB) was identified as the by far gentler method, producing spectra with abundant molecular ion signals and much reduced fragmentation. Analytically, pencil lead was found to be ineffective as a matrix, however, appears to be an extremely easy and inexpensive method for producing sodium and potassium adducts.

  11. Solute Migration from the Aquifer Matrix into a Solution Conduit and the Reverse.

    PubMed

    Li, Guangquan; Field, Malcolm S

    2016-09-01

    A solution conduit has a permeable wall allowing for water exchange and solute transfer between the conduit and its surrounding aquifer matrix. In this paper, we use Laplace Transform to solve a one-dimensional equation constructed using the Euler approach to describe advective transport of solute in a conduit, a production-value problem. Both nonuniform cross-section of the conduit and nonuniform seepage at the conduit wall are considered in the solution. Physical analysis using the Lagrangian approach and a lumping method is performed to verify the solution. Two-way transfer between conduit water and matrix water is also investigated by using the solution for the production-value problem as a first-order approximation. The approximate solution agrees well with the exact solution if dimensionless travel time in the conduit is an order of magnitude smaller than unity. Our analytical solution is based on the assumption that the spatial and/or temporal heterogeneity in the wall solute flux is the dominant factor in the spreading of spring-breakthrough curves, and conduit dispersion is only a secondary mechanism. Such an approach can lead to the better understanding of water exchange and solute transfer between conduits and aquifer matrix. Euler and Lagrangian approaches are used to solve transport in conduit. Two-way transfer between conduit and matrix is investigated. The solution is applicable to transport in conduit of persisting solute from matrix. © 2016, National Ground Water Association.

  12. An improved ray theory and transfer matrix method-based model for lightning electromagnetic pulses propagating in Earth-ionosphere waveguide and its applications

    NASA Astrophysics Data System (ADS)

    Qin, Zilong; Chen, Mingli; Zhu, Baoyou; Du, Ya-ping

    2017-01-01

    An improved ray theory and transfer matrix method-based model for a lightning electromagnetic pulse (LEMP) propagating in Earth-ionosphere waveguide (EIWG) is proposed and tested. The model involves the presentation of a lightning source, parameterization of the lower ionosphere, derivation of a transfer function representing all effects of EIWG on LEMP sky wave, and determination of attenuation mode of the LEMP ground wave. The lightning source is simplified as an electric point dipole standing on Earth surface with finite conductance. The transfer function for the sky wave is derived based on ray theory and transfer matrix method. The attenuation mode for the ground wave is solved from Fock's diffraction equations. The model is then applied to several lightning sferics observed in central China during day and night times within 1000 km. The results show that the model can precisely predict the time domain sky wave for all these observed lightning sferics. Both simulations and observations show that the lightning sferics in nighttime has a more complicated waveform than in daytime. Particularly, when a LEMP propagates from east to west (Φ = 270°) and in nighttime, its sky wave tends to be a double-peak waveform (dispersed sky wave) rather than a single peak one. Such a dispersed sky wave in nighttime may be attributed to the magneto-ionic splitting phenomenon in the lower ionosphere. The model provides us an efficient way for retrieving the electron density profile of the lower ionosphere and hence to monitor its spatial and temporal variations via lightning sferics.

  13. Cortical dipole imaging using truncated total least squares considering transfer matrix error.

    PubMed

    Hori, Junichi; Takeuchi, Kosuke

    2013-01-01

    Cortical dipole imaging has been proposed as a method to visualize electroencephalogram in high spatial resolution. We investigated the inverse technique of cortical dipole imaging using a truncated total least squares (TTLS). The TTLS is a regularization technique to reduce the influence from both the measurement noise and the transfer matrix error caused by the head model distortion. The estimation of the regularization parameter was also investigated based on L-curve. The computer simulation suggested that the estimation accuracy was improved by the TTLS compared with Tikhonov regularization. The proposed method was applied to human experimental data of visual evoked potentials. We confirmed the TTLS provided the high spatial resolution of cortical dipole imaging.

  14. Coherent-Anomaly Method in Critical Phenomena. III. Mean-Field Transfer-Matrix Method in the 2D Ising Model

    NASA Astrophysics Data System (ADS)

    Hu, Xiao; Katori, Makoto; Suzuki, Masuo

    1987-11-01

    Two kinds of systematic mean-field transfer-matrix methods are formulated in the 2-dimensional Ising spin system, by introducing Weiss-like and Bethe-like approximations. All the critical exponents as well as the true critical point can be estimated in these methods following the CAM procedure. The numerical results of the above system are Tc*≃2.271 (J/kB), γ{=}γ'≃1.749, β≃0.131 and δ≃15.1. The specific heat is confirmd to be continuous and to have a logarithmic divergence at the true critical point, i.e., α{=}α'{=}0. Thus, the finite-degree-of-approximation scaling ansatz is shown to be correct and very powerful in practical estimations of the critical exponents as well as the true critical point.

  15. Reverse matrix converter control method for PMSM drives using DPC

    NASA Astrophysics Data System (ADS)

    Bak, Yeongsu; Lee, Kyo-Beum

    2018-05-01

    This paper proposes a control method for a reverse matrix converter (RMC) that drives a three-phase permanent magnet synchronous motor (PMSM). In this proposed method, direct power control (DPC) is used to control the voltage source rectifier of the RMC. The RMC is an indirect matrix converter operating in the boost mode, in which the power-flow directions of the input and output are switched. It has a minimum voltage transfer ratio of 1/0.866 in a linear-modulation region. In this paper, a control method that uses DPC as an additional control method is proposed in order to control the RMC driving a PMSM in the output stage. Simulations and experimental results verify the effectiveness of the proposed control method.

  16. Other notable protein blotting methods: a brief review.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2015-01-01

    Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

  17. A Two-Time Scale Decentralized Model Predictive Controller Based on Input and Output Model

    PubMed Central

    Niu, Jian; Zhao, Jun; Xu, Zuhua; Qian, Jixin

    2009-01-01

    A decentralized model predictive controller applicable for some systems which exhibit different dynamic characteristics in different channels was presented in this paper. These systems can be regarded as combinations of a fast model and a slow model, the response speeds of which are in two-time scale. Because most practical models used for control are obtained in the form of transfer function matrix by plant tests, a singular perturbation method was firstly used to separate the original transfer function matrix into two models in two-time scale. Then a decentralized model predictive controller was designed based on the two models derived from the original system. And the stability of the control method was proved. Simulations showed that the method was effective. PMID:19834542

  18. Lattice Methods and the Nuclear Few- and Many-Body Problem

    NASA Astrophysics Data System (ADS)

    Lee, Dean

    This chapter builds upon the review of lattice methods and effective field theory of the previous chapter. We begin with a brief overview of lattice calculations using chiral effective field theory and some recent applications. We then describe several methods for computing scattering on the lattice. After that we focus on the main goal, explaining the theory and algorithms relevant to lattice simulations of nuclear few- and many-body systems. We discuss the exact equivalence of four different lattice formalisms, the Grassmann path integral, transfer matrix operator, Grassmann path integral with auxiliary fields, and transfer matrix operator with auxiliary fields. Along with our analysis we include several coding examples and a number of exercises for the calculations of few- and many-body systems at leading order in chiral effective field theory.

  19. Performance analysis of cross-seeding WDM-PON system using transfer matrix method

    NASA Astrophysics Data System (ADS)

    Simatupang, Joni Welman; Pukhrambam, Puspa Devi; Huang, Yen-Ru

    2016-12-01

    In this paper, a model based on the transfer matrix method is adopted to analyze the effects of Rayleigh backscattering and Fresnel multiple reflections on a cross-seeding WDM-PON system. As part of analytical approximation methods, this time-independent model is quite simple but very efficient when it is applied to various WDM-PON transmission systems, including the cross-seeding scheme. The cross seeding scheme is most beneficial for systems with low loop-back ONU gain or low reflection loss at the drop fiber for upstream data in bidirectional transmission. However for downstream data transmission, multiple reflections power could destroy the usefulness of the cross-seeding scheme when the reflectivity is high enough and the RN is positioned near OLT or close to ONU.

  20. A reduced-order integral formulation to account for the finite size effect of isotropic square panels using the transfer matrix method.

    PubMed

    Bonfiglio, Paolo; Pompoli, Francesco; Lionti, Riccardo

    2016-04-01

    The transfer matrix method is a well-established prediction tool for the simulation of sound transmission loss and the sound absorption coefficient of flat multilayer systems. Much research has been dedicated to enhancing the accuracy of the method by introducing a finite size effect of the structure to be simulated. The aim of this paper is to present a reduced-order integral formulation to predict radiation efficiency and radiation impedance for a panel with equal lateral dimensions. The results are presented and discussed for different materials in terms of radiation efficiency, sound transmission loss, and the sound absorption coefficient. Finally, the application of the proposed methodology for rectangular multilayer systems is also investigated and validated against experimental data.

  1. Deterministic and stochastic methods of calculation of polarization characteristics of radiation in natural environment

    NASA Astrophysics Data System (ADS)

    Strelkov, S. A.; Sushkevich, T. A.; Maksakova, S. V.

    2017-11-01

    We are talking about russian achievements of the world level in the theory of radiation transfer, taking into account its polarization in natural media and the current scientific potential developing in Russia, which adequately provides the methodological basis for theoretically-calculated research of radiation processes and radiation fields in natural media using supercomputers and mass parallelism. A new version of the matrix transfer operator is proposed for solving problems of polarized radiation transfer in heterogeneous media by the method of influence functions, when deterministic and stochastic methods can be combined.

  2. Critical speeds and forced response solutions for active magnetic bearing turbomachinery, part 2

    NASA Technical Reports Server (NTRS)

    Rawal, D.; Keesee, J.; Kirk, R. Gordon

    1991-01-01

    The need for better performance of turbomachinery with active magnetic bearings has necessitated a study of such systems for accurate prediction of their vibrational characteristics. A modification of existing transfer matrix methods for rotor analysis is presented to predict the response of rotor systems with active magnetic bearings. The position of the magnetic bearing sensors is taken into account and the effect of changing sensor position on the vibrational characteristics of the rotor system is studied. The modified algorithm is validated using a simpler Jeffcott model described previously. The effect of changing from a rotating unbalance excitation to a constant excitation in a single plane is also studied. A typical eight stage centrifugal compressor rotor is analyzed using the modified transfer matrix code. The results for a two mass Jeffcott model were presented previously. The results obtained by running this model with the transfer matrix method were compared with the results of the Jeffcott analysis for the purposes of verification. Also included are plots of amplitude versus frequency for the eight stage centrifugal compressor rotor. These plots demonstrate the significant influence that sensor location has on the amplitude and critical frequencies of the rotor system.

  3. Numerical simulations of electromagnetic scattering by Solar system objects

    NASA Astrophysics Data System (ADS)

    Dlugach, Janna M.

    2016-11-01

    Having been profoundly stimulated by the seminal work of Viktor V. Sobolev, I have been involved in multi-decadal research in the fields of radiative transfer, electromagnetic scattering by morphologically complex particles and particulate media, and planetary remote sensing. Much of this research has been done in close collaboration with other "descendants" of Academician Sobolev. This tutorial paper gives a representative overview of the results of extensive numerical simulations (in the vast majority carried out in collaboration with Michael Mishchenko) used to analyze remote-sensing observations of Solar system objects and based on highly accurate methods of the radiative transfer theory and direct computer solvers of the Maxwell equations. Using the atmosphere of Jupiter as a proving ground and performing T-matrix and radiative-transfer calculations helps demonstrate the strong effect of aerosol-particle shapes on the accuracy of remote-sensing retrievals. I then discuss the application of the T-matrix method, a numerically exact solution of the vector radiative transfer equation, and the theory of coherent backscattering to an analysis of polarimetric radar observations of Saturn's rings. Numerical modeling performed by using the superposition T-matrix method in application to cometary dust in the form of aggregates serves to reproduce the results of polarimetric observations of the distant comet C/2010 S1. On the basis of direct computer solutions of the Maxwell equations, it is demonstrated that all backscattering effects predicted by the low-density theories of radiative transfer and coherent backscattering can also be identified for media with volume packing densities typically encountered in natural and artificial environments. This result implies that spectacular opposition effects observed for some high-albedo atmoshereless Solar system bodies can be attributed to coherent backscattering of sunlight by regolith layers composed of microscopic particles.

  4. Transfer matrix calculation for ion optical elements using real fields

    NASA Astrophysics Data System (ADS)

    Mishra, P. M.; Blaum, K.; George, S.; Grieser, M.; Wolf, A.

    2018-03-01

    With the increasing importance of ion storage rings and traps in low energy physics experiments, an efficient transport of ion species from the ion source area to the experimental setup becomes essential. Some available, powerful software packages rely on transfer matrix calculations in order to compute the ion trajectory through the ion-optical beamline systems of high complexity. With analytical approaches, so far the transfer matrices are documented only for a few ideal ion optical elements. Here we describe an approach (using beam tracking calculations) to determine the transfer matrix for any individual electrostatic or magnetostatic ion optical element. We verify the procedure by considering the well-known cases and then apply it to derive the transfer matrix of a 90-degree electrostatic quadrupole deflector including its realistic geometry and fringe fields. A transfer line consisting of a quadrupole deflector and a quadrupole doublet is considered, where the results from the standard first order transfer matrix based ion optical simulation program implementing the derived transfer matrix is compared with the real field beam tracking simulations.

  5. Photonic band structures solved by a plane-wave-based transfer-matrix method.

    PubMed

    Li, Zhi-Yuan; Lin, Lan-Lan

    2003-04-01

    Transfer-matrix methods adopting a plane-wave basis have been routinely used to calculate the scattering of electromagnetic waves by general multilayer gratings and photonic crystal slabs. In this paper we show that this technique, when combined with Bloch's theorem, can be extended to solve the photonic band structure for 2D and 3D photonic crystal structures. Three different eigensolution schemes to solve the traditional band diagrams along high-symmetry lines in the first Brillouin zone of the crystal are discussed. Optimal rules for the Fourier expansion over the dielectric function and electromagnetic fields with discontinuities occurring at the boundary of different material domains have been employed to accelerate the convergence of numerical computation. Application of this method to an important class of 3D layer-by-layer photonic crystals reveals the superior convergency of this different approach over the conventional plane-wave expansion method.

  6. Iterative Methods for the Non-LTE Transfer of Polarized Radiation: Resonance Line Polarization in One-dimensional Atmospheres

    NASA Astrophysics Data System (ADS)

    Trujillo Bueno, Javier; Manso Sainz, Rafael

    1999-05-01

    This paper shows how to generalize to non-LTE polarization transfer some operator splitting methods that were originally developed for solving unpolarized transfer problems. These are the Jacobi-based accelerated Λ-iteration (ALI) method of Olson, Auer, & Buchler and the iterative schemes based on Gauss-Seidel and successive overrelaxation (SOR) iteration of Trujillo Bueno and Fabiani Bendicho. The theoretical framework chosen for the formulation of polarization transfer problems is the quantum electrodynamics (QED) theory of Landi Degl'Innocenti, which specifies the excitation state of the atoms in terms of the irreducible tensor components of the atomic density matrix. This first paper establishes the grounds of our numerical approach to non-LTE polarization transfer by concentrating on the standard case of scattering line polarization in a gas of two-level atoms, including the Hanle effect due to a weak microturbulent and isotropic magnetic field. We begin demonstrating that the well-known Λ-iteration method leads to the self-consistent solution of this type of problem if one initializes using the ``exact'' solution corresponding to the unpolarized case. We show then how the above-mentioned splitting methods can be easily derived from this simple Λ-iteration scheme. We show that our SOR method is 10 times faster than the Jacobi-based ALI method, while our implementation of the Gauss-Seidel method is 4 times faster. These iterative schemes lead to the self-consistent solution independently of the chosen initialization. The convergence rate of these iterative methods is very high; they do not require either the construction or the inversion of any matrix, and the computing time per iteration is similar to that of the Λ-iteration method.

  7. Determination of poles and zeros of transfer functions for flexible spacecraft attitude control

    NASA Technical Reports Server (NTRS)

    Ohkami, Y.; Likins, P. W.

    1976-01-01

    The transfer function matrix is obtained for a three-input and three-output model of minimum sensors and actuators for the attitude control system of flexible spacecraft, and a method is described for determining the poles and zeros of this transfer function. Three cases are considered: (1) the actuators and the sensors are all attached to the primary body, (2) the actuators are on the primary body and the sensors are on the sub-body, and (3) the actuators are on the sub-body and the sensors are on the primary body. The zero-determination problem is shown to reduce to eigenvalue calculations of a matrix which is constructed from the inertial and modal matrices in a simple fashion.

  8. The Green's matrix and the boundary integral equations for analysis of time-harmonic dynamics of elastic helical springs.

    PubMed

    Sorokin, Sergey V

    2011-03-01

    Helical springs serve as vibration isolators in virtually any suspension system. Various exact and approximate methods may be employed to determine the eigenfrequencies of vibrations of these structural elements and their dynamic transfer functions. The method of boundary integral equations is a meaningful alternative to obtain exact solutions of problems of the time-harmonic dynamics of elastic springs in the framework of Bernoulli-Euler beam theory. In this paper, the derivations of the Green's matrix, of the Somigliana's identities, and of the boundary integral equations are presented. The vibrational power transmission in an infinitely long spring is analyzed by means of the Green's matrix. The eigenfrequencies and the dynamic transfer functions are found by solving the boundary integral equations. In the course of analysis, the essential features and advantages of the method of boundary integral equations are highlighted. The reported analytical results may be used to study the time-harmonic motion in any wave guide governed by a system of linear differential equations in a single spatial coordinate along its axis. © 2011 Acoustical Society of America

  9. Novel Architectures for Achieving Direct Electron Transfer in Enzymatic Biofuel Cells

    NASA Astrophysics Data System (ADS)

    Blaik, Rita A.

    Enzymatic biofuel cells are a promising source of alternative energy for small device applications, but still face the challenge of achieving direct electron transfer with high enzyme concentrations in a simple system. In this dissertation, methods of constructing electrodes consisting of enzymes attached to nanoparticle-enhanced substrates that serve as high surface area templates are evaluated. In the first method described, glucose oxidase is covalently attached to gold nanoparticles that are assembled onto genetically engineered M13 bacteriophage. The resulting anodes achieve a high peak current per area and a significant improvement in enzyme surface coverage. In the second system, fructose dehydrogenase, a membrane-bound enzyme that has the natural ability to achieve direct electron transfer, is immobilized into a matrix consisting of binders and carbon nanotubes to extend the lifetime of the anode. For the cathode, bilirubin oxidase is immobilized in a carbon nanotube and sol-gel matrix to achieve direct electron transfer. Finally, a full fuel cell consisting of both an anode and cathode is constructed and evaluated with each system described.

  10. A methodology for formulating a minimal uncertainty model for robust control system design and analysis

    NASA Technical Reports Server (NTRS)

    Belcastro, Christine M.; Chang, B.-C.; Fischl, Robert

    1989-01-01

    In the design and analysis of robust control systems for uncertain plants, the technique of formulating what is termed an M-delta model has become widely accepted and applied in the robust control literature. The M represents the transfer function matrix M(s) of the nominal system, and delta represents an uncertainty matrix acting on M(s). The uncertainty can arise from various sources, such as structured uncertainty from parameter variations or multiple unstructured uncertainties from unmodeled dynamics and other neglected phenomena. In general, delta is a block diagonal matrix, and for real parameter variations the diagonal elements are real. As stated in the literature, this structure can always be formed for any linear interconnection of inputs, outputs, transfer functions, parameter variations, and perturbations. However, very little of the literature addresses methods for obtaining this structure, and none of this literature addresses a general methodology for obtaining a minimal M-delta model for a wide class of uncertainty. Since have a delta matrix of minimum order would improve the efficiency of structured singular value (or multivariable stability margin) computations, a method of obtaining a minimal M-delta model would be useful. A generalized method of obtaining a minimal M-delta structure for systems with real parameter variations is given.

  11. Heat exchanger and method of making. [rocket lining

    NASA Technical Reports Server (NTRS)

    Fortini, A.; Kazaroff, J. M. (Inventor)

    1980-01-01

    A heat exchange of increased effectiveness is disclosed. A porous metal matrix is disposed in a metal chamber or between walls through which a heat-transfer fluid is directed. The porous metal matrix has internal bonds and is bonded to the chamber in order to remove all thermal contact resistance within the composite structure. Utilization of the invention in a rocket chamber is disclosed as a specific use. Also disclosed is a method of constructing the heat exchanger.

  12. [A cost-benefit analysis of a Mexican food-support program].

    PubMed

    Ventura-Alfaro, Carmelita E; Gutiérrez-Reyes, Juan P; Bertozzi-Kenefick, Stefano M; Caldés-Gómez, Natalia

    2011-06-01

    Objective Presenting an estimate of a Mexican food-support program (FSP) program's cost transfer ratio (CTR) from start-up (2003) to May 2005. Methods The program's activities were listed by constructing a time allocation matrix to ascertain how much time was spent on each of the program's activities by the personnel so involved. Another cost matrix was also constructed which was completed with information from the program's accountancy records. The program's total cost, activity cost and the value of given FSP transfers were thus estimated. Results Food delivery CRT for 2003, 2004 and 2005 was 0.150, 0.218, 0.230, respectively; cash CTR was 0.132in 2004 and 0.105 in 2005. Conclusion Comparing CTR values according to transfer type is a good way to promote discussion related to this topic; however, the decision for making a transfer does not depend exclusively on efficiency but on both mechanisms' effectiveness.

  13. Integrable Floquet dynamics, generalized exclusion processes and "fused" matrix ansatz

    NASA Astrophysics Data System (ADS)

    Vanicat, Matthieu

    2018-04-01

    We present a general method for constructing integrable stochastic processes, with two-step discrete time Floquet dynamics, from the transfer matrix formalism. The models can be interpreted as a discrete time parallel update. The method can be applied for both periodic and open boundary conditions. We also show how the stationary distribution can be built as a matrix product state. As an illustration we construct parallel discrete time dynamics associated with the R-matrix of the SSEP and of the ASEP, and provide the associated stationary distributions in a matrix product form. We use this general framework to introduce new integrable generalized exclusion processes, where a fixed number of particles is allowed on each lattice site in opposition to the (single particle) exclusion process models. They are constructed using the fusion procedure of R-matrices (and K-matrices for open boundary conditions) for the SSEP and ASEP. We develop a new method, that we named "fused" matrix ansatz, to build explicitly the stationary distribution in a matrix product form. We use this algebraic structure to compute physical observables such as the correlation functions and the mean particle current.

  14. Minimum impulse three-body trajectories.

    NASA Technical Reports Server (NTRS)

    D'Amario, L.; Edelbaum, T. N.

    1973-01-01

    A rapid and accurate method of calculating optimal impulsive transfers in the restricted problem of three bodies has been developed. The technique combines a multi-conic method of trajectory integration with primer vector theory and an accelerated gradient method of trajectory optimization. A unique feature is that the state transition matrix and the primer vector are found analytical without additional integrations or differentiations. The method has been applied to the determination of optimal two and three impulse transfers between the L2 libration point and circular orbits about both the earth and the moon.

  15. Heat transfer enhancement of PCM melting in 2D horizontal elliptical tube using metallic porous matrix

    NASA Astrophysics Data System (ADS)

    Jourabian, Mahmoud; Farhadi, Mousa; Rabienataj Darzi, Ahmad Ali

    2016-12-01

    In this study, the melting process of ice as a phase-change material (PCM) saturated with a nickel-steel porous matrix inside a horizontal elliptical tube is investigated. Due to the low thermal conductivity of the PCM, it is motivated to augment the heat transfer performance of the system simultaneously by finding an optimum value of the aspect ratio and impregnating a metallic porous matrix into the base PCM. The lattice Boltzmann method with a double distribution function formulated based on the enthalpy method, is applied at the representative elementary volume scale under the local thermal equilibrium assumption between the PCM and porous matrix in the composite. While reducing or increasing the aspect ratio of the circular tubes leads to the expedited melting, the 90° inclination of each elliptical tube in the case of the pure PCM melting does not affect the melting rate. With the reduction in the porosity, the effective thermal conductivity and melting rate in all tubes promoted. Although the natural convection is fully suppressed due to the significant flow blockage in the porous structure, the melting rates are generally increased in all cases.

  16. Method Of Signal Amplification In Multi-Chromophore Luminescence Sensors

    DOEpatents

    Levitsky, Igor A.; Krivoshlykov, Sergei G.

    2004-02-03

    A fluorescence-based method for highly sensitive and selective detection of analyte molecules is proposed. The method employs the energy transfer between two or more fluorescent chromophores in a carefully selected polymer matrix. In one preferred embodiment, signal amplification has been achieved in the fluorescent sensing of dimethyl methylphosphonate (DMMP) using two dyes, 3-aminofluoranthene (AM) and Nile Red (NR), in a hydrogen bond acidic polymer matrix. The selected polymer matrix quenches the fluorescence of both dyes and shifts dye emission and absorption spectra relative to more inert matrices. Upon DMMP sorption, the AM fluorescence shifts to the red at the same time the NR absorption shifts to the blue, resulting in better band overlap and increased energy transfer between chromophores. In another preferred embodiment, the sensitive material is incorporated into an optical fiber system enabling efficient excitation of the dye and collecting the fluorescent signal form the sensitive material on the remote end of the system. The proposed method can be applied to multichromophore luminescence sensor systems incorporating N-chromophores leading to N-fold signal amplification and improved selectivity. The method can be used in all applications where highly sensitive detection of basic gases, such as dimethyl methylphosphonate (DMMP), Sarin, Soman and other chemical warfare agents having basic properties, is required, including environmental monitoring, chemical industry and medicine.

  17. Generation of gas-phase ions from charged clusters: an important ionization step causing suppression of matrix and analyte ions in matrix-assisted laser desorption/ionization mass spectrometry.

    PubMed

    Lou, Xianwen; van Dongen, Joost L J; Milroy, Lech-Gustav; Meijer, E W

    2016-12-30

    Ionization in matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS) is a very complicated process. It has been reported that quaternary ammonium salts show extremely strong matrix and analyte suppression effects which cannot satisfactorily be explained by charge transfer reactions. Further investigation of the reasons causing these effects can be useful to improve our understanding of the MALDI process. The dried-droplet and modified thin-layer methods were used as sample preparation methods. In the dried-droplet method, analytes were co-crystallized with matrix, whereas in the modified thin-layer method analytes were deposited on the surface of matrix crystals. Model compounds, tetrabutylammonium iodide ([N(Bu) 4 ]I), cesium iodide (CsI), trihexylamine (THA) and polyethylene glycol 600 (PEG 600), were selected as the test analytes given their ability to generate exclusively pre-formed ions, protonated ions and metal ion adducts respectively in MALDI. The strong matrix suppression effect (MSE) observed using the dried-droplet method might disappear using the modified thin-layer method, which suggests that the incorporation of analytes in matrix crystals contributes to the MSE. By depositing analytes on the matrix surface instead of incorporating in the matrix crystals, the competition for evaporation/ionization from charged matrix/analyte clusters could be weakened resulting in reduced MSE. Further supporting evidence for this inference was found by studying the analyte suppression effect using the same two sample deposition methods. By comparing differences between the mass spectra obtained via the two sample preparation methods, we present evidence suggesting that the generation of gas-phase ions from charged matrix/analyte clusters may induce significant suppression of matrix and analyte ions. The results suggest that the generation of gas-phase ions from charged matrix/analyte clusters is an important ionization step in MALDI-MS. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Capillary atmospheric pressure electron capture ionization (cAPECI): a highly efficient ionization method for nitroaromatic compounds.

    PubMed

    Derpmann, Valerie; Mueller, David; Bejan, Iustinian; Sonderfeld, Hannah; Wilberscheid, Sonja; Koppmann, Ralf; Brockmann, Klaus J; Benter, Thorsten

    2014-03-01

    We report on a novel method for atmospheric pressure ionization of compounds with elevated electron affinity (e.g., nitroaromatic compounds) or gas phase acidity (e.g., phenols), respectively. The method is based on the generation of thermal electrons by the photo-electric effect, followed by electron capture of oxygen when air is the gas matrix yielding O2(-) or of the analyte directly with nitrogen as matrix. Charge transfer or proton abstraction by O2(-) leads to the ionization of the analytes. The interaction of UV-light with metals is a clean method for the generation of thermal electrons at atmospheric pressure. Furthermore, only negative ions are generated and neutral radical formation is minimized, in contrast to discharge- or dopant assisted methods. Ionization takes place inside the transfer capillary of the mass spectrometer leading to comparably short transfer times of ions to the high vacuum region of the mass spectrometer. This strongly reduces ion transformation processes, resulting in mass spectra that more closely relate to the neutral analyte distribution. cAPECI is thus a soft and selective ionization method with detection limits in the pptV range. In comparison to standard ionization methods (e.g., PTR), cAPECI is superior with respect to both selectivity and achievable detection limits. cAPECI demonstrates to be a promising ionization method for applications in relevant fields as, for example, explosives detection and atmospheric chemistry.

  19. Evaluation of light extraction efficiency for the light-emitting diodes based on the transfer matrix formalism and ray-tracing method

    NASA Astrophysics Data System (ADS)

    Pingbo, An; Li, Wang; Hongxi, Lu; Zhiguo, Yu; Lei, Liu; Xin, Xi; Lixia, Zhao; Junxi, Wang; Jinmin, Li

    2016-06-01

    The internal quantum efficiency (IQE) of the light-emitting diodes can be calculated by the ratio of the external quantum efficiency (EQE) and the light extraction efficiency (LEE). The EQE can be measured experimentally, but the LEE is difficult to calculate due to the complicated LED structures. In this work, a model was established to calculate the LEE by combining the transfer matrix formalism and an in-plane ray tracing method. With the calculated LEE, the IQE was determined and made a good agreement with that obtained by the ABC model and temperature-dependent photoluminescence method. The proposed method makes the determination of the IQE more practical and conventional. Project supported by the National Natural Science Foundation of China (Nos.11574306, 61334009), the China International Science and Technology Cooperation Program (No. 2014DFG62280), and the National High Technology Program of China (No. 2015AA03A101).

  20. Homogeneous Liquid Phase Transfer of Graphene Oxide into Epoxy Resins.

    PubMed

    Amirova, Lyaysan; Surnova, Albina; Balkaev, Dinar; Musin, Delus; Amirov, Rustem; Dimiev, Ayrat M

    2017-04-05

    The quality of polymer composite materials depends on the distribution of the filler in the polymer matrix. Due to the presence of the oxygen functional groups, graphene oxide (GO) has a strong affinity to epoxy resins, providing potential opportunity for the uniform distribution of GO sheets in the matrix. Another advantage of GO over its nonoxidized counterpart is its ability to exfoliate to single-atomic-layer sheets in water and in some organic solvents. However, these advantages of GO have not yet been fully realized due to the lack of the methods efficiently introducing GO into the epoxy resin. Here we develop a novel homogeneous liquid phase transfer method that affords uniform distribution, and fully exfoliated condition of GO in the polymer matrix. The most pronounced alteration of properties of the cured composites is registered at the 0.10%-0.15% GO content. Addition of as little as 0.10% GO leads to the increase of the Young's modulus by 48%. Moreover, we demonstrate successful introduction of GO into the epoxy matrix containing an active diluent-modifier; this opens new venues for fabrication of improved GO-epoxy-modifier composites with a broad range of predesigned properties. The experiments done on reproducing the two literature methods, using alternative GO introduction techniques, lead to either decrease or insignificant increase of the Young's modulus of the resulting GO-epoxy composites.

  1. On the Equivalence of the Summation and Transfer-Matrix Methods in Wave Propagation through Multilayers of Lossless and Lossy Media

    ERIC Educational Resources Information Center

    Pereyra, Pedro; Robledo-Martinez, Arturo

    2009-01-01

    We explicitly show that the well-known transmission and reflection amplitudes of planar slabs, obtained via an algebraic summation of Fresnel amplitudes, are completely equivalent to those obtained from transfer matrices in the scattering approach. This equivalence makes the finite periodic systems theory a powerful alternative to the cumbersome…

  2. An Illumination-Adaptive Colorimetric Measurement Using Color Image Sensor

    NASA Astrophysics Data System (ADS)

    Lee, Sung-Hak; Lee, Jong-Hyub; Sohng, Kyu-Ik

    An image sensor for a use of colorimeter is characterized based on the CIE standard colorimetric observer. We use the method of least squares to derive a colorimetric characterization matrix between RGB output signals and CIE XYZ tristimulus values. This paper proposes an adaptive measuring method to obtain the chromaticity of colored scenes and illumination through a 3×3 camera transfer matrix under a certain illuminant. Camera RGB outputs, sensor status values, and photoelectric characteristic are used to obtain the chromaticity. Experimental results show that the proposed method is valid in the measuring performance.

  3. Multilayer solar cell waveguide structures containing metamaterials

    NASA Astrophysics Data System (ADS)

    Hamouche, Houria.; Shabat, Mohammed. M.; Schaadt, Daniel M.

    2017-01-01

    Multilayer antireflection coating structures made from silicon and metamaterials are designed and investigated using the Transfer Matrix Method (TMM). The Transfer Matrix Method is a very useful algorithm for the analysis of periodic structures. We investigate in this paper two anti-reflection coating structures for silicon solar cells with a metamaterial film layer. In the first structure, the metamaterial film layer is sandwiched between a semi-infinite glass cover layer and a semi-infinite silicon substrate layer. The second structure consists of a four layers, a pair of metamaterial-dielectric layer with opposite real part of refractive indices, is placed between the two semi-infinite cover and substrate. We have simulated the absorptivity property of the structures for adjustable thicknesses by using MAPLE software. The absorptivity of the structures achieves greater than 80% for incident electromagnetic wave of transverse magnetic (TM) polarization.

  4. Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

    NASA Astrophysics Data System (ADS)

    Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

    2007-12-01

    This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

  5. Heat and Mass Transfer in an L Shaped Porous Medium

    NASA Astrophysics Data System (ADS)

    Salman Ahmed, N. J.; Azeem; Yunus Khan, T. M.

    2017-08-01

    This article is an extension to the heat transfer in L-shaped porous medium by including the mass diffusion. The heat and mass transfer in the porous domain is represented by three coupled partial differential equations representing the fluid movement, energy transport and mass transport. The equations are converted into algebraic form of equations by the application of finite element method that can be conveniently solved by matrix method. An iterative approach is adopted to solve the coupled equations by setting suitable convergence criterion. The results are discussed in terms of heat transfer characteristics influenced by physical parameters such as buoyancy ratio, Lewis number, Rayleigh number etc. It is found that these physical parameters have significant effect on heat and mass transfer behavior of L-shaped porous medium.

  6. Chemical analysis of pharmaceuticals and explosives in fingermarks using matrix-assisted laser desorption ionization/time-of-flight mass spectrometry.

    PubMed

    Kaplan-Sandquist, Kimberly; LeBeau, Marc A; Miller, Mark L

    2014-02-01

    Chemical analysis of latent fingermarks, "touch chemistry," has the potential of providing intelligence or forensically relevant information. Matrix-assisted laser desorption ionization/time-of-flight mass spectrometry (MALDI/TOF MS) was used as an analytical platform for obtaining mass spectra and chemical images of target drugs and explosives in fingermark residues following conventional fingerprint development methods and MALDI matrix processing. There were two main purposes of this research: (1) develop effective laboratory methods for detecting drugs and explosives in fingermark residues and (2) determine the feasibility of detecting drugs and explosives after casual contact with pills, powders, and residues. Further, synthetic latent print reference pads were evaluated as mimics of natural fingermark residue to determine if the pads could be used for method development and quality control. The results suggest that artificial amino acid and sebaceous oil residue pads are not suitable to adequately simulate natural fingermark chemistry for MALDI/TOF MS analysis. However, the pads were useful for designing experiments and setting instrumental parameters. Based on the natural fingermark residue experiments, handling whole or broken pills did not transfer sufficient quantities of drugs to allow for definitive detection. Transferring drugs or explosives in the form of powders and residues was successful for preparing analytes for detection after contact with fingers and deposition of fingermark residue. One downfall to handling powders was that the analyte particles were easily spread beyond the original fingermark during development. Analyte particles were confined in the original fingermark when using transfer residues. The MALDI/TOF MS was able to detect procaine, pseudoephedrine, TNT, and RDX from contact residue under laboratory conditions with the integration of conventional fingerprint development methods and MALDI matrix. MALDI/TOF MS is a nondestructive technique which provides chemical information in both the mass spectra and chemical images. Published by Elsevier Ireland Ltd.

  7. Fragment charge difference method for estimating donor-acceptor electronic coupling: Application to DNA π-stacks

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Rösch, Notker

    2002-09-01

    The purpose of this communication is two-fold. We introduce the fragment charge difference (FCD) method to estimate the electron transfer matrix element HDA between a donor D and an acceptor A, and we apply this method to several aspects of hole transfer electronic couplings in π-stacks of DNA, including systems with several donor-acceptor sites. Within the two-state model, our scheme can be simplified to recover a convenient estimate of the electron transfer matrix element HDA=(1-Δq2)1/2(E2-E1)/2 based on the vertical excitation energy E2-E1 and the charge difference Δq between donor and acceptor. For systems with strong charge separation, Δq≳0.95, one should resort to the FCD method. As favorable feature, we demonstrate the stability of the FCD approach for systems which require an approach beyond the two-state model. On the basis of ab initio calculations of various DNA related systems, we compared three approaches for estimating the electronic coupling: the minimum splitting method, the generalized Mulliken-Hush (GMH) scheme, and the FCD approach. We studied the sensitivity of FCD and GMH couplings to the donor-acceptor energy gap and found both schemes to be quite robust; they are applicable also in cases where donor and acceptor states are off resonance. In the application to π-stacks of DNA, we demonstrated for the Watson-Crick pair dimer [(GC),(GC)] how structural changes considerably affect the coupling strength of electron hole transfer. For models of three Watson-Crick pairs, we showed that the two-state model significantly overestimates the hole transfer coupling whereas simultaneous treatment of several states leads to satisfactory results.

  8. Matrix resin effects in composite delamination - Mode I fracture aspects

    NASA Technical Reports Server (NTRS)

    Hunston, Donald L.; Moulton, Richard J.; Johnston, Norman J.; Bascom, Willard D.

    1987-01-01

    A number of thermoset, toughened thermoset, and thermoplastic resin matrix systems were characterized for Mode I critical strain energy release rates, and their composites were tested for interlaminar critical strain energy release rates using the double cantilever beam method. A clear correlation is found between the two sets of data. With brittle resins, the interlaminar critical strain energy release rates are somewhat larger than the neat resin values due to a full transfer of the neat resin toughness to the composite and toughening mechanisms associated with crack growth. With tougher matrices, the higher critical strain energy release rates are only partially transferred to the composites, presumably because the fibers restrict the crack-tip deformation zones.

  9. Charge-transfer contributions to the excitonic coupling matrix element in BODIPY-based energy transfer cassettes

    NASA Astrophysics Data System (ADS)

    Spiegel, J. Dominik; Lyskov, Igor; Kleinschmidt, Martin; Marian, Christel M.

    2017-01-01

    BODIPY-based dyads serve as model systems for the investigation of excitation energy transfer (EET). Through-space EET is brought about by direct and exchange interactions between the transition densities of donor and acceptor localized states. The presence of a molecular linker gives rise to additional charge transfer (CT) contributions. Here, we present a novel approach for the calculation of the excitonic coupling matrix element (ECME) including CT contributions which is based on supermolecular one-electron transition density matrices (STD). The validity of the approach is assessed for a model system of two π -stacked ethylene molecules at varying intermolecular separation. Wave functions and electronic excitation energies of five EET cassettes comprising anthracene as exciton donor and BODIPY as exciton acceptor are obtained by the redesigned combined density functional theory and multireference configuration interaction (DFT/MRCI-R) method. CT contributions to the ECME are shown to be important in the covalently linked EET cassettes.

  10. Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

    PubMed Central

    Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

    2015-01-01

    Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s−1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications. PMID:25996307

  11. Sandwiched confinement of quantum dots in graphene matrix for efficient electron transfer and photocurrent production

    NASA Astrophysics Data System (ADS)

    Zhu, Nan; Zheng, Kaibo; Karki, Khadga J.; Abdellah, Mohamed; Zhu, Qiushi; Carlson, Stefan; Haase, Dörthe; Žídek, Karel; Ulstrup, Jens; Canton, Sophie E.; Pullerits, Tõnu; Chi, Qijin

    2015-05-01

    Quantum dots (QDs) and graphene are both promising materials for the development of new-generation optoelectronic devices. Towards this end, synergic assembly of these two building blocks is a key step but remains a challenge. Here, we show a one-step strategy for organizing QDs in a graphene matrix via interfacial self-assembly, leading to the formation of sandwiched hybrid QD-graphene nanofilms. We have explored structural features, electron transfer kinetics and photocurrent generation capacity of such hybrid nanofilms using a wide variety of advanced techniques. Graphene nanosheets interlink QDs and significantly improve electronic coupling, resulting in fast electron transfer from photoexcited QDs to graphene with a rate constant of 1.3 × 109 s-1. Efficient electron transfer dramatically enhances photocurrent generation in a liquid-junction QD-sensitized solar cell where the hybrid nanofilm acts as a photoanode. We thereby demonstrate a cost-effective method to construct large-area QD-graphene hybrid nanofilms with straightforward scale-up potential for optoelectronic applications.

  12. Fem Formulation of Heat Transfer in Cylindrical Porous Medium

    NASA Astrophysics Data System (ADS)

    Azeem; Khaleed, H. M. T.; Soudagar, Manzoor Elahi M.

    2017-08-01

    Heat transfer in porous medium can be derived from the fundamental laws of flow in porous region ass given by Henry Darcy. The fluid flow and energy transport inside the porous medium can be described with the help of momentum and energy equations. The heat transfer in cylindrical porous medium differs from its counterpart in radial and axial coordinates. The present work is focused to discuss the finite element formulation of heat transfer in cylindrical porous medium. The basic partial differential equations are derived using Darcy law which is the converted into a set of algebraic equations with the help of finite element method. The resulting equations are solved by matrix method for two solution variables involved in the coupled equations.

  13. Knowledge-transfer learning for prediction of matrix metalloprotease substrate-cleavage sites.

    PubMed

    Wang, Yanan; Song, Jiangning; Marquez-Lago, Tatiana T; Leier, André; Li, Chen; Lithgow, Trevor; Webb, Geoffrey I; Shen, Hong-Bin

    2017-07-18

    Matrix Metalloproteases (MMPs) are an important family of proteases that play crucial roles in key cellular and disease processes. Therefore, MMPs constitute important targets for drug design, development and delivery. Advanced proteomic technologies have identified type-specific target substrates; however, the complete repertoire of MMP substrates remains uncharacterized. Indeed, computational prediction of substrate-cleavage sites associated with MMPs is a challenging problem. This holds especially true when considering MMPs with few experimentally verified cleavage sites, such as for MMP-2, -3, -7, and -8. To fill this gap, we propose a new knowledge-transfer computational framework which effectively utilizes the hidden shared knowledge from some MMP types to enhance predictions of other, distinct target substrate-cleavage sites. Our computational framework uses support vector machines combined with transfer machine learning and feature selection. To demonstrate the value of the model, we extracted a variety of substrate sequence-derived features and compared the performance of our method using both 5-fold cross-validation and independent tests. The results show that our transfer-learning-based method provides a robust performance, which is at least comparable to traditional feature-selection methods for prediction of MMP-2, -3, -7, -8, -9 and -12 substrate-cleavage sites on independent tests. The results also demonstrate that our proposed computational framework provides a useful alternative for the characterization of sequence-level determinants of MMP-substrate specificity.

  14. A direct approach to the design of linear multivariable systems

    NASA Technical Reports Server (NTRS)

    Agrawal, B. L.

    1974-01-01

    Design of multivariable systems is considered and design procedures are formulated in the light of the most recent work on model matching. The word model matching is used exclusively to mean matching the input-output behavior of two systems. The term is used in the frequency domain to indicate the comparison of two transfer matrices containing transfer functions as elements. Design methods where non-interaction is not used as a criteria were studied. Two design methods are considered. The first method of design is based solely upon the specification of generalized error coefficients for each individual transfer function of the overall system transfer matrix. The second design method is called the pole fixing method because all the system poles are fixed at preassigned positions. The zeros of terms either above or below the diagonal are partially fixed via steady state error coefficients. The advantages and disadvantages of each method are discussed and an example is worked to demonstrate their uses. The special cases of triangular decoupling and minimum constraints are discussed.

  15. A subsystem identification method based on the path concept with coupling strength estimation

    NASA Astrophysics Data System (ADS)

    Magrans, Francesc Xavier; Poblet-Puig, Jordi; Rodríguez-Ferran, Antonio

    2018-02-01

    For complex geometries, the definition of the subsystems is not a straightforward task. We present here a subsystem identification method based on the direct transfer matrix, which represents the first-order paths. The key ingredient is a cluster analysis of the rows of the powers of the transfer matrix. These powers represent high-order paths in the system and are more affected than low-order paths by damping. Once subsystems are identified, the proposed approach also provides a quantification of the degree of coupling between subsystems. This information is relevant to decide whether a subsystem may be analysed in a computer model or measured in the laboratory independently of the rest or subsystems or not. The two features (subsystem identification and quantification of the degree of coupling) are illustrated by means of numerical examples: plates coupled by means of springs and rooms connected by means of a cavity.

  16. Matrix operator theory of radiative transfer. I - Rayleigh scattering.

    NASA Technical Reports Server (NTRS)

    Plass, G. N.; Kattawar, G. W.; Catchings, F. E.

    1973-01-01

    An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; and (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions.

  17. Electrical transport engineering of semiconductor superlattice structures

    NASA Astrophysics Data System (ADS)

    Shokri, Aliasghar

    2014-04-01

    We investigate the influence of doping concentration on band structures of electrons and electrical transmission in a typical aperiodic semiconductor superlattice consisting of quantum well and barrier layers, theoretically. For this purpose, we assume that each unit cell of the superlattice contains alternately two types of material GaAs (as a well) and GaAlAs (as a barrier) with six sublayers of two materials. Our calculations are based on the generalized Kronig-Penny (KP) model and the transfer matrix method within the framework of the parabolic conductance band effective mass approximation in the coherent regime. This model reduces the numerical calculation time and enables us to use the transfer matrix method to investigate transport in the superlattices. We show that by varying the doping concentration and geometrical parameters, one can easily block the transmission of the electrons. The numerical results may be useful in designing of nanoenergy filter devices.

  18. Methods to estimate the transfer of contaminants into recycling products - A case study from Austria.

    PubMed

    Knapp, Julika; Allesch, Astrid; Müller, Wolfgang; Bockreis, Anke

    2017-11-01

    Recycling of waste materials is desirable to reduce the consumption of limited primary resources, but also includes the risk of recycling unwanted, hazardous substances. In Austria, the legal framework demands secondary products must not present a higher risk than comparable products derived from primary resources. However, the act provides no definition on how to assess this risk potential. This paper describes the development of different quantitative and qualitative methods to estimate the transfer of contaminants in recycling processes. The quantitative methods comprise the comparison of concentrations of harmful substances in recycling products to corresponding primary products and to existing limit values. The developed evaluation matrix, which considers further aspects, allows for the assessment of the qualitative risk potential. The results show that, depending on the assessed waste fraction, particular contaminants can be critical. Their concentrations were higher than in comparable primary materials and did not comply with existing limit values. On the other hand, the results show that a long-term, well-established quality control system can assure compliance with the limit values. The results of the qualitative assessment obtained with the evaluation matrix support the results of the quantitative assessment. Therefore, the evaluation matrix can be suitable to quickly screen waste streams used for recycling to estimate their potential environmental and health risks. To prevent the transfer of contaminants into product cycles, improved data of relevant substances in secondary resources are necessary. In addition, regulations for material recycling are required to assure adequate quality control measures, including limit values. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Unveiling the Semicoherent Interface with Definite Orientation Relationships between Reinforcements and Matrix in Novel Al3BC/Al Composites.

    PubMed

    Zhao, Yongfeng; Qian, Zhao; Ma, Xia; Chen, Houwen; Gao, Tong; Wu, Yuying; Liu, Xiangfa

    2016-10-05

    High-strength lightweight Al-based composites are promising materials for a wide range of applications. To provide high performance, a strong bonding interface for effective load transfer from the matrix to the reinforcement is essential. In this work, the novel Al 3 BC reinforced Al composites have been in situ fabricated through a liquid-solid reaction method and the bonding interface between Al 3 BC and Al matrix has been unveiled. The HRTEM characterizations on the Al 3 BC/Al interface verify it to be a semicoherent bonding structure with definite orientation relationships: (0001) Al 3 BC //(11̅1) Al ;[112̅0] Al 3 BC //[011] Al . Periodic arrays of geometrical misfit dislocations are also observed along the interface at each (0001) Al 3 BC plane or every five (11̅1) Al planes. This kind of interface between the reinforcement and the matrix is strong enough for effective load transfer, which would lead to the evidently improved strength and stiffness of the introduced new Al 3 BC/Al composites.

  20. SU-E-T-395: Multi-GPU-Based VMAT Treatment Plan Optimization Using a Column-Generation Approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Z; Shi, F; Jia, X

    Purpose: GPU has been employed to speed up VMAT optimizations from hours to minutes. However, its limited memory capacity makes it difficult to handle cases with a huge dose-deposition-coefficient (DDC) matrix, e.g. those with a large target size, multiple arcs, small beam angle intervals and/or small beamlet size. We propose multi-GPU-based VMAT optimization to solve this memory issue to make GPU-based VMAT more practical for clinical use. Methods: Our column-generation-based method generates apertures sequentially by iteratively searching for an optimal feasible aperture (referred as pricing problem, PP) and optimizing aperture intensities (referred as master problem, MP). The PP requires accessmore » to the large DDC matrix, which is implemented on a multi-GPU system. Each GPU stores a DDC sub-matrix corresponding to one fraction of beam angles and is only responsible for calculation related to those angles. Broadcast and parallel reduction schemes are adopted for inter-GPU data transfer. MP is a relatively small-scale problem and is implemented on one GPU. One headand- neck cancer case was used for test. Three different strategies for VMAT optimization on single GPU were also implemented for comparison: (S1) truncating DDC matrix to ignore its small value entries for optimization; (S2) transferring DDC matrix part by part to GPU during optimizations whenever needed; (S3) moving DDC matrix related calculation onto CPU. Results: Our multi-GPU-based implementation reaches a good plan within 1 minute. Although S1 was 10 seconds faster than our method, the obtained plan quality is worse. Both S2 and S3 handle the full DDC matrix and hence yield the same plan as in our method. However, the computation time is longer, namely 4 minutes and 30 minutes, respectively. Conclusion: Our multi-GPU-based VMAT optimization can effectively solve the limited memory issue with good plan quality and high efficiency, making GPUbased ultra-fast VMAT planning practical for real clinical use.« less

  1. A multi-layer discrete-ordinate method for vector radiative transfer in a vertically-inhomogeneous, emitting and scattering atmosphere. I - Theory. II - Application

    NASA Technical Reports Server (NTRS)

    Weng, Fuzhong

    1992-01-01

    A theory is developed for discretizing the vector integro-differential radiative transfer equation including both solar and thermal radiation. A complete solution and boundary equations are obtained using the discrete-ordinate method. An efficient numerical procedure is presented for calculating the phase matrix and achieving computational stability. With natural light used as a beam source, the Stokes parameters from the model proposed here are compared with the analytical solutions of Chandrasekhar (1960) for a Rayleigh scattering atmosphere. The model is then applied to microwave frequencies with a thermal source, and the brightness temperatures are compared with those from Stamnes'(1988) radiative transfer model.

  2. Singlet oxygen Triplet Energy Transfer based imaging technology for mapping protein-protein proximity in intact cells

    PubMed Central

    To, Tsz-Leung; Fadul, Michael J.; Shu, Xiaokun

    2014-01-01

    Many cellular processes are carried out by large protein complexes that can span several tens of nanometers. Whereas Forster resonance energy transfer has a detection range of <10 nm, here we report the theoretical development and experimental demonstration of a new fluorescence imaging technology with a detection range of up to several tens of nanometers: singlet oxygen triplet energy transfer. We demonstrate that our method confirms the topology of a large protein complex in intact cells, which spans from the endoplasmic reticulum to the outer mitochondrial membrane and the matrix. This new method is thus suited for mapping protein proximity in large protein complexes. PMID:24905026

  3. Multispectral selective near-perfect light absorption by graphene monolayer using aperiodic multilayer microstructures

    NASA Astrophysics Data System (ADS)

    Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.

    2018-03-01

    We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.

  4. Algebraic multigrid methods applied to problems in computational structural mechanics

    NASA Technical Reports Server (NTRS)

    Mccormick, Steve; Ruge, John

    1989-01-01

    The development of algebraic multigrid (AMG) methods and their application to certain problems in structural mechanics are described with emphasis on two- and three-dimensional linear elasticity equations and the 'jacket problems' (three-dimensional beam structures). Various possible extensions of AMG are also described. The basic idea of AMG is to develop the discretization sequence based on the target matrix and not the differential equation. Therefore, the matrix is analyzed for certain dependencies that permit the proper construction of coarser matrices and attendant transfer operators. In this manner, AMG appears to be adaptable to structural analysis applications.

  5. Improved heat switch for gas sorption compressor

    NASA Technical Reports Server (NTRS)

    Chan, C. K.

    1985-01-01

    Thermal conductivities of the charcoal bed and the copper matrix for the gas adsorption compressor were measured by the concentric-cylinder method. The presence of the copper matrix in the charcoal bed enhanced the bed conductance by at least an order of magnitude. Thermal capacities of the adsorbent cell and the heat leaks to two compressor designs were measured by the transient method. The new gas adsorption compressor had a heat switch that could transfer eight times more heat than the previous one. The cycle time for the new prototype compressor is also improved by a factor of eight to within the minute range.

  6. Numerical investigations on the effect of slenderness ratio of matrix elements in cryogenic chill down process

    NASA Astrophysics Data System (ADS)

    Reby Roy, K. E.; Mohammed, Jesna; Abhiroop, V. M.; Thekkethil, S. R.

    2017-02-01

    Cryogenic fluids have many applications in space, medicine, preservation etc. The chill-down of cryogenic fluid transfer line is a complicated phenomenon occurring in most of the cryogenic systems. The cryogenic fluid transfer line, which is initially at room temperature, has to be cooled to the temperature of the cryogen as fast as possible. When the cryogenic fluid at liquid state passes along the line, transient heat transfer between the cryogen and the transfer line causes voracious evaporation of the liquid. This paper makes a contribution to the two-phase flow along a rectangular flow passage consisting of an array of elliptically shaped matrix elements. A simplified 2D model is considered and the problem is solved using ANSYS FLUENT. The present analysis aims to study the influence of the slenderness ratio of matrix elements on the heat transfer rate and chill down time. For a comparative study, matrix elements of slenderness ratios 5 and 10 are considered. Liquid nitrogen at 74K flows through the matrix. The material of the transfer line is assumed to be aluminium which is initially at room temperature. The influence of Reynolds numbers from 800 to 3000 on chill-down is also investigated.

  7. A hybrid finite element-transfer matrix model for vibroacoustic systems with flat and homogeneous acoustic treatments.

    PubMed

    Alimonti, Luca; Atalla, Noureddine; Berry, Alain; Sgard, Franck

    2015-02-01

    Practical vibroacoustic systems involve passive acoustic treatments consisting of highly dissipative media such as poroelastic materials. The numerical modeling of such systems at low to mid frequencies typically relies on substructuring methodologies based on finite element models. Namely, the master subsystems (i.e., structural and acoustic domains) are described by a finite set of uncoupled modes, whereas condensation procedures are typically preferred for the acoustic treatments. However, although accurate, such methodology is computationally expensive when real life applications are considered. A potential reduction of the computational burden could be obtained by approximating the effect of the acoustic treatment on the master subsystems without introducing physical degrees of freedom. To do that, the treatment has to be assumed homogeneous, flat, and of infinite lateral extent. Under these hypotheses, simple analytical tools like the transfer matrix method can be employed. In this paper, a hybrid finite element-transfer matrix methodology is proposed. The impact of the limiting assumptions inherent within the analytical framework are assessed for the case of plate-cavity systems involving flat and homogeneous acoustic treatments. The results prove that the hybrid model can capture the qualitative behavior of the vibroacoustic system while reducing the computational effort.

  8. Ultrarapid electrophoretic transfer of high and low molecular weight proteins using heat.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2009-01-01

    An ultrarapid method for the electrophoretic transfer of high and low molecular weight proteins to nitrocellulose membranes following sodium dodecyl sulfate (SDS) polyacrylamide gel is described here. The transfer was performed with heated (70-75 degrees C) normal transfer buffer from which methanol had been omitted. Complete transfer of high and low molecular weight antigens (molecular weight protein standards, a purified protein, and proteins from a human tissue extract) could be carried out in 10 min for a 7% (0.75 mm) SDS polyacrylamide gel. For 10 and 12.5% gels (0.75 mm) the corresponding time was 15 min. A complete transfer could be carried out in 20 min for 7, 10, and 12.5% gels (1.5 mm gels). The permeability of the gel is increased by heat, such that the proteins trapped in the polyacrylamide gel matrix can be easily transferred to the membrane. The heat mediated transfer method was compared with a conventional transfer protocol, under similar conditions. The conventional method transferred minimal low molecular weight proteins while retaining most of the high molecular weight proteins in the gel. In summary, this procedure is particularly useful for the transfer of high molecular weight proteins, very rapid, and avoids the use of methanol.

  9. Matrix operator theory of radiative transfer. 1: rayleigh scattering.

    PubMed

    Plass, G N; Kattawar, G W; Catchings, F E

    1973-02-01

    An entirely rigorous method for the solution of the equations for radiative transfer based on the matrix operator theory is reviewed. The advantages of the present method are: (1) all orders of the reflection and transmission matrices are calculated at once; (2) layers of any thickness may be combined, so that a realistic model of the atmosphere can be developed from any arbitrary number of layers, each with different properties and thicknesses; (3) calculations can readily be made for large optical depths and with highly anisotropic phase functions; (4) results are obtained for any desired value of the surface albedo including the value unity and for a large number of polar and azimuthal angles including the polar angle theta = 0 degrees ; (5) all fundamental equations can be interpreted immediately in terms of the physical interactions appropriate to the problem; (6) both upward and downward radiance can be calculated at interior points from relatively simple expressions. Both the general theory and its history together with the method of calculation are discussed. As a first example of the method numerous curves are given for both the reflected and transmitted radiance for Rayleigh scattering from a homogeneous layer for a range of optical thicknesses from 0.0019 to 4096, surface albedo A = 0, 0.2, and 1, and cosine of solar zenith angle micro = 1, 0.5397, and 0.1882. It is shown that the matrix operator approach contains the doubling method as a special case.

  10. Simultaneous determination of aflatoxin B₁, B₂, G₁, and G₂ in corn powder, edible oil, peanut butter, and soy sauce by liquid chromatography with tandem mass spectrometry utilizing turbulent flow chromatography.

    PubMed

    Fan, Sufang; Li, Qiang; Zhang, Xiaoguang; Cui, Xiaobin; Zhang, Dongsheng; Zhang, Yan

    2015-05-01

    A novel fully automated method based on dual column switching using turbulent flow chromatography followed by liquid chromatography with tandem mass spectrometry was developed for the determination of aflatoxin B1 , B2 , G1 , and G2 in corn powder, edible oil, peanut butter, and soy sauce samples. After ultrasound-assisted extraction, samples were directly injected to the chromatographic system and the analytes were concentrated into the clean-up loading column. Through purge switching, the analytes were transferred to the analytical column for subsequent detection by mass spectrometry. Different types of TurboFlow(TM) columns, transfer flow rate, transfer time were optimized. The limits of detection and quantification of this method ranged between 0.2-2.0 and 0.5-4.0 μg/kg for aflatoxins in different matrixes, respectively. Recoveries of aflatoxins were in range of 83-108.1% for all samples, matrix effects were in range of 34.1-104.7%. The developed method has been successfully applied in the analysis of aflatoxin B1 , B2 , G1 , and G2 in real samples. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Parameter retrieval of chiral metamaterials based on the state-space approach.

    PubMed

    Zarifi, Davoud; Soleimani, Mohammad; Abdolali, Ali

    2013-08-01

    This paper deals with the introduction of an approach for the electromagnetic characterization of homogeneous chiral layers. The proposed method is based on the state-space approach and properties of a 4×4 state transition matrix. Based on this, first, the forward problem analysis through the state-space method is reviewed and properties of the state transition matrix of a chiral layer are presented and proved as two theorems. The formulation of a proposed electromagnetic characterization method is then presented. In this method, scattering data for a linearly polarized plane wave incident normally on a homogeneous chiral slab are combined with properties of a state transition matrix and provide a powerful characterization method. The main difference with respect to other well-established retrieval procedures based on the use of the scattering parameters relies on the direct computation of the transfer matrix of the slab as opposed to the conventional calculation of the propagation constant and impedance of the modes supported by the medium. The proposed approach allows avoiding nonlinearity of the problem but requires getting enough equations to fulfill the task which was provided by considering some properties of the state transition matrix. To demonstrate the applicability and validity of the method, the constitutive parameters of two well-known dispersive chiral metamaterial structures at microwave frequencies are retrieved. The results show that the proposed method is robust and reliable.

  12. The solution of radiative transfer problems in molecular bands without the LTE assumption by accelerated lambda iteration methods

    NASA Technical Reports Server (NTRS)

    Kutepov, A. A.; Kunze, D.; Hummer, D. G.; Rybicki, G. B.

    1991-01-01

    An iterative method based on the use of approximate transfer operators, which was designed initially to solve multilevel NLTE line formation problems in stellar atmospheres, is adapted and applied to the solution of the NLTE molecular band radiative transfer in planetary atmospheres. The matrices to be constructed and inverted are much smaller than those used in the traditional Curtis matrix technique, which makes possible the treatment of more realistic problems using relatively small computers. This technique converges much more rapidly than straightforward iteration between the transfer equation and the equations of statistical equilibrium. A test application of this new technique to the solution of NLTE radiative transfer problems for optically thick and thin bands (the 4.3 micron CO2 band in the Venusian atmosphere and the 4.7 and 2.3 micron CO bands in the earth's atmosphere) is described.

  13. Matrix heat exchanger including a liquid, thermal couplant

    DOEpatents

    Fewell, Thomas E.; Ward, Charles T.

    1976-01-01

    A tube-to-tube heat exchanger is disclosed with a thermally conductive matrix between and around the tubes to define annuli between the tubes and matrix. The annuli are filled to a level with a molten metal or alloy to provide a conductive heat transfer path from one tube through the matrix to the second tube. A matrix heat exchanger of this type is particularly useful for heat transfer between fluids which would react should one leak into the second.

  14. Dependent scattering and absorption by densely packed discrete spherical particles: Effects of complex refractive index

    NASA Astrophysics Data System (ADS)

    Ma, L. X.; Tan, J. Y.; Zhao, J. M.; Wang, F. Q.; Wang, C. A.; Wang, Y. Y.

    2017-07-01

    Due to the dependent scattering and absorption effects, the radiative transfer equation (RTE) may not be suitable for dealing with radiative transfer in dense discrete random media. This paper continues previous research on multiple and dependent scattering in densely packed discrete particle systems, and puts emphasis on the effects of particle complex refractive index. The Mueller matrix elements of the scattering system with different complex refractive indexes are obtained by both electromagnetic method and radiative transfer method. The Maxwell equations are directly solved based on the superposition T-matrix method, while the RTE is solved by the Monte Carlo method combined with the hard sphere model in the Percus-Yevick approximation (HSPYA) to consider the dependent scattering effects. The results show that for densely packed discrete random media composed of medium size parameter particles (equals 6.964 in this study), the demarcation line between independent and dependent scattering has remarkable connections with the particle complex refractive index. With the particle volume fraction increase to a certain value, densely packed discrete particles with higher refractive index contrasts between the particles and host medium and higher particle absorption indexes are more likely to show stronger dependent characteristics. Due to the failure of the extended Rayleigh-Debye scattering condition, the HSPYA has weak effect on the dependent scattering correction at large phase shift parameters.

  15. Resonant electronic excitation energy transfer by exchange mechanism in the quantum dot system

    NASA Astrophysics Data System (ADS)

    Chikalova-Luzina, O. P.; Samosvat, D. M.; Vyatkin, V. M.; Zegrya, G. G.

    2017-11-01

    A microscopic theory of nonradiative resonance energy transfer between spherical A3B5 semiconductor quantum dots by the exchange mechanism is suggested. The interdot Coulomb interaction is taken into consideration. It is assumed that the quantum dot-donor and the quantum dot-acceptor are made from the same A3B5 compound and are embedded in the matrix of another material that produces potential barriers for electrons and holes. The dependences of the energy transfer rate on the quantum-dot system parameters are found in the frame of the Kane model that provides the most adequate description of the real spectra of A3B5 semiconductors. The analytical treatment is carried out with using the density matrix method, which enabled us to perform an energy transfer analysis both in the weak-interaction approximation and in the strong-interaction approximation. The numerical calculations showed the saturation of the energy transfer rate at the distances between the donor and the acceptor approaching the contact one. The contributions of the exchange and direct Coulomb intractions can be of the same order at the small distances and can have the same value in the saturation range.

  16. Development of a poly(dimethylacrylamide) based matrix material for solid phase high density peptide array synthesis employing a laser based material transfer

    NASA Astrophysics Data System (ADS)

    Ridder, Barbara; Foertsch, Tobias C.; Welle, Alexander; Mattes, Daniela S.; von Bojnicic-Kninski, Clemens M.; Loeffler, Felix F.; Nesterov-Mueller, Alexander; Meier, Michael A. R.; Breitling, Frank

    2016-12-01

    Poly(dimethylacrylamide) (PDMA) based matrix materials were developed for laser-based in situ solid phase peptide synthesis to produce high density arrays. In this specific array synthesis approach, amino acid derivatives are embedded into a matrix material, serving as a ;solid; solvent material at room temperature. Then, a laser pulse transfers this mixture to the target position on a synthesis slide, where the peptide array is synthesized. Upon heating above the glass transition temperature of the matrix material, it softens, allowing diffusion of the amino acid derivatives to the synthesis surface and serving as a solvent for peptide bond formation. Here, we synthesized PDMA six-arm star polymers, offering the desired matrix material properties, using atom transfer radical polymerization. With the synthesized polymers as matrix material, we structured and synthesized arrays with combinatorial laser transfer. With densities of up to 20,000 peptide spots per cm2, the resolution could be increased compared to the commercially available standard matrix material. Time-of-Flight Secondary Ion Mass Spectrometry experiments revealed the penetration behavior of an amino acid derivative into the prepared acceptor synthesis surface and the effectiveness of the washing protocols.

  17. Heat exchanger containing a component capable of discontinuous movement

    DOEpatents

    Wilson, D.G.

    1993-11-09

    Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices. 11 figures.

  18. Heat exchanger containing a component capable of discontinuous movement

    DOEpatents

    Wilson, David Gordon

    2001-04-17

    Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices.

  19. Heat exchanger containing a component capable of discontinuous movement

    DOEpatents

    Wilson, David G.

    1993-01-01

    Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices.

  20. Heat exchanger containing a component capable of discontinuous movement

    DOEpatents

    Wilson, David Gordon

    2002-01-01

    Regenerative heat exchangers are described for transferring heat between hot and cold fluids. The heat exchangers have seal-leakage rates significantly less than those of conventional regenerative heat exchangers because the matrix is discontinuously moved and is releasably sealed while in a stationary position. Both rotary and modular heat exchangers are described. Also described are methods for transferring heat between a hot and cold fluid using the discontinuous movement of matrices.

  1. Western blotting of high and low molecular weight proteins using heat.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2015-01-01

    A method for the electrophoretic transfer of high and low molecular weight proteins to nitrocellulose membranes following sodium dodecyl sulfate (SDS) polyacrylamide gel is described here. The transfer was performed with heated (70-75 °C) normal transfer buffer from which methanol had been omitted. Complete transfer of high and low molecular weight antigens (molecular weight protein standards, a purified protein, and proteins from a human tissue extract) could be carried out in 10 min for a 7 % (0.75 mm) SDS polyacrylamide gel. For 10 and 12.5 % gels (0.75 mm) the corresponding time was 15 min. A complete transfer could be carried out in 20 min for 7, 10, and 12.5 % gels (1.5 mm gels). The permeability of the gel is increased by heat, such that the proteins trapped in the polyacrylamide gel matrix can be easily transferred to the membrane. The heat mediated transfer method was compared with a conventional transfer protocol, under similar conditions. The conventional method transferred minimal low molecular weight proteins while retaining most of the high molecular weight proteins in the gel. In summary, this procedure is particularly useful for the transfer of high molecular weight proteins, very rapid, and avoids the use of methanol.

  2. METHOD 8261: USING SURROGATES TO MEASURE MATRIX EFFECTS AND CORRECT ANALYTICAL RESULTS

    EPA Science Inventory

    Vacuum distillation uses a specialized apparatus. This apparatus has been developed and patented by
    the EPA. Through the Federal Technology Transfer Act this invention has been made available for commercialization. Available vendors for this instrumentation are being evaluat...

  3. Monitoring hydraulic stimulation using telluric sounding

    NASA Astrophysics Data System (ADS)

    Rees, Nigel; Heinson, Graham; Conway, Dennis

    2018-01-01

    The telluric sounding (TS) method is introduced as a potential tool for monitoring hydraulic fracturing at depth. The advantage of this technique is that it requires only the measurement of electric fields, which are cheap and easy when compared with magnetotelluric measurements. Additionally, the transfer function between electric fields from two locations is essentially the identity matrix for a 1D Earth no matter what the vertical structure. Therefore, changes in the earth resulting from the introduction of conductive bodies underneath one of these sites can be associated with deviations away from the identity matrix, with static shift appearing as a galvanic multiplier at all periods. Singular value decomposition and eigenvalue analysis can reduce the complexity of the resulting telluric distortion matrix to simpler parameters that can be visualised in the form of Mohr circles. This technique would be useful in constraining the lateral extent of resistivity changes. We test the viability of utilising the TS method for monitoring on both a synthetic dataset and for a hydraulic stimulation of an enhanced geothermal system case study conducted in Paralana, South Australia. The synthetic data example shows small but consistent changes in the transfer functions associated with hydraulic stimulation, with grids of Mohr circles introduced as a useful diagnostic tool for visualising the extent of fluid movement. The Paralana electric field data were relatively noisy and affected by the dead band making the analysis of transfer functions difficult. However, changes in the order of 5% were observed from 5 s to longer periods. We conclude that deep monitoring using the TS method is marginal at depths in the order of 4 km and that in order to have meaningful interpretations, electric field data need to be of a high quality with low levels of site noise.[Figure not available: see fulltext.

  4. On the transfer matrix of the supersymmetric eight-vertex model. I. Periodic boundary conditions

    NASA Astrophysics Data System (ADS)

    Hagendorf, Christian; Liénardy, Jean

    2018-03-01

    The square-lattice eight-vertex model with vertex weights a, b, c, d obeying the relation (a^2+ab)(b^2+ab) = (c^2+ab)(d^2+ab) and periodic boundary conditions is considered. It is shown that the transfer matrix of the model for L  =  2n  +  1 vertical lines and periodic boundary conditions along the horizontal direction possesses the doubly degenerate eigenvalue \\Thetan = (a+b){\\hspace{0pt}}2n+1 . This proves a conjecture by Stroganov from 2001. The proof uses the supersymmetry of a related XYZ spin-chain Hamiltonian. The eigenstates of the transfer matrix corresponding to \\Thetan are shown to be the ground states of the spin-chain Hamiltonian. Moreover, for positive vertex weights \\Thetan is the largest eigenvalue of the transfer matrix.

  5. Experiences on p-Version Time-Discontinuous Galerkin's Method for Nonlinear Heat Transfer Analysis and Sensitivity Analysis

    NASA Technical Reports Server (NTRS)

    Hou, Gene

    2004-01-01

    The focus of this research is on the development of analysis and sensitivity analysis equations for nonlinear, transient heat transfer problems modeled by p-version, time discontinuous finite element approximation. The resulting matrix equation of the state equation is simply in the form ofA(x)x = c, representing a single step, time marching scheme. The Newton-Raphson's method is used to solve the nonlinear equation. Examples are first provided to demonstrate the accuracy characteristics of the resultant finite element approximation. A direct differentiation approach is then used to compute the thermal sensitivities of a nonlinear heat transfer problem. The report shows that only minimal coding effort is required to enhance the analysis code with the sensitivity analysis capability.

  6. Quantum propagation and confinement in 1D systems using the transfer-matrix method

    NASA Astrophysics Data System (ADS)

    Pujol, Olivier; Carles, Robert; Pérez, José-Philippe

    2014-05-01

    The aim of this article is to provide some Matlab scripts to the teaching community in quantum physics. The scripts are based on the transfer-matrix formalism and offer a very efficient and versatile tool to solve problems of a physical object (electron, proton, neutron, etc) with one-dimensional (1D) stationary potential energy. Resonant tunnelling through a multiple-barrier or confinement in wells of various shapes is particularly analysed. The results are quantitatively discussed with semiconductor heterostructures, harmonic and anharmonic molecular vibrations, or neutrons in a gravity field. Scripts and other examples (hydrogen-like ions and transmission by a smooth variation of potential energy) are available freely at http://www-loa.univ-lille1.fr/˜pujol in three languages: English, French and Spanish.

  7. Range and stability of structural colors generated by Morpho-inspired color reflectors.

    PubMed

    Chung, Kyungjae; Shin, Jung H

    2013-05-01

    The range and stability of structural colors generated by Morpho-inspired color reflectors are investigated. We find that despite the internal randomness of such structures that gives rise to their Morpho-like angle-independent iridescence, their colors under ambient lighting condition can be predicted by simple transfer-matrix calculations of corresponding planar multilayer structures. By calculating the possible range of colors generated by multilayers of different structures and material combinations using such transfer-matrix methods, we find that low-refractive index multilayers with intrastructure absorption, such as the melanin-containing chitin/air multilayer structure from the Morpho butterflies, can provide not only the most pure structural colors with the largest color gamut, but also the highest stability of color against variations in multilayer structure.

  8. Matrix-free and material-enhanced laser desorption/ionization mass spectrometry for the analysis of low molecular weight compounds.

    PubMed

    Rainer, Matthias; Qureshi, Muhammad Nasimullah; Bonn, Günther Karl

    2011-06-01

    The application of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry (MS) for the analysis of low molecular weight (LMW) compounds, such as pharmacologically active constituents or metabolites, is usually hampered by employing conventional MALDI matrices owing to interferences caused by matrix molecules below 700 Da. As a consequence, interpretation of mass spectra remains challenging, although matrix suppression can be achieved under certain conditions. Unlike the conventional MALDI methods which usually suffer from background signals, matrix-free techniques have become more and more popular for the analysis of LMW compounds. In this review we describe recently introduced materials for laser desorption/ionization (LDI) as alternatives to conventionally applied MALDI matrices. In particular, we want to highlight a new method for LDI which is referred to as matrix-free material-enhanced LDI (MELDI). In matrix-free MELDI it could be clearly shown, that besides chemical functionalities, the material's morphology plays a crucial role regarding energy-transfer capabilities. Therefore, it is of great interest to also investigate parameters such as particle size and porosity to study their impact on the LDI process. Especially nanomaterials such as diamond-like carbon, C(60) fullerenes and nanoparticulate silica beads were found to be excellent energy-absorbing materials in matrix-free MELDI.

  9. On the Feynman-Hellmann theorem in quantum field theory and the calculation of matrix elements

    DOE PAGES

    Bouchard, Chris; Chang, Chia Cheng; Kurth, Thorsten; ...

    2017-07-12

    In this paper, the Feynman-Hellmann theorem can be derived from the long Euclidean-time limit of correlation functions determined with functional derivatives of the partition function. Using this insight, we fully develop an improved method for computing matrix elements of external currents utilizing only two-point correlation functions. Our method applies to matrix elements of any external bilinear current, including nonzero momentum transfer, flavor-changing, and two or more current insertion matrix elements. The ability to identify and control all the systematic uncertainties in the analysis of the correlation functions stems from the unique time dependence of the ground-state matrix elements and the fact that all excited states and contact terms are Euclidean-time dependent. We demonstrate the utility of our method with a calculation of the nucleon axial charge using gradient-flowed domain-wall valence quarks on themore » $$N_f=2+1+1$$ MILC highly improved staggered quark ensemble with lattice spacing and pion mass of approximately 0.15 fm and 310 MeV respectively. We show full control over excited-state systematics with the new method and obtain a value of $$g_A = 1.213(26)$$ with a quark-mass-dependent renormalization coefficient.« less

  10. Combined heat and mass transfer device for improving separation process

    DOEpatents

    Tran, Thanh Nhon

    1999-01-01

    A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area.

  11. Combined heat and mass transfer device for improving separation process

    DOEpatents

    Tran, T.N.

    1999-08-24

    A two-phase small channel heat exchange matrix simultaneously provides for heat transfer and mass transfer between the liquid and vapor phases of a multi-component mixture at a single, predetermined location within a separation column, significantly improving the thermodynamic efficiency of the separation process. The small channel heat exchange matrix is composed of a series of channels having a hydraulic diameter no greater than 5.0 millimeters for conducting a two-phase coolant. In operation, the matrix provides the liquid-vapor contacting surfaces within the separation column, such that heat and mass are transferred simultaneously between the liquid and vapor phases. The two-phase coolant allows for a uniform heat transfer coefficient to be maintained along the length of the channels and across the surface of the matrix. Preferably, a perforated, concave sheet connects each channel to an adjacent channel to facilitate the flow of the liquid and vapor phases within the column and to increase the liquid-vapor contacting surface area. 12 figs.

  12. Peter Waterman and T-Matrix Methods

    NASA Technical Reports Server (NTRS)

    Mishchenko, M. I.; Martin, P.A.

    2013-01-01

    This paper summarizes the scientific legacy of Peter C. Waterman (1928-2012) who introduced concepts and theoretical techniques that have had a major impact on the fields of scattering by particles and particle groups, optical particletcharacterization, radiative transfer, and remote sensing. A biographical sketch is also included.

  13. Rotordynamic Analysis with Shell Elements for the Transfer Matrix Method

    DTIC Science & Technology

    1989-08-01

    consistent kindness and extraordinarily good direction in the completion of this work. I am very pleased to acknowledge my brothers in Christ. Vinai ...modelling used in the transfer ma- trix approach. Rouch et al., (1979), Nelson (1980), To (1981), Greenhill et al., (1985), and Gupta (1986) have all...Reliability in Design, Vol. 107, pp. 4 2 1-4 3 0 . Gupta , A.K., 1986, --Finite Element Analysis of Vibration of Tapered Beams," Shock and Vibration

  14. Research on soundproof properties of cylindrical shells of generalized phononic crystals

    NASA Astrophysics Data System (ADS)

    Liu, Ru; Shu, Haisheng; Wang, Xingguo

    2017-04-01

    Based on the previous studies, the concept of generalized phononic crystals (GPCs) is further introduced into the cylindrical shell structures in this paper. And a type of cylindrical shells of generalized phononic crystals (CS-GPCs) is constructed, the structural field and acoustic-structural coupled field of the composite cylindrical shells are examined respectively. For the structural field, the transfer matrix method of mechanical state vector is adopted to build the transfer matrix of radial waves propagating from inside to outside. For the acoustic-structural coupled field, the expressions of the acoustic transmission/reflection coefficients and the sound insulation of acoustic waves with the excitation of center line sound source are set up. And the acoustic transmission coefficient and the frequency response of sound insulation in this mode were numerical calculated. Furthermore, the theoretical analysis results are verified by using the method of combining the numerical calculation and finite element simulation. Finally, the effects of inner and outer fluid parameters on the transmission/reflection coefficients of CS-GPCs are analyzed in detail.

  15. Half-lives of α -decaying nuclei in the medium-mass region within the transfer matrix method

    NASA Astrophysics Data System (ADS)

    Wu, Shuangxiang; Qian, Yibin; Ren, Zhongzhou

    2018-05-01

    The α -decay half-lives of even-even nuclei from Sm to Th are systematically studied based on the transfer matrix method. For the nuclear potential, a type of cosh-parametrized form is applied to calculate the penetration probability. Through a least-squares fit to experimental half-lives, we optimize the parameters in the potential and the α preformation factor P0. During this process, P0 is treated as a constant for each parent nucleus. Eventually, the calculated half-lives are found to agree well with the experimental data, which verifies the accuracy of the present approach. Furthermore, in recent studies, P0 is regulated by the shell and paring effects plus the nuclear deformation. To this end, P0 is here associated with the structural quantity, i.e., the microscopic correction of nuclear mass (Emic). In this way, the agreement between theory and experiment is greatly improved by more than 20%, validating the appropriate treatment of P0 in the scheme of Emic.

  16. Beyond the single-file fluid limit using transfer matrix method: Exact results for confined parallel hard squares

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gurin, Péter; Varga, Szabolcs

    2015-06-14

    We extend the transfer matrix method of one-dimensional hard core fluids placed between confining walls for that case where the particles can pass each other and at most two layers can form. We derive an eigenvalue equation for a quasi-one-dimensional system of hard squares confined between two parallel walls, where the pore width is between σ and 3σ (σ is the side length of the square). The exact equation of state and the nearest neighbor distribution functions show three different structures: a fluid phase with one layer, a fluid phase with two layers, and a solid-like structure where the fluidmore » layers are strongly correlated. The structural transition between differently ordered fluids develops continuously with increasing density, i.e., no thermodynamic phase transition occurs. The high density structure of the system consists of clusters with two layers which are broken with particles staying in the middle of the pore.« less

  17. Analysis of transition-metal acetylacetonate complexes by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.

    PubMed

    Wyatt, Mark F; Havard, Stephen; Stein, Bridget K; Brenton, A Gareth

    2008-01-01

    Transition-metal acetylacetonate complexes of the form Metal(acac)(2), where Metal = Fe(II), Co(II), Ni(II), Cu(II), and Zn(II), and Metal(acac)(3), where Metal = V(III), Cr(III), Mn(III), Fe(III), and Co(III), were investigated by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS). The data was acquired using the aprotic, electron transfer matrix, 2-[(2E)-3-(4-tert-butylphenyl)-2-methylprop-2-enylidene]malononitrile (DCTB), and the observation of positive radical ions is shown clearly to depend on the metal element and the oxidation state it occupies. The ionization energy of DCTB was calculated to be 8.08 eV by density functional theory methods, which is notably lower than the experimental value, but within the range of other computational values. This value is very close to those of the analytes, so the existing electron transfer mechanism which is based on the ionization energies of the matrix and analyte, cannot be used predictively. Similarly, the data neither proves nor disproves the validity of the existing electron transfer ionization mechanism, with respect to metal coordination complexes without strong chromophores. In this case, periodic trends may be more useful in explaining the observed species and the prediction of species from sets of similar complexes. The addition of a sodium salt benefits the MALDI-TOFMS characterization of certain compounds studied, but the benefit of the addition of ammonium or silver salts is negligible.

  18. A quasi steady state method for solving transient Darcy flow in complex 3D fractured networks accounting for matrix to fracture flow

    NASA Astrophysics Data System (ADS)

    Nœtinger, B.

    2015-02-01

    Modeling natural Discrete Fracture Networks (DFN) receives more and more attention in applied geosciences, from oil and gas industry, to geothermal recovery and aquifer management. The fractures may be either natural, or artificial in case of well stimulation. Accounting for the flow inside the fracture network, and accounting for the transfers between the matrix and the fractures, with the same level of accuracy is an important issue for calibrating the well architecture and for setting up optimal resources recovery strategies. Recently, we proposed an original method allowing to model transient pressure diffusion in the fracture network only [1]. The matrix was assumed to be impervious. A systematic approximation scheme was built, allowing to model the initial DFN by a set of N unknowns located at each identified intersection between fractures. The higher N, the higher the accuracy of the model. The main assumption was using a quasi steady state hypothesis, that states that the characteristic diffusion time over one single fracture is negligible compared with the characteristic time of the macroscopic problem, e.g. change of boundary conditions. In that context, the lowest order approximation N = 1 has the form of solving a transient problem in a resistor/capacitor network, a so-called pipe network. Its topology is the same as the network of geometrical intersections between fractures. In this paper, we generalize this approach in order to account for fluxes from matrix to fractures. The quasi steady state hypothesis at the fracture level is still kept. Then, we show that in the case of well separated time scales between matrix and fractures, the preceding model needs only to be slightly modified in order to incorporate these fluxes. The additional knowledge of the so-called matrix to fracture transfer function allows to modify the mass matrix that becomes a time convolution operator. This is reminiscent of existing space averaged transient dual porosity models.

  19. Heat-mediated, ultra-rapid electrophoretic transfer of high and low molecular weight proteins to nitrocellulose membranes.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2002-08-01

    Here, we report an ultra-rapid method for the transfer of high and low molecular weight proteins to nitrocellulose membranes following sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). In this procedure, the electro-transfer was performed with heated (70-75 degrees C) normal transfer buffer from which methanol had been omitted. Complete transfer of high and low molecular weight proteins (a purified protein, molecular weight protein standards and proteins from a human tissue extract) could be carried out in 10 min for a 0.75-mm, 7% SDS-PAGE gel. For 10% and 12.5% gels (0.75 mm), the corresponding time was 15 min. In the case of 1.5-mm gels, a complete transfer could be carried out in 20 min for 7%, 10% and 12.5% gels. The permeability of the gel is increased by heat, such that the proteins trapped in the polyacrylamide gel matrix can be easily transferred to the membrane. When the heat-mediated transfer method was compared with a conventional transfer protocol, under similar conditions, we found that the latter method transferred minimal low molecular weight proteins while retaining most of the high molecular weight proteins in the gel. In summary, this procedure is very rapid, avoids the use of methanol and is particularly useful for the transfer of high molecular weight proteins.

  20. Formulation of a dynamic analysis method for a generic family of hoop-mast antenna systems

    NASA Technical Reports Server (NTRS)

    Gabriele, A.; Loewy, R.

    1981-01-01

    Analytical studies of mast-cable-hoop-membrane type antennas were conducted using a transfer matrix numerical analysis approach. This method, by virtue of its specialization and the inherently easy compartmentalization of the formulation and numerical procedures, can be significantly more efficient in computer time required and in the time needed to review and interpret the results.

  1. Transferring elements of a density matrix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allahverdyan, Armen E.; Hovhannisyan, Karen V.; Yerevan State University, A. Manoogian Street 1, Yerevan

    2010-01-15

    We study restrictions imposed by quantum mechanics on the process of matrix-element transfer. This problem is at the core of quantum measurements and state transfer. Given two systems A and B with initial density matrices lambda and r, respectively, we consider interactions that lead to transferring certain matrix elements of unknown lambda into those of the final state r-tilde of B. We find that this process eliminates the memory on the transferred (or certain other) matrix elements from the final state of A. If one diagonal matrix element is transferred, r(tilde sign){sub aa}=lambda{sub aa}, the memory on each nondiagonal elementmore » lambda{sub an}ot ={sub b} is completely eliminated from the final density operator of A. Consider the following three quantities, Relambda{sub an}ot ={sub b}, Imlambda{sub an}ot ={sub b}, and lambda{sub aa}-lambda{sub bb} (the real and imaginary part of a nondiagonal element and the corresponding difference between diagonal elements). Transferring one of them, e.g., Rer(tilde sign){sub an}ot ={sub b}=Relambda{sub an}ot ={sub b}, erases the memory on two others from the final state of A. Generalization of these setups to a finite-accuracy transfer brings in a trade-off between the accuracy and the amount of preserved memory. This trade-off is expressed via system-independent uncertainty relations that account for local aspects of the accuracy-disturbance trade-off in quantum measurements. Thus, the general aspect of state disturbance in quantum measurements is elimination of memory on non-diagonal elements, rather than diagonalization.« less

  2. Creep-induced residual stress strengthening in a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Widjaja, S.; Jakus, K.; Ritter, J.E.

    The feasibility of inducing a compressive residual stress in the matrix of a Nicalon-fiber-reinforced BMAS-glass-ceramic-matrix composite through a creep-load transfer treatment was studied. Specimens were crept at 1100 C under constant tensile load to cause load transfer from the matrix to the fibers, then cooled under load. Upon removal of the load at room temperature, the matrix was put into compression by the elastic recovery of the fibers. This compressive residual stress in the matrix increased the room-temperature proportional limit stress of the composite. The increase in the proportional limit stress was found to be dependent upon the applied creepmore » stress, with an increase in creep stress resulting in an increase in the proportional limit stress. Acoustic emission results showed that the onset of significant matrix cracking correlated closely to the proportional limit stress. Changes in the state of residual stress in the matrix were supported by X-ray diffraction results. Fracture surfaces of all specimens exhibited fiber pullout behavior, indicating that the creep-load transfer process did not embrittle the fiber/matrix interface.« less

  3. Calculation of electronic coupling matrix elements for ground and excited state electron transfer reactions: Comparison of the generalized Mulliken-Hush and block diagonalization methods

    NASA Astrophysics Data System (ADS)

    Cave, Robert J.; Newton, Marshall D.

    1997-06-01

    Two independent methods are presented for the nonperturbative calculation of the electronic coupling matrix element (Hab) for electron transfer reactions using ab initio electronic structure theory. The first is based on the generalized Mulliken-Hush (GMH) model, a multistate generalization of the Mulliken Hush formalism for the electronic coupling. The second is based on the block diagonalization (BD) approach of Cederbaum, Domcke, and co-workers. Detailed quantitative comparisons of the two methods are carried out based on results for (a) several states of the system Zn2OH2+ and (b) the low-lying states of the benzene-Cl atom complex and its contact ion pair. Generally good agreement between the two methods is obtained over a range of geometries. Either method can be applied at an arbitrary nuclear geometry and, as a result, may be used to test the validity of the Condon approximation. Examples of nonmonotonic behavior of the electronic coupling as a function of nuclear coordinates are observed for Zn2OH2+. Both methods also yield a natural definition of the effective distance (rDA) between donor (D) and acceptor (A) sites, in contrast to earlier approaches which required independent estimates of rDA, generally based on molecular structure data.

  4. Thermal form-factor approach to dynamical correlation functions of integrable lattice models

    NASA Astrophysics Data System (ADS)

    Göhmann, Frank; Karbach, Michael; Klümper, Andreas; Kozlowski, Karol K.; Suzuki, Junji

    2017-11-01

    We propose a method for calculating dynamical correlation functions at finite temperature in integrable lattice models of Yang-Baxter type. The method is based on an expansion of the correlation functions as a series over matrix elements of a time-dependent quantum transfer matrix rather than the Hamiltonian. In the infinite Trotter-number limit the matrix elements become time independent and turn into the thermal form factors studied previously in the context of static correlation functions. We make this explicit with the example of the XXZ model. We show how the form factors can be summed utilizing certain auxiliary functions solving finite sets of nonlinear integral equations. The case of the XX model is worked out in more detail leading to a novel form-factor series representation of the dynamical transverse two-point function.

  5. The Linear Parameters and the Decoupling Matrix for Linearly Coupled Motion in 6 Dimensional Phase Space

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parzen, George

    It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 x 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 x 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4- dimensional phase space, wheremore » R has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, the β i,α i, i = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters,β i,α i, i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters α i and β i, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programing procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

  6. The linear parameters and the decoupling matrix for linearly coupled motion in 6 dimensional phase space. Informal report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parzen, G.

    It will be shown that starting from a coordinate system where the 6 phase space coordinates are linearly coupled, one can go to a new coordinate system, where the motion is uncoupled, by means of a linear transformation. The original coupled coordinates and the new uncoupled coordinates are related by a 6 {times} 6 matrix, R. R will be called the decoupling matrix. It will be shown that of the 36 elements of the 6 {times} 6 decoupling matrix R, only 12 elements are independent. This may be contrasted with the results for motion in 4-dimensional phase space, where Rmore » has 4 independent elements. A set of equations is given from which the 12 elements of R can be computed from the one period transfer matrix. This set of equations also allows the linear parameters, {beta}{sub i}, {alpha}{sub i} = 1, 3, for the uncoupled coordinates, to be computed from the one period transfer matrix. An alternative procedure for computing the linear parameters, the {beta}{sub i}, {alpha}{sub i} i = 1, 3, and the 12 independent elements of the decoupling matrix R is also given which depends on computing the eigenvectors of the one period transfer matrix. These results can be used in a tracking program, where the one period transfer matrix can be computed by multiplying the transfer matrices of all the elements in a period, to compute the linear parameters {alpha}{sub i} and {beta}{sub i}, i = 1, 3, and the elements of the decoupling matrix R. The procedure presented here for studying coupled motion in 6-dimensional phase space can also be applied to coupled motion in 4-dimensional phase space, where it may be a useful alternative procedure to the procedure presented by Edwards and Teng. In particular, it gives a simpler programming procedure for computing the beta functions and the emittances for coupled motion in 4-dimensional phase space.« less

  7. Propagation of SH waves in an infinite/semi-infinite piezoelectric/piezomagnetic periodically layered structure.

    PubMed

    Pang, Yu; Liu, Yu-Shan; Liu, Jin-Xi; Feng, Wen-Jie

    2016-04-01

    In this paper, SH bulk/surface waves propagating in the corresponding infinite/semi-infinite piezoelectric (PE)/piezomagnetic (PM) and PM/PE periodically layered composites are investigated by two methods, the stiffness matrix method and the transfer matrix method. For a semi-infinite PE/PM or PM/PE medium, the free surface is parallel to the layer interface. Both PE and PM materials are assumed to be transversely isotropic solids. Dispersion equations are derived by the stiffness/transfer matrix methods, respectively. The effects of electric-magnetic (ME) boundary conditions at the free surface and the layer thickness ratios on dispersion curves are considered in detail. Numerical examples show that the results calculated by the two methods are the same. The dispersion curves of SH surface waves are below the bulk bands or inside the frequency gaps. The ratio of the layer thickness has an important effect not only on the bulk bands but also on the dispersion curves of SH surface waves. Electric and magnetic boundary conditions, respectively, determine the dispersion curves of SH surface waves for the PE/PM and PM/PE semi-infinite structures. The band structures of SH bulk waves are consistent for the PE/PM and PM/PE structures, however, the dispersive behaviors of SH surface waves are indeed different for the two composites. The realization of the above-mentioned characteristics of SH waves will make it possible to design PE/PM acoustic wave devices with periodical structures and achieve the better performance. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouchard, Chris; Chang, Chia Cheng; Kurth, Thorsten

    In this paper, the Feynman-Hellmann theorem can be derived from the long Euclidean-time limit of correlation functions determined with functional derivatives of the partition function. Using this insight, we fully develop an improved method for computing matrix elements of external currents utilizing only two-point correlation functions. Our method applies to matrix elements of any external bilinear current, including nonzero momentum transfer, flavor-changing, and two or more current insertion matrix elements. The ability to identify and control all the systematic uncertainties in the analysis of the correlation functions stems from the unique time dependence of the ground-state matrix elements and the fact that all excited states and contact terms are Euclidean-time dependent. We demonstrate the utility of our method with a calculation of the nucleon axial charge using gradient-flowed domain-wall valence quarks on themore » $$N_f=2+1+1$$ MILC highly improved staggered quark ensemble with lattice spacing and pion mass of approximately 0.15 fm and 310 MeV respectively. We show full control over excited-state systematics with the new method and obtain a value of $$g_A = 1.213(26)$$ with a quark-mass-dependent renormalization coefficient.« less

  9. Evaluation of Several Approximate Methods for Calculating the Symmetrical Bending-Moment Response of Flexible Airplanes to Isotropic Atmospheric Turbulence

    NASA Technical Reports Server (NTRS)

    Bennett, Floyd V.; Yntema, Robert T.

    1959-01-01

    Several approximate procedures for calculating the bending-moment response of flexible airplanes to continuous isotropic turbulence are presented and evaluated. The modal methods (the mode-displacement and force-summation methods) and a matrix method (segmented-wing method) are considered. These approximate procedures are applied to a simplified airplane for which an exact solution to the equation of motion can be obtained. The simplified airplane consists of a uniform beam with a concentrated fuselage mass at the center. Airplane motions are limited to vertical rigid-body translation and symmetrical wing bending deflections. Output power spectra of wing bending moments based on the exact transfer-function solutions are used as a basis for the evaluation of the approximate methods. It is shown that the force-summation and the matrix methods give satisfactory accuracy and that the mode-displacement method gives unsatisfactory accuracy.

  10. Release of hydrogen from nanoconfined hydrides by application of microwaves

    NASA Astrophysics Data System (ADS)

    Sanz-Moral, Luis Miguel; Navarrete, Alexander; Sturm, Guido; Link, Guido; Rueda, Miriam; Stefanidis, Georgios; Martín, Ángel

    2017-06-01

    The release of hydrogen from solid hydrides by thermolysis can be improved by nanoconfinement of the hydride in a suitable micro/mesoporous support, but the slow heat transfer by conduction through the support can be a limitation. In this work, a C/SiO2 mesoporous material has been synthesized and employed as matrix for nanoconfinement of hydrides. The matrix showed high surface area and pore volume (386 m2/g and 1.41 cm3/g), which enabled the confinement of high concentrations of hydride. Furthermore, by modification of the proportion between C and SiO2, the dielectric properties of the complex could be modified, making it susceptible to microwave heating. As with this heating method the entire sample is heated simultaneously, the heat transfer resistances associated to conduction were eliminated. To demonstrate this possibility, ethane 1,2-diaminoborane (EDAB) was embedded on the C/SiO2 matrix at concentrations ranging from 11 to 31%wt using a wet impregnation method, and a device appropriate for hydrogen release from this material by application of microwaves was designed with the aid of a numerical simulation. Hydrogen liberation tests by conventional heating and microwaves were compared, showing that by microwave heating hydrogen release can be initiated and stopped in shorter times.

  11. Kohn-Sham potentials from electron densities using a matrix representation within finite atomic orbital basis sets

    NASA Astrophysics Data System (ADS)

    Zhang, Xing; Carter, Emily A.

    2018-01-01

    We revisit the static response function-based Kohn-Sham (KS) inversion procedure for determining the KS effective potential that corresponds to a given target electron density within finite atomic orbital basis sets. Instead of expanding the potential in an auxiliary basis set, we directly update the potential in its matrix representation. Through numerical examples, we show that the reconstructed density rapidly converges to the target density. Preliminary results are presented to illustrate the possibility of obtaining a local potential in real space from the optimized potential in its matrix representation. We have further applied this matrix-based KS inversion approach to density functional embedding theory. A proof-of-concept study of a solvated proton transfer reaction demonstrates the method's promise.

  12. Transfer reaction code with nonlocal interactions

    DOE PAGES

    Titus, L. J.; Ross, A.; Nunes, F. M.

    2016-07-14

    We present a suite of codes (NLAT for nonlocal adiabatic transfer) to calculate the transfer cross section for single-nucleon transfer reactions, (d,N)(d,N) or (N,d)(N,d), including nonlocal nucleon–target interactions, within the adiabatic distorted wave approximation. For this purpose, we implement an iterative method for solving the second order nonlocal differential equation, for both scattering and bound states. The final observables that can be obtained with NLAT are differential angular distributions for the cross sections of A(d,N)BA(d,N)B or B(N,d)AB(N,d)A. Details on the implementation of the TT-matrix to obtain the final cross sections within the adiabatic distorted wave approximation method are also provided.more » This code is suitable to be applied for deuteron induced reactions in the range of View the MathML sourceEd=10–70MeV, and provides cross sections with 4% accuracy.« less

  13. INTERNATIONAL CONFERENCE ON SEMICONDUCTOR INJECTION LASERS SELCO-87: Transient heat conduction in laser diodes

    NASA Astrophysics Data System (ADS)

    Enders, P.; Galley, J.

    1988-11-01

    The dynamics of heat transfer in stripe GaAlAs laser diodes is investigated by solving the linear diffusion equation for a quasitwo-dimensional multilayer structure. The calculations are rationalized drastically by the transfer matrix method and also using for the first time the asymptotes of the decay constants. Special attention is given to the convergence of the Fourier series. A comparison with experimental results reveals however that this is essentially the Stefan problem (with moving boundary conditions).

  14. The Relationship between N-Back Performance and Matrix Reasoning--Implications for Training and Transfer

    ERIC Educational Resources Information Center

    Jaeggi, Susanne M.; Studer-Luethi, Barbara; Buschkuehl, Martin; Su, Yi-Fen; Jonides, John; Perrig, Walter J.

    2010-01-01

    We have previously demonstrated that training on a dual n-back task results in improvements in fluid intelligence ("Gf") as measured by matrix reasoning tasks. Here, we explored the underlying mechanisms of this transfer effect in two studies, and we evaluated the transfer potential of a single n-back task. In the first study, we demonstrated that…

  15. The matrix effect in secondary ion mass spectrometry

    NASA Astrophysics Data System (ADS)

    Seah, M. P.; Shard, A. G.

    2018-05-01

    Matrix effects in the secondary ion mass spectrometry (SIMS) of selected elemental systems have been analyzed to investigate the applicability of a mathematical description of the matrix effect, called here the charge transfer (CT) model. This model was originally derived for proton exchange and organic positive secondary ions, to characterise the enhancement or suppression of intensities in organic binary systems. In the systems considered in this paper protons are specifically excluded, which enables an assessment of whether the model applies for electrons as well. The present importance is in organic systems but, here we analyse simpler inorganic systems. Matrix effects in elemental systems cannot involve proton transfer if there are no protons present but may be caused by electron transfer and so electron transfer may also be involved in the matrix effects for organic systems. There are general similarities in both the magnitudes of the ion intensities as well as the matrix effects for both positive and negative secondary ions in both systems and so the CT model may be more widely applicable. Published SIMS analyses of binary elemental mixtures are analyzed. The data of Kim et al., for the Pt/Co system, provide, with good precision, data for such a system. This gives evidence for the applicability of the CT model, where electron, rather than proton, transfer is the matrix enhancing and suppressing mechanism. The published data of Prudon et al., for the important Si/Ge system, provides further evidence for the effects for both positive and negative secondary ions and allows rudimentary rules to be developed for the enhancing and suppressing species.

  16. Non-LTE radiative transfer with lambda-acceleration - Convergence properties using exact full and diagonal lambda-operators

    NASA Technical Reports Server (NTRS)

    Macfarlane, J. J.

    1992-01-01

    We investigate the convergence properties of Lambda-acceleration methods for non-LTE radiative transfer problems in planar and spherical geometry. Matrix elements of the 'exact' A-operator are used to accelerate convergence to a solution in which both the radiative transfer and atomic rate equations are simultaneously satisfied. Convergence properties of two-level and multilevel atomic systems are investigated for methods using: (1) the complete Lambda-operator, and (2) the diagonal of the Lambda-operator. We find that the convergence properties for the method utilizing the complete Lambda-operator are significantly better than those of the diagonal Lambda-operator method, often reducing the number of iterations needed for convergence by a factor of between two and seven. However, the overall computational time required for large scale calculations - that is, those with many atomic levels and spatial zones - is typically a factor of a few larger for the complete Lambda-operator method, suggesting that the approach should be best applied to problems in which convergence is especially difficult.

  17. Förster-type energy transfer as a probe for changes in local fluctuations of the protein matrix.

    PubMed

    Somogyi, B; Matkó, J; Papp, S; Hevessy, J; Welch, G R; Damjanovich, S

    1984-07-17

    Much evidence, on both theoretical and experimental sides, indicates the importance of local fluctuations (in energy levels, conformational substates, etc.) of the macromolecular matrix in the biological activity of proteins. We describe here a novel application of the Förster-type energy-transfer process capable of monitoring changes both in local fluctuations and in conformational states of macromolecules. A new energy-transfer parameter, f, is defined as an average transfer efficiency, [E], normalized by the actual average quantum efficiency of the donor fluorescence, [phi D]. A simple oscillator model (for a one donor-one acceptor system) is presented to show the sensitivity of this parameter to changes in amplitudes of local fluctuations. The different modes of averaging (static, dynamic, and intermediate cases) occurring for a given value of the average transfer rate, [kt], and the experimental requirements as well as limitations of the method are also discussed. The experimental tests were performed on the ribonuclease T1-pyridoxamine 5'-phosphate conjugate (a one donor-one acceptor system) by studying the change of the f parameter with temperature, an environmental parameter expectedly perturbing local fluctuations of proteins. The parameter f increased with increasing temperature as expected on the basis of the oscillator model, suggesting that it really reflects changes of fluctuation amplitudes (significant changes in the orientation factor, k2, as well as in the spectral properties of the fluorophores can be excluded by anisotropy measurements and spectral investigations). Possibilities of the general applicability of the method are also discussed.

  18. A general solution strategy of modified power method for higher mode solutions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Peng; Lee, Hyunsuk; Lee, Deokjung, E-mail: deokjung@unist.ac.kr

    2016-01-15

    A general solution strategy of the modified power iteration method for calculating higher eigenmodes has been developed and applied in continuous energy Monte Carlo simulation. The new approach adopts four features: 1) the eigen decomposition of transfer matrix, 2) weight cancellation for higher modes, 3) population control with higher mode weights, and 4) stabilization technique of statistical fluctuations using multi-cycle accumulations. The numerical tests of neutron transport eigenvalue problems successfully demonstrate that the new strategy can significantly accelerate the fission source convergence with stable convergence behavior while obtaining multiple higher eigenmodes at the same time. The advantages of the newmore » strategy can be summarized as 1) the replacement of the cumbersome solution step of high order polynomial equations required by Booth's original method with the simple matrix eigen decomposition, 2) faster fission source convergence in inactive cycles, 3) more stable behaviors in both inactive and active cycles, and 4) smaller variances in active cycles. Advantages 3 and 4 can be attributed to the lower sensitivity of the new strategy to statistical fluctuations due to the multi-cycle accumulations. The application of the modified power method to continuous energy Monte Carlo simulation and the higher eigenmodes up to 4th order are reported for the first time in this paper. -- Graphical abstract: -- Highlights: •Modified power method is applied to continuous energy Monte Carlo simulation. •Transfer matrix is introduced to generalize the modified power method. •All mode based population control is applied to get the higher eigenmodes. •Statistic fluctuation can be greatly reduced using accumulated tally results. •Fission source convergence is accelerated with higher mode solutions.« less

  19. Effective representation of amide III, II, I, and A modes on local vibrational modes: Analysis of ab initio quantum calculation results.

    PubMed

    Hahn, Seungsoo

    2016-10-28

    The Hamiltonian matrix for the first excited vibrational states of a protein can be effectively represented by local vibrational modes constituting amide III, II, I, and A modes to simulate various vibrational spectra. Methods for obtaining the Hamiltonian matrix from ab initio quantum calculation results are discussed, where the methods consist of three steps: selection of local vibrational mode coordinates, calculation of a reduced Hessian matrix, and extraction of the Hamiltonian matrix from the Hessian matrix. We introduce several methods for each step. The methods were assessed based on the density functional theory calculation results of 24 oligopeptides with four different peptide lengths and six different secondary structures. The completeness of a Hamiltonian matrix represented in the reduced local mode space is improved by adopting a specific atom group for each amide mode and reducing the effect of ignored local modes. The calculation results are also compared to previous models using C=O stretching vibration and transition dipole couplings. We found that local electric transition dipole moments of the amide modes are mainly bound on the local peptide planes. Their direction and magnitude are well conserved except amide A modes, which show large variation. Contrary to amide I modes, the vibrational coupling constants of amide III, II, and A modes obtained by analysis of a dipeptide are not transferable to oligopeptides with the same secondary conformation because coupling constants are affected by the surrounding atomic environment.

  20. Matrix Transfer Function Design for Flexible Structures: An Application

    NASA Technical Reports Server (NTRS)

    Brennan, T. J.; Compito, A. V.; Doran, A. L.; Gustafson, C. L.; Wong, C. L.

    1985-01-01

    The application of matrix transfer function design techniques to the problem of disturbance rejection on a flexible space structure is demonstrated. The design approach is based on parameterizing a class of stabilizing compensators for the plant and formulating the design specifications as a constrained minimization problem in terms of these parameters. The solution yields a matrix transfer function representation of the compensator. A state space realization of the compensator is constructed to investigate performance and stability on the nominal and perturbed models. The application is made to the ACOSSA (Active Control of Space Structures) optical structure.

  1. Effective Methods for Solving Band SLEs after Parabolic Nonlinear PDEs

    NASA Astrophysics Data System (ADS)

    Veneva, Milena; Ayriyan, Alexander

    2018-04-01

    A class of models of heat transfer processes in a multilayer domain is considered. The governing equation is a nonlinear heat-transfer equation with different temperature-dependent densities and thermal coefficients in each layer. Homogeneous Neumann boundary conditions and ideal contact ones are applied. A finite difference scheme on a special uneven mesh with a second-order approximation in the case of a piecewise constant spatial step is built. This discretization leads to a pentadiagonal system of linear equations (SLEs) with a matrix which is neither diagonally dominant, nor positive definite. Two different methods for solving such a SLE are developed - diagonal dominantization and symbolic algorithms.

  2. A multi-state fragment charge difference approach for diabatic states in electron transfer: Extension and automation

    NASA Astrophysics Data System (ADS)

    Yang, Chou-Hsun; Hsu, Chao-Ping

    2013-10-01

    The electron transfer (ET) rate prediction requires the electronic coupling values. The Generalized Mulliken-Hush (GMH) and Fragment Charge Difference (FCD) schemes have been useful approaches to calculate ET coupling from an excited state calculation. In their typical form, both methods use two eigenstates in forming the target charge-localized diabatic states. For problems involve three or four states, a direct generalization is possible, but it is necessary to pick and assign the locally excited or charge-transfer states involved. In this work, we generalize the 3-state scheme for a multi-state FCD without the need of manual pick or assignment for the states. In this scheme, the diabatic states are obtained separately in the charge-transfer or neutral excited subspaces, defined by their eigenvalues in the fragment charge-difference matrix. In each subspace, the Hamiltonians are diagonalized, and there exist off-diagonal Hamiltonian matrix elements between different subspaces, particularly the charge-transfer and neutral excited diabatic states. The ET coupling values are obtained as the corresponding off-diagonal Hamiltonian matrix elements. A similar multi-state GMH scheme can also be developed. We test the new multi-state schemes for the performance in systems that have been studied using more than two states with FCD or GMH. We found that the multi-state approach yields much better charge-localized states in these systems. We further test for the dependence on the number of state included in the calculation of ET couplings. The final coupling values are converged when the number of state included is increased. In one system where experimental value is available, the multi-state FCD coupling value agrees better with the previous experimental result. We found that the multi-state GMH and FCD are useful when the original two-state approach fails.

  3. UV recording with vinyl acetate and muicle dye film

    NASA Astrophysics Data System (ADS)

    Toxqui-Lopez, S.; Olivares-Pérez, A.; Santacruz-Vazquez, V.; Fuentes-Tapia, I.; Ordoñez-Padilla, J.

    2015-03-01

    Nowadays, there are many types of holographic recording medium some of them are photopolymer systems that generally consist of a polymeric host matrix, photopolymerizable momomer, photosensitizing dye and charge transfer agent but some of them have an undesirable feature, the toxicity of their components. Therefore, the present research study material recording, vinyl acetate is selected as polymeric matrix and natural dye from "muicle plant" is used as the photoinitiation these components are not toxic. The films are fabricated using gravity settling method at room temperature by this method, uniform films is obtained with good optical quality. To characterize the medium, been obtained when the coherent reed light (632.8 nm) was sent normally to the grating.

  4. MODELING FUNCTIONALLY GRADED INTERPHASE REGIONS IN CARBON NANOTUBE REINFORCED COMPOSITES

    NASA Technical Reports Server (NTRS)

    Seidel, G. D.; Lagoudas, D. C.; Frankland, S. J. V.; Gates, T. S.

    2006-01-01

    A combination of micromechanics methods and molecular dynamics simulations are used to obtain the effective properties of the carbon nanotube reinforced composites with functionally graded interphase regions. The multilayer composite cylinders method accounts for the effects of non-perfect load transfer in carbon nanotube reinforced polymer matrix composites using a piecewise functionally graded interphase. The functional form of the properties in the interphase region, as well as the interphase thickness, is derived from molecular dynamics simulations of carbon nanotubes in a polymer matrix. Results indicate that the functional form of the interphase can have a significant effect on all the effective elastic constants except for the effective axial modulus for which no noticeable effects are evident.

  5. Methods of computing steady-state voltage stability margins of power systems

    DOEpatents

    Chow, Joe Hong; Ghiocel, Scott Gordon

    2018-03-20

    In steady-state voltage stability analysis, as load increases toward a maximum, conventional Newton-Raphson power flow Jacobian matrix becomes increasingly ill-conditioned so power flow fails to converge before reaching maximum loading. A method to directly eliminate this singularity reformulates the power flow problem by introducing an AQ bus with specified bus angle and reactive power consumption of a load bus. For steady-state voltage stability analysis, the angle separation between the swing bus and AQ bus can be varied to control power transfer to the load, rather than specifying the load power itself. For an AQ bus, the power flow formulation is only made up of a reactive power equation, thus reducing the size of the Jacobian matrix by one. This reduced Jacobian matrix is nonsingular at the critical voltage point, eliminating a major difficulty in voltage stability analysis for power system operations.

  6. Solar system applications of Mie theory and of radiative transfer of polarized light

    NASA Technical Reports Server (NTRS)

    Whitehill, L. P.

    1972-01-01

    A theory of the multiple scattering of polarized light is discussed using the doubling method of van de Hulst. The concept of the Stokes parameters is derived and used to develop the form of the scattering phase matrix of a single particle. The diffuse reflection and transmission matrices of a single scattering plane parallel atmosphere are expressed as a function of the phase matrix, and the symmetry properties of these matrices are examined. Four matrices are required to describe scattering and transmission. The scattering matrix that results from the addition of two identical layers is derived. Using the doubling method, the scattering and transmission matrices of layers of arbitrary optical thickness can be derived. The doubling equations are then rewritten in terms of their Fourier components. Computation time is reduced since each Fourier component doubles independently. Computation time is also reduced through the use of symmetry properties.

  7. Integrability and conformal data of the dimer model

    NASA Astrophysics Data System (ADS)

    Morin-Duchesne, Alexi; Rasmussen, Jørgen; Ruelle, Philippe

    2016-04-01

    The central charge of the dimer model on the square lattice is still being debated in the literature. In this paper, we provide evidence supporting the consistency of a c=-2 description. Using Lieb’s transfer matrix and its description in terms of the Temperley-Lieb algebra {{TL}}n at β =0, we provide a new solution of the dimer model in terms of the model of critical dense polymers on a tilted lattice and offer an understanding of the lattice integrability of the dimer model. The dimer transfer matrix is analyzed in the scaling limit, and the result for {L}0-\\frac{c}{24} is expressed in terms of fermions. Higher Virasoro modes are likewise constructed as limits of elements of {{TL}}n and are found to yield a c=-2 realization of the Virasoro algebra, familiar from fermionic bc ghost systems. In this realization, the dimer Fock spaces are shown to decompose, as Virasoro modules, into direct sums of Feigin-Fuchs modules, themselves exhibiting reducible yet indecomposable structures. In the scaling limit, the eigenvalues of the lattice integrals of motion are found to agree exactly with those of the c=-2 conformal integrals of motion. Consistent with the expression for {L}0-\\frac{c}{24} obtained from the transfer matrix, we also construct higher Virasoro modes with c = 1 and find that the dimer Fock space is completely reducible under their action. However, the transfer matrix is found not to be a generating function for the c = 1 integrals of motion. Although this indicates that Lieb’s transfer matrix description is incompatible with the c = 1 interpretation, it does not rule out the existence of an alternative, c = 1 compatible, transfer matrix description of the dimer model.

  8. Recent advances in understanding the reinforcing ability and mechanism of carbon nanotubes in ceramic matrix composites.

    PubMed

    Estili, Mehdi; Sakka, Yoshio

    2014-12-01

    Since the discovery of carbon nanotubes (CNTs), commonly referred to as ultimate reinforcement, the main purpose for fabricating CNT-ceramic matrix composites has been mainly to improve the fracture toughness and strength of the ceramic matrix materials. However, there have been many studies reporting marginal improvements or even the degradation of mechanical properties. On the other hand, those studies claiming noticeable toughening measured using indentation, which is an indirect/unreliable characterization method, have not demonstrated the responsible mechanisms applicable to the nanoscale, flexible CNTs; instead, those studies proposed those classical methods applicable to microscale fiber/whisker reinforced ceramics without showing any convincing evidence of load transfer to the CNTs. Therefore, the ability of CNTs to directly improve the macroscopic mechanical properties of structural ceramics has been strongly questioned and debated in the last ten years. In order to properly discuss the reinforcing ability (and possible mechanisms) of CNTs in a ceramic host material, there are three fundamental questions to our knowledge at both the nanoscale and macroscale levels that need to be addressed: (1) does the intrinsic load-bearing ability of CNTs change when embedded in a ceramic host matrix?; (2) when there is an intimate atomic-level interface without any chemical reaction with the matrix, could one expect any load transfer to the CNTs along with effective load bearing by them during crack propagation?; and (3) considering their nanometer-scale dimensions, flexibility and radial softness, are the CNTs able to improve the mechanical properties of the host ceramic matrix at the macroscale when individually, intimately and uniformly dispersed? If so, how? Also, what is the effect of CNT concentration in such a defect-free composite system? Here, we briefly review the recent studies addressing the above fundamental questions. In particular, we discuss the new reinforcing mechanism at the nanoscale responsible for unprecedented, simultaneous mechanical improvements and highlight the scalable processing method enabling the fabrication of defect-free CNT-concentered ceramics and CNT-graded composites with unprecedented properties. Finally, possible future directions will be briefly presented.

  9. Recent advances in understanding the reinforcing ability and mechanism of carbon nanotubes in ceramic matrix composites

    PubMed Central

    Estili, Mehdi; Sakka, Yoshio

    2014-01-01

    Since the discovery of carbon nanotubes (CNTs), commonly referred to as ultimate reinforcement, the main purpose for fabricating CNT–ceramic matrix composites has been mainly to improve the fracture toughness and strength of the ceramic matrix materials. However, there have been many studies reporting marginal improvements or even the degradation of mechanical properties. On the other hand, those studies claiming noticeable toughening measured using indentation, which is an indirect/unreliable characterization method, have not demonstrated the responsible mechanisms applicable to the nanoscale, flexible CNTs; instead, those studies proposed those classical methods applicable to microscale fiber/whisker reinforced ceramics without showing any convincing evidence of load transfer to the CNTs. Therefore, the ability of CNTs to directly improve the macroscopic mechanical properties of structural ceramics has been strongly questioned and debated in the last ten years. In order to properly discuss the reinforcing ability (and possible mechanisms) of CNTs in a ceramic host material, there are three fundamental questions to our knowledge at both the nanoscale and macroscale levels that need to be addressed: (1) does the intrinsic load-bearing ability of CNTs change when embedded in a ceramic host matrix?; (2) when there is an intimate atomic-level interface without any chemical reaction with the matrix, could one expect any load transfer to the CNTs along with effective load bearing by them during crack propagation?; and (3) considering their nanometer-scale dimensions, flexibility and radial softness, are the CNTs able to improve the mechanical properties of the host ceramic matrix at the macroscale when individually, intimately and uniformly dispersed? If so, how? Also, what is the effect of CNT concentration in such a defect-free composite system? Here, we briefly review the recent studies addressing the above fundamental questions. In particular, we discuss the new reinforcing mechanism at the nanoscale responsible for unprecedented, simultaneous mechanical improvements and highlight the scalable processing method enabling the fabrication of defect-free CNT-concentered ceramics and CNT-graded composites with unprecedented properties. Finally, possible future directions will be briefly presented. PMID:27877730

  10. Energy transfer and reaction dynamics of matrix-isolated 1,2-difluoroethane-d4

    NASA Astrophysics Data System (ADS)

    Raff, Lionel M.

    1990-09-01

    The molecular dynamics of vibrationally excited 1,2-difluoroethane-d4 isolated in Ar, Kr, and Xe matrices at 12 K are investigated using trajectory methods. The matrix model is an fcc crystal containing 125 unit cells with 666 atoms in a cubic (5×5×5) arrangement. It is assumed that 1,2-difluoroethane-d4 is held interstitially within the volume bounded by the innermost unit cell of the crystal. The transport effects of the bulk are simulated using the velocity reset method introduced by Riley, Coltrin, and Diestler [J. Chem. Phys. 88, 5934 (1988)]. The system potential is written as the separable sum of a lattice potential, a lattice-molecule interaction and a gas-phase potential for 1,2-difluoroethane. The first two of these are assumed to have pairwise form while the molecular potential is a modified form of the global potential previously developed for 1,2-difluoroethane [J. Phys. Chem. 91, 3266 (1987)]. Calculated sublimation energies for the pure crystals are in good accord with the experimental data. The distribution of metastable-state energies for matrix-isolated 1,2-difluoroethane-d4 is Gaussian in form. In krypton, the full width at half maximum for the distribution is 0.37 eV. For a total excitation energy of 6.314 eV, the observed dynamic processes are vibrational relaxation, orientational exchange, and four-center DF elimination reactions. The first of these processes is characterized by a near linear, first-order decay curve with rate coefficients in the range 1.30-1.48×1011 s-1. The average rates in krypton and xenon are nearly equal. The process is slightly slower in argon. The decay curves exhibit characteristic high-frequency oscillations that are generally seen in energy transfer studies. It is demonstrated that these oscillations are associated with the frequencies for intramolecular energy transfer so that the entire frequency spectrum for such transfer processes can be obtained from the Fourier transform of the decay curve. Orientational exchange is shown to occur with much greater frequency as the unit cell spacing decreases. The occurrence of orientational exchange generally results in a very rapid dissipation of molecular rotational energy to the lattice which causes a characteristic break to occur in the decay curve. It is shown that 16% of the total energy transfer to the lattice in argon is a result of such rotational energy transfer. The propensity for four-center DF elimination is found to be greater in argon than in either krypton or xenon. The relaxation data show that this effect is not the result of different energy transfer rates but is probably associated with steric effects resulting from the smaller lattice dimensions in argon. Isotope effects upon the energy partitioning in unimolecular reactions of 1,2-difluoroethane and upon the energy transfer dynamics under matrix-isolation conditions are also reported.

  11. Activation product transport in fusion reactors. [RAPTOR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Klein, A.C.

    1983-01-01

    Activated corrosion and neutron sputtering products will enter the coolant and/or tritium breeding material of fusion reactor power plants and experiments and cause personnel access problems. Radiation levels around plant components due to these products will cause difficulties with maintenance and repair operations throughout the plant. Similar problems are experienced around fission reactor systems. The determination of the transport of radioactive corrosion and neutron sputtering products through the system is achieved using the computer code RAPTOR. This code calculates the mass transfer of a number of activation products based on the corrosion and sputtering rates through the system, the depositionmore » and release characteristics of various plant components, the neturon flux spectrum, as well as other plant parameters. RAPTOR assembles a system of first order linear differential equations into a matrix equation based upon the reactor system parameters. Included in the transfer matrix are the deposition and erosion coefficients, and the decay and activation data for the various plant nodes and radioactive isotopes. A source vector supplies the corrosion and neutron sputtering source rates. This matrix equation is then solved using a matrix operator technique to give the specific activity distribution of each radioactive species throughout the plant. Once the amount of mass transfer is determined, the photon transport due to the radioactive corrosion and sputtering product sources can be evaluated, and dose rates around the plant components of interest as a function of time can be determined. This method has been used to estimate the radiation hazards around a number of fusion reactor system designs.« less

  12. Active and Passive 3D Vector Radiative Transfer with Preferentially-Aligned Ice Particles

    NASA Astrophysics Data System (ADS)

    Adams, I. S.; Munchak, S. J.; Pelissier, C.; Kuo, K. S.; Heymsfield, G. M.

    2017-12-01

    To support the observation of clouds and precipitation using combinations of radars and radiometers, a forward model capable of representing diverse sensing geometries for active and passive instruments is necessary for correctly interpreting and consistently combining multi-sensor measurements from ground-based, airborne, and spaceborne platforms. As such, the Atmospheric Radiative Transfer Simulator (ARTS) uses Monte Carlo integration to produce radar reflectivities and radiometric brightness temperatures for three-dimensional cloud and precipitation input fields. This radiative transfer framework is capable of efficiently sampling Gaussian antenna beams and fully accounting for multiple scattering. By relying on common ray-tracing tools, gaseous absorption models, and scattering properties, the model reproduces accurate and consistent radar and radiometer observables. While such a framework is an important component for simulating remote sensing observables, the key driver for self-consistent radiative transfer calculations of clouds and precipitation is scattering data. Research over the past decade has demonstrated that spheroidal models of frozen hydrometeors cannot accurately reproduce all necessary scattering properties at all desired frequencies. The discrete dipole approximation offers flexibility in calculating scattering for arbitrary particle geometries, but at great computational expense. When considering scattering for certain pristine ice particles, the Extended Boundary Condition Method, or T-Matrix, is much more computationally efficient; however, convergence for T-Matrix calculations fails at large size parameters and high aspect ratios. To address these deficiencies, we implemented the Invariant Imbedding T-Matrix Method (IITM). A brief overview of ARTS and IITM will be given, including details for handling preferentially-aligned hydrometeors. Examples highlighting the performance of the model for simulating space-based and airborne measurements will be offered, and some case studies showing the response to particle type and orientation will be presented. Simulations of polarized radar (Z, LDR, ZDR) and radiometer (Stokes I and Q) quantities will be used to demonstrate the capabilities of the model.

  13. Adaptive Inverse Control for Rotorcraft Vibration Reduction

    NASA Technical Reports Server (NTRS)

    Jacklin, Stephen A.

    1985-01-01

    This thesis extends the Least Mean Square (LMS) algorithm to solve the mult!ple-input, multiple-output problem of alleviating N/Rev (revolutions per minute by number of blades) helicopter fuselage vibration by means of adaptive inverse control. A frequency domain locally linear model is used to represent the transfer matrix relating the higher harmonic pitch control inputs to the harmonic vibration outputs to be controlled. By using the inverse matrix as the controller gain matrix, an adaptive inverse regulator is formed to alleviate the N/Rev vibration. The stability and rate of convergence properties of the extended LMS algorithm are discussed. It is shown that the stability ranges for the elements of the stability gain matrix are directly related to the eigenvalues of the vibration signal information matrix for the learning phase, but not for the control phase. The overall conclusion is that the LMS adaptive inverse control method can form a robust vibration control system, but will require some tuning of the input sensor gains, the stability gain matrix, and the amount of control relaxation to be used. The learning curve of the controller during the learning phase is shown to be quantitatively close to that predicted by averaging the learning curves of the normal modes. For higher order transfer matrices, a rough estimate of the inverse is needed to start the algorithm efficiently. The simulation results indicate that the factor which most influences LMS adaptive inverse control is the product of the control relaxation and the the stability gain matrix. A small stability gain matrix makes the controller less sensitive to relaxation selection, and permits faster and more stable vibration reduction, than by choosing the stability gain matrix large and the control relaxation term small. It is shown that the best selections of the stability gain matrix elements and the amount of control relaxation is basically a compromise between slow, stable convergence and fast convergence with increased possibility of unstable identification. In the simulation studies, the LMS adaptive inverse control algorithm is shown to be capable of adapting the inverse (controller) matrix to track changes in the flight conditions. The algorithm converges quickly for moderate disturbances, while taking longer for larger disturbances. Perfect knowledge of the inverse matrix is not required for good control of the N/Rev vibration. However it is shown that measurement noise will prevent the LMS adaptive inverse control technique from controlling the vibration, unless the signal averaging method presented is incorporated into the algorithm.

  14. Money creation process in a random redistribution model

    NASA Astrophysics Data System (ADS)

    Chen, Siyan; Wang, Yougui; Li, Keqiang; Wu, Jinshan

    2014-01-01

    In this paper, the dynamical process of money creation in a random exchange model with debt is investigated. The money creation kinetics are analyzed by both the money-transfer matrix method and the diffusion method. From both approaches, we attain the same conclusion: the source of money creation in the case of random exchange is the agents with neither money nor debt. These analytical results are demonstrated by computer simulations.

  15. Ultrashort hybrid metal-insulator plasmonic directional coupler.

    PubMed

    Noghani, Mahmoud Talafi; Samiei, Mohammad Hashem Vadjed

    2013-11-01

    An ultrashort plasmonic directional coupler based on the hybrid metal-insulator slab waveguide is proposed and analyzed at the telecommunication wavelength of 1550 nm. It is first analyzed using the supermode theory based on mode analysis via the transfer matrix method in the interaction region. Then the 2D model of the coupler, including transition arms, is analyzed using a commercial finite-element method simulator. The hybrid slab waveguide is composed of a metallic layer of silver and two dielectric layers of silica (SiO2) and silicon (Si). The coupler is optimized to have a minimum coupling length and to transfer maximum power considering the layer thicknesses as optimization variables. The resulting coupling length in the submicrometer region along with a noticeable power transfer efficiency are advantages of the proposed coupler compared to previously reported plasmonic couplers.

  16. Application of Transfer Matrix Approach to Modeling and Decentralized Control of Lattice-Based Structures

    NASA Technical Reports Server (NTRS)

    Cramer, Nick; Swei, Sean Shan-Min; Cheung, Kenny; Teodorescu, Mircea

    2015-01-01

    This paper presents a modeling and control of aerostructure developed by lattice-based cellular materials/components. The proposed aerostructure concept leverages a building block strategy for lattice-based components which provide great adaptability to varying ight scenarios, the needs of which are essential for in- ight wing shaping control. A decentralized structural control design is proposed that utilizes discrete-time lumped mass transfer matrix method (DT-LM-TMM). The objective is to develop an e ective reduced order model through DT-LM-TMM that can be used to design a decentralized controller for the structural control of a wing. The proposed approach developed in this paper shows that, as far as the performance of overall structural system is concerned, the reduced order model can be as e ective as the full order model in designing an optimal stabilizing controller.

  17. Exact first order scattering correction for vector radiative transfer in coupled atmosphere and ocean systems

    NASA Astrophysics Data System (ADS)

    Zhai, Peng-Wang; Hu, Yongxiang; Josset, Damien B.; Trepte, Charles R.; Lucker, Patricia L.; Lin, Bing

    2012-06-01

    We have developed a Vector Radiative Transfer (VRT) code for coupled atmosphere and ocean systems based on the successive order of scattering (SOS) method. In order to achieve efficiency and maintain accuracy, the scattering matrix is expanded in terms of the Wigner d functions and the delta fit or delta-M technique is used to truncate the commonly-present large forward scattering peak. To further improve the accuracy of the SOS code, we have implemented the analytical first order scattering treatment using the exact scattering matrix of the medium in the SOS code. The expansion and truncation techniques are kept for higher order scattering. The exact first order scattering correction was originally published by Nakajima and Takana.1 A new contribution of this work is to account for the exact secondary light scattering caused by the light reflected by and transmitted through the rough air-sea interface.

  18. Resonance Energy Transfer Studies from Derivatives of Thiophene Substituted 1,3,4-Oxadiazoles to Coumarin-334 Dye in Liquid and Dye-Doped Polymer Media

    NASA Astrophysics Data System (ADS)

    Naik, Lohit; Deshapande, Narahari; Khazi, Imtiyaz Ahamed M.; Malimath, G. H.

    2018-02-01

    In the present work, we have carried out energy transfer studies using newly synthesised derivatives of thiophene substituted 1,3,4-oxadiazoles namely, 2-(-4-(thiophene-3-yl)phenyl)-5-(5-(thiophene-3-yl)thiophene-2-yl)-1,3,4-oxadiazole [TTO], 2-(-4-(benzo[b]thiophene-2-yl)phenyl)-5-(5-(benzo[b]thiophene-2-yl)-1,3,4-oxadiozole [TBO] and 2-(4-(4-(trifluoromethyl)phenyl)phenyl)-5-(5-(4-(trifluoromethyl)phenyl)thiophen-2-yl)-1,3,4-oxadiazole [TMO] as donors and laser dye coumarin-334 as acceptor in ethanol and dye-doped polymer (poly(methyl methacrylate) (PMMA)) media following steady-state and time-resolved fluorescence methods. Bimolecular quenching constant ( k q), translation diffusion rate parameter ( k d), diffusion length ( D l), critical transfer distance ( R 0), donor- acceptor distance ( r) and energy transfer efficiency ( E T) are calculated. It is observed that, critical transfer distance is more than the diffusion length for all the pairs. Further, bimolecular quenching constant is also more than the translation diffusion rate parameter. Hence, our experimental findings suggest that overall energy transfer is due to Förster resonance energy transfer (FRET) between donor and acceptor in both the media and for all the pairs. In addition, considerable increase in fluorescence intensity and energy transfer efficiency is observed in dye-doped polymer matrix systems as compared to liquid media. This suggests that, these donor-acceptor pairs doped in PMMA matrix may be used for applications such as energy transfer dye lasers (ETDL) to improve the efficiency and photostability, to enhance tunability and for plastic scintillation detectors.

  19. Atmospheric pressure matrix-assisted laser desorption ionization as a plume diagnostic tool in laser evaporation methods

    NASA Astrophysics Data System (ADS)

    Callahan, John H.; Galicia, Marsha C.; Vertes, Akos

    2002-09-01

    Laser evaporation techniques, including matrix-assisted pulsed laser evaporation (MAPLE), are attracting increasing attention due to their ability to deposit thin layers of undegraded synthetic and biopolymers. Laser evaporation methods can be implemented in reflection geometry with the laser and the substrate positioned on the same side of the target. In some applications (e.g. direct write, DW), however, transmission geometry is used, i.e. the thin target is placed between the laser and the substrate. In this case, the laser pulse perforates the target and transfers some target material to the substrate. In order to optimize evaporation processes it is important to know the composition of the target plume and the material deposited from the plume. We used a recently introduced analytical method, atmospheric pressure matrix-assisted laser desorption ionization (AP-MALDI) to characterize the ionic components of the plume both in reflection and in transmission geometry. This technique can also be used to directly probe materials deposited on surfaces (such as glass slides) by laser evaporation methods. The test compound (small peptides, e.g. Angiotensin I, ATI or Substance P) was mixed with a MALDI matrix (α-cyano-4-hydroxycinnamic acid (CHCA), sinapinic acid (SA) or 2,5-dihydroxybenzoic acid (DHB)) and applied to the stainless steel (reflection geometry) or transparent conducting (transmission geometry) target holder. In addition to the classical dried droplet method, we also used electrospray target deposition to gain better control of crystallite size, thickness and homogeneity. The target was mounted in front of the inlet orifice of an ion trap mass spectrometer (IT-MS) that sampled the ionic components of the plume generated by a nitrogen laser. We studied the effect of several parameters, such as, the orifice to target distance, illumination geometry, extracting voltage distribution and sample preparation on the generated ions. Various analyte-matrix and matrix-matrix cluster ions were observed with relatively low abundance of the matrix ions.

  20. A test for interfacial effects and stress transfer in ceramic matrix composites

    NASA Technical Reports Server (NTRS)

    1988-01-01

    A test specimen was devised for measuring stress transfer between a high modulus fiber and a ceramic matrix. Single filaments of SiC were embedded in chemically vapor deposited SiC on a thin plate of molybdenum. The CVD overcoating which encapsulated the fiber was continuous with a coating of SiC on the molybdenum. When placed in a microtensile test device and loaded in the fiber direction, the fiber fracture characteristics provide information on the fiber/matrix adhesion and stress transfer. Problems were encountered due to the formation of a weak boundary between the SiC and the molybdenum which obviated any meaningful tensile tests. Also, the high CVD temperature used in fabricating these specimens restrict the fiber, matrix (and substrate) to materials having similar thermal coefficients of expansion in order to minimize thermal stresses.

  1. Coherent Microwave Scattering Model of Marsh Grass

    NASA Astrophysics Data System (ADS)

    Duan, Xueyang; Jones, Cathleen E.

    2017-12-01

    In this work, we developed an electromagnetic scattering model to analyze radar scattering from tall-grass-covered lands such as wetlands and marshes. The model adopts the generalized iterative extended boundary condition method (GIEBCM) algorithm, previously developed for buried cylindrical media such as vegetation roots, to simulate the scattering from the grass layer. The major challenge of applying GIEBCM to tall grass is the extremely time-consuming iteration among the large number of short subcylinders building up the grass. To overcome this issue, we extended the GIEBCM to multilevel GIEBCM, or M-GIEBCM, in which we first use GIEBCM to calculate a T matrix (transition matrix) database of "straws" with various lengths, thicknesses, orientations, curvatures, and dielectric properties; we then construct the grass with a group of straws from the database and apply GIEBCM again to calculate the T matrix of the overall grass scene. The grass T matrix is transferred to S matrix (scattering matrix) and combined with the ground S matrix, which is computed using the stabilized extended boundary condition method, to obtain the total scattering. In this article, we will demonstrate the capability of the model by simulating scattering from scenes with different grass densities, different grass structures, different grass water contents, and different ground moisture contents. This model will help with radar experiment design and image interpretation for marshland and wetland observations.

  2. Lattice Virasoro algebra and corner transfer matrices in the Baxter eight-vertex model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Itoyama, H.; Thacker, H.B.

    1987-04-06

    A lattice Virasoro algebra is constructed for the Baxter eight-vertex model. The operator L/sub 0/ is obtained from the logarithm of the corner transfer matrix and is given by the first moment of the XYZ spin-chain Hamiltonian. The algebra is valid even when the Hamiltonian includes a mass term, in which case it represents lattice coordinate transformations which distinguish between even and odd sublattices. We apply the quantum inverse scattering method to demonstrate that the Virasoro algebra follows from the Yang-Baxter relations.

  3. Distance dependence in photo-induced intramolecular electron transfer

    NASA Astrophysics Data System (ADS)

    Larsson, Sven; Volosov, Andrey

    1986-09-01

    The distance dependence of the rate of photo-induced electron transfer reactions is studied. A quantum mechanical method CNDO/S is applied to a series of molecules recently investigated by Hush et al. experimentally. The calculations show a large interaction through the saturated bridge which connects the two chromophores. The electronic matrix element HAB decreases a factor 10 in about 4 Å. There is also a decrease of the rate due to less exothermicity for the longer molecule. The results are in fair agreement with the experimental results.

  4. Singular value description of a digital radiographic detector: Theory and measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kyprianou, Iacovos S.; Badano, Aldo; Gallas, Brandon D.

    The H operator represents the deterministic performance of any imaging system. For a linear, digital imaging system, this system operator can be written in terms of a matrix, H, that describes the deterministic response of the system to a set of point objects. A singular value decomposition of this matrix results in a set of orthogonal functions (singular vectors) that form the system basis. A linear combination of these vectors completely describes the transfer of objects through the linear system, where the respective singular values associated with each singular vector describe the magnitude with which that contribution to the objectmore » is transferred through the system. This paper is focused on the measurement, analysis, and interpretation of the H matrix for digital x-ray detectors. A key ingredient in the measurement of the H matrix is the detector response to a single x ray (or infinitestimal x-ray beam). The authors have developed a method to estimate the 2D detector shift-variant, asymmetric ray response function (RRF) from multiple measured line response functions (LRFs) using a modified edge technique. The RRF measurements cover a range of x-ray incident angles from 0 deg. (equivalent location at the detector center) to 30 deg. (equivalent location at the detector edge) for a standard radiographic or cone-beam CT geometric setup. To demonstrate the method, three beam qualities were tested using the inherent, Lu/Er, and Yb beam filtration. The authors show that measures using the LRF, derived from an edge measurement, underestimate the system's performance when compared with the H matrix derived using the RRF. Furthermore, the authors show that edge measurements must be performed at multiple directions in order to capture rotational asymmetries of the RRF. The authors interpret the results of the H matrix SVD and provide correlations with the familiar MTF methodology. Discussion is made about the benefits of the H matrix technique with regards to signal detection theory, and the characterization of shift-variant imaging systems.« less

  5. Finite element analysis of stress transfer mechanism from matrix to the fiber in SWCN reinforced nanocomposites

    NASA Astrophysics Data System (ADS)

    Günay, E.

    2017-02-01

    This study defined as micromechanical finite element (FE) approach examining the stress transfer mechanism in single-walled carbon nanotube (SWCN) reinforced composites. In the modeling, 3D unit-cell method was evaluated. Carbon nanotube reinforced composites were modeled as three layers which comprises CNT, interface and matrix material. Firstly; matrix, fiber and interfacial materials all together considered as three layered cylindrical nanocomposite. Secondly, the cylindrical matrix material was assumed to be isotropic and also considered as a continuous medium. Then, fiber material was represented with zigzag type SWCNs. Finally, SWCN was combined with the elastic medium by using springs with different constants. In the FE modeling of SWCN reinforced composite model springs were modeled by using ANSYS spring damper element COMBIN14. The developed interfacial van der Waals interaction effects between the continuous matrix layer and the carbon nanotube fiber layer were simulated by applying these various spring stiffness values. In this study, the layered composite cylindrical FE model was presented as the equivalent mechanical properties of SWCN structures in terms of Young's modulus. The obtained results and literature values were presented and discussed. Figures, 16, 17, and 18 of the original article PDF file, as supplied to AIP Publishing, were affected by a PDF-processing error. Consequently, a solid diamond symbol appeared instead of a Greek tau on the y axis labels for these three figures. This article was updated on 17 March 2017 to correct the PDF-processing error, with the scientific content remaining unchanged.

  6. Development of a multi-matrix LC-MS/MS method for urea quantitation and its application in human respiratory disease studies.

    PubMed

    Wang, Jianshuang; Gao, Yang; Dorshorst, Drew W; Cai, Fang; Bremer, Meire; Milanowski, Dennis; Staton, Tracy L; Cape, Stephanie S; Dean, Brian; Ding, Xiao

    2017-01-30

    In human respiratory disease studies, liquid samples such as nasal secretion (NS), lung epithelial lining fluid (ELF), or upper airway mucosal lining fluid (MLF) are frequently collected, but their volumes often remain unknown. The lack of volume information makes it hard to estimate the actual concentration of recovered active pharmaceutical ingredient or biomarkers. Urea has been proposed to serve as a sample volume marker because it can freely diffuse through most body compartments and is less affected by disease states. Here, we report an easy and reliable LC-MS/MS method for cross-matrix measurement of urea in serum, plasma, universal transfer medium (UTM), synthetic absorptive matrix elution buffer 1 (SAMe1) and synthetic absorptive matrix elution buffer 2 (SAMe2) which are commonly sampled in human respiratory disease studies. The method uses two stable-isotope-labeled urea isotopologues, [ 15 N 2 ]-urea and [ 13 C, 15 N 2 ]-urea, as the surrogate analyte and the internal standard, respectively. This approach provides the best measurement consistency across different matrices. The analyte extraction was individually optimized in each matrix. Specifically in UTM, SAMe1 and SAMe2, the unique salting-out assisted liquid-liquid extraction (SALLE) not only dramatically reduces the matrix interferences but also improves the assay recovery. The use of an HILIC column largely increases the analyte retention. The typical run time is 3.6min which allows for high throughput analysis. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Comparison of matrix method and ray tracing in the study of complex optical systems

    NASA Astrophysics Data System (ADS)

    Anterrieu, Eric; Perez, Jose-Philippe

    2000-06-01

    In the context of the classical study of optical systems within the geometrical Gauss approximation, the cardinal elements are efficiently obtained with the aid of the transfer matrix between the input and output planes of the system. In order to take into account the geometrical aberrations, a ray tracing approach, using the Snell- Descartes laws, has been implemented in an interactive software. Both methods are applied for measuring the correction to be done to a human eye suffering from ametropia. This software may be used by optometrists and ophthalmologists for solving the problems encountered when considering this pathology. The ray tracing approach gives a significant improvement and could be very helpful for a better understanding of an eventual surgical act.

  8. 7Li(d,p)8Li transfer reaction in the NCSM/RGM approach

    NASA Astrophysics Data System (ADS)

    Raimondi, F.; Hupin, G.; Navrátil, P.; Quaglioni, S.

    2018-03-01

    Recently, we applied an ab initio method, the no-core shell model combined with the resonating group method, to the transfer reactions with light p-shell nuclei as targets and deuteron as the projectile. In particular, we studied the elastic scattering of deuterium on 7Li and the 7Li(d,p)8Li transfer reaction starting from a realistic two-nucleon interaction. In this contribution, we review of our main results on the 7Li(d,p)8Li transfer reaction, and we extend the study of the relevant reaction channels, by showing the dominant resonant phase shifts of the scattering matrix. We assess also the impact of the polarization effects of the deuteron below the breakup on the positive-parity resonant states in the reaction. For this purpose, we perform an analysis of the convergence trend of the phase and eigenphase shifts, with respect to the number of deuteron pseudostates included in the model space.

  9. Three-dimensional ordered particulate structures: Method to retrieve characteristics from photonic band gap data

    NASA Astrophysics Data System (ADS)

    Miskevich, Alexander A.; Loiko, Valery A.

    2015-01-01

    A method to retrieve characteristics of ordered particulate structures, such as photonic crystals, is proposed. It is based on the solution of the inverse problem using data on the photonic band gap (PBG). The quasicrystalline approximation (QCA) of the theory of multiple scattering of waves and the transfer matrix method (TMM) are used. Retrieval of the refractive index of particles is demonstrated. Refractive indices of the artificial opal particles are estimated using the published experimental data.

  10. Spectrofluorimetric assessment of hydrochlorothiazide using optical sensor nano-composite terbium ion doped in sol-gel matrix.

    PubMed

    Youssef, A O

    2012-05-01

    A new, simple, sensitive and selective spectrofluorimetric method for the determination of Hydrochlorothiazide was developed in acetonitrile at pH 6.2. The Hydrochlorothiazide can remarkably enhance the luminescence intensity of the Tb(3+) ion doped in sol-gel matrix at λ(ex) = 370 nm. The intensity of the emission band of Tb(3+) ion doped in sol-gel matrix was increased due to the energy transfer from the triplet excited state of Hydrochlorothiazide to ((5)D(4)) excited energy state of Tb(3) ion. The enhancement of the emission band of Tb(3+) ion doped in sol-gel matrix at ((5)D(4)→(7)F(5)) 545 nm was directly proportion to the concentration of Hydrochlorothiazide with a dynamic ranges of 5.0 × 10(-10)-5.0 × 10(-6) mol L(-1) and detection limit of 2.2 × 10(-11) mol L(-1).

  11. Highly sensitive and selective spectrofluorimetric determination of metoclopramide hydrochloride in pharmaceutical tablets and serum samples using Eu3+ ion doped in sol-gel matrix.

    PubMed

    Attia, M S; Aboaly, M M

    2010-06-30

    A simple, sensitive and selective spectrofluorimetric method for the determination of Metoclopramide hydrochloride (MCP) is developed. The MCP can remarkably enhances the luminescence intensity of the Eu(3+) ion doped in sol-gel matrix at lambda(ex)=380 nm in DMSO at pH 8.7. The intensity of the emission band of Eu(3+) ion doped in sol-gel matrix increases due to energy transfer from MCP to Eu(3+) in the excited state. The enhancement of the emission band of Eu(3+) ion doped in sol-gel matrix at 617 nm was found to be directly proportional to the concentration of MCP with a dynamic range of 5 x 10(-9) - 1.0 x 10(-6) mol L(-1) and detection limit of 2.2 x10(-11) mol L(-1). Copyright 2010 Elsevier B.V. All rights reserved.

  12. Graphene nanoplatelets induced heterogeneous bimodal structural magnesium matrix composites with enhanced mechanical properties

    PubMed Central

    Xiang, Shulin; Wang, Xiaojun; Gupta, Manoj; Wu, Kun; Hu, Xiaoshi; Zheng, Mingyi

    2016-01-01

    In this work, graphene nanoplatelets (GNPs) reinforced magnesium (Mg) matrix composites were synthesised using the multi-step dispersion route. Well-dispersed but inhomogeneously distributed GNPs were obtained in the matrix. Compared with the monolithic alloy, the nanocomposites exhibited dramatically enhanced Young’s modulus, yield strength and ultimate tensile strength and relatively high plasticity, which mainly attributed to the significant heterogeneous laminated microstructure induced by the addition of GNPs. With increasing of the concentration of GNPs, mechanical properties of the composites were gradually improved. Especially, the strengthening efficiency of all the composites exceeded 100%, which was significantly higher than that of carbon nanotubes reinforced Mg matrix composites. The grain refinement and load transfer provided by the two-dimensional and wrinkled surface structure of GNPs were the dominated strengthening mechanisms of the composites. This investigation develops a new method for incorporating GNPs in metals for fabricating high-performance composites. PMID:27941839

  13. Graphene nanoplatelets induced heterogeneous bimodal structural magnesium matrix composites with enhanced mechanical properties

    NASA Astrophysics Data System (ADS)

    Xiang, Shulin; Wang, Xiaojun; Gupta, Manoj; Wu, Kun; Hu, Xiaoshi; Zheng, Mingyi

    2016-12-01

    In this work, graphene nanoplatelets (GNPs) reinforced magnesium (Mg) matrix composites were synthesised using the multi-step dispersion route. Well-dispersed but inhomogeneously distributed GNPs were obtained in the matrix. Compared with the monolithic alloy, the nanocomposites exhibited dramatically enhanced Young’s modulus, yield strength and ultimate tensile strength and relatively high plasticity, which mainly attributed to the significant heterogeneous laminated microstructure induced by the addition of GNPs. With increasing of the concentration of GNPs, mechanical properties of the composites were gradually improved. Especially, the strengthening efficiency of all the composites exceeded 100%, which was significantly higher than that of carbon nanotubes reinforced Mg matrix composites. The grain refinement and load transfer provided by the two-dimensional and wrinkled surface structure of GNPs were the dominated strengthening mechanisms of the composites. This investigation develops a new method for incorporating GNPs in metals for fabricating high-performance composites.

  14. Tribological properties and lubrication mechanism of in situ graphene-nickel matrix composite impregnated with lubricating oil

    NASA Astrophysics Data System (ADS)

    Lei, Yu; Du, Jinfang; Pang, Xianjuan; Wang, Haizhong; Yang, Hua; Jiang, Jinlong

    2018-05-01

    A solid-liquid synergetic lubricating system has been designed to develop a novel self-lubricating nickel matrix composite. The graphene-nickel (G-Ni) matrix composite with porous structure was fabricated by in situ growing graphene in bulk nickel using a powder metallurgy method. The porous structures of the composite were used to store polyalphaolefin (PAO) oil for self-lubricating. It is found that the G-Ni matrix composite under oil lubrication condition exhibited superior tribological properties as compared to pure nickel and the composite under dry sliding condition. The prestored oil was released from pores to the sliding surface forming a lubricating oil film during friction process. This lubricating oil film can protect the worn surface from severe oxidation, and help the formation and transfer of a carbon-based solid tribofilm derived from graphene and lubricating oil. This solid (graphene)-liquid (oil) synergistic lubricating mechanism is responsible for the reduction of friction coefficient and improvement of wear resistance of the in situ fabricated G-Ni matrix composite.

  15. New numerical method for radiation heat transfer in nonhomogeneous participating media

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Howell, J.R.; Tan, Zhiqiang

    A new numerical method, which solves the exact integral equations of distance-angular integration form for radiation transfer, is introduced in this paper. By constructing and prestoring the numerical integral formulas for the distance integral for appropriate kernel functions, this method eliminates the time consuming evaluations of the kernels of the space integrals in the formal computations. In addition, when the number of elements in the system is large, the resulting coefficient matrix is quite sparse. Thus, either considerable time or much storage can be saved. A weakness of the method is discussed, and some remedies are suggested. As illustrations, somemore » one-dimensional and two-dimensional problems in both homogeneous and inhomogeneous emitting, absorbing, and linear anisotropic scattering media are studied. Some results are compared with available data. 13 refs.« less

  16. Matrix Formalism of Synchrobetatron Coupling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Xiaobiao; /SLAC

    In this paper we present a complete linear synchrobetatron coupling formalism by studying the transfer matrix which describes linear horizontal and longitudinal motions. With the technique established in the linear horizontal-vertical coupling study [D. Sagan and D. Rubin, Phys. Rev. ST Accel. Beams 2, 074001 (1999)], we found a transformation to block diagonalize the transfer matrix and decouple the betatron motion and the synchrotron motion. By separating the usual dispersion term from the horizontal coordinate first, we were able to obtain analytic expressions of the transformation under reasonable approximations. We also obtained the perturbations to the betatron tune and themore » Courant-Snyder functions. The closed orbit changes due to finite energy gains at rf cavities and radiation energy losses were also studied by the 5 x 5 extended transfer matrix with the fifth column describing kicks in the 4-dimension phase space.« less

  17. Sparse matrix-vector multiplication on network-on-chip

    NASA Astrophysics Data System (ADS)

    Sun, C.-C.; Götze, J.; Jheng, H.-Y.; Ruan, S.-J.

    2010-12-01

    In this paper, we present an idea for performing matrix-vector multiplication by using Network-on-Chip (NoC) architecture. In traditional IC design on-chip communications have been designed with dedicated point-to-point interconnections. Therefore, regular local data transfer is the major concept of many parallel implementations. However, when dealing with the parallel implementation of sparse matrix-vector multiplication (SMVM), which is the main step of all iterative algorithms for solving systems of linear equation, the required data transfers depend on the sparsity structure of the matrix and can be extremely irregular. Using the NoC architecture makes it possible to deal with arbitrary structure of the data transfers; i.e. with the irregular structure of the sparse matrices. So far, we have already implemented the proposed SMVM-NoC architecture with the size 4×4 and 5×5 in IEEE 754 single float point precision using FPGA.

  18. An information hidden model holding cover distributions

    NASA Astrophysics Data System (ADS)

    Fu, Min; Cai, Chao; Dai, Zuxu

    2018-03-01

    The goal of steganography is to embed secret data into a cover so no one apart from the sender and intended recipients can find the secret data. Usually, the way the cover changing was decided by a hidden function. There were no existing model could be used to find an optimal function which can greatly reduce the distortion the cover suffered. This paper considers the cover carrying secret message as a random Markov chain, taking the advantages of a deterministic relation between initial distributions and transferring matrix of the Markov chain, and takes the transferring matrix as a constriction to decrease statistical distortion the cover suffered in the process of information hiding. Furthermore, a hidden function is designed and the transferring matrix is also presented to be a matrix from the original cover to the stego cover. Experiment results show that the new model preserves a consistent statistical characterizations of original and stego cover.

  19. Combined effects of slip and convective boundary condition on MHD 3D stretched flow of nanofluid through porous media inspired by non-linear thermal radiation

    NASA Astrophysics Data System (ADS)

    Nayak, M. K.; Shaw, Sachin; Pandey, V. S.; Chamkha, Ali J.

    2018-02-01

    In the present study, the main concern is to investigate the magnetohydrodynamic nanofluid flow subject to porous matrix and convective heating past a permeable linear stretching sheet. In addition, the influence of velocity slip, viscous dissipation, Joule heating and non-linear thermal radiation are considered. A new micro-convection model known as the Patel model is implemented for considerable enhancement of the thermal conductivity and hence, the heat transfer capability of nanofluids. Moreover, a convective heat transfer model is introduced where the bottom surface of the sheet gets heated due to a convection mechanism from a hot fluid of particular temperature. The numerical results of the transformed governing differential equations have been obtained by using fourth-order Runge-Kutta method along with shooting approach and secant method is used for better approximation. In the present analysis, base fluids such as water and Ethylene glycol and Copper, Silver and Aluminum oxide nanoparticles are considered. Results of the present investigation show that inclusion of porous matrix contributes to slow down the fluid velocity and diminution of wall shear stress (axial as well as transverse). Drag force due to magnetic field strength, velocity slip and imposed fluid suction impede the fluid motion and upsurge the heat transfer rate from the surface. In addition, rise in viscous dissipation widens the thermal boundary layer.

  20. Teaching Stable Two-Mirror Resonators through the Fractional Fourier Transform

    ERIC Educational Resources Information Center

    Moreno, Ignacio; Garcia-Martinez, Pascuala; Ferreira, Carlos

    2010-01-01

    We analyse two-mirror resonators in terms of their fractional Fourier transform (FRFT) properties. We use the basic ABCD ray transfer matrix method to show how the resonator can be regarded as the cascade of two propagation-lens-propagation FRFT systems. Then, we present a connection between the geometric properties of the resonator (the g…

  1. Hybrid matrix method for stable numerical analysis of the propagation of Dirac electrons in gapless bilayer graphene superlattices

    NASA Astrophysics Data System (ADS)

    Briones-Torres, J. A.; Pernas-Salomón, R.; Pérez-Álvarez, R.; Rodríguez-Vargas, I.

    2016-05-01

    Gapless bilayer graphene (GBG), like monolayer graphene, is a material system with unique properties, such as anti-Klein tunneling and intrinsic Fano resonances. These properties rely on the gapless parabolic dispersion relation and the chiral nature of bilayer graphene electrons. In addition, propagating and evanescent electron states coexist inherently in this material, giving rise to these exotic properties. In this sense, bilayer graphene is unique, since in most material systems in which Fano resonance phenomena are manifested an external source that provides extended states is required. However, from a numerical standpoint, the presence of evanescent-divergent states in the eigenfunctions linear superposition representing the Dirac spinors, leads to a numerical degradation (the so called Ωd problem) in the practical applications of the standard Coefficient Transfer Matrix (K) method used to study charge transport properties in Bilayer Graphene based multi-barrier systems. We present here a straightforward procedure based in the hybrid compliance-stiffness matrix method (H) that can overcome this numerical degradation. Our results show that in contrast to standard matrix method, the proposed H method is suitable to study the transmission and transport properties of electrons in GBG superlattice since it remains numerically stable regardless the size of the superlattice and the range of values taken by the input parameters: the energy and angle of the incident electrons, the barrier height and the thickness and number of barriers. We show that the matrix determinant can be used as a test of the numerical accuracy in real calculations.

  2. Electronic coupling matrix elements from charge constrained density functional theory calculations using a plane wave basis set

    NASA Astrophysics Data System (ADS)

    Oberhofer, Harald; Blumberger, Jochen

    2010-12-01

    We present a plane wave basis set implementation for the calculation of electronic coupling matrix elements of electron transfer reactions within the framework of constrained density functional theory (CDFT). Following the work of Wu and Van Voorhis [J. Chem. Phys. 125, 164105 (2006)], the diabatic wavefunctions are approximated by the Kohn-Sham determinants obtained from CDFT calculations, and the coupling matrix element calculated by an efficient integration scheme. Our results for intermolecular electron transfer in small systems agree very well with high-level ab initio calculations based on generalized Mulliken-Hush theory, and with previous local basis set CDFT calculations. The effect of thermal fluctuations on the coupling matrix element is demonstrated for intramolecular electron transfer in the tetrathiafulvalene-diquinone (Q-TTF-Q-) anion. Sampling the electronic coupling along density functional based molecular dynamics trajectories, we find that thermal fluctuations, in particular the slow bending motion of the molecule, can lead to changes in the instantaneous electron transfer rate by more than an order of magnitude. The thermal average, ( {< {| {H_ab } |^2 } > } )^{1/2} = 6.7 {mH}, is significantly higher than the value obtained for the minimum energy structure, | {H_ab } | = 3.8 {mH}. While CDFT in combination with generalized gradient approximation (GGA) functionals describes the intermolecular electron transfer in the studied systems well, exact exchange is required for Q-TTF-Q- in order to obtain coupling matrix elements in agreement with experiment (3.9 mH). The implementation presented opens up the possibility to compute electronic coupling matrix elements for extended systems where donor, acceptor, and the environment are treated at the quantum mechanical (QM) level.

  3. MS-CASPT2 study of hole transfer in guanine-indole complexes using the generalized Mulliken-Hush method: effective two-state treatment.

    PubMed

    Butchosa, C; Simon, S; Blancafort, L; Voityuk, A

    2012-07-12

    Because hole transfer from nucleobases to amino acid residues in DNA-protein complexes can prevent oxidative damage of DNA in living cells, computational modeling of the process is of high interest. We performed MS-CASPT2 calculations of several model structures of π-stacked guanine and indole and derived electron-transfer (ET) parameters for these systems using the generalized Mulliken-Hush (GMH) method. We show that the two-state model commonly applied to treat thermal ET between adjacent donor and acceptor is of limited use for the considered systems because of the small gap between the ground and first excited states in the indole radical cation. The ET parameters obtained within the two-state GMH scheme can deviate significantly from the corresponding matrix elements of the two-state effective Hamiltonian based on the GMH treatment of three adiabatic states. The computed values of diabatic energies and electronic couplings provide benchmarks to assess the performance of less sophisticated computational methods.

  4. Improving mass transfer to soften tissues by pulsed electric fields: fundamentals and applications.

    PubMed

    Puértolas, E; Luengo, E; Álvarez, I; Raso, J

    2012-01-01

    The mass transfer phenomenon occurs in many operations of the food industry with the purpose of obtaining a given substance of interest, removing water from foods, or introducing a given substance into the food matrix. Pretreatments that modify the permeability of the cell membranes, such as grinding, heating, or enzymatic treatment, enhance the mass transfer. However, these techniques may require a significant amount of energy and can cause losses of valuable food compounds. Pulsed electric field (PEF) technology is a nonthermal processing method that causes permeabilization of cell membranes using low energy requirements and minimizing quality deterioration of the food compounds. Many practical applications of PEF for enhancing mass transfer in the food industry have been investigated. The purpose of this chapter is to give an overview of the state of the art of application of PEF for improving mass transfer in the food industry.

  5. A brief review of other notable protein blotting methods.

    PubMed

    Kurien, Biji T; Scofield, R Hal

    2009-01-01

    A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

  6. Heat Transfer Characteristics of Regenerator Matrix (Case of Packed Wire Gauzes)

    NASA Technical Reports Server (NTRS)

    Hamaguchi, K.; Takahashi, S.; Miyabe, H.

    1984-01-01

    The average heat transfer coefficient in the matrix of laminated wire screens (10 to 250 mesh) for a Stirling engine heat exchanger was studied experimentally. The data are correlated by N sub ud = 0.42 R sub ed 0.56 (3 or = R sub ed or = 400), and R sub ed are the Nusselt and Reynolds nubmers based on the wire diameter. The pressure drop decreased and the heat transfer increased as the wire diameter was decreased.

  7. Synthesis and Luminescence Properties of Transparent Nanocrystalline GdF3:Tb Glass-Ceramic Scintillator.

    PubMed

    Lee, Gyuhyon; Savage, Nicholas; Wagner, Brent; Zhang, Yuelan; Jacobs, Benjamin; Menkara, Hisham; Summers, Christopher; Kang, Zhitao

    2014-03-01

    Transparent glass-ceramic containing rare-earth doped halide nanocrystals exhibits enhanced luminescence performance. In this study, a glass-ceramic with Tb doped gadolinium fluoride nanocrystals embedded in an aluminosilicate glass matrix is investigated for X-ray imaging applications. The nanocrystalline glass-ceramic scintillator was prepared by a melt-quench method followed by an anneal. The GdF 3 :Tb nanocrystals precipitated within the oxide glass matrix during the processing and their luminescence and scintillation properties were investigated. In this nanocomposite scintillator system, the incorporation of high atomic number Gd compound into the glass matrix increases the X-ray stopping power of the glass scintillator, and effective energy transfer between Gd 3+ and Tb 3+ ions in the nanocrystals enhances the scintillation efficiency.

  8. Synthesis and Luminescence Properties of Transparent Nanocrystalline GdF3:Tb Glass-Ceramic Scintillator

    PubMed Central

    Lee, Gyuhyon; Savage, Nicholas; Wagner, Brent; Zhang, Yuelan; Jacobs, Benjamin; Menkara, Hisham; Summers, Christopher; Kang, Zhitao

    2014-01-01

    Transparent glass-ceramic containing rare-earth doped halide nanocrystals exhibits enhanced luminescence performance. In this study, a glass-ceramic with Tb doped gadolinium fluoride nanocrystals embedded in an aluminosilicate glass matrix is investigated for X-ray imaging applications. The nanocrystalline glass-ceramic scintillator was prepared by a melt-quench method followed by an anneal. The GdF3:Tb nanocrystals precipitated within the oxide glass matrix during the processing and their luminescence and scintillation properties were investigated. In this nanocomposite scintillator system, the incorporation of high atomic number Gd compound into the glass matrix increases the X-ray stopping power of the glass scintillator, and effective energy transfer between Gd3+ and Tb3+ ions in the nanocrystals enhances the scintillation efficiency. PMID:24610960

  9. Toda theories as contractions of affine Toda theories

    NASA Astrophysics Data System (ADS)

    Aghamohammadi, A.; Khorrami, M.; Shariati, A.

    1996-02-01

    Using a contraction procedure, we obtain Toda theories and their structures, from affine Toda theories and their corresponding structures. By structures, we mean the equation of motion, the classical Lax pair, the boundary term for half line theories, and the quantum transfer matrix. The Lax pair and the transfer matrix so obtained, depend nontrivially on the spectral parameter.

  10. Calculation of electronic coupling matrix elements for ground and excited state electron transfer reactions: Comparison of the generalized Mulliken{endash}Hush and block diagonalization methods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cave, R.J.; Newton, M.D.

    1997-06-01

    Two independent methods are presented for the nonperturbative calculation of the electronic coupling matrix element (H{sub ab}) for electron transfer reactions using {ital ab initio} electronic structure theory. The first is based on the generalized Mulliken{endash}Hush (GMH) model, a multistate generalization of the Mulliken Hush formalism for the electronic coupling. The second is based on the block diagonalization (BD) approach of Cederbaum, Domcke, and co-workers. Detailed quantitative comparisons of the two methods are carried out based on results for (a) several states of the system Zn{sub 2}OH{sub 2}{sup +} and (b) the low-lying states of the benzene{endash}Cl atom complex andmore » its contact ion pair. Generally good agreement between the two methods is obtained over a range of geometries. Either method can be applied at an arbitrary nuclear geometry and, as a result, may be used to test the validity of the Condon approximation. Examples of nonmonotonic behavior of the electronic coupling as a function of nuclear coordinates are observed for Zn{sub 2}OH{sub 2}{sup +}. Both methods also yield a natural definition of the effective distance (r{sub DA}) between donor (D) and acceptor (A) sites, in contrast to earlier approaches which required independent estimates of r{sub DA}, generally based on molecular structure data. {copyright} {ital 1997 American Institute of Physics.}« less

  11. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlapmore » matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Angstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.« less

  12. An accurate and linear-scaling method for calculating charge-transfer excitation energies and diabatic couplings.

    PubMed

    Pavanello, Michele; Van Voorhis, Troy; Visscher, Lucas; Neugebauer, Johannes

    2013-02-07

    Quantum-mechanical methods that are both computationally fast and accurate are not yet available for electronic excitations having charge transfer character. In this work, we present a significant step forward towards this goal for those charge transfer excitations that take place between non-covalently bound molecules. In particular, we present a method that scales linearly with the number of non-covalently bound molecules in the system and is based on a two-pronged approach: The molecular electronic structure of broken-symmetry charge-localized states is obtained with the frozen density embedding formulation of subsystem density-functional theory; subsequently, in a post-SCF calculation, the full-electron Hamiltonian and overlap matrix elements among the charge-localized states are evaluated with an algorithm which takes full advantage of the subsystem DFT density partitioning technique. The method is benchmarked against coupled-cluster calculations and achieves chemical accuracy for the systems considered for intermolecular separations ranging from hydrogen-bond distances to tens of Ångstroms. Numerical examples are provided for molecular clusters comprised of up to 56 non-covalently bound molecules.

  13. A proposed method for enhanced eigen-pair extraction using finite element methods: Theory and application

    NASA Technical Reports Server (NTRS)

    Jara-Almonte, J.; Mitchell, L. D.

    1988-01-01

    The paper covers two distinct parts: theory and application. The goal of this work was the reduction of model size with an increase in eigenvalue/vector accuracy. This method is ideal for the condensation of large truss- or beam-type structures. The theoretical approach involves the conversion of a continuum transfer matrix beam element into an 'Exact' dynamic stiffness element. This formulation is implemented in a finite element environment. This results in the need to solve a transcendental eigenvalue problem. Once the eigenvalue is determined the eigenvectors can be reconstructed with any desired spatial precision. No discretization limitations are imposed on the reconstruction. The results of such a combined finite element and transfer matrix formulation is a much smaller FEM eigenvalue problem. This formulation has the ability to extract higher eigenvalues as easily and as accurately as lower eigenvalues. Moreover, one can extract many more eigenvalues/vectors from the model than the number of degrees of freedom in the FEM formulation. Typically, the number of eigenvalues accurately extractable via the 'Exact' element method are at least 8 times the number of degrees of freedom. In contrast, the FEM usually extracts one accurate (within 5 percent) eigenvalue for each 3-4 degrees of freedom. The 'Exact' element results in a 20-30 improvement in the number of accurately extractable eigenvalues and eigenvectors.

  14. Non-matrix Matched Glass Disk Calibration Standards Improve XRF Micronutrient Analysis of Wheat Grain across Five Laboratories in India

    PubMed Central

    Guild, Georgia E.; Stangoulis, James C. R.

    2016-01-01

    Within the HarvestPlus program there are many collaborators currently using X-Ray Fluorescence (XRF) spectroscopy to measure Fe and Zn in their target crops. In India, five HarvestPlus wheat collaborators have laboratories that conduct this analysis and their throughput has increased significantly. The benefits of using XRF are its ease of use, minimal sample preparation and high throughput analysis. The lack of commercially available calibration standards has led to a need for alternative calibration arrangements for many of the instruments. Consequently, the majority of instruments have either been installed with an electronic transfer of an original grain calibration set developed by a preferred lab, or a locally supplied calibration. Unfortunately, neither of these methods has been entirely successful. The electronic transfer is unable to account for small variations between the instruments, whereas the use of a locally provided calibration set is heavily reliant on the accuracy of the reference analysis method, which is particularly difficult to achieve when analyzing low levels of micronutrient. Consequently, we have developed a calibration method that uses non-matrix matched glass disks. Here we present the validation of this method and show this calibration approach can improve the reproducibility and accuracy of whole grain wheat analysis on 5 different XRF instruments across the HarvestPlus breeding program. PMID:27375644

  15. A method to model latent heat for transient analysis using NASTRAN

    NASA Technical Reports Server (NTRS)

    Harder, R. L.

    1982-01-01

    A sample heat transfer analysis is demonstrated which includes the heat of fusion. The method can be used to analyze a system with nonconstant specific heat. The enthalpy is introduced as an independent degree of freedom at each node. The user input consists of a curve of temperature as a function of enthalpy, which may include a constant temperature phase change. The basic NASTRAN heat transfer capability is used to model the effects of latent heat with existing direct matrix output and nonlinear load data cards. Although some user care is required, the numerical stability of the integration is quite good when the given recommendations are followed. The theoretical equations used and the NASTRAN techniques are shown.

  16. Acta Aeronautica et Astronautica Sinica (Selected Articles),

    DTIC Science & Technology

    1986-05-09

    Let us assume the third vibration mode. Then, the matrix form of the coupled linear equations is obtained as follows: 30 L. -i .- *’ v j h 1. - Y I - u5...F When higher vibration modes are considered, the same m~ethod can be used. From eqn. (31,we have the transfer functions: A c,37 + Cse+ C,s+ C, $+ C’s... vibration modes of the gyro at point 1 with respect to x. Then, transfer function, .WO (s) is s)=W, 1( I )W, 1 ( s ) 2( 1 )W,( S T- ( I s ) l, 3 7+1,s+1 1 ls

  17. Transfer matrix approach to electron transport in monolayer MoS2/MoO x heterostructures

    NASA Astrophysics Data System (ADS)

    Li, Gen

    2018-05-01

    Oxygen plasma treatment can introduce oxidation into monolayer MoS2 to transfer MoS2 into MoO x , causing the formation of MoS2/MoO x heterostructures. We find the MoS2/MoO x heterostructures have the similar geometry compared with GaAs/Ga1‑x Al x As semiconductor superlattice. Thus, We employ the established transfer matrix method to analyse the electron transport in the MoS2/MoO x heterostructures with double-well and step-well geometries. We also considere the coupling between transverse and longitudinal kinetic energy because the electron effective mass changes spatially in the MoS2/MoO x heterostructures. We find the resonant peaks show red shift with the increasing of transverse momentum, which is similar to the previous work studying the transverse-momentum-dependent transmission in GaAs/Ga1‑x Al x As double-barrier structure. We find electric field can enhance the magnitude of peaks and intensify the coupling between longitudinal and transverse momentums. Moreover, higher bias is applied to optimize resonant tunnelling condition to show negative differential effect can be observed in the MoS2/MoO x system.

  18. A discrete spherical harmonics method for radiative transfer analysis in inhomogeneous polarized planar atmosphere

    NASA Astrophysics Data System (ADS)

    Tapimo, Romuald; Tagne Kamdem, Hervé Thierry; Yemele, David

    2018-03-01

    A discrete spherical harmonics method is developed for the radiative transfer problem in inhomogeneous polarized planar atmosphere illuminated at the top by a collimated sunlight while the bottom reflects the radiation. The method expands both the Stokes vector and the phase matrix in a finite series of generalized spherical functions and the resulting vector radiative transfer equation is expressed in a set of polar directions. Hence, the polarized characteristics of the radiance within the atmosphere at any polar direction and azimuthal angle can be determined without linearization and/or interpolations. The spatial dependent of the problem is solved using the spectral Chebyshev method. The emergent and transmitted radiative intensity and the degree of polarization are predicted for both Rayleigh and Mie scattering. The discrete spherical harmonics method predictions for optical thin atmosphere using 36 streams are found in good agreement with benchmark literature results. The maximum deviation between the proposed method and literature results and for polar directions \\vert μ \\vert ≥0.1 is less than 0.5% and 0.9% for the Rayleigh and Mie scattering, respectively. These deviations for directions close to zero are about 3% and 10% for Rayleigh and Mie scattering, respectively.

  19. Efficient computer algebra algorithms for polynomial matrices in control design

    NASA Technical Reports Server (NTRS)

    Baras, J. S.; Macenany, D. C.; Munach, R.

    1989-01-01

    The theory of polynomial matrices plays a key role in the design and analysis of multi-input multi-output control and communications systems using frequency domain methods. Examples include coprime factorizations of transfer functions, cannonical realizations from matrix fraction descriptions, and the transfer function design of feedback compensators. Typically, such problems abstract in a natural way to the need to solve systems of Diophantine equations or systems of linear equations over polynomials. These and other problems involving polynomial matrices can in turn be reduced to polynomial matrix triangularization procedures, a result which is not surprising given the importance of matrix triangularization techniques in numerical linear algebra. Matrices with entries from a field and Gaussian elimination play a fundamental role in understanding the triangularization process. In the case of polynomial matrices, matrices with entries from a ring for which Gaussian elimination is not defined and triangularization is accomplished by what is quite properly called Euclidean elimination. Unfortunately, the numerical stability and sensitivity issues which accompany floating point approaches to Euclidean elimination are not very well understood. New algorithms are presented which circumvent entirely such numerical issues through the use of exact, symbolic methods in computer algebra. The use of such error-free algorithms guarantees that the results are accurate to within the precision of the model data--the best that can be hoped for. Care must be taken in the design of such algorithms due to the phenomenon of intermediate expressions swell.

  20. Magneto-phonon polaritons of antiferromagnetic/ion-crystal superlattices

    NASA Astrophysics Data System (ADS)

    Ta, Jin-Xing; Song, Yu-Ling; Wang, Xuan-Zhang

    2010-07-01

    Magnetophonon polaritons in the superlattices composed of alternating antiferromagnetic and ion-crystal components are investigated with the transfer matrix method. Numerical simulations based on FeF2/TlBr superlattices show that there are four different bulk polariton bands, with negative refraction and positive refraction. Many surface polariton modes with various features arise around the bulk bands with negative refraction.

  1. Transient Thermal State of an Active Braille Matrix with Incorporated Thermal Actuators by Means of Finite Element Method

    ERIC Educational Resources Information Center

    Alutei, Alexandra-Maria; Szelitzky, Emoke; Mandru, Dan

    2013-01-01

    In this article the authors present the transient thermal analysis for a developed thermal linear actuator based on wax paraffin used to drive the cells of a Braille device. A numerical investigation of transient heat transfer phenomenon during paraffin melting and solidification in an encapsulated recipient has been carried out using the ANSYS…

  2. Advanced Physical Models and Numerical Methods for High Enthalpy and Plasma Flows Applied to Hypersonics

    DTIC Science & Technology

    2011-07-28

    4874–48??, 1970. [16] R. O. Jung , J. B. Boffard, L. W. Anderson, and C. C. Lin. Electron-impact excitation cross sections from the xenon j = 2...Journal of Quantitative Spectroscopy and Radiative Transfer, 5(2):503– 510, 1965. [35] O. Zatsarinny and K. Bartschat. B -spline Breit- Pauli R-matrix

  3. A mixture approach to the acoustic properties of a macroscopically inhomogeneous porous aluminum in the equivalent fluid approximation.

    PubMed

    Sacristan, C J; Dupont, T; Sicot, O; Leclaire, P; Verdière, K; Panneton, R; Gong, X L

    2016-10-01

    The acoustic properties of an air-saturated macroscopically inhomogeneous aluminum foam in the equivalent fluid approximation are studied. A reference sample built by forcing a highly compressible melamine foam with conical shape inside a constant diameter rigid tube is studied first. In this process, a radial compression varying with depth is applied. With the help of an assumption on the compressed pore geometry, properties of the reference sample can be modelled everywhere in the thickness and it is possible to use the classical transfer matrix method as theoretical reference. In the mixture approach, the material is viewed as a mixture of two known materials placed in a patchwork configuration and with proportions of each varying with depth. The properties are derived from the use of a mixing law. For the reference sample, the classical transfer matrix method is used to validate the experimental results. These results are used to validate the mixture approach. The mixture approach is then used to characterize a porous aluminium for which only the properties of the external faces are known. A porosity profile is needed and is obtained from the simulated annealing optimization process.

  4. Transient radiative transfer in a scattering slab considering polarization.

    PubMed

    Yi, Hongliang; Ben, Xun; Tan, Heping

    2013-11-04

    The characteristics of the transient and polarization must be considered for a complete and correct description of short-pulse laser transfer in a scattering medium. A Monte Carlo (MC) method combined with a time shift and superposition principle is developed to simulate transient vector (polarized) radiative transfer in a scattering medium. The transient vector radiative transfer matrix (TVRTM) is defined to describe the transient polarization behavior of short-pulse laser propagating in the scattering medium. According to the definition of reflectivity, a new criterion of reflection at Fresnel surface is presented. In order to improve the computational efficiency and accuracy, a time shift and superposition principle is applied to the MC model for transient vector radiative transfer. The results for transient scalar radiative transfer and steady-state vector radiative transfer are compared with those in published literatures, respectively, and an excellent agreement between them is observed, which validates the correctness of the present model. Finally, transient radiative transfer is simulated considering the polarization effect of short-pulse laser in a scattering medium, and the distributions of Stokes vector in angular and temporal space are presented.

  5. Dispersion relations of elastic waves in one-dimensional piezoelectric/piezomagnetic phononic crystal with functionally graded interlayers.

    PubMed

    Guo, Xiao; Wei, Peijun; Lan, Man; Li, Li

    2016-08-01

    The effects of functionally graded interlayers on dispersion relations of elastic waves in a one-dimensional piezoelectric/piezomagnetic phononic crystal are studied in this paper. First, the state transfer equation of the functionally graded interlayer is derived from the motion equation by the reduction of order (from second order to first order). The transfer matrix of the functionally graded interlayer is obtained by solving the state transfer equation with the spatial-varying coefficient. Based on the transfer matrixes of the piezoelectric slab, the piezomagnetic slab and the functionally graded interlayers, the total transfer matrix of a single cell is obtained. Further, the Bloch theorem is used to obtain the resultant dispersion equations of in-plane and anti-plane Bloch waves. The dispersion equations are solved numerically and the numerical results are shown graphically. Five kinds of profiles of functionally graded interlayers between a piezoelectric slab and a piezomagnetic slab are considered. It is shown that the functionally graded interlayers have evident influences on the dispersion curves and the band gaps. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Internal damping due to dislocation movements induced by thermal expansion mismatch between matrix and particles in metal matrix composites. [Al/SiC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Girand, C.; Lormand, G.; Fougeres, R.

    In metal matrix composites (MMCs), the mechanical 1 of the reinforcement-matrix interface is an important parameter because it governs the load transfer from matrix to particles, from which the mechanical properties of these materials are derived. Therefore, it would be useful to set out an experimental method able to characterize the interface and the adjacent matrix behaviors. Thus, a study has been undertaken by means of internal damping (I.D.) measurements, which are well known to be very sensitive for studying irreversible displacements at the atomic scale. More especially, this investigation is based on the fact that, during cooling of MMC's,more » stress concentrations originating from differences in coefficients of thermal expansion (C.T.E.) of matrix and particles should induce dislocation movements in the matrix surrounding the reinforcement; that is, local microplastic strains occur. Therefore, during I.D. measurements vs temperature these movements should contribute to MMCs I.D. in a process similar to those involved around first order phase transitions in solids. The aim of this paper is to present, in the case of Al/SiC particulate composites, new developments of this approach that has previously led to promising results in the case of Al-Si alloys.« less

  7. Experimental Waterflow Determination of the Dynamic Hydraulic Transfer Function for the J-2X Oxidizer Turbopump. Part Two; Results and Interpretation

    NASA Technical Reports Server (NTRS)

    Zoladz, Tom; Patel, Sandeep; Lee, Erik; Karon, Dave

    2011-01-01

    Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

  8. Artificial dispersion via high-order homogenization: magnetoelectric coupling and magnetism from dielectric layers

    PubMed Central

    Liu, Yan; Guenneau, Sébastien; Gralak, Boris

    2013-01-01

    We investigate a high-order homogenization (HOH) algorithm for periodic multi-layered stacks. The mathematical tool of choice is a transfer matrix method. Expressions for effective permeability, permittivity and magnetoelectric coupling are explored by frequency power expansions. On the physical side, this HOH uncovers a magnetoelectric coupling effect (odd-order approximation) and artificial magnetism (even-order approximation) in moderate contrast photonic crystals. Comparing the effective parameters' expressions of a stack with three layers against that of a stack with two layers, we note that the magnetoelectric coupling effect vanishes while the artificial magnetism can still be achieved in a centre-symmetric periodic structure. Furthermore, we numerically check the effective parameters through the dispersion law and transmission property of a stack with two dielectric layers against that of an effective bianisotropic medium: they are in good agreement throughout the low-frequency (acoustic) band until the first stop band, where the analyticity of the logarithm function of the transfer matrix () breaks down. PMID:24101891

  9. Exactly solved mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy

    NASA Astrophysics Data System (ADS)

    Lisnyi, Bohdan; Strečka, Jozef

    2015-03-01

    The mixed spin-(1,1/2) Ising-Heisenberg diamond chain with a single-ion anisotropy is exactly solved through the generalized decoration-iteration transformation and the transfer-matrix method. The decoration-iteration transformation is first used for establishing a rigorous mapping equivalence with the corresponding spin-1 Blume-Emery-Griffiths chain, which is subsequently exactly treated within the transfer-matrix technique. Apart from three classical ground states the model exhibits three striking quantum ground states in which a singlet-dimer state of the interstitial Heisenberg spins is accompanied either with a frustrated state or a polarized state or a non-magnetic state of the nodal Ising spins. It is evidenced that two magnetization plateaus at zero and/or one-half of the saturation magnetization may appear in low-temperature magnetization curves. The specific heat may display remarkable temperature dependences with up to three and four distinct round maxima in a zero and non-zero magnetic field, respectively.

  10. High-flexibility combinatorial peptide synthesis with laser-based transfer of monomers in solid matrix material.

    PubMed

    Loeffler, Felix F; Foertsch, Tobias C; Popov, Roman; Mattes, Daniela S; Schlageter, Martin; Sedlmayr, Martyna; Ridder, Barbara; Dang, Florian-Xuan; von Bojničić-Kninski, Clemens; Weber, Laura K; Fischer, Andrea; Greifenstein, Juliane; Bykovskaya, Valentina; Buliev, Ivan; Bischoff, F Ralf; Hahn, Lothar; Meier, Michael A R; Bräse, Stefan; Powell, Annie K; Balaban, Teodor Silviu; Breitling, Frank; Nesterov-Mueller, Alexander

    2016-06-14

    Laser writing is used to structure surfaces in many different ways in materials and life sciences. However, combinatorial patterning applications are still limited. Here we present a method for cost-efficient combinatorial synthesis of very-high-density peptide arrays with natural and synthetic monomers. A laser automatically transfers nanometre-thin solid material spots from different donor slides to an acceptor. Each donor bears a thin polymer film, embedding one type of monomer. Coupling occurs in a separate heating step, where the matrix becomes viscous and building blocks diffuse and couple to the acceptor surface. Furthermore, we can consecutively deposit two material layers of activation reagents and amino acids. Subsequent heat-induced mixing facilitates an in situ activation and coupling of the monomers. This allows us to incorporate building blocks with click chemistry compatibility or a large variety of commercially available non-activated, for example, posttranslationally modified building blocks into the array's peptides with >17,000 spots per cm(2).

  11. Modal density of rectangular structures in a wide frequency range

    NASA Astrophysics Data System (ADS)

    Parrinello, A.; Ghiringhelli, G. L.

    2018-04-01

    A novel approach to investigate the modal density of a rectangular structure in a wide frequency range is presented. First, the modal density is derived, in the whole frequency range of interest, on the basis of sound transmission through the infinite counterpart of the structure; then, it is corrected by means of the low-frequency modal behavior of the structure, taking into account actual size and boundary conditions. A statistical analysis reveals the connection between the modal density of the structure and the transmission of sound through its thickness. A transfer matrix approach is used to compute the required acoustic parameters, making it possible to deal with structures having arbitrary stratifications of different layers. A finite element method is applied on coarse grids to derive the first few eigenfrequencies required to correct the modal density. Both the transfer matrix approach and the coarse grids involved in the finite element analysis grant high efficiency. Comparison with alternative formulations demonstrates the effectiveness of the proposed methodology.

  12. Quantization of an electromagnetic field in two-dimensional photonic structures based on the scattering matrix formalism ( S-quantization)

    NASA Astrophysics Data System (ADS)

    Ivanov, K. A.; Nikolaev, V. V.; Gubaydullin, A. R.; Kaliteevski, M. A.

    2017-10-01

    Based on the scattering matrix formalism, we have developed a method of quantization of an electromagnetic field in two-dimensional photonic nanostructures ( S-quantization in the two-dimensional case). In this method, the fields at the boundaries of the quantization box are expanded into a Fourier series and are related with each other by the scattering matrix of the system, which is the product of matrices describing the propagation of plane waves in empty regions of the quantization box and the scattering matrix of the photonic structure (or an arbitrary inhomogeneity). The quantization condition (similarly to the onedimensional case) is formulated as follows: the eigenvalues of the scattering matrix are equal to unity, which corresponds to the fact that the set of waves that are incident on the structure (components of the expansion into the Fourier series) is equal to the set of waves that travel away from the structure (outgoing waves). The coefficients of the matrix of scattering through the inhomogeneous structure have been calculated using the following procedure: the structure is divided into parallel layers such that the permittivity in each layer varies only along the axis that is perpendicular to the layers. Using the Fourier transform, the Maxwell equations have been written in the form of a matrix that relates the Fourier components of the electric field at the boundaries of neighboring layers. The product of these matrices is the transfer matrix in the basis of the Fourier components of the electric field. Represented in a block form, it is composed by matrices that contain the reflection and transmission coefficients for the Fourier components of the field, which, in turn, constitute the scattering matrix. The developed method considerably simplifies the calculation scheme for the analysis of the behavior of the electromagnetic field in structures with a two-dimensional inhomogeneity. In addition, this method makes it possible to obviate difficulties that arise in the analysis of the Purcell effect because of the divergence of the integral describing the effective volume of the mode in open systems.

  13. Study of Anti-Vortex Baffle Effect in Suppressing Swirling Flow in LOX Tank

    NASA Technical Reports Server (NTRS)

    Yang, H. Q.; Peugeot, John

    2011-01-01

    Experimental results describing the hydraulic dynamic pump transfer matrix (Yp) for a cavitating J-2X oxidizer turbopump inducer+impeller tested in subscale waterflow are presented. The transfer function is required for integrated vehicle pogo stability analysis as well as optimization of local inducer pumping stability. Dynamic transfer functions across widely varying pump hydrodynamic inlet conditions are extracted from measured data in conjunction with 1D-model based corrections. Derived Dynamic transfer functions are initially interpreted relative to traditional Pogo pump equations. Water-to-liquid oxygen scaling of measured cavitation characteristics are discussed. Comparison of key dynamic transfer matrix terms derived from waterflow testing are made with those implemented in preliminary Ares Upper Stage Pogo stability modeling. Alternate cavitating pump hydraulic dynamic equations are suggested which better reflect frequency dependencies of measured transfer matrices.

  14. LANDSAT-D investigations in snow hydrology

    NASA Technical Reports Server (NTRS)

    Dozier, J.

    1983-01-01

    Progress on the registration of TM data to digital topographic data; on comparison of TM, MSS and NOAA meteorological satellite data for snowcover mapping; and on radiative transfer models for atmospheric correction is reported. Some methods for analyzing spatial contiguity of snow within the snow covered area were selected. The methods are based on a two-channel version of the grey level co-occurence matrix, combined with edge detection derived from an algorithm for computing slopes and exposures from digital terrain data.

  15. Seamless metal-clad fiber-reinforced organic matrix composite structures and process for their manufacture

    NASA Technical Reports Server (NTRS)

    Bluck, Raymond M. (Inventor); Bush, Harold G. (Inventor); Johnson, Robert R. (Inventor)

    1990-01-01

    A metallic outer sleeve is provided which is capable of enveloping a hollow metallic inner member having continuous reinforcing fibers attached to the distal end thereof. The inner member is then introduced into outer sleeve until inner member is completely enveloped by outer sleeve. A liquid matrix member is then injected into space between inner member and outer sleeve. A pressurized heat transfer medium is flowed through the inside of inner member, thereby forming a fiber reinforced matrix composite material. The wall thicknesses of both inner member and outer sleeve are then reduced to the appropriate size by chemical etching, to adjust the thermal expansion coefficient of the metal-clad composite structure to the desired value. thereby forming a fiber reinforced matrix composite material. The wall thicknesses of both inner member and outer sleeve are then reduced to the appropriate size by chemical etching, to adjust the thermal expansion coefficient of the metal-clad composite structure to the desired value. The novelty of this invention resides in the development of a efficient method of producing seamless metal clad fiber reinforced organic matrix composite structures.

  16. Registration using natural features for augmented reality systems.

    PubMed

    Yuan, M L; Ong, S K; Nee, A Y C

    2006-01-01

    Registration is one of the most difficult problems in augmented reality (AR) systems. In this paper, a simple registration method using natural features based on the projective reconstruction technique is proposed. This method consists of two steps: embedding and rendering. Embedding involves specifying four points to build the world coordinate system on which a virtual object will be superimposed. In rendering, the Kanade-Lucas-Tomasi (KLT) feature tracker is used to track the natural feature correspondences in the live video. The natural features that have been tracked are used to estimate the corresponding projective matrix in the image sequence. Next, the projective reconstruction technique is used to transfer the four specified points to compute the registration matrix for augmentation. This paper also proposes a robust method for estimating the projective matrix, where the natural features that have been tracked are normalized (translation and scaling) and used as the input data. The estimated projective matrix will be used as an initial estimate for a nonlinear optimization method that minimizes the actual residual errors based on the Levenberg-Marquardt (LM) minimization method, thus making the results more robust and stable. The proposed registration method has three major advantages: 1) It is simple, as no predefined fiducials or markers are used for registration for either indoor and outdoor AR applications. 2) It is robust, because it remains effective as long as at least six natural features are tracked during the entire augmentation, and the existence of the corresponding projective matrices in the live video is guaranteed. Meanwhile, the robust method to estimate the projective matrix can obtain stable results even when there are some outliers during the tracking process. 3) Virtual objects can still be superimposed on the specified areas, even if some parts of the areas are occluded during the entire process. Some indoor and outdoor experiments have been conducted to validate the performance of this proposed method.

  17. A nonequilibrium model for reactive contaminant transport through fractured porous media: Model development and semianalytical solution

    NASA Astrophysics Data System (ADS)

    Joshi, Nitin; Ojha, C. S. P.; Sharma, P. K.

    2012-10-01

    In this study a conceptual model that accounts for the effects of nonequilibrium contaminant transport in a fractured porous media is developed. Present model accounts for both physical and sorption nonequilibrium. Analytical solution was developed using the Laplace transform technique, which was then numerically inverted to obtain solute concentration in the fracture matrix system. The semianalytical solution developed here can incorporate both semi-infinite and finite fracture matrix extent. In addition, the model can account for flexible boundary conditions and nonzero initial condition in the fracture matrix system. The present semianalytical solution was validated against the existing analytical solutions for the fracture matrix system. In order to differentiate between various sorption/transport mechanism different cases of sorption and mass transfer were analyzed by comparing the breakthrough curves and temporal moments. It was found that significant differences in the signature of sorption and mass transfer exists. Applicability of the developed model was evaluated by simulating the published experimental data of Calcium and Strontium transport in a single fracture. The present model simulated the experimental data reasonably well in comparison to the model based on equilibrium sorption assumption in fracture matrix system, and multi rate mass transfer model.

  18. Macro- to microscale strain transfer in fibrous tissues is heterogeneous and tissue-specific.

    PubMed

    Han, Woojin M; Heo, Su-Jin; Driscoll, Tristan P; Smith, Lachlan J; Mauck, Robert L; Elliott, Dawn M

    2013-08-06

    Mechanical deformation applied at the joint or tissue level is transmitted through the macroscale extracellular matrix to the microscale local matrix, where it is transduced to cells within these tissues and modulates tissue growth, maintenance, and repair. The objective of this study was to investigate how applied tissue strain is transferred through the local matrix to the cell and nucleus in meniscus, tendon, and the annulus fibrosus, as well as in stem cell-seeded scaffolds engineered to reproduce the organized microstructure of these native tissues. To carry out this study, we developed a custom confocal microscope-mounted tensile testing device and simultaneously monitored strain across multiple length scales. Results showed that mean strain was heterogeneous and significantly attenuated, but coordinated, at the local matrix level in native tissues (35-70% strain attenuation). Conversely, freshly seeded scaffolds exhibited very direct and uniform strain transfer from the tissue to the local matrix level (15-25% strain attenuation). In addition, strain transfer from local matrix to cells and nuclei was dependent on fiber orientation and tissue type. Histological analysis suggested that different domains exist within these fibrous tissues, with most of the tissue being fibrous, characterized by an aligned collagen structure and elongated cells, and other regions being proteoglycan (PG)-rich, characterized by a dense accumulation of PGs and rounder cells. In meniscus, the observed heterogeneity in strain transfer correlated strongly with cellular morphology, where rounder cells located in PG-rich microdomains were shielded from deformation, while elongated cells in fibrous microdomains deformed readily. Collectively, these findings suggest that different tissues utilize distinct strain-attenuating mechanisms according to their unique structure and cellular phenotype, and these differences likely alter the local biologic response of such tissues and constructs in response to mechanical perturbation. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. Assessing transfer property and reliability of urban bus network based on complex network theory

    NASA Astrophysics Data System (ADS)

    Zhang, Hui; Zhuge, Cheng-Xiang; Zhao, Xiang; Song, Wen-Bo

    Transfer reliability has an important impact on the urban bus network. The proportion of zero and one transfer time is a key indicator to measure the connectivity of bus networks. However, it is hard to calculate the transfer time between nodes because of the complicated network structure. In this paper, the topological structures of urban bus network in Jinan are constructed by space L and space P. A method to calculate transfer times between stations has been proposed by reachable matrix under space P. The result shows that it is efficient to calculate the transfer time between nodes in large networks. In order to test the transfer reliability, a node failure process has been built according to degree, clustering coefficient and betweenness centrality under space L and space P. The results show that the deliberate attack by betweenness centrality under space P is more effective compared with other five attack modes. This research could provide a power tool to find hub stations in bus networks and give a help for traffic manager to guarantee the normal operation of urban bus systems.

  20. The application of S-transformation and M-2DPCA in I.C. Engine fault diagnosis

    NASA Astrophysics Data System (ADS)

    Zhang, Shixiong; Cai, Yanping; Mu, Weijie

    2017-04-01

    According to the problem of parameter selection and feature extraction for vibration diagnosis of traditional internal combustion engine is discussed. The method based on S-transformation and Module Two Dimensional Principal Components Analysis (M-2DPCA) is proposed to carry out fault diagnosis of I.C. Engine valve mechanism. First of all, the method transfers cylinder surface vibration signals of I.C. into images through S-transform. The second, extracting the optimized projection vectors from the general distribution matrix G which is obtained by all sample sub-images, so that vibration spectrum images can be modularized using M-2DPCA. The last, these features matrix obtained from images project will served as the enters of nearest neighbor classifier, it is used to achieve fault types' division. The method is applied to the diagnosis example of the vibration signal of the valve mechanism eight operating modes, recognition rate up to 94.17 percent; the effectiveness of the proposed method is proved.

  1. Many-body expansion of the Fock matrix in the fragment molecular orbital method

    NASA Astrophysics Data System (ADS)

    Fedorov, Dmitri G.; Kitaura, Kazuo

    2017-09-01

    A many-body expansion of the Fock matrix in the fragment molecular orbital method is derived up to three-body terms for restricted Hartree-Fock and density functional theory in the atomic orbital basis and compared to the expansion in the basis of fragment molecular orbitals (MOs). The physical nature of many-body corrections is revealed in terms of charge transfer terms. An improvement of the fragment MO expansion is proposed by adding exchange to the embedding. The accuracy of all developed methods is demonstrated in comparison to unfragmented results for polyalanines, a water cluster, Trp-cage (PDB: 1L2Y) and crambin (PDB: 1CRN) proteins, a zeolite cluster, a Si nano-wire, and a boron nitride ribbon. The physical nature of metallicity is discussed, and it is shown what kinds of metallic systems can be treated by fragment-based methods. The density of states is calculated for a fully closed and a partially open nano-ring of boron nitride with a diameter of 105 nm.

  2. Simplified Dynamic Analysis of Grinders Spindle Node

    NASA Astrophysics Data System (ADS)

    Demec, Peter

    2014-12-01

    The contribution deals with the simplified dynamic analysis of surface grinding machine spindle node. Dynamic analysis is based on the use of the transfer matrix method, which is essentially a matrix form of method of initial parameters. The advantage of the described method, despite the seemingly complex mathematical apparatus, is primarily, that it does not require for solve the problem of costly commercial software using finite element method. All calculations can be made for example in MS Excel, which is advantageous especially in the initial stages of constructing of spindle node for the rapid assessment of the suitability its design. After detailing the entire structure of spindle node is then also necessary to perform the refined dynamic analysis in the environment of FEM, which it requires the necessary skills and experience and it is therefore economically difficult. This work was developed within grant project KEGA No. 023TUKE-4/2012 Creation of a comprehensive educational - teaching material for the article Production technique using a combination of traditional and modern information technology and e-learning.

  3. Theoretical investigation of the force and dynamically coupled torsional-axial-lateral dynamic response of eared rotors

    NASA Technical Reports Server (NTRS)

    David, J. W.; Mitchell, L. D.

    1982-01-01

    Difficulties in solution methodology to be used to deal with the potentially higher nonlinear rotor equations when dynamic coupling is included. A solution methodology is selected to solve the nonlinear differential equations. The selected method was verified to give good results even at large nonlinearity levels. The transfer matrix methodology is extended to the solution of nonlinear problems.

  4. Sensitivity Equation Derivation for Transient Heat Transfer Problems

    NASA Technical Reports Server (NTRS)

    Hou, Gene; Chien, Ta-Cheng; Sheen, Jeenson

    2004-01-01

    The focus of the paper is on the derivation of sensitivity equations for transient heat transfer problems modeled by different discretization processes. Two examples will be used in this study to facilitate the discussion. The first example is a coupled, transient heat transfer problem that simulates the press molding process in fabrication of composite laminates. These state equations are discretized into standard h-version finite elements and solved by a multiple step, predictor-corrector scheme. The sensitivity analysis results based upon the direct and adjoint variable approaches will be presented. The second example is a nonlinear transient heat transfer problem solved by a p-version time-discontinuous Galerkin's Method. The resulting matrix equation of the state equation is simply in the form of Ax = b, representing a single step, time marching scheme. A direct differentiation approach will be used to compute the thermal sensitivities of a sample 2D problem.

  5. Optimal trajectories for aeroassisted orbital transfer

    NASA Technical Reports Server (NTRS)

    Miele, A.; Venkataraman, P.

    1983-01-01

    Consideration is given to classical and minimax problems involved in aeroassisted transfer from high earth orbit (HEO) to low earth orbit (LEO). The transfer is restricted to coplanar operation, with trajectory control effected by means of lift modulation. The performance of the maneuver is indexed to the energy expenditure or, alternatively, the time integral of the heating rate. Firist-order optimality conditions are defined for the classical approach, as are a sequential gradient-restoration algorithm and a combined gradient-restoration algorithm. Minimization techniques are presented for the aeroassisted transfer energy consumption and time-delay integral of the heating rate, as well as minimization of the pressure. It is shown that the eigenvalues of the Jacobian matrix of the differential system is both stiff and unstable, implying that the sequential gradient restoration algorithm in its present version is unsuitable. A new method, involving a multipoint approach to the two-poing boundary value problem, is recommended.

  6. Design of a Matrix Transducer for Three-Dimensional Second Harmonic Transesophageal Echocardiography

    NASA Astrophysics Data System (ADS)

    Blaak, Sandra; van Neer, Paul L. M. J.; Prins, Christian; Bosch, Johan G.; Lancée, Charles T.; van der Steen, Antonius F. W.; de Jong, Nico

    Three-dimensional (3D) echocardiography visualizes the 3D anatomy and function of the heart. For 3D imaging an ultrasound matrix of several thousands of elements is required. To connect the matrix to an external imaging system, smart signal processing with integrated circuitry in the tip of the TEE probe is required for channel reduction. To separate the low voltage integrated receive circuitry from the high voltages required for transmission, our design features a separate transmit and receive subarray. In this study we focus on the transmit subarray. A 3D model of an individual element was developed using the finite element method (FEM). The model was validated by laser interferometer and acoustic measurements. Measurement and simulations matched well. The maximum transmit transfer was 3 nm/V at 2.4 MHz for both the FEM simulation of an element in air and the laser interferometer measurement. The FEM simulation of an element in water resulted in a maximum transfer of 43 kPa/V at 2.3 MHz and the acoustic measurement in 55 kPa/V at 2.5 MHz. The maximum pressure is ~1 MPa/120Vpp, which is sufficient pressure for second harmonic imaging. The proposed design of the transmit subarray is suitable for its role in a 3D 2H TEE probe.

  7. Charge transfer collisions of Si^3+ with H at low energies

    NASA Astrophysics Data System (ADS)

    Joseph, D. C.; Gu, J. P.; Saha, B. C.

    2009-11-01

    Charge transfer of positively charged ions with atomic hydrogen is important not only in magnetically confined plasmas between impurity ions and H atoms from the chamber walls influences the overall ionization balance and effects the plasma cooling but also in astrophysics, where it plays a key role in determining the properties of the observed gas. It also provides a recombination mechanism for multiply charged ions in X-ray ionized astronomical environments. We report an investigation using the molecular-orbital close-coupling (MOCC) method, both quantum mechanically and semi-classically, in the adiabatic representation. Ab initio adiabatic potentials and coupling matrix elements--radial and angular--are calculated using the MRD-CI method. Comparison of our results with other theoretical as well as experimental findings will be discussed.

  8. An Embedded 3D Fracture Modeling Approach for Simulating Fracture-Dominated Fluid Flow and Heat Transfer in Geothermal Reservoirs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnston, Henry; Wang, Cong; Winterfeld, Philip

    An efficient modeling approach is described for incorporating arbitrary 3D, discrete fractures, such as hydraulic fractures or faults, into modeling fracture-dominated fluid flow and heat transfer in fractured geothermal reservoirs. This technique allows 3D discrete fractures to be discretized independently from surrounding rock volume and inserted explicitly into a primary fracture/matrix grid, generated without including 3D discrete fractures in prior. An effective computational algorithm is developed to discretize these 3D discrete fractures and construct local connections between 3D fractures and fracture/matrix grid blocks of representing the surrounding rock volume. The constructed gridding information on 3D fractures is then added tomore » the primary grid. This embedded fracture modeling approach can be directly implemented into a developed geothermal reservoir simulator via the integral finite difference (IFD) method or with TOUGH2 technology This embedded fracture modeling approach is very promising and computationally efficient to handle realistic 3D discrete fractures with complicated geometries, connections, and spatial distributions. Compared with other fracture modeling approaches, it avoids cumbersome 3D unstructured, local refining procedures, and increases computational efficiency by simplifying Jacobian matrix size and sparsity, while keeps sufficient accuracy. Several numeral simulations are present to demonstrate the utility and robustness of the proposed technique. Our numerical experiments show that this approach captures all the key patterns about fluid flow and heat transfer dominated by fractures in these cases. Thus, this approach is readily available to simulation of fractured geothermal reservoirs with both artificial and natural fractures.« less

  9. Microseed matrix screening for optimization in protein crystallization: what have we learned?

    PubMed

    D'Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W; Marsh, May

    2014-09-01

    Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems.

  10. Microseed matrix screening for optimization in protein crystallization: what have we learned?

    PubMed Central

    D’Arcy, Allan; Bergfors, Terese; Cowan-Jacob, Sandra W.; Marsh, May

    2014-01-01

    Protein crystals obtained in initial screens typically require optimization before they are of X-ray diffraction quality. Seeding is one such optimization method. In classical seeding experiments, the seed crystals are put into new, albeit similar, conditions. The past decade has seen the emergence of an alternative seeding strategy: microseed matrix screening (MMS). In this strategy, the seed crystals are transferred into conditions unrelated to the seed source. Examples of MMS applications from in-house projects and the literature include the generation of multiple crystal forms and different space groups, better diffracting crystals and crystallization of previously uncrystallizable targets. MMS can be implemented robotically, making it a viable option for drug-discovery programs. In conclusion, MMS is a simple, time- and cost-efficient optimization method that is applicable to many recalcitrant crystallization problems. PMID:25195878

  11. Investigation of solvent-free MALDI-TOFMS sample preparation methods for the analysis of organometallic and coordination compounds.

    PubMed

    Hughes, Laura; Wyatt, Mark F; Stein, Bridget K; Brenton, A Gareth

    2009-01-15

    An investigation of various solvent-free matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOFMS) sample preparation methods for the characterization of organometallic and coordination compounds is described. Such methods are desirable for insoluble materials, compounds that are only soluble in disadvantageous solvents, or complexes that dissociate in solution, all of which present a major "difficulty" to most mass spectrometry techniques. First-row transition metal acetylacetonate complexes, which have been characterized previously by solution preparation MALDI-TOFMS, were used to evaluate the various solvent-free procedures. These procedures comprise two distinct steps: the first being the efficient "solids mixing" (the mixing of sample and matrix), and the second being the effective transfer of the sample/matrix mixture to the MALDI target plate. This investigation shows that vortex mixing is the most efficient first step and that smearing using a microspatula is the most effective second step. In addition, the second step is shown to be much more critical than the first step in obtaining high-quality data. Case studies of truly insoluble materials highlight the importance of these techniques for the wider chemistry community.

  12. Scattering Matrix for Typical Urban Anthropogenic Origin Cement Dust and Discrimination of Representative Atmospheric Particulates

    NASA Astrophysics Data System (ADS)

    Liu, Jia; Zhang, Yongming; Zhang, Qixing; Wang, Jinjun

    2018-03-01

    The complete scattering matrix for cement dust was measured as a function of scattering angle from 5° to 160° at a wavelength of 532 nm, as a representative of mineral dust of anthropogenic origin in urban areas. Other related characteristics of cement dust, such as particle size distribution, chemical composition, refractive index, and micromorphology, were also analyzed. For this objective, a newly improved apparatus was built and calibrated using water droplets. Measurements of water droplets were in good agreement with Lorenz-Mie calculations. To facilitate the direct applicability of measurements for cement dust in radiative transfer calculation, the synthetic scattering matrix was computed and defined over the full scattering angle range from 0° to 180°. The scattering matrices for cement dust and typical natural mineral dusts were found to be similar in trends and angular behaviors. Angular distributions of all matrix elements were confined to rather limited domains. To promote the application of light-scattering matrix in atmospheric observation and remote sensing, discrimination methods for various atmospheric particulates (cement dust, soot, smolder smoke, and water droplets) based on the angular distributions of their scattering matrix elements are discussed. The ratio -F12/F11 proved to be the most effective discrimination method when a single matrix element is employed; aerosol identification can be achieved based on -F12/F11 values at 90° and 160°. Meanwhile, the combinations of -F12/F11 with F22/F11 (or (F11 - F22)/(F11 + F22)) or -F12/F11 with F44/F11 at 160° can be used when multiple matrix elements at the same scattering angle are selected.

  13. Effect of partial heating at mid of vertical plate adjacent to porous medium

    NASA Astrophysics Data System (ADS)

    Mulla, Mohammed Fahimuddin; Pallan, Khalid. M.; Al-Rashed, A. A. A. A.

    2018-05-01

    Heat and mass transfer in porous medium due to heating of vertical plate at mid-section is analyzed for various physical parameters. The heat and mass transfer in porous medium is modeled with the help of momentum, energy and concentration equations in terms of non-dimensional partial differential equations. The partial differential equations are converted into simpler form of algebraic equations with the help of finite element method. A computer code is developed to assemble the matrix form of algebraic equations into global matrices and then to solve them in an iterative manner to obtain the temperature, concentration and streamline distribution inside the porous medium. It is found that the heat transfer behavior of porous medium heated at middle section is considerably different from other cases.

  14. Polarized radiative transfer considering thermal emission in semitransparent media

    NASA Astrophysics Data System (ADS)

    Ben, Xun; Yi, Hong-Liang; Tan, He-Ping

    2014-09-01

    The characteristics of the polarization must be considered for a complete and correct description of radiation transfer in a scattering medium. Observing and identifying the polarizition characteristics of the thermal emission of a hot semitransparent medium have a major significance to analyze the optical responses of the medium for different temperatures. In this paper, a Monte Carlo method is developed for polarzied radiative transfer in a semitransparent medium. There are mainly two kinds of mechanisms leading to polarization of light: specular reflection on the Fresnel boundary and scattering by particles. The determination of scattering direction is the key to solve polarized radiative transfer problem using the Monte Carlo method. An optimized rejection method is used to calculate the scattering angles. In the model, the treatment of specular reflection is also considered, and in the process of tracing photons, the normalization must be applied to the Stokes vector when scattering, reflection, or transmission occurs. The vector radiative transfer matrix (VRTM) is defined and solved using Monte Carlo strategy, by which all four Stokes elements can be determined. Our results for Rayleigh scattering and Mie scattering are compared well with published data. The accuracy of the developed Monte Carlo method is shown to be good enough for the solution to vector radiative transfer. Polarization characteristics of thermal emission in a hot semitransparent medium is investigated, and results show that the U and V parameters of Stokes vector are equal to zero, an obvious peak always appear in the Q curve instead of the I curve, and refractive index has a completely different effect on I from Q.

  15. Ab initio quantum chemical study of electron transfer in carboranes

    NASA Astrophysics Data System (ADS)

    Pati, Ranjit; Pineda, Andrew C.; Pandey, Ravindra; Karna, Shashi P.

    2005-05-01

    The electron transfer (ET) properties of 10- and 12-vertex carboranes are investigated by the ab initio Hartree-Fock method within the Marcus-Hush (MH) two-state model and the Koopman theorem (KT) approach. The calculated value of the ET coupling matrix element, VAB, is consistently higher in the KT approach than in the MH two-state model. For the carborane molecules functionalized by -CH 2 groups at C-vertices, VAB strongly depends on the relative orientation of the planes containing the terminal -CH 2 groups. The predicted conformation dependence of VAB offers a molecular mechanism to control ET between two active centers in molecular systems.

  16. Ground Test of the Urine Processing Assembly for Accelerations and Transfer Functions

    NASA Technical Reports Server (NTRS)

    Houston, Janice; Almond, Deborah F. (Technical Monitor)

    2001-01-01

    This viewgraph presentation gives an overview of the ground test of the urine processing assembly for accelerations and transfer functions. Details are given on the test setup, test data, data analysis, analytical results, and microgravity assessment. The conclusions of the tests include the following: (1) the single input/multiple output method is useful if the data is acquired by tri-axial accelerometers and inputs can be considered uncorrelated; (2) tying coherence with the matrix yields higher confidence in results; (3) the WRS#2 rack ORUs need to be isolated; (4) and future work includes a plan for characterizing performance of isolation materials.

  17. Detection of no-model input-output pairs in closed-loop systems.

    PubMed

    Potts, Alain Segundo; Alvarado, Christiam Segundo Morales; Garcia, Claudio

    2017-11-01

    The detection of no-model input-output (IO) pairs is important because it can speed up the multivariable system identification process, since all the pairs with null transfer functions are previously discarded and it can also improve the identified model quality, thus improving the performance of model based controllers. In the available literature, the methods focus just on the open-loop case, since in this case there is not the effect of the controller forcing the main diagonal in the transfer matrix to one and all the other terms to zero. In this paper, a modification of a previous method able to detect no-model IO pairs in open-loop systems is presented, but adapted to perform this duty in closed-loop systems. Tests are performed by using the traditional methods and the proposed one to show its effectiveness. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  18. Advanced Doubling Adding Method for Radiative Transfer in Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Liu, Quanhua; Weng, Fuzhong

    2006-12-01

    The doubling adding method (DA) is one of the most accurate tools for detailed multiple-scattering calculations. The principle of the method goes back to the nineteenth century in a problem dealing with reflection and transmission by glass plates. Since then the doubling adding method has been widely used as a reference tool for other radiative transfer models. The method has never been used in operational applications owing to tremendous demand on computational resources from the model. This study derives an analytical expression replacing the most complicated thermal source terms in the doubling adding method. The new development is called the advanced doubling adding (ADA) method. Thanks also to the efficiency of matrix and vector manipulations in FORTRAN 90/95, the advanced doubling adding method is about 60 times faster than the doubling adding method. The radiance (i.e., forward) computation code of ADA is easily translated into tangent linear and adjoint codes for radiance gradient calculations. The simplicity in forward and Jacobian computation codes is very useful for operational applications and for the consistency between the forward and adjoint calculations in satellite data assimilation.

  19. Ballistic-diffusive approximation for the thermal dynamics of metallic nanoparticles in nanocomposite materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shirdel-Havar, A. H., E-mail: Amir.hushang.shirdel@gmail.com; Masoudian Saadabad, R.

    2015-03-21

    Based on ballistic-diffusive approximation, a method is presented to model heat transfer in nanocomposites containing metal nanoparticles. This method provides analytical expression for the temperature dynamics of metallic nanoparticles embedded in a dielectric medium. In this study, nanoparticles are considered as spherical shells, so that Boltzmann equation is solved using ballistic-diffusive approximation to calculate the electron and lattice thermal dynamics in gold nanoparticles, while thermal exchange between the particles is taken into account. The model was used to investigate the influence of particle size and metal concentration of the medium on the electron and lattice thermal dynamics. It is shownmore » that these two parameters are crucial in determining the nanocomposite thermal behavior. Our results showed that the heat transfer rate from nanoparticles to the matrix decreases as the nanoparticle size increases. On the other hand, increasing the metal concentration of the medium can also decrease the heat transfer rate.« less

  20. Analysis of simplified heat transfer models for thermal property determination of nano-film by TDTR method

    NASA Astrophysics Data System (ADS)

    Wang, Xinwei; Chen, Zhe; Sun, Fangyuan; Zhang, Hang; Jiang, Yuyan; Tang, Dawei

    2018-03-01

    Heat transfer in nanostructures is of critical importance for a wide range of applications such as functional materials and thermal management of electronics. Time-domain thermoreflectance (TDTR) has been proved to be a reliable measurement technique for the thermal property determinations of nanoscale structures. However, it is difficult to determine more than three thermal properties at the same time. Heat transfer model simplifications can reduce the fitting variables and provide an alternative way for thermal property determination. In this paper, two simplified models are investigated and analyzed by the transform matrix method and simulations. TDTR measurements are performed on Al-SiO2-Si samples with different SiO2 thickness. Both theoretical and experimental results show that the simplified tri-layer model (STM) is reliable and suitable for thin film samples with a wide range of thickness. Furthermore, the STM can also extract the intrinsic thermal conductivity and interfacial thermal resistance from serial samples with different thickness.

  1. Algorithms for Efficient Computation of Transfer Functions for Large Order Flexible Systems

    NASA Technical Reports Server (NTRS)

    Maghami, Peiman G.; Giesy, Daniel P.

    1998-01-01

    An efficient and robust computational scheme is given for the calculation of the frequency response function of a large order, flexible system implemented with a linear, time invariant control system. Advantage is taken of the highly structured sparsity of the system matrix of the plant based on a model of the structure using normal mode coordinates. The computational time per frequency point of the new computational scheme is a linear function of system size, a significant improvement over traditional, still-matrix techniques whose computational times per frequency point range from quadratic to cubic functions of system size. This permits the practical frequency domain analysis of systems of much larger order than by traditional, full-matrix techniques. Formulations are given for both open- and closed-loop systems. Numerical examples are presented showing the advantages of the present formulation over traditional approaches, both in speed and in accuracy. Using a model with 703 structural modes, the present method was up to two orders of magnitude faster than a traditional method. The present method generally showed good to excellent accuracy throughout the range of test frequencies, while traditional methods gave adequate accuracy for lower frequencies, but generally deteriorated in performance at higher frequencies with worst case errors being many orders of magnitude times the correct values.

  2. Identification of impact force acting on composite laminated plates using the radiated sound measured with microphones

    NASA Astrophysics Data System (ADS)

    Atobe, Satoshi; Nonami, Shunsuke; Hu, Ning; Fukunaga, Hisao

    2017-09-01

    Foreign object impact events are serious threats to composite laminates because impact damage leads to significant degradation of the mechanical properties of the structure. Identification of the location and force history of the impact that was applied to the structure can provide useful information for assessing the structural integrity. This study proposes a method for identifying impact forces acting on CFRP (carbon fiber reinforced plastic) laminated plates on the basis of the sound radiated from the impacted structure. Identification of the impact location and force history is performed using the sound pressure measured with microphones. To devise a method for identifying the impact location from the difference in the arrival times of the sound wave detected with the microphones, the propagation path of the sound wave from the impacted point to the sensor is examined. For the identification of the force history, an experimentally constructed transfer matrix is employed to relate the force history to the corresponding sound pressure. To verify the validity of the proposed method, impact tests are conducted by using a CFRP cross-ply laminate as the specimen, and an impulse hammer as the impactor. The experimental results confirm the validity of the present method for identifying the impact location from the arrival time of the sound wave detected with the microphones. Moreover, the results of force history identification show the feasibility of identifying the force history accurately from the measured sound pressure using the experimental transfer matrix.

  3. A finite element formulation preserving symmetric and banded diffusion stiffness matrix characteristics for fractional differential equations

    NASA Astrophysics Data System (ADS)

    Lin, Zeng; Wang, Dongdong

    2017-10-01

    Due to the nonlocal property of the fractional derivative, the finite element analysis of fractional diffusion equation often leads to a dense and non-symmetric stiffness matrix, in contrast to the conventional finite element formulation with a particularly desirable symmetric and banded stiffness matrix structure for the typical diffusion equation. This work first proposes a finite element formulation that preserves the symmetry and banded stiffness matrix characteristics for the fractional diffusion equation. The key point of the proposed formulation is the symmetric weak form construction through introducing a fractional weight function. It turns out that the stiffness part of the present formulation is identical to its counterpart of the finite element method for the conventional diffusion equation and thus the stiffness matrix formulation becomes trivial. Meanwhile, the fractional derivative effect in the discrete formulation is completely transferred to the force vector, which is obviously much easier and efficient to compute than the dense fractional derivative stiffness matrix. Subsequently, it is further shown that for the general fractional advection-diffusion-reaction equation, the symmetric and banded structure can also be maintained for the diffusion stiffness matrix, although the total stiffness matrix is not symmetric in this case. More importantly, it is demonstrated that under certain conditions this symmetric diffusion stiffness matrix formulation is capable of producing very favorable numerical solutions in comparison with the conventional non-symmetric diffusion stiffness matrix finite element formulation. The effectiveness of the proposed methodology is illustrated through a series of numerical examples.

  4. Ultralow-Carbon Nanotube-Toughened Epoxy: The Critical Role of a Double-Layer Interface.

    PubMed

    Liu, Jingwei; Chen, Chao; Feng, Yuezhan; Liao, Yonggui; Ye, Yunsheng; Xie, Xiaolin; Mai, Yiu-Wing

    2018-01-10

    Understanding the chemistry and structure of interfaces within epoxy resins is important for studying the mechanical properties of nanofiller-filled nanocomposites as well as for developing high-performance polymer nanocomposites. Despite the intensive efforts to construct nanofiller/matrix interfaces, few studies have demonstrated an enhanced stress-transferring efficiency while avoiding unfavorable deformation due to undesirable interface fractures. Here, we report an optimized method to prepare epoxy-based nanocomposites whose interfaces are chemically modulated by poly(glycidyl methacrylate)-block-poly(hexyl methacrylate) (PGMA-b-PHMA)-functionalized multiwalled carbon nanotubes (bc@fMWNTs) and also offer a fundamental explanation of crack growth behavior and the toughening mechanism of the resulting nanocomposites. The presence of block copolymers on the surface of the MWNT results in a promising double-layered interface, in which (1) the outer-layered PGMA segment provides good dispersion in and strong interface bonding with the epoxy matrix, which enhances load transfer efficiency and debonding stress, and (2) the interlayered rubbery PHMA segment around the MWNT provides the maximum removable space for nanotubes as well as triggering cavitation while promoting local plastic matrix deformation, for example, shear banding to dissipate fracture energy. An outstanding toughening effect is achieved with only a 0.05 wt % carbon nanotube loading with the bc@fMWNT, that is, needing only a 20-times lower loading to obtain improvements in fracture toughness comparable to epoxy-based nanocomposites. The enhancements of their corresponding ultimate mode-I fracture toughnesses and fracture energies are 4 times higher than those of pristine MWNT-filled epoxy. These results demonstrate that a MWNT/epoxy interface could be optimized by changing the component structure of grafted modifiers, thereby facilitating the transfer of both mechanical load and energy dissipation across the nanofiller/matrix interface. This work provides a new route for the rational design and development of polymer nanocomposites with exceptional mechanical performance.

  5. Optical implementation of systolic array processing

    NASA Technical Reports Server (NTRS)

    Caulfield, H. J.; Rhodes, W. T.; Foster, M. J.; Horvitz, S.

    1981-01-01

    Algorithms for matrix vector multiplication are implemented using acousto-optic cells for multiplication and input data transfer and using charge coupled devices detector arrays for accumulation and output of the results. No two dimensional matrix mask is required; matrix changes are implemented electronically. A system for multiplying a 50 component nonnegative real vector by a 50 by 50 nonnegative real matrix is described. Modifications for bipolar real and complex valued processing are possible, as are extensions to matrix-matrix multiplication and multiplication of a vector by multiple matrices.

  6. Calculated photonic structures for infrared emittance control

    NASA Astrophysics Data System (ADS)

    Rung, Andreas; Ribbing, Carl G.

    2002-06-01

    Using an available program package based on the transfer-matrix method, we calculated the photonic band structure for two different structures: a quasi-three-dimensional crystal of square air rods in a high-index matrix and an opal structure of high-index spheres in a matrix of low index, epsilon = 1.5. The high index used is representative of gallium arsenide in the thermal infrared range. The geometric parameters of the rod dimension, sphere radius, and lattice constants were chosen to give total reflectance for normal incidence, i.e., minimum thermal emittance, in either one of the two infrared atmospheric windows. For these four photonic crystals, the bulk reflectance spectra and the wavelength-averaged thermal emittance as a function of crystal thickness were calculated. The results reveal that potentially useful thermal signature suppression is obtained for crystals as thin as 20-50 mum, i.e., comparable with that of a paint layer.

  7. Effect of octa(aminophenyl) polyhedral oligomeric silsesquioxane functionalized graphene oxide on the mechanical and dielectric properties of polyimide composites.

    PubMed

    Liao, Wei-Hao; Yang, Shin-Yi; Hsiao, Sheng-Tsung; Wang, Yu-Sheng; Li, Shin-Ming; Ma, Chen-Chi M; Tien, Hsi-Wen; Zeng, Shi-Jun

    2014-09-24

    An effective method is proposed to prepare octa(aminophenyl) silsesquioxane (OAPS) functionalized graphene oxide (GO) reinforced polyimide (PI) composites with a low dielectric constant and ultrastrong mechanical properties. The amine-functionalized surface of OAPS-GO is a versatile starting platform for in situ polymerization, which promotes the uniform dispersion of OAPS-GO in the PI matrix. Compared with GO/PI composites, the strong interfacial interaction between OAPS-GO and the PI matrix through covalent bonds facilitates a load transfer from the PI matrix to the OAPS-GO. The OAPS-GO/PI composite film with 3.0 wt % OAPS-GO exhibited an 11.2-fold increase in tensile strength, and a 10.4-fold enhancement in tensile modulus compared with neat PI. The dielectric constant (D(k)) decreased with the increasing content of 2D porous OAPS-GO, and a D(k) value of 1.9 was achieved.

  8. Adsorption behavior of plasmid DNA onto perfusion chromatographic matrix.

    PubMed

    Limonta, Miladys; Zumalacárregui, Lourdes; Soler, Dayana

    2012-05-01

    Anion exchange chromatography is the most popular chromatographic method for plasmid separation. POROS RI 50 is a perfusion chromatographic support which is a reversed phase matrix and is an alternative to conventional ones due to its mass transfer properties. The adsorption and elution of the pIDKE2 plasmid onto reversed phase POROS R1 50 was studied. Langmuir isotherm model was adjusted in order to get the maximum adsorption capacity and the dissociation constant for POROS R1 50-plasmid DNA (pDNA) system. Breakthrough curves were obtained for volumetric flows between 0.69-3.33 mL/min, given dynamic capacity up to 2.3 times higher than those reported for ionic exchange matrix used during the purification process of plasmids with similar size to that of pIDKE2. The efficiency was less than 45% for the flow conditions and initial concentration studied, which means that the support will not be operated under saturation circumstances.

  9. Stiffening of fluid membranes due to thermal undulations: density-matrix renormalization-group study.

    PubMed

    Nishiyama, Yoshihiro

    2002-12-01

    It has been considered that the effective bending rigidity of fluid membranes should be reduced by thermal undulations. However, recent thorough investigation by Pinnow and Helfrich revealed the significance of measure factors for the partition sum. Accepting the local curvature as a statistical measure, they found that fluid membranes are stiffened macroscopically. In order to examine this remarkable idea, we performed extensive ab initio simulations for a fluid membrane. We set up a transfer matrix that is diagonalized by means of the density-matrix renormalization group. Our method has an advantage, in that it allows us to survey various statistical measures. As a consequence, we found that the effective bending rigidity flows toward strong coupling under the choice of local curvature as a statistical measure. On the contrary, for other measures such as normal displacement and tilt angle, we found a clear tendency toward softening.

  10. Acoustic response of a rectangular levitator with orifices

    NASA Technical Reports Server (NTRS)

    El-Raheb, Michael; Wagner, Paul

    1990-01-01

    The acoustic response of a rectangular cavity to speaker-generated excitation through waveguides terminating at orifices in the cavity walls is analyzed. To find the effects of orifices, acoustic pressure is expressed by eigenfunctions satisfying Neumann boundary conditions as well as by those satisfying Dirichlet ones. Some of the excess unknowns can be eliminated by point constraints set over the boundary, by appeal to Lagrange undetermined multipliers. The resulting transfer matrix must be further reduced by partial condensation to the order of a matrix describing unmixed boundary conditions. If the cavity is subjected to an axial temperature dependence, the transfer matrix is determined numerically.

  11. Biaxial (Tension-Torsion) Testing of an Oxide/Oxide Ceramic Matrix Composite

    DTIC Science & Technology

    2013-03-01

    estimation algorithms and constants . . . . . . . . . . . . . 61 4.27 Biaxial (tension-torsion) load spreadsheet with independent axial load and torsion...through the composite and provides the main load - bearing capability. The interaction of the two (or more) phases takes place in the interface. The...transfer loads between fibers[15]. The fiber-to-fiber load transfer mechanism provided by the matrix plays a major role in the load - bearing properties of the

  12. Diagonalizing controller for a superconducting six-axis accelerometer

    NASA Astrophysics Data System (ADS)

    Bachrach, B.; Canavan, E. R.; Levine, W. S.

    A relatively simple MIMO (multiple input, multiple output) controller which converts an instrument with a nondiagonally dominant transfer function matrix into a strongly diagonally dominant device is developed. The instrument, which uses inductance bridges to sense the position of a magnetically levitated superconducting mass, has very lightly damped resonances and fairly strong cross coupling. By taking advantage of the particular structure of the instrument's transfer function matrix, it is possible to develop a relatively simple controller which achieves the desired decoupling. This controller consists of two parts. The first part cancels the nondiagonal terms of the open-loop transfer function matrix, while the second part is simply a set of SISO (single input, single output) controllers. The stability of the closed-loop system is studied using Rosenbrock's INA (inverse Nyguist array) technique, which produces a simple set of conditions guaranteeing stability. Simulation of the closed-loop system indicates that it should easily achieve its performance goals.

  13. Exogenous ROS-induced cell sheet transfer based on hematoporphyrin-polyketone film via a one-step process.

    PubMed

    Koo, Min-Ah; Lee, Mi Hee; Kwon, Byeong-Ju; Seon, Gyeung Mi; Kim, Min Sung; Kim, Dohyun; Nam, Ki Chang; Park, Jong-Chul

    2018-04-01

    To date, most of invasive cell sheet harvesting methods have used culture surface property variations, such as wettability, pH, electricity, and magnetism, to induce cell detachment. These methods that rely on surface property changes are effective when cell detachment prior to application is necessary, but of limited use when used for cell sheet transfer to target regions. The study reports a new reactive oxygen species (ROS)-induced strategy based on hematoporphyrin-incorporated polyketone film (Hp-PK film) to transfer cell sheets directly to target areas without an intermediate harvesting process. After green LED (510 nm) irradiation, production of exogenous ROS from the Hp-PK films induces cell sheet detachment and transfer. The study suggests that ROS-induced cell detachment property of the Hp-PK film is closely related to conformational changes of extracellular matrix (ECM) proteins. Also, this strategy with the Hp-PK film can be applied by regulating production rate of exogenous ROS in various types of cells, including fibroblasts, mesenchymal stem cells and keratinocytes. In conclusion, ROS-induced method using the Hp-PK film can be used for one-step cell sheet transplantation and has potential in biomedical applications. Copyright © 2018 Elsevier Ltd. All rights reserved.

  14. A design tool for direct and non-stochastic calculations of near-field radiative transfer in complex structures: The NF-RT-FDTD algorithm

    NASA Astrophysics Data System (ADS)

    Didari, Azadeh; Pinar Mengüç, M.

    2017-08-01

    Advances in nanotechnology and nanophotonics are inextricably linked with the need for reliable computational algorithms to be adapted as design tools for the development of new concepts in energy harvesting, radiative cooling, nanolithography and nano-scale manufacturing, among others. In this paper, we provide an outline for such a computational tool, named NF-RT-FDTD, to determine the near-field radiative transfer between structured surfaces using Finite Difference Time Domain method. NF-RT-FDTD is a direct and non-stochastic algorithm, which accounts for the statistical nature of the thermal radiation and is easily applicable to any arbitrary geometry at thermal equilibrium. We present a review of the fundamental relations for far- and near-field radiative transfer between different geometries with nano-scale surface and volumetric features and gaps, and then we discuss the details of the NF-RT-FDTD formulation, its application to sample geometries and outline its future expansion to more complex geometries. In addition, we briefly discuss some of the recent numerical works for direct and indirect calculations of near-field thermal radiation transfer, including Scattering Matrix method, Finite Difference Time Domain method (FDTD), Wiener Chaos Expansion, Fluctuating Surface Current (FSC), Fluctuating Volume Current (FVC) and Thermal Discrete Dipole Approximations (TDDA).

  15. Finitized conformal spectrum of the Ising model on the cylinder and torus

    NASA Astrophysics Data System (ADS)

    O'Brien, David L.; Pearce, Paul A.; Ole Warnaar, S.

    1996-02-01

    The spectrum of the critical Ising model on a lattice with cylindrical and toroidal boundary conditions is calculated by commuting transfer matrix methods. Using a simple truncation procedure, we obtain the natural finitizations of the conformal spectra recently proposed by Melzer. These finitizations imply polynomial identities which in the large lattice limit give rise to the Rogers-Ramanujan identities for the c = {1}/{2} Virasoro characters.

  16. Transfer matrix modeling and experimental validation of cellular porous material with resonant inclusions.

    PubMed

    Doutres, Olivier; Atalla, Noureddine; Osman, Haisam

    2015-06-01

    Porous materials are widely used for improving sound absorption and sound transmission loss of vibrating structures. However, their efficiency is limited to medium and high frequencies of sound. A solution for improving their low frequency behavior while keeping an acceptable thickness is to embed resonant structures such as Helmholtz resonators (HRs). This work investigates the absorption and transmission acoustic performances of a cellular porous material with a two-dimensional periodic arrangement of HR inclusions. A low frequency model of a resonant periodic unit cell based on the parallel transfer matrix method is presented. The model is validated by comparison with impedance tube measurements and simulations based on both the finite element method and a homogenization based model. At the HR resonance frequency (i) the transmission loss is greatly improved and (ii) the sound absorption of the foam can be either decreased or improved depending on the HR tuning frequency and on the thickness and properties of the host foam. Finally, the diffuse field sound absorption and diffuse field sound transmission loss performance of a 2.6 m(2) resonant cellular material are measured. It is shown that the improvements observed at the Helmholtz resonant frequency on a single cell are confirmed at a larger scale.

  17. Multiscale strain analysis of tissue equivalents using a custom-designed biaxial testing device.

    PubMed

    Bell, B J; Nauman, E; Voytik-Harbin, S L

    2012-03-21

    Mechanical signals transferred between a cell and its extracellular matrix play an important role in regulating fundamental cell behavior. To further define the complex mechanical interactions between cells and matrix from a multiscale perspective, a biaxial testing device was designed and built. Finite element analysis was used to optimize the cruciform specimen geometry so that stresses within the central region were concentrated and homogenous while minimizing shear and grip effects. This system was used to apply an equibiaxial loading and unloading regimen to fibroblast-seeded tissue equivalents. Digital image correlation and spot tracking were used to calculate three-dimensional strains and associated strain transfer ratios at macro (construct), meso, matrix (collagen fibril), cell (mitochondria), and nuclear levels. At meso and matrix levels, strains in the 1- and 2-direction were statistically similar throughout the loading-unloading cycle. Interestingly, a significant amplification of cellular and nuclear strains was observed in the direction perpendicular to the cell axis. Findings indicate that strain transfer is dependent upon local anisotropies generated by the cell-matrix force balance. Such multiscale approaches to tissue mechanics will assist in advancement of modern biomechanical theories as well as development and optimization of preconditioning regimens for functional engineered tissue constructs. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  18. Representing Matrix Cracks Through Decomposition of the Deformation Gradient Tensor in Continuum Damage Mechanics Methods

    NASA Technical Reports Server (NTRS)

    Leone, Frank A., Jr.

    2015-01-01

    A method is presented to represent the large-deformation kinematics of intraply matrix cracks and delaminations in continuum damage mechanics (CDM) constitutive material models. The method involves the additive decomposition of the deformation gradient tensor into 'crack' and 'bulk material' components. The response of the intact bulk material is represented by a reduced deformation gradient tensor, and the opening of an embedded cohesive interface is represented by a normalized cohesive displacement-jump vector. The rotation of the embedded interface is tracked as the material deforms and as the crack opens. The distribution of the total local deformation between the bulk material and the cohesive interface components is determined by minimizing the difference between the cohesive stress and the bulk material stress projected onto the cohesive interface. The improvements to the accuracy of CDM models that incorporate the presented method over existing approaches are demonstrated for a single element subjected to simple shear deformation and for a finite element model of a unidirectional open-hole tension specimen. The material model is implemented as a VUMAT user subroutine for the Abaqus/Explicit finite element software. The presented deformation gradient decomposition method reduces the artificial load transfer across matrix cracks subjected to large shearing deformations, and avoids the spurious secondary failure modes that often occur in analyses based on conventional progressive damage models.

  19. Comparative study between the results of effective index based matrix method and characterization of fabricated SU-8 waveguide

    NASA Astrophysics Data System (ADS)

    Samanta, Swagata; Dey, Pradip Kumar; Banerji, Pallab; Ganguly, Pranabendu

    2017-01-01

    A study regarding the validity of effective-index based matrix method (EIMM) for the fabricated SU-8 channel waveguides is reported. The design method is extremely fast compared to other existing numerical techniques, such as, BPM and FDTD. In EIMM, the effective index method was applied in depth direction of the waveguide and the resulted lateral index profile was analyzed by a transfer matrix method. By EIMM one can compute the guided mode propagation constants and mode profiles for each mode for any dimensions of the waveguides. The technique may also be used to design single mode waveguide. SU-8 waveguide fabrication was carried out by continuous-wave direct laser writing process at 375 nm wavelength. The measured propagation losses of these wire waveguides having air and PDMS as superstrates were 0.51 dB/mm and 0.3 dB/mm respectively. The number of guided modes, obtained theoretically as well as experimentally, for air-cladded waveguide was much more than that of PDMS-cladded waveguide. We were able to excite the isolated fundamental mode for the later by precise fiber positioning, and mode image was recorded. The mode profiles, mode indices, and refractive index profiles were extracted from this mode image of the fundamental mode which matched remarkably well with the theoretical predictions.

  20. Synthesis of TiO2-poly(3-hexylthiophene) hybrid particles through surface-initiated Kumada catalyst-transfer polycondensation.

    PubMed

    Boon, Florian; Moerman, David; Laurencin, Danielle; Richeter, Sébastien; Guari, Yannick; Mehdi, Ahmad; Dubois, Philippe; Lazzaroni, Roberto; Clément, Sébastien

    2014-09-30

    TiO2/conjugated polymers are promising materials in solar energy conversion where efficient photoinduced charge transfers are required. Here, a "grafting-from" approach for the synthesis of TiO2 nanoparticles supported with conjugated polymer brushes is presented. Poly(3-hexylthiophene) (P3HT), a benchmark material for organic electronics, was selectively grown from TiO2 nanoparticles by surface-initiated Kumada catalyst-transfer polycondensation. The grafting of the polymer onto the surface of the TiO2 nanoparticles by this method was demonstrated by (1)H and (13)C solid-state NMR, X-ray photoelectron spectrometry, thermogravimetric analysis, transmission electron microscopy, and UV-visible spectroscopy. Sedimentation tests in tetrahydrofuran revealed improved dispersion stability for the TiO2@P3HT hybrid material. Films were produced by solvent casting, and the quality of the dispersion of the modified TiO2 nanoparticles was evaluated by atomic force microscopy. The dispersion of the P3HT-coated TiO2 NPs in the P3HT matrix was found to be homogeneous, and the fibrillar structure of the P3HT matrix was maintained which is favorable for charge transport. Fluorescence quenching measurements on these hybrid materials in CHCl3 indicated improved photoinduced electron-transfer efficiency. All in all, better physicochemical properties for P3HT/TiO2 hybrid material were reached via the surface-initiated "grafted-from" approach compared to the "grafting-onto" approach.

  1. Regularization and computational methods for precise solution of perturbed orbit transfer problems

    NASA Astrophysics Data System (ADS)

    Woollands, Robyn Michele

    The author has developed a suite of algorithms for solving the perturbed Lambert's problem in celestial mechanics. These algorithms have been implemented as a parallel computation tool that has broad applicability. This tool is composed of four component algorithms and each provides unique benefits for solving a particular type of orbit transfer problem. The first one utilizes a Keplerian solver (a-iteration) for solving the unperturbed Lambert's problem. This algorithm not only provides a "warm start" for solving the perturbed problem but is also used to identify which of several perturbed solvers is best suited for the job. The second algorithm solves the perturbed Lambert's problem using a variant of the modified Chebyshev-Picard iteration initial value solver that solves two-point boundary value problems. This method converges over about one third of an orbit and does not require a Newton-type shooting method and thus no state transition matrix needs to be computed. The third algorithm makes use of regularization of the differential equations through the Kustaanheimo-Stiefel transformation and extends the domain of convergence over which the modified Chebyshev-Picard iteration two-point boundary value solver will converge, from about one third of an orbit to almost a full orbit. This algorithm also does not require a Newton-type shooting method. The fourth algorithm uses the method of particular solutions and the modified Chebyshev-Picard iteration initial value solver to solve the perturbed two-impulse Lambert problem over multiple revolutions. The method of particular solutions is a shooting method but differs from the Newton-type shooting methods in that it does not require integration of the state transition matrix. The mathematical developments that underlie these four algorithms are derived in the chapters of this dissertation. For each of the algorithms, some orbit transfer test cases are included to provide insight on accuracy and efficiency of these individual algorithms. Following this discussion, the combined parallel algorithm, known as the unified Lambert tool, is presented and an explanation is given as to how it automatically selects which of the three perturbed solvers to compute the perturbed solution for a particular orbit transfer. The unified Lambert tool may be used to determine a single orbit transfer or for generating of an extremal field map. A case study is presented for a mission that is required to rendezvous with two pieces of orbit debris (spent rocket boosters). The unified Lambert tool software developed in this dissertation is already being utilized by several industrial partners and we are confident that it will play a significant role in practical applications, including solution of Lambert problems that arise in the current applications focused on enhanced space situational awareness.

  2. The hydrogen tunneling splitting in malonaldehyde: A full-dimensional time-independent quantum mechanical method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Feng; Ren, Yinghui; Bian, Wensheng, E-mail: bian@iccas.ac.cn

    The accurate time-independent quantum dynamics calculations on the ground-state tunneling splitting of malonaldehyde in full dimensionality are reported for the first time. This is achieved with an efficient method developed by us. In our method, the basis functions are customized for the hydrogen transfer process which has the effect of greatly reducing the size of the final Hamiltonian matrix, and the Lanczos method and parallel strategy are used to further overcome the memory and central processing unit time bottlenecks. The obtained ground-state tunneling splitting of 24.5 cm{sup −1} is in excellent agreement with the benchmark value of 23.8 cm{sup −1}more » computed with the full-dimensional, multi-configurational time-dependent Hartree approach on the same potential energy surface, and we estimate that our reported value has an uncertainty of less than 0.5 cm{sup −1}. Moreover, the role of various vibrational modes strongly coupled to the hydrogen transfer process is revealed.« less

  3. COVARIANCE ESTIMATION USING CONJUGATE GRADIENT FOR 3D CLASSIFICATION IN CRYO-EM.

    PubMed

    Andén, Joakim; Katsevich, Eugene; Singer, Amit

    2015-04-01

    Classifying structural variability in noisy projections of biological macromolecules is a central problem in Cryo-EM. In this work, we build on a previous method for estimating the covariance matrix of the three-dimensional structure present in the molecules being imaged. Our proposed method allows for incorporation of contrast transfer function and non-uniform distribution of viewing angles, making it more suitable for real-world data. We evaluate its performance on a synthetic dataset and an experimental dataset obtained by imaging a 70S ribosome complex.

  4. Nanostructured 2D cellular materials in silicon by sidewall transfer lithography NEMS

    NASA Astrophysics Data System (ADS)

    Syms, Richard R. A.; Liu, Dixi; Ahmad, Munir M.

    2017-07-01

    Sidewall transfer lithography (STL) is demonstrated as a method for parallel fabrication of 2D nanostructured cellular solids in single-crystal silicon. The linear mechanical properties of four lattices (perfect and defected diamond; singly and doubly periodic honeycomb) with low effective Young’s moduli and effective Poisson’s ratio ranging from positive to negative are modelled using analytic theory and the matrix stiffness method with an emphasis on boundary effects. The lattices are fabricated with a minimum feature size of 100 nm and an aspect ratio of 40:1 using single- and double-level STL and deep reactive ion etching of bonded silicon-on-insulator. Nanoelectromechanical systems (NEMS) containing cellular materials are used to demonstrate stretching, bending and brittle fracture. Predicted edge effects are observed, theoretical values of Poisson’s ratio are verified and failure patterns are described.

  5. Preserving Simplecticity in the Numerical Integration of Linear Beam Optics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allen, Christopher K.

    2017-07-01

    Presented are mathematical tools and methods for the development of numerical integration techniques that preserve the symplectic condition inherent to mechanics. The intended audience is for beam physicists with backgrounds in numerical modeling and simulation with particular attention to beam optics applications. The paper focuses on Lie methods that are inherently symplectic regardless of the integration accuracy order. Section 2 provides the mathematically tools used in the sequel and necessary for the reader to extend the covered techniques. Section 3 places those tools in the context of charged-particle beam optics; in particular linear beam optics is presented in terms ofmore » a Lie algebraic matrix representation. Section 4 presents numerical stepping techniques with particular emphasis on a third-order leapfrog method. Section 5 discusses the modeling of field imperfections with particular attention to the fringe fields of quadrupole focusing magnets. The direct computation of a third order transfer matrix for a fringe field is shown.« less

  6. Inverse estimation of the elastic and anelastic properties of the porous frame of anisotropic open-cell foams.

    PubMed

    Cuenca, Jacques; Göransson, Peter

    2012-08-01

    This paper presents a method for simultaneously identifying both the elastic and anelastic properties of the porous frame of anisotropic open-cell foams. The approach is based on an inverse estimation procedure of the complex stiffness matrix of the frame by performing a model fit of a set of transfer functions of a sample of material subjected to compression excitation in vacuo. The material elastic properties are assumed to have orthotropic symmetry and the anelastic properties are described using a fractional-derivative model within the framework of an augmented Hooke's law. The inverse estimation problem is formulated as a numerical optimization procedure and solved using the globally convergent method of moving asymptotes. To show the feasibility of the approach a numerically generated target material is used here as a benchmark. It is shown that the method provides the full frequency-dependent orthotropic complex stiffness matrix within a reasonable degree of accuracy.

  7. Nuclear waste storage container with metal matrix

    DOEpatents

    Sump, Kenneth R.

    1978-01-01

    The invention relates to a storage container for high-level waste having a metal matrix for the high-level waste, thereby providing greater impact strength for the waste container and increasing heat transfer properties.

  8. Multilayer-MCTDH approach to the energy transfer dynamics in the LH2 antenna complex

    NASA Astrophysics Data System (ADS)

    Shibl, Mohamed F.; Schulze, Jan; Al-Marri, Mohammed J.; Kühn, Oliver

    2017-09-01

    The multilayer multiconfiguration time-dependent Hartree method is used to study the coupled exciton-vibrational dynamics in a high-dimensional nonameric model of the LH2 antenna complex of purple bacteria. The exciton-vibrational coupling is parametrized within the Huang-Rhys model according to phonon and intramolecular vibrational modes derived from an experimental bacteriochlorophyll spectral density. In contrast to reduced density matrix approaches, the Schrödinger equation is solved explicitly, giving access to the full wave function. This facilitates an unbiased analysis in terms of the coupled dynamics of excitonic and vibrational degrees of freedom. For the present system, we identify spectator modes for the B800 to B800 transfer and we find a non-additive effect of phonon and intramolecular vibrational modes on the B800 to B850 exciton transfer.

  9. Constructing diabatic states from adiabatic states: Extending generalized Mulliken-Hush to multiple charge centers with Boys localization

    NASA Astrophysics Data System (ADS)

    Subotnik, Joseph E.; Yeganeh, Sina; Cave, Robert J.; Ratner, Mark A.

    2008-12-01

    This article shows that, although Boys localization is usually applied to single-electron orbitals, the Boys method itself can be applied to many electron molecular states. For the two-state charge-transfer problem, we show analytically that Boys localization yields the same charge-localized diabatic states as those found by generalized Mulliken-Hush theory. We suggest that for future work in electron transfer, where systems have more than two charge centers, one may benefit by using a variant of Boys localization to construct diabatic potential energy surfaces and extract electronic coupling matrix elements. We discuss two chemical examples of Boys localization and propose a generalization of the Boys algorithm for creating diabatic states with localized spin density that should be useful for Dexter triplet-triplet energy transfer.

  10. Constructing diabatic states from adiabatic states: extending generalized Mulliken-Hush to multiple charge centers with boys localization.

    PubMed

    Subotnik, Joseph E; Yeganeh, Sina; Cave, Robert J; Ratner, Mark A

    2008-12-28

    This article shows that, although Boys localization is usually applied to single-electron orbitals, the Boys method itself can be applied to many electron molecular states. For the two-state charge-transfer problem, we show analytically that Boys localization yields the same charge-localized diabatic states as those found by generalized Mulliken-Hush theory. We suggest that for future work in electron transfer, where systems have more than two charge centers, one may benefit by using a variant of Boys localization to construct diabatic potential energy surfaces and extract electronic coupling matrix elements. We discuss two chemical examples of Boys localization and propose a generalization of the Boys algorithm for creating diabatic states with localized spin density that should be useful for Dexter triplet-triplet energy transfer.

  11. Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

    2001-04-01

    Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

  12. Insight into the Effects of Reinforcement Shape on Achieving Continuous Martensite Transformation in Phase Transforming Matrix Composites

    NASA Astrophysics Data System (ADS)

    Zhang, Xudong; Ren, Junqiang; Wang, Xiaofei; Zong, Hongxiang; Cui, Lishan; Ding, Xiangdong

    2017-12-01

    A continuous martensite transformation is indispensable for achieving large linear superelasticity and low modulus in phase transforming metal-based composites. However, determining how to accurately condition the residual martensite in a shape memory alloy matrix though the reinforcement shape to achieve continuous martensite transformation has been a challenge. Here, we take the finite element method to perform a comparative study of the effects of nanoinclusion shape on the interaction and martensite phase transformation in this new composite. Two typical samples are compared: one reinforced by metallic nanowires and the other by nanoparticles. We find that the residual martensite within the shape memory alloy matrix after a pretreatment can be tailored by the reinforcement shape. In particular, our results show that the shape memory alloy matrix can retain enough residual martensite phases to achieve continuous martensite transformation in the subsequent loading when the aspect ratio of nanoreinforcement is larger than 20. In contrast, the composites reinforced with spherical or low aspect ratio reinforcement show a typical nonlinear superelasticity as a result of a low stress transfer-induced discontinuous martensite transformation within the shape memory alloy matrix.

  13. Optics of short-pitch deformed-helix ferroelectric liquid crystals: Symmetries, exceptional points, and polarization-resolved angular patterns

    NASA Astrophysics Data System (ADS)

    Kiselev, Alexei D.; Chigrinov, Vladimir G.

    2014-10-01

    In order to explore electric-field-induced transformations of polarization singularities in the polarization-resolved angular (conoscopic) patterns emerging after deformed-helix ferroelectric liquid crystal (DHFLC) cells with subwavelength helix pitch, we combine the transfer matrix formalism with the results for the effective dielectric tensor of biaxial FLCs evaluated using an improved technique of averaging over distorted helical structures. Within the framework of the transfer matrix method, we deduce a number of symmetry relations and show that the symmetry axis of L lines (curves of linear polarization) is directed along the major in-plane optical axis which rotates under the action of the electric field. When the angle between this axis and the polarization plane of incident linearly polarized light is above its critical value, the C points (points of circular polarization) appear in the form of symmetrically arranged chains of densely packed star-monstar pairs. We also emphasize the role of phase singularities of a different kind and discuss the enhanced electro-optic response of DHFLCs near the exceptional point where the condition of zero-field isotropy is fulfilled.

  14. A Transfer Hamiltonian Model for Devices Based on Quantum Dot Arrays

    PubMed Central

    Illera, S.; Prades, J. D.; Cirera, A.; Cornet, A.

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide. PMID:25879055

  15. Transfer-matrix study of a hard-square lattice gas with two kinds of particles and density anomaly

    NASA Astrophysics Data System (ADS)

    Oliveira, Tiago J.; Stilck, Jürgen F.

    2015-09-01

    Using transfer matrix and finite-size scaling methods, we study the thermodynamic behavior of a lattice gas with two kinds of particles on the square lattice. Only excluded volume interactions are considered, so that the model is athermal. Large particles exclude the site they occupy and its four first neighbors, while small particles exclude only their site. Two thermodynamic phases are found: a disordered phase where large particles occupy both sublattices with the same probability and an ordered phase where one of the two sublattices is preferentially occupied by them. The transition between these phases is continuous at small concentrations of the small particles and discontinuous at larger concentrations, both transitions are separated by a tricritical point. Estimates of the central charge suggest that the critical line is in the Ising universality class, while the tricritical point has tricritical Ising (Blume-Emery-Griffiths) exponents. The isobaric curves of the total density as functions of the fugacity of small or large particles display a minimum in the disordered phase.

  16. A transfer hamiltonian model for devices based on quantum dot arrays.

    PubMed

    Illera, S; Prades, J D; Cirera, A; Cornet, A

    2015-01-01

    We present a model of electron transport through a random distribution of interacting quantum dots embedded in a dielectric matrix to simulate realistic devices. The method underlying the model depends only on fundamental parameters of the system and it is based on the Transfer Hamiltonian approach. A set of noncoherent rate equations can be written and the interaction between the quantum dots and between the quantum dots and the electrodes is introduced by transition rates and capacitive couplings. A realistic modelization of the capacitive couplings, the transmission coefficients, the electron/hole tunneling currents, and the density of states of each quantum dot have been taken into account. The effects of the local potential are computed within the self-consistent field regime. While the description of the theoretical framework is kept as general as possible, two specific prototypical devices, an arbitrary array of quantum dots embedded in a matrix insulator and a transistor device based on quantum dots, are used to illustrate the kind of unique insight that numerical simulations based on the theory are able to provide.

  17. Contaminant sequestration in karstic aquifers: Experiments and quantification

    NASA Astrophysics Data System (ADS)

    Li, Guangquan; Loper, David E.; Kung, Robin

    2008-02-01

    A karstic aquifer typically has significant secondary porosity consisting of an interconnected system of caves or conduits. Conduit-borne contaminants can enter the contiguous limestone matrix, remain inside for a longer time than in the conduit, and subsequently be flushed out. This retention or sequestration can significantly influence the fate of contaminants within the aquifer and alter the shape of the breakthrough curve. The mechanisms involved in sequestration have been identified and quantified by analysis of the breakthrough curves generated by a set of laboratory experiments in which a conduit, porous limestone matrix, and conservative contaminant were simulated by a porous-walled pipe, chamber of closely packed glass beads, and salt, respectively. Experiments were conducted with both active and passive transfer of water between conduit and matrix, simulating differing hydrogeologic regimes. In active transfer the primary control parameter is the volume of water transferred; sequestration is primarily due to advection with the effects of diffusion and dispersion being minimal. In passive transfer the control parameters are the conduit Reynolds number and the duration that contaminant resides in the conduit; sequestration is caused by the combined effects of the conduit pressure drop, pressure variation due to bedform, and diffusion. Active and passive transfer can be unified by analyzing the ratio of the scale of pressure variation to the conduit length. In accordance with the resolved mechanisms a variety of models have been constructed to recover solute distributions in the matrix and to regenerate breakthrough curves. These analyses and models provide a potential approach to investigate contaminant migration in karstic aquifers.

  18. Regenerator filled with a matrix of polycrystalline iron whiskers

    NASA Astrophysics Data System (ADS)

    Eder, F. X.; Appel, H.

    1982-08-01

    In thermal regenerators, parameters were optimized: convection coefficient, surface of heat accumulating matrix, matrix density and heat capacity, and frequency of cycle inversions. The variation of heat capacity with working temperature was also computed. Polycrystalline iron whiskers prove a good compromise as matrix for heat regenerators at working temperatures ranging from 300 to 80 K. They were compared with wire mesh screens and microspheres of bronze and stainless steel. For theses structures and materials, thermal conductivity, pressure drop, heat transfer and yield were calculated and related to the experimental values. As transport heat gas, helium, argon, and dry nitrogen were applied at pressures up to 20 bar. Experimental and theoretical studies result in a set of formulas for calculating pressure drop, heat capacity, and heat transfer rate for a given thermal regenerator in function of mass flow. It is proved that a whisker matrix has an efficiency that depends strongly on gas pressure and composition. Iron whiskers make a good matrix with heat capacities of kW/cu cm per K, but their relative high pressure drop may, at low pressures, be a limitation. A regenerator expansion machine is described.

  19. Steady State Transportation Cooling in Porous Media Under Local, Non-Thermal Equilibrium Fluid Flow

    NASA Technical Reports Server (NTRS)

    Rodriquez, Alvaro Che

    2002-01-01

    An analytical solution to the steady-state fluid temperature for 1-D (one dimensional) transpiration cooling has been derived. Transpiration cooling has potential use in the aerospace industry for protection against high heating environments for re-entry vehicles. Literature for analytical treatments of transpiration cooling has been largely confined to the assumption of thermal equilibrium between the porous matrix and fluid. In the present analysis, the fundamental fluid and matrix equations are coupled through a volumetric heat transfer coefficient and investigated in non-thermal equilibrium. The effects of varying the thermal conductivity of the solid matrix and the heat transfer coefficient are investigated. The results are also compared to existing experimental data.

  20. Addressable inverter matrix for process and device characterization

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Sayah, H. R.

    1985-01-01

    The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold vltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

  1. Addressable inverter matrix for process and device characterization

    NASA Technical Reports Server (NTRS)

    Buehler, M. G.; Sayah, H. R.

    1985-01-01

    The addressable inverter matrix consists of 222 inverters each accessible with the aid of a shift register. The structure has proven useful in characterizing the variability of inverter transfer curves and in diagnosing processing faults. For good 3-micron CMOS bulk inverters investigated in this study, the percent standard deviation of the inverter threshold voltage was less than one percent and the inverter gain (the slope of the inverter transfer curve at the inverter threshold voltage) was less than 3 percent. The average noise margin for the inverters was near 2 volts for a power supply voltage of 5 volts. The specific faults studied included undersize pull-down transistor widths and various open contacts in the matrix.

  2. Aspects of fabrication aluminium matrix heterophase composites by suspension method

    NASA Astrophysics Data System (ADS)

    Dolata, A. J.; Dyzia, M.

    2012-05-01

    Composites with an aluminium alloy matrix (AlMMC) exhibit several advantageous properties such as good strength, stiffness, low density, resistance and dimensional stability to elevated temperatures, good thermal expansion coefficient and particularly high resistance to friction wear. Therefore such composites are more and more used in modern engineering constructions. Composites reinforced with hard ceramic particles (Al2O3, SiC) are gradually being implemented into production in automotive or aircraft industries. Another application of AlMMC is in the electronics industry, where the dimensional stability and capacity to absorb and remove heat is used in radiators. However the main problems are still: a reduction of production costs, developing methods of composite material tests and final product quality assessment, standardisation, development of recycling and mechanical processing methods. AlMMC production technologies, based on liquid-phase methods, and the shaping of products by casting methods, belong to the cheapest production methods. Application of a suspension method for the production of composites with heterophase reinforcement may turn out to be a new material and technological solution. The article presents the material and technological aspects of the transfer procedures for the production of composite suspensions from laboratory scale to a semi-industrial scale.

  3. Water exchange and pressure transfer between conduits and matrix and their influence on hydrodynamics of two karst aquifers with sinking streams

    NASA Astrophysics Data System (ADS)

    Bailly-Comte, Vincent; Martin, Jonathan B.; Jourde, Hervé; Screaton, Elizabeth J.; Pistre, Séverin; Langston, Abigail

    2010-05-01

    SummaryKarst aquifers are heterogeneous media where conduits usually drain water from lower permeability volumes (matrix and fractures). For more than a century, various approaches have used flood recession curves, which integrate all hydrodynamic processes in a karst aquifer, to infer physical properties of the movement and storage of groundwater. These investigations typically only consider flow to the conduits and thus have lacked quantitative observations of how pressure transfer and water exchange between matrix and conduit during flooding could influence recession curves. We present analyses of simultaneous discharge and water level time series of two distinctly different karst systems, one with low porosity and permeability matrix rocks in southern France, and one with high porosity and permeability matrix rocks in north-central Florida (USA). We apply simple mathematical models of flood recession using time series representations of recharge, storage, and discharge processes in the karst aquifer. We show that karst spring hydrographs can be interpreted according to pressure transfer between two distinct components of the aquifer, conduit and matrix porosity, which induce two distinct responses at the spring. Water exchange between conduits and matrix porosity successively control the flow regime at the spring. This exchange is governed by hydraulic head differences between conduits and matrix, head gradients within conduits, and the contrast of permeability between conduits and matrix. These observations have consequences for physical interpretations of recession curves and modeling of karst spring flows, particularly for the relative magnitudes of base flow and quick flow from karst springs. Finally, these results suggest that similar analyses of recession curves can be applied to karst aquifers with distinct physical characteristics utilizing well and spring hydrograph data, but information must be known about the hydrodynamics and physical properties of the aquifer before the results can be correctly interpreted.

  4. Verification of three-microphone impedance tube method for measurement of transmission loss in aerogels

    NASA Astrophysics Data System (ADS)

    Connick, Robert J.

    Accurate measurement of normal incident transmission loss is essential for the acoustic characterization of building materials. In this research, a method of measuring normal incidence sound transmission loss proposed by Salissou et al. as a complement to standard E2611-09 of the American Society for Testing and Materials [Standard Test Method for Measurement of Normal Incidence Sound Transmission of Acoustical Materials Based on the Transfer Matrix Method (American Society for Testing and Materials, New York, 2009)] is verified. Two sam- ples from the original literature are used to verify the method as well as a Filtros RTM sample. Following the verification, several nano-material Aerogel samples are measured.

  5. Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

    PubMed

    Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

    2005-01-27

    Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

  6. Elastic plate spallation

    NASA Technical Reports Server (NTRS)

    Oline, L.; Medaglia, J.

    1972-01-01

    The dynamic finite element method was used to investigate elastic stress waves in a plate. Strain displacement and stress strain relations are discussed along with the stiffness and mass matrix. The results of studying point load, and distributed load over small, intermediate, and large radii are reported. The derivation of finite element matrices, and the derivation of lumped and consistent matrices for one dimensional problems with Laplace transfer solutions are included. The computer program JMMSPALL is also included.

  7. Styrene-terminated polysulfone oligomers as matrix material for graphite reinforced composites: An initial study

    NASA Technical Reports Server (NTRS)

    Garcia, Dana; Bowles, Kenneth J.; Vannucci, Raymond D.

    1987-01-01

    Styrene terminated polysulfone oligomers are part of an oligomeric class of compounds with end groups capable of thermal polymerization. These materials can be used as matrices for graphite reinforced composites. The initial evaluation of styrene terminated polysulfone oligomer based composites are summarized in terms of fabrication methods, and mechanical and environmental properties. In addition, a description and evaluation is provided of the NASA/Industry Fellowship Program for Technology Transfer.

  8. Transfer matrix method solving interface optical phonons in wurtzite core-multishell nanowires of III-nitrides

    NASA Astrophysics Data System (ADS)

    Xue, Z. X.; Qu, Y.; Xie, H.; Ban, S. L.

    2016-12-01

    Within the framework of dielectric continuum and Loudon's uniaxial crystal models, the transfer matrix method (TMM) is developed to investigate interface optical phonons (IOPs) in cylindrical wurtzite core-multishell nanowires (CMSNWs) consisting of ternary mixed crystals (TMCs). The IOPs in GaN/InxGa1-xN/InyGa1-yN and GaN/InxGa1-xN/InyGa1-yN/InzGa1-zN CMSNWs are calculated as examples. The results show that there may be several types of IOPs existing in certain frequency regions in CMSNWs for a given component due to the phonon dispersion anisotropy in wurtzite nitrides. The IOPs are classified by possible combinations of the interfaces in CMSNWs. Furthermore, the dispersion relations and electro-static potentials of each kind of IOPs are discussed in detail. The dispersion relations of IOPs in CMSNWs is found to be the combination of that in each nearest two layer CSNW. It can explain the fact that the total branch number of IOPs obey the 2n rule. It is also found that the peak positions of electro-static potentials are decided by the layer component order from the inner layer to outside in CMSNWs. The results indicate that TMM for IOPs is available and can be commodiously extended to other cylindrical wurtzite III-nitride CMSNWs. Based on this method, one can further discuss the IOPs related photoelectric properties in nitride CMSNWs consisting of TMCs.

  9. Sharp Estimates in Ruelle Theorems for Matrix Transfer Operators

    NASA Astrophysics Data System (ADS)

    Campbell, J.; Latushkin, Y.

    A matrix coefficient transfer operator , on the space of -sections of an m-dimensional vector bundle over n-dimensional compact manifold is considered. The spectral radius of is estimated bya; and the essential spectral radius by Here is the set of ergodic f-invariant measures, and for is the measure-theoretic entropy of f, is the largest Lyapunov exponent of the cocycle over f generated by , and is the smallest Lyapunov exponent of the differential of f.

  10. Fast and Accurate Hybrid Stream PCRTMSOLAR Radiative Transfer Model for Reflected Solar Spectrum Simulation in the Cloudy Atmosphere

    NASA Technical Reports Server (NTRS)

    Yang, Qiguang; Liu, Xu; Wu, Wan; Kizer, Susan; Baize, Rosemary R.

    2016-01-01

    A hybrid stream PCRTM-SOLAR model has been proposed for fast and accurate radiative transfer simulation. It calculates the reflected solar (RS) radiances with a fast coarse way and then, with the help of a pre-saved matrix, transforms the results to obtain the desired high accurate RS spectrum. The methodology has been demonstrated with the hybrid stream discrete ordinate (HSDO) radiative transfer (RT) model. The HSDO method calculates the monochromatic radiances using a 4-stream discrete ordinate method, where only a small number of monochromatic radiances are simulated with both 4-stream and a larger N-stream (N = 16) discrete ordinate RT algorithm. The accuracy of the obtained channel radiance is comparable to the result from N-stream moderate resolution atmospheric transmission version 5 (MODTRAN5). The root-mean-square errors are usually less than 5x10(exp -4) mW/sq cm/sr/cm. The computational speed is three to four-orders of magnitude faster than the medium speed correlated-k option MODTRAN5. This method is very efficient to simulate thousands of RS spectra under multi-layer clouds/aerosols and solar radiation conditions for climate change study and numerical weather prediction applications.

  11. The GMOseek matrix: a decision support tool for optimizing the detection of genetically modified plants.

    PubMed

    Block, Annette; Debode, Frédéric; Grohmann, Lutz; Hulin, Julie; Taverniers, Isabel; Kluga, Linda; Barbau-Piednoir, Elodie; Broeders, Sylvia; Huber, Ingrid; Van den Bulcke, Marc; Heinze, Petra; Berben, Gilbert; Busch, Ulrich; Roosens, Nancy; Janssen, Eric; Žel, Jana; Gruden, Kristina; Morisset, Dany

    2013-08-22

    Since their first commercialization, the diversity of taxa and the genetic composition of transgene sequences in genetically modified plants (GMOs) are constantly increasing. To date, the detection of GMOs and derived products is commonly performed by PCR-based methods targeting specific DNA sequences introduced into the host genome. Information available regarding the GMOs' molecular characterization is dispersed and not appropriately organized. For this reason, GMO testing is very challenging and requires more complex screening strategies and decision making schemes, demanding in return the use of efficient bioinformatics tools relying on reliable information. The GMOseek matrix was built as a comprehensive, online open-access tabulated database which provides a reliable, comprehensive and user-friendly overview of 328 GMO events and 247 different genetic elements (status: 18/07/2013). The GMOseek matrix is aiming to facilitate GMO detection from plant origin at different phases of the analysis. It assists in selecting the targets for a screening analysis, interpreting the screening results, checking the occurrence of a screening element in a group of selected GMOs, identifying gaps in the available pool of GMO detection methods, and designing a decision tree. The GMOseek matrix is an independent database with effective functionalities in a format facilitating transferability to other platforms. Data were collected from all available sources and experimentally tested where detection methods and certified reference materials (CRMs) were available. The GMOseek matrix is currently a unique and very valuable tool with reliable information on GMOs from plant origin and their present genetic elements that enables further development of appropriate strategies for GMO detection. It is flexible enough to be further updated with new information and integrated in different applications and platforms.

  12. The GMOseek matrix: a decision support tool for optimizing the detection of genetically modified plants

    PubMed Central

    2013-01-01

    Background Since their first commercialization, the diversity of taxa and the genetic composition of transgene sequences in genetically modified plants (GMOs) are constantly increasing. To date, the detection of GMOs and derived products is commonly performed by PCR-based methods targeting specific DNA sequences introduced into the host genome. Information available regarding the GMOs’ molecular characterization is dispersed and not appropriately organized. For this reason, GMO testing is very challenging and requires more complex screening strategies and decision making schemes, demanding in return the use of efficient bioinformatics tools relying on reliable information. Description The GMOseek matrix was built as a comprehensive, online open-access tabulated database which provides a reliable, comprehensive and user-friendly overview of 328 GMO events and 247 different genetic elements (status: 18/07/2013). The GMOseek matrix is aiming to facilitate GMO detection from plant origin at different phases of the analysis. It assists in selecting the targets for a screening analysis, interpreting the screening results, checking the occurrence of a screening element in a group of selected GMOs, identifying gaps in the available pool of GMO detection methods, and designing a decision tree. The GMOseek matrix is an independent database with effective functionalities in a format facilitating transferability to other platforms. Data were collected from all available sources and experimentally tested where detection methods and certified reference materials (CRMs) were available. Conclusions The GMOseek matrix is currently a unique and very valuable tool with reliable information on GMOs from plant origin and their present genetic elements that enables further development of appropriate strategies for GMO detection. It is flexible enough to be further updated with new information and integrated in different applications and platforms. PMID:23965170

  13. Heat transfer and fluid flow analysis of self-healing in metallic materials

    NASA Astrophysics Data System (ADS)

    Martínez Lucci, J.; Amano, R. S.; Rohatgi, P. K.

    2017-03-01

    This paper explores imparting self-healing characteristics to metal matrices similar to what are observed in biological systems and are being developed for polymeric materials. To impart self-healing properties to metal matrices, a liquid healing method was investigated; the met hod consists of a container filled with low melting alloy acting as a healing agent, embedded into a high melting metal matrix. When the matrix is cracked; self-healing is achieved by melting the healing agent allowing the liquid metal to flow into the crack. Upon cooling, solidification of the healing agent occurs and seals the crack. The objective of this research is to investigate the fluid flow and heat transfer to impart self-healing property to metal matrices. In this study, a dimensionless healing factor, which may help predict the possibility of healing is proposed. The healing factor is defined as the ratio of the viscous forces and the contact area of liquid metal and solid which prevent flow, and volume expansion, density, and velocity of the liquid metal, gravity, crack size and orientation which promote flow. The factor incorporates the parameters that control self-healing mechanism. It was observed that for lower values of the healing factor, the liquid flows, and for higher values of healing factor, the liquid remains in the container and healing does not occur. To validate and identify the critical range of the healing factor, experiments and simulations were performed for selected combinations of healing agents and metal matrices. The simulations were performed for three-dimensional models and a commercial software 3D Ansys-Fluent was used. Three experimental methods of synthesis of self-healing composites were used. The first method consisted of creating a hole in the matrices, and liquid healing agent was poured into the hole. The second method consisted of micro tubes containing the healing agent, and the third method consisted of incorporating micro balloons containing the healing agent in the matrix. The observed critical range of the healing factor is between 407 and 495; only for healing factor values below 407 healing was observed in the matrices.

  14. Evaluation of the applicability of the dual‐domain mass transfer model in porous media containing connected high‐conductivity channels

    USGS Publications Warehouse

    Liu, Gaisheng; Zheng, Chunmiao; Gorelick, Steven M.

    2007-01-01

    This paper evaluates the dual‐domain mass transfer (DDMT) model to represent transport processes when small‐scale high‐conductivity (K) preferential flow paths (PFPs) are present in a homogenous porous media matrix. The effects of PFPs upon solute transport were examined through detailed numerical experiments involving different realizations of PFP networks, PFP/matrix conductivity contrasts varying from 10:1 to 200:1, different magnitudes of effective conductivities, and a range of molecular diffusion coefficients. Results suggest that the DDMT model can reproduce both the near‐source peak and the downstream low‐concentration spreading observed in the embedded dendritic network when there are large conductivity contrasts between high‐K PFPs and the low‐K matrix. The accuracy of the DDMT model is also affected by the geometry of PFP networks and by the relative significance of the diffusion process in the network‐matrix system.

  15. Tune color of single-phase LiGd(MoO4)2-X(WO4)X: Sm3+, Tb3+ via adjusting the proportion of matrix and energy transfer to create white-light phosphor

    NASA Astrophysics Data System (ADS)

    Wu, Hongyue; Yang, Junfeng; Wang, Xiaoxue; Gan, Shucai; Li, Linlin

    2018-03-01

    A series of LiGd(MO4)2: Sm3+, Tb3+ (M = Mo, W) phosphors was prepared by a conventional solid state reaction method. Powder X-Ray diffraction (XRD) analysis reveals that the compounds are of the same structure type. Their luminescent properties have been studied. The optimal doping concentrations are 8% for Sm3+ and 18% for Tb3+ in the LiGd(MoO4)2 host. Sm3+ and Tb3+ have different sensitivity to the Mo/W ratio. For LiGd(MoO4)2-X(WO4)X: Sm3+ (X = 0, 0.4, 0.8, 1.2, 1.6, 2.0), the strongest emission intensity is 1.766 times than that of the weakest, while 171 times for LiGd(MoO4)2-X(WO4)X: Tb3+. The experimental results show that Mo/W ratio strong influences on the properties of LiGd(MoO4)2-X(WO4)X: Tb3+. With the increasing of WO42- groups concentration, the shape of characteristic excitation peaks of Tb3+ is almost the same and the excitation intensity gradually increase. Moreover, the energy transfer from Tb3+ to Sm3+ has been realized in the co-doped phosphors. The experimental analysis and theoretical calculations reveal that the quadrupole-quadrupole interaction is the dominant mechanism for the Tb3+→Sm3+ energy transfer. Therefore, luminous intensity can be adjusted by different sensitivities to matrix composition and energy transfer from Tb3+→Sm3+. By this tuning color method, white-light-emitting phosphor has been prepared. The excitation wavelength is 378 nm, and this indicates that the white-light-emitting phosphor could be pumped by near-UV light.

  16. Long-range correction for tight-binding TD-DFT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Humeniuk, Alexander; Mitrić, Roland, E-mail: roland.mitric@uni-wuerzburg.de

    2015-10-07

    We present two improvements to the tight-binding approximation of time-dependent density functional theory (TD-DFTB): First, we add an exact Hartree-Fock exchange term, which is switched on at large distances, to the ground state Hamiltonian and similarly to the coupling matrix that enters the linear response equations for the calculation of excited electronic states. We show that the excitation energies of charge transfer states are improved relative to the standard approach without the long-range correction by testing the method on a set of molecules from the database in Peach et al. [J. Chem. Phys. 128, 044118 (2008)] which are known tomore » exhibit problematic charge transfer states. The degree of spatial overlap between occupied and virtual orbitals indicates where TD-DFTB and long-range corrected TD-DFTB (lc-TD-DFTB) can be expected to produce large errors. Second, we improve the calculation of oscillator strengths. The transition dipoles are obtained from Slater Koster files for the dipole matrix elements between valence orbitals. In particular, excitations localized on a single atom, which appear dark when using Mulliken transition charges, acquire a more realistic oscillator strength in this way. These extensions pave the way for using lc-TD-DFTB to describe the electronic structure of large chromophoric polymers, where uncorrected TD-DFTB fails to describe the high degree of conjugation and produces spurious low-lying charge transfer states.« less

  17. Effect of storage and processing on plasmid, yeast and plant genomic DNA stability in juice from genetically modified oranges.

    PubMed

    Weiss, Julia; Ros-Chumillas, Maria; Peña, Leandro; Egea-Cortines, Marcos

    2007-01-30

    Recombinant DNA technology is an important tool in the development of plant varieties with new favourable features. There is strong opposition towards this technology due to the potential risk of horizontal gene transfer between genetically modified plant material and food-associated bacteria, especially if genes for antibiotic resistance are involved. Since horizontal transfer efficiency depends on size and length of homologous sequences, we investigated the effect of conditions required for orange juice processing on the stability of DNA from three different origins: plasmid DNA, yeast genomic DNA and endogenous genomic DNA from transgenic sweet orange (C. sinensis L. Osb.). Acidic orange juice matrix had a strong degrading effect on plasmid DNA which becomes apparent in a conformation change from supercoiled structure to nicked, linear structure within 5h of storage at 4 degrees C. Genomic yeast DNA was degraded during exposure to acidic orange juice matrix within 4 days, and also the genomic DNA of C. sinensis suffered degradation within 2 days of storage as indicated by amplification results from transgene markers. Standard pasteurization procedures affected DNA integrity depending on the method and time used. Our data show that the current standard industrial procedures to pasteurize orange juice as well as its acidic nature causes a strong degradation of both yeast and endogenous genomic DNA below sizes reported to be suitable for horizontal gene transfer.

  18. Charge-Transfer Complexes and Photochemistry of Ozone with Ferrocene and n-Butylferrocene: A UV-vis Matrix-Isolation Study.

    PubMed

    Pinelo, Laura F; Kugel, Roger W; Ault, Bruce S

    2015-10-15

    The reactions of ozone with ferrocene (cp2Fe) and with n-butylferrocene (n-butyl cp2Fe) were studied using matrix isolation, UV-vis spectroscopy, and theoretical calculations. The codeposition of cp2Fe with O3 and of n-butyl cp2Fe with O3 into an argon matrix led to the production of 1:1 charge-transfer complexes with absorptions at 765 and 815 nm, respectively. These absorptions contribute to the green matrix color observed upon initial deposition. The charge-transfer complexes underwent photochemical reactions upon irradiation with red light (λ ≥ 600 nm). Theoretical UV-vis spectra of the charge-transfer complexes and photochemical products were calculated using TD-DFT at the B3LYP/6-311G++(d,2p) level of theory. The calculated UV-vis spectra were in good agreement with the experimental results. MO analysis of these long-wavelength transitions showed them to be n→ π* on the ozone subunit in the complex and indicated that the formation of the charge-transfer complex between ozone and cp2Fe or n-butyl cp2Fe affects how readily the π* orbital on O3 is populated when red light (λ ≥ 600 nm) is absorbed. 1:1 complexes of cp2Fe and n-butyl cp2Fe with O2 were also observed experimentally and calculated theoretically. These results support and enhance previous infrared studies of the mechanism of photooxidation of ferrocene by ozone, a reaction that has considerable significance for the formation of iron oxide thin films for a range of applications.

  19. Numerical solutions to the time-dependent Bloch equations revisited.

    PubMed

    Murase, Kenya; Tanki, Nobuyoshi

    2011-01-01

    The purpose of this study was to demonstrate a simple and fast method for solving the time-dependent Bloch equations. First, the time-dependent Bloch equations were reduced to a homogeneous linear differential equation, and then a simple equation was derived to solve it using a matrix operation. The validity of this method was investigated by comparing with the analytical solutions in the case of constant radiofrequency irradiation. There was a good agreement between them, indicating the validity of this method. As a further example, this method was applied to the time-dependent Bloch equations in the two-pool exchange model for chemical exchange saturation transfer (CEST) or amide proton transfer (APT) magnetic resonance imaging (MRI), and the Z-spectra and asymmetry spectra were calculated from their solutions. They were also calculated using the fourth/fifth-order Runge-Kutta-Fehlberg (RKF) method for comparison. There was also a good agreement between them, and this method was much faster than the RKF method. In conclusion, this method will be useful for analyzing the complex CEST or APT contrast mechanism and/or investigating the optimal conditions for CEST or APT MRI. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Tablet potency of Tianeptine in coated tablets by near infrared spectroscopy: model optimisation, calibration transfer and confidence intervals.

    PubMed

    Boiret, Mathieu; Meunier, Loïc; Ginot, Yves-Michel

    2011-02-20

    A near infrared (NIR) method was developed for determination of tablet potency of active pharmaceutical ingredient (API) in a complex coated tablet matrix. The calibration set contained samples from laboratory and production scale batches. The reference values were obtained by high performance liquid chromatography (HPLC) and partial least squares (PLS) regression was used to establish a model. The model was challenged by calculating tablet potency of two external test sets. Root mean square errors of prediction were respectively equal to 2.0% and 2.7%. To use this model with a second spectrometer from the production field, a calibration transfer method called piecewise direct standardisation (PDS) was used. After the transfer, the root mean square error of prediction of the first test set was 2.4% compared to 4.0% without transferring the spectra. A statistical technique using bootstrap of PLS residuals was used to estimate confidence intervals of tablet potency calculations. This method requires an optimised PLS model, selection of the bootstrap number and determination of the risk. In the case of a chemical analysis, the tablet potency value will be included within the confidence interval calculated by the bootstrap method. An easy to use graphical interface was developed to easily determine if the predictions, surrounded by minimum and maximum values, are within the specifications defined by the regulatory organisation. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. A Framework for Integrated Component and System Analyses of Instabilities

    NASA Technical Reports Server (NTRS)

    Ahuja, Vineet; Erwin, James; Arunajatesan, Srinivasan; Cattafesta, Lou; Liu, Fei

    2010-01-01

    Instabilities associated with fluid handling and operation in liquid rocket propulsion systems and test facilities usually manifest themselves as structural vibrations or some form of structural damage. While the source of the instability is directly related to the performance of a component such as a turbopump, valve or a flow control element, the associated pressure fluctuations as they propagate through the system have the potential to amplify and resonate with natural modes of the structural elements and components of the system. In this paper, the authors have developed an innovative multi-level approach that involves analysis at the component and systems level. The primary source of the unsteadiness is modeled with a high-fidelity hybrid RANS/LES based CFD methodology that has been previously used to study instabilities in feed systems. This high fidelity approach is used to quantify the instability and understand the physics associated with the instability. System response to the driving instability is determined through a transfer matrix approach wherein the incoming and outgoing pressure and velocity fluctuations are related through a transfer (or transmission) matrix. The coefficients of the transfer matrix for each component (i.e. valve, pipe, orifice etc.) are individually derived from the flow physics associated with the component. A demonstration case representing a test loop/test facility comprised of a network of elements is constructed with the transfer matrix approach and the amplification of modes analyzed as the instability propagates through the test loop.

  2. Inferring Weighted Directed Association Network from Multivariate Time Series with a Synthetic Method of Partial Symbolic Transfer Entropy Spectrum and Granger Causality

    PubMed Central

    Hu, Yanzhu; Ai, Xinbo

    2016-01-01

    Complex network methodology is very useful for complex system explorer. However, the relationships among variables in complex system are usually not clear. Therefore, inferring association networks among variables from their observed data has been a popular research topic. We propose a synthetic method, named small-shuffle partial symbolic transfer entropy spectrum (SSPSTES), for inferring association network from multivariate time series. The method synthesizes surrogate data, partial symbolic transfer entropy (PSTE) and Granger causality. A proper threshold selection is crucial for common correlation identification methods and it is not easy for users. The proposed method can not only identify the strong correlation without selecting a threshold but also has the ability of correlation quantification, direction identification and temporal relation identification. The method can be divided into three layers, i.e. data layer, model layer and network layer. In the model layer, the method identifies all the possible pair-wise correlation. In the network layer, we introduce a filter algorithm to remove the indirect weak correlation and retain strong correlation. Finally, we build a weighted adjacency matrix, the value of each entry representing the correlation level between pair-wise variables, and then get the weighted directed association network. Two numerical simulated data from linear system and nonlinear system are illustrated to show the steps and performance of the proposed approach. The ability of the proposed method is approved by an application finally. PMID:27832153

  3. Defect modes in photonic crystal slabs studied using terahertz time-domain spectroscopy.

    PubMed

    Jian, Zhongping; Pearce, Jeremy; Mittleman, Daniel M

    2004-09-01

    We describe broadband coherent transmission studies of two-dimensional photonic crystals consisting of a hexagonal array of air holes in a dielectric slab in a planar waveguide. By filling several of the air holes in the photonic crystal slab, we observe the signature of a defect mode within the stop band, in both the amplitude and phase spectra. The experimental results are in reasonable agreement with theoretical calculations using the transfer matrix method.

  4. Generating ultra wide low-frequency gap for transverse wave isolation via inertial amplification effects

    NASA Astrophysics Data System (ADS)

    Li, Jingru; Li, Sheng

    2018-02-01

    Low-frequency transverse wave propagation plays a significant role in the out-of-plane vibration control. To efficiently attenuate the propagation of transverse waves at low-frequency range, this letter proposed a new type phononic beam by attaching inertial amplification mechanisms on it. The wave propagation of the beam with enhanced effective inertia is analyzed using the transfer matrix method. It is demonstrated that the low-frequency gap within inertial amplification effects can possess much wider bandwidth than using the local resonance method, thus is more suitable for designing applications to suppress transverse wave propagation.

  5. Method for molding ceramic powders

    DOEpatents

    Janney, Mark A.

    1990-01-01

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  6. Method for molding ceramic powders

    DOEpatents

    Janney, M.A.

    1990-01-16

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant for the metal-containing powder, and a monomer solution. The monomer solution includes at least one multifunctional monomer, a free-radical initiator, and an organic solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, where after the product may be sintered.

  7. Plasmonic Structure Enhanced Exciton Generation at the Interface between the Perovskite Absorber and Copper Nanoparticles

    PubMed Central

    Lin, Kuen-Feng; Chiang, Chien-Hung; Wu, Chun-Guey

    2014-01-01

    The refractive index and extinction coefficient of a triiodide perovskite absorber (TPA) were obtained by fitting the transmittance spectra of TPA/PEDOT:PSS/ITO/glass using the transfer matrix method. Cu nanoplasmonic structures were designed to enhance the exciton generation in the TPA and to simultaneously reduce the film thickness of the TPA. Excitons were effectively generated at the interface between TPA and Cu nanoparticles, as observed through the 3D finite-difference time-domain method. The exciton distribution is advantageous for the exciton dissociation and carrier transport. PMID:25295290

  8. Quantum kinetic expansion in the spin-boson model: Matrix formulation and system-bath factorized initial state.

    PubMed

    Gong, Zhihao; Tang, Zhoufei; Wang, Haobin; Wu, Jianlan

    2017-12-28

    Within the framework of the hierarchy equation of motion (HEOM), the quantum kinetic expansion (QKE) method of the spin-boson model is reformulated in the matrix representation. The equivalence between the two formulations (HEOM matrices and quantum operators) is numerically verified from the calculation of the time-integrated QKE rates. The matrix formulation of the QKE is extended to the system-bath factorized initial state. Following a one-to-one mapping between HEOM matrices and quantum operators, a quantum kinetic equation is rederived. The rate kernel is modified by an extra term following a systematic expansion over the site-site coupling. This modified QKE is numerically tested for its reliability by calculating the time-integrated rate and non-Markovian population kinetics. For an intermediate-to-strong dissipation strength and a large site-site coupling, the population transfer is found to be significantly different when the initial condition is changed from the local equilibrium to system-bath factorized state.

  9. MALDI In-Source Decay of Protein: The Mechanism of c-Ion Formation

    PubMed Central

    Takayama, Mitsuo

    2016-01-01

    The in-source decay (ISD) phenomenon, the fragmentation at an N–Cα bond of a peptide backbone that occurs within several tens of nanoseconds in the ion-source in matrix-assisted laser desorption/ionization mass spectrometry (MALDI MS), is discussed from the standpoints of the discovery and early publications dealing with MALDI-ISD, the formation of c-ions in energy-sudden desorption/ionization methods, the formation of radical species in a MALDI, model construction for ISD, and matrix materials that are suitable for use in MALDI-ISD. The formation of c-ions derived from peptides and proteins in MALDI-ISD can be rationalized by a mechanism involving intermolecular hydrogen transfer, denoted as the “Takayama’s model” by De Pauw’s group (Anal. Chem. 79: 8678–8685, 2007). It should be emphasized that the model for MALDI-ISD was constructed on the basis of X-ray crystallography and scanning probe microscopy (SPM) analyses of matrix crystals, as well as the use of isotopically-labelled peptides. PMID:27162707

  10. Heat transfer and flow friction correlations for perforated plate matrix heat exchangers

    NASA Astrophysics Data System (ADS)

    Ratna Raju, L.; Kumar, S. Sunil; Chowdhury, K.; Nandi, T. K.

    2017-02-01

    Perforated plate matrix heat exchangers (MHE) are constructed of high conductivity perforated plates stacked alternately with low conductivity spacers. They are being increasingly used in many cryogenic applications including Claude cycle or Reversed Brayton cycle cryo-refrigerators and liquefiers. Design of high NTU (number of (heat) transfer unit) cryogenic MHEs requires accurate heat transfer coefficient and flow friction factor. Thermo-hydraulic behaviour of perforated plates strongly depends on the geometrical parameters. Existing correlations, however, are mostly expressed as functions of Reynolds number only. This causes, for a given configuration, significant variations in coefficients from one correlation to the other. In this paper we present heat transfer and flow friction correlations as functions of all geometrical and other controlling variables. A FluentTM based numerical model has been developed for heat transfer and pressure drop studies over a stack of alternately arranged perforated plates and spacers. The model is validated with the data from literature. Generalized correlations are obtained through regression analysis over a large number of computed data.

  11. Heat Transfer and Fluid Transport of Supercritical CO 2 in Enhanced Geothermal System with Local Thermal Non-equilibrium Model

    DOE PAGES

    Zhang, Le; Luo, Feng; Xu, Ruina; ...

    2014-12-31

    The heat transfer and fluid transport of supercritical CO 2 in enhanced geothermal system (EGS) is studied numerically with local thermal non-equilibrium model, which accounts for the temperature difference between solid matrix and fluid components in porous media and uses two energy equations to describe heat transfer in the solid matrix and in the fluid, respectively. As compared with the previous results of our research group, the effect of local thermal non-equilibrium mainly depends on the volumetric heat transfer coefficient ah, which has a significant effect on the production temperature at reservoir outlet and thermal breakthrough time. The uniformity ofmore » volumetric heat transfer coefficient ah has little influence on the thermal breakthrough time, but the temperature difference become more obvious with time after thermal breakthrough with this simulation model. The thermal breakthrough time reduces and the effect of local thermal non-equilibrium becomes significant with decreasing ah.« less

  12. Use of residence time distribution for evaluation of gaseous pollutant volatilization from stored swine manure.

    PubMed

    Liao, C M

    1997-01-01

    A quantification analysis for evaluation of gaseous pollutant volatilization as a result of mass transfer from stored swine manure is presented from the viewpoint of residence time distribution. The method is based on evaluating the moments of concentration vs. time curves of both air and gaseous pollutants. The concept of moments of concentration histories is applicable to characterize the dispersal of the supplied air or gaseous pollutant in a ventilated system. The mean age or residence time of airflow can be calculated from an inverse system state matrix [B]-1 of a linear dynamic equation describing the dynamics of gaseous pollutant in a ventilated airspace. The sum elements in an arbitrary row i in matrix [B]-1 is equal to the mean age of airflow in airspace i. The mean age of gaseous pollutant in airspace i can be obtained from the area under the concentration profile divided by the equilibrium concentration reading in that space caused by gaseous pollutant sources. Matrix [B]-1 can also be represented in terms of the inverse local airflow rate matrix ([W]-1), transition probability matrix ([P]), and air volume matrix ([V]) as, [B]-1 = [W]-1[P][V]. Finally the mean age of airflow in a ventilated airspace can be interpreted by the physical characteristics of matrices [W] and [P]. The practical use of the concepts is also applied in a typical pig unit.

  13. Stress transfer around a broken fiber in unidirectional fiber-reinforced composites considering matrix damage evolution and interface slipping

    NASA Astrophysics Data System (ADS)

    Yang, Zhong; Zhang, BoMing; Zhao, Lin; Sun, XinYang

    2011-02-01

    A shear-lag model is applied to study the stress transfer around a broken fiber within unidirectional fiber-reinforced composites (FRC) subjected to uniaxial tensile loading along the fiber direction. The matrix damage and interfacial debonding, which are the main failure modes, are considered in the model. The maximum stress criterion with the linear damage evolution theory is used for the matrix. The slipping friction stress is considered in the interfacial debonding region using Coulomb friction theory, in which interfacial clamping stress comes from radial residual stress and mismatch of Poisson's ratios of constituents (fiber and matrix). The stress distributions in the fiber and matrix are obtained by the shear-lag theory added with boundary conditions, which includes force continuity and displacement compatibility constraints in the broken and neighboring intact fibers. The result gives axial stress distribution in fibers and shear stress in the interface and compares the theory reasonably well with the measurement by a polarized light microscope. The relation curves between damage, debonding and ineffective region lengths with external strain loading are obtained.

  14. Generalized design of a zero-geometric-loss, astigmatism-free, modified four-objective multipass matrix system.

    PubMed

    Guo, Yin; Sun, LiQun; Yang, Zheng; Liu, Zilong

    2016-02-20

    During this study we constructed a generalized parametric modified four-objective multipass matrix system (MMS). We used an optical system comprising four asymmetrical spherical mirrors to improve the alignment process. The use of a paraxial equation for the design of the front transfer optics yielded the initial condition for modeling our MMS. We performed a ray tracing simulation to calculate the significant aberration of the system (astigmatism). Based on the calculated meridional and sagittal focus positions, the complementary focusing mirror was easily designed to provide an output beam free of astigmatism. We have presented an example of a 108-transit multipass system (5×7 matrix arrangement) with a relatively larger numerical aperture source (xenon light source). The whole system exhibits zero theoretical geometrical loss when simulated with Zemax software. The MMS construction strategy described in this study provides an anastigmatic output beam and the generalized approach to design a controllable matrix spot pattern on the field mirrors. Asymmetrical reflective mirrors aid in aligning the whole system with high efficiency. With the generalized design strategy in terms of optics configuration and asymmetrical fabrication method in this paper, other kinds of multipass matrix system coupled with different sources and detector systems also can be achieved.

  15. Carbon based sample supports and matrices for laser desorption/ ionization mass spectrometry.

    PubMed

    Rainer, Matthias; Najam-ul-Haq, Muhammad; Huck, Christian W; Vallant, Rainer M; Heigl, Nico; Hahn, Hans; Bakry, Rania; Bonn, Günther K

    2007-01-01

    Laser desorption/ionization mass spectrometry (LDI-MS) is a widespread and powerful technique for mass analysis allowing the soft ionization of molecules such as peptides, proteins and carbohydrates. In many applications, an energy absorbing matrix has to be added to the analytes in order to protect them from being fragmented by direct laser beam. LDI-MS in conjunction with matrix is commonly referred as matrix-assisted LDI (MALDI). One of the striking disadvantages of this method is the desorption of matrix molecules, which causes interferences originating from matrix background ions in lower mass range (< 1000 Da). This has been led to the development of a variety of different carbon based LDI sample supports, which are capable of absorbing laser light and simultaneously transfering energy to the analytes for desorption. Furthermore carbon containing sample supports are used as carrier materials for the specific binding and preconcentration of molecules out of complex samples. Their subsequent analysis with MALDI mass spectrometry allows performing studies in metabolomics and proteomics. Finally a thin layer of carbon significantly improves sensitivity concerning detection limit. Analytes in low femtomole and attomole range can be detected in this regard. In the present article, these aspects are reviewed from patents where nano-based carbon materials are comprehensively utilized.

  16. Determination of mass and heat transfer parameters during freeze-drying cycles of pharmaceutical products.

    PubMed

    Hottot, A; Vessot, S; Andrieu, J

    2005-01-01

    The principal aim of this study was to evaluate the water vapour mass transfer resistance of the dried layer and the vial heat transfer coefficient values of a pharmaceutical product during the primary drying period. First, overall vial heat transfer coefficient values, Kv, were determined by a gravimetric method based on pure ice sublimation experiments. Thus, it was possible to set up a map of the total heat flux received by each vial throughout the plate surface of our pilot scale freeze-dryer. Important heterogeneities were observed for the vials placed at the plate edges and for the vials placed at the center of the plate. As well, the same gravimetric method was also used to precisely determine the influence of main lyophilization operating parameters (shelf temperature and gas total pressure) or the vial types and sizes on these overall heat transfer coefficient values. A semi-empirical relationship as a function of total gas pressure was proposed. The transient method by pressure rise analysis (PRA method) after interrupting the water vapour flow between the sublimation chamber and the condenser, previously set up and validated in our laboratory, was then extensively used with an amorphous BSA-based formulation to identify the dried layer mass transfer resistance values, Rp, the ice front temperature, and the total heat transfer coefficient values, Kv, with or without annealing treatment. It was proved that this method gave accurate and coherent data only during the first half of the sublimation period when the totality of the vials of the set was still sublimating. Thus, this rapid method allowed estimation of, on line and in situ, the sublimation front temperature and the characterization of the morphology and structure of the freeze-dried layer, all along the first part of the sublimation period. The estimated sublimation temperatures shown by the PRA model were about 2 degrees C lower than the experimental values obtained using thermocouples inserted inside the vial, in accordance with previous data given by this method for similar freeze-drying conditions. As well, by using this method we could confirm the homogenization of the dried layer porous structure by annealing treatment after the freezing step. Furthermore, frozen matrix structure analysis (mean pore diameter) using optical microscopy and mass transfer modelling of water vapour by molecular diffusion (Knudsen regime) allowed, in some cases, to predict the experimental values of this overall mass transfer resistance directly related to the freeze-dried cake permeability.

  17. Laser-assisted photothermal imprinting of nanocomposite

    NASA Astrophysics Data System (ADS)

    Lu, Y.; Shao, D. B.; Chen, S. C.

    2004-08-01

    We report on a laser-assisted photothermal imprinting method for directly patterning carbon nanofiber-reinforced polyethylene nanocomposite. A single laser pulse from a solid state Nd :YAG laser (10ns pluse, 532 and 355nm wavelengths) is used to melt/soften a thin skin layer of the polymer nanocomposite. Meanwhile, a fused quartz mold with micro sized surface relief structures is pressed against the surface of the composite. Successful pattern transfer is realized upon releasing the quartz mold. Although polyethylene is transparent to the laser beam, the carbon nanofibers in the high density polyethylene (HDPE) matrix absorb the laser energy and convert it into heat. Numerical heat conduction simulation shows the HDPE matrix is partially melted or softened, allowing for easier imprinting of the relief pattern of the quartz mold.

  18. Equilibrium radiative heating tables for Earth entry

    NASA Astrophysics Data System (ADS)

    Sutton, Kenneth; Hartung, Lin C.

    1990-05-01

    The recent resurgence of interest in blunt-body atmospheric entry for applications such as aeroassisted orbital transfer and planetary return has engendered a corresponding revival of interest in radiative heating. Radiative heating may be of importance in these blunt-body flows because of the highly energetic shock layer around the blunt nose. Sutton developed an inviscid, stagnation point, radiation coupled flow field code for investigating blunt-body atmospheric entry. The method has been compared with ground-based and flight data, and reasonable agreement has been found. To provide information for entry body studies in support of lunar and Mars return scenarios of interest in the 1970's, the code was exercised over a matrix of Earth entry conditions. Recently, this matrix was extended slightly to reflect entry vehicle designs of current interest. Complete results are presented.

  19. Method for producing strain tolerant multifilamentary oxide superconducting wire

    DOEpatents

    Finnemore, D.K.; Miller, T.A.; Ostenson, J.E.; Schwartzkopf, L.A.; Sanders, S.C.

    1994-07-19

    A strain tolerant multifilamentary wire capable of carrying superconducting currents is provided comprising a plurality of discontinuous filaments formed from a high temperature superconducting material. The discontinuous filaments have a length at least several orders of magnitude greater than the filament diameter and are sufficiently strong while in an amorphous state to withstand compaction. A normal metal is interposed between and binds the discontinuous filaments to form a normal metal matrix capable of withstanding heat treatment for converting the filaments to a superconducting state. The geometry of the filaments within the normal metal matrix provides substantial filament-to-filament overlap, and the normal metal is sufficiently thin to allow supercurrent transfer between the overlapped discontinuous filaments but is also sufficiently thick to provide strain relief to the filaments. 6 figs.

  20. Method for producing strain tolerant multifilamentary oxide superconducting wire

    DOEpatents

    Finnemore, Douglas K.; Miller, Theodore A.; Ostenson, Jerome E.; Schwartzkopf, Louis A.; Sanders, Steven C.

    1994-07-19

    A strain tolerant multifilamentary wire capable of carrying superconducting currents is provided comprising a plurality of discontinuous filaments formed from a high temperature superconducting material. The discontinuous filaments have a length at least several orders of magnitude greater than the filament diameter and are sufficiently strong while in an amorphous state to withstand compaction. A normal metal is interposed between and binds the discontinuous filaments to form a normal metal matrix capable of withstanding heat treatment for converting the filaments to a superconducting state. The geometry of the filaments within the normal metal matrix provides substantial filament-to-filament overlap, and the normal metal is sufficiently thin to allow supercurrent transfer between the overlapped discontinuous filaments but is also sufficiently thick to provide strain relief to the filaments.

  1. A transfer matrix approach to vibration localization in mistuned blade assemblies

    NASA Technical Reports Server (NTRS)

    Ottarson, Gisli; Pierre, Chritophe

    1993-01-01

    A study of mode localization in mistuned bladed disks is performed using transfer matrices. The transfer matrix approach yields the free response of a general, mono-coupled, perfectly cyclic assembly in closed form. A mistuned structure is represented by random transfer matrices, and the expansion of these matrices in terms of the small mistuning parameter leads to the definition of a measure of sensitivity to mistuning. An approximation of the localization factor, the spatially averaged rate of exponential attenuation per blade-disk sector, is obtained through perturbation techniques in the limits of high and low sensitivity. The methodology is applied to a common model of a bladed disk and the results verified by Monte Carlo simulations. The easily calculated sensitivity measure may prove to be a valuable design tool due to its system-independent quantification of mistuning effects such as mode localization.

  2. Deformed quantum double realization of the toric code and beyond

    NASA Astrophysics Data System (ADS)

    Padmanabhan, Pramod; Ibieta-Jimenez, Juan Pablo; Bernabe Ferreira, Miguel Jorge; Teotonio-Sobrinho, Paulo

    2016-09-01

    Quantum double models, such as the toric code, can be constructed from transfer matrices of lattice gauge theories with discrete gauge groups and parametrized by the center of the gauge group algebra and its dual. For general choices of these parameters the transfer matrix contains operators acting on links which can also be thought of as perturbations to the quantum double model driving it out of its topological phase and destroying the exact solvability of the quantum double model. We modify these transfer matrices with perturbations and extract exactly solvable models which remain in a quantum phase, thus nullifying the effect of the perturbation. The algebra of the modified vertex and plaquette operators now obey a deformed version of the quantum double algebra. The Abelian cases are shown to be in the quantum double phase whereas the non-Abelian phases are shown to be in a modified phase of the corresponding quantum double phase. These are illustrated with the groups Zn and S3. The quantum phases are determined by studying the excitations of these systems namely their fusion rules and the statistics. We then go further to construct a transfer matrix which contains the other Z2 phase namely the double semion phase. More generally for other discrete groups these transfer matrices contain the twisted quantum double models. These transfer matrices can be thought of as being obtained by introducing extra parameters into the transfer matrix of lattice gauge theories. These parameters are central elements belonging to the tensor products of the algebra and its dual and are associated to vertices and volumes of the three dimensional lattice. As in the case of the lattice gauge theories we construct the operators creating the excitations in this case and study their braiding and fusion properties.

  3. LC/DAD/ESI/MS method for the determination of imidacloprid, thiacloprid, and spinosad in olives and olive oil after field treatment.

    PubMed

    Angioni, Alberto; Porcu, Luciano; Pirisi, Filippo

    2011-10-26

    The behavior in the field and the transfer from olives to olive oil during the technological process of imidacloprid, thiacloprid, and spinosad were studied. The extraction method used was effective in extracting the analytes of interest, and no interfering peaks were detected in the chromatogram. The residue levels found in olives after treatment were 0.14, 0.04, and 0.30 mg/kg for imidacloprid, thiacloprid, and spinosad, respectively, far below the maximum residue levels (MRLs) set for these insecticides in EU. At the preharvest interval (PHI), no residue was detected for imidacloprid and thiacloprid, while spinosad showed a residue level of 0.04 mg/kg. The study of the effect of the technological process on pesticide transfer in olive oil showed that these insecticides tend to remain in the olive cake. The LC/DAD/ESI/MS method showed good performance with adequate recoveries ranging from 80 to 119% and good method limits of quantitation (LOQs) and of determination (LODs). No matrix effect was detected.

  4. Experimental estimation of migration and transfer of organic substances from consumer articles to cotton wipes: Evaluation of underlying mechanisms.

    PubMed

    Clausen, Per Axel; Spaan, Suzanne; Brouwer, Derk H; Marquart, Hans; le Feber, Maaike; Engel, Roel; Geerts, Lieve; Jensen, Keld Alstrup; Kofoed-Sørensen, Vivi; Hansen, Brian; De Brouwere, Katleen

    2016-01-01

    The aim of this work was to identify the key mechanisms governing transport of organic chemical substances from consumer articles to cotton wipes. The results were used to establish a mechanistic model to improve assessment of dermal contact exposure. Four types of PVC flooring, 10 types of textiles and one type of inkjet printed paper were used to establish the mechanisms and model. Kinetic extraction studies in methanol demonstrated existence of matrix diffusion and indicated the presence of a substance surface layer on some articles. Consequently, the proposed substance transfer model considers mechanical transport from a surface film and matrix diffusion in an article with a known initial total substance concentration. The estimated chemical substance transfer values to cotton wipes were comparable to the literature data (relative transfer ∼ 2%), whereas relative transfer efficiencies from spiked substrates were high (∼ 50%). For consumer articles, high correlation (r(2)=0.92) was observed between predicted and measured transfer efficiencies, but concentrations were overpredicted by a factor of 10. Adjusting the relative transfer from about 50% used in the model to about 2.5% removed overprediction. Further studies are required to confirm the model for generic use.

  5. Resin infiltration transfer technique

    DOEpatents

    Miller, David V [Pittsburgh, PA; Baranwal, Rita [Glenshaw, PA

    2009-12-08

    A process has been developed for fabricating composite structures using either reaction forming or polymer infiltration and pyrolysis techniques to densify the composite matrix. The matrix and reinforcement materials of choice can include, but are not limited to, silicon carbide (SiC) and zirconium carbide (ZrC). The novel process can be used to fabricate complex, net-shape or near-net shape, high-quality ceramic composites with a crack-free matrix.

  6. An efficient method to prepare magnetic hydroxyapatite-functionalized multi-walled carbon nanotubes nanocomposite for bone defects.

    PubMed

    Afroze, J D; Abden, M J; Islam, M A

    2018-05-01

    Hydroxyapatite-functionalized multi-walled carbon nanotube (HA-fMWCNT) magnetic nanocomposite was successfully prepared using a novel slurry-compounding method. The prepared HA-fMWCNT nanocomposite with the addition of small amount (0.5 wt%) of fMWCNT exhibited much greater improvement in mechanical properties due to strong interfacial adhesion between acid-treated MWCNTs fillers and HA matrix, thus efficient stress transfer to nanotubes from the matrix. The nanocomposite exhibited excellent haemocompatibility. Fractographic analysis was performed in order to understand the fracture behavior and toughening mechanisms. The fracture mechanisms and micro-deformation were examined by studying the microstructure of arrested crack tips using field emission scanning electron microscopy (FESEM). The origination and formation of micro-cracks are the dominant fracture mechanisms and micro-deformation in the HA-fMWCNTs nanocomposite. The developed new method enables to the fabrication of magnetic HA-fMWCNTs nanocomposite with superior mechanical performance may be potential for application as high load-bearing bone implants in the biomedical field. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Multiple Scattering in Planetary Regoliths Using Incoherent Interactions

    NASA Astrophysics Data System (ADS)

    Muinonen, K.; Markkanen, J.; Vaisanen, T.; Penttilä, A.

    2017-12-01

    We consider scattering of light by a planetary regolith using novel numerical methods for discrete random media of particles. Understanding the scattering process is of key importance for spectroscopic, photometric, and polarimetric modeling of airless planetary objects, including radar studies. In our modeling, the size of the spherical random medium can range from microscopic to macroscopic sizes, whereas the particles are assumed to be of the order of the wavelength in size. We extend the radiative transfer and coherent backscattering method (RT-CB) to the case of dense packing of particles by adopting the ensemble-averaged first-order incoherent extinction, scattering, and absorption characteristics of a volume element of particles as input. In the radiative transfer part, at each absorption and scattering process, we account for absorption with the help of the single-scattering albedo and peel off the Stokes parameters of radiation emerging from the medium in predefined scattering angles. We then generate a new scattering direction using the joint probability density for the local polar and azimuthal scattering angles. In the coherent backscattering part, we utilize amplitude scattering matrices along the radiative-transfer path and the reciprocal path. Furthermore, we replace the far-field interactions of the RT-CB method with rigorous interactions facilitated by the Superposition T-matrix method (STMM). This gives rise to a new RT-RT method, radiative transfer with reciprocal interactions. For microscopic random media, we then compare the new results to asymptotically exact results computed using the STMM, succeeding in the numerical validation of the new methods.Acknowledgments. Research supported by European Research Council with Advanced Grant No. 320773 SAEMPL, Scattering and Absorption of ElectroMagnetic waves in ParticuLate media. Computational resources provided by CSC - IT Centre for Science Ltd, Finland.

  8. Quantum simulation of an ultrathin body field-effect transistor with channel imperfections

    NASA Astrophysics Data System (ADS)

    Vyurkov, V.; Semenikhin, I.; Filippov, S.; Orlikovsky, A.

    2012-04-01

    An efficient program for the all-quantum simulation of nanometer field-effect transistors is elaborated. The model is based on the Landauer-Buttiker approach. Our calculation of transmission coefficients employs a transfer-matrix technique involving the arbitrary precision (multiprecision) arithmetic to cope with evanescent modes. Modified in such way, the transfer-matrix technique turns out to be much faster in practical simulations than that of scattering-matrix. Results of the simulation demonstrate the impact of realistic channel imperfections (random charged centers and wall roughness) on transistor characteristics. The Landauer-Buttiker approach is developed to incorporate calculation of the noise at an arbitrary temperature. We also validate the ballistic Landauer-Buttiker approach for the usual situation when heavily doped contacts are indispensably included into the simulation region.

  9. Virtues of Polarization in Remote Sensing of Atmospheres and Oceans

    NASA Astrophysics Data System (ADS)

    Kattawar, G. W.

    2007-12-01

    Polarization of skylight has been used for navigation by many insects and ocean organisms for millions of years. In fact, some marine organisms rely on polarization vision for their very existence. However, the use of polarization in remote sensing is just now becoming a powerful tool in many areas of science such as in the detection of cancerous skin lesions, bioaerosols (such as anthrax), hydrosols in the ocean, and plant diseases, just to mention a few. We will first introduce the Stokes parameter-Mueller matrix formalism and discuss ways to measure the elements of both. Several methods will be discussed to show how a combination of polarimetric quantities can be mapped to improve contrast by the human visual system when ordinary radiance measurements fail to do so. These ideas will be extended into the multiple scattering domain where we will introduce an "effective Mueller matrix" and see the benefits arising from it. One of the primary reasons for inclusion of polarization in the equation of transfer is that it is the only correct way to do radiative transfer. We will then conclude with areas of future research that will surely lead to even more striking applications.

  10. Torsional vibration measurements on rotating shaft system using laser doppler vibrometer

    NASA Astrophysics Data System (ADS)

    Xiang, Ling; Yang, Shixi; Gan, Chunbiao

    2012-11-01

    In this work, a laser torsional vibrameter was used to measure the torsion vibration of a rotating shaft system under electrical network impact. Based on the principles of laser Doppler velocimetry, the laser torsional vibrometer (LTV) are non-contact measurement of torsional oscillation of rotating shafts, offering significant advantages over conventional techniques. Furthermore, a highly complex shafting system is analyzed by a modified Riccati torsional transfer matrix. The system is modeled as a chain consisting of an elastic spring with concentrated mass points, and the multi-segments lumped mass model is established for this shafting system. By the modified Riccati torsional transfer matrix method, an accumulated calculation is effectively eliminated to obtain the natural frequencies. The electrical network impacts can activize the torsional vibration of shaft system, and the activized torsion vibration frequencies contained the natural frequencies of shaft system. The torsional vibrations of the shaft system were measured under electrical network impacts in laser Doppler torsional vibrometer. By comparisons, the natural frequencies by measurement were consistent with the values by calculation. The results verify the instrument is robust, user friendly and can be calibrated in situ. The laser torsional vibrometer represents a significant step forward in rotating machinery diagnostics.

  11. Integration of Libration Point Orbit Dynamics into a Universal 3-D Autonomous Formation Flying Algorithm

    NASA Technical Reports Server (NTRS)

    Folta, David; Bauer, Frank H. (Technical Monitor)

    2001-01-01

    The autonomous formation flying control algorithm developed by the Goddard Space Flight Center (GSFC) for the New Millennium Program (NMP) Earth Observing-1 (EO-1) mission is investigated for applicability to libration point orbit formations. In the EO-1 formation-flying algorithm, control is accomplished via linearization about a reference transfer orbit with a state transition matrix (STM) computed from state inputs. The effect of libration point orbit dynamics on this algorithm architecture is explored via computation of STMs using the flight proven code, a monodromy matrix developed from a N-body model of a libration orbit, and a standard STM developed from the gravitational and coriolis effects as measured at the libration point. A comparison of formation flying Delta-Vs calculated from these methods is made to a standard linear quadratic regulator (LQR) method. The universal 3-D approach is optimal in the sense that it can be accommodated as an open-loop or closed-loop control using only state information.

  12. Transport Phenomena in Fluid Dynamics: Matrix Heat Exchangers and Their Applications in Energy Systems

    DTIC Science & Technology

    2009-07-01

    presented a summary of recent research on boiling in microchannels . He addressed the topics of macro scale versus micro scale heat transfer , two phase...flow regime, flow boiling 14 heat transfer results for microchannels , heat transfer mechanisms in microchannels , and flow boiling models for... Heat Transfer Boiling In Minichannel And Microchannel Flow Passages Of Compact Evaporators, Keynote Lecture Presented at the Engineering Foundation

  13. Giant oscillating magnetoresistance in silicene-based structures

    NASA Astrophysics Data System (ADS)

    Oubram, O.; Navarro, O.; Rodríguez-Vargas, I.; Guzman, E. J.; Cisneros-Villalobos, L.; Velásquez-Aguilar, J. G.

    2018-02-01

    Ballistic electron transport in a silicene structure, composed of a pair of magnetic gates, in the ferromagnetic and an-tiferromagnetic configuration is studied. This theoretical study has been done using the matrix transfer method to calculate the transmission, the conductance for parallel and antiparallel magnetic alignment and the magnetoresistance. Results show that conductance and magnetoresistance oscillate as a function of the length between the two magnetic domains. The forbidden transmission region also increases as a function of the barrier separation distance.

  14. A new state space model for the NASA/JPL 70-meter antenna servo controls

    NASA Technical Reports Server (NTRS)

    Hill, R. E.

    1987-01-01

    A control axis referenced model of the NASA/JPL 70-m antenna structure is combined with the dynamic equations of servo components to produce a comprehansive state variable (matrix) model of the coupled system. An interactive Fortran program for generating the linear system model and computing its salient parameters is described. Results are produced in a state variable, block diagram, and in factored transfer function forms to facilitate design and analysis by classical as well as modern control methods.

  15. Electron capture in collisions of N^+ with H and H^+ with N

    NASA Astrophysics Data System (ADS)

    Lin, C. Y.; Stancil, P. C.; Gu, J. P.; Buenker, R. J.; Kimura, M.

    2004-05-01

    Charge transfer processes due to collisions of N^+ with atomic hydrogen and H^+ with atomic nitrogen are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) method. The MOCC calculations utilize ab initio adiabatic potential curves and nonadiabatic radial and rotational coupling matrix elements obtained with the multireference single- and double-excitation configuration interaction approach. Total and state-selective cross sections for the energy range 0.1-500 eV/u will be presented and compared with existing experimental and theoretical data.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suhendi, Endi; Syariati, Rifki; Noor, Fatimah A.

    We modeled a tunneling current in a p-n junction based on armchair graphene nanoribbons (AGNRs) by using an Airy function approach (AFA) and a transfer matrix method (TMM). We used β-type AGNRs, in which its band gap energy and electron effective mass depends on its width as given by the extended Huckel theory. It was shown that the tunneling currents evaluated by employing the AFA are the same as those obtained under the TMM. Moreover, the calculated tunneling current was proportional to the voltage bias and inversely with temperature.

  17. Reduced modeling of flexible structures for decentralized control

    NASA Technical Reports Server (NTRS)

    Yousuff, A.; Tan, T. M.; Bahar, L. Y.; Konstantinidis, M. F.

    1986-01-01

    Based upon the modified finite element-transfer matrix method, this paper presents a technique for reduced modeling of flexible structures for decentralized control. The modeling decisions are carried out at (finite-) element level, and are dictated by control objectives. A simply supported beam with two sets of actuators and sensors (linear force actuator and linear position and velocity sensors) is considered for illustration. In this case, it is conjectured that the decentrally controlled closed loop system is guaranteed to be at least marginally stable.

  18. Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.

    PubMed

    Lin, Chenxi; Povinelli, Michelle L

    2011-09-12

    We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.

  19. Surface plasmons in new waveguide structures containing ultra-thin metal and silicon layers

    NASA Astrophysics Data System (ADS)

    Shabat, M. M.; Ubeid, M. F.; Abu Rahma, M. A.

    2018-05-01

    Reflected and transmitted powers due to the interaction of electromagnetic waves with a structure containing thin metal and silicon layer are investigated in more detail. The formulations for the transverse electric wave case are provided. Transfer matrix method is used to find the reflection and the transmission coefficients at each interface. Numerical results are presented to show the effect of the structure parameters, the incidence angle and the wavelength on the reflected, transmitted and loss powers.

  20. Low cost damage tolerant composite fabrication

    NASA Technical Reports Server (NTRS)

    Palmer, R. J.; Freeman, W. T.

    1988-01-01

    The resin transfer molding (RTM) process applied to composite aircraft parts offers the potential for using low cost resin systems with dry graphite fabrics that can be significantly less expensive than prepreg tape fabricated components. Stitched graphite fabric composites have demonstrated compression after impact failure performance that equals or exceeds that of thermoplastic or tough thermoset matrix composites. This paper reviews methods developed to fabricate complex shape composite parts using stitched graphite fabrics to increase damage tolerance with RTM processes to reduce fabrication cost.

  1. Tunable overlapping long-period fiber grating and its bending vector sensing application

    NASA Astrophysics Data System (ADS)

    Hu, Wei; Zhang, Weigang; Chen, Lei; Wang, Song; Zhang, Yunshan; Zhang, Yanxin; Kong, Lingxin; Yu, Lin; Yan, Tieyi; Li, Yanping

    2018-03-01

    A novel overlapping long-period fiber grating (OLPFG) is proposed and experimentally demonstrated in this paper. The OLPFG is composed of two partially overlapping long-period fiber gratings (LPFG). Based on the coupled model theory and transfer matrix method, it is found that the phase shift LPFG and LPFGs interference are two special situations of the proposed OLPFG. Moreover, the confirmation experiments verified that the proposed OLPFG has a high bending sensitivity in opposite directions, and the temperature crosstalk can be compensated spontaneously.

  2. Higher-order compositional modeling of three-phase flow in 3D fractured porous media based on cross-flow equilibrium

    NASA Astrophysics Data System (ADS)

    Moortgat, Joachim; Firoozabadi, Abbas

    2013-10-01

    Numerical simulation of multiphase compositional flow in fractured porous media, when all the species can transfer between the phases, is a real challenge. Despite the broad applications in hydrocarbon reservoir engineering and hydrology, a compositional numerical simulator for three-phase flow in fractured media has not appeared in the literature, to the best of our knowledge. In this work, we present a three-phase fully compositional simulator for fractured media, based on higher-order finite element methods. To achieve computational efficiency, we invoke the cross-flow equilibrium (CFE) concept between discrete fractures and a small neighborhood in the matrix blocks. We adopt the mixed hybrid finite element (MHFE) method to approximate convective Darcy fluxes and the pressure equation. This approach is the most natural choice for flow in fractured media. The mass balance equations are discretized by the discontinuous Galerkin (DG) method, which is perhaps the most efficient approach to capture physical discontinuities in phase properties at the matrix-fracture interfaces and at phase boundaries. In this work, we account for gravity and Fickian diffusion. The modeling of capillary effects is discussed in a separate paper. We present the mathematical framework, using the implicit-pressure-explicit-composition (IMPEC) scheme, which facilitates rigorous thermodynamic stability analyses and the computation of phase behavior effects to account for transfer of species between the phases. A deceptively simple CFL condition is implemented to improve numerical stability and accuracy. We provide six numerical examples at both small and larger scales and in two and three dimensions, to demonstrate powerful features of the formulation.

  3. Wave propagation through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces.

    PubMed

    Jiao, Fengyu; Wei, Peijun; Li, Yueqiu

    2018-01-01

    Reflection and transmission of plane waves through a flexoelectric piezoelectric slab sandwiched by two piezoelectric half-spaces are studied in this paper. The secular equations in the flexoelectric piezoelectric material are first derived from the general governing equation. Different from the classical piezoelectric medium, there are five kinds of coupled elastic waves in the piezoelectric material with the microstructure effects taken into consideration. The state vectors are obtained by the summation of contributions from all possible partial waves. The state transfer equation of flexoelectric piezoelectric slab is derived from the motion equation by the reduction of order, and the transfer matrix of flexoelectric piezoelectric slab is obtained by solving the state transfer equation. By using the continuous conditions at the interface and the approach of partition matrix, we get the resultant algebraic equations in term of the transfer matrix from which the reflection and transmission coefficients can be calculated. The amplitude ratios and further the energy flux ratios of various waves are evaluated numerically. The numerical results are shown graphically and are validated by the energy conservation law. Based on these numerical results, the influences of two characteristic lengths of microstructure and the flexoelectric coefficients on the wave propagation are discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Acceleration of GPU-based Krylov solvers via data transfer reduction

    DOE PAGES

    Anzt, Hartwig; Tomov, Stanimire; Luszczek, Piotr; ...

    2015-04-08

    Krylov subspace iterative solvers are often the method of choice when solving large sparse linear systems. At the same time, hardware accelerators such as graphics processing units continue to offer significant floating point performance gains for matrix and vector computations through easy-to-use libraries of computational kernels. However, as these libraries are usually composed of a well optimized but limited set of linear algebra operations, applications that use them often fail to reduce certain data communications, and hence fail to leverage the full potential of the accelerator. In this study, we target the acceleration of Krylov subspace iterative methods for graphicsmore » processing units, and in particular the Biconjugate Gradient Stabilized solver that significant improvement can be achieved by reformulating the method to reduce data-communications through application-specific kernels instead of using the generic BLAS kernels, e.g. as provided by NVIDIA’s cuBLAS library, and by designing a graphics processing unit specific sparse matrix-vector product kernel that is able to more efficiently use the graphics processing unit’s computing power. Furthermore, we derive a model estimating the performance improvement, and use experimental data to validate the expected runtime savings. Finally, considering that the derived implementation achieves significantly higher performance, we assert that similar optimizations addressing algorithm structure, as well as sparse matrix-vector, are crucial for the subsequent development of high-performance graphics processing units accelerated Krylov subspace iterative methods.« less

  5. An ambiguity of information content and error in an ill-posed satellite inversion

    NASA Astrophysics Data System (ADS)

    Koner, Prabhat

    According to Rodgers (2000, stochastic approach), the averaging kernel (AK) is the representational matrix to understand the information content in a scholastic inversion. On the other hand, in deterministic approach this is referred to as model resolution matrix (MRM, Menke 1989). The analysis of AK/MRM can only give some understanding of how much regularization is imposed on the inverse problem. The trace of the AK/MRM matrix, which is the so-called degree of freedom from signal (DFS; stochastic) or degree of freedom in retrieval (DFR; deterministic). There are no physical/mathematical explanations in the literature: why the trace of the matrix is a valid form to calculate this quantity? We will present an ambiguity between information and error using a real life problem of SST retrieval from GOES13. The stochastic information content calculation is based on the linear assumption. The validity of such mathematics in satellite inversion will be questioned because it is based on the nonlinear radiative transfer and ill-conditioned inverse problems. References: Menke, W., 1989: Geophysical data analysis: discrete inverse theory. San Diego academic press. Rodgers, C.D., 2000: Inverse methods for atmospheric soundings: theory and practice. Singapore :World Scientific.

  6. Simulation of radioelement volatility during the vitrification of radioactive wastes by arc plasma.

    PubMed

    Ghiloufi, Imed

    2009-04-15

    A computer model is used to simulate the volatility of some radioelements cesium ((137)Cs), cobalt ((60)Co), and ruthenium ((106)Ru) during the radioactive wastes vitrification by thermal plasma. This model is based on the calculation of system composition using the free enthalpy minimization method, coupled with the equation of mass transfer at the reactional interface. The model enables the determination of the effects of various parameters (e.g., temperature, plasma current, and matrix composition) on the radioelement volatility. The obtained results indicate that any increase in molten bath temperature causes an increase in the cobalt volatility; while ruthenium has a less obvious behavior. It is also found that the oxygen flux in the carrier gas supports the radioelement incorporations in the containment matrix, except in the case of the ruthenium which is more volatile under an oxidizing atmosphere. For electrolyses effects, an increase in the plasma current considerably increases both the vaporization speed and the vaporized quantities of (137)Cs and (60)Co. The increase of silicon percentage in the containment matrix supports the incorporation of (60)Co and (137)Cs in the matrix. The simulation results are compared favorably to the experimental measurements obtained by emission spectroscopy.

  7. Controller design via structural reduced modeling by FETM

    NASA Technical Reports Server (NTRS)

    Yousuff, A.

    1986-01-01

    The Finite Element - Transfer Matrix (FETM) method has been developed to reduce the computations involved in analysis of structures. This widely accepted method, however, has certain limitations, and does not directly produce reduced models for control design. To overcome these shortcomings, a modification of FETM method has been developed. The modified FETM method easily produces reduced models that are tailored toward subsequent control design. Other features of this method are its ability to: (1) extract open loop frequencies and mode shapes with less computations, (2) overcome limitations of the original FETM method, and (3) simplify the procedures for output feedback, constrained compensation, and decentralized control. This semi annual report presents the development of the modified FETM, and through an example, illustrates its applicability to an output feedback and a decentralized control design.

  8. DBR, Sub-wavelength grating, and Photonic crystal slab Fabry-Perot cavity design using phase analysis by FDTD.

    PubMed

    Kim, Jae Hwan Eric; Chrostowski, Lukas; Bisaillon, Eric; Plant, David V

    2007-08-06

    We demonstrate a Finite-Difference Time-Domain (FDTD) phase methodology to estimate resonant wavelengths in Fabry-Perot (FP) cavity structures. We validate the phase method in a conventional Vertical-Cavity Surface-Emitting Laser (VCSEL) structure using a transfer-matrix method, and compare results with a FDTD reflectance method. We extend this approach to a Sub-Wavelength Grating (SWG) and a Photonic Crystal (Phc) slab, either of which may replace one of the Distributed Bragg Reflectors (DBRs) in the VCSEL, and predict resonant conditions with varying lithographic parameters. Finally, we compare the resonant tunabilities of three different VCSEL structures, taking quality factors into account.

  9. The spectrum of a vertex model and related spin one chain sitting in a genus five curve

    NASA Astrophysics Data System (ADS)

    Martins, M. J.

    2017-11-01

    We derive the transfer matrix eigenvalues of a three-state vertex model whose weights are based on a R-matrix not of difference form with spectral parameters lying on a genus five curve. We have shown that the basic building blocks for both the transfer matrix eigenvalues and Bethe equations can be expressed in terms of meromorphic functions on an elliptic curve. We discuss the properties of an underlying spin one chain originated from a particular choice of the R-matrix second spectral parameter. We present numerical and analytical evidences that the respective low-energy excitations can be gapped or massless depending on the strength of the interaction coupling. In the massive phase we provide analytical and numerical evidences in favor of an exact expression for the lowest energy gap. We point out that the critical point separating these two distinct physical regimes coincides with the one in which the weights geometry degenerate into union of genus one curves.

  10. Extracting electron transfer coupling elements from constrained density functional theory

    NASA Astrophysics Data System (ADS)

    Wu, Qin; Van Voorhis, Troy

    2006-10-01

    Constrained density functional theory (DFT) is a useful tool for studying electron transfer (ET) reactions. It can straightforwardly construct the charge-localized diabatic states and give a direct measure of the inner-sphere reorganization energy. In this work, a method is presented for calculating the electronic coupling matrix element (Hab) based on constrained DFT. This method completely avoids the use of ground-state DFT energies because they are known to irrationally predict fractional electron transfer in many cases. Instead it makes use of the constrained DFT energies and the Kohn-Sham wave functions for the diabatic states in a careful way. Test calculations on the Zn2+ and the benzene-Cl atom systems show that the new prescription yields reasonable agreement with the standard generalized Mulliken-Hush method. We then proceed to produce the diabatic and adiabatic potential energy curves along the reaction pathway for intervalence ET in the tetrathiafulvalene-diquinone (Q-TTF-Q) anion. While the unconstrained DFT curve has no reaction barrier and gives Hab≈17kcal /mol, which qualitatively disagrees with experimental results, the Hab calculated from constrained DFT is about 3kcal /mol and the generated ground state has a barrier height of 1.70kcal/mol, successfully predicting (Q-TTF-Q)- to be a class II mixed-valence compound.

  11. MRI-based, wireless determination of the transfer function of a linear implant: Introduction of the transfer matrix.

    PubMed

    Tokaya, Janot P; Raaijmakers, Alexander J E; Luijten, Peter R; van den Berg, Cornelis A T

    2018-04-24

    We introduce the transfer matrix (TM) that makes MR-based wireless determination of transfer functions (TFs) possible. TFs are implant specific measures for RF-safety assessment of linear implants. The TF relates an incident tangential electric field on an implant to a scattered electric field at its tip that generally governs local heating. The TM extends this concept and relates an incident tangential electric field to a current distribution in the implant therewith characterizing the RF response along the entire implant. The TM is exploited to measure TFs with MRI without hardware alterations. A model of rightward and leftward propagating attenuated waves undergoing multiple reflections is used to derive an analytical expression for the TM. This allows parameterization of the TM of generic implants, e.g., (partially) insulated single wires, in a homogeneous medium in a few unknowns that simultaneously describe the TF. These unknowns can be determined with MRI making it possible to measure the TM and, therefore, also the TF. The TM is able to predict an induced current due to an incident electric field and can be accurately parameterized with a limited number of unknowns. Using this description the TF is determined accurately (with a Pearson correlation coefficient R ≥ 0.9 between measurements and simulations) from MRI acquisitions. The TM enables measuring of TFs with MRI of the tested generic implant models. The MR-based method does not need hardware alterations and is wireless hence making TF determination in more realistic scenarios conceivable. © 2018 The Authors Magnetic Resonance in Medicine published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine.

  12. Methods for heat transfer and temperature field analysis of the insulated diesel phase 2 progress report

    NASA Technical Reports Server (NTRS)

    Morel, T.; Kerlbar, R.; Fort, E. F.; Blumberg, P. N.

    1985-01-01

    This report describes work done during Phase 2 of a 3 year program aimed at developing a comprehensive heat transfer and thermal analysis methodology for design analysis of insulated diesel engines. The overall program addresses all the key heat transfer issues: (1) spatially and time-resolved convective and radiative in-cylinder heat transfer, (2) steady-state conduction in the overall structure, and (3) cyclical and load/speed temperature transients in the engine structure. During Phase 2, radiation heat transfer model was developed, which accounts for soot formation and burn up. A methodology was developed for carrying out the multi-dimensional finite-element heat conduction calculations within the framework of thermodynamic cycle codes. Studies were carried out using the integrated methodology to address key issues in low heat rejection engines. A wide ranging design analysis matrix was covered, including a variety of insulation strategies, recovery devices and base engine configurations. A single cylinder Cummins engine was installed at Purdue University, and it was brought to a full operational status. The development of instrumentation was continued, concentrating on radiation heat flux detector, total heat flux probe, and accurate pressure-crank angle data acquisition.

  13. Theory and experimental results of transfer-NOE experiments. 1. The influence of the off rate versus cross-relaxation rates

    NASA Astrophysics Data System (ADS)

    Lippens, R. M.; Cerf, C.; Hallenga, K.

    The theory of the transferred nuclear Overhauser effect is presented in the framework of an extended relaxation matrix representation. This matrix representation allows a coherent description of all one- and two-dimensional experiments. We present analytical solutions for the buildup of magnetization in the 2D transfer-NOE experiment, for all ratios of the off rate k to the cross-relaxation rates R involved. We show that systematic deviations in distance determination occur when the off rate becomes comparable to or smaller than the relaxation rates. Experimental results on the peptide/protein system oxytocin/neurophysin confirming this analysis are presented. The importance of residual mobility in the bound ligand, as demonstrated by the experimental data, is also discussed.

  14. Ion-to-Neutral Ratios and Thermal Proton Transfer in Matrix-Assisted Laser Desorption/Ionization

    NASA Astrophysics Data System (ADS)

    Lu, I.-Chung; Chu, Kuan Yu; Lin, Chih-Yuan; Wu, Shang-Yun; Dyakov, Yuri A.; Chen, Jien-Lian; Gray-Weale, Angus; Lee, Yuan-Tseh; Ni, Chi-Kung

    2015-07-01

    The ion-to-neutral ratios of four commonly used solid matrices, α-cyano-4-hydroxycinnamic acid (CHCA), 2,5-dihydroxybenzoic acid (2,5-DHB), sinapinic acid (SA), and ferulic acid (FA) in matrix-assisted laser desorption/ionization (MALDI) at 355 nm are reported. Ions are measured using a time-of-flight mass spectrometer combined with a time-sliced ion imaging detector. Neutrals are measured using a rotatable quadrupole mass spectrometer. The ion-to-neutral ratios of CHCA are three orders of magnitude larger than those of the other matrices at the same laser fluence. The ion-to-neutral ratios predicted using the thermal proton transfer model are similar to the experimental measurements, indicating that thermal proton transfer reactions play a major role in generating ions in ultraviolet-MALDI.

  15. Betatron motion with coupling of horizontal and vertical degrees of freedom

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    S. A. Bogacz; V. A. Lebedev

    2002-11-21

    The Courant-Snyder parameterization of one-dimensional linear betatron motion is generalized to two-dimensional coupled linear motion. To represent the 4 x 4 symplectic transfer matrix the following ten parameters were chosen: four beta-functions, four alpha-functions and two betatron phase advances which have a meaning similar to the Courant-Snyder parameterization. Such a parameterization works equally well for weak and strong coupling and can be useful for analysis of coupled betatron motion in circular accelerators as well as in transfer lines. Similarly, the transfer matrix, the bilinear form describing the phase space ellipsoid and the second order moments are related to the eigen-vectors.more » Corresponding equations can be useful in interpreting tracking results and experimental data.« less

  16. Controller design via structural reduced modeling by FETM

    NASA Technical Reports Server (NTRS)

    Yousuff, Ajmal

    1987-01-01

    The Finite Element-Transfer Matrix (FETM) method has been developed to reduce the computations involved in analysis of structures. This widely accepted method, however, has certain limitations, and does not address the issues of control design. To overcome these, a modification of the FETM method has been developed. The new method easily produces reduced models tailored toward subsequent control design. Other features of this method are its ability to: (1) extract open loop frequencies and mode shapes with less computations, (2) overcome limitations of the original FETM method, and (3) simplify the design procedures for output feedback, constrained compensation, and decentralized control. This report presents the development of the new method, generation of reduced models by this method, their properties, and the role of these reduced models in control design. Examples are included to illustrate the methodology.

  17. Effects of nuclear structure in the spin-dependent scattering of weakly interacting massive particles

    NASA Astrophysics Data System (ADS)

    Nikolaev, M. A.; Klapdor-Kleingrothaus, H. V.

    1993-06-01

    We present calculations of the nuclear from factors for spin-dependent elastic scattering of dark matter WIMPs from123Te and131Xe isotopes, proposed to be used for dark matter detection. A method based on the theory of finite Fermi systems was used to describe the reduction of the single-particle spin-dependent matrix elements in the nuclear medium. Nucleon single-particle states were calculated in a realistic shell model potential; pairing effects were treated within the BCS model. The coupling of the lowest single-particle levels in123Te to collective 2+ excitations of the core was taken into account phenomenologically. The calculated nuclear form factors are considerably less then the single-particle ones for low momentum transfer. At high momentum transfer some dynamical amplification takes place due to the pion exchange term in the effective nuclear interaction. But as the momentum transfer increases, the difference disappears, the momentum transfer increases and the quenching effect disappears. The shape of the nuclear form factor for the131Xe isotope differs from the one obtained using an oscillator basis.

  18. Predicting plant protein subcellular multi-localization by Chou's PseAAC formulation based multi-label homolog knowledge transfer learning.

    PubMed

    Mei, Suyu

    2012-10-07

    Recent years have witnessed much progress in computational modeling for protein subcellular localization. However, there are far few computational models for predicting plant protein subcellular multi-localization. In this paper, we propose a multi-label multi-kernel transfer learning model for predicting multiple subcellular locations of plant proteins (MLMK-TLM). The method proposes a multi-label confusion matrix and adapts one-against-all multi-class probabilistic outputs to multi-label learning scenario, based on which we further extend our published work MK-TLM (multi-kernel transfer learning based on Chou's PseAAC formulation for protein submitochondria localization) for plant protein subcellular multi-localization. By proper homolog knowledge transfer, MLMK-TLM is applicable to novel plant protein subcellular localization in multi-label learning scenario. The experiments on plant protein benchmark dataset show that MLMK-TLM outperforms the baseline model. Unlike the existing models, MLMK-TLM also reports its misleading tendency, which is important for comprehensive survey of model's multi-labeling performance. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Left-handed materials and negative refraction: Transfer matrix and FDTD calculations

    NASA Astrophysics Data System (ADS)

    Soukoulis, Costas M.

    2004-03-01

    We will present transfer matrix calculations of metallic wires, split ring resonators (SRR) and left-handed materials (LHM). Our results [1] show that the transfer matrix method can capture all the details characteristics of the metamaterials. In particular the dependence of the resonance frequency and its width on the structural parameters of the SRR and the size of the unit cell is studied. Also the dependence of the imaginary part of effective permittivity of arrays of metallic wires is studied in detail. It is found [2,3] that the imaginary part of effective permittivity has small values even for wires as small as 20 micron in diameter. The transfer matrix is very useful in calculating both the amplitude and the phase of the transmission and reflection coefficient. These numerical data was used [4] in the determination of the effective parameters of the metamaterials. It was indeed found that the refractive index was unambiguously negative in the frequency region where both ɛ and μ were negative. Finally, we will show that SRR have a strong electric response, equivalent to that of cut wires [5], which dominates the response of LHM. A new criterion is introduced to clearly identify if an experimental expression peak is left- or right handed. Finite difference time domain (FDTD) simulations will be presented for the transmission of the EM wave through the interface of the positive and negative refraction index. It is found [6] that the wave is trapped temporarily at the interface and after a long time the wave front moves eventually in the direction of negative refraction. The differences between negative refraction in photonic crystals and left-handed materials will be also discussed. Work supported by US-DOE, DARPA, NSF and EU (DALHM project). References: [1] P. Markos and C. M. Soukoulis, Phys. Rev. B 65, 033401 (2002); Phys. Rev. E 65, 036622 (2002). [2] P. Markos, I. Rousochatzakis and C. M. Soukoulis, Phys. Rev. B 66, 045601 (2002). [3] P. Markos and C. M. Soukoulis, Optics Letters 28, 846 (2003); Optics Express 11, 649 (2003). [4] D. R. Smith, S. Schultz, P. Markos and C. M. Soukoulis, Phys. Rev. B 65, 195104 (2002). [5] Th. Koschny, P. Markos, D. R. Smith and C. M. Soukoulis, Phys. Rev. E 67, xxxx (2003) [6] S. Foteinopoulou, E. N. Economou and C. M. Soukoulis, Phys. Rev. Lett. 90, 107402 (2003); S. Foteinopoulou and C. M. Soukoulis, Phys. Rev. B 67, 235107 (2003)

  20. Carbon Dots and 9AA as a Binary Matrix for the Detection of Small Molecules by Matrix-Assisted Laser Desorption/Ionization Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Chen, Yongli; Gao, Dan; Bai, Hangrui; Liu, Hongxia; Lin, Shuo; Jiang, Yuyang

    2016-07-01

    Application of matrix-assisted laser-desorption/ionization mass spectrometry (MALDI MS) to analyze small molecules have some limitations, due to the inhomogeneous analyte/matrix co-crystallization and interference of matrix-related peaks in low m/z region. In this work, carbon dots (CDs) were for the first time applied as a binary matrix with 9-Aminoacridine (9AA) in MALDI MS for small molecules analysis. By 9AA/CDs assisted desorption/ionization (D/I) process, a wide range of small molecules, including nucleosides, amino acids, oligosaccharides, peptides, and anticancer drugs with a higher sensitivity were demonstrated in the positive ion mode. A detection limit down to 5 fmol was achieved for cytidine. 9AA/CDs matrix also exhibited excellent reproducibility compared with 9AA matrix. Moreover, by exploring the ionization mechanism of the matrix, the influence factors might be attributed to the four parts: (1) the strong UV absorption of 9AA/CDs due to their π-conjugated network; (2) the carboxyl groups modified on the CDs surface act as protonation sites for proton transfer in positive ion mode; (3) the thin layer crystal of 9AA/CDs could reach a high surface temperature more easily and lower transfer energy for LDI MS; (4) CDs could serve as a matrix additive to suppress 9AA ionization. Furthermore, this matrix was allowed for the analysis of glucose as well as nucleosides in human urine, and the level of cytidine was quantified with a linear range of 0.05-5 mM (R2 > 0.99). Therefore, the 9AA/CDs matrix was proven to be an effective MALDI matrix for the analysis of small molecules with improved sensitivity and reproducibility. This work provides an alternative solution for small molecules detection that can be further used in complex samples analysis.

  1. Analysis and measurement of the transfer matrix of a 9-cell, 1.3-GHz superconducting cavity

    DOE PAGES

    Halavanau, A.; Eddy, N.; Edstrom, D.; ...

    2017-04-13

    Superconducting linacs are capable of producing intense, stable, high-quality electron beams that have found widespread applications in science and industry. Here, the 9-cell, 1.3-GHz superconducting standing-wave accelerating rf cavity originally developed for e +/e - linear-collider applications has been broadly employed in various superconducting-linac designs. In this paper we discuss the transfer matrix of such a cavity and present its measurement performed at the Fermilab Accelerator Science and Technology (FAST) facility. Finally, the experimental results are found to be in agreement with analytical calculations and numerical simulations.

  2. Tests of conformal field theory at the Yang-Lee singularity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wydro, Tomasz; McCabe, John F.

    2009-12-14

    This paper studies the Yang-Lee edge singularity of 2-dimensional (2D) Ising model based on a quantum spin chain and transfer matrix measurements on the cylinder. Based on finite-size scaling, the low-lying excitation spectrum is found at the Yang-Lee edge singularity. Based on transfer matrix techniques, the single structure constant is evaluated at the Yang-Lee edge singularity. The results of both types of measurements are found to be fully consistent with the predictions for the (A{sub 4}, A{sub 1}) minimal conformal field theory, which was previously identified with this critical point.

  3. A discrete fracture model for two-phase flow in fractured porous media

    NASA Astrophysics Data System (ADS)

    Gläser, Dennis; Helmig, Rainer; Flemisch, Bernd; Class, Holger

    2017-12-01

    A discrete fracture model on the basis of a cell-centered finite volume scheme with multi-point flux approximation (MPFA) is presented. The fractures are included in a d-dimensional computational domain as (d - 1)-dimensional entities living on the element facets, which requires the grid to have the element facets aligned with the fracture geometries. However, the approach overcomes the problem of small cells inside the fractures when compared to equi-dimensional models. The system of equations considered is solved on both the matrix and the fracture domain, where on the prior the fractures are treated as interior boundaries and on the latter the exchange term between fracture and matrix appears as an additional source/sink. This exchange term is represented by the matrix-fracture fluxes, computed as functions of the unknowns in both domains by applying adequate modifications to the MPFA scheme. The method is applicable to both low-permeable as well as highly conductive fractures. The quality of the results obtained by the discrete fracture model is studied by comparison to an equi-dimensional discretization on a simple geometry for both single- and two-phase flow. For the case of two-phase flow in a highly conductive fracture, good agreement in the solution and in the matrix-fracture transfer fluxes could be observed, while for a low-permeable fracture the discrepancies were more pronounced. The method is then applied two-phase flow through a realistic fracture network in two and three dimensions.

  4. Hyperspherical close-coupling calculations for charge-transfer cross sections in He2++H(1s) collisions at low energies

    NASA Astrophysics Data System (ADS)

    Liu, Chien-Nan; Le, Anh-Thu; Morishita, Toru; Esry, B. D.; Lin, C. D.

    2003-05-01

    A theory for ion-atom collisions at low energies based on the hyperspherical close-coupling (HSCC) method is presented. In hyperspherical coordinates the wave function is expanded in analogy to the Born-Oppenheimer approximation where the adiabatic channel functions are calculated with B-spline basis functions while the coupled hyperradial equations are solved by a combination of R-matrix propagation and the slow/smooth variable discretization method. The HSCC method is applied to calculate charge-transfer cross sections for He2++H(1s)→He+(n=2)+H+ reactions at center-of-mass energies from 10 eV to 4 keV. The results are shown to be in general good agreement with calculations based on the molecular orbital (MO) expansion method where electron translation factors (ETF’s) or switching functions have been incorporated in each MO. However, discrepancies were found at very low energies. It is shown that the HSCC method can be used to study low-energy ion-atom collisions without the need to introduce the ad hoc ETF’s, and the results are free from ambiguities associated with the traditional MO expansion approach.

  5. Closed-loop transfer recovery with observer-based controllers. I - Analysis. II - Design

    NASA Technical Reports Server (NTRS)

    Chen, Ben M.; Saberi, Ali; Ly, Uy-Loi

    1992-01-01

    A detailed study is presented of three fundamental issues related to the problem of closed-loop transfer (CLT) recovery. The first issues concerns what can and cannot be achieved for a given system and for an arbitrary target CLT function (TCLTF). The second issue involves developing necessary and/or sufficient conditions for a TCLTF to be recoverable either exactly or approximately. The third issue involves the necessary and/or sufficient conditions on a given system such that it has at least one recoverable TCLTF. The results of the analysis identify some fundamental limitations of the given system as a consequence of its structural properties which enables designers to appreciate at the outset different design limitations incurred in the synthesis of output-feedback controllers. Then, the actual design of full-order or reduced-order observer-based controllers is addressed which will achieve as close as possibly the desired TCLTF. Three design methods are considered: (1) the ATEA method, (2) a method that minimizes the H2-norm of a recovery matrix, and (3) a method that minimizes the respective H(infinity) norm. The relative merits of the methods are discussed.

  6. Dehydration reactions, mass transfer and rock deformation relationships during subduction of Alpine metabauxites: insights from LIBS compositional profiles between metamorphic veins

    NASA Astrophysics Data System (ADS)

    Verlaguet, Anne; Brunet, Fabrice; Goffé, Bruno; Menut, Denis; Findling, Nathaniel; Poinssot, Christophe

    2013-04-01

    In subduction zones, the significant amounts of aqueous fluid released in the course of the successive dehydration reactions occurring during prograde metamorphism are expected to strongly influence the rock rheology, as well as kinetics of metamorphic reactions and mass transfer efficiency. Mineralized veins, ubiquitous in metamorphic rocks, can be seen as preserved witnesses of fluid and mass redistribution that partly accommodate the rock deformation (lateral segregation). However, the driving forces and mechanisms of mass transfer towards fluid-filled open spaces remain somewhat unclear. The aim of this study is to investigate the vein-forming processes and the modalities of mass transfer during local fluid-rock interactions, and their links with fluid production and rock deformation, with new insights from Laser Induced Breakdown Spectroscopy (LIBS) profiles. This study focuses on karstic pockets (metre scale) of Triassic metabauxites embedded in thick carbonate units, that have been isolated from large-scale fluid flow during HP-LT Alpine metamorphism (W. Vanoise, French Alps). These rocks display several generations of metamorphic veins containing various Al-bearing minerals, which give particular insights into mass transfer processes. It is proposed that the internally-derived fluid (~13 vol% produced by successive dehydration reactions) has promoted the opening of fluid-filled open spaces (euhedral habits of vein minerals) and served as medium for diffusive mass transfer from rock to vein. Based on mineralogical and textural features, two vein types can be distinguished: (1) some veins are filled with newly formed products of either prograde (chloritoid) or retrograde (chlorite) metamorphic reactions; in this case, fluid-filled open spaces seem to offer energetically favourable nucleation/growth sites; (2) the second vein type is filled with cookeite (Li-Al-rich chlorite) or pyrophyllite, that were present in the host rock prior to the vein formation. In this closed chemical system, mass transfer from rock to vein was achieved through the fluid, in a dissolution-transport-precipitation process, possibly stress-assisted. To investigate the modalities of mass transfer towards this second vein type, LIBS profiles were performed in the rock matrix, taking Li concentration as a proxy for cookeite distribution. Cookeite is highly concentrated (40-70 vol%) in regularly spaced veins, and the LIBS profiles show that cookeite is evenly distributed in the rock matrix comprised between two veins. The absence of diffusion profiles suggests that the characteristic diffusion length for Li, Al and Si is greater than or equal to the distance separating two cookeite veins (3-6 cm). This is in agreement with characteristic diffusion lengths calculated from both grain boundary and pore fluid diffusion coefficients, for the estimated duration of the peak of metamorphism. Concerning mass transfer driving forces, phyllosilicates have very different morphologies in the rock matrix (fibers) compared to veins (euhedral crystals): fluid-mineral interfacial energy may be maximal in the small matrix pores, which can maintain higher cookeite solubility than in fluid-filled open spaces. Therefore, as soon as veins open, chemical potential gradients may develop and drive cookeite transfer from rock matrix to veins.

  7. The Role of Initial Learning, Problem Features, Prior Knowledge, and Pattern Recognition on Transfer Success

    ERIC Educational Resources Information Center

    Dinsmore, Daniel L.; Baggetta, Peter; Doyle, Stephanie; Loughlin, Sandra M.

    2014-01-01

    The purpose of this study was to demonstrate that transfer ability (positive and negative) varies depending on the nature of the problems, using the knowledge transfer matrix, as well as being dependent on the individual differences of the learner. A total of 178 participants from the United States and New Zealand completed measures of prior…

  8. Algorithms and software used in selecting structure of machine-training cluster based on neurocomputers

    NASA Astrophysics Data System (ADS)

    Romanchuk, V. A.; Lukashenko, V. V.

    2018-05-01

    The technique of functioning of a control system by a computing cluster based on neurocomputers is proposed. Particular attention is paid to the method of choosing the structure of the computing cluster due to the fact that the existing methods are not effective because of a specialized hardware base - neurocomputers, which are highly parallel computer devices with an architecture different from the von Neumann architecture. A developed algorithm for choosing the computational structure of a cloud cluster is described, starting from the direction of data transfer in the flow control graph of the program and its adjacency matrix.

  9. Coherent-Anomaly Method in Critical Phenomena. IV.

    NASA Astrophysics Data System (ADS)

    Hu, Xiao; Suzuki, Masuo

    The systematic Weiss-like and Bethe-like approximations based on the mean-field transfer-matrix method are used to investigate the asymptotic behavior of the induced magnetization on a semi-infinite square lattice, and to investigate the wave-number dependence of the susceptibility in a nonuniform external field. The critical exponents ν, ν', ηi and η are estimated following the general CAM prescription. A new scaling relation ν·ηi=β is obtained in the framework of the finite-degree-of-approximation scaling. Together with previous papers, all the static critical exponents have been estimated by the CAM, and are shown to satisfy the well-known scaling relations.

  10. Remnants of the devil's staircase of phase transitions in the model of dimer adsorption at nonzero temperature

    NASA Astrophysics Data System (ADS)

    Akimenko, S. S.; Fefelov, V. F.; Myshlyavtsev, A. V.; Stishenko, P. V.

    2018-02-01

    The model of dimers adsorption on hexagonal lattice with different orientations to surface and hard-spheres lateral interactions has been studied at nonzero temperature. The transfer-matrix method was used as the main one and the Monte Carlo method was used for checking of some extreme cases. Adsorption isotherms, dependencies of the entropy from the density of the adsorption layer and of the energy from the system temperature at certain points of the phase space, were computed. It was found that at least the first ten phases of the ground state still persist at nonzero temperatures.

  11. Nanofocusing of the free-space optical energy with plasmonic Tamm states.

    PubMed

    Niu, Linyu; Xiang, Yinxiao; Luo, Weiwei; Cai, Wei; Qi, Jiwei; Zhang, Xinzheng; Xu, Jingjun

    2016-12-20

    To achieve extreme electromagnetic enhancement, we propose a plasmonic Tamm states (PTSs) configuration based on the metal-insulator-metal Bragg reflector, which is realized by periodically modulating the width of the insulator. Both the thick (2D) and thin (3D) structures are discussed. Through optimization performed by the impedance-based transfer matrix method and the finite difference time domain method, we find that both the electric field and magnetic field intensities can be increased by three orders of magnitude. The field-enhancement inside the PTSs configuration is not limited to extremely sharp waveguide terminal, which can greatly reduce processing difficulties.

  12. Modeling and design of a pre-stressed piezoelectric stack actuator

    NASA Astrophysics Data System (ADS)

    Jiang, Shiping; Cheng, Lei

    2017-07-01

    To provide a method for designing a pre-stressed PSA with high-performance, it is very meaningful to model the dynamic characteristics of the pre-stressed PSA accurately. A novel model, which considers both the electric side and the mechanical side of the PSA as distributed systems, is put forward to describe the dynamics characteristics of the PSA and the pre-stressed PSA. The role of the pre-stressed mechanism is derived and analyzed by extended transfer matrix method, and then the principle of design of the pre-stressed mechanism is obtained. The theoretical analysis is in accordance with the experimental results.

  13. Method for molding ceramic powders using a water-based gel casting

    DOEpatents

    Janney, Mark A.; Omatete, Ogbemi O.

    1991-07-02

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant, and a monomer solution. The monomer solution includes at least one monofunctional monomer and at least one difunctional monomer, a free-radical initiator, and a aqueous solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product any be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  14. Method for molding ceramic powders using a water-based gel casting process

    DOEpatents

    Jenny, Mark A.; Omalete, Ogbemi O.

    1992-09-08

    A method for molding ceramic powders comprises forming a slurry mixture including ceramic powder, a dispersant, and a monomer solution. The monomer solution includes at least one monofunctional monomer and at least one difunctional monomer, a free-radical initiator, and a aqueous solvent. The slurry mixture is transferred to a mold, and the mold containing the slurry mixture is heated to polymerize and crosslink the monomer and form a firm polymer-solvent gel matrix. The solid product may be removed from the mold and heated to first remove the solvent and subsequently remove the polymer, whereafter the product may be sintered.

  15. Artificial Neural Network and application in calibration transfer of AOTF-based NIR spectrometer

    NASA Astrophysics Data System (ADS)

    Wang, Wenbo; Jiang, Chengzhi; Xu, Kexin; Wang, Bin

    2002-09-01

    Chemometrics is widely applied to develop models for quantitative prediction of unknown samples in Near-infrared (NIR) spectroscopy. However, calibrated models generally fail when new instruments are introduced or replacement of the instrument parts occurs. Therefore, calibration transfer becomes necessary to avoid the costly, time-consuming recalibration of models. Piecewise Direct Standardization (PDS) has been proven to be a reference method for standardization. In this paper, Artificial Neural Network (ANN) is employed as an alternative to transfer spectra between instruments. Two Acousto-optic Tunable Filter NIR spectrometers are employed in the experiment. Spectra of glucose solution are collected on the spectrometers through transflectance mode. A Back propagation Network with two layers is employed to simulate the function between instruments piecewisely. Standardization subset is selected by Kennard and Stone (K-S) algorithm in the first two score space of Principal Component Analysis (PCA) of spectra matrix. In current experiment, it is noted that obvious nonlinearity exists between instruments and attempts are made to correct such nonlinear effect. Prediction results before and after successful calibration transfer are compared. Successful transfer can be achieved by adapting window size and training parameters. Final results reveal that ANN is effective in correcting the nonlinear instrumental difference and a only 1.5~2 times larger prediction error is expected after successful transfer.

  16. Effects of multiple scattering and surface albedo on the photochemistry of the troposphere

    NASA Technical Reports Server (NTRS)

    Augustsson, T. R.; Tiwari, S. N.

    1981-01-01

    The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfer code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included

  17. CdS-Nanowires Flexible Photo-detector with Ag-Nanowires Electrode Based on Non-transfer Process

    PubMed Central

    Pei, Yanli; Pei, Ruihan; Liang, Xiaoci; Wang, Yuhao; Liu, Ling; Chen, Haibiao; Liang, Jun

    2016-01-01

    In this study, UV-visible flexible resistivity-type photo-detectors were demonstrated with CdS-nanowires (NWs) percolation network channel and Ag-NWs percolation network electrode. The devices were fabricated on Mixed Cellulose Esters (MCE) membrane using a lithographic filtration method combined with a facile non-transfer process. The photo-detectors demonstrated strong adhesion, fast response time, fast decay time, and high photo sensitivity. The high performance could be attributed to the high quality single crystalline CdS-NWs, encapsulation of NWs in MCE matrix and excellent interconnection of the NWs. Furthermore, the sensing performance was maintained even the device was bent at an angle of 90°. This research may pave the way for the facile fabrication of flexible photo-detectors with high performances. PMID:26899726

  18. Thermal Stress Analysis of a Continuous and Pulsed End-Pumped Nd:YAG Rod Crystal Using Non-Classic Conduction Heat Transfer Theory

    NASA Astrophysics Data System (ADS)

    Mojahedi, Mahdi; Shekoohinejad, Hamidreza

    2018-02-01

    In this paper, temperature distribution in the continuous and pulsed end-pumped Nd:YAG rod crystal is determined using nonclassical and classical heat conduction theories. In order to find the temperature distribution in crystal, heat transfer differential equations of crystal with consideration of boundary conditions are derived based on non-Fourier's model and temperature distribution of the crystal is achieved by an analytical method. Then, by transferring non-Fourier differential equations to matrix equations, using finite element method, temperature and stress of every point of crystal are calculated in the time domain. According to the results, a comparison between classical and nonclassical theories is represented to investigate rupture power values. In continuous end pumping with equal input powers, non-Fourier theory predicts greater temperature and stress compared to Fourier theory. It also shows that with an increase in relaxation time, crystal rupture power decreases. Despite of these results, in single rectangular pulsed end-pumping condition, with an equal input power, Fourier theory indicates higher temperature and stress rather than non-Fourier theory. It is also observed that, when the relaxation time increases, maximum amounts of temperature and stress decrease.

  19. The theoretical study of passive and active optical devices via planewave based transfer (scattering) matrix method and other approaches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhuo, Ye

    2011-01-01

    In this thesis, we theoretically study the electromagnetic wave propagation in several passive and active optical components and devices including 2-D photonic crystals, straight and curved waveguides, organic light emitting diodes (OLEDs), and etc. Several optical designs are also presented like organic photovoltaic (OPV) cells and solar concentrators. The first part of the thesis focuses on theoretical investigation. First, the plane-wave-based transfer (scattering) matrix method (TMM) is briefly described with a short review of photonic crystals and other numerical methods to study them (Chapter 1 and 2). Next TMM, the numerical method itself is investigated in details and developed inmore » advance to deal with more complex optical systems. In chapter 3, TMM is extended in curvilinear coordinates to study curved nanoribbon waveguides. The problem of a curved structure is transformed into an equivalent one of a straight structure with spatially dependent tensors of dielectric constant and magnetic permeability. In chapter 4, a new set of localized basis orbitals are introduced to locally represent electromagnetic field in photonic crystals as alternative to planewave basis. The second part of the thesis focuses on the design of optical devices. First, two examples of TMM applications are given. The first example is the design of metal grating structures as replacements of ITO to enhance the optical absorption in OPV cells (chapter 6). The second one is the design of the same structure as above to enhance the light extraction of OLEDs (chapter 7). Next, two design examples by ray tracing method are given, including applying a microlens array to enhance the light extraction of OLEDs (chapter 5) and an all-angle wide-wavelength design of solar concentrator (chapter 8). In summary, this dissertation has extended TMM which makes it capable of treating complex optical systems. Several optical designs by TMM and ray tracing method are also given as a full complement of this work.« less

  20. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  1. An interval precise integration method for transient unbalance response analysis of rotor system with uncertainty

    NASA Astrophysics Data System (ADS)

    Fu, Chao; Ren, Xingmin; Yang, Yongfeng; Xia, Yebao; Deng, Wangqun

    2018-07-01

    A non-intrusive interval precise integration method (IPIM) is proposed in this paper to analyze the transient unbalance response of uncertain rotor systems. The transfer matrix method (TMM) is used to derive the deterministic equations of motion of a hollow-shaft overhung rotor. The uncertain transient dynamic problem is solved by combing the Chebyshev approximation theory with the modified precise integration method (PIM). Transient response bounds are calculated by interval arithmetic of the expansion coefficients. Theoretical error analysis of the proposed method is provided briefly, and its accuracy is further validated by comparing with the scanning method in simulations. Numerical results show that the IPIM can keep good accuracy in vibration prediction of the start-up transient process. Furthermore, the proposed method can also provide theoretical guidance to other transient dynamic mechanical systems with uncertainties.

  2. Matrix Organizational Structure and Its Effects Upon Education Organizations.

    ERIC Educational Resources Information Center

    Yates, James R.

    Applying matrix organizational structure to the organization of special education services is the focus of this paper. Beginning with a list of ways in which educational organizations differ from business or military organizations, the author warns that educators must be cautious when transferring organizational structures from other disciplines…

  3. Societal and economic valuation of technology-transfer deals

    NASA Astrophysics Data System (ADS)

    Holmes, Joseph S., Jr.

    2009-09-01

    The industrial adoption of concepts such as open innovation brings new legitimacy to activities technology-transfer professionals have conducted for over 20 years. This movement highlights the need for an increased understanding of the valuation of intellectual property (IP) and technology-transfer deals. Valuation, though a centerpiece of corporate finance, is more challenging when applied to the inherent uncertainty surrounding innovation. Technology-transfer professionals are often overwhelmed by the complexity and data requirements of valuation techniques and skeptical of their applicability to and utility for technology transfer. The market longs for an approach which bridges the gap between valuation fundamentals and technology-transfer realities. This paper presents the foundations of a simple, flexible, precise/accurate, and useful framework for considering the valuation of technology-transfer deals. The approach is predicated on a 12-factor model—a 3×4 value matrix predicated on categories of economic, societal, and strategic value. Each of these three categories consists of three core subcategories followed by a fourth "other" category to facilitate inevitable special considerations. This 12-factor value matrix provides a framework for harvesting data during deals and for the application of best-of-breed valuation techniques which can be employed on a per-factor basis. Future work will include framework implementation within a database platform.

  4. Humic acids as both matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and adsorbent for magnetic solid phase extraction.

    PubMed

    Zhao, Qin; Xu, Jing; Yin, Jia; Feng, Yu-Qi

    2015-08-19

    In the present study, humic acids (HAs) were applied as both a matrix for matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) and an adsorbent of magnetic solid phase extraction (MSPE) for the first time. As natural macromolecule compounds, HAs are inherently highly functionalized and contain laser energy absorbing-transferring aromatic structures. This special molecular structure made HAs a good candidate for use as a MALDI matrix in small molecule analysis. At the same time, due to its good adsorption ability, HAs was prepared as MSPE adsorbent via a simple co-mixing method, in which the commercially available HAs were directly mixed with Fe3O4 magnetic nanoparticles (MNPs) in a mortar and grinded evenly and completely. In this process, MNPs were physically wrapped and adhered to tiny HAs leading to the formation of magnetic HAs (MHAs). To verify the bi-function of the MHAs, Rhodamine B (RdB) was chosen as model compound. Our results show that the combination of MHAs-based MSPE and MALDI-TOF-MS can provide a rapid and sensitive method for the determination of RdB in chili oil. The whole analytical procedure could be completed within 30 min for simultaneous determination of more than 20 samples, and the limit of quantitation for RdB was found to be 0.02 μg/g. The recoveries in chili oil were in the range 73.8-81.5% with the RSDs less than 21.3% (intraday) and 20.3% (interday). The proposed strategy has potential applications for high-throughput analysis of small molecules in complex samples. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. In vitro model to study the effects of matrix stiffening on Ca2+ handling and myofilament function in isolated adult rat cardiomyocytes

    PubMed Central

    Najafi, Aref; Fontoura, Dulce; Valent, Erik; Goebel, Max; Kardux, Kim; Falcão‐Pires, Inês; van der Velden, Jolanda

    2017-01-01

    Key points This paper describes a novel model that allows exploration of matrix‐induced cardiomyocyte adaptations independent of the passive effect of matrix rigidity on cardiomyocyte function.Detachment of adult cardiomyocytes from the matrix enables the study of matrix effects on cell shortening, Ca2+ handling and myofilament function.Cell shortening and Ca2+ handling are altered in cardiomyocytes cultured for 24 h on a stiff matrix.Matrix stiffness‐impaired cardiomyocyte contractility is reversed upon normalization of extracellular stiffness.Matrix stiffness‐induced reduction in unloaded shortening is more pronounced in cardiomyocytes isolated from obese ZSF1 rats with heart failure with preserved ejection fraction compared to lean ZSF1 rats. Abstract Extracellular matrix (ECM) stiffening is a key element of cardiac disease. Increased rigidity of the ECM passively inhibits cardiac contraction, but if and how matrix stiffening also actively alters cardiomyocyte contractility is incompletely understood. In vitro models designed to study cardiomyocyte–matrix interaction lack the possibility to separate passive inhibition by a stiff matrix from active matrix‐induced alterations of cardiomyocyte properties. Here we introduce a novel experimental model that allows exploration of cardiomyocyte functional alterations in response to matrix stiffening. Adult rat cardiomyocytes were cultured for 24 h on matrices of tuneable stiffness representing the healthy and the diseased heart and detached from their matrix before functional measurements. We demonstrate that matrix stiffening, independent of passive inhibition, reduces cell shortening and Ca2+ handling but does not alter myofilament‐generated force. Additionally, detachment of adult cultured cardiomyocytes allowed the transfer of cells from one matrix to another. This revealed that stiffness‐induced cardiomyocyte changes are reversed when matrix stiffness is normalized. These matrix stiffness‐induced changes in cardiomyocyte function could not be explained by adaptation in the microtubules. Additionally, cardiomyocytes isolated from stiff hearts of the obese ZSF1 rat model of heart failure with preserved ejection fraction show more pronounced reduction in unloaded shortening in response to matrix stiffening. Taken together, we introduce a method that allows evaluation of the influence of ECM properties on cardiomyocyte function separate from the passive inhibitory component of a stiff matrix. As such, it adds an important and physiologically relevant tool to investigate the functional consequences of cardiomyocyte–matrix interactions. PMID:28485491

  6. Assessment of CO2 Storage Potential in Naturally Fractured Reservoirs With Dual-Porosity Models

    NASA Astrophysics Data System (ADS)

    March, Rafael; Doster, Florian; Geiger, Sebastian

    2018-03-01

    Naturally Fractured Reservoirs (NFR's) have received little attention as potential CO2 storage sites. Two main facts deter from storage projects in fractured reservoirs: (1) CO2 tends to be nonwetting in target formations and capillary forces will keep CO2 in the fractures, which typically have low pore volume; and (2) the high conductivity of the fractures may lead to increased spatial spreading of the CO2 plume. Numerical simulations are a powerful tool to understand the physics behind brine-CO2 flow in NFR's. Dual-porosity models are typically used to simulate multiphase flow in fractured formations. However, existing dual-porosity models are based on crude approximations of the matrix-fracture fluid transfer processes and often fail to capture the dynamics of fluid exchange accurately. Therefore, more accurate transfer functions are needed in order to evaluate the CO2 transfer to the matrix. This work presents an assessment of CO2 storage potential in NFR's using dual-porosity models. We investigate the impact of a system of fractures on storage in a saline aquifer, by analyzing the time scales of brine drainage by CO2 in the matrix blocks and the maximum CO2 that can be stored in the rock matrix. A new model to estimate drainage time scales is developed and used in a transfer function for dual-porosity simulations. We then analyze how injection rates should be limited in order to avoid early spill of CO2 (lost control of the plume) on a conceptual anticline model. Numerical simulations on the anticline show that naturally fractured reservoirs may be used to store CO2.

  7. A NEW RELEVANCE ESTIMATOR FOR THE COMPILATION AND VISUALIZATION OF DISEASE PATTERNS AND POTENTIAL DRUG TARGETS.

    PubMed

    VON Korff, Modest; Fink, Tobias; Sander, Thomas

    2017-01-01

    A new computational method is presented to extract disease patterns from heterogeneous and text-based data. For this study, 22 million PubMed records were mined for co-occurrences of gene name synonyms and disease MeSH terms. The resulting publication counts were transferred into a matrix Mdata. In this matrix, a disease was represented by a row and a gene by a column. Each field in the matrix represented the publication count for a co-occurring disease-gene pair. A second matrix with identical dimensions Mrelevance was derived from Mdata. To create Mrelevance the values from Mdata were normalized. The normalized values were multiplied by the column-wise calculated Gini coefficient. This multiplication resulted in a relevance estimator for every gene in relation to a disease. From Mrelevance the similarities between all row vectors were calculated. The resulting similarity matrix Srelevance related 5,000 diseases by the relevance estimators calculated for 15,000 genes. Three diseases were analyzed in detail for the validation of the disease patterns and the relevant genes. Cytoscape was used to visualize and to analyze Mrelevance and Srelevance together with the genes and diseases. Summarizing the results, it can be stated that the relevance estimator introduced here was able to detect valid disease patterns and to identify genes that encoded key proteins and potential targets for drug discovery projects.

  8. Organic light-emitting diodes for lighting: High color quality by controlling energy transfer processes in host-guest-systems

    NASA Astrophysics Data System (ADS)

    Weichsel, Caroline; Reineke, Sebastian; Furno, Mauro; Lüssem, Björn; Leo, Karl

    2012-02-01

    Exciton generation and transfer processes in a multilayer organic light-emitting diode (OLED) are studied in order to realize OLEDs with warm white color coordinates and high color-rendering index (CRI). We investigate a host-guest-system containing four phosphorescent emitters and two matrix materials with different transport properties. We show, by time-resolved spectroscopy, that an energy back-transfer from the blue emitter to the matrix materials occurs, which can be used to transport excitons to the other emitter molecules. Furthermore, we investigate the excitonic and electronic transfer processes by designing suitable emission layer stacks. As a result, we obtain an OLED with Commission Internationale de lÉclairage (CIE) coordinates of (0.444;0.409), a CRI of 82, and a spectrum independent of the applied current. The OLED shows an external quantum efficiency of 10% and a luminous efficacy of 17.4 lm/W at 1000 cd/m2.

  9. Ultrafast energy transfer with competing channels: Non-equilibrium Förster and Modified Redfield theories

    NASA Astrophysics Data System (ADS)

    Seibt, Joachim; Mančal, Tomáš

    2017-05-01

    We derive equations of motion for the reduced density matrix of a molecular system which undergoes energy transfer dynamics competing with fast internal conversion channels. Environmental degrees of freedom of such a system have no time to relax to quasi-equilibrium in the electronic excited state of the donor molecule, and thus the conditions of validity of Förster and Modified Redfield theories in their standard formulations do not apply. We derive non-equilibrium versions of the two well-known rate theories and apply them to the case of carotenoid-chlorophyll energy transfer. Although our reduced density matrix approach does not account for the formation of vibronic excitons, it still confirms the important role of the donor ground-state vibrational states in establishing the resonance energy transfer conditions. We show that it is essential to work with a theory valid in a strong system-bath interaction regime to obtain correct dependence of the rates on donor-acceptor energy gap.

  10. Color normalization of histology slides using graph regularized sparse NMF

    NASA Astrophysics Data System (ADS)

    Sha, Lingdao; Schonfeld, Dan; Sethi, Amit

    2017-03-01

    Computer based automatic medical image processing and quantification are becoming popular in digital pathology. However, preparation of histology slides can vary widely due to differences in staining equipment, procedures and reagents, which can reduce the accuracy of algorithms that analyze their color and texture information. To re- duce the unwanted color variations, various supervised and unsupervised color normalization methods have been proposed. Compared with supervised color normalization methods, unsupervised color normalization methods have advantages of time and cost efficient and universal applicability. Most of the unsupervised color normaliza- tion methods for histology are based on stain separation. Based on the fact that stain concentration cannot be negative and different parts of the tissue absorb different stains, nonnegative matrix factorization (NMF), and particular its sparse version (SNMF), are good candidates for stain separation. However, most of the existing unsupervised color normalization method like PCA, ICA, NMF and SNMF fail to consider important information about sparse manifolds that its pixels occupy, which could potentially result in loss of texture information during color normalization. Manifold learning methods like Graph Laplacian have proven to be very effective in interpreting high-dimensional data. In this paper, we propose a novel unsupervised stain separation method called graph regularized sparse nonnegative matrix factorization (GSNMF). By considering the sparse prior of stain concentration together with manifold information from high-dimensional image data, our method shows better performance in stain color deconvolution than existing unsupervised color deconvolution methods, especially in keeping connected texture information. To utilized the texture information, we construct a nearest neighbor graph between pixels within a spatial area of an image based on their distances using heat kernal in lαβ space. The representation of a pixel in the stain density space is constrained to follow the feature distance of the pixel to pixels in the neighborhood graph. Utilizing color matrix transfer method with the stain concentrations found using our GSNMF method, the color normalization performance was also better than existing methods.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Wenting; Zhang, Qinggang; Wang, Ruiqin

    Unsaturated metal species (UMS) confined in nanomaterials play important roles for electron transfer in a wide range of catalytic reactions. However, the limited fabrication methods of UMS restrict their wider catalytic applications. Here in this paper, we report on the synergy of unsaturated Zn and Cu dopants confined in carbon dots (ZnCu-CDs) to produce enhanced electron transfer and photooxidation processes in the doped CDs. The Zn/Cu species chelate with the carbon matrix mainly through Cu-O(N)-Zn-O(N)-Cu complexes. Within this structure, Cu 2+ acts as a mild oxidizer that facilely increases the unsaturated Zn content and also precisely tunes the unsaturated Znmore » valence state to Zn d+, where d is between 1 and 2, instead of Zn. With the help of UMS, electron-transfer pathways are produced, enhancing both the electron donating (7.0 times) and-accepting (5.3 times) abilities relative to conventional CDs. Because of these synergistic effects, the photocatalytic efficiency of CDs in photooxidation reactions is shown to improve more than 5-fold.« less

  12. Simultaneous heat and mass transfer inside a vertical channel in evaporating a heated falling glycols liquid film

    NASA Astrophysics Data System (ADS)

    Nait Alla, Abderrahman; Feddaoui, M'barek; Meftah, Hicham

    2015-12-01

    The interactive effects of heat and mass transfer in the evaporation of ethylene and propylene glycol flowing as falling films on vertical channel was investigated. The liquid film falls along a left plate which is externally subjected to a uniform heat flux while the right plate is the dry wall and is kept thermally insulated. The model solves the coupled governing equations in both phases together with the boundary and interfacial conditions. The systems of equations obtained by using an implicit finite difference method are solved by Tridiagonal Matrix Algorithm. The influence of the inlet liquid flow, Reynolds number in the gas flow and the wall heat flux on the intensity of heat and mass transfers are examined. A comparison between the results obtained for studied glycols and water in the same conditions is made. The results indicate that water evaporates in more intense way in comparison to glycols and the increase of gas flow rate tends to improve slightly the evaporation.

  13. Attachment techniques for high temperature strain

    NASA Astrophysics Data System (ADS)

    Wnuk, Steve P., Jr.

    1993-01-01

    Attachment methods for making resistive strain measurements to 2500 F were studied. A survey of available strain gages and attachment techniques was made, and the results are compiled for metal and carbon composite test materials. A theoretical analysis of strain transfer into a bonded strain gage was made, and the important physical parameters of the strain transfer medium, the ceramic matrix, were identified. A pull tester to measure pull-out tests on commonly used strain gage cements indicated that all cements tested displayed adequate strength for good strain transfer. Rokide flame sprayed coatings produced significantly stronger bonds than ceramic cements. An in-depth study of the flame spray process produced simplified installation procedures which also resulted in greater reliability and durability. Application procedures incorporating improvements made during this program are appended to the report. Strain gages installed on carbon composites, Rene' 41, 316 stainless steel, and TZM using attachment techniques developed during this program were successfully tested to 2500 F. Photographs of installation techniques, test procedures, and graphs of the test data are included in this report.

  14. Charge transfer and ionization in collisions of Si3+ with H from low to high energy

    NASA Astrophysics Data System (ADS)

    Wang, J. G.; He, B.; Ning, Y.; Liu, C. L.; Yan, J.; Stancil, P. C.; Schultz, D. R.

    2006-11-01

    Charge transfer processes due to collisions of ground state Si3+(3sS1) ions with atomic hydrogen are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) and classical-trajectory Monte Carlo (CTMC) methods. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained from Herrero [J. Phys. B 29, 5583 (1996)] which were calculated with a full configuration-interaction method. Total and state-selective single-electron capture cross sections are obtained for collision energies from 0.01eV/u to 1MeV/u . Total and state-selective rate coefficients are also presented for temperatures from 2×103K to 107K . Comparison with existing data reveals that the total CTMC cross sections are in good agreement with the experimental measurements at the higher considered energies and that previous Landau-Zener calculations underestimate the total rate coefficients by a factor of up to two. The CTMC calculations of target ionization are presented for high energies.

  15. Designing spin-channel geometries for entanglement distribution

    NASA Astrophysics Data System (ADS)

    Levi, E. K.; Kirton, P. G.; Lovett, B. W.

    2016-09-01

    We investigate different geometries of spin-1/2 nitrogen impurity channels for distributing entanglement between pairs of remote nitrogen vacancy centers (NVs) in diamond. To go beyond the system size limits imposed by directly solving the master equation, we implement a matrix product operator method to describe the open system dynamics. In so doing, we provide an early demonstration of how the time-evolving block decimation algorithm can be used for answering a problem related to a real physical system that could not be accessed by other methods. For a fixed NV separation there is an interplay between incoherent impurity spin decay and coherent entanglement transfer: Long-transfer-time, few-spin systems experience strong dephasing that can be overcome by increasing the number of spins in the channel. We examine how missing spins and disorder in the coupling strengths affect the dynamics, finding that in some regimes a spin ladder is a more effective conduit for information than a single-spin chain.

  16. Properties of Zero-Free Transfer Function Matrices

    NASA Astrophysics Data System (ADS)

    D. O. Anderson, Brian; Deistler, Manfred

    Transfer functions of linear, time-invariant finite-dimensional systems with more outputs than inputs, as arise in factor analysis (for example in econometrics), have, for state-variable descriptions with generic entries in the relevant matrices, no finite zeros. This paper gives a number of characterizations of such systems (and indeed square discrete-time systems with no zeros), using state-variable, impulse response, and matrix-fraction descriptions. Key properties include the ability to recover the input values at any time from a bounded interval of output values, without any knowledge of an initial state, and an ability to verify the no-zero property in terms of a property of the impulse response coefficient matrices. Results are particularized to cases where the transfer function matrix in question may or may not have a zero at infinity or a zero at zero.

  17. Collisional Dynamics of the B 3Pi(O+) State of Bromine Monochloride.

    DTIC Science & Technology

    1986-08-01

    many useful discussions on energy transfer studies and continual friendship, to Lt. Brian McFeeters for execution of an RKR program, and to AFWL...2 C. The Halogens and Interhalogens.................... 6 D. The Study of Molecular Energy Transfer............ 9 E. Problem...Matrix.............. 137 8. The BrCl(B) Quenching Mechanism................ 144 9. Energy Transfer with Rare Gases................ 145 10. Summary of

  18. Proton exchange membrane based on chitosan and solvent-free carbon nanotube fluids for fuel cells applications.

    PubMed

    Wang, Jie; Gong, Chunli; Wen, Sheng; Liu, Hai; Qin, Caiqin; Xiong, Chuanxi; Dong, Lijie

    2018-04-15

    Poor dispersion and inert ionic conduction are two major obstacles towards using carbon nanotubes (CNTs) to modify polymer electrolyte membranes (PEMs) in energy conversion devices. In this work, solvent-free carbon nanotube fluids (CNT fluids) with liquid-like behavior are prepared through an ion exchange method and incorporated into a chitosan (CS) matrix to fabricate composite membranes. The electrostatic interactions between SO 3 - groups in the CNT fluids and NH 2 groups in the CS matrix, in addition to the unique flow properties of the CNT fluids, promote the uniform dispersion of CNT fluids in the CS matrix. Markedly, the CS/CNT fluid-3 composite membrane is simultaneously reinforced and toughened by 180% and 300% compared to pure CS membrane, respectively. Moreover, the SO 3 - groups in the CNT fluids facilitate the proton transfer such that the proton conductivity of CS/CNT fluid-3 composite membrane reaches a maximum value of 0.044 S cm -1 at 80 °C. Copyright © 2018 Elsevier Ltd. All rights reserved.

  19. Multiple scattered radiation emerging from Rayleigh and continental haze layers. I - Radiance, polarization, and neutral points

    NASA Technical Reports Server (NTRS)

    Kattawar, G. W.; Plass, G. N.; Hitzfelder, S. J.

    1976-01-01

    The matrix operator method was used to calculate the polarization of radiation scattered on layers of various optical thicknesses, with results compared for Rayleigh scattering and for scattering from a continental haze. In both cases, there are neutral points arising from the zeros of the polarization of single scattered photons at scattering angles of zero and 180 degrees. The angular position of these Rayleigh-like neutral points (RNP) in the sky shows appreciable variation with the optical thickness of the scattering layer for a Rayleigh phase matrix, but only a small variation for haze L phase matrix. Another type of neutral point exists for non-Rayleigh phase functions that is associated with the zeros of the polarization for single scattering which occurs between the end points of the curve. A comparison of radiances calculated from the complete theory of radiative transfer using Stokes vectors with those obtained from the scalar theory shows that differences of the order of 23% may be obtained for Rayleigh scattering, while the largest difference found for a haze L phase function was of the order of 0.1%.

  20. An R-matrix study of electron induced processes in BF3 plasma

    NASA Astrophysics Data System (ADS)

    Gupta, Dhanoj; Chakrabarti, Kalyan; Yoon, Jung-Sik; Song, Mi-Young

    2017-12-01

    An R-matrix formalism is used to study electron collision with the BF3 molecule using Quantemol-N, a computational system for electron molecule collisions which uses the molecular R-matrix method. Several target models are tested for BF3 in its equilibrium geometry, and the results are presented for the best model. Scattering calculations are then performed to yield resonance parameters, elastic, differential, excitation, and momentum transfer cross sections. The results for all the cross sections are compared with the experimental and theoretical data, and a good agreement is obtained. The resonances have been detected at 3.79 and 13.58 eV, with the ionization threshold being 15.7 eV. We have also estimated the absolute dissociative electron attachment (DEA) cross section for the F- ion production from BF3, which is a maiden attempt. The peak of the DEA is at around 13.5 eV, which is well supported by the resonance detected at 13.58 eV. The cross sections reported here find a variety of applications in the plasma technology.

  1. Influence of lipids on the interfacial disposition of respiratory syncytical virus matrix protein.

    PubMed

    McPhee, Helen K; Carlisle, Jennifer L; Beeby, Andrew; Money, Victoria A; Watson, Scott M D; Yeo, R Paul; Sanderson, John M

    2011-01-04

    The propensity of a matrix protein from an enveloped virus of the Mononegavirales family to associate with lipids representative of the viral envelope has been determined using label-free methods, including tensiometry and Brewster angle microscopy on lipid films at the air-water interface and atomic force microscopy on monolayers transferred to OTS-treated silicon wafers. This has enabled factors that influence the disposition of the protein with respect to the lipid interface to be characterized. In the absence of sphingomyelin, respiratory syncytial virus matrix protein penetrates monolayers composed of mixtures of phosphocholines with phosphoethanolamines or cholesterol at the air-water interface. In ternary mixtures composed of sphingomyelin, 1,2-dioleoyl-sn-glycero-3-phosphocholine, and cholesterol, the protein exhibits two separate behaviors: (1) peripheral association with the surface of sphingomyelin-rich domains and (2) penetration of sphingomyelin-poor domains. Prolonged incubation of the protein with mixtures of phosphocholines and phosphoethanolamines leads to the formation of helical protein assemblies of uniform diameter that demonstrate an inherent propensity of the protein to assemble into a filamentous form.

  2. The use of urinary bladder matrix in the treatment of complicated open wounds.

    PubMed

    Lanteri Parcells, Alexis; Abernathie, Brenon; Datiashvili, Ramazi

    2014-07-01

    Management of complicated open wounds represents a challenge when reconstructive options are not applicable. Urinary bladder matrix (UBM) provides a biocompatible material that allows inductivetissue remodeling. The use of urinary bladder matrix inthe treatment of 5 patients with complicated open wounds that failed toheal with conventional therapy is presented. A 3-year old male sustained a second-degree oil burn measuring 8 cm x 4 cm to his dorsal forearm; UBM was applied weekly and the wound epithelialized in 3 weeks. A 52-year old male sustained massive second and third degree burns to his leg after a fire; UBM was applied weekly and the wound epithelialized in 28 weeks. A 61-year old female sustained a severe crushing injury to her right knee. A gastrocnemius muscle transfer and rectus abdominus muscle free flap transfer both failed, then UBM and vacuum-assisted closure therapy were applied and the wound epithelialized in 24 weeks. A 54-year old female underwent a breast mastectomy and immediate reconstruction with pedicled transverse rectus abdominus flap. The patient developed partial necrosis and the wound was managed with UBM and vacuum-assisted closure therapy. The wound epithelialized in 12 weeks. A 36-year old female sustained severe degloving injuries to both hands with exposed metacarpals. Weekly application of UBM provided tissue remodeling over the bones, which allowed successful skin grafting and closure. These experiences show UBM to be an effective method in management of complicated open wounds in select cases. Further studies need to be implemented to confirm this conclusion.

  3. The modelling of the flow-induced vibrations of periodic flat and axial-symmetric structures with a wave-based method

    NASA Astrophysics Data System (ADS)

    Errico, F.; Ichchou, M.; De Rosa, S.; Bareille, O.; Franco, F.

    2018-06-01

    The stochastic response of periodic flat and axial-symmetric structures, subjected to random and spatially-correlated loads, is here analysed through an approach based on the combination of a wave finite element and a transfer matrix method. Although giving a lower computational cost, the present approach keeps the same accuracy of classic finite element methods. When dealing with homogeneous structures, the accuracy is also extended to higher frequencies, without increasing the time of calculation. Depending on the complexity of the structure and the frequency range, the computational cost can be reduced more than two orders of magnitude. The presented methodology is validated both for simple and complex structural shapes, under deterministic and random loads.

  4. Phase transition in the spin- 3 / 2 Blume-Emery-Griffiths model with antiferromagnetic second neighbor interactions

    NASA Astrophysics Data System (ADS)

    Yezli, M.; Bekhechi, S.; Hontinfinde, F.; EZ-Zahraouy, H.

    2016-04-01

    Two nonperturbative methods such as Monte-Carlo simulation (MC) and Transfer-Matrix Finite-Size-Scaling calculations (TMFSS) have been used to study the phase transition of the spin- 3 / 2 ​Blume-Emery-Griffiths model (BEG) with quadrupolar and antiferromagnetic next-nearest-neighbor exchange interactions. Ground state and finite temperature phase diagrams are obtained by means of these two methods. New degenerate phases are found and only second order phase transitions occur for all values of the parameter interactions. No sign of the intermediate phase is found from both methods. Critical exponents are also obtained from TMFSS calculations. Ising criticality and nonuniversal behaviors are observed depending on the strength of the second neighbor interaction.

  5. Numerical implementation, verification and validation of two-phase flow four-equation drift flux model with Jacobian-free Newton–Krylov method

    DOE PAGES

    Zou, Ling; Zhao, Haihua; Zhang, Hongbin

    2016-08-24

    This study presents a numerical investigation on using the Jacobian-free Newton–Krylov (JFNK) method to solve the two-phase flow four-equation drift flux model with realistic constitutive correlations (‘closure models’). The drift flux model is based on Isshi and his collaborators’ work. Additional constitutive correlations for vertical channel flow, such as two-phase flow pressure drop, flow regime map, wall boiling and interfacial heat transfer models, were taken from the RELAP5-3D Code Manual and included to complete the model. The staggered grid finite volume method and fully implicit backward Euler method was used for the spatial discretization and time integration schemes, respectively. Themore » Jacobian-free Newton–Krylov method shows no difficulty in solving the two-phase flow drift flux model with a discrete flow regime map. In addition to the Jacobian-free approach, the preconditioning matrix is obtained by using the default finite differencing method provided in the PETSc package, and consequently the labor-intensive implementation of complex analytical Jacobian matrix is avoided. Extensive and successful numerical verification and validation have been performed to prove the correct implementation of the models and methods. Code-to-code comparison with RELAP5-3D has further demonstrated the successful implementation of the drift flux model.« less

  6. Waste disposal technology transfer matching requirement clusters for waste disposal facilities in China.

    PubMed

    Dorn, Thomas; Nelles, Michael; Flamme, Sabine; Jinming, Cai

    2012-11-01

    Even though technology transfer has been part of development aid programmes for many decades, it has more often than not failed to come to fruition. One reason is the absence of simple guidelines or decision making tools that help operators or plant owners to decide on the most suitable technology to adopt. Practical suggestions for choosing the most suitable technology to combat a specific problem are hard to get and technology drawbacks are not sufficiently highlighted. Western counterparts in technology transfer or development projects often underestimate or don't sufficiently account for the high investment costs for the imported incineration plant; the differing nature of Chinese MSW; the need for trained manpower; and the need to treat flue gas, bunker leakage water, and ash, all of which contain highly toxic elements. This article sets out requirements for municipal solid waste disposal plant owner/operators in China as well as giving an attribute assessment for the prevalent waste disposal plant types in order to assist individual decision makers in their evaluation process for what plant type might be most suitable in a given situation. There is no 'best' plant for all needs and purposes, and requirement constellations rely on generalisations meaning they cannot be blindly applied, but an alignment of a type of plant to a type of owner or operator can realistically be achieved. To this end, a four-step approach is suggested and a technology matrix is set out to ease the choice of technology to transfer and avoid past errors. The four steps are (1) Identification of plant owner/operator requirement clusters; (2) Determination of different municipal solid waste (MSW) treatment plant attributes; (3) Development of a matrix matching requirement clusters to plant attributes; (4) Application of Quality Function Deployment Method to aid in technology localisation. The technology transfer matrices thus derived show significant performance differences between the various technologies available. It is hoped that the resulting research can build a bridge between technology transfer research and waste disposal research in order to enhance the exchange of more sustainable solutions in future. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Determination of triazine herbicides in seaweeds: development of a sample preparation method based on Matrix Solid Phase Dispersion and Solid Phase Extraction Clean-up.

    PubMed

    Rodríguez-González, N; González-Castro, M J; Beceiro-González, E; Muniategui-Lorenzo, S; Prada-Rodríguez, D

    2014-04-01

    A method using dual process columns of Matrix Solid Phase Dispersion (MSPD) and Solid Phase Extraction (SPE) has been developed for extracting and cleaning-up of nine triazine herbicides (ametryn, atrazine, cyanazine, prometryn, propazine, simazine, simetryn, terbuthylazine and terbutryn) in seaweed samples. Under optimized conditions, samples were blended with 2g of octasilyl-derivatized silica (C8) and transferred into an SPE cartridge containing ENVI-Carb II/PSA (0.5/0.5 g) as a clean up co-sorbent. Then the dispersed sample was washed with 10 mL of n-hexane and triazines were eluted with 20 mL ethyl acetate and 5 mL acetonitrile. Finally the extract was concentrated to dryness, re-constituted with 1 mL methanol:water (1:1) and injected into the HPLC-DAD system. The linearity of the calibration curves was excellent in matrix matched standards, and yielded the coefficients of determination>0.995 for all the target analytes. The recoveries ranged from 75% to 100% with relative standard deviations lower than 7%. The achieved LOQs (<10 µg kg(-1)) for all triazines under study permits to ensure proper determination at the maximum allowed residue levels set in the European Union Legislation. Samples of three seaweeds were subjected to the procedure proving the suitability of MSPD method for the analysis of triazines in different seaweeds samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Porting of the transfer-matrix method for multilayer thin-film computations on graphics processing units

    NASA Astrophysics Data System (ADS)

    Limmer, Steffen; Fey, Dietmar

    2013-07-01

    Thin-film computations are often a time-consuming task during optical design. An efficient way to accelerate these computations with the help of graphics processing units (GPUs) is described. It turned out that significant speed-ups can be achieved. We investigate the circumstances under which the best speed-up values can be expected. Therefore we compare different GPUs among themselves and with a modern CPU. Furthermore, the effect of thickness modulation on the speed-up and the runtime behavior depending on the input data is examined.

  9. Numerical Modeling of Two-Terminal Quantum Well Devices

    DTIC Science & Technology

    1989-04-17

    transfer matrix methods . This was implemented for a perfectly symmetric resonant tunneling structure such as the one shown in figure 3. This technique has...occur for mean well widths near 0.08v or 0.09v. This situation requires further analysis . The situation for the well width of 70A, yielded low Q...WSe.4W AA L1ot. OVefol striwe Tunmelen "ers (a) (b) Figure 1: Pseudomorphic InO. 5 3 Ga 0 .4 7 As/AlA3/ InAa resonant tunneling diodes proposed in

  10. Tunneling calculations for GaAs-Al(x)Ga(1-x) as graded band-gap sawtooth superlattices. Thesis

    NASA Technical Reports Server (NTRS)

    Forrest, Kathrine A.; Meijer, Paul H. E.

    1991-01-01

    Quantum mechanical tunneling calculations for sawtooth (linearly graded band-gap) and step-barrier AlGaAs superlattices were performed by means of a transfer matrix method, within the effective mass approximation. The transmission coefficient and tunneling current versus applied voltage were computed for several representative structures. Particular consideration was given to effective mass variations. The tunneling properties of step and sawtooth superlattices show some qualitative similarities. Both structures exhibit resonant tunneling, however, because they deform differently under applied fields, the J-V curves differ.

  11. Direct computational approach to lattice supersymmetric quantum mechanics

    NASA Astrophysics Data System (ADS)

    Kadoh, Daisuke; Nakayama, Katsumasa

    2018-07-01

    We study the lattice supersymmetric models numerically using the transfer matrix approach. This method consists only of deterministic processes and has no statistical uncertainties. We improve it by performing a scale transformation of variables such that the Witten index is correctly reproduced from the lattice model, and the other prescriptions are shown in detail. Compared to the precious Monte-Carlo results, we can estimate the effective masses, SUSY Ward identity and the cut-off dependence of the results in high precision. Those kinds of information are useful in improving lattice formulation of supersymmetric models.

  12. A TBA approach to thermal transport in the XXZ Heisenberg model

    NASA Astrophysics Data System (ADS)

    Zotos, X.

    2017-10-01

    We show that the thermal Drude weight and magnetothermal coefficient of the 1D easy-plane Heisenberg model can be evaluated by an extension of the Bethe ansatz thermodynamics formulation by Takahashi and Suzuki (1972 Prog. Theor. Phys. 48 2187). They have earlier been obtained by the quantum transfer matrix method (Klümper 1999 Z. Phys. B 91 507). Furthermore, this approach can be applied to the study of the far-out of equilibrium energy current generated at the interface between two semi-infinite chains held at different temperatures.

  13. Some optical properties of one dimensional annular photonic crystal with plasma frequency

    NASA Astrophysics Data System (ADS)

    Pandeya, G. N.; Thapa, Khem B.

    2018-05-01

    This paper presents the reflection bands, photonic band gaps, of the one-dimensional annul photonic crystal (APC) containing double negative (DNG) metamaterials and air. The proposed annular structure consists of the alternate layers of dispersive DNG material and air immersed in free space. The reflectance properties of the APC by employing the transfer matrix method (TMM) in the cylindrical waves for TE polarization is studied theoretically. In addition of this, we have also studied the effect of plasma frequency on the reflection behavior of the considered annular structure.

  14. Viscoelastic behavior and life-time predictions

    NASA Technical Reports Server (NTRS)

    Dillard, D. A.; Brinson, H. F.

    1985-01-01

    Fiber reinforced plastics were considered for many structural applications in automotive, aerospace and other industries. A major concern was and remains the failure modes associated with the polymer matrix which serves to bind the fibers together and transfer the load through connections, from fiber to fiber and ply to ply. An accelerated characterization procedure for prediction of delayed failures was developed. This method utilizes time-temperature-stress-moisture superposition principles in conjunction with laminated plate theory. Because failures are inherently nonlinear, the testing and analytic modeling for both moduli and strength is based upon nonlinear viscoelastic concepts.

  15. Energy band and transport properties in magnetic aperiodic graphene superlattices of Thue-Morse sequence

    NASA Astrophysics Data System (ADS)

    Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue

    2016-02-01

    Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.

  16. Addressable test matrix for measuring analog transfer characteristics of test elements used for integrated process control and device evaluation

    NASA Technical Reports Server (NTRS)

    Buehler, Martin G. (Inventor)

    1988-01-01

    A set of addressable test structures, each of which uses addressing schemes to access individual elements of the structure in a matrix, is used to test the quality of a wafer before integrated circuits produced thereon are diced, packaged and subjected to final testing. The electrical characteristic of each element is checked and compared to the electrical characteristic of all other like elements in the matrix. The effectiveness of the addressable test matrix is in readily analyzing the electrical characteristics of the test elements and in providing diagnostic information.

  17. Quantum interference in multi-branched molecules: The exact transfer matrix solutions.

    PubMed

    Jiang, Yu

    2017-12-07

    We present a transfer matrix formalism for studying quantum interference in a single molecule electronic system with internal branched structures. Based on the Schrödinger equation with the Bethe ansatz and employing Kirchhoff's rule for quantum wires, we derive a general closed-form expression for the transmission and reflection amplitudes of a two-port quantum network. We show that the transport through a molecule with complex internal structures can be reduced to that of a single two-port scattering unit, which contains all the information of the original composite molecule. Our method allows for the calculation of the transmission coefficient for various types of individual molecular modules giving rise to different resonant transport behaviors such as the Breit-Wigner, Fano, and Mach-Zehnder resonances. As an illustration, we first re-derive the transmittance of the Aharonov-Bohm ring, and then we apply our formulation to N identical parity-time (PT)-symmetric potentials, connected in series as well as in parallel. It is shown that the spectral singularities and PT-symmetric transitions of single scattering cells may be observed in coupled systems. Such transitions may occur at the same or distinct values of the critical parameters, depending on the connection modes under which the scattering objects are coupled.

  18. Estimating the Volterra Series Transfer Function over coherent optical OFDM for efficient monitoring of the fiber channel nonlinearity.

    PubMed

    Shulkind, Gal; Nazarathy, Moshe

    2012-12-17

    We present an efficient method for system identification (nonlinear channel estimation) of third order nonlinear Volterra Series Transfer Function (VSTF) characterizing the four-wave-mixing nonlinear process over a coherent OFDM fiber link. Despite the seemingly large number of degrees of freedom in the VSTF (cubic in the number of frequency points) we identified a compressed VSTF representation which does not entail loss of information. Additional slightly lossy compression may be obtained by discarding very low power VSTF coefficients associated with regions of destructive interference in the FWM phased array effect. Based on this two-staged VSTF compressed representation, we develop a robust and efficient algorithm of nonlinear system identification (optical performance monitoring) estimating the VSTF by transmission of an extended training sequence over the OFDM link, performing just a matrix-vector multiplication at the receiver by a pseudo-inverse matrix which is pre-evaluated offline. For 512 (1024) frequency samples per channel, the VSTF measurement takes less than 1 (10) msec to complete with computational complexity of one real-valued multiply-add operation per time sample. Relative to a naïve exhaustive three-tone-test, our algorithm is far more tolerant of ASE additive noise and its acquisition time is orders of magnitude faster.

  19. Review of magnetic refrigeration system as alternative to conventional refrigeration system

    NASA Astrophysics Data System (ADS)

    Mezaal, N. A.; Osintsev, K. V.; Zhirgalova, T. B.

    2017-10-01

    The refrigeration system is one of the most important systems in industry. Developers are constantly seeking for how to avoid the damage to the environment. Magnetic refrigeration is an emerging, environment-friendly technology based on a magnetic solid that acts as a refrigerant by magneto-caloric effect (MCE). In the case of ferromagnetic materials, MCE warms as the magnetic moments of the atom are aligned by the application of a magnetic field. There are two types of magnetic phase changes that may occur at the Curie point: first order magnetic transition (FOMT) and second order magnetic transition (SOMT). The reference cycle for magnetic refrigeration is AMR (Active Magnetic Regenerative cycle), where the magnetic material matrix works both as a refrigerating medium and as a heat regenerating medium, while the fluid flowing in the porous matrix works as a heat transfer medium. Regeneration can be accomplished by blowing a heat transfer fluid in a reciprocating fashion through the regenerator made of magnetocaloric material that is alternately magnetized and demagnetized. Many magnetic refrigeration prototypes with different designs and software models have been built in different parts of the world. In this paper, the authors try to shed light on the magnetic refrigeration and show its effectiveness compared with conventional refrigeration methods.

  20. Optimization of matrix solid-phase dispersion for the rapid determination of salicylate and benzophenone-type UV absorbing substances in marketed fish.

    PubMed

    Tsai, Dung-Ying; Chen, Chien-Liang; Ding, Wang-Hsien

    2014-07-01

    A simple and effective method for the rapid determination of five salicylate and benzophenone-type UV absorbing substances in marketed fish is described. The method involves the use of matrix solid-phase dispersion (MSPD) prior to their determination by on-line silylation gas chromatography tandem mass spectrometry (GC-MS/MS). The parameters that affect the extraction efficiency were optimized using a Box-Behnken design method. The optimal extraction conditions involved dispersing 0.5g of freeze-dried powdered fish with 1.0g of Florisil using a mortar and pestle. This blend was then transferred to a solid-phase extraction (SPE) cartridge containing 1.0g of octadecyl bonded silica (C18), as the clean-up co-sorbent. The target analytes were then eluted with 7mL of acetonitrile. The extract was derivatized on-line in the GC injection-port by reaction with a trimethylsilylating (TMS) reagent. The TMS-derivatives were then identified and quantitated by GC-MS/MS. The limits of quantitation (LOQs) were less than 0.1ng/g. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. Immunochemical-based method for detection of hazelnut proteins in processed foods.

    PubMed

    Ben Rejeb, Samuel; Abbott, Michael; Davies, David; Querry, Jessica; Cléroux, Chantal; Streng, Christine; Delahaut, Philippe; Yeung, Jupiter M

    2003-01-01

    A competitive enzyme-linked immunosorbent assay (ELISA) was developed to detect hazelnut by using polyclonal antibodies generated against a protein extract of roasted hazelnut. No cross-reactivity was observed in tests against 39 commodities, including many common allergens, tree nuts, and legumes. Hazelnut protein standard solutions at 0.45 ng/mL [inhibition concentration (IC80) of the competitive test] were clearly identified by the ELISA. An extraction and quantification method was developed and optimized for chocolate, cookies, breakfast cereals, and ice cream, major food commodities likely to be cross-contaminated with undeclared hazelnut during food processing. No sample cleanup was required when extracts were diluted 10-fold. Recovery results were generated with blank matrixes spiked at 4 levels from 1 to 10 microg/g hazelnut protein. With the developed extraction and sample handling procedure, hazelnut proteins were recovered at 64-83% from chocolate and at 78-97% from other matrixes. A confirmatory technique was developed with sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western transfer. The developed methods were applied to a small market survey of chocolate products and allowed the identification of undeclared hazelnut in these products.

  2. Quantum Chemical Calculations Using Accelerators: Migrating Matrix Operations to the NVIDIA Kepler GPU and the Intel Xeon Phi.

    PubMed

    Leang, Sarom S; Rendell, Alistair P; Gordon, Mark S

    2014-03-11

    Increasingly, modern computer systems comprise a multicore general-purpose processor augmented with a number of special purpose devices or accelerators connected via an external interface such as a PCI bus. The NVIDIA Kepler Graphical Processing Unit (GPU) and the Intel Phi are two examples of such accelerators. Accelerators offer peak performances that can be well above those of the host processor. How to exploit this heterogeneous environment for legacy application codes is not, however, straightforward. This paper considers how matrix operations in typical quantum chemical calculations can be migrated to the GPU and Phi systems. Double precision general matrix multiply operations are endemic in electronic structure calculations, especially methods that include electron correlation, such as density functional theory, second order perturbation theory, and coupled cluster theory. The use of approaches that automatically determine whether to use the host or an accelerator, based on problem size, is explored, with computations that are occurring on the accelerator and/or the host. For data-transfers over PCI-e, the GPU provides the best overall performance for data sizes up to 4096 MB with consistent upload and download rates between 5-5.6 GB/s and 5.4-6.3 GB/s, respectively. The GPU outperforms the Phi for both square and nonsquare matrix multiplications.

  3. Extracting electron transfer coupling elements from constrained density functional theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu Qin; Van Voorhis, Troy

    2006-10-28

    Constrained density functional theory (DFT) is a useful tool for studying electron transfer (ET) reactions. It can straightforwardly construct the charge-localized diabatic states and give a direct measure of the inner-sphere reorganization energy. In this work, a method is presented for calculating the electronic coupling matrix element (H{sub ab}) based on constrained DFT. This method completely avoids the use of ground-state DFT energies because they are known to irrationally predict fractional electron transfer in many cases. Instead it makes use of the constrained DFT energies and the Kohn-Sham wave functions for the diabatic states in a careful way. Test calculationsmore » on the Zn{sub 2}{sup +} and the benzene-Cl atom systems show that the new prescription yields reasonable agreement with the standard generalized Mulliken-Hush method. We then proceed to produce the diabatic and adiabatic potential energy curves along the reaction pathway for intervalence ET in the tetrathiafulvalene-diquinone (Q-TTF-Q) anion. While the unconstrained DFT curve has no reaction barrier and gives H{sub ab}{approx_equal}17 kcal/mol, which qualitatively disagrees with experimental results, the H{sub ab} calculated from constrained DFT is about 3 kcal/mol and the generated ground state has a barrier height of 1.70 kcal/mol, successfully predicting (Q-TTF-Q){sup -} to be a class II mixed-valence compound.« less

  4. A simultaneous characterization and uncertainty analysis of thermal conductivity and diffusivity of bio-insulate material "Palm date Wood" obtained from a periodic method

    NASA Astrophysics Data System (ADS)

    Tlijani, M.; Ben Younes, R.; Durastanti, J. F.; Boudenne, A.

    2010-11-01

    A periodic method is used to determine simultaneously both thermal conductivity and diffusivity of various insulate materials at room temperature. The sample is placed between two metallic plates and temperature modulation is applied on the front side of one of the metallic plates. The temperature at the front and rear sides of both plates is measured and the experimental transfer function is calculated. The theoretical thermal heat transfer function is calculated by the quadripole method. Thermal conductivity and diffusivity are simultaneously identified from both real and imaginary parts of the experimental transfer function. The thermophysical parameters of several wood scale samples obtained from palm wood trees and common trees with unknown thermal properties (E) with different thicknesses were studied. The value identified for the thermal conductivity 0.03 Wm-1 K-1 compared with different insulate solid material such as glass, glass-wool and PVC is much better and close to the air conductivity, It allowed us to consider the wood scale extracted from palm wood trees, bio and renewable material as good heat insulator aiming in the future as a use for lightness applications, insulating or as a reinforcement in a given matrix. These potentialities still unknown are stengthened by the enormous quantity of such kind of wood gathered annually from palm trees and considered as wastes.

  5. Longer Contact Times Increase Cross-Contamination of Enterobacter aerogenes from Surfaces to Food.

    PubMed

    Miranda, Robyn C; Schaffner, Donald W

    2016-11-01

    Bacterial cross-contamination from surfaces to food can contribute to foodborne disease. The cross-contamination rate of Enterobacter aerogenes on household surfaces was evaluated by using scenarios that differed by surface type, food type, contact time (<1, 5, 30, and 300 s), and inoculum matrix (tryptic soy broth or peptone buffer). The surfaces used were stainless steel, tile, wood, and carpet. The food types were watermelon, bread, bread with butter, and gummy candy. Surfaces (25 cm 2 ) were spot inoculated with 1 ml of inoculum and allowed to dry for 5 h, yielding an approximate concentration of 10 7 CFU/surface. Foods (with a 16-cm 2 contact area) were dropped onto the surfaces from a height of 12.5 cm and left to rest as appropriate. Posttransfer, surfaces and foods were placed in sterile filter bags and homogenized or massaged, diluted, and plated on tryptic soy agar. The transfer rate was quantified as the log percent transfer from the surface to the food. Contact time, food, and surface type all had highly significant effects (P < 0.000001) on the log percent transfer of bacteria. The inoculum matrix (tryptic soy broth or peptone buffer) also had a significant effect on transfer (P = 0.013), and most interaction terms were significant. More bacteria transferred to watermelon (∼0.2 to 97%) than to any other food, while the least bacteria transferred to gummy candy (∼0.1 to 62%). Transfer of bacteria to bread (∼0.02 to 94%) was similar to transfer of bacteria to bread with butter (∼0.02 to 82%), and these transfer rates under a given set of conditions were more variable than with watermelon and gummy candy. The popular notion of the "five-second rule" is that food dropped on the floor and left there for <5 s is "safe" because bacteria need time to transfer. The rule has been explored by a single study in the published literature and on at least two television shows. Results from two academic laboratories have been shared through press releases but remain unpublished. We explored this topic by using four different surfaces (stainless steel, ceramic tile, wood, and carpet), four different foods (watermelon, bread, bread with butter, and gummy candy), four different contact times (<1, 5, 30, and 300 s), and two bacterial preparation methods. Although we found that longer contact times result in more transfer, we also found that other factors, including the nature of the food and the surface, are of equal or greater importance. Some transfer takes place "instantaneously," at times of <1 s, disproving the five-second rule. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  6. Longer Contact Times Increase Cross-Contamination of Enterobacter aerogenes from Surfaces to Food

    PubMed Central

    Miranda, Robyn C.

    2016-01-01

    ABSTRACT Bacterial cross-contamination from surfaces to food can contribute to foodborne disease. The cross-contamination rate of Enterobacter aerogenes on household surfaces was evaluated by using scenarios that differed by surface type, food type, contact time (<1, 5, 30, and 300 s), and inoculum matrix (tryptic soy broth or peptone buffer). The surfaces used were stainless steel, tile, wood, and carpet. The food types were watermelon, bread, bread with butter, and gummy candy. Surfaces (25 cm2) were spot inoculated with 1 ml of inoculum and allowed to dry for 5 h, yielding an approximate concentration of 107 CFU/surface. Foods (with a 16-cm2 contact area) were dropped onto the surfaces from a height of 12.5 cm and left to rest as appropriate. Posttransfer, surfaces and foods were placed in sterile filter bags and homogenized or massaged, diluted, and plated on tryptic soy agar. The transfer rate was quantified as the log percent transfer from the surface to the food. Contact time, food, and surface type all had highly significant effects (P < 0.000001) on the log percent transfer of bacteria. The inoculum matrix (tryptic soy broth or peptone buffer) also had a significant effect on transfer (P = 0.013), and most interaction terms were significant. More bacteria transferred to watermelon (∼0.2 to 97%) than to any other food, while the least bacteria transferred to gummy candy (∼0.1 to 62%). Transfer of bacteria to bread (∼0.02 to 94%) was similar to transfer of bacteria to bread with butter (∼0.02 to 82%), and these transfer rates under a given set of conditions were more variable than with watermelon and gummy candy. IMPORTANCE The popular notion of the “five-second rule” is that food dropped on the floor and left there for <5 s is “safe” because bacteria need time to transfer. The rule has been explored by a single study in the published literature and on at least two television shows. Results from two academic laboratories have been shared through press releases but remain unpublished. We explored this topic by using four different surfaces (stainless steel, ceramic tile, wood, and carpet), four different foods (watermelon, bread, bread with butter, and gummy candy), four different contact times (<1, 5, 30, and 300 s), and two bacterial preparation methods. Although we found that longer contact times result in more transfer, we also found that other factors, including the nature of the food and the surface, are of equal or greater importance. Some transfer takes place “instantaneously,” at times of <1 s, disproving the five-second rule. PMID:27590818

  7. Gene transfer device utilizing micron-spiked electrodes produced by the self-organization phenomenon of Fe-alloy.

    PubMed

    Miyano, Naoki; Inoue, Yuuki; Teramura, Yuji; Fujii, Keisuke; Tsumori, Fujio; Iwata, Hiroo; Kotera, Hidetoshi

    2008-07-01

    In the diffusional phase transformation of two-phase alloys, the new phase precipitates form the matrix phase at specific temperatures, followed by the formation of a mixed microstructure comprising the precipitate and the matrix. It has been found that by specific chemical-etching treatment, the precipitate in Fe-25Cr-6Ni alloy projects substantially and clusters at the surface. The configuration of the precipitate has an extremely high aspect ratio: it is several microns in width and several tens of microns in length (known as micron-spiked). This study targets the development of a gene transfer device with a micro-spike produced based on the self-organization phenomenon of the Fe-25Cr-6Ni alloy. With this spike-projected device, we tried to efficiently transfer plasmid DNA into adherent cells by electric pulse-triggered gene transfer using a plasmid-loaded electrode (electroporation-based reverse transfection). The spiked structure was applied to a substrate of the device to allow efficient gene transfer into adherent cells, although the general substrate was flat and had a smooth surface. The results suggest that this unique spike-projected device has potential applications in gene transfer devices for the analysis of the human genome in the post-genome period.

  8. Supertrees Based on the Subtree Prune-and-Regraft Distance

    PubMed Central

    Whidden, Christopher; Zeh, Norbert; Beiko, Robert G.

    2014-01-01

    Supertree methods reconcile a set of phylogenetic trees into a single structure that is often interpreted as a branching history of species. A key challenge is combining conflicting evolutionary histories that are due to artifacts of phylogenetic reconstruction and phenomena such as lateral gene transfer (LGT). Many supertree approaches use optimality criteria that do not reflect underlying processes, have known biases, and may be unduly influenced by LGT. We present the first method to construct supertrees by using the subtree prune-and-regraft (SPR) distance as an optimality criterion. Although calculating the rooted SPR distance between a pair of trees is NP-hard, our new maximum agreement forest-based methods can reconcile trees with hundreds of taxa and > 50 transfers in fractions of a second, which enables repeated calculations during the course of an iterative search. Our approach can accommodate trees in which uncertain relationships have been collapsed to multifurcating nodes. Using a series of benchmark datasets simulated under plausible rates of LGT, we show that SPR supertrees are more similar to correct species histories than supertrees based on parsimony or Robinson–Foulds distance criteria. We successfully constructed an SPR supertree from a phylogenomic dataset of 40,631 gene trees that covered 244 genomes representing several major bacterial phyla. Our SPR-based approach also allowed direct inference of highways of gene transfer between bacterial classes and genera. A Small number of these highways connect genera in different phyla and can highlight specific genes implicated in long-distance LGT. [Lateral gene transfer; matrix representation with parsimony; phylogenomics; prokaryotic phylogeny; Robinson–Foulds; subtree prune-and-regraft; supertrees.] PMID:24695589

  9. Growth factor transgenes interactively regulate articular chondrocytes.

    PubMed

    Shi, Shuiliang; Mercer, Scott; Eckert, George J; Trippel, Stephen B

    2013-04-01

    Adult articular chondrocytes lack an effective repair response to correct damage from injury or osteoarthritis. Polypeptide growth factors that stimulate articular chondrocyte proliferation and cartilage matrix synthesis may augment this response. Gene transfer is a promising approach to delivering such factors. Multiple growth factor genes regulate these cell functions, but multiple growth factor gene transfer remains unexplored. We tested the hypothesis that multiple growth factor gene transfer selectively modulates articular chondrocyte proliferation and matrix synthesis. We tested the hypothesis by delivering combinations of the transgenes encoding insulin-like growth factor I (IGF-I), fibroblast growth factor-2 (FGF-2), transforming growth factor beta1 (TGF-β1), bone morphogenetic protein-2 (BMP-2), and bone morphogenetic protien-7 (BMP-7) to articular chondrocytes and measured changes in the production of DNA, glycosaminoglycan, and collagen. The transgenes differentially regulated all these chondrocyte activities. In concert, the transgenes interacted to generate widely divergent responses from the cells. These interactions ranged from inhibitory to synergistic. The transgene pair encoding IGF-I and FGF-2 maximized cell proliferation. The three-transgene group encoding IGF-I, BMP-2, and BMP-7 maximized matrix production and also optimized the balance between cell proliferation and matrix production. These data demonstrate an approach to articular chondrocyte regulation that may be tailored to stimulate specific cell functions, and suggest that certain growth factor gene combinations have potential value for cell-based articular cartilage repair. Copyright © 2012 Wiley Periodicals, Inc.

  10. Charge Transfer in Collisions of S^4+ with H.

    NASA Astrophysics Data System (ADS)

    Stancil, P. C.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Zygelman, B.

    2001-05-01

    Charge transfer processes due to collisions of ground state S^4+ ions with atomic hydrogen were investigated for energies between 1 meV/u and 10 MeV/u using the quantum-mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling, classical trajectory Monte Carlo (CTMC), and continuum distorted wave methods. The MOCC calculations utilized ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. A number of variants of the CTMC approach were explored, including different momentum and radial distributions for the initial state, as well as effective charge and quantum-defect models to determine the corresponding quantum state after capture into final partially-stripped S^3+ excited classical states. Hydrogen target isotope effects were explored and rate coefficients for temperatures between 100 and 10^6 K will be presented

  11. Vibrationally-resolved Charge Transfer of O^3+ Ions with Molecular Hydrogen

    NASA Astrophysics Data System (ADS)

    Wang, J. G.; Stancil, P. C.; Turner, A. R.; Cooper, D. L.

    2003-05-01

    Charge transfer processes due to collisions of ground state O^3+ ions with H2 are investigated using the quantum-mechanical molecular-orbital close-coupling (MOCC) method. The MOCC calculations utilize ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. Vibrationally-resolved cross sections for energies between 0.1 eV/u and 2 keV/u using the infinite order sudden approximation (IOSA), vibrational sudden approximation (VSA), and electronic approximation (EA), but including Frank-Condon factors (the centroid approximation) will be presented. Comparison with existing experimental data for total cross sections shows best agreement with IOSA and discrepancies for VSA and EA. Triplet-singlet cross section ratios obtained with IOSA are found generally to be in harmony with experiment. JGW and PCS acknowledge support from NASA grant 11453.

  12. Charge Transfer in Collisions of S^4+ with He.

    NASA Astrophysics Data System (ADS)

    Wang, J. G.; Stancil, P. C.; Turner, A. R.; Cooper, D. L.; Schultz, D. R.; Rakovic, M. J.; Fritsch, W.; Zygelman, B.

    2001-05-01

    Charge transfer processes due to collisions of ground state S^4+ ions with atomic helium were investigated for energies between 0.1 meV/u and 10 MeV/u. Total and state-selective cross sections and rate coefficients were obtained utilizing the quantum-mechanical molecular-orbital close-coupling (MOCC), atomic-orbital close-coupling, classical trajectory Monte Carlo (CTMC), and continuum distorted wave methods. The MOCC calculations utilized ab initio adiabatic potentials and nonadiabatic radial coupling matrix elements obtained with the spin-coupled valence-bond approach. A number of variants of the CTMC approach were also explored. Previous data are limited to an earlier Landau-Zener calculation of the total rate coefficient for which our results are two orders of magnitude larger. An observed multichannel interference effect in the MOCC results will also be discussed.

  13. Förster resonance energy transfer (FRET)-based picosecond lifetime reference for instrument response evaluation

    NASA Astrophysics Data System (ADS)

    Luchowski, R.; Kapusta, P.; Szabelski, M.; Sarkar, P.; Borejdo, J.; Gryczynski, Z.; Gryczynski, I.

    2009-09-01

    Förster resonance energy transfer (FRET) can be utilized to achieve ultrashort fluorescence responses in time-domain fluorometry. In a poly(vinyl) alcohol matrix, the presence of 60 mM Rhodamine 800 acceptor shortens the fluorescence lifetime of a pyridine 1 donor to about 20 ps. Such a fast fluorescence response is very similar to the instrument response function (IRF) obtained using scattered excitation light. A solid fluorescent sample (e.g a film) with picosecond lifetime is ideal for IRF measurements and particularly useful for time-resolved microscopy. Avalanche photodiode detectors, commonly used in this field, feature color- dependent-timing responses. We demonstrate that recording the fluorescence decay of the proposed FRET-based reference sample yields a better IRF approximation than the conventional light-scattering method and therefore avoids systematic errors in decay curve analysis.

  14. Multivariable frequency domain identification via 2-norm minimization

    NASA Technical Reports Server (NTRS)

    Bayard, David S.

    1992-01-01

    The author develops a computational approach to multivariable frequency domain identification, based on 2-norm minimization. In particular, a Gauss-Newton (GN) iteration is developed to minimize the 2-norm of the error between frequency domain data and a matrix fraction transfer function estimate. To improve the global performance of the optimization algorithm, the GN iteration is initialized using the solution to a particular sequentially reweighted least squares problem, denoted as the SK iteration. The least squares problems which arise from both the SK and GN iterations are shown to involve sparse matrices with identical block structure. A sparse matrix QR factorization method is developed to exploit the special block structure, and to efficiently compute the least squares solution. A numerical example involving the identification of a multiple-input multiple-output (MIMO) plant having 286 unknown parameters is given to illustrate the effectiveness of the algorithm.

  15. In vitro model to study the effects of matrix stiffening on Ca2+ handling and myofilament function in isolated adult rat cardiomyocytes.

    PubMed

    van Deel, Elza D; Najafi, Aref; Fontoura, Dulce; Valent, Erik; Goebel, Max; Kardux, Kim; Falcão-Pires, Inês; van der Velden, Jolanda

    2017-07-15

    This paper describes a novel model that allows exploration of matrix-induced cardiomyocyte adaptations independent of the passive effect of matrix rigidity on cardiomyocyte function. Detachment of adult cardiomyocytes from the matrix enables the study of matrix effects on cell shortening, Ca 2+ handling and myofilament function. Cell shortening and Ca 2+ handling are altered in cardiomyocytes cultured for 24 h on a stiff matrix. Matrix stiffness-impaired cardiomyocyte contractility is reversed upon normalization of extracellular stiffness. Matrix stiffness-induced reduction in unloaded shortening is more pronounced in cardiomyocytes isolated from obese ZSF1 rats with heart failure with preserved ejection fraction compared to lean ZSF1 rats. Extracellular matrix (ECM) stiffening is a key element of cardiac disease. Increased rigidity of the ECM passively inhibits cardiac contraction, but if and how matrix stiffening also actively alters cardiomyocyte contractility is incompletely understood. In vitro models designed to study cardiomyocyte-matrix interaction lack the possibility to separate passive inhibition by a stiff matrix from active matrix-induced alterations of cardiomyocyte properties. Here we introduce a novel experimental model that allows exploration of cardiomyocyte functional alterations in response to matrix stiffening. Adult rat cardiomyocytes were cultured for 24 h on matrices of tuneable stiffness representing the healthy and the diseased heart and detached from their matrix before functional measurements. We demonstrate that matrix stiffening, independent of passive inhibition, reduces cell shortening and Ca 2+ handling but does not alter myofilament-generated force. Additionally, detachment of adult cultured cardiomyocytes allowed the transfer of cells from one matrix to another. This revealed that stiffness-induced cardiomyocyte changes are reversed when matrix stiffness is normalized. These matrix stiffness-induced changes in cardiomyocyte function could not be explained by adaptation in the microtubules. Additionally, cardiomyocytes isolated from stiff hearts of the obese ZSF1 rat model of heart failure with preserved ejection fraction show more pronounced reduction in unloaded shortening in response to matrix stiffening. Taken together, we introduce a method that allows evaluation of the influence of ECM properties on cardiomyocyte function separate from the passive inhibitory component of a stiff matrix. As such, it adds an important and physiologically relevant tool to investigate the functional consequences of cardiomyocyte-matrix interactions. © 2017 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  16. Nanostructured hybrid hydrogels prepared by a combination of atom transfer radical polymerization and free radical polymerization

    PubMed Central

    Bencherif, Sidi A.; Siegwart, Daniel J.; Srinivasan, Abiraman; Horkay, Ferenc; Hollinger, Jeffrey O.; Washburn, Newell R.; Matyjaszewski, Krzysztof

    2012-01-01

    A new method to prepare nanostructured hybrid hydrogels by incorporating well-defined poly(oligo (ethylene oxide) monomethyl ether methacrylate) (POEO300MA) nanogels of sizes 110–120 nm into a larger three-dimensional (3D) matrix was developed for drug delivery scaffolds for tissue engineering applications. Rhodamine B isothiocyanate-labeled dextran (RITC-Dx) or fluorescein isothiocyanate-labeled dextran (FITC-Dx)-loaded POEO300MA nanogels with pendant hydroxyl groups were prepared by activators generated electron transfer atom transfer radical polymerization (AGET ATRP) in cyclohexane inverse miniemulsion. Hydroxyl-containing nanogels were functionalized with methacrylated groups to generate photoreactive nanospheres. 1H NMR spectroscopy confirmed that polymerizable nanogels were successfully incorporated covalently into 3D hyaluronic acid-glycidyl methacrylate (HAGM) hydrogels after free radical photo-polymerization (FRP). The introduction of disulfide moieties into the polymerizable groups resulted in a controlled release of nanogels from cross-linked HAGM hydrogels under a reducing environment. The effect of gel hybridization on the macroscopic properties (swelling and mechanics) was studied. It is shown that swelling and nanogel content are independent of scaffold mechanics. In-vitro assays showed the nanostructured hybrid hydrogels were cytocompatible and the GRGDS (Gly–Arg–Gly–Asp–Ser) contained in the nanogel structure promoted cell–substrate interactions within 4 days of incubation. These nanostructured hydrogels have potential as an artificial extracellular matrix (ECM) impermeable to low molecular weight biomolecules and with controlled pharmaceutical release capability. Moreover, the nanogels can control drug or biomolecule delivery, while hyaluronic acid based-hydrogels can act as a macroscopic scaffold for tissue regeneration and regulator for nanogel release. PMID:19592087

  17. The study of electromagnetic wave propagation in photonic crystals via planewave based transfer (scattering) matrix method with active gain material applications

    NASA Astrophysics Data System (ADS)

    Li, Ming

    In this dissertation, a set of numerical simulation tools are developed under previous work to efficiently and accurately study one-dimensional (1D), two-dimensional (2D), 2D slab and three-dimensional (3D) photonic crystal structures and their defects effects by means of spectrum (transmission, reflection, absorption), band structure (dispersion relation), and electric and/or magnetic fields distribution (mode profiles). Further more, the lasing property and spontaneous emission behaviors are studied when active gain materials are presented in the photonic crystal structures. First, the planewave based transfer (scattering) matrix method (TMM) is described in every detail along with a brief review of photonic crystal history (Chapter 1 and 2). As a frequency domain method, TMM has the following major advantages over other numerical methods: (1) the planewave basis makes Maxwell's Equations a linear algebra problem and there are mature numerical package to solve linear algebra problem such as Lapack and Scalapack (for parallel computation). (2) Transfer (scattering) matrix method make 3D problem into 2D slices and link all slices together via the scattering matrix (S matrix) which reduces computation time and memory usage dramatically and makes 3D real photonic crystal devices design possible; and this also makes the simulated domain no length limitation along the propagation direction (ideal for waveguide simulation). (3) It is a frequency domain method and calculation results are all for steady state, without the influences of finite time span convolution effects and/or transient effects. (4) TMM can treat dispersive material (such as metal at visible light) naturally without introducing any additional computation; and meanwhile TMM can also deal with anisotropic material and magnetic material (such as perfectly matched layer) naturally from its algorithms. (5) Extension of TMM to deal with active gain material can be done through an iteration procedure with gain material expressed by electric field dependent dielectric constant. Next, the concepts of spectrum interpolation (Chapter 3), higher-order incident (Chapter 4) and perfectly matched layer (Chapter 5) are introduced and applied to TMM, with detailed simulation for 1D, 2D, and 3D photonic crystal examples. Curvilinear coordinate transform is applied to the Maxwell's Equations to study waveguide bend (Chapter 6). By finding the phase difference along propagation direction at various XY plane locations, the behaviors of electromagnetic wave propagation (such as light bending, focusing etc) can be studied (Chapter 7), which can be applied to diffractive optics for new devices design. Numerical simulation tools for lasing devices are usually based on rate equations which are not accurate above the threshold and for small scale lasing cavities (such as nano-scale cavities). Recently, we extend the TMM package function to include the capacity of dealing active gain materials. Both lasing (above threshold) and spontaneous emission (below threshold) can be studied in the frame work of our Gain-TMM algorithm. Chapter 8 will illustrate the algorithm in detail and show the simulation results for 3D photonic crystal lasing devices. Then, microwave experiments (mainly resonant cavity embedded at layer-by-layer woodpile structures) are performed at Chapter 9 as an efficient practical way to study photonic crystal devices. The size of photonic crystal under microwave region is at the order of centimeter which makes the fabrication easier to realize. At the same time due to the scaling property, the result of microwave experiments can be applied directly to optical or infrared frequency regions. The systematic TMM simulations for various resonant cavities are performed and consistent results are obtained when compared with microwave experiments. Besides scaling the experimental results to much smaller wavelength, designing potential photonic crystal devices for application at microwave is also an interesting and important topic. Finally, we describe the future development of TMM algorithm such as using localized functions as basis to more efficiently simulate disorder problems (Chapter 10). Future applications of photonic crystal concepts are also discussed at Chapter 10. Along with this dissertation, TMM Photonic Crystal Package User Manual and Gain TMM Photonic Crystal Package User Manual written by me, Dr. Jiangrong Cao (Canon USA) and Dr. Xinhua Hu (Ames Lab) focus more on the programming detail, software user interface, trouble shooting, and step-by-step instructions. This dissertation and the two user manuals are essential documents for TMM software package beginners and advanced users. Future software developments, new version releases and FAQs can be tracked through my web page: http://www.public.iastate.edu/~mli/ In summary, this dissertation has extended the planewave based transfer (scattering) matrix method in many aspects which make the TMM and Gain-TMM software package a powerful simulation tool in photonic crystal study. Comparisons of TMM and GTMM results with other published numerical results and experimental results indicate that TMM and GTMM is accurate and highly efficient in photonic crystal device simulation and design. (Abstract shortened by UMI.)

  18. Enhanced Mechanical Properties of Graphene (Reduced Graphene Oxide)/Aluminum Composites with a Bioinspired Nanolaminated Structure.

    PubMed

    Li, Zan; Guo, Qiang; Li, Zhiqiang; Fan, Genlian; Xiong, Ding-Bang; Su, Yishi; Zhang, Jie; Zhang, Di

    2015-12-09

    Bulk graphene (reduced graphene oxide)-reinforced Al matrix composites with a bioinspired nanolaminated microstructure were fabricated via a composite powder assembly approach. Compared with the unreinforced Al matrix, these composites were shown to possess significantly improved stiffness and tensile strength, and a similar or even slightly higher total elongation. These observations were interpreted by the facilitated load transfer between graphene and the Al matrix, and the extrinsic toughening effect as a result of the nanolaminated microstructure.

  19. Modular Exhaust Design and Manufacturing Techniques for Low Cost Mid Volume Rapid Buidl to Order Systems

    DTIC Science & Technology

    2014-08-06

    the pressure field is uniform across them, but which allow mass flow to be diverted. Series elements have a constant mass flow across the ports...they can be used to calculate the pressure and mass flow after the element from the pressure and mass flow prior to the element, as shown in...the matrix product of each transfer matrix in turn. The final matrix gives no information about the pressures and mass flows within the element

  20. Effect of the carbonyl iron particles on acoustic absorption properties of magnetic polyurethane foam

    NASA Astrophysics Data System (ADS)

    Geng, Jialu; Wang, Caiping; Zhu, Honglang; Wang, Xiaojie

    2018-03-01

    Elastomeric matrix embedded with magnetic micro-sized particles has magnetically controllable properties, which has been investigated extensively in the last decades. In this study we develop a new magnetically controllable elastomeric material for acoustic applications at lower frequencies. The soft polyurethane foam is used as matrix material due to its extraordinary elastic and acoustic absorption properties. One-step method is used to synthesize polyurethane foam, in which all components including polyether polyols 330N, MDI, deionized water, silicone oil, carbonyl iron particle (CIP) and catalyst are put into one container for curing. Changing any component can induce the change of polyurethane foam's properties, such as physical and acoustic properties. The effect of the content of MDI on acoustic absorption is studied. The CIPs are aligned under extra magnetic field during the foaming process. And the property of polyurethane foam with aligned CIPs is also investigated. Scanning electron microscope (SEM) is used to observe the structure of pore and particle-chain. The two-microphone impedance tube and the transfer function method are used to test acoustic absorption property of the magnetic foams.

  1. A Damage Resistance Comparison Between Candidate Polymer Matrix Composite Feedline Materials

    NASA Technical Reports Server (NTRS)

    Nettles, A. T

    2000-01-01

    As part of NASAs focused technology programs for future reusable launch vehicles, a task is underway to study the feasibility of using the polymer matrix composite feedlines instead of metal ones on propulsion systems. This is desirable to reduce weight and manufacturing costs. The task consists of comparing several prototype composite feedlines made by various methods. These methods are electron-beam curing, standard hand lay-up and autoclave cure, solvent assisted resin transfer molding, and thermoplastic tape laying. One of the critical technology drivers for composite components is resistance to foreign objects damage. This paper presents results of an experimental study of the damage resistance of the candidate materials that the prototype feedlines are manufactured from. The materials examined all have a 5-harness weave of IM7 as the fiber constituent (except for the thermoplastic, which is unidirectional tape laid up in a bidirectional configuration). The resin tested were 977-6, PR 520, SE-SA-1, RS-E3 (e-beam curable), Cycom 823 and PEEK. The results showed that the 977-6 and PEEK were the most damage resistant in all tested cases.

  2. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    PubMed

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  3. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    PubMed Central

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K.; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F. Ralf; Breitling, Frank; Loeffler, Felix F.

    2014-01-01

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches. PMID:27600347

  4. Synthesis of Hadamard transformers by use of multimode interference optical waveguides.

    PubMed

    Gupta, Atma Ram; Tsutsumi, Kiyoshi; Nakayama, Junichi

    2003-05-20

    We propose a synthesis method of optical Hadamard transformer using multimode interference (MMI) couplers. By using the signal transfer matrix of 2 x 2, 4 x 4, and 8 x 8 MMI couplers, we show that sum and difference units of input signals can be synthesized. An interchange unit of two signals can also be synthesized. One synthesis method of Hadamard transformers is a combination of only 2 x 2 units, and the other is a combination of N x N(N > or = 4) units as well as 2 x 2 units. The design examples of operation units are shown, and the size and the output power of Hadamard transformers are estimated.

  5. Analysis of band structure, transmission properties, and dispersion behavior of THz wave in one-dimensional parabolic plasma photonic crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Askari, Nasim; Eslami, Esmaeil, E-mail: eeslami@iust.ac.ir; Mirzaie, Reza

    2015-11-15

    The photonic band gap of obliquely incident terahertz electromagnetic waves in a one-dimensional plasma photonic crystal is studied. The periodic structure consists of lossless dielectric and inhomogeneous plasma with a parabolic density profile. The dispersion relation and the THz wave transmittance are analyzed based on the electromagnetic equations and transfer matrix method. The dependence of effective plasma frequency and photonic band gap characteristics on dielectric and plasma thickness, plasma density, and incident angle are discussed in detail. A theoretical calculation for effective plasma frequency is presented and compared with numerical results. Results of these two methods are in good agreement.

  6. Comprehensive photonics-electronics convergent simulation and its application to high-speed electronic circuit integration on a Si/Ge photonic chip

    NASA Astrophysics Data System (ADS)

    Takeda, Kotaro; Honda, Kentaro; Takeya, Tsutomu; Okazaki, Kota; Hiraki, Tatsurou; Tsuchizawa, Tai; Nishi, Hidetaka; Kou, Rai; Fukuda, Hiroshi; Usui, Mitsuo; Nosaka, Hideyuki; Yamamoto, Tsuyoshi; Yamada, Koji

    2015-01-01

    We developed a design technique for a photonics-electronics convergence system by using an equivalent circuit of optical devices in an electrical circuit simulator. We used the transfer matrix method to calculate the response of an optical device. This method used physical parameters and dimensions of optical devices as calculation parameters to design a device in the electrical circuit simulator. It also used an intermediate frequency to express the wavelength dependence of optical devices. By using both techniques, we simulated bit error rates and eye diagrams of optical and electrical integrated circuits and calculated influences of device structure change and wavelength shift penalty.

  7. Automatic transfer function generation for volume rendering of high-resolution x-ray 3D digital mammography images

    NASA Astrophysics Data System (ADS)

    Alyassin, Abdal M.

    2002-05-01

    3D Digital mammography (3DDM) is a new technology that provides high resolution X-ray breast tomographic data. Like any other tomographic medical imaging modalities, viewing a stack of tomographic images may require time especially if the images are of large matrix size. In addition, it may cause difficulty to conceptually construct 3D breast structures. Therefore, there is a need to readily visualize the data in 3D. However, one of the issues that hinder the usage of volume rendering (VR) is finding an automatic way to generate transfer functions that efficiently map the important diagnostic information in the data. We have developed a method that randomly samples the volume. Based on the mean and the standard deviation of these samples, the technique determines the lower limit and upper limit of a piecewise linear ramp transfer function. We have volume rendered several 3DDM data using this technique and compared visually the outcome with the result from a conventional automatic technique. The transfer function generated through the proposed technique provided superior VR images over the conventional technique. Furthermore, the improvement in the reproducibility of the transfer function correlated with the number of samples taken from the volume at the expense of the processing time.

  8. Tip-Enhanced Photoinduced Electron Transfer and Ionization on Vertical Silicon Nanowires.

    PubMed

    Chen, Xiaoming; Wang, Tao; Lin, Leimiao; Wo, Fangjie; Liu, Yaqin; Liang, Xiao; Ye, Hui; Wu, Jianmin

    2018-05-02

    Nanostructured semiconductors are one of the most potent candidates for matrix-free laser desorption/ionization mass spectrometric (LDI-MS) analysis of low-molecular-weight molecules. Herein, the enhanced photoinduced electron transfer and LDI on the tip of a vertical silicon nanowire (SiNW) array were investigated. Theoretical simulation and LDI detection of indigo and isatin molecules in negative ion mode revealed that the electric field can be enhanced on the tip end of SiNWs, thereby promoting the energy and electron transfer to the analytes adsorbed on the tip of SiNWs. On the basis of this finding, a tip-contact sampling method coupled with LDI-MS detection was established. In this strategy, the tip of SiNWs can be regarded as microextraction heads for the sampling of molecules when they come in contact with analytes. Impression of skin, tissue, and pericarp on the vertical SiNW array can effectively transfer endogenous metabolites or exogenous substances onto the tip. Upon laser irradiation, the adsorbed molecules on the SiNW tip can be efficiently ionized and detected in negative ion mode because of the tip-enhanced electron transfer and LDI effect. We believe this work may significantly expand the application of LDI-MS in various fields.

  9. Validation of a numerical method for interface-resolving simulation of multicomponent gas-liquid mass transfer and evaluation of multicomponent diffusion models

    NASA Astrophysics Data System (ADS)

    Woo, Mino; Wörner, Martin; Tischer, Steffen; Deutschmann, Olaf

    2018-03-01

    The multicomponent model and the effective diffusivity model are well established diffusion models for numerical simulation of single-phase flows consisting of several components but are seldom used for two-phase flows so far. In this paper, a specific numerical model for interfacial mass transfer by means of a continuous single-field concentration formulation is combined with the multicomponent model and effective diffusivity model and is validated for multicomponent mass transfer. For this purpose, several test cases for one-dimensional physical or reactive mass transfer of ternary mixtures are considered. The numerical results are compared with analytical or numerical solutions of the Maxell-Stefan equations and/or experimental data. The composition-dependent elements of the diffusivity matrix of the multicomponent and effective diffusivity model are found to substantially differ for non-dilute conditions. The species mole fraction or concentration profiles computed with both diffusion models are, however, for all test cases very similar and in good agreement with the analytical/numerical solutions or measurements. For practical computations, the effective diffusivity model is recommended due to its simplicity and lower computational costs.

  10. A photoemission moments model using density functional and transfer matrix methods applied to coating layers on surfaces: Theory

    NASA Astrophysics Data System (ADS)

    Jensen, Kevin L.; Finkenstadt, Daniel; Shabaev, Andrew; Lambrakos, Samuel G.; Moody, Nathan A.; Petillo, John J.; Yamaguchi, Hisato; Liu, Fangze

    2018-01-01

    Recent experimental measurements of a bulk material covered with a small number of graphene layers reported by Yamaguchi et al. [NPJ 2D Mater. Appl. 1, 12 (2017)] (on bialkali) and Liu et al. [Appl. Phys. Lett. 110, 041607 (2017)] (on copper) and the needs of emission models in beam optics codes have lead to substantial changes in a Moments model of photoemission. The changes account for (i) a barrier profile and density of states factor based on density functional theory (DFT) evaluations, (ii) a Drude-Lorentz model of the optical constants and laser penetration depth, and (iii) a transmission probability evaluated by an Airy Transfer Matrix Approach. Importantly, the DFT results lead to a surface barrier profile of a shape similar to both resonant barriers and reflectionless wells: the associated quantum mechanical transmission probabilities are shown to be comparable to those recently required to enable the Moments (and Three Step) model to match experimental data but for reasons very different than the assumption by conventional wisdom that a barrier is responsible. The substantial modifications of the Moments model components, motivated by computational materials methods, are developed. The results prepare the Moments model for use in treating heterostructures and discrete energy level systems (e.g., quantum dots) proposed for decoupling the opposing metrics of performance that undermine the performance of advanced light sources like the x-ray Free Electron Laser. The consequences of the modified components on quantum yield, emittance, and emission models needed by beam optics codes are discussed.

  11. Boundary transfer matrices and boundary quantum KZ equations

    NASA Astrophysics Data System (ADS)

    Vlaar, Bart

    2015-07-01

    A simple relation between inhomogeneous transfer matrices and boundary quantum Knizhnik-Zamolodchikov (KZ) equations is exhibited for quantum integrable systems with reflecting boundary conditions, analogous to an observation by Gaudin for periodic systems. Thus, the boundary quantum KZ equations receive a new motivation. We also derive the commutativity of Sklyanin's boundary transfer matrices by merely imposing appropriate reflection equations, in particular without using the conditions of crossing symmetry and unitarity of the R-matrix.

  12. Effects of multiple scattering and surface albedo on the photochemistry of the troposphere. Final report, period ending 30 Nov 1981

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Augustsson, T.R.; Tiwari, S.N.

    The effect of treatment of incoming solar radiation on the photochemistry of the troposphere is discussed. A one dimensional photochemical model of the troposphere containing the species of the nitrogen, oxygen, carbon, hydrogen, and sulfur families was developed. The vertical flux is simulated by use of the parameterized eddy diffusion coefficients. The photochemical model is coupled to a radiative transfer model that calculates the radiation field due to the incoming solar radiation which initiates much of the photochemistry of the troposphere. Vertical profiles of tropospheric species were compared with the Leighton approximation, radiative transfer, matrix inversion model. The radiative transfermore » code includes the effects of multiple scattering due to molecules and aerosols, pure absorption, and surface albedo on the transfer of incoming solar radiation. It is indicated that significant differences exist for several key photolysis frequencies and species number density profiles between the Leighton approximation and the profiles generated with, radiative transfer, matrix inversion technique. Most species show enhanced vertical profiles when the more realistic treatment of the incoming solar radiation field is included« less

  13. Application of magnetoelastic materials in spatiotemporally modulated phononic crystals for nonreciprocal wave propagation

    NASA Astrophysics Data System (ADS)

    Ansari, M. H.; Attarzadeh, M. A.; Nouh, M.; Karami, M. Amin

    2018-01-01

    In this paper, a physical platform is proposed to change the properties of phononic crystals in space and time in order to achieve nonreciprocal wave transmission. The utilization of magnetoelastic materials in elastic phononic systems is studied. Material properties of magnetoelastic materials change significantly with an external magnetic field. This property is used to design systems with a desired wave propagation pattern. The properties of the magnetoelastic medium are changed in a traveling wave pattern, which changes in both space and time. A phononic crystal with such a modulation exhibits one-way wave propagation behavior. An extended transfer matrix method (TMM) is developed to model a system with time varying properties. The stop band and the pass band of a reciprocal and a nonreciprocal bar are found using this method. The TMM is used to find the transfer function of a magnetoelastic bar. The obtained results match those obtained via the theoretical Floquet-Bloch approach and numerical simulations. It is shown that the stop band in the transfer function of a system with temporal varying property for the forward wave propagation is different from the same in the backward wave propagation. The proposed configuration enables the physical realization of a class of smart structures that incorporates nonreciprocal wave propagation.

  14. Transfer-matrices for series-type microwave antenna circuits. [L-band radiometer

    NASA Technical Reports Server (NTRS)

    Schmidt, R. F.

    1981-01-01

    Transfer matrices are developed which permit analysis and computer evaluation of certain series type microwave antenna circuits associated with an L-Band microwave radiometer (LBMR) under investigation at Goddard Space Flight Center. This radiometer is one of several diverse instrument designs to be used for the determination of soil moisture, sea state, salinity, and temperature data. Four port matrix notation is used throughout for the evaluation of LBMR circuits with mismatched couplers and lossy transmission lines. Matrix parameters in examples are predicted on an impedance analysis and an assumption of an array aperture distribution. The notation presented is easily adapted to longer and more varied chains of matrices, and to matrices of larger dimension.

  15. Systems identification technology development for large space systems

    NASA Technical Reports Server (NTRS)

    Armstrong, E. S.

    1982-01-01

    A methodology for synthesizinng systems identification, both parameter and state, estimation and related control schemes for flexible aerospace structures is developed with emphasis on the Maypole hoop column antenna as a real world application. Modeling studies of the Maypole cable hoop membrane type antenna are conducted using a transfer matrix numerical analysis approach. This methodology was chosen as particularly well suited for handling a large number of antenna configurations of a generic type. A dedicated transfer matrix analysis, both by virtue of its specialization and the inherently easy compartmentalization of the formulation and numerical procedures, is significantly more efficient not only in computer time required but, more importantly, in the time needed to review and interpret the results.

  16. Temperature distribution of thick thermoset composites

    NASA Astrophysics Data System (ADS)

    Guo, Zhan-Sheng; Du, Shanyi; Zhang, Boming

    2004-05-01

    The development of temperature distribution of thick polymeric matrix laminates during an autoclave vacuum bag process was measured and compared with numerically calculated results. The finite element formulation of the transient heat transfer problem was carried out for polymeric matrix composite materials from the heat transfer differential equations including internal heat generation produced by exothermic chemical reactions. Software based on the general finite element software package was developed for numerical simulation of the entire composite process. From the experimental and numerical results, it was found that the measured temperature profiles were in good agreement with the numerical ones, and conventional cure cycles recommended by prepreg manufacturers for thin laminates should be modified to prevent temperature overshoot.

  17. Theoretical study of solvent effects on the electronic coupling matrix elements in rigidly linked donor-acceptor systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cave, R.J.; Newton, M.D.; Kumar, K.

    1995-12-07

    The recently developed generalized Mulliken-Hush approach for the calculation of the electronic coupling matrix element for electron-transfer processes is applied to two rigidly linked donor-bridge-acceptor systems having dimethoxyanthracene as the donor and a dicarbomethoxycyclobutene unit as the acceptor. The dependence of the electronic coupling matrix element as a function of bridge type is examined with and without solvent molecules present. For clamp-shaped bridge structures solvent can have a dramatic effect on the electronic coupling matrix element. The behavior with variation of solvent is in good agreement with that observed experimentally for these systems. 23 refs., 2 tabs.

  18. Optical Analog to Electromagnetically Induced Transparency in Cascaded Ring-Resonator Systems.

    PubMed

    Wang, Yonghua; Zheng, Hua; Xue, Chenyang; Zhang, Wendong

    2016-07-25

    The analogue of electromagnetically induced transparency in optical methods has shown great potential in slow light and sensing applications. Here, we experimentally demonstrated a coupled resonator induced transparency system with three cascaded ring coupled resonators in a silicon chip. The structure was modeled by using the transfer matrix method. Influences of various parameters including coupling ratio of couplers, waveguide loss and additional loss of couplers on transmission characteristic and group index have been investigated theoretically and numerically in detail. The transmission character of the system was measured by the vertical grating coupling method. The enhanced quality factor reached 1.22 × 10⁵. In addition, we further test the temperature performance of the device. The results provide a new method for the manipulation of light in highly integrated optical circuits and sensing applications.

  19. Coherent-Anomaly Method in Critical Phenomena. III.

    NASA Astrophysics Data System (ADS)

    Hu, Xiao; Katori, Makoto; Suzuki, Masuo

    Two kinds of systematic mean-field transfer-matrix methods are formulated in the 2-dimensional Ising spin system, by introducing Weiss-like and Bethe-like approximations. All the critical exponents as well as the true critical point can be estimated in these methods following the CAM procedure. The numerical results of the above system are Tc* = 2.271 (J/kB), γ=γ' ≃ 1.749, β≃0.131 and δ ≃ 15.1. The specific heat is confirmed to be continuous and to have a logarithmic divergence at the true critical point, i.e., α=α'=0. Thus, the finite-degree-of-approximation scaling ansatz is shown to be correct and very powerful in practical estimations of the critical exponents as well as the true critical point.

  20. Integrated optics to improve resolution on multiple configuration

    NASA Astrophysics Data System (ADS)

    Liu, Hua; Ding, Quanxin; Guo, Chunjie; Zhou, Liwei

    2015-04-01

    Inspired to in order to reveal the structure to improve imaging resolution, further technical requirement is proposed in some areas of the function and influence on the development of multiple configuration. To breakthrough diffraction limit, smart structures are recommended as the most efficient and economical method, while by used to improve the system performance, especially on signal to noise ratio and resolution. Integrated optics were considered in the selection, with which typical multiple configuration, by use the method of simulation experiment. Methodology can change traditional design concept and to develop the application space. Our calculations using multiple matrix transfer method, also the correlative algorithm and full calculations, show the expected beam shaping through system and, in particular, the experimental results will support our argument, which will be reported in the presentation.

Top